Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity
Directory of Open Access Journals (Sweden)
Harmit S. Ranhotra
2016-07-01
Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.
Could tight junctions regulate the barrier function of the aged skin?
Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš
2016-03-01
The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Hydrogen sulfide metabolism regulates endothelial solute barrier function
Directory of Open Access Journals (Sweden)
Shuai Yuan
2016-10-01
Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.
Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean
2012-01-01
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868
Herbal medicines that benefit epidermal permeability barrier function
Directory of Open Access Journals (Sweden)
Lizhi Hu
2015-06-01
Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.
Epidermal Growth Factor and Intestinal Barrier Function
Directory of Open Access Journals (Sweden)
Xiaopeng Tang
2016-01-01
Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.
Patching, Simon G
2017-03-01
Glucose transporters (GLUTs) at the blood-brain barrier maintain the continuous high glucose and energy demands of the brain. They also act as therapeutic targets and provide routes of entry for drug delivery to the brain and central nervous system for treatment of neurological and neurovascular conditions and brain tumours. This article first describes the distribution, function and regulation of glucose transporters at the blood-brain barrier, the major ones being the sodium-independent facilitative transporters GLUT1 and GLUT3. Other GLUTs and sodium-dependent transporters (SGLTs) have also been identified at lower levels and under various physiological conditions. It then considers the effects on glucose transporter expression and distribution of hypoglycemia and hyperglycemia associated with diabetes and oxygen/glucose deprivation associated with cerebral ischemia. A reduction in glucose transporters at the blood-brain barrier that occurs before the onset of the main pathophysiological changes and symptoms of Alzheimer's disease is a potential causative effect in the vascular hypothesis of the disease. Mutations in glucose transporters, notably those identified in GLUT1 deficiency syndrome, and some recreational drug compounds also alter the expression and/or activity of glucose transporters at the blood-brain barrier. Approaches for drug delivery across the blood-brain barrier include the pro-drug strategy whereby drug molecules are conjugated to glucose transporter substrates or encapsulated in nano-enabled delivery systems (e.g. liposomes, micelles, nanoparticles) that are functionalised to target glucose transporters. Finally, the continuous development of blood-brain barrier in vitro models is important for studying glucose transporter function, effects of disease conditions and interactions with drugs and xenobiotics.
MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.
Directory of Open Access Journals (Sweden)
Victor Chatterjee
Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.
Claudins, dietary milk proteins, and intestinal barrier regulation.
Kotler, Belinda M; Kerstetter, Jane E; Insogna, Karl L
2013-01-01
The family of claudin proteins plays an important role in regulating the intestinal barrier by modulating the permeability of tight junctions. The impact of dietary protein on claudin biology has not been studied extensively. Whey proteins have been reported to improve intestinal barrier function, but their mechanism of action is not clear. Recent studies, however, have demonstrated increased intestinal claudin expression in response to milk protein components. Reviewed here are new findings suggesting that whey-protein-derived transforming growth factor β transcriptionally upregulates claudin-4 expression via a Smad-4-dependent pathway. These and other data, including limited clinical studies, are summarized below and, in the aggregate, suggest a therapeutic role for whey protein in diseases of intestinal barrier dysfunction, perhaps, in part, by regulating claudin expression. © 2013 International Life Sciences Institute.
Fasano, Alessio
2011-01-01
The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.
Sturgeon, Craig; Fasano, Alessio
2016-01-01
Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.
International Nuclear Information System (INIS)
Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae; Park, Sang Chul
2010-01-01
One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin α, karyopherin β, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.
Energy Technology Data Exchange (ETDEWEB)
Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Park, Sang Chul, E-mail: scpark@snu.ac.kr [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of)
2010-01-01
One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin {alpha}, karyopherin {beta}, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.
International Nuclear Information System (INIS)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma
2010-01-01
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
Energy Technology Data Exchange (ETDEWEB)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)
2010-07-02
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
DEFF Research Database (Denmark)
2016-01-01
Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...
Self-regulation of turbulence bursts and transport barriers
International Nuclear Information System (INIS)
Floriani, E; Ciraolo, G; Ghendrih, Ph; Sarazin, Y; Lima, R
2013-01-01
The interplay between turbulent bursts and transport barriers is analyzed with a simplified model of interchange turbulence in magnetically confined plasmas. The turbulent bursts spread into the transport barriers and, depending on the competing magnitude of the burst and stopping capability of the barrier, can burn through. Simulations of two models of transport barriers are presented: a hard barrier where interchange turbulence modes are stable in a prescribed region and a soft barrier with external plasma biasing. The response of the transport barriers to the non-linear perturbations of the turbulent bursts, addressed in a predator–prey approach, indicates that the barriers monitor an amplification factor of the turbulent bursts, with amplification smaller than one for most bursts and, in some cases, amplification factors that can significantly exceed unity. The weak barriers in corrugated profiles and magnetic structures, as well as the standard barriers, are characterized by these transmission properties, which then regulate the turbulent burst transport properties. The interplays of barriers and turbulent bursts are modeled as competing stochastic processes. For different classes of the probability density function (PDF) of these processes, one can predict the heavy tail properties of the bursts downstream from the barrier, either exponential for a leaky barrier, or with power laws for a tight barrier. The intrinsic probing of the transport barriers by the turbulent bursts thus gives access to the properties of the barriers. The main stochastic variables are the barrier width and the spreading distance of the turbulent bursts within the barrier, together with their level of correlation. One finds that in the case of a barrier with volumetric losses, such as radiation or particle losses as addressed in our present simulations, the stochastic model predicts a leaky behavior with an exponential PDF of escaping turbulent bursts in agreement with the simulation
Hornburger, Michael C; Mayer, Bettina A; Leonhardt, Stefanie; Willer, Elisabeth A; Zahler, Stefan; Beyerle, Andrea; Rajalingam, Krishnaraj; Vollmar, Angelika M; Fürst, Robert
2014-04-01
Inhibitor of apoptosis (IAP) proteins, such as XIAP or cIAP1/2, are important regulators of apoptosis in cancer cells, and IAP antagonists are currently evaluated as antitumor agents. Beyond their function in cancer cells, this study demonstrates a novel role of IAPs as regulators of vascular endothelial permeability. Two structurally different IAP antagonists, ABT and Smac085, as well as silencing of IAPs, reduced the thrombin receptor-activating peptide (TRAP)-induced barrier dysfunction in human endothelial cells as assessed by measuring macromolecular permeability or transendothelial electrical resistance. ABT diminished thrombin-evoked stress fiber formation, activation of myosin light chain 2, and disassembly of adherens junctions independent of calcium signaling, protein kinase C, and mitogen-activated protein kinases. Interestingly, ABT and silencing of IAPs, in particular XIAP, reduced the TRAP-evoked RhoA activation, whereas Rac1 was not affected. XIAP and, to a lesser extent, cIAP1 were found to directly interact with RhoA independently of the RhoA activation status. Under cell-free conditions, XIAP did not induce an ubiquitination of RhoA. In summary, our work discloses IAPs as crucial regulators of endothelial permeability and suggests IAP inhibition as interesting approach for the prevention of endothelial barrier dysfunction.
Hu, Jun; Chen, Lingli; Zheng, Wenyong; Shi, Min; Liu, Liu; Xie, Chunlin; Wang, Xinkai; Niu, Yaorong; Hou, Qiliang; Xu, Xiaofan; Xu, Baoyang; Tang, Yimei; Zhou, Shuyi; Yan, Yiqin; Yang, Tao; Ma, Libao; Yan, Xianghua
2018-01-01
Increased intestinal epithelial barrier function damages caused by early weaning stress have adverse effects on swine health and feed utilization efficiency. Probiotics have emerged as the promising antibiotic alternatives used for intestinal barrier function damage prevention. Our previous data showed that Lactobacillus frumenti was identified as a predominant Lactobacillus in the intestinal microbiota of weaned piglets. However, whether the intestinal epithelial barrier function in piglets was regulated by L. frumenti is still unclear. Here, piglets received a PBS vehicle or PBS suspension (2 ml, 108 CFU/ml) containing the L. frumenti by oral gavage once a day during the period of 6–20 days of age prior to early weaning. Our data demonstrated that oral administration of L. frumenti significantly improved the intestinal mucosal integrity and decreased the serum endotoxin and D-lactic acid levels in early-weaned piglets (26 days of age). The intestinal tight junction proteins (including ZO-1, Occludin, and Claudin-1) were significantly up-regulated by L. frumenti administration. The serum immunoglobulin G (IgG) levels, intestinal secretory immunoglobulin A (sIgA) levels, and interferon-γ (IFN-γ) levels were significantly increased by L. frumenti administration. Furthermore, our data revealed that oral administration of L. frumenti significantly increased the relative abundances of health-promoting microbes (including L. frumenti, Lactobacillus gasseri LA39, Parabacteroides distasonis, and Kazachstania telluris) and decreased the relative abundances of opportunistic pathogens (including Desulfovibrio desulfuricans and Candida humilis). Functional alteration of the intestinal bacterial community by L. frumenti administration was characterized by the significantly increased fatty acids and protein metabolism and decreased diseases-associated metabolic pathways. These findings suggest that L. frumenti facilitates intestinal epithelial barrier function maintenance
Abl family kinases regulate endothelial barrier function in vitro and in mice.
Directory of Open Access Journals (Sweden)
Elizabeth M Chislock
Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use
Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function
Directory of Open Access Journals (Sweden)
David eBueno
2014-10-01
Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.
Desmoglein 2 regulates the intestinal epithelial barrier via p38 mitogen-activated protein kinase.
Ungewiß, Hanna; Vielmuth, Franziska; Suzuki, Shintaro T; Maiser, Andreas; Harz, Hartmann; Leonhardt, Heinrich; Kugelmann, Daniela; Schlegel, Nicolas; Waschke, Jens
2017-07-24
Intestinal epithelial barrier properties are maintained by a junctional complex consisting of tight junctions (TJ), adherens junctions (AJ) and desmosomes. Desmoglein 2 (Dsg2), an adhesion molecule of desmosomes and the only Dsg isoform expressed in enterocytes, is required for epithelial barrier properties and may contribute to barrier defects in Crohn's disease. Here, we identified extradesmosomal Dsg2 on the surface of polarized enterocytes by Triton extraction, confocal microscopy, SIM and STED. Atomic force microscopy (AFM) revealed Dsg2-specific binding events along the cell border on the surface of enterocytes with a mean unbinding force of around 30pN. Binding events were blocked by an inhibitory antibody targeting Dsg2 which under same conditions activated p38MAPK but did not reduce cell cohesion. In enterocytes deficient for Dsg2, p38MAPK activity was reduced and both barrier integrity and reformation were impaired. Dsc2 rescue did not restore p38MAPK activity indicating that Dsg2 is required. Accordingly, direct activation of p38MAPK in Dsg2-deficient cells enhanced barrier reformation demonstrating that Dsg2-mediated activation of p38MAPK is crucial for barrier function. Collectively, our data show that Dsg2, beside its adhesion function, regulates intestinal barrier function via p38MAPK signalling. This is in contrast to keratinocytes and points towards tissue-specific signalling functions of desmosomal cadherins.
Krüppel-like factor 5 is essential for maintenance of barrier function in mouse colon.
Liu, Yang; Chidgey, Martyn; Yang, Vincent W; Bialkowska, Agnieszka B
2017-11-01
Krüppel-like factor 5 (KLF5) is a member of the zinc finger family of transcription factors that regulates homeostasis of the intestinal epithelium. Previous studies suggested an indispensable role of KLF5 in maintaining intestinal barrier function. In the current study, we investigated the mechanisms by which KLF5 regulates colonic barrier function in vivo and in vitro. We used an inducible and a constitutive intestine-specific Klf5 knockout mouse models ( Villin-CreER T2 ;Klf5 fl/fl designated as Klf5 ΔIND and Villin-Cre;Klf5 fl/fl as Klf5 ΔIS ) and studied an inducible KLF5 knockdown in Caco-2 BBe cells using a lentiviral Tet-on system (Caco-2 BBe KLF5ΔIND ). Specific knockout of Klf5 in colonic tissues, either inducible or constitutive, resulted in increased intestinal permeability. The phenotype was accompanied by a significant reduction in Dsg2 , which encodes desmoglein-2, a desmosomal cadherin, at both mRNA and protein levels. Transmission electron microscopy showed alterations of desmosomal morphology in both KLF5 knockdown Caco-2 BBe cells and Klf5 knockout mouse colonic tissues. Inducible knockdown of KLF5 in Caco-2BBe cells grown on Transwell plates led to impaired barrier function as evidenced by decreased transepithelial electrical resistance and increased paracellular permeability to fluorescein isothiocyanate-4 kDa dextran. Furthermore, DSG2 was significantly decreased in KLF5 knockdown cells, and DSG2 overexpression partially rescued the impaired barrier function caused by KLF5 knockdown. Electron microscopy studies demonstrated altered desmosomal morphology after KLF5 knockdown. In combination with chromatin immunoprecipitation analysis and promoter study, our data show that KLF5 regulates intestinal barrier function by mediating the transcription of DSG2 , a gene encoding a major component of desmosome structures. NEW & NOTEWORTHY The study is original research on the direct function of a Krüppel-like factor on intestinal barrier function
Ling, Xiang; Linglong, Peng; Weixia, Du; Hong, Wei
2016-01-01
Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ). Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC). It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P zonulin release (P zonulin (P zonulin protein release and improvement of intestinal TJ integrity.
Benedicto, Ignacio; Lehmann, Guillermo L; Ginsberg, Michael; Nolan, Daniel J; Bareja, Rohan; Elemento, Olivier; Salfati, Zelda; Alam, Nazia M; Prusky, Glen T; Llanos, Pierre; Rabbany, Sina Y; Maminishkis, Arvydas; Miller, Sheldon S; Rafii, Shahin; Rodriguez-Boulan, Enrique
2017-05-19
The outer blood-retina barrier is established through the coordinated terminal maturation of the retinal pigment epithelium (RPE), fenestrated choroid endothelial cells (ECs) and Bruch's membrane, a highly organized basement membrane that lies between both cell types. Here we study the contribution of choroid ECs to this process by comparing their gene expression profile before (P5) and after (P30) the critical postnatal period when mice acquire mature visual function. Transcriptome analyses show that expression of extracellular matrix-related genes changes dramatically over this period. Co-culture experiments support the existence of a novel regulatory pathway: ECs secrete factors that remodel RPE basement membrane, and integrin receptors sense these changes triggering Rho GTPase signals that modulate RPE tight junctions and enhance RPE barrier function. We anticipate our results will spawn a search for additional roles of choroid ECs in RPE physiology and disease.
Skin Barrier Function and Allergens
DEFF Research Database (Denmark)
Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan
2016-01-01
The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...
Directory of Open Access Journals (Sweden)
Xiang Ling
Full Text Available Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ. Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC. It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P < 0.01. Compared with the LPS group, bifidobacterium significantly decreased the production of IL-6 and TNF-α (P < 0.01 and suppressed zonulin release (P < 0.05. In addition, bifidobacterium pretreatment up-regulated occludin, claudin-3 and ZO-1 expression (P < 0.01 and also preserved these proteins localization at TJ compared with the LPS group. In the in vivo study, bifidobacterium decreased the incidence of NEC from 88 to 47% (P < 0.05 and reduced the severity in the NEC model. Increased levels of IL-6 and TNF-α in the ileum of NEC rats were normalized in bifidobacterium treated rats (P < 0.05. Moreover, administration of bifidobacterium attenuated the increase in intestinal permeability (P < 0.01, decreased the levels of serum zonulin (P < 0.05, normalized the expression and localization of TJ proteins in the ileum compared with animals with NEC. We concluded that bifidobacterium may
How hormones influence composition and physiological function of the brain-blood barrier.
Hampl, R; Bičíková, M; Sosvorová, L
2015-01-01
Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.
Regulation of defensive function on gingival epithelial cells can prevent periodontal disease.
Fujita, Tsuyoshi; Yoshimoto, Tetsuya; Kajiya, Mikihito; Ouhara, Kazuhisa; Matsuda, Shinji; Takemura, Tasuku; Akutagawa, Keiichi; Takeda, Katsuhiro; Mizuno, Noriyoshi; Kurihara, Hidemi
2018-05-01
Periodontal disease is a bacterial biofilm-associated inflammatory disease that has been implicated in many systemic diseases. A new preventive method for periodontal disease needs to be developed in order to promote the health of the elderly in a super-aged society. The gingival epithelium plays an important role as a mechanical barrier against bacterial invasion and a part of the innate immune response to infectious inflammation in periodontal tissue. The disorganization of cell-cell interactions and subsequent inflammation contribute to the initiation of periodontal disease. These make us consider that regulation of host defensive functions, epithelial barrier and neutrophil activity, may become novel preventive methods for periodontal inflammation. Based on this concept, we have found that several agents regulate the barrier function of gingival epithelial cells and suppress the accumulation of neutrophils in the gingival epithelium. We herein introduce the actions of irsogladine maleate, azithromycin, amphotericin B, and Houttuynia cordata (dokudami in Japanese), which is commonly used in traditional medicine, on the epithelial barrier and neutrophil migration in gingival epithelial cells in vivo and in vitro , in order to provide support for the clinical application of these agents to the prevention of periodontal inflammation.
Standards for the Protection of Skin Barrier Function.
Giménez-Arnau, Ana
2016-01-01
The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.
Ghosh, Siddhartha S; He, Hongliang; Wang, Jing; Gehr, Todd W; Ghosh, Shobha
2018-01-02
Curcumin has anti-inflammatory, anti-oxidant and anti-proliferative properties established largely by in vitro studies. Accordingly, oral administration of curcumin beneficially modulates many diseases including diabetes, fatty-liver disease, atherosclerosis, arthritis, cancer and neurological disorders such as depression, Alzheimer's or Parkinson's disease. However, limited bioavailability and inability to detect curcumin in circulation or target tissues has hindered the validation of a causal role. We established curcumin-mediated decrease in the release of gut bacteria-derived lipopolysaccharide (LPS) into circulation by maintaining the integrity of the intestinal barrier function as the mechanism underlying the attenuation of metabolic diseases (diabetes, atherosclerosis, kidney disease) by curcumin supplementation precluding the need for curcumin absorption. In view of the causative role of circulating LPS and resulting chronic inflammation in the development of diseases listed above, this review summarizes the mechanism by which curcumin affects the several layers of the intestinal barrier and, despite negligible absorption, can beneficially modulate these diseases.
ROS-activated calcium signaling mechanisms regulating endothelial barrier function.
Di, Anke; Mehta, Dolly; Malik, Asrar B
2016-09-01
Increased vascular permeability is a common pathogenic feature in many inflammatory diseases. For example in acute lung injury (ALI) and its most severe form, the acute respiratory distress syndrome (ARDS), lung microvessel endothelia lose their junctional integrity resulting in leakiness of the endothelial barrier and accumulation of protein rich edema. Increased reactive oxygen species (ROS) generated by neutrophils (PMNs) and other inflammatory cells play an important role in increasing endothelial permeability. In essence, multiple inflammatory syndromes are caused by dysfunction and compromise of the barrier properties of the endothelium as a consequence of unregulated acute inflammatory response. This review focuses on the role of ROS signaling in controlling endothelial permeability with particular focus on ALI. We summarize below recent progress in defining signaling events leading to increased endothelial permeability and ALI. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Constanza Ballesteros-Martinez
2017-10-01
Full Text Available Anaphylaxis, the most serious and life-threatening allergic reaction, produces the release of inflammatory mediators by mast cells and basophils. Regulator of calcineurin 1 (Rcan1 is a negative regulator of mast-cell degranulation. The action of mediators leads to vasodilation and an increase in vascular permeability, causing great loss of intravascular volume in a short time. Nevertheless, the molecular basis remains unexplored on the vascular level. We investigated Rcan1 expression induced by histamine, platelet-activating factor (PAF, and epinephrine in primary human vein (HV-/artery (HA-derived endothelial cells (ECs and human dermal microvascular ECs (HMVEC-D. Vascular permeability was analyzed in vitro in human ECs with forced Rcan1 expression using Transwell migration assays and in vivo using Rcan1 knockout mice. Histamine, but neither PAF nor epinephrine, induced Rcan1-4 mRNA and protein expression in primary HV-ECs, HA-ECs, and HMVEC-D through histamine receptor 1 (H1R. These effects were prevented by pharmacological inhibition of calcineurin with cyclosporine A. Moreover, intravenous histamine administration increased Rcan1 expression in lung tissues of mice undergoing experimental anaphylaxis. Functional in vitro assays showed that overexpression of Rcan1 promotes barrier integrity, suggesting a role played by this molecule in vascular permeability. Consistent with these findings, in vivo models of subcutaneous and intravenous histamine-mediated fluid extravasation showed increased response in skin, aorta, and lungs of Rcan1-deficient mice compared with wild-type animals. These findings reveal that endothelial Rcan1 is synthesized in response to histamine through a calcineurin-sensitive pathway and may reduce barrier breakdown, thus contributing to the strengthening of the endothelium and resistance to anaphylaxis. These new insights underscore its potential role as a regulator of sensitivity to anaphylaxis in humans.
Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina
2016-02-01
A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Barriers to Construction Health and Safety Self-regulation: A Scoping Case of Nigeria
Directory of Open Access Journals (Sweden)
Umeokafor Nnedinma
2017-03-01
Full Text Available This scoping study builds on the recent uncovering that in terms of health and safety (H&S, the Nigerian construction industry is self-regulated in various forms, not unregulated and that the size of company can further explain H&S self-regulation. Consequently, the barriers identified through literature review were assessed using questionnaires. Analysis of the data collected from construction practitioners in Nigeria shows that ‘economic factors’ mostly explains the barriers to construction H&S self-regulation. This is followed by the ‘ability to self-regulate’ and ‘lack of awareness’. Furthermore, the results show significant differences among small, medium and large construction contractors on seven factors of which include ‘normative case’ factors, ‘H&S is a duty’, ‘H&S is the right thing’ and ‘unfair H&S standards or legislation’. Although a scoping study, the study draws attention to the barriers to construction H&S self-regulation in Nigeria and demonstrates an alternative to state regulation of H&S.
The intestinal barrier function and its involvement in digestive disease
Directory of Open Access Journals (Sweden)
Eloísa Salvo-Romero
2015-11-01
Full Text Available The gastrointestinal mucosal surface is lined with epithelial cells representing an effective barrier made up with intercellular junctions that separate the inner and the outer environments, and block the passage of potentially harmful substances. However, epithelial cells are also responsible for the absorption of nutrients and electrolytes, hence a semipermeable barrier is required that selectively allows a number of substances in while keeping others out. To this end, the intestine developed the "intestinal barrier function", a defensive system involving various elements, both intra- and extracellular, that work in a coordinated way to impede the passage of antigens, toxins, and microbial byproducts, and simultaneously preserves the correct development of the epithelial barrier, the immune system, and the acquisition of tolerance against dietary antigens and the intestinal microbiota. Disturbances in the mechanisms of the barrier function favor the development of exaggerated immune responses; while exact implications remain unknown, changes in intestinal barrier function have been associated with the development of inflammatory conditions in the gastrointestinal tract. This review details de various elements of the intestinal barrier function, and the key molecular and cellular changes described for gastrointestinal diseases associated with dysfunction in this defensive mechanism.
Government regulation of business in a changing institutional barrier
Directory of Open Access Journals (Sweden)
Novikova I.
2013-02-01
Full Text Available The article examines the domestic experience in government regulation of business in a changing institutional barrier.Compared the degree of economic freedom in Ukraine. The emphasis is on the need to develop a national strategy of institutional development of domestic entrepreneurship.
Energy Technology Data Exchange (ETDEWEB)
Eum, Sung Yong, E-mail: seum@miami.edu; Jaraki, Dima; András, Ibolya E.; Toborek, Michal
2015-09-15
Occludin is an essential integral transmembrane protein regulating tight junction (TJ) integrity in brain endothelial cells. Phosphorylation of occludin is associated with its localization to TJ sites and incorporation into intact TJ assembly. The present study is focused on the role of lipid rafts in polychlorinated biphenyl (PCB)-induced disruption of occludin and endothelial barrier function. Exposure of human brain endothelial cells to 2,2′,4,4′,5,5′-hexachlorobiphenyl (PCB153) induced dephosphorylation of threonine residues of occludin and displacement of occludin from detergent-resistant membrane (DRM)/lipid raft fractions within 1 h. Moreover, lipid rafts modulated the reduction of occludin level through activation of matrix metalloproteinase 2 (MMP-2) after 24 h PCB153 treatment. Inhibition of protein phosphatase 2A (PP2A) activity by okadaic acid or fostriecin markedly protected against PCB153-induced displacement of occludin and increased permeability of endothelial cells. The implication of lipid rafts and PP2A signaling in these processes was further defined by co-immunoprecipitation of occludin with PP2A and caveolin-1, a marker protein of lipid rafts. Indeed, a significant MMP-2 activity was observed in lipid rafts and was increased by exposure to PCB153. The pretreatment of MMP-2 inhibitors protected against PCB153-induced loss of occludin and disruption of lipid raft structure prevented the increase of endothelial permeability. Overall, these results indicate that lipid raft-associated processes, such as PP2A and MMP-2 activation, participate in PCB153-induced disruption of occludin function in brain endothelial barrier. This study contributes to a better understanding of the mechanisms leading to brain endothelial barrier dysfunction in response to exposure to environmental pollutants, such as ortho-substituted PCBs. - Highlights: • PCB153 disturbed human brain endothelial barrier through disruption of occludin. • Lipid raft-associated PP
Functional barriers: Properties and evaluation
Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.
2005-01-01
Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of
Atomistic modeling of the structural components of the blood-brain barrier
Glukhova, O. E.; Grishina, O. A.; Slepchenkov, M. M.
2015-03-01
Blood-brain barrier, which is a barrage system between the brain and blood vessels, plays a key role in the "isolation" of the brain of unnecessary information, and reduce the "noise" in the interneuron communication. It is known that the barrier function of the BBB strictly depends on the initial state of the organism and changes significantly with age and, especially in developing the "vascular accidents". Disclosure mechanisms of regulation of the barrier function will develop new ways to deliver neurotrophic drugs to the brain in the newborn. The aim of this work is the construction of atomistic models of structural components of the blood-brain barrier to reveal the mechanisms of regulation of the barrier function.
Sorting Tubules Regulate Blood-Brain Barrier Transcytosis
Directory of Open Access Journals (Sweden)
Roberto Villaseñor
2017-12-01
Full Text Available Transcytosis across the blood-brain barrier (BBB regulates key processes of the brain, but the intracellular sorting mechanisms that determine successful receptor-mediated transcytosis in brain endothelial cells (BECs remain unidentified. Here, we used Transferrin receptor-based Brain Shuttle constructs to investigate intracellular transport in BECs, and we uncovered a pathway for the regulation of receptor-mediated transcytosis. By combining live-cell imaging and mathematical modeling in vitro with super-resolution microscopy of the BBB, we show that intracellular tubules promote transcytosis across the BBB. A monovalent construct (sFab sorted for transcytosis was localized to intracellular tubules, whereas a bivalent construct (dFab sorted for degradation formed clusters with impaired transport along tubules. Manipulating tubule biogenesis by overexpressing the small GTPase Rab17 increased dFab transport into tubules and induced its transcytosis in BECs. We propose that sorting tubules regulate transcytosis in BECs and may be a general mechanism for receptor-mediated transport across the BBB.
Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis
International Nuclear Information System (INIS)
Svenson, Ola
2000-02-01
The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses
Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis
Energy Technology Data Exchange (ETDEWEB)
Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology
2000-02-01
The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.
Théodore, Florence; Juárez-Ramírez, Clara; Cahuana-Hurtado, Lucero; Blanco, Ilian; Tolentino-Mayo, Lizbeth; Bonvecchio, Anabelle
2014-01-01
To identify barriers and opportunities for the regulation of food and beverage advertising to children. A qualitative study. Fourteen key informants from the congress, private sector, officials from the ministry of health and academics involved in the issue of regulation of advertising were interviewed. Barriers identified: conception of obesity as an individual problem, minimization of the negative effects on health, definition of the vulnerability of children bounded to their cognitive development. Facilitators support from various sectors of society regulation, extensive scientific discussion on the subject, successful experience and its lessons on tabacco industry. Mexico has key elements for achieving effective regulation on advertising.
A study on the quantitative evaluation of skin barrier function
Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko
2015-03-01
We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.
Gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice
Fang, Yu; Chen, Hao; Hu, Yuhui; Djukic, Zorka; Tevebaugh, Whitney; Shaheen, Nicholas J.; Orlando, Roy C.; Hu, Jianguo
2013-01-01
The barrier function of the esophageal epithelium is a major defense against gastroesophageal reflux disease. Previous studies have shown that reflux damage is reflected in a decrease in transepithelial electrical resistance associated with tight junction alterations in the esophageal epithelium. To develop novel therapies, it is critical to understand the molecular mechanisms whereby contact with a refluxate impairs esophageal barrier function. In this study, surgical models of duodenal and mixed reflux were developed in mice. Mouse esophageal epithelium was analyzed by gene microarray. Gene set enrichment analysis showed upregulation of inflammation-related gene sets and the NF-κB pathway due to reflux. Significance analysis of microarrays revealed upregulation of NF-κB target genes. Overexpression of NF-κB subunits (p50 and p65) and NF-κB target genes (matrix metalloproteinases-3 and -9, IL-1β, IL-6, and IL-8) confirmed activation of the NF-κB pathway in the esophageal epithelium. In addition, real-time PCR, Western blotting, and immunohistochemical staining also showed downregulation and mislocalization of claudins-1 and -4. In a second animal experiment, treatment with an NF-κB inhibitor, BAY 11-7085 (20 mg·kg−1·day−1 ip for 10 days), counteracted the effects of duodenal and mixed reflux on epithelial resistance and NF-κB-regulated cytokines. We conclude that gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice and that targeting the NF-κB pathway may strengthen esophageal barrier function against reflux. PMID:23639809
RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry
Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.
2014-01-01
ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621
Applications of Skyrme energy-density functional to fusion reactions spanning the fusion barriers
International Nuclear Information System (INIS)
Liu Min; Wang, Ning; Li Zhuxia; Wu Xizhen; Zhao Enguang
2006-01-01
The Skyrme energy density functional has been applied to the study of heavy-ion fusion reactions. The barriers for fusion reactions are calculated by the Skyrme energy density functional with proton and neutron density distributions determined by using restricted density variational (RDV) method within the same energy density functional together with semi-classical approach known as the extended semi-classical Thomas-Fermi method. Based on the fusion barrier obtained, we propose a parametrization of the empirical barrier distribution to take into account the multi-dimensional character of real barrier and then apply it to calculate the fusion excitation functions in terms of barrier penetration concept. A large number of measured fusion excitation functions spanning the fusion barriers can be reproduced well. The competition between suppression and enhancement effects on sub-barrier fusion caused by neutron-shell-closure and excess neutron effects is studied
Abe, Ayumi; Takano, Kenichi; Kojima, Takashi; Nomura, Kazuaki; Kakuki, Takuya; Kaneko, Yakuto; Yamamoto, Motohisa; Takahashi, Hiroki; Himi, Tetsuo
2016-06-01
Tight junctions (TJs) are necessary for salivary gland function and may serve as indicators of salivary gland epithelial dysfunction. IgG4-related disease (IgG4-RD) is a newly recognized fibro-inflammatory condition which disrupts the TJ associated epithelial barrier. The salivary glands are one of the most frequently involved organs in IgG4-RD, however, changes of the TJ associated epithelial barrier in salivary gland duct epithelium is poorly understood. Here, we investigated the regulation and function of TJs in human submandibular gland ductal epithelial cells (HSDECs) in normal and IgG4-RD. We examined submandibular gland (SMG) tissue from eight control individuals and 22 patients with IgG4-RD and established an HSDEC culture system. Immunohistochemistry, immunocytochemistry, western blotting, and measurement of transepithelial electrical resistance (TER) were performed. Claudin-4, claudin-7, occludin, and JAM-A were expressed at the apical side of the duct epithelium in submandibular gland (SMG) tissue and at the cell borders in HSDECs of normal and IgG4-RD. The expression and distribution of TJs in SMG tissue were not different in control individuals and patients with IgG4-RD in vivo and in vitro. Although interferon-gamma (IFNγ) generally disrupts the integrity and function of TJs, as manifested by decreased epithelial barrier function, IFNγ markedly increased the epithelial barrier function of HSDECs via upregulation of claudin-7 expression in HSDECs from patients with IgG4-RD. This is the first report showing an IFNγ-dependent increase in epithelial barrier function in the salivary gland duct epithelium. Our results provide insights into the functional significance of TJs in salivary gland duct epithelium in physiological and pathological conditions, including IgG4-RD.
Permanent isolation surface barrier: Functional performance
International Nuclear Information System (INIS)
Wing, N.R.
1993-10-01
This document presents the functional performance parameters for permanent isolation surface barriers. Permanent isolation surface barriers have been proposed for use at the Hanford Site (and elsewhere) to isolate and dispose of certain types of waste in place. Much of the waste that would be disposed of using in-place isolation techniques is located in subsurface structures, such as solid waste burial grounds, tanks, vaults, and cribs. Unless protected in some way, the wastes could be transported to the accessible environment via transport pathways, such as water infiltration, biointrusion, wind and water erosion, human interference, and/or gaseous release
Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.
Directory of Open Access Journals (Sweden)
Reiko J Tanaka
Full Text Available Atopic dermatitis (AD is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs, whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier
Uniting Control Lyapunov and Control Barrier Functions
Romdlony, Zakiyullah; Jayawardhana, Bayu
2014-01-01
In this paper, we propose a nonlinear control design for solving the problem of stabilization with guaranteed safety. The design is based on the merging of a Control Lyapunov Function and a Control Barrier Function. The proposed control method allows us to combine the design of a stabilizer based on
Barrier performance researches for the safety evaluation
International Nuclear Information System (INIS)
Niibori, Yuichi
2004-01-01
So far, many researches were conducted to propose a scientific evidence (a safety case) for the realization of geological disposal in Japan. In order to regulate the geological disposal system of radioactive wastes, on the other hand, we need also a holistic approach to integrate various data related for the performance evaluations of the engineered barrier system and the natural barrier system. However, the scientific bases are not sufficient to establish the safety regulation for such a natural system. For example, we often apply the specific probability density function (PDF) to the uncertainty of barrier system due to the essential heterogeneity. However, the applicability is not clear in the regulation point of view. A viewpoint to understand such an applicability of PDFs has been presented. (author)
Kho, Dan T; Johnson, Rebecca H; O'Carroll, Simon J; Angel, Catherine E; Graham, E Scott
2017-09-21
Herein we demonstrate the sensitive nature of human blood-brain barrier (BBB) endothelial cells to sodium azide and its gaseous product. Sodium azide is known to be acutely cytotoxic at low millimolar concentrations, hence its use as a biological preservative (e.g., in antibodies). Loss of barrier integrity was noticed in experiments using Electric Cell-substrate Impedance Sensing (ECIS) biosensor technology, to measure endothelial barrier integrity continuously in real-time. Initially the effect of sodium azide was observed as an artefact where it was present in antibodies being employed in neutralisation experiments. This was confirmed where antibody clones that were azide-free did not mediate loss of barrier function. A delayed loss of barrier function in neighbouring wells implied the influence of a liberated gaseous product. ECIS technology demonstrated that the BBB endothelial cells had a lower level of direct sensitivity to sodium azide of ~3 µM. Evidence of gaseous toxicity was consistently observed at 30 µM and above, with disrupted barrier function and cell death in neighbouring wells. We highlight the ability of this cellular biosensor technology to reveal both the direct and gaseous toxicity mediated by sodium azide. The sensitivity and temporal dimension of ECIS technology was instrumental in these observations. These findings have substantial implications for the wide use of sodium azide in biological reagents, raising issues of their application in live-cell assays and with regard to the protection of the user. This research also has wider relevance highlighting the sensitivity of brain endothelial cells to a known mitochondrial disruptor. It is logical to hypothesise that BBB endothelial dysfunction due to mitochondrial dys-regulation could have an important but underappreciated role in a range of neurological diseases.
Barrier properties of cultured retinal pigment epithelium.
Rizzolo, Lawrence J
2014-09-01
The principal function of an epithelium is to form a dynamic barrier that regulates movement between body compartments. Each epithelium is specialized with barrier functions that are specific for the tissues it serves. The apical surface commonly faces a lumen, but the retinal pigment epithelium (RPE) appears to be unique by a facing solid tissue, the sensory retina. Nonetheless, there exists a thin (subretinal) space that can become fluid filled during pathology. RPE separates the subretinal space from the blood supply of the outer retina, thereby forming the outer blood-retinal barrier. The intricate interaction between the RPE and sensory retina presents challenges for learning how accurately culture models reflect native behavior. The challenge is heightened by findings that detail the variation of RPE barrier proteins both among species and at different stages of the life cycle. Among the striking differences is the expression of claudin family members. Claudins are the tight junction proteins that regulate ion diffusion across the spaces that lie between the cells of a monolayer. Claudin expression by RPE varies with species and life-stage, which implies functional differences among commonly used animal models. Investigators have turned to transcriptomics to supplement functional studies when comparing native and cultured tissue. The most detailed studies of the outer blood-retinal barrier have focused on human RPE with transcriptome and functional studies reported for human fetal, adult, and stem-cell derived RPE. Copyright © 2014 Elsevier Ltd. All rights reserved.
Chichger, Havovi; Braza, Julie; Duong, Huetran; Harrington, Elizabeth O
2015-06-01
Enhanced protein tyrosine phosphorylation is associated with changes in vascular permeability through formation and dissolution of adherens junctions and regulation of stress fiber formation. Inhibition of the protein tyrosine phosphorylase SH2 domain-containing protein tyrosine phosphatase 2 (SHP2) increases tyrosine phosphorylation of vascular endothelial cadherin and β-catenin, resulting in disruption of the endothelial monolayer and edema formation in the pulmonary endothelium. Vascular permeability is a hallmark of acute lung injury (ALI); thus, enhanced SHP2 activity offers potential therapeutic value for the pulmonary vasculature in diseases such as ALI, but this has not been characterized. To assess whether SHP2 activity mediates protection against edema in the endothelium, we assessed the effect of molecular activation of SHP2 on lung endothelial barrier function in response to the edemagenic agents LPS and thrombin. Both LPS and thrombin reduced SHP2 activity, correlated with decreased focal adhesion kinase (FAK) phosphorylation (Y(397) and Y(925)) and diminished SHP2 protein-protein associations with FAK. Overexpression of constitutively active SHP2 (SHP2(D61A)) enhanced baseline endothelial monolayer resistance and completely blocked LPS- and thrombin-induced permeability in vitro and significantly blunted pulmonary edema formation induced by either endotoxin (LPS) or Pseudomonas aeruginosa exposure in vivo. Chemical inhibition of FAK decreased SHP2 protein-protein interactions with FAK concomitant with increased permeability; however, overexpression of SHP2(D61A) rescued the endothelium and maintained FAK activity and FAK-SHP2 protein interactions. Our data suggest that SHP2 activation offers the pulmonary endothelium protection against barrier permeability mediators downstream of the FAK signaling pathway. We postulate that further studies into the promotion of SHP2 activation in the pulmonary endothelium may offer a therapeutic approach for patients
Distinct functions of Crumbs regulating slit diaphragms and endocytosis in Drosophila nephrocytes.
Hochapfel, Florian; Denk, Lucia; Mendl, Gudrun; Schulze, Ulf; Maaßen, Christine; Zaytseva, Yulia; Pavenstädt, Hermann; Weide, Thomas; Rachel, Reinhard; Witzgall, Ralph; Krahn, Michael P
2017-12-01
Mammalian podocytes, the key determinants of the kidney's filtration barrier, differentiate from columnar epithelial cells and several key determinants of apical-basal polarity in the conventional epithelia have been shown to regulate podocyte morphogenesis and function. However, little is known about the role of Crumbs, a conserved polarity regulator in many epithelia, for slit-diaphragm formation and podocyte function. In this study, we used Drosophila nephrocytes as model system for mammalian podocytes and identified a conserved function of Crumbs proteins for cellular morphogenesis, nephrocyte diaphragm assembly/maintenance, and endocytosis. Nephrocyte-specific knock-down of Crumbs results in disturbed nephrocyte diaphragm assembly/maintenance and decreased endocytosis, which can be rescued by Drosophila Crumbs as well as human Crumbs2 and Crumbs3, which were both expressed in human podocytes. In contrast to the extracellular domain, which facilitates nephrocyte diaphragm assembly/maintenance, the intracellular FERM-interaction motif of Crumbs is essential for regulating endocytosis. Moreover, Moesin, which binds to the FERM-binding domain of Crumbs, is essential for efficient endocytosis. Thus, we describe here a new mechanism of nephrocyte development and function, which is likely to be conserved in mammalian podocytes.
The impact of ultraviolet therapy on stratum corneum ceramides and barrier function
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2011-01-01
therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...
The impact of ultraviolet therapy on stratum corneum ceramides and barrier function
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2011-01-01
therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...
Crossing safety barriers: influence of children's morphological and functional variables.
Cordovil, Rita; Vieira, Filomena; Barreiros, João
2012-05-01
Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.
The important role of stratum corneum lipids for the cutaneous barrier function.
van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A
2014-03-01
The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.
A search for parameters of universal sub-barrier fusion excitation function
Energy Technology Data Exchange (ETDEWEB)
Qu, W.W. [Medical College of Soochow University, School of Radiation Medicine and Protection, Soochow (China); Zhang, G.L. [Beihang University, School of Physics and Nuclear Energy Engineering, Beijing (China); Wolski, R. [Henryk Niewodniczanski Institute of Nuclear Physics PAS, Cracow (Poland)
2016-11-15
Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections. (orig.)
The Drosophila blood-brain barrier: Development and function of a glial endothelium
Directory of Open Access Journals (Sweden)
Stefanie eLimmer
2014-11-01
Full Text Available The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.
The Drosophila blood-brain barrier: development and function of a glial endothelium.
Limmer, Stefanie; Weiler, Astrid; Volkenhoff, Anne; Babatz, Felix; Klämbt, Christian
2014-01-01
The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial (SPG) cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.
A nuclide transfer model for barriers of the seabed repository using response function
International Nuclear Information System (INIS)
Lee, Youn Myoung; Kang, Chul Hyung; Hahn, Pil Soo
1996-01-01
A nuclide transfer by utilizing mass transfer coefficient and barrier response function defined for each barrier is proposed, by which the final nuclide transfer rate into the sea water can be evaluated. When simple and immediate quantification of the nuclide release is necessary in the conservative aspect, using this kind of approach may be advantageous since each layered barrier can be treated separately from other media in series in the repository system, making it possible to apply separate solutions in succession to other various media. Although one disadvantage is that while flux continuity can be maintained at the interface by using the exit nuclide flux from the first medium as the source flux for the next one, there may be no guarantee for concentration continuity, this problem could be eliminated assuming that there is no boundary resistance to mass transfer across the interface. Mass transfer coefficient can be determined by the assumption that the nuclide concentration gradient at the interface between adjacent barriers remains constant and barrier response function is obtained from an analytical expression for nuclide flow rate out of each barrier in response to a unit impulse into the barrier multiplied by mass transfer coefficient. Total time-dependent nuclide transfer rate from the barrier can then be obtained by convoluting the response function for the barrier with a previously calculated set of time-varying input of nuclide flow rate for the previous barrier. 18 refs., 5 figs. (author)
Stabilization with guaranteed safety using Control Lyapunov–Barrier Function
Romdlony, Muhammad Zakiyullah; Jayawardhana, Bayu
2016-01-01
We propose a novel nonlinear control method for solving the problem of stabilization with guaranteed safety for nonlinear systems. The design is based on the merging of the well-known Control Lyapunov Function (CLF) and the recent concept of Control Barrier Function (CBF). The proposed control
Crossing the entropy barrier of dynamical zeta functions
International Nuclear Information System (INIS)
Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F.
1992-01-01
Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.)
Crossing the entropy barrier of dynamical zeta functions
Energy Technology Data Exchange (ETDEWEB)
Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)
1992-01-01
Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).
Fatty acids are required for epidermal permeability barrier function.
Mao-Qiang, M; Elias, P M; Feingold, K R
1993-08-01
The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.
Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.
Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T
2012-01-01
Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.
Jamin, Augusta; Wicklund, April; Wiebe, Matthew S
2014-05-01
Barrier-to-autointegration factor (BAF) is a DNA binding protein with multiple cellular functions, including the ability to act as a potent defense against vaccinia virus infection. This antiviral function involves BAF's ability to condense double-stranded DNA and subsequently prevent viral DNA replication. In recent years, it has become increasingly evident that dynamic phosphorylation involving the vaccinia virus B1 kinase and cellular enzymes is likely a key regulator of multiple BAF functions; however, the precise mechanisms are poorly understood. Here we analyzed how phosphorylation impacts BAF's DNA binding, subcellular localization, dimerization, and antipoxviral activity through the characterization of BAF phosphomimetic and unphosphorylatable mutants. Our studies demonstrate that increased phosphorylation enhances BAF's mobilization from the nucleus to the cytosol, while dephosphorylation restricts BAF to the nucleus. Phosphorylation also impairs both BAF's dimerization and its DNA binding activity. Furthermore, our studies of BAF's antiviral activity revealed that hyperphosphorylated BAF is unable to suppress viral DNA replication or virus production. Interestingly, the unphosphorylatable BAF mutant, which is capable of binding DNA but localizes predominantly to the nucleus, was also incapable of suppressing viral replication. Thus, both DNA binding and localization are important determinants of BAF's antiviral function. Finally, our examination of how phosphatases are involved in regulating BAF revealed that PP2A dephosphorylates BAF during vaccinia infection, thus counterbalancing the activity of the B1 kinase. Altogether, these data demonstrate that phosphoregulation of BAF by viral and cellular enzymes modulates this protein at multiple molecular levels, thus determining its effectiveness as an antiviral factor and likely other functions as well. The barrier-to-autointegration factor (BAF) contributes to cellular genomic integrity in multiple ways
Directory of Open Access Journals (Sweden)
Pasricha J
1991-01-01
Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.
Barrier functions for Pucci-Heisenberg operators and applications
Cutri , Alessandra; Tchou , Nicoletta
2007-01-01
International audience; The aim of this article is the explicit construction of some barrier functions ("fundamental solutions") for the Pucci-Heisenberg operators. Using these functions we obtain the continuity property, up to the boundary, for the viscosity solution of fully non-linear Dirichlet problems on the Heisenberg group, if the boundary of the domain satisfies some regularity geometrical assumptions (e.g. an exterior Heisenberg-ball condition at the characteristic points). We point ...
Safety barriers and safety functions a comparison of different applications
International Nuclear Information System (INIS)
Harms-Ringdahl, L.
1998-01-01
A study is being made with the focus on different theories and applications concerning 'safety barriers' and 'safety functions'. One aim is to compare the characteristics of different kinds of safely functions, which can be purpose, efficiency, reliability, weak points etc. A further aim is to summarize how the combination of different barriers are described and evaluated. Of special interest are applications from nuclear and chemical process safety. The study is based on a literature review, interviews and discussions. Some preliminary conclusions are made. For example, it appears to exist a need for better tools to support the design and evaluation of procedures. There are a great number of theoretical models describing safety functions. However, it still appears to be an interest in further development of models, which might give the basis for improved practical tools. (author)
Executive functions and self-regulation.
Hofmann, Wilhelm; Schmeichel, Brandon J; Baddeley, Alan D
2012-03-01
Self-regulation is a core aspect of adaptive human behavior that has been studied, largely in parallel, through the lenses of social and personality psychology as well as cognitive psychology. Here, we argue for more communication between these disciplines and highlight recent research that speaks to their connection. We outline how basic facets of executive functioning (working memory operations, behavioral inhibition, and task-switching) may subserve successful self-regulation. We also argue that temporary reductions in executive functions underlie many of the situational risk factors identified in the social psychological research on self-regulation and review recent evidence that the training of executive functions holds significant potential for improving poor self-regulation in problem populations. Copyright © 2012 Elsevier Ltd. All rights reserved.
Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa
2015-01-01
Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018
Directory of Open Access Journals (Sweden)
Hee Soon Shin
2015-01-01
Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.
Simal-Gándara, J; Sarria-Vidal, M; Koorevaar, A; Rijk, R
2000-08-01
The advent of the functional barrier concept in food packaging has brought with it a requirement for fast tests of permeation through potential barrier materials. In such tests it would be convenient for both foodstuffs and materials below the functional barrier (sub-barrier materials) to be represented by standard simulants. By means of inverse gas chromatography, liquid paraffin spiked with appropriate permeants was considered as a potential simulant of sub-barrier materials based on polypropylene (PP) or similar polyolefins. Experiments were performed to characterize the kinetics of the permeation of low molecular weight model permeants (octene, toluene and isopropanol) from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick oriented PP) into the food stimulants olive oil and 3% (w/v) acetic acid. These permeation results were interpreted in terms of three permeation kinetic models regarding the solubility of a particular model permeant in the post-barrier medium (i.e. the food simulant). The results obtained justify the development and evaluation of liquid sub-barrier simulants that would allow flexible yet rigorous testing of new laminated multilayer packaging materials.
Wiltshire, Rachael; Nelson, Vicky; Kho, Dan Ting; Angel, Catherine E; O'Carroll, Simon J; Graham, E Scott
2016-01-27
Herein we show that S1P rapidly and acutely reduces the focal adhesion strength and barrier tightness of brain endothelial cells. xCELLigence biosensor technology was used to measure focal adhesion, which was reduced by S1P acutely and this response was mediated through both S1P1 and S1P2 receptors. S1P increased secretion of several pro-inflammatory mediators from brain endothelial cells. However, the magnitude of this response was small in comparison to that mediated by TNFα or IL-1β. Furthermore, S1P did not significantly increase cell-surface expression of any key cell adhesion molecules involved in leukocyte recruitment, included ICAM-1 and VCAM-1. Finally, we reveal that S1P acutely and dynamically regulates microvascular endothelial barrier tightness in a manner consistent with regulated rapid opening followed by closing and strengthening of the barrier. We hypothesise that the role of the S1P receptors in this process is not to cause barrier dysfunction, but is related to controlled opening of the endothelial junctions. This was revealed using real-time measurement of barrier integrity using ECIS ZΘ TEER technology and endothelial viability using xCELLigence technology. Finally, we show that these responses do not occur simply though the pharmacology of a single S1P receptor but involves coordinated action of S1P1 and S1P2 receptors.
Barrier and system performances within a safety case: their functioning and evolution with time
International Nuclear Information System (INIS)
Hedin, A.; Voinis, S.; Fillion, E.; Keller, S.; Lalieux, Ph.; Nachmilner, L.; Nys, V.; Rodriguez, J.; Sevougian, D.; Wollrath, J.
2002-01-01
The following six questions were used as the basis for the discussions in a Working Group: - What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? - Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? - What is the requested or required performance versus the expected realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? - What is the issue associated with the geosphere stability for different geological systems? - How are barriers and system performances, as a function of time, evaluated (presented and communicated) in a safety case? - What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)
Trauma-Induced Heterotopic Ossification Regulates the Blood-Nerve Barrier
Directory of Open Access Journals (Sweden)
Zbigniew Gugala
2018-06-01
Full Text Available De novo bone formation can occur in soft tissues as a result of traumatic injury. This process, known as heterotopic ossification (HO, has recently been linked to the peripheral nervous system. Studies suggest that HO may resemble neural crest-derived bone formation and is activated through the release of key bone matrix proteins leading to opening of the blood-nerve barrier (BNB. One of the first steps in this process is the activation of a neuro-inflammatory cascade, which results in migration of chondro-osseous progenitors, and other cells from both the endoneurial and perineurial regions of the peripheral nerves. The perineurial cells undergo brown adipogenesis, to form essential support cells, which regulate expression and activation of matrix metallopeptidase 9 (MMP9 an essential regulatory protein involved in opening the BNB. However, recent studies suggest that, in mice, a key bone matrix protein, bone morphogenetic protein 2 (BMP2 is able to immediately cross the BNB to activate signaling in specific cells within the endoneurial compartment. BMP signaling correlates with bone formation and appears critical for the induction of HO. Surprisingly, several other bone matrix proteins have also been reported to regulate the BNB, leading us to question whether these matrix proteins are important in regulating the BNB. However, this temporary regulation of the BNB does not appear to result in degeneration of the peripheral nerve, but rather may represent one of the first steps in innervation of the newly forming bone.
Myosin Light Chain Kinase Mediates Intestinal Barrier Disruption following Burn Injury
Chen, Chuanli; Wang, Pei; Su, Qin; Wang, Shiliang; Wang, Fengjun
2012-01-01
Background Severe burn injury results in the loss of intestinal barrier function, however, the underlying mechanism remains unclear. Myosin light chain (MLC) phosphorylation mediated by MLC kinase (MLCK) is critical to the pathophysiological regulation of intestinal barrier function. We hypothesized that the MLCK-dependent MLC phosphorylation mediates the regulation of intestinal barrier function following burn injury, and that MLCK inhibition attenuates the burn-induced intestinal barrier disfunction. Methodology/Principal Findings Male balb/c mice were assigned randomly to either sham burn (control) or 30% total body surface area (TBSA) full thickness burn without or with intraperitoneal injection of ML-9 (2 mg/kg), an MLCK inhibitor. In vivo intestinal permeability to fluorescein isothiocyanate (FITC)-dextran was measured. Intestinal mucosa injury was assessed histologically. Tight junction proteins ZO-1, occludin and claudin-1 was analyzed by immunofluorescent assay. Expression of MLCK and phosphorylated MLC in ileal mucosa was assessed by Western blot. Intestinal permeability was increased significantly after burn injury, which was accompanied by mucosa injury, tight junction protein alterations, and increase of both MLCK and MLC phosphorylation. Treatment with ML-9 attenuated the burn-caused increase of intestinal permeability, mucosa injury, tight junction protein alterations, and decreased MLC phosphorylation, but not MLCK expression. Conclusions/Significance The MLCK-dependent MLC phosphorylation mediates intestinal epithelial barrier dysfunction after severe burn injury. It is suggested that MLCK-dependent MLC phosphorylation may be a critical target for the therapeutic treatment of intestinal epithelial barrier disruption after severe burn injury. PMID:22529961
Directory of Open Access Journals (Sweden)
Helen B. Stolp
2013-08-01
Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.
Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L
2016-08-01
OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence. METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures. RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence. CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Terciolo, Chloé; Dobric, Aurélie; Ouaissi, Mehdi; Siret, Carole; Breuzard, Gilles; Silvy, Françoise; Marchiori, Bastien; Germain, Sébastien; Bonier, Renaté; Hama, Adel; Owens, Roisin; Lombardo, Dominique; Rigot, Véronique; André, Frédéric
2017-08-01
Alteration in intestinal permeability is the main factor underlying the pathogenesis of many diseases affecting the gut, such as inflammatory bowel disease [IBD]. Characterization of molecules targeting the restoration of intestinal barrier integrity is therefore vital for the development of alternative therapies. The yeast Saccharomyces boulardii CNCM I-745 [Sb], used to prevent and treat antibiotic-associated infectious and functional diarrhea, may have a beneficial effect in the treatment of IBD. We analyzed the impact of Sb supernatant on tissue integrity and components of adherens junctions using cultured explants of colon from both IBD and healthy patients. To evaluate the pathways by which Sb regulates the expression of E-cadherin at the cell surface, we developed in vitro assays using human colonic cell lines, including cell aggregation, a calcium switch assay, real-time measurement of transepithelial electrical resistance [TEER] and pulse-chase experiments. We showed that Sb supernatant treatment of colonic explants protects the epithelial morphology and maintains E-cadherin expression at the cell surface. In vitro experiments revealed that Sb supernatant enhances E-cadherin delivery to the cell surface by re-routing endocytosed E-cadherin back to the plasma membrane. This process, involving Rab11A-dependent recycling endosome, leads to restoration of enterocyte adherens junctions, in addition to the overall restoration and strengthening of intestinal barrier function. These findings open new possibilities of discovering novel options for prevention and therapy of diseases that affect intestinal permeability. Copyright © 2017 European Crohn's and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com
Sphingosine 1-Phosphate (S1P) Carrier-dependent Regulation of Endothelial Barrier
Wilkerson, Brent A.; Grass, G. Daniel; Wing, Shane B.; Argraves, W. Scott; Argraves, Kelley M.
2012-01-01
Sphingosine 1-phosphate (S1P) is a blood-borne lysosphingolipid that acts to promote endothelial cell (EC) barrier function. In plasma, S1P is associated with both high density lipoproteins (HDL) and albumin, but it is not known whether the carriers impart different effects on S1P signaling. Here we establish that HDL-S1P sustains EC barrier longer than albumin-S1P. We showed that the sustained barrier effects of HDL-S1P are dependent on signaling by the S1P receptor, S1P1, and involve persistent activation of Akt and endothelial NOS (eNOS), as well as activity of the downstream NO target, soluble guanylate cyclase (sGC). Total S1P1 protein levels were found to be higher in response to HDL-S1P treatment as compared with albumin-S1P, and this effect was not associated with increased S1P1 mRNA or dependent on de novo protein synthesis. Several pieces of evidence indicate that long term EC barrier enhancement activity of HDL-S1P is due to specific effects on S1P1 trafficking. First, the rate of S1P1 degradation, which is proteasome-mediated, was slower in HDL-S1P-treated cells as compared with cells treated with albumin-S1P. Second, the long term barrier-promoting effects of HDL-S1P were abrogated by treatment with the recycling blocker, monensin. Finally, cell surface levels of S1P1 and levels of S1P1 in caveolin-enriched microdomains were higher after treatment with HDL-S1P as compared with albumin-S1P. Together, the findings reveal S1P carrier-specific effects on S1P1 and point to HDL as the physiological mediator of sustained S1P1-PI3K-Akt-eNOS-sGC-dependent EC barrier function. PMID:23135269
Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok
2004-03-01
Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.
Myosin light chain kinase mediates intestinal barrier disruption following burn injury.
Directory of Open Access Journals (Sweden)
Chuanli Chen
Full Text Available BACKGROUND: Severe burn injury results in the loss of intestinal barrier function, however, the underlying mechanism remains unclear. Myosin light chain (MLC phosphorylation mediated by MLC kinase (MLCK is critical to the pathophysiological regulation of intestinal barrier function. We hypothesized that the MLCK-dependent MLC phosphorylation mediates the regulation of intestinal barrier function following burn injury, and that MLCK inhibition attenuates the burn-induced intestinal barrier disfunction. METHODOLOGY/PRINCIPAL FINDINGS: Male balb/c mice were assigned randomly to either sham burn (control or 30% total body surface area (TBSA full thickness burn without or with intraperitoneal injection of ML-9 (2 mg/kg, an MLCK inhibitor. In vivo intestinal permeability to fluorescein isothiocyanate (FITC-dextran was measured. Intestinal mucosa injury was assessed histologically. Tight junction proteins ZO-1, occludin and claudin-1 was analyzed by immunofluorescent assay. Expression of MLCK and phosphorylated MLC in ileal mucosa was assessed by Western blot. Intestinal permeability was increased significantly after burn injury, which was accompanied by mucosa injury, tight junction protein alterations, and increase of both MLCK and MLC phosphorylation. Treatment with ML-9 attenuated the burn-caused increase of intestinal permeability, mucosa injury, tight junction protein alterations, and decreased MLC phosphorylation, but not MLCK expression. CONCLUSIONS/SIGNIFICANCE: The MLCK-dependent MLC phosphorylation mediates intestinal epithelial barrier dysfunction after severe burn injury. It is suggested that MLCK-dependent MLC phosphorylation may be a critical target for the therapeutic treatment of intestinal epithelial barrier disruption after severe burn injury.
Fasano, Alessio
2008-01-01
The anatomical and functional arrangement of the gastrointestinal tract suggests that this organ, beside its digestive and absorptive functions, regulates the trafficking of macromolecules between the environment and the host through a barrier mechanism. Under physiological circumstances, this trafficking is safeguarded by the competency of intercellular tight junctions, structures whose physiological modulation is mediated by, among others, the recently described protein zonulin. To prevent harm and minimize inflammation, the same paracellular pathway, in concert with the gut-associated lymphoid tissue and the neuroendocrine network, controls the equilibrium between tolerance and immunity to nonself antigens. The zonulin pathway has been exploited to deliver drugs, macromolecules, or vaccines that normally would not be absorbed through the gastrointestinal mucosal barrier. However, if the tightly regulated trafficking of macromolecules is jeopardized secondary to prolonged zonulin up-regulation, the excessive flow of nonself antigens in the intestinal submucosa can cause both intestinal and extraintestinal autoimmune disorders in genetically susceptible individuals. This new paradigm subverts traditional theories underlying the development of autoimmunity, which are based on molecular mimicry and/or the bystander effect, and suggests that the autoimmune process can be arrested if the interplay between genes and environmental triggers is prevented by re-establishing intestinal barrier competency. Understanding the role of zonulin-dependent intestinal barrier dysfunction in the pathogenesis of autoimmune diseases is an area of translational research that encompasses many fields. PMID:18832585
Miyauchi, Eiji; O'Callaghan, John; Buttó, Ludovica F; Hurley, Gráinne; Melgar, Silvia; Tanabe, Soichi; Shanahan, Fergus; Nally, Kenneth; O'Toole, Paul W
2012-11-01
Enhanced barrier function is one mechanism whereby commensals and probiotic bacteria limit translocation of foreign antigens or pathogens in the gut. However, barrier protection is not exhibited by all probiotic or commensals and the strain-specific molecules involved remain to be clarified. We evaluated the effects of 33 individual Lactobacillus salivarius strains on the hydrogen peroxide (H(2)O(2))-induced barrier impairment in human epithelial Caco-2 cells. These strains showed markedly different effects on H(2)O(2)-induced reduction in transepithelial resistance (TER). The effective strains such as UCC118 and CCUG38008 attenuated H(2)O(2)-induced disassembly and relocalization of tight junction proteins, but the ineffective strain AH43324 did not. Strains UCC118 and CCUG38008 induced phosphorylation of extracellular signal-regulated kinase (ERK) in Caco-2 cells, and the ERK inhibitor U0126 attenuated the barrier-protecting effect of these strains. In contrast, the AH43324 strain induced phosphorylation of Akt and p38, which was associated with an absence of a protective effect. Global transcriptome analysis of UCC118 and AH43324 revealed that some genes in a bacteriocin gene cluster were upregulated in AH43324 under TER assay conditions. A bacteriocin-negative UCC118 mutant displayed significantly greater suppressive effect on H(2)O(2)-induced reduction in TER compared with wild-type UCC118. The wild-type strain augmented H(2)O(2)-induced phosphorylation of Akt and p38, whereas a bacteriocin-negative UCC118 mutant did not. These observations indicate that L. salivarius strains are widely divergent in their capacity for barrier protection, and this is underpinned by differences in the activation of intracellular signaling pathways. Furthermore, bacteriocin production appears to have an attenuating influence on lactobacillus-mediated barrier protection.
Directory of Open Access Journals (Sweden)
Magdalena Boer
2016-02-01
Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.
Ceramides and barrier function in healthy skin
DEFF Research Database (Denmark)
Jungerstedt, J; Hellgren, Lars; Drachmann, Tue
2010-01-01
Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...
Identification of Novel Ovarian Cancer Oncogenes that Function by Regulating Exosome Function
2017-09-01
Novel Ovarian Cancer Oncogenes that Function by Regulating Exosome Function September 2017 x 1Sep2016...31Aug2017 Email: mbirrer@partners.org 6 Identification of Novel Ovarian Cancer Oncogenes that Function by Regulating Exosome Function xx
Directory of Open Access Journals (Sweden)
Elisabeth Padilla
2014-06-01
Full Text Available We studied a case of failure in applying traditional ecological knowledge (TEK in comanagement as the basis for formal hunting regulations. We based the study on the Porcupine Caribou (Rangifer tarandus Herd "let the leaders pass" policy, established for the Dempster Highway of the Western Canadian Arctic, and identified conditions creating barriers in the successful application of TEK through comanagement. Stated as propositions, identified barriers include: (1 the context-specific nature of TEK limits its application in resource management regulations; (2 changes in traditional authority systems, hunting technology, and the social organization of harvesting caribou affect the effectiveness of TEK approaches in a contemporary social setting; (3 indigenous efforts toward self-government and political autonomy limit regional comanagement consensus in a heterogeneous cultural landscape; (4 the mismatch of agency enforcement of hunting regulations and TEK-based education is problematic. We analyzed the case through four historical phases of caribou management, complementing the study with a literature review of TEK and wildlife comanagement to explain why TEK integration of caribou leaders in regulatory resource management fell short of success. Identifying and understanding the social dynamics related to these barriers make apparent solutions for transforming the comanagement process.
Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I
2000-08-01
The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.
Barrier mechanisms in the Drosophila blood-brain barrier
Directory of Open Access Journals (Sweden)
Samantha Jane Hindle
2014-12-01
Full Text Available The invertebrate blood-brain barrier field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through GPCR signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate blood-brain barrier has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many blood-brain barrier mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the blood-brain barrier can govern whole animal physiologies. This includes novel functions of blood-brain barrier gap junctions in orchestrating synchronized neuroblast proliferation, and of blood-brain barrier secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate blood-brain barrier anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.
Directory of Open Access Journals (Sweden)
Adam Paré
Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.
The long noncoding RNA TUG1 regulates blood-tumor barrier permeability by targeting miR-144.
Cai, Heng; Xue, Yixue; Wang, Ping; Wang, Zhenhua; Li, Zhen; Hu, Yi; Li, Zhiqing; Shang, Xiuli; Liu, Yunhui
2015-08-14
Blood-tumor barrier (BTB) limits the delivery of chemotherapeutic agent to brain tumor tissues. Long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in various biologic processes of tumors. However, the role of lncRNAs in BTB permeability is unclear. LncRNA TUG1 (taurine upregulated gene 1) was highly expressed in glioma vascular endothelial cells from glioma tissues. It also upregulated in glioma co-cultured endothelial cells (GEC) from BTB model in vitro. Knockdown of TUG1 increased BTB permeability, and meanwhile down-regulated the expression of the tight junction proteins ZO-1, occludin, and claudin-5. Both bioinformatics and luciferase reporter assays demonstrated that TUG1 influenced BTB permeability via binding to miR-144. Furthermore, Knockdown of TUG1 also down-regulated Heat shock transcription factor 2 (HSF2), a transcription factor of the heat shock transcription factor family, which was defined as a direct and functional downstream target of miR-144. HSF2 up-regulated the promoter activities and interacted with the promoters of ZO-1, occludin, and claudin-5 in GECs. In conclusion, our results indicate that knockdown of TUG1 increased BTB permeability via binding to miR-144 and then reducing EC tight junction protein expression by targeting HSF2. Thus, TUG1 may represent a useful future therapeutic target for enhancing BTB permeability.
Regulation of Tight Junctions in Upper Airway Epithelium
Directory of Open Access Journals (Sweden)
Takashi Kojima
2013-01-01
Full Text Available The mucosal barrier of the upper respiratory tract including the nasal cavity, which is the first site of exposure to inhaled antigens, plays an important role in host defense in terms of innate immunity and is regulated in large part by tight junctions of epithelial cells. Tight junction molecules are expressed in both M cells and dendritic cells as well as epithelial cells of upper airway. Various antigens are sampled, transported, and released to lymphocytes through the cells in nasal mucosa while they maintain the integrity of the barrier. Expression of tight junction molecules and the barrier function in normal human nasal epithelial cells (HNECs are affected by various stimuli including growth factor, TLR ligand, and cytokine. In addition, epithelial-derived thymic stromal lymphopoietin (TSLP, which is a master switch for allergic inflammatory diseases including allergic rhinitis, enhances the barrier function together with an increase of tight junction molecules in HNECs. Furthermore, respiratory syncytial virus infection in HNECs in vitro induces expression of tight junction molecules and the barrier function together with proinflammatory cytokine release. This paper summarizes the recent progress in our understanding of the regulation of tight junctions in the upper airway epithelium under normal, allergic, and RSV-infected conditions.
Regulation of Thrombin-Induced Lung Endothelial Cell Barrier Disruption by Protein Kinase C Delta.
Directory of Open Access Journals (Sweden)
Lishi Xie
Full Text Available Protein Kinase C (PKC plays a significant role in thrombin-induced loss of endothelial cell (EC barrier integrity; however, the existence of more than 10 isozymes of PKC and tissue-specific isoform expression has limited our understanding of this important second messenger in vascular homeostasis. In this study, we show that PKCδ isoform promotes thrombin-induced loss of human pulmonary artery EC barrier integrity, findings substantiated by PKCδ inhibitory studies (rottlerin, dominant negative PKCδ construct and PKCδ silencing (siRNA. In addition, we identified PKCδ as a signaling mediator upstream of both thrombin-induced MLC phosphorylation and Rho GTPase activation affecting stress fiber formation, cell contraction and loss of EC barrier integrity. Our inhibitor-based studies indicate that thrombin-induced PKCδ activation exerts a positive feedback on Rho GTPase activation and contributes to Rac1 GTPase inhibition. Moreover, PKD (or PKCμ and CPI-17, two known PKCδ targets, were found to be activated by PKCδ in EC and served as modulators of cytoskeleton rearrangement. These studies clarify the role of PKCδ in EC cytoskeleton regulation, and highlight PKCδ as a therapeutic target in inflammatory lung disorders, characterized by the loss of barrier integrity, such as acute lung injury and sepsis.
Amone-P'Olak, Kennedy; Jones, Peter; Meiser-Stedman, Richard; Abbott, Rosemary; Ayella-Ataro, Paul Stephen; Amone, Jackson; Ovuga, Emilio
2014-12-01
Exposure to war is associated with considerable risks for long-term mental health problems (MHP) and poor functioning. Yet little is known about functioning and mental health service (MHS) use among former child soldiers (FCS). We assessed whether different categories of war experiences predict functioning and perceived need for, sources of and barriers to MHS among FCS. Data were drawn from an on-going War-affected Youths (WAYS) cohort study of FCS in Uganda. Participants completed questionnaires about war experiences, functioning and perceived need for, sources of and barriers to MHS. Regression analyses and parametric tests were used to assess between-group differences. Deaths, material losses, threat to loved ones and sexual abuse significantly predicted poor functioning. FCS who received MHS function better than those who did not. Females reported more emotional and behavioural problems and needed MHS more than males. FCS who function poorly indicated more barriers to MHS than those who function well. Stigma, fear of family break-up and lack of health workers were identified as barriers to MHS. Various war experiences affect functioning differently. A significant need for MHS exists amidst barriers to MHS. Nevertheless, FCS are interested in receiving MHS and believe it would benefit them. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan
2015-03-01
The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.
Directory of Open Access Journals (Sweden)
M Qaiser Fatmi
Full Text Available The oligomerization/co-localization of protein complexes and their cooperative regulation in protein function is a key feature in many biological systems. The synergistic regulation in different subunits often enhances the functional properties of the multi-enzyme complex. The present study used molecular dynamics and Brownian dynamics simulations to study the effects of allostery, oligomerization and intermediate channeling on enhancing the protein function of tryptophan synthase (TRPS. TRPS uses a set of α/β-dimeric units to catalyze the last two steps of L-tryptophan biosynthesis, and the rate is remarkably slower in the isolated monomers. Our work shows that without their binding partner, the isolated monomers are stable and more rigid. The substrates can form fairly stable interactions with the protein in both forms when the protein reaches the final ligand-bound conformations. Our simulations also revealed that the α/β-dimeric unit stabilizes the substrate-protein conformation in the ligand binding process, which lowers the conformation transition barrier and helps the protein conformations shift from an open/inactive form to a closed/active form. Brownian dynamics simulations with a coarse-grained model illustrate how protein conformations affect substrate channeling. The results highlight the complex roles of protein oligomerization and the fine balance between rigidity and dynamics in protein function.
Directory of Open Access Journals (Sweden)
Kai Wang
2016-05-01
Full Text Available Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ loci occludin and zona occludens (ZO-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.
Regulated functions and integrability
Directory of Open Access Journals (Sweden)
Ján Gunčaga
2009-04-01
Full Text Available Properties of functions defined on a bounded closed interval, weaker than continuity, have been considered by many mathematicians. Functions having both sides limits at each point are called regulated and were considered by J. Dieudonné [2], D. Fraňková [3] and others (see for example S. Banach [1], S. Saks [8]. The main class of functions we deal with consists of piece-wise constant ones. These functions play a fundamental role in the integration theory which had been developed by Igor Kluvanek (see Š. Tkacik [9]. We present an outline of this theory.
Vranken, Marjolein J M; Mantel-Teeuwisse, Aukje K; Jünger, Saskia; Radbruch, Lukas; Scholten, Willem; Lisman, John A; Subataite, Marija; Schutjens, Marie-Hélène D B
2017-06-01
Barriers linked to drug control systems are considered to contribute to inequitable access to controlled medicines, leaving millions of people in pain and suffering. Most studies focus on access to opioids for the treatment of severe (cancer) pain. This study aims to identify specific access barriers for patients with opioid dependence in legislation and regulations of 11 central and eastern European countries. This study builds on a previous analysis of legislation and regulations as part of the EU 7th Framework Access To Opioid Medication in Europe (ATOME) project. An in-depth analysis was undertaken to determine specific barriers for patients with opioid dependence in need of opioid analgesics or opioid agonist therapy (OAT). For each country, the number and nature of specific potential barriers for these patients were assessed according to eight categories: prescribing; dispensing; manufacturing; usage; trade and distribution; affordability; penalties; and other. An additional keyword search was conducted to minimize the omission of barriers. Barriers in an additional category, language, were recorded qualitatively. Countries included Bulgaria, Cyprus, Estonia, Greece, Hungary, Latvia, Lithuania, Serbia, Slovakia, Slovenia and Turkey. Ten of the 11 countries (all except Estonia) showed specific potential barriers in their legislation and regulations. The total number of barriers varied from two (Slovenia) to 46 (Lithuania); the number of categories varied from one (Slovenia) to five (Lithuania). Most specific potential barriers were shown in the categories 'prescribing', 'usage' and 'other'. The total number in a single category varied from one to 18 (Lithuania, prescribing). Individual differences between countries in the same specific potential barrier were shown; for example, variation in minimum age criteria for admission to OAT ranging from 15 (Lithuania, in special cases) to 20 years (Greece). All countries had stigmatizing language in their legislation
Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji
2016-01-01
To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.
Energy Technology Data Exchange (ETDEWEB)
NONE
2005-07-01
Driving forces and barriers behind development and usage of environmental technology is discussed, and also whether there are certain characteristics related to environmental innovations compared to other innovations in general. The development of environmental technology is in principle dominated by the same drivers and barriers as any other technology, but the order and strength of the various factors may be different. This examination as well as other empirical studies shows that regulations play a greater part for environmental technology than 'pure market forces'. To many participants it is important to be one step ahead of the regulations, i.e. the expected regulations are equally important as the factual ones in driving the technology development. Players in the business community express that it is important that the authorities cooperate with them when introducing new regulations. This will increase acceptance for the regulations and facilitate the necessary adjustments. The most important barrier in the development and use of the technologies studied is probably the lack of demand.
Effects of industrial detergents on the barrier function of human skin
DEFF Research Database (Denmark)
Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner
2000-01-01
Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...
Directory of Open Access Journals (Sweden)
Lefeng Wang
2017-01-01
Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.
Patterson, C E; Stasek, J E; Schaphorst, K L; Davis, H W; Garcia, J G
1995-06-01
We have previously characterized several G proteins in endothelial cells (EC) as substrates for the ADP-ribosyltransferase activity of both pertussis (PT) and cholera toxin and described the modulation of key EC physiological responses, including gap formation and barrier function, by these toxins. In this study, we investigated the mechanisms involved in PT-mediated regulation of bovine pulmonary artery endothelial cells barrier function. PT caused a dose-dependent increase in albumin transfer, dependent upon action of the holotoxin, since neither the heat-inactivated PT, the isolated oligomer, nor the protomer induced EC permeability. PT-induced gap formation and barrier dysfunction were additive to either thrombin- or thrombin receptor-activating peptide-induced permeability, suggesting that thrombin and PT utilize distinct mechanisms. PT did not result in Ca2+ mobilization or alter either basal or thrombin-induced myosin light chain phosphorylation. However, PT stimulated protein kinase C (PKC) activation, and both PKC downregulation and PKC inhibition attenuated PT-induced permeability, indicating that PKC activity is involved in PT-induced barrier dysfunction. Like thrombin-induced permeability, the PT effect was blocked by prior increases in adenosine 3',5'-cyclic monophosphate. Thus PT-catalyzed ADP-ribosylation of a G protein (possibly other than Gi) may regulate cytoskeletal protein interactions, leading to EC barrier dysfunction.
Directory of Open Access Journals (Sweden)
Ling-Yun Chu
Full Text Available The endothelial junction is tightly controlled to restrict the passage of blood cells and solutes. Disruption of endothelial barrier function by bacterial endotoxins, cytokines or growth factors results in inflammation and vascular damage leading to vascular diseases. We have identified 5-methoxytryptophan (5-MTP as an anti-inflammatory factor by metabolomic analysis of conditioned medium of human fibroblasts. Here we postulated that endothelial cells release 5-MTP to protect the barrier function. Conditioned medium of human umbilical vein endothelial cells (HUVECs prevented endothelial hyperpermeability and VE-cadherin downregulation induced by VEGF, LPS and cytokines. We analyzed the metabolomic profile of HUVEC conditioned medium and detected 5-MTP but not melatonin, serotonin or their catabolites, which was confirmed by enzyme-linked immunosorbent assay. Addition of synthetic pure 5-MTP preserved VE-cadherin and maintained barrier function despite challenge with pro-inflammatory mediators. Tryptophan hydroxylase-1, an enzyme required for 5-MTP biosynthesis, was downregulated in HUVECs by pro-inflammatory mediators and it was accompanied by reduction of 5-MTP. 5-MTP protected VE-cadherin and prevented endothelial hyperpermeability by blocking p38 MAPK activation. A chemical inhibitor of p38 MAPK, SB202190, exhibited a similar protective effect as 5-MTP. To determine whether 5-MTP prevents vascular hyperpermeability in vivo, we evaluated the effect of 5-MTP administration on LPS-induced murine microvascular permeability with Evans blue. 5-MTP significantly prevented Evans blue dye leakage. Our findings indicate that 5-MTP is a new class of endothelium-derived molecules which protects endothelial barrier function by blocking p38 MAPK.
Functions of an engineered barrier system for a nuclear waste repository in basalt
International Nuclear Information System (INIS)
Coons, W.E.; Moore, E.L.; Smith, M.J.; Kaser, J.D.
1980-01-01
Defined in this document are the functions of components selected for an engineered barrier system for a nuclear waste repository in basalt. The definitions provide a focal point for barrier material research and development by delineating the purpose and operative lifetime of each component of the engineered system. A five-component system (comprised of waste form, canister, buffer, overpack, and tailored backfill) is discussed in terms of effective operation throughout the course of repository history, recognizing that the emplacement environment changes with time. While components of the system are mutually supporting, redundancy is provided by subsystems of physical and chemical barriers which act in concert with the geology to provide a formidable barrier to transport of hazardous materials to the biosphere. The operating philosophy of the conceptual engineered barrier system is clarified by examples pertinent to storage in basalt, and a technical approach to barrier design and material selection is proposed. A method for system validation and qualification is also included which considers performance criteria proposed by external agencies in conjunction with site-specific models and risk assessment to define acceptable levels of system performance
Blood-aqueous Barrier Function in a Patient With Choroideremia
Directory of Open Access Journals (Sweden)
Muh-Shy Chen
2010-02-01
Full Text Available The purpose was to determine whether there was a breakdown of the blood-aqueous barrier in a patient with choroideremia. A 27-year-old man with typical choroideremia underwent standardized ophthalmo-logical evaluation, including quantitative measurement of aqueous flare intensity, by a laser flare-cell meter. The results showed areas of atrophy of the choriocapillaries and retinal pigment epithelium in the mid-periphery and posterior pole, although not in the macula. Fluorescein angiography showed areas of loss of the choriocapillaries and retinal pigment epithelium. The fovea was spared with a surrounding zone of hy-perfluorescence. Electroretinography showed a subnormal photopic amplitude and extinguished scotopic response. Electrooculography revealed that the light peak/dark trough ratio was reduced. Goldmann perimetry showed constricted peripheral fields. Laser photometry showed an increase in the aqueous flare intensity in both eyes, as compared with normal subjects. We conclude that the function of the blood-aqueous barrier might be affected in patients with choroideremia.
Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika
2017-07-01
Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
ZHANG Yuanyuan
2016-12-01
Full Text Available The incidence of non-alcoholic fatty liver disease (NAFLD has been increasing year by year in China. Intestinal mucosa is the largest organ for bacterial storage, and intestinal mucosal barrier includes biological barrier, mechanical barrier, immunological barrier, and chemical barrier. This article investigates the important role of intestinal mucosal barrier function in the pathogenesis of NAFLD. As for the intestinal biological barrier, abnormalities in gut microbiota occur earlier than obesity and other metabolic disorders; small intestinal bacterial overgrowth may affect energy metabolism, promote insulin resistance, and get involved in the pathogenesis of NAFLD; regulation of gut microbiota has a certain clinical effect in the treatment of NAFLD. Intestinal mechanical barrier impairment increases the mucosal permeability and is associated with intestinal dysbacteriosis. The changes in intestinal immunological barrier may be associated with obesity, metabolic disorders, and liver inflammation. The changes in intestinal chemical barrier can inhibit the synthesis and secretion of very low-density lipoprotein and low-density lipoprotein in hepatocytes and may result in triglyceride deposition in the liver. It is pointed out that the research on intestinal mucosal barrier function provides promising prospects for the prevention and treatment of NAFLD.
Molecular Pathophysiology of Epithelial Barrier Dysfunction in Inflammatory Bowel Diseases
Directory of Open Access Journals (Sweden)
Jessica Y. Lee
2018-03-01
Full Text Available Over the years, the scientific community has explored myriads of theories in search of the etiology and a cure for inflammatory bowel disease (IBD. The cumulative evidence has pointed to the key role of the intestinal barrier and the breakdown of these mechanisms in IBD. More and more scientists and clinicians are embracing the concept of the impaired intestinal epithelial barrier and its role in the pathogenesis and natural history of IBD. However, we are missing a key tool that bridges these scientific insights to clinical practice. Our goal is to overcome the limitations in understanding the molecular physiology of intestinal barrier function and develop a clinical tool to assess and quantify it. This review article explores the proteins in the intestinal tissue that are pivotal in regulating intestinal permeability. Understanding the molecular pathophysiology of impaired intestinal barrier function in IBD may lead to the development of a biochemical method of assessing intestinal tissue integrity which will have a significant impact on the development of novel therapies targeting the intestinal mucosa.
Lee, Sangheon; Woo, Jiyong; Lee, Daeseok; Cha, Euijun; Hwang, Hyunsang
2014-01-01
In this research, we analyzed the multi-functional role of a tunnel barrier that can be integrated in devices. This tunnel barrier, acting as an internal resistor, changes its resistance with applied bias. Therefore, the current flow in the devices can be controlled by a tunneling mechanism that modifies the tunnel barrier thickness for non-linearity and switching uniformity of devices. When a device is in a low-resistance state, the tunnel barrier controls the current behavior of the device because most of the bias is applied to the tunnel barrier owing to its higher resistance. Furthermore, the tunnel barrier induces uniform filament formation during set operation with the tunnel barrier controlling the current flow.
Lipids and skin barrier function - a clinical perspective
DEFF Research Database (Denmark)
Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.
2008-01-01
The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...
Chaotic correlations in barrier billiards with arbitrary barriers
International Nuclear Information System (INIS)
Osbaldestin, A H; Adamson, L N C
2013-01-01
We study autocorrelation functions in symmetric barrier billiards for golden mean trajectories with arbitrary barriers. Renormalization analysis reveals the presence of a chaotic invariant set and thus that, for a typical barrier, there are chaotic correlations. The chaotic renormalization set is the analogue of the so-called orchid that arises in a generalized Harper equation. (paper)
International Nuclear Information System (INIS)
Yokoi, Norihiko; Kinoshita, Shigeru; Morimoto, Taketoshi; Yoshizaki, Kazuo.
1995-01-01
Using gadolinium diethylenetriaminepentaacetic acid (Gd-DTPA) as a tracer, the barrier function of the corneal epithelium and endothelium was evaluated by proton nuclear magnetic resonance. Whole pig eyes and cornea excised with scleral rim, which had been incubated in dextran-added Gd-DTPA solution, were subjected to T 1 relaxation measurement and magnetic resonance imaging (MRI). After incubation, the T 1 relaxation rate (1/T 1 ) of the excised cornea increased to a steady value, whereas that of the cornea from the whole eye increased only slightly. These results indicated that the increase in the T 1 relaxation rate of the excised cornea was attributable to Gd-DTPA penetration from the corneal endothelium and that the corneal epithelium exhibited a strong barrier function against Gd-DTPA entry. The MRI study also confirmed the strong barrier, enhanced signals being detected within the aqueous fluid in the T 1 -weighted image only when the corneal epithelium was abraded. Since Gd-DTPA scarcely penetrates the intact corneal epithelium, Gd-DTPA-enhanced MRI shows potential as a quantitative tracer in evaluating epithelial barrier disruption. (author)
International Nuclear Information System (INIS)
Savio, Andrea; Poncet, Alain
2011-01-01
In this work, we compute the Wigner distribution function on one-dimensional devices from wave functions generated by solving the Schroedinger equation. Our goal is to investigate certain issues that we encountered in implementing Wigner transport equation solvers, such as the large discrepancies observed between the boundary conditions and the solution in the neighborhood of the boundaries. By evaluating the Wigner function without solving the Wigner transport equation, we intend to ensure that the actual boundary conditions are consistent with those commonly applied in literature. We study both single- and double-barrier unbiased structures. We use simple potential profiles, so that we can compute the wave functions analytically for better accuracy. We vary a number of structure geometry, material, meshing, and numerical parameters, among which are the contact length, the barrier height, the number of incident wave functions, and the numerical precision used for the computations, and we observe how the Wigner function at the device boundaries is affected. For the double-barrier structures, we look at the density matrix function and we study a model for the device transmission spectrum which helps explain the lobelike artifacts that we observe on the Wigner function.
Blood-brain barrier transport of drugs for the treatment of brain diseases.
Gabathuler, Reinhard
2009-06-01
The central nervous system is a sanctuary protected by barriers that regulate brain homeostasis and control the transport of endogenous compounds into the brain. The blood-brain barrier, formed by endothelial cells of the brain capillaries, restricts access to brain cells allowing entry only to amino acids, glucose and hormones needed for normal brain cell function and metabolism. This very tight regulation of brain cell access is essential for the survival of neurons which do not have a significant capacity to regenerate, but also prevents therapeutic compounds, small and large, from reaching the brain. As a result, various strategies are being developed to enhance access of drugs to the brain parenchyma at therapeutically meaningful concentrations to effectively manage disease.
Control of creatine metabolism by HIF is an endogenous mechanism of barrier regulation in colitis.
Glover, Louise E; Bowers, Brittelle E; Saeedi, Bejan; Ehrentraut, Stefan F; Campbell, Eric L; Bayless, Amanda J; Dobrinskikh, Evgenia; Kendrick, Agnieszka A; Kelly, Caleb J; Burgess, Adrianne; Miller, Lauren; Kominsky, Douglas J; Jedlicka, Paul; Colgan, Sean P
2013-12-03
Mucosal surfaces of the lower gastrointestinal tract are subject to frequent, pronounced fluctuations in oxygen tension, particularly during inflammation. Adaptive responses to hypoxia are orchestrated largely by the hypoxia-inducible transcription factors (HIFs). As HIF-1α and HIF-2α are coexpressed in mucosal epithelia that constitute the barrier between the lumen and the underlying immune milieu, we sought to define the discrete contribution of HIF-1 and HIF-2 transactivation pathways to intestinal epithelial cell homeostasis. The present study identifies creatine kinases (CKs), key metabolic enzymes for rapid ATP generation via the phosphocreatine-creatine kinase (PCr/CK) system, as a unique gene family that is coordinately regulated by HIF. Cytosolic CKs are expressed in a HIF-2-dependent manner in vitro and localize to apical intestinal epithelial cell adherens junctions, where they are critical for junction assembly and epithelial integrity. Supplementation with dietary creatine markedly ameliorated both disease severity and inflammatory responses in colitis models. Further, enzymes of the PCr/CK metabolic shuttle demonstrate dysregulated mucosal expression in a subset of ulcerative colitis and Crohn disease patients. These findings establish a role for HIF-regulated CK in epithelial homeostasis and reveal a fundamental link between cellular bioenergetics and mucosal barrier.
Subacute stress and chronic stress interact to decrease intestinal barrier function in rats.
Lauffer, Adriana; Vanuytsel, Tim; Vanormelingen, Christophe; Vanheel, Hanne; Salim Rasoel, Shadea; Tóth, Joran; Tack, Jan; Fornari, Fernando; Farré, Ricard
2016-01-01
Psychological stress increases intestinal permeability, potentially leading to low-grade inflammation and symptoms in functional gastrointestinal disorders. We assessed the effect of subacute, chronic and combined stress on intestinal barrier function and mast cell density. Male Wistar rats were allocated to four experimental groups (n = 8/group): 1/sham; 2/subacute stress (isolation and limited movement for 24 h); 3/chronic crowding stress for 14 days and 4/combined subacute and chronic stress. Jejunum and colon were collected to measure: transepithelial electrical resistance (TEER; a measure of epithelial barrier function); gene expression of tight junction molecules; mast cell density. Plasma corticosterone concentration was increased in all three stress conditions versus sham, with highest concentrations in the combined stress condition. TEER in the jejunum was decreased in all stress conditions, but was significantly lower in the combined stress condition than in the other groups. TEER in the jejunum correlated negatively with corticosterone concentration. Increased expression of claudin 1, 5 and 8, occludin and zonula occludens 1 mRNAs was detected after subacute stress in the jejunum. In contrast, colonic TEER was decreased only after combined stress, and the expression of tight junction molecules was unaltered. Increased mast cell density was observed in the chronic and combined stress condition in the colon only. In conclusion, our data show that chronic stress sensitizes the gastrointestinal tract to the effects of subacute stress on intestinal barrier function; different underlying cellular and molecular alterations are indicated in the small intestine versus the colon.
Suitability of polystyrene as a functional barrier layer in coloured food contact materials.
Genualdi, Susan; Addo Ntim, Susana; Begley, Timothy
2015-01-01
Functional barriers in food contact materials (FCMs) are used to prevent or reduce migration from inner layers in multilayer structures to food. The effectiveness of functional barrier layers was investigated in coloured polystyrene (PS) bowls due to their intended condition of use with hot liquids such as soups or stew. Migration experiments were performed over a 10-day period using USFDA-recommended food simulants (10% ethanol, 50% ethanol, corn oil and Miglyol) along with several other food oils. At the end of the 10 days, solvent dyes had migrated from the PS bowls at 12, 1 and 31,000 ng cm(-)(2) into coconut oil, palm kernel oil and Miglyol respectively, and in coconut oil and Miglyol the colour change was visible to the human eye. Scanning electron microscope (SEM) images revealed that the functional barrier was no longer intact for the bowls exposed to coconut oil, palm kernel oil, Miglyol, 10% ethanol, 50% ethanol and goat's milk. Additional tests showed that 1-dodecanol, a lauryl alcohol derived from palm kernel oil and coconut oil, was present in the PS bowls at an average concentration of 11 mg kg(-1). This compound is likely to have been used as a dispersing agent for the solvent dye and aided the migration of the solvent dye from the PS bowl into the food simulant. The solvent dye was not found in the 10% ethanol, 50% ethanol and goat's milk food simulants above their respective limits of detection, which is likely to be due to its insolubility in aqueous solutions. A disrupted barrier layer is of concern because if there are unregulated materials in the inner layers of the laminate, they may migrate to food, and therefore be considered unapproved food additives resulting in the food being deemed adulterated under the Federal Food Drug and Cosmetic Act.
Moeser, Adam J; Borst, Luke B; Overman, Beth L; Pittman, Jeremy S
2012-10-01
The objective of this study was to investigate intestinal function and morphology associated with peri-weaning failure to thrive syndrome (PFTS) in swine. Jejunum and distal ileum from control and pigs exhibiting PFTS was harvested at weaning, 4 and 11 days post-weaning (PW) for intestinal barrier function studies and histological analyses (n=6 pigs per group). Marked disturbances in intestinal barrier function was observed in PFTS pigs, compared with controls, indicated by lower (p<0.05) TER and increased (p<0.01) permeability to FITC dextran (4 kDa). Intestines from weaned pigs, subjected to a 4-day fast, exhibited minor disturbances in intestinal barrier function. Villus atrophy and crypt hyperplasia were observed in the PFTS intestine compared with control and fasted pigs. These data demonstrate that PFTS is associated with profound disturbances in intestinal epithelial barrier function and alterations in mucosal and epithelial morphology in which anorexia is not the sole factor. Copyright © 2012 Elsevier Ltd. All rights reserved.
Modelling of migration from multi-layers and functional barriers: Estimation of parameters
Dole, P.; Voulzatis, Y.; Vitrac, O.; Reynier, A.; Hankemeier, T.; Aucejo, S.; Feigenbaum, A.
2006-01-01
Functional barriers form parts of multi-layer packaging materials, which are deemed to protect the food from migration of a broad range of contaminants, e.g. those associated with reused packaging. Often, neither the presence nor the identity of the contaminants is known, so that safety assessment
The barrier within: endothelial transport of hormones.
Kolka, Cathryn M; Bergman, Richard N
2012-08-01
Hormones are involved in a plethora of processes including development and growth, metabolism, mood, and immune responses. These essential functions are dependent on the ability of the hormone to access its target tissue. In the case of endocrine hormones that are transported through the blood, this often means that the endothelium must be crossed. Many studies have shown that the concentrations of hormones and nutrients in blood can be very different from those surrounding the cells on the tissue side of the blood vessel endothelium, suggesting that transport across this barrier can be rate limiting for hormone action. This transport can be regulated by altering the surface area of the blood vessel available for diffusion through to the underlying tissue or by the permeability of the endothelium. Many hormones are known to directly or indirectly affect the endothelial barrier, thus affecting their own distribution to their target tissues. Dysfunction of the endothelial barrier is found in many diseases, particularly those associated with the metabolic syndrome. The interrelatedness of hormones may help to explain why the cluster of diseases in the metabolic syndrome occur together so frequently and suggests that treating the endothelium may ameliorate defects in more than one disease. Here, we review the structure and function of the endothelium, its contribution to the function of hormones, and its involvement in disease.
The Drosophila surface glia transcriptome: evolutionary conserved blood-brain barrier processes
DeSalvo, Michael K.; Hindle, Samantha J.; Rusan, Zeid M.; Orng, Souvinh; Eddison, Mark; Halliwill, Kyle; Bainton, Roland J.
2014-01-01
Central nervous system (CNS) function is dependent on the stringent regulation of metabolites, drugs, cells, and pathogens exposed to the CNS space. Cellular blood-brain barrier (BBB) structures are highly specific checkpoints governing entry and exit of all small molecules to and from the brain interstitial space, but the precise mechanisms that regulate the BBB are not well understood. In addition, the BBB has long been a challenging obstacle to the pharmacologic treatment of CNS diseases; ...
Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo
2016-10-01
Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.
Directory of Open Access Journals (Sweden)
Benjamin B. Williams
2015-08-01
Full Text Available The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD and colitis-associated cancer (CAC. Glycoprotein A33 (GPA33 is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33−/− mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33−/− mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS to injure the intestinal epithelium. Gpa33−/− mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM followed by two cycles of DSS. In contrast, Gpa33−/− mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33−/− mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33−/− mice provide a valuable model to study the mechanisms
Ceramides and barrier function in healthy skin
DEFF Research Database (Denmark)
Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae
2010-01-01
Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...
More, Vijay R; Campos, Christopher R; Evans, Rebecca A; Oliver, Keith D; Chan, Gary Ny; Miller, David S; Cannon, Ronald E
2017-04-01
Lipid sensor peroxisome proliferator-activated receptor alpha (PPAR- α) is the master regulator of lipid metabolism. Dietary release of endogenous free fatty acids, fibrates, and certain persistent environmental pollutants, e.g. perfluoroalkyl fire-fighting foam components, are peroxisome proliferator-activated receptor alpha ligands. Here, we define a role for peroxisome proliferator-activated receptor alpha in regulating the expression of three ATP-driven drug efflux transporters at the rat and mouse blood-brain barriers: P-glycoprotein (Abcb1), breast cancer resistance protein (Bcrp/Abcg2), and multidrug resistance-associated protein 2 (Mrp2/Abcc2). Exposing isolated rat brain capillaries to linoleic acid, clofibrate, or PKAs increased the transport activity and protein expression of the three ABC transporters. These effects were blocked by the PPAR- α antagonist, GW6471. Dosing rats with 20 mg/kg or 200 mg/kg of clofibrate decreased the brain accumulation of the P-glycoprotein substrate, verapamil, by 50% (in situ brain perfusion; effects blocked by GW6471) and increased P-glycoprotein expression and activity in capillaries ex vivo. Fasting C57Bl/6 wild-type mice for 24 h increased both serum lipids and brain capillary P-glycoprotein transport activity. Fasting did not alter P-glycoprotein activity in PPAR- α knockout mice. These results indicate that hyperlipidemia, lipid-lowering fibrates and exposure to certain fire-fighting foam components activate blood-brain barrier peroxisome proliferator-activated receptor alpha, increase drug efflux transporter expression and reduce drug delivery to the brain.
miRNA-mediated functional changes through co-regulating function related genes.
Directory of Open Access Journals (Sweden)
Jie He
Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.
The blood-brain barrier and oncology : new insights into function and modulation
Bart, J; Groen, HJM; Hendrikse, NH; van der Graaf, WTA; Vaalburg, W; de Vries, EGE
2000-01-01
The efficacy of chemotherapy for malignant primary or metastatic brain tumours is still poor. This is at least partly due to the presence of the blood-brain barrier (BBB). The functionality of the BBB can be explained by physicochemical features and efflux pump mechanisms. An overview of the
Directory of Open Access Journals (Sweden)
Jerome Mauris
Full Text Available BACKGROUND: Interaction of transmembrane mucins with the multivalent carbohydrate-binding protein galectin-3 is critical to maintaining the integrity of the ocular surface epithelial glycocalyx. This study aimed to determine whether disruption of galectin-3 multimerization and insertion of synthetic glycopolymers in the plasma membrane could be used to modulate glycocalyx barrier function in corneal epithelial cells. METHODOLOGY/PRINCIPAL FINDINGS: Abrogation of galectin-3 biosynthesis in multilayered cultures of human corneal epithelial cells using siRNA, and in galectin-3 null mice, resulted in significant loss of corneal barrier function, as indicated by increased permeability to the rose bengal diagnostic dye. Addition of β-lactose, a competitive carbohydrate inhibitor of galectin-3 binding activity, to the cell culture system, transiently disrupted barrier function. In these experiments, treatment with a dominant negative inhibitor of galectin-3 polymerization lacking the N-terminal domain, but not full-length galectin-3, prevented the recovery of barrier function to basal levels. As determined by fluorescence microscopy, both cellobiose- and lactose-containing glycopolymers incorporated into apical membranes of corneal epithelial cells, independently of the chain length distribution of the densely glycosylated, polymeric backbones. Membrane incorporation of cellobiose glycopolymers impaired barrier function in corneal epithelial cells, contrary to their lactose-containing counterparts, which bound to galectin-3 in pull-down assays. CONCLUSIONS/SIGNIFICANCE: These results indicate that galectin-3 multimerization and surface recognition of lactosyl residues is required to maintain glycocalyx barrier function at the ocular surface. Transient modification of galectin-3 binding could be therapeutically used to enhance the efficiency of topical drug delivery.
International Nuclear Information System (INIS)
Lowe, S.S.
1993-01-01
The mission of the Tank Waste Remediation System (TWRS) Program is to store, treat, and immobilize highly radioactive Hanford waste in an environmentally sound, safe, and cost-effective manner. The scope of the TWRS Program includes project and program activities for receiving, storing, maintaining, treating, and disposing onsite, or packaging for offsite disposal, all Hanford tank waste. Hanford tank waste includes the contents of 149 single-shell tanks (SSTs) and 28 double-shell tanks (DSTs), plus any new waste added to these facilities, and all encapsulated cesium and strontium stored onsite and returned from offsite users. A key element of the TWRS Program is retrieval of the waste in the SSTs. The waste stored in these underground tanks must be removed in order to minimize environmental, safety, and health risks associated with continuing waste storage. Subsurface barriers are being considered as a means to mitigate the effects of tank leaks including those occurring during SST waste retrieval. The functions to be performed by subsurface barriers based on their role in retrieving waste from the SSTs are described, and the requirements which constrain their application are identified. These functions and requirements together define the functional baseline for subsurface barriers
International Nuclear Information System (INIS)
Preter, P. de; Lalieux, Ph.
2002-01-01
In general terms the basis long-term safety functions of a disposal system (i.e. the engineered barrier system, including the waste forms and the host rock) are the functions that the system as a whole or its constituents must fulfill in order to assure an adequate level of long-term radiological safety. The long-term safety functions of a disposal system constitute a generic and methodological tool that can be used in a double sense. In the first place these functions provide an a priori instrument for designing the system: the implementer must ensure that these safety functions are fulfilled by a series of robust system barriers and components. These functions can also be used as an a posteriori means to describe and assess in general terms the functioning of the system. In this way they are an important qualitative element to help to support the safety case and to identify further R and D priorities. By providing a general description of system functioning they are also a communication tool to stakeholders who are less familiar with the details of a safety case. Instead of limiting the description to a multi-barrier system, the safety functions enable to better explain how the different barriers contribute to one or more safety functions and by which processes this is performed. By doing so the system description moves from multi-barrier to multi-function. The aim of this paper is to provide such a general description of the system functioning for the Belgian case of deep disposal of high-level waste (mainly spent fuel or vitrified waste from fuel reprocessing) in the Boom Clay, o poorly-indurated argillaceous formation. From the detailed safety and performance evaluations the main time frames after repository closure are identified. Each time frame relates to a period during which the successive safety functions play a key role. Also, in each time frame the radiological impact on the environment is distinctly different. (authors)
Directory of Open Access Journals (Sweden)
Judith Radloff
2017-08-01
Full Text Available The pig represents a preferred model for the analysis of intestinal immunology. However, the barrier of the follicle-associated epithelium (FAE covering porcine Peyer's patches (PP has not yet been characterized in detail. This study aimed to perform this characterization in order to pave the way toward an understanding of the functional contribution of epithelial barrier properties in gut immunology. Porcine tissue specimens were taken from the distal small intestine in order to obtain electrophysiological data of PP FAE and neighboring villous epithelium (VE, employing the Ussing chamber technique. Transepithelial resistance (TER and paracellular fluorescein flux were measured, and tissues were morphometrically compared. In selfsame tissues, expression and localization of major tight junction (TJ proteins (claudin-1, -2, -3, -4, -5, and -8 were analyzed. PP FAE specimens showed a higher TER and a lower apparent permeability for sodium fluorescein than VE. Immunoblotting revealed an expression of all claudins within both epithelia, with markedly stronger expression of the sealing TJ protein claudin-4 in PP FAE compared with the neighboring VE. Immunohistochemistry confirmed the expression and localization of all claudins in both PP FAE and VE, with stronger claudin-4 abundance in PP FAE. The results are in accordance with the physiological function of the FAE, which strongly regulates and limits antigen uptake determining a mandatory transcellular route for antigen presentation, highlighting the importance of this structure for the first steps of the intestinal immune response. Thus, this study provides detailed insights into the specific barrier properties of the porcine FAE covering intestinal PP, at the interface of intestinal immunology and barriology.
Trends in drug delivery through tissue barriers containing tight junctions.
Tscheik, Christian; Blasig, Ingolf E; Winkler, Lars
2013-04-01
A limitation in the uptake of many drugs is the restricted permeation through tissue barriers. There are two general ways to cross barriers formed by cell layers: by transcytosis or by diffusion through the intercellular space. In the latter, tight junctions (TJs) play the decisive role in the regulation of the barrier permeability. Thus, transient modulation of TJs is a potent strategy to improve drug delivery. There have been extensive studies on surfactant-like absorption enhancers. One of the most effective enhancers found is sodium caprate. However, this modulates TJs in an unspecific fashion. A novel approach would be the specific modulation of TJ-associated marvel proteins and claudins, which are the main structural components of the TJs. Recent studies have identified synthetic peptidomimetics and RNA interference techniques to downregulate the expression of targeted TJ proteins. This review summarizes current progress and discusses the impact on TJs' barrier function.
Sleep Restriction Impairs Blood–Brain Barrier Function
He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J.; Wang, Yuping
2014-01-01
The blood–brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. PMID:25355222
Directory of Open Access Journals (Sweden)
Luissint Anny-Claude
2012-11-01
Full Text Available Abstract The Blood–brain barrier (BBB, present at the level of the endothelium of cerebral blood vessels, selectively restricts the blood-to-brain paracellular diffusion of compounds; it is mandatory for cerebral homeostasis and proper neuronal function. The barrier properties of these specialized endothelial cells notably depend on tight junctions (TJs between adjacent cells: TJs are dynamic structures consisting of a number of transmembrane and membrane-associated cytoplasmic proteins, which are assembled in a multimolecular complex and acting as a platform for intracellular signaling. Although the structural composition of these complexes has been well described in the recent years, our knowledge about their functional regulation still remains fragmentary. Importantly, pericytes, embedded in the vascular basement membrane, and perivascular microglial cells, astrocytes and neurons contribute to the regulation of endothelial TJs and BBB function, altogether constituting the so-called neurovascular unit. The present review summarizes our current understanding of the structure and functional regulation of endothelial TJs at the BBB. Accumulating evidence points to a correlation between BBB dysfunction, alteration of TJ complexes and progression of a variety of CNS diseases, such as stroke, multiple sclerosis and brain tumors, as well as neurodegenerative diseases like Parkinson’s and Alzheimer’s diseases. Understanding how TJ integrity is controlled may thus help improve drug delivery across the BBB and the design of therapeutic strategies for neurological disorders.
The Effects of Anthrax Lethal Toxin on Host Barrier Function
Directory of Open Access Journals (Sweden)
David M. Frucht
2011-06-01
Full Text Available The pathological actions of anthrax toxin require the activities of its edema factor (EF and lethal factor (LF enzyme components, which gain intracellular access via its receptor-binding component, protective antigen (PA. LF is a metalloproteinase with specificity for selected mitogen-activated protein kinase kinases (MKKs, but its activity is not directly lethal to many types of primary and transformed cells in vitro. Nevertheless, in vivo treatment of several animal species with the combination of LF and PA (termed lethal toxin or LT leads to morbidity and mortality, suggesting that LT-dependent toxicity is mediated by cellular interactions between host cells. Decades of research have revealed that a central hallmark of this toxicity is the disruption of key cellular barriers required to maintain homeostasis. This review will focus on the current understanding of the effects of LT on barrier function, highlighting recent progress in establishing the molecular mechanisms underlying these effects.
The Drosophila surface glia transcriptome: evolutionary conserved blood-brain barrier processes.
Directory of Open Access Journals (Sweden)
Michael K DeSalvo
2014-11-01
Full Text Available AbstractCentral nervous system (CNS function is dependent on the stringent regulation of metabolites, drugs, cells, and pathogens exposed to the CNS space. Cellular blood-brain barrier (BBB structures are highly specific checkpoints governing entry and exit of all small molecules to and from the brain interstitial space, but the precise mechanisms that regulate the BBB are not well understood. In addition, the BBB has long been a challenging obstacle to the pharmacologic treatment of CNS diseases; thus model systems that can parse the functions of the BBB are highly desirable. In this study, we sought to define the transcriptome of the adult Drosophila melanogaster BBB by isolating the BBB surface glia with FACS and profiling their gene expression with microarrays. By comparing the transcriptome of these surface glia to that of all brain glia, brain neurons, and whole brains, we present a catalog of transcripts that are selectively enriched at the Drosophila BBB. We found that the fly surface glia show high expression of many ABC and SLC transporters, cell adhesion molecules, metabolic enzymes, signaling molecules, and components of xenobiotic metabolism pathways. Using gene sequence-based alignments, we compare the Drosophila and Murine BBB transcriptomes and discover many shared chemoprotective and small molecule control pathways, thus affirming the relevance of invertebrate models for studying evolutionary conserved BBB properties. The Drosophila BBB transcriptome is valuable to vertebrate and insect biologists alike as a resource for studying proteins underlying diffusion barrier development and maintenance, glial biology, and regulation of drug transport at tissue barriers.
The Drosophila surface glia transcriptome: evolutionary conserved blood-brain barrier processes.
DeSalvo, Michael K; Hindle, Samantha J; Rusan, Zeid M; Orng, Souvinh; Eddison, Mark; Halliwill, Kyle; Bainton, Roland J
2014-01-01
Central nervous system (CNS) function is dependent on the stringent regulation of metabolites, drugs, cells, and pathogens exposed to the CNS space. Cellular blood-brain barrier (BBB) structures are highly specific checkpoints governing entry and exit of all small molecules to and from the brain interstitial space, but the precise mechanisms that regulate the BBB are not well understood. In addition, the BBB has long been a challenging obstacle to the pharmacologic treatment of CNS diseases; thus model systems that can parse the functions of the BBB are highly desirable. In this study, we sought to define the transcriptome of the adult Drosophila melanogaster BBB by isolating the BBB surface glia with fluorescence activated cell sorting (FACS) and profiling their gene expression with microarrays. By comparing the transcriptome of these surface glia to that of all brain glia, brain neurons, and whole brains, we present a catalog of transcripts that are selectively enriched at the Drosophila BBB. We found that the fly surface glia show high expression of many ATP-binding cassette (ABC) and solute carrier (SLC) transporters, cell adhesion molecules, metabolic enzymes, signaling molecules, and components of xenobiotic metabolism pathways. Using gene sequence-based alignments, we compare the Drosophila and Murine BBB transcriptomes and discover many shared chemoprotective and small molecule control pathways, thus affirming the relevance of invertebrate models for studying evolutionary conserved BBB properties. The Drosophila BBB transcriptome is valuable to vertebrate and insect biologists alike as a resource for studying proteins underlying diffusion barrier development and maintenance, glial biology, and regulation of drug transport at tissue barriers.
Zhang, Shishuang; Zhi, Yongle; Li, Fei; Huang, Shan; Gao, Huabin; Han, Zhaoli; Ge, Xintong; Li, Dai; Chen, Fanglian; Kong, Xiaodong; Lei, Ping
2018-04-15
To date, the pathogenesis of Alzheimer's disease (AD) remains unclear. It is well-known that excessive deposition of Aβ in the brain is a crucial part of the pathogenesis of AD. In recent years, the AD neurovascular unit hypothesis has attracted much attention. Impairment of the blood-brain barrier (BBB) leads to abnormal amyloid-β (Aβ) transport, and chronic cerebral hypoperfusion causes Aβ deposition throughout the onset and progression of AD. Endothelial progenitor cells (EPCs) are the universal cells for repairing blood vessels. Our previous studies have shown that a reduced number of EPCs in the peripheral blood results in cerebral vascular repair disorder, cerebral hypoperfusion and neurodegeneration, which might be related to the cognitive dysfunction of AD patients. This study was designed to confirm whether EPCs transplantation could repair the blood-brain barrier, stimulate angiogenesis and reduce Aβ deposition in AD. The expression of ZO-1, Occludin and Claudin-5 was up-regulated in APP/PS1 transgenic mice after hippocampal transplantation of EPCs. Consistent with previous studies, EPC transplants also increased the microvessel density. We observed that Aβ senile plaque deposition was decreased and hippocampal cell apoptosis was reduced after EPCs transplantation. The Morris water maze test showed that spatial learning and memory functions were significantly improved in mice transplanted with EPCs. Consequently, EPCs could up-regulate the expression of tight junction proteins, repair BBB tight junction function, stimulate angiogenesis, promote Aβ clearance, and decrease neuronal loss, ultimately improve cognitive function. Taken together, these data demonstrate EPCs may play an important role in the therapeutic implications for vascular dysfunction in AD. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Nazzy Pakpour
Full Text Available Anopheline mosquitoes are the primary vectors of parasites in the genus Plasmodium, the causative agents of malaria. Malaria parasites undergo a series of complex transformations upon ingestion by the mosquito host. During this process, the physical barrier of the midgut epithelium, along with innate immune defenses, functionally restrict parasite development. Although these defenses have been studied for some time, the regulatory factors that control them are poorly understood. The protein kinase C (PKC gene family consists of serine/threonine kinases that serve as central signaling molecules and regulators of a broad spectrum of cellular processes including epithelial barrier function and immunity. Indeed, PKCs are highly conserved, ranging from 7 isoforms in Drosophila to 16 isoforms in mammals, yet none have been identified in mosquitoes. Despite conservation of the PKC gene family and their potential as targets for transmission-blocking strategies for malaria, no direct connections between PKCs, the mosquito immune response or epithelial barrier integrity are known. Here, we identify and characterize six PKC gene family members--PKCδ, PKCε, PKCζ, PKD, PKN, and an indeterminate conventional PKC--in Anopheles gambiae and Anopheles stephensi. Sequence and phylogenetic analyses of the anopheline PKCs support most subfamily assignments. All six PKCs are expressed in the midgut epithelia of A. gambiae and A. stephensi post-blood feeding, indicating availability for signaling in a tissue that is critical for malaria parasite development. Although inhibition of PKC enzymatic activity decreased NF-κB-regulated anti-microbial peptide expression in mosquito cells in vitro, PKC inhibition had no effect on expression of a panel of immune genes in the midgut epithelium in vivo. PKC inhibition did, however, significantly increase midgut barrier integrity and decrease development of P. falciparum oocysts in A. stephensi, suggesting that PKC
Tfayli, Ali; Jamal, Dima; Vyumvuhore, Raoul; Manfait, Michel; Baillet-Guffroy, Arlette
2013-11-07
The stratum corneum is the outermost layer of the skin; its barrier function is highly dependent on the composition and the structure as well as the organization of lipids in its extracellular matrix. Ceramides, free fatty acids and cholesterol represent the major lipid classes present in this matrix. They play an important role in maintaining the normal hydration levels required for the normal physiological function. Despite the advancement in the understanding of the structure, composition and the function of the stratum corneum (SC), the concern of "dry skin" remains important in dermatology and care research. Most studies focus on the quantification of water in the skin using different techniques including Raman spectroscopy, while the studies that investigate the effect of hydration on the quality of the barrier function of the skin are limited. Raman spectroscopy provides structural, conformational and organizational information that could help elucidate the effect of hydration on the barrier function of the skin. In order to assess the effect of relative humidity on the lipid barrier function; we used Raman spectroscopy to follow-up the evolution of the conformation and the organization of three synthetic ceramides (CER) differing from each other by the nature of their polar heads (sphingosine, phytosphingosine and α hydroxyl sphingosine), CER 2, III and 5 respectively. CER III and 5 showed a more compact and ordered organization with stronger polar interactions at intermediate relative humidity values, while CER 2 showed opposite tendencies to those observed with CER III and 5.
Yu, Leilei; Zhai, Qixiao; Tian, Fengwei; Liu, Xiaoming; Wang, Gang; Zhao, Jianxin; Zhang, Hao; Narbad, Arjan; Chen, Wei
2016-12-02
Aluminum (Al) is a ubiquitous metal that can seriously harm the health of animals and humans. In our previous study, we demonstrated that Lactobacillus plantarum CCFM639 can decrease Al burden in the tissues of mice by inhibiting intestinal Al absorption. The main aim of the present research was to investigate whether the protection by the strain is also associated with enhancement of the intestinal barrier, alleviation of oxidative stress and modulation of the inflammatory response. In an in vitro cell model, two protection modes (intervention and therapy) were examined and the results indicated that L. plantarum CCFM639 alleviated Al-induced cytotoxicity. In a mouse model, L. plantarum CCFM639 treatment was found to significantly alleviate oxidative stress in the intestinal tract, regulate the function of the intestinal mucosal immune system, restore the integrity of tight junction proteins and maintain intestinal permeability. These results suggest that in addition to Al sequestration, L. plantarum CCFM639 can also inhibit Al absorption by protecting the intestinal barrier, alleviating Al-induced oxidative stress and inflammatory response. Therefore, L. plantarum CCFM639 has the potential to be a dietary supplement ingredient that provides protection against Al-induced gut injury.
Directory of Open Access Journals (Sweden)
Leilei Yu
2016-12-01
Full Text Available Aluminum (Al is a ubiquitous metal that can seriously harm the health of animals and humans. In our previous study, we demonstrated that Lactobacillus plantarum CCFM639 can decrease Al burden in the tissues of mice by inhibiting intestinal Al absorption. The main aim of the present research was to investigate whether the protection by the strain is also associated with enhancement of the intestinal barrier, alleviation of oxidative stress and modulation of the inflammatory response. In an in vitro cell model, two protection modes (intervention and therapy were examined and the results indicated that L. plantarum CCFM639 alleviated Al-induced cytotoxicity. In a mouse model, L. plantarum CCFM639 treatment was found to significantly alleviate oxidative stress in the intestinal tract, regulate the function of the intestinal mucosal immune system, restore the integrity of tight junction proteins and maintain intestinal permeability. These results suggest that in addition to Al sequestration, L. plantarum CCFM639 can also inhibit Al absorption by protecting the intestinal barrier, alleviating Al-induced oxidative stress and inflammatory response. Therefore, L. plantarum CCFM639 has the potential to be a dietary supplement ingredient that provides protection against Al-induced gut injury.
Acyl-CoA binding protein and epidermal barrier function
DEFF Research Database (Denmark)
Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J
2014-01-01
The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...
Bershtein, Shimon; Serohijos, Adrian W R; Bhattacharyya, Sanchari; Manhart, Michael; Choi, Jeong-Mo; Mu, Wanmeng; Zhou, Jingwen; Shakhnovich, Eugene I
2015-10-01
Horizontal gene transfer (HGT) plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR), with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90%) in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM), correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the intracellular
Directory of Open Access Journals (Sweden)
Shimon Bershtein
2015-10-01
Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the
Directory of Open Access Journals (Sweden)
Pei Wang
2013-09-01
Full Text Available Background/Aims: The mechanisms involved in endothelial barrier dysfunction induced by hypoxia are incompletely understood. There is debate about the role of hypoxia-inducible factor-1α (HIF-1α in endothelial barrier disruption. The aim of this study was to investigate the effect of genetic overexpression of HIF-1α on barrier function and the underlying mechanisms in hypoxic endothelial cells. Methods: The plasmid pcDNA3.1/V5-His-HIF-1α was stably transfected into human endothelial cells. The cells were exposed to normoxia or hypoxia. The mRNA and protein expressions of HIF-1α were detected by RT-PCR and Western blot respectively. The barrier function was assessed by measuring the transendothelial electrical resistance (TER. The Western blot analysis was used to determine the protein expression of glucose transporter-1 (GLUT-1, zonular occludens-1 (ZO-1, occludin, and myosin light chain kinase (MLCK in endothelial cells. The mRNA expression of proinflammatory cytokines was detected by qRT-PCR. Results: Genetic overexpression of HIF-1α significantly increased the mRNA and protein expression of HIF-1α in endothelial cells. The overexpression of HIF-1α enhanced the hypoxia-induced increase of HIF-1α and GLUT-1 protein expression. HIF-1α overexpression not only exacerbated hypoxia-induced endothelial barrier dysfunction but also augmented hypoxia-induced up-regulation of MLCK protein expression. HIF-1α overexpression also enhanced IL-1β, IL-6 and TNF-α mRNA expression. Conclusion: We provide evidence that genetic overexpression of HIF-1α aggravates the hypoxia-induced endothelial barrier dysfunction via enhancing the up-regulation of MLCK protein expression caused by hypoxia, suggesting a potential role for HIF-1α in the pathogenesis of endothelial barrier dysfunction in hypoxia.
Smith, I M; Baker, A; Arneborg, N; Jespersen, L
2015-11-01
The human gastrointestinal epithelium makes up the largest barrier separating the body from the external environment. Whereas invasive pathogens cause epithelial barrier disruption, probiotic micro-organisms modulate tight junction regulation and improve epithelial barrier function. In addition, probiotic strains may be able to reduce epithelial barrier disruption caused by pathogenic species. The aim of this study was to explore non-Saccharomyces yeast modulation of epithelial cell barrier function in vitro. Benchmarking against established probiotic strains, we evaluated the ability of four nonpathogenic yeast species to modulate transepithelial electrical resistance (TER) across a monolayer of differentiated human colonocytes (Caco-2 cells). Further, we assessed yeast modulation of a Salmonella Typhimurium-induced epithelial cell barrier function insult. Our findings demonstrate distinct patterns of non-Saccharomyces yeast modulation of epithelial cell barrier function. While the established probiotic yeast Saccharomyces boulardii increased TER across a Caco-2 monolayer by 30%, Kluyveromyces marxianus exhibited significantly stronger properties of TER enhancement (50% TER increase). In addition, our data demonstrate significant yeast-mediated modulation of Salmonella-induced epithelial cell barrier disruption and identify K. marxianus and Metschnikowia gruessii as two non-Saccharomyces yeasts capable of protecting human epithelial cells from pathogen invasion. This study demonstrates distinct patterns of non-Saccharomyces yeast modulation of epithelial cell barrier function in vitro. Further, our data demonstrate significant yeast-mediated modulation of Salmonella Typhimurium-induced epithelial cell barrier disruption and identify Kluyveromyces marxianus and Metschnikowia gruessii as two non-Saccharomyces yeasts capable of protecting human epithelial cells from pathogen invasion. This study is the first to demonstrate significant non-Saccharomyces yeast
Food Derived Bioactive Peptides and Intestinal Barrier Function
Directory of Open Access Journals (Sweden)
Olga Martínez-Augustin
2014-12-01
Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.
Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie
2017-12-01
Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.
Saunders, Norman R; Dziegielewska, Katarzyna M; Unsicker, Klaus; Ek, C Joakim
2016-11-01
The brain functions within a specialized environment tightly controlled by brain barrier mechanisms. Understanding the regulation of barrier formation is important for understanding brain development and may also lead to finding new ways to deliver pharmacotherapies to the brain; access of many potentially promising drugs is severely hindered by these barrier mechanisms. The cellular composition of the neurovascular unit of the blood-brain barrier proper and their effects on regulation of its function are beginning to be understood. One hallmark of the neurovascular unit in the adult is the astroglial foot processes that tightly surround cerebral blood vessels. However their role in barrier formation is still unclear. In this study we examined barrier function in newborn, juvenile and adult mice lacking fibroblast growth factor-2 (FGF-2), which has been shown to result in altered astroglial differentiation during development. We show that during development of FGF-2 deficient mice the astroglial contacts with cerebral blood vessels are delayed compared with wild-type animals. However, this delay did not result in changes to the permeability properties of the blood brain barrier as assessed by exclusion of either small or larger sized molecules at this interface. In addition cerebral vessels were positive for tight-junction proteins and we observed no difference in the ultrastructure of the tight-junctions. The results indicate that the direct contact of astroglia processes to cerebral blood vessels is not necessary for either the formation of the tight-junctions or for basic permeability properties and function of the blood-brain barrier. © 2016 Wiley Periodicals, Inc. Develop Neurobiol 76: 1201-1212, 2016. © 2016 Wiley Periodicals, Inc.
Sleep restriction impairs blood-brain barrier function.
He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J; Wang, Yuping; Pan, Weihong
2014-10-29
The blood-brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. Copyright © 2014 the authors 0270-6474/14/3414697-10$15.00/0.
Zhang, Chi; Paddock, Kieran; Chou, Adriana; Scholp, Austin; Gong, Ting; Jiang, Jack J
2018-04-18
Voice abuse is known to be a common risk factor of voice disorders and prolonged; high-intensity phonation has been shown to damage the vocal fold epithelium. We aim to evaluate the effects of phonation on the integrity and barrier function of vocal fold epithelium using a porcine laryngeal model. Ex vivo porcine larynges were phonated at low intensity or high intensity for 15, 30, or 60 min within 4 h after harvest. Vocal fold epithelium was visualized using transmission electron microscopy (TEM). The barrier function of vocal fold epithelium was evaluated by measuring the permeability to model molecules, fluorescein (376 Da), and fluorescein isothiocyanate (FITC)-dextrans of 4000 and 10,000 Da (FD4, FD10), in a Franz diffusing cell. Cell death and dilated intercellular space after phonation were observed using TEM. Thickness of vocal fold epithelium was significantly reduced after low-intensity phonation for 30 and 60 min and high-intensity phonation for 15, 30, and 60 min. Epithelial permeability to fluorescein was significantly increased after low-intensity phonation for 30 and 60 min, and high-intensity phonation. Permeability to FD4 was significantly increased after high-intensity phonation for 30 and 60 min. Phonation did not alter the permeability to FD10 significantly. Long-duration phonation destroys the integrity and barrier function of vocal fold epithelium. These effects likely make vocal folds more vulnerable to other environmental irritants, such as tobacco smoke, reflux components, allergens, and inhaled pollutants. Destroyed barrier function may be an important factor in the pathogenesis of voice lesions related to voice abuse.
International Nuclear Information System (INIS)
Monnot, Andrew D.; Behl, Mamta; Ho, Sanna; Zheng, Wei
2011-01-01
Maintaining brain Cu homeostasis is vital for normal brain function. The role of systemic Fe deficiency (FeD) or overload (FeO) due to metabolic diseases or environmental insults in Cu homeostasis in the cerebrospinal fluid (CSF) and brain tissues remains unknown. This study was designed to investigate how blood-brain barrier (BBB) and blood-SCF barrier (BCB) regulated Cu transport and how FeO or FeD altered brain Cu homeostasis. Rats received an Fe-enriched or Fe-depleted diet for 4 weeks. FeD and FeO treatment resulted in a significant increase (+ 55%) and decrease (− 56%) in CSF Cu levels (p < 0.05), respectively; however, neither treatment had any effect on CSF Fe levels. The FeD, but not FeO, led to significant increases in Cu levels in brain parenchyma and the choroid plexus. In situ brain perfusion studies demonstrated that the rate of Cu transport into the brain parenchyma was significantly faster in FeD rats (+ 92%) and significantly slower (− 53%) in FeO rats than in controls. In vitro two chamber Transwell transepithelial transport studies using primary choroidal epithelial cells revealed a predominant efflux of Cu from the CSF to blood compartment by the BCB. Further ventriculo-cisternal perfusion studies showed that Cu clearance by the choroid plexus in FeD animals was significantly greater than control (p < 0.05). Taken together, our results demonstrate that both the BBB and BCB contribute to maintain a stable Cu homeostasis in the brain and CSF. Cu appears to enter the brain primarily via the BBB and is subsequently removed from the CSF by the BCB. FeD has a more profound effect on brain Cu levels than FeO. FeD increases Cu transport at the brain barriers and prompts Cu overload in the CNS. The BCB plays a key role in removing the excess Cu from the CSF.
Energy Technology Data Exchange (ETDEWEB)
Monnot, Andrew D.; Behl, Mamta; Ho, Sanna; Zheng, Wei, E-mail: wzheng@purdue.edu
2011-11-15
Maintaining brain Cu homeostasis is vital for normal brain function. The role of systemic Fe deficiency (FeD) or overload (FeO) due to metabolic diseases or environmental insults in Cu homeostasis in the cerebrospinal fluid (CSF) and brain tissues remains unknown. This study was designed to investigate how blood-brain barrier (BBB) and blood-SCF barrier (BCB) regulated Cu transport and how FeO or FeD altered brain Cu homeostasis. Rats received an Fe-enriched or Fe-depleted diet for 4 weeks. FeD and FeO treatment resulted in a significant increase (+ 55%) and decrease (- 56%) in CSF Cu levels (p < 0.05), respectively; however, neither treatment had any effect on CSF Fe levels. The FeD, but not FeO, led to significant increases in Cu levels in brain parenchyma and the choroid plexus. In situ brain perfusion studies demonstrated that the rate of Cu transport into the brain parenchyma was significantly faster in FeD rats (+ 92%) and significantly slower (- 53%) in FeO rats than in controls. In vitro two chamber Transwell transepithelial transport studies using primary choroidal epithelial cells revealed a predominant efflux of Cu from the CSF to blood compartment by the BCB. Further ventriculo-cisternal perfusion studies showed that Cu clearance by the choroid plexus in FeD animals was significantly greater than control (p < 0.05). Taken together, our results demonstrate that both the BBB and BCB contribute to maintain a stable Cu homeostasis in the brain and CSF. Cu appears to enter the brain primarily via the BBB and is subsequently removed from the CSF by the BCB. FeD has a more profound effect on brain Cu levels than FeO. FeD increases Cu transport at the brain barriers and prompts Cu overload in the CNS. The BCB plays a key role in removing the excess Cu from the CSF.
Effects of Lactobacillus plantarum on gut barrier function in experimental obstructive jaundice
Zhou, Yu-Kun; Qin, Huan-Long; Zhang, Ming; Shen, Tong-Yi; Chen, Hong-Qi; Ma, Yan-Lei; Chu, Zhao-Xin; Zhang, Peng; Liu, Zhi-Hua
2012-01-01
AIM: To investigate the mechanisms of Lactobacillus plantarum (L. plantarum) action on gut barrier in preoperative and postoperative experimental obstructive jaundice in rats. METHODS: Forty rats were randomly divided into groups of sham-operation, bile duct ligation (BDL), BDL + L. plantarum, BDL + internal biliary drainage (IBD), and BDL + IBD + L. plantarum. Ten days after L. plantarum administration, blood and ileal samples were collected from the rats for morphological examination, and intestinal barrier function, liver function, intestinal oxidative stress and protein kinase C (PKC) activity measurement. The distribution and expression of the PKC and tight junction (TJ) proteins, such as occludin, zonula occludens-1, claudin-1, claudin-4, junction adhesion molecule-A and F-actin, were examined by confocal laser scanning microscopy, immunohistochemistry, Western blotting, real-time fluorescent quantitative polymerase chain reaction assay. RESULTS: L. plantarum administration substantially restored gut barrier, decreased enterocyte apoptosis, improved intestinal oxidative stress, promoted the activity and expression of protein kinase (BDL vs BDL + L. plantarum, 0.295 ± 0.007 vs 0.349 ± 0.003, P plantarum, 0.407 ± 0.046 vs 0.465 ± 0.135, P plantarum, 0.266 ± 0.118 vs 0.326 ± 0.009, P plantarum was more prominent after internal biliary drainage ( BDL + IBD vs BDL + IBD + L. plantarum, 0.415 ± 0.105 vs 0.494 ± 0.145, P plantarum can decrease intestinal epithelial cell apoptosis, reduce oxidative stress, and prevent TJ disruption in biliary obstruction by activating the PKC pathway. PMID:22912548
Fasano, Alessio
2008-11-01
The anatomical and functional arrangement of the gastrointestinal tract suggests that this organ, beside its digestive and absorptive functions, regulates the trafficking of macromolecules between the environment and the host through a barrier mechanism. Under physiological circumstances, this trafficking is safeguarded by the competency of intercellular tight junctions, structures whose physiological modulation is mediated by, among others, the recently described protein zonulin. To prevent harm and minimize inflammation, the same paracellular pathway, in concert with the gut-associated lymphoid tissue and the neuroendocrine network, controls the equilibrium between tolerance and immunity to nonself antigens. The zonulin pathway has been exploited to deliver drugs, macromolecules, or vaccines that normally would not be absorbed through the gastrointestinal mucosal barrier. However, if the tightly regulated trafficking of macromolecules is jeopardized secondary to prolonged zonulin up-regulation, the excessive flow of nonself antigens in the intestinal submucosa can cause both intestinal and extraintestinal autoimmune disorders in genetically susceptible individuals. This new paradigm subverts traditional theories underlying the development of autoimmunity, which are based on molecular mimicry and/or the bystander effect, and suggests that the autoimmune process can be arrested if the interplay between genes and environmental triggers is prevented by re-establishing intestinal barrier competency. Understanding the role of zonulin-dependent intestinal barrier dysfunction in the pathogenesis of autoimmune diseases is an area of translational research that encompasses many fields.
Driving forces and barriers for environmental technology development
International Nuclear Information System (INIS)
2005-01-01
Driving forces and barriers behind development and usage of environmental technology is discussed, and also whether there are certain characteristics related to environmental innovations compared to other innovations in general. The development of environmental technology is in principle dominated by the same drivers and barriers as any other technology, but the order and strength of the various factors may be different. This examination as well as other empirical studies shows that regulations play a greater part for environmental technology than 'pure market forces'. To many participants it is important to be one step ahead of the regulations, i.e. the expected regulations are equally important as the factual ones in driving the technology development. Players in the business community express that it is important that the authorities cooperate with them when introducing new regulations. This will increase acceptance for the regulations and facilitate the necessary adjustments. The most important barrier in the development and use of the technologies studied is probably the lack of demand
Optimal design of wind barriers using 3D computational fluid dynamics simulations
Fang, H.; Wu, X.; Yang, X.
2017-12-01
Desertification is a significant global environmental and ecological problem that requires human-regulated control and management. Wind barriers are commonly used to reduce wind velocity or trap drifting sand in arid or semi-arid areas. Therefore, optimal design of wind barriers becomes critical in Aeolian engineering. In the current study, we perform 3D computational fluid dynamics (CFD) simulations for flow passing through wind barriers with different structural parameters. To validate the simulation results, we first inter-compare the simulated flow field results with those from both wind-tunnel experiments and field measurements. Quantitative analyses of the shelter effect are then conducted based on a series of simulations with different structural parameters (such as wind barrier porosity, row numbers, inter-row spacing and belt schemes). The results show that wind barriers with porosity of 0.35 could provide the longest shelter distance (i.e., where the wind velocity reduction is more than 50%) thus are recommended in engineering designs. To determine the optimal row number and belt scheme, we introduce a cost function that takes both wind-velocity reduction effects and economical expense into account. The calculated cost function show that a 3-row-belt scheme with inter-row spacing of 6h (h as the height of wind barriers) and inter-belt spacing of 12h is the most effective.
Directory of Open Access Journals (Sweden)
Golo Storch
2016-07-01
Full Text Available Stereodynamic ligands offer intriguing possibilities in enantioselective catalysis. “NU-BIPHEPs” are a class of stereodynamic diphosphine ligands which are easily accessible via rhodium-catalyzed double [2 + 2 + 2] cycloadditions. This study explores the preparation of differently functionalized “NU-BIPHEP(O” compounds, the characterization of non-covalent adduct formation and the quantification of enantiomerization barriers. In order to explore the possibilities of functionalization, we studied modifications of the ligand backbone, e.g., with 3,5-dichlorobenzoyl chloride. Diastereomeric adducts with Okamoto-type cellulose derivatives and on-column deracemization were realized on the basis of non-covalent interactions. Enantioselective dynamic HPLC (DHPLC allowed for the determination of rotational barriers of ΔG‡298K = 92.2 ± 0.3 kJ mol−1 and 99.5 ± 0.1 kJ mol−1 underlining the stereodynamic properties of “NU-BIPHEPs” and “NU-BIPHEP(Os”, respectively. These results make the preparation of tailor-made functionalized stereodynamic ligands possible and give an outline for possible applications in enantioselective catalysis.
Interrelationship of brain-functions with cardiovascular regulations
International Nuclear Information System (INIS)
Rahman, M.K.
1993-03-01
Neurotransmitters and neuropeptides are involved in the regulation of nervous function, behaviour, emotion, sex, sleep, mood of higher animals including the humans. They act and they occur simultaneously in the brain as neurotransmitters or neuromodulators and in plasma as circulating hormones. The direct regulatory interactions of a given substance in the blood and in the brain are still unknown, but some results have already been published regarding these relationships. The present paper briefly describes the systematic review-type studies on the interrelationship of the brain functions and the cardiovascular regulation. 35 refs, 7 figs, 1 tab
Astrocytic modulation of Blood Brain Barrier: Perspectives on Parkinson´s Disease
Directory of Open Access Journals (Sweden)
Ricardo eCabezas
2014-08-01
Full Text Available TThe blood–brain barrier (BBB is a tightly regulated interface in the Central Nervous System that regulates the exchange of molecules in and out from the brain thus maintaining the CNS homeostasis. It is mainly composed of endothelial cells, pericytes and astrocytes that create a neurovascular unit with the adjacent neurons. Astrocytes are essential for the formation and maintenance of the BBB by providing secreted factors that lead to the adequate association between the cells of the BBB and the formation of strong tight junctions. Under neurological disorders, such as chronic cerebral ischemia, brain trauma, Epilepsy, Alzheimer and Parkinson´s Diseases, a disruption of the BBB takes place, involving a lost in the permeability of the barrier and phenotypical changes in both the endothelial cells and astrocytes. In this aspect, it has been established that the process of reactive gliosis is a common feature of astrocytes during BBB disruption, which has a detrimental effect on the barrier function and a subsequent damage in neuronal survival. In this review we discuss the implications of astrocyte functions in the protection of the BBB, and in the development of Parkinson´s disease and related disorders. Additionally, we highlight the current and future strategies in astrocyte protection aimed at the development of restorative therapies for the BBB in pathological conditions.
Barrier mechanisms in the Drosophila blood-brain barrier.
Hindle, Samantha J; Bainton, Roland J
2014-01-01
The invertebrate blood-brain barrier (BBB) field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through G-protein coupled receptor signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate BBB has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many BBB mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the BBB can govern whole animal physiologies. This includes novel functions of BBB gap junctions in orchestrating synchronized neuroblast proliferation, and of BBB secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate BBB anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.
Directory of Open Access Journals (Sweden)
Lisanne Martine van Leeuwen
2018-02-01
Full Text Available The central nervous system (CNS has specific barriers that protect the brain from potential threats and tightly regulate molecular transport. Despite the critical functions of the CNS barriers, the mechanisms underlying their development and function are not well understood, and there are very limited experimental models for their study. Claudin 5 is a tight junction protein required for blood brain barrier (BBB and, probably, choroid plexus (CP structure and function in vertebrates. Here, we show that the gene claudin 5a is the zebrafish orthologue with high fidelity expression, in the BBB and CP barriers, that demonstrates the conservation of the BBB and CP between humans and zebrafish. Expression of claudin 5a correlates with developmental tightening of the BBB and is restricted to a subset of the brain vasculature clearly delineating the BBB. We show that claudin 5a-expressing cells of the CP are ciliated ependymal cells that drive fluid flow in the brain ventricles. Finally, we find that CP development precedes BBB development and that claudin 5a expression occurs simultaneously with angiogenesis. Thus, our novel transgenic zebrafish represents an ideal model to study CNS barrier development and function, critical in understanding the mechanisms underlying CNS barrier function in health and disease.
EMMPRIN Modulates Epithelial Barrier Function through a MMP–Mediated Occludin Cleavage
Huet, Eric; Vallée, Benoit; Delbé, Jean; Mourah, Samia; Prulière-Escabasse, Virginie; Tremouilleres, Magali; Kadomatsu, Kenji; Doan, Serge; Baudouin, Christophe; Menashi, Suzanne; Gabison, Eric E.
2011-01-01
Dry eye is a common disease that develops as a result of alteration of tear fluid, leading to osmotic stress and a perturbed epithelial barrier. Matrix metalloproteinase-9 (MMP-9) may be important in dry eye disease, as its genetic knockout conferred resistance to the epithelial disruption. We show that extracellular matrix metalloproteinase inducer (EMMPRIN; also termed CD147), an inducer of MMP expression, participates in the pathogenesis of dry eye through MMP-mediated cleavage of occludin, an important component of tight junctions. EMMPRIN expression was increased on the ocular surface of dry eye patients and correlated with those of MMP-9. High osmolarity in cell culture, mimicking dry eye conditions, increased both EMMPRIN and MMP-9 and resulted in the disruption of epithelial junctions through the cleavage of occludin. Exogenously added recombinant EMMPRIN had similar effects that were abrogated in the presence of the MMP inhibitor marimastat. Membrane occludin immunostaining was markedly increased in the apical corneal epithelium of both EMMPRIN and MMP-9 knock-out mice. Furthermore, an inverse correlation between EMMPRIN and occludin membrane staining was consistently observed both in vitro and in vivo as a function of corneal epithelial cells differentiation. These data suggest a possible role of EMMPRIN in regulating the amount of occludin at the cell surface in homeostasis beyond pathological situations such as dry eye disease, and EMMPRIN may be essential for the formation and maintenance of organized epithelial structure. PMID:21777561
Functional Anatomy and Oncologic Barriers of the Larynx.
Mor, Niv; Blitzer, Andrew
2015-08-01
Laryngeal barriers to tumor spread are a product of laryngeal development, anatomic barriers, and enzymatic activity. Supraglottic and glottic/subglottic development is distinct and partially explains the metastatic behavior of laryngeal carcinoma. Dense connective tissues and elastic fibers provide anatomic barriers within the larynx. Laryngeal cartilage contains dense cartilage, enzyme inhibitors, and an intact perichondrium making it relatively resistant to tumor invasion; however, focal areas of vulnerability are created by ossified cartilage and natural interruptions in the perichondrium. Local inflammation and the enzymatic interplay between tumor and host are important factors in the spread of laryngeal tumor. Copyright © 2015 Elsevier Inc. All rights reserved.
Hawkins, Brian T; Grego, Sonia; Sellgren, Katelyn L
2015-05-22
Blood-brain barrier (BBB) function is regulated by dynamic interactions among cell types within the neurovascular unit, including astrocytes and endothelial cells. Co-culture models of the BBB typically involve astrocytes seeded on two-dimensional (2D) surfaces, which recent studies indicate cause astrocytes to express a phenotype similar to that of reactive astrocytes in situ. We hypothesized that the culture conditions of astrocytes would differentially affect their ability to modulate BBB function in vitro. Brain endothelial cells were grown alone or in co-culture with astrocytes. Astrocytes were grown either as conventional (2D) monolayers, or in a collagen-based gel which allows them to grow in a three-dimensional (3D) construct. Astrocytes were viable in 3D conditions, and displayed a marked reduction in their expression of glial fibrillary acidic protein (GFAP), suggesting reduced activation. Stimulation of astrocytes with transforming growth factor (TGF)β1 decreased transendothelial electrical resistance (TEER) and reduced expression of claudin-5 in co-cultures, whereas treatment of endothelial cells in the absence of astrocytes was without effect. The effect of TGFβ1 on TEER was significantly more pronounced in endothelial cells cultured with 3D astrocytes compared to 2D astrocytes. These results demonstrate that astrocyte culture conditions differentially affect their ability to modulate brain endothelial barrier function, and suggest a direct relationship between reactive gliosis and BBB permeability. Moreover, these studies demonstrate the potential importance of physiologically relevant culture conditions to in vitro modeling of disease processes that affect the neurovascular unit. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hiemstra, I. H.; Klaver, E. J.; Vrijland, K.
2014-01-01
The administration of helminths is considered a promising strategy for the treatment of autoimmune diseases due to their immunomodulatory properties. Currently, the application of the helminth Trichuris suis as a treatment for Crohn's disease is being studied in large multi-center clinical trials....... The intestinal epithelium forms an efficient barrier between the intestinal lumen containing the microbial flora and helminths, and dendritic cells (DCs) present in the lamina propria that determine the TH response. Here, we investigated how excreted/secreted (E/S) products of T. suis affect the barrier function...... of intestinal epithelial cells (IECs) in order to reach the DCs and modulate the immune response. We show that T. suis E/S products reduce the barrier function and the expression of the tight junction proteins EMP-1 and claudin-4 in IEC CMT93/69 monolayers in a glycan-dependent manner. This resulted...
Directory of Open Access Journals (Sweden)
C Lehner
2016-05-01
Full Text Available Tissue barriers function as “gate keepers” between different compartments (usually blood and tissue and are formed by specialised membrane-associated proteins, localising to the apicolateral plasma membrane domain of epithelial and endothelial cells. By sealing the paracellular space, the free diffusion of solutes and molecules across epithelia and endothelia is impeded. Thereby, tissue barriers contribute to the establishment and maintenance of a distinct internal and external environment, which is crucial during organ development and allows maintenance of an organ-specific homeostatic milieu. So far, various epithelial and endothelial tissue barriers have been described, including the blood-brain barrier, the blood-retina barrier, the blood-testis barrier, the blood-placenta barrier, and the cerebrospinal fluid (CSF-brain barrier, which are vital for physiological function and any disturbance of these barriers can result in severe organ damage or even death. Here, we describe the identification of a novel barrier, located in the vascular bed of tendons, which we term the blood-tendon barrier (BTB. By using immunohistochemistry, transmission electron microscopy, and tracer studies we demonstrate the presence of a functional endothelial barrier within tendons restricting the passage of large blood-borne molecules into the surrounding tendon tissue. We further provide in vitro evidence that the BTB potentially contributes to the creation of a distinct internal tissue environment impacting upon the proliferation and differentiation of tendon-resident cells, effects which might be fundamental for the onset of tendon pathologies.
Lipids in the cell: organisation regulates function.
Santos, Ana L; Preta, Giulio
2018-06-01
Lipids are fundamental building blocks of all cells and play important roles in the pathogenesis of different diseases, including inflammation, autoimmune disease, cancer, and neurodegeneration. The lipid composition of different organelles can vary substantially from cell to cell, but increasing evidence demonstrates that lipids become organised specifically in each compartment, and this organisation is essential for regulating cell function. For example, lipid microdomains in the plasma membrane, known as lipid rafts, are platforms for concentrating protein receptors and can influence intra-cellular signalling. Lipid organisation is tightly regulated and can be observed across different model organisms, including bacteria, yeast, Drosophila, and Caenorhabditis elegans, suggesting that lipid organisation is evolutionarily conserved. In this review, we summarise the importance and function of specific lipid domains in main cellular organelles and discuss recent advances that investigate how these specific and highly regulated structures contribute to diverse biological processes.
Thiolated silicone oils as adhesive skin protectants for improved barrier function.
Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A
2016-06-01
The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.
Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira
2014-02-01
We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
What Health-Related Functions Are Regulated by the Nervous System?
... What health-related functions are regulated by the nervous system? The nervous system plays a role in nearly every aspect of ... feeling emotions. Functions that are regulated by the nervous system include (but are not limited to): Brain growth ...
Potential barrier classification by short-time measurement
International Nuclear Information System (INIS)
Granot, Er'el; Marchewka, Avi
2006-01-01
We investigate the short-time dynamics of a delta-function potential barrier on an initially confined wave packet. There are mainly two conclusions: (A) At short times the probability density of the first particles that passed through the barrier is unaffected by it. (B) When the barrier is absorptive (i.e., its potential is imaginary) it affects the transmitted wave function at shorter times than a real potential barrier. Therefore, it is possible to distinguish between an imaginary and a real potential barrier by measuring its effect at short times only on the transmitting wave function
Potential barrier classification by short-time measurement
Granot, Er'El; Marchewka, Avi
2006-03-01
We investigate the short-time dynamics of a delta-function potential barrier on an initially confined wave packet. There are mainly two conclusions: (A) At short times the probability density of the first particles that passed through the barrier is unaffected by it. (B) When the barrier is absorptive (i.e., its potential is imaginary) it affects the transmitted wave function at shorter times than a real potential barrier. Therefore, it is possible to distinguish between an imaginary and a real potential barrier by measuring its effect at short times only on the transmitting wave function.
Fernando, Antonio T; Consedine, Nathan S
2017-06-01
Compassion is an expectation of patients, regulatory bodies, and physicians themselves. Most research has, however, studied compassion fatigue rather than compassion itself and has concentrated on the role of the physician. The Transactional Model of Physician Compassion suggests that physician, patient, external environment, and clinical factors are all relevant. Because these factors vary both across different specialities and among physicians with differing degrees of experience, barriers to compassion are also likely to vary. We describe barriers to physician compassion as a function of specialization (psychiatry, general practice, surgery, internal medicine, and pediatrics) and physician experience. We used a cross-sectional study using demographic data, specialization, practice parameters, and the Barriers to Physician Compassion Questionnaire. Nonrandom convenience sampling was used to recruit 580 doctors, of whom 444 belonged to the targeted speciality groups. The sample was characterized before conducting a factorial Multivariate Analysis of Covariance and further post hoc analyses. A 5 (speciality grouping) × 2 (more vs. less physician experience) Multivariate Analysis of Covariance showed that the barriers varied as a function of both speciality and experience. In general, psychiatrists reported lower barriers, whereas general practitioners and internal medicine specialists generally reported greater barriers. Barriers were generally greater among less experienced doctors. Documenting and investigating barriers to compassion in different speciality groups have the potential to broaden current foci beyond the physician and inform interventions aimed at enhancing medical compassion. In addition, certain aspects of the training or practice of psychiatry that enhance compassion may mitigate barriers to compassion in other specialities. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.
Chan, Bun; Gilbert, Andrew T B; Gill, Peter M W; Radom, Leo
2014-09-09
We have examined the performance of a variety of density functional theory procedures for the calculation of complexation energies and proton-exchange barriers, with a focus on the Minnesota-class of functionals that are generally highly robust and generally show good accuracy. A curious observation is that M05-type and M06-type methods show an atypical decrease in calculated barriers with increasing proportion of Hartree-Fock exchange. To obtain a clearer picture of the performance of the underlying components of M05-type and M06-type functionals, we have investigated the combination of MPW-type and PBE-type exchange and B95-type and PBE-type correlation procedures. We find that, for the extensive E3 test set, the general performance of the various hybrid-DFT procedures improves in the following order: PBE1-B95 → PBE1-PBE → MPW1-PBE → PW6-B95. As M05-type and M06-type procedures are related to PBE1-B95, it would be of interest to formulate and examine the general performance of an alternative Minnesota DFT method related to PW6-B95.
Directory of Open Access Journals (Sweden)
Yajie Hu
2018-04-01
Full Text Available Enterovirus 71 (EV-A71 and coxsackievirus A16 (CV-A16 remain the predominant etiological agents of hand, foot, and mouth disease (HFMD. The clinical manifestations caused by the two viruses are obviously different. CV-A16 usually triggers a repeated infection, and airway epithelial integrity is often the potential causative factor of respiratory repeated infections. Our previous studies have demonstrated that there were some differentially expressed miRNAs involved in the regulation of adhesion function of epithelial barrier in EV-A71 and CV-A16 infections. In this study, we compared the differences between EV-A71 and CV-A16 infections on the airway epithelial barrier function in human bronchial epithelial (16HBE cells and further screened the key miRNA which leaded to the formation of these differences. Our results showed that more rapid proliferation, more serious destruction of 16HBE cells permeability, more apoptosis and disruption of intercellular adhesion-associated molecules were found in CV-A16 infection as compared to EV-A71 infection. Furthermore, we also identified that microRNA-4516 (miR-4516, which presented down-regulation in EV-A71 infection and up-regulation in CV-A16 infection was an important regulator of intercellular junctions by targeting Poliovirus receptor related protein 1(PVRL1. The expressions of PVRL1, claudin4, ZO-1 and E-cadherin in CV-A16-infected cells were significantly less than those in EV-A71-infected cells, while the expressions of these proteins were subverted when pre-treated with miR-4516-overexpression plasmid in EV-A71 infected and miR-4516-knockdown plasmid in CV-A16 infected 16HBE cells. Thus, these data suggested that the opposite expression of miR-4516 in EV-A71 and CV-A16 infections might be the initial steps leading to different epithelial impairments of 16HBE cells by destroying intercellular adhesion, which finally resulted in different outcomes of EV-A71 and CV-A16 infections.
Brandsch, Rainer
2017-10-01
Migration modelling provides reliable migration estimates from food-contact materials (FCM) to food or food simulants based on mass-transfer parameters like diffusion and partition coefficients related to individual materials. In most cases, mass-transfer parameters are not readily available from the literature and for this reason are estimated with a given uncertainty. Historically, uncertainty was accounted for by introducing upper limit concepts first, turning out to be of limited applicability due to highly overestimated migration results. Probabilistic migration modelling gives the possibility to consider uncertainty of the mass-transfer parameters as well as other model inputs. With respect to a functional barrier, the most important parameters among others are the diffusion properties of the functional barrier and its thickness. A software tool that accepts distribution as inputs and is capable of applying Monte Carlo methods, i.e., random sampling from the input distributions of the relevant parameters (i.e., diffusion coefficient and layer thickness), predicts migration results with related uncertainty and confidence intervals. The capabilities of probabilistic migration modelling are presented in the view of three case studies (1) sensitivity analysis, (2) functional barrier efficiency and (3) validation by experimental testing. Based on the predicted migration by probabilistic migration modelling and related exposure estimates, safety evaluation of new materials in the context of existing or new packaging concepts is possible. Identifying associated migration risk and potential safety concerns in the early stage of packaging development is possible. Furthermore, dedicated material selection exhibiting required functional barrier efficiency under application conditions becomes feasible. Validation of the migration risk assessment by probabilistic migration modelling through a minimum of dedicated experimental testing is strongly recommended.
Chen, Wei-Yang; Wang, Min; Zhang, Jingwen; Barve, Shirish S; McClain, Craig J; Joshi-Barve, Swati
2017-12-01
Increasing evidence suggests that environmental and dietary factors can affect intestinal epithelial integrity leading to gut permeability and bacterial translocation. Intestinal barrier dysfunction is a pathogenic process associated with many chronic disorders. Acrolein is an environmental and dietary pollutant and a lipid-derived endogenous metabolite. The impact of acrolein on the intestine has not been investigated before and is evaluated in this study, both in vitro and in vivo. Our data demonstrate that oral acrolein exposure in mice caused damage to the intestinal epithelial barrier, resulting in increased permeability and subsequently translocation of bacterial endotoxin-lipopolysaccharide into the blood. Similar results were seen in vitro using established Caco-2 cell monolayers wherein acrolein decreased barrier function and increased permeability. Acrolein also caused the down-regulation and/or redistribution of three representative tight junction proteins (ie, zonula occludens-1, Occludin, Claudin-1) that critically regulate epithelial paracellular permeability. In addition, acrolein induced endoplasmic reticulum stress-mediated death of epithelial cells, which is an important mechanism contributing to intestinal barrier damage/dysfunction, and gut permeability. Overall, we demonstrate that exposure to acrolein affects the intestinal epithelium by decrease/redistribution of tight junction proteins and endoplasmic reticulum stress-mediated epithelial cell death, thereby resulting in loss of barrier integrity and function. Our findings highlight the adverse consequences of environmental and dietary pollutants on intestinal barrier integrity/function with relevance to gut permeability and the development of disease. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Samantha J. Hindle
2017-10-01
Full Text Available Summary: Central nervous system (CNS chemical protection depends upon discrete control of small-molecule access by the blood-brain barrier (BBB. Curiously, some drugs cause CNS side-effects despite negligible transit past the BBB. To investigate this phenomenon, we asked whether the highly BBB-enriched drug efflux transporter MDR1 has dual functions in controlling drug and endogenous molecule CNS homeostasis. If this is true, then brain-impermeable drugs could induce behavioral changes by affecting brain levels of endogenous molecules. Using computational, genetic, and pharmacologic approaches across diverse organisms, we demonstrate that BBB-localized efflux transporters are critical for regulating brain levels of endogenous steroids and steroid-regulated behaviors (sleep in Drosophila and anxiety in mice. Furthermore, we show that MDR1-interacting drugs are associated with anxiety-related behaviors in humans. We propose a general mechanism for common behavioral side effects of prescription drugs: pharmacologically challenging BBB efflux transporters disrupts brain levels of endogenous substrates and implicates the BBB in behavioral regulation. : Hindle et al. shed light on the curious finding that some drugs cause behavioral side-effects despite negligible access into the brain. These authors propose a unifying hypothesis that links blood-brain barrier drug transporter function and brain access of circulating steroids to common CNS adverse drug responses. Keywords: drug side effect mechanisms, central nervous system, blood brain barrier, behavior, toxicology, drug transporters, endobiotics, steroid hormones
Hughes, Sheryl O; Power, Thomas G; O'Connor, Teresia M; Orlet Fisher, Jennifer
2015-06-01
The purpose of the present study was to examine relationships between child eating self-regulation, child non-eating self-regulation, and child BMIz in a low-income sample of Hispanic families with preschoolers. The eating in the absence of hunger task as well as parent-report of child satiety responsiveness and food responsiveness were used to assess child eating self-regulation. Two laboratory tasks assessing executive functioning, a parent questionnaire assessing child effortful control (a temperament dimension related to executive functioning), and the delay of gratification and gift delay tasks assessing child emotion regulation were used to assess child non-eating self-regulation. Bivariate correlations were run among all variables in the study. Hierarchical linear regression analyses assessed: (1) child eating self-regulation associations with the demographic, executive functioning, effortful control, and emotion regulation measures; and (2) child BMI z-score associations with executive functioning, effortful control, emotion regulation measures, and eating self-regulation measures. Within child eating self-regulation, only the two parent-report measures were related. Low to moderate positive correlations were found between measures of executive functioning, effortful control, and emotion regulation. Only three relationships were found between child eating self-regulation and other forms of child self-regulation: eating in the absence of hunger was positively associated with delay of gratification, and poor regulation on the gift delay task was associated positively with maternal reports of food responsiveness and negatively with parent-reports of satiety responsiveness. Regression analyses showed that child eating self-regulation was associated with child BMIz but other forms of child self-regulation were not. Implications for understanding the role of self-regulation in the development of child obesity are discussed. Copyright © 2015 Elsevier Ltd. All
The Relationship Between Emotion Regulation, Executive Functioning, and Aggressive Behaviors.
Holley, Sarah R; Ewing, Scott T; Stiver, Jordan T; Bloch, Lian
2015-06-30
Emotion regulation deficits and executive functioning deficits have independently been shown to increase vulnerability toward engaging in aggressive behaviors. The effects of these risk factors, however, have not been evaluated in relation to one another. This study evaluated the degree to which each was associated with aggressive behaviors in a sample of 168 undergraduate students. Executive functioning (cognitive inhibition and mental flexibility) was assessed with a Stroop-like neuropsychological task. Emotion regulation and aggressive behaviors were assessed via self-report inventories. Results showed main effects for both emotion regulation and executive functioning, as well as a significant interaction, indicating that those who scored lowest in both domains reported engaging in aggressive behaviors the most frequently. When different types of aggression were examined, this interaction was only significant for acts of physical aggression, not for acts of verbal aggression. Therefore, for physical aggression, emotion regulation and executive functioning exerted a moderating effect on one another. The implications are that, at least for acts of physical aggression, relatively strong capabilities in either domain may buffer against tendencies to engage in aggressive behaviors. Thus, both emotion regulation skills and executive functioning abilities may be valuable targets for interventions aiming to reduce aggressive behaviors. © The Author(s) 2015.
Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning.
Spreeuwenberg, M.A.; Verdonk, J.M.; Gaskins, H.R.; Verstegen, M.W.A.
2001-01-01
Compromising alterations in gastrointestinal architecture are common during the weaning transition of pigs. The relation between villous atrophy and epithelial barrier function at weaning is not well understood. This study evaluated in vitro transepithelial transport by Ussing metabolic chambers,
DEFF Research Database (Denmark)
Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis
2013-01-01
antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...
Menge, Tyler; Zhao, Yuhai; Zhao, Jing; Wataha, Kathryn; Geber, Michael; Zhang, Jianhu; Letourneau, Phillip; Redell, John; Shen, Li; Wang, Jing; Peng, Zhalong; Xue, Hasen; Kozar, Rosemary; Cox, Charles S.; Khakoo, Aarif Y.; Holcomb, John B.; Dash, Pramod K.; Pati, Shibani
2013-01-01
Mesenchymal stem cells (MCSs) have been shown to have therapeutic potential in multiple disease states associated with vascular instability including traumatic brain injury (TBI). In the present study, Tissue Inhibitor of Matrix Metalloproteinase-3 (TIMP3) is identified as the soluble factor produced by MSCs that can recapitulate the beneficial effects of MSCs on endothelial function and blood brain barrier (BBB) compromise in TBI. Attenuation of TIMP3 expression in MSCs completely abrogates the effect of MSCs on BBB permeability and stability, while intravenous administration of rTIMP3 alone can inhibit BBB permeability in TBI. Our results demonstrate that MSCs increase circulating levels of soluble TIMP3, which inhibits VEGF-A induced breakdown of endothelial AJs in vitro and in vivo. These findings elucidate a clear molecular mechanism for the effects of MSCs on the BBB in TBI, and directly demonstrate a role for TIMP3 in regulation of BBB integrity. PMID:23175708
Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K
2008-11-15
Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.
Lasp-1 regulates podosome function.
Directory of Open Access Journals (Sweden)
Miriam Stölting
Full Text Available Eukaryotic cells form a variety of adhesive structures to connect with their environment and to regulate cell motility. In contrast to classical focal adhesions, podosomes, highly dynamic structures of different cell types, are actively engaged in matrix remodelling and degradation. Podosomes are composed of an actin-rich core region surrounded by a ring-like structure containing signalling molecules, motor proteins as well as cytoskeleton-associated proteins. Lasp-1 is a ubiquitously expressed, actin-binding protein that is known to regulate cytoskeleton architecture and cell migration. This multidomain protein is predominantely present at focal adhesions, however, a second pool of Lasp-1 molecules is also found at lamellipodia and vesicle-like microdomains in the cytosol.In this report, we show that Lasp-1 is a novel component and regulator of podosomes. Immunofluorescence studies reveal a localization of Lasp-1 in the podosome ring structure, where it colocalizes with zyxin and vinculin. Life cell imaging experiments demonstrate that Lasp-1 is recruited in early steps of podosome assembly. A siRNA-mediated Lasp-1 knockdown in human macrophages affects podosome dynamics as well as their matrix degradation capacity. In summary, our data indicate that Lasp-1 is a novel component of podosomes and is involved in the regulation of podosomal function.
Functional Food Market Development in Serbia: Motivations and Barriers
Directory of Open Access Journals (Sweden)
Žaklina Stojanović
2013-11-01
Full Text Available The aim of this paper is to present main findings obtained from the empirical analysis of the functional food market in Serbia. The analysis is based on the in-depth interviews with relevant processors and retailers present on the market. The following set of topics are considered: (1 motivations (driving forces and barriers to offer products with nutrition and health (N&H claim and (2 perception of consumer demand toward N&H claimed products. Differences between Serbia and other Western Balkan Countries (WBC are explored by using nonparametric techniques based on the independent samples. Results support overall conclusion that this market segment in Serbia is underdeveloped and rather producer than consumer driven compared to more developed WBC markets.
Directory of Open Access Journals (Sweden)
Huiying Liu
2016-12-01
Full Text Available Background Acute lung injury and acute respiratory distress syndrome (ALI/ARDS is a severe clinical syndrome with mortality rate as high as 30–40%. There is no treatment yet to improve pulmonary endothelial barrier function in patients with severe pulmonary edema. Developing therapies to protect endothelial barrier integrity and stabilizing gas exchange is getting more and more attention. Sphingosine-1-phosphate (S1P is able to enhance the resistance of endothelial cell barrier. S1P at physiological concentrations plays an important role in maintaining endothelial barrier function. Proliferation, regeneration and anti-inflammatory activity that mesenchymal stem cells (MSCs exhibit make it possible to regulate the homeostatic control of S1P. Methods By building a pulmonary endothelial cell model of acute injury, we investigated the regulation of S1P receptors and sphingosine kinases expression by MSCs during the treatment of acute lung injury using RT-PCR, and investigated the HPAECs Micro-electronics impedance using Real Time Cellular Analysis. Results It was found that the down-regulation of TNF-α expression was more significant when MSC was used in combination with S1P. The combination effection mainly worked on S1PR2, S1PR3 and SphK2. The results show that when MSCs were used in combination with S1P, the selectivity of S1P receptors was increased and the homeostatic control of S1P concentration was improved through regulation of expression of S1P metabolic enzymes. Discussions The study found that, as a potential treatment, MSCs could work on multiple S1P related genes simultaneously. When it was used in combination with S1P, the expression regulation result of related genes was not simply the superposition of each other, but more significant outcome was obtained. This study establishes the experimental basis for further exploring the efficacy of improving endothelial barrier function in acute lung injury, using MSCs in combination with S1
Liu, Huiying; Zhang, Zili; Li, Puyuan; Yuan, Xin; Zheng, Jing; Liu, Jinwen; Bai, Changqing; Niu, Wenkai
2016-01-01
Acute lung injury and acute respiratory distress syndrome (ALI/ARDS) is a severe clinical syndrome with mortality rate as high as 30-40%. There is no treatment yet to improve pulmonary endothelial barrier function in patients with severe pulmonary edema. Developing therapies to protect endothelial barrier integrity and stabilizing gas exchange is getting more and more attention. Sphingosine-1-phosphate (S1P) is able to enhance the resistance of endothelial cell barrier. S1P at physiological concentrations plays an important role in maintaining endothelial barrier function. Proliferation, regeneration and anti-inflammatory activity that mesenchymal stem cells (MSCs) exhibit make it possible to regulate the homeostatic control of S1P. By building a pulmonary endothelial cell model of acute injury, we investigated the regulation of S1P receptors and sphingosine kinases expression by MSCs during the treatment of acute lung injury using RT-PCR, and investigated the HPAECs Micro-electronics impedance using Real Time Cellular Analysis. It was found that the down-regulation of TNF- α expression was more significant when MSC was used in combination with S1P. The combination effection mainly worked on S1PR2, S1PR3 and SphK2. The results show that when MSCs were used in combination with S1P, the selectivity of S1P receptors was increased and the homeostatic control of S1P concentration was improved through regulation of expression of S1P metabolic enzymes. The study found that, as a potential treatment, MSCs could work on multiple S1P related genes simultaneously. When it was used in combination with S1P, the expression regulation result of related genes was not simply the superposition of each other, but more significant outcome was obtained. This study establishes the experimental basis for further exploring the efficacy of improving endothelial barrier function in acute lung injury, using MSCs in combination with S1P and their possible synergistic mechanism.
van Heerden, Philippus D R; Kiddle, Guy; Pellny, Till K; Mokwala, Phatlane W; Jordaan, Anine; Strauss, Abram J; de Beer, Misha; Schlüter, Urte; Kunert, Karl J; Foyer, Christine H
2008-09-01
Symbiotic nitrogen fixation is sensitive to dark chilling (7 degrees C-15 degrees C)-induced inhibition in soybean (Glycine max). To characterize the mechanisms that cause the stress-induced loss of nodule function, we examined nodule structure, carbon-nitrogen interactions, and respiration in two soybean genotypes that differ in chilling sensitivity: PAN809 (PAN), which is chilling sensitive, and Highveld Top (HT), which is more chilling resistant. Nodule numbers were unaffected by dark chilling, as was the abundance of the nitrogenase and leghemoglobin proteins. However, dark chilling decreased nodule respiration rates, nitrogenase activities, and NifH and NifK mRNAs and increased nodule starch, sucrose, and glucose in both genotypes. Ureide and fructose contents decreased only in PAN nodules. While the chilling-induced decreases in nodule respiration persisted in PAN even after return to optimal temperatures, respiration started to recover in HT by the end of the chilling period. The area of the intercellular spaces in the nodule cortex and infected zone was greatly decreased in HT after three nights of chilling, an acclimatory response that was absent from PAN. These data show that HT nodules are able to regulate both respiration and the area of the intercellular spaces during chilling and in this way control the oxygen diffusion barrier, which is a key component of the nodule stress response. We conclude that chilling-induced loss of symbiotic nitrogen fixation in PAN is caused by the inhibition of respiration coupled to the failure to regulate the oxygen diffusion barrier effectively. The resultant limitations on nitrogen availability contribute to the greater chilling-induced inhibition of photosynthesis in PAN than in HT.
International Nuclear Information System (INIS)
Sena, P.A.
1986-01-01
The ground vehicle is one of the most effective tools available to an adversary force. Vehicles can be used to penetrate many types of perimeter barriers, transport equipment and personnel rapidly over long distances, and deliver large amounts of explosives directly to facilities in suicide missions. The function of a vehicle barrier system is to detain or disable a defined threat vehicle at a selected distance from a protected facility. Numerous facilities are installing, or planning to install, vehicle barrier systems and many of these facilities are requesting guidance to do so adequately. Therefore, vehicle barriers are being evaluated to determine their stopping capabilities so that systems can be designed that are both balanced and capable of providing a desired degree of protection. Equally important, many of the considerations that should be taken into account when establishing a vehicle barrier system have been identified. These considerations which pertain to site preparation, barrier selection, system integration and operation, and vehicle/barrier interaction, are discussed in this paper
Longitudinal Associations among Child Maltreatment, Social Functioning, and Cortisol Regulation
Alink, Lenneke R. A.; Cicchetti, Dante; Kim, Jungmeen; Rogosch, Fred A.
2012-01-01
Child maltreatment increases the risk for impaired social functioning and cortisol regulation. However, the longitudinal interplay among these factors is still unclear. This study aimed to shed light on the effect of maltreatment on social functioning and cortisol regulation over time. The sample consisted of 236 children (mean age 7.64 years, SD…
International Nuclear Information System (INIS)
Bierman, J.D.; Chan, P.; Liang, J.F.; Kelly, M.P.; Sonzogni, A.A.; Vandenbosch, R.
1996-01-01
Fusion excitation functions spanning the entire barrier region in 1 MeV energy steps for the two systems 40 Ca + 192 Os, 194 Pt are presented. The results of fission fragment angular distribution measurements for fusion-fission of 40 Ca + 197 Au at several projectile energies within the barrier region are also presented. The fusion data is of high enough precision to allow for extraction of the distribution of fusion barriers from the second differential of the product of E and σ. Basic coupled channels calculations which are in quite good agreement with the data are shown and discussed
Redox Regulation of Mitochondrial Function
Handy, Diane E.
2012-01-01
Abstract Redox-dependent processes influence most cellular functions, such as differentiation, proliferation, and apoptosis. Mitochondria are at the center of these processes, as mitochondria both generate reactive oxygen species (ROS) that drive redox-sensitive events and respond to ROS-mediated changes in the cellular redox state. In this review, we examine the regulation of cellular ROS, their modes of production and removal, and the redox-sensitive targets that are modified by their flux. In particular, we focus on the actions of redox-sensitive targets that alter mitochondrial function and the role of these redox modifications on metabolism, mitochondrial biogenesis, receptor-mediated signaling, and apoptotic pathways. We also consider the role of mitochondria in modulating these pathways, and discuss how redox-dependent events may contribute to pathobiology by altering mitochondrial function. Antioxid. Redox Signal. 16, 1323–1367. PMID:22146081
Cho, Jaehyun; Jeon, Ikseong; Kim, Seong Yun; Lim, Soonho; Jho, Jae Young
2017-08-23
A series of polyketone (PK) nanocomposite films with varying content of noncovalently functionalized graphene nanoplatelet with 1-aminopyrene (GNP/APy) is prepared by solution blending with a solvent of hexafluoro-2-propanol. GNP/APy, prepared by a facile method, can effectively induce specific interaction such as hydrogen bonding between the amine functional group of GNP/APy and the carbonyl functional group of the PK matrix. With comparison of GNP and GNP/Py as reference materials, intensive investigation on filler-matrix interaction is achieved. In addition, the dispersion state of the functionalized GNP (f-GNPs; GNP/Py and GNP/APy) in the PK matrix is analyzed by three-dimensional nondestructive X-ray microcomputed tomography, and the increased dispersion state of those fillers results in significant improvement in the water vapor transmission rate (WVTR). The enhancement in WVTR of the PK/GNP/APy nanocomposite film at 1 wt % loading of filler leads to a barrier performance approximately 2 times larger compared to that of PK/GNP nanocomposite film and an approximately 92% reduction in WVTR compared to the case of pristine PK film. We expect that this facile method of graphene functionalization to enhance graphene dispersibility as well as interfacial interaction with the polymer matrix will be widely utilized to expand the potential of graphene materials to barrier film applications.
DEFF Research Database (Denmark)
Tetens, Inge
related to a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function. The food constituent that is the subject of the health claim is a combination of flaxseed oil and vitamin E. The Panel considers that the combination of flaxseed oil and vitamin E...... be drawn from these studies for the scientific substantiation of the claim. The Panel concludes that a cause and effect relationship has not been established between the consumption of a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function...... is sufficiently characterised. The claimed effect is “contributes to maintain skin permeability barrier function”. The target population proposed by the applicant is healthy adults with dry and sensitive skin. Maintenance of the permeability barrier function of the skin is a beneficial physiological effect...
Danielsson, Karin; Ebrahimi, Majid; Nylander, Elisabet; Wahlin, Ylva Britt; Nylander, Karin
2017-02-08
Lichen planus is a chronic recurrent inflammatory disease affecting both skin and mucosa, mainly in oral and/or genital regions. Keratinocytes go through a well-regulated process of proliferation and differentiation, alterations in which may result in defects in the protective epithelial barrier. Long-term barrier impairment might lead to chronic inflammation. In order to broaden our understanding of the differentiation process in mucosal lichen planus, we mapped the expression of 4 factors known to be involved in differentiation. Biopsies were collected from oral and genital lichen planus lesions and normal controls. Altered expression of all 4 factors in epithelium from lichen planus lesions was found, clearly indicating disturbed epithelial differentiation in lichen planus lesions.
Saiki, Asako; Ishida, Yasuaki; Segawa, Shuichi; Hirota, Ryuichi; Nakamura, Takeshi; Kuroda, Akio
2016-05-01
Inorganic polyphosphate (polyP) was previously identified as a probiotic-derived substance that enhances intestinal barrier function. PolyP-accumulating bacteria are expected to have beneficial effects on the human gastrointestinal tract. In this study, we selected Lactobacillus paracasei JCM 1163 as a strain with the potential to accumulate polyP, because among the probiotic bacteria stored in our laboratory, it had the largest amount of polyP. The chain length of polyP accumulated in L. paracasei JCM 1163 was approximately 700 phosphate (Pi) residues. L. paracasei JCM 1163 accumulated polyP when Pi was added to Pi-starved cells. We further improved the ability of L. paracasei JCM 1163 to accumulate polyP by nitrosoguanidine mutagenesis. The mutant accumulated polyP at a level of 1500 nmol/mg protein-approximately 190 times that of the wild-type strain. PolyP extracted from the L. paracasei JCM 1163 significantly suppressed the oxidant-induced intestinal permeability in mouse small intestine. In conclusion, we have succeeded in breeding the polyP-accumulating Lactobacillus mutant that is expected to enhance intestinal barrier function.
González, Hugo; Elgueta, Daniela; Montoya, Andro; Pacheco, Rodrigo
2014-09-15
Neuroinflammation constitutes a fundamental process involved in the progression of several neurodegenerative disorders, such as Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis and multiple sclerosis. Microglial cells play a central role in neuroinflammation, promoting neuroprotective or neurotoxic microenvironments, thus controlling neuronal fate. Acquisition of different microglial functions is regulated by intercellular interactions with neurons, astrocytes, the blood-brain barrier, and T-cells infiltrating the central nervous system. In this study, an overview of the regulation of microglial function mediated by different intercellular communications is summarised and discussed. Afterward, we focus in T-cell-mediated regulation of neuroinflammation involved in neurodegenerative disorders. Copyright © 2014 Elsevier B.V. All rights reserved.
Astrocyte–endothelial interactions and blood–brain barrier permeability*
Abbott, N Joan
2002-01-01
The blood–brain barrier (BBB) is formed by brain endothelial cells lining the cerebral microvasculature, and is an important mechanism for protecting the brain from fluctuations in plasma composition, and from circulating agents such as neurotransmitters and xenobiotics capable of disturbing neural function. The barrier also plays an important role in the homeostatic regulation of the brain microenvironment necessary for the stable and co-ordinated activity of neurones. The BBB phenotype develops under the influence of associated brain cells, especially astrocytic glia, and consists of more complex tight junctions than in other capillary endothelia, and a number of specific transport and enzyme systems which regulate molecular traffic across the endothelial cells. Transporters characteristic of the BBB phenotype include both uptake mechanisms (e.g. GLUT-1 glucose carrier, L1 amino acid transporter) and efflux transporters (e.g. P-glycoprotein). In addition to a role in long-term barrier induction and maintenance, astrocytes and other cells can release chemical factors that modulate endothelial permeability over a time-scale of seconds to minutes. Cell culture models, both primary and cell lines, have been used to investigate aspects of barrier induction and modulation. Conditioned medium taken from growing glial cells can reproduce some of the inductive effects, evidence for involvement of diffusible factors. However, for some features of endothelial differentiation and induction, the extracellular matrix plays an important role. Several candidate molecules have been identified, capable of mimicking aspects of glial-mediated barrier induction of brain endothelium; these include TGFβ, GDNF, bFGF, IL-6 and steroids. In addition, factors secreted by brain endothelial cells including leukaemia inhibitory factor (LIF) have been shown to induce astrocytic differentiation. Thus endothelium and astrocytes are involved in two-way induction. Short-term modulation of brain
Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya
2016-09-01
Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.
Regulation of macrophage development and function in peripheral tissues
Lavin, Yonit; Mortha, Arthur; Rahman, Adeeb; Merad, Miriam
2015-01-01
Macrophages are immune cells of haematopoietic origin that provide crucial innate immune defence and have tissue-specific functions in the regulation and maintenance of organ homeostasis. Recent studies of macrophage ontogeny, as well as transcriptional and epigenetic identity, have started to reveal the decisive role of the tissue stroma in the regulation of macrophage function. These findings suggest that most macrophages seed the tissues during embryonic development and functionally specialize in response to cytokines and metabolites that are released by the stroma and drive the expression of unique transcription factors. In this Review, we discuss how recent insights into macrophage ontogeny and macrophage–stroma interactions contribute to our understanding of the crosstalk that shapes macrophage function and the maintenance of organ integrity. PMID:26603899
Bile acids in regulation of intestinal physiology.
LENUS (Irish Health Repository)
Keating, Niamh
2009-10-01
In addition to their roles in facilitating lipid digestion and absorption, bile acids are recognized as important regulators of intestinal function. Exposure to bile acids can dramatically influence intestinal transport and barrier properties; in recent years, they have also become appreciated as important factors in regulating cell growth and survival. Indeed, few cells reside within the intestinal mucosa that are not altered to some degree by exposure to bile acids. The past decade saw great advances in the knowledge of how bile acids exert their actions at the cellular and molecular levels. In this review, we summarize the current understanding of the role of bile acids in regulation of intestinal physiology.
Kim, Seungbum; Goel, Ruby; Kumar, Ashok; Qi, Yanfei; Lobaton, Gil; Hosaka, Koji; Mohammed, Mohammed; Handberg, Eileen M; Richards, Elaine M; Pepine, Carl J; Raizada, Mohan K
2018-03-30
Recent evidence indicates a link between gut pathology and microbiome with hypertension (HTN) in animal models. However, whether this association exists in humans is unknown. Thus, our objectives in the present study were to test the hypotheses that high blood pressure (BP) patients have distinct gut microbiomes and that gut-epithelial barrier function markers and microbiome composition could predict systolic BP (SBP). Fecal samples, analyzed by shotgun metagenomics, displayed taxonomic and functional changes, including altered butyrate production between patients with high BP and reference subjects. Significant increases in plasma of intestinal fatty acid binding protein (I-FABP), lipopolysaccharide (LPS), and augmented gut-targetting proinflammatory T helper 17 (Th17) cells in high BP patients demonstrated increased intestinal inflammation and permeability. Zonulin, a gut epithelial tight junction protein regulator, was markedly elevated, further supporting gut barrier dysfunction in high BP. Zonulin strongly correlated with SBP (R 2 = 0.5301, P <0.0001). Two models predicting SBP were built using stepwise linear regression analysis of microbiome data and circulating markers of gut health, and validated in a separate cohort by prediction of SBP from zonulin in plasma (R 2 = 0.4608, P <0.0001). The mouse model of HTN, chronic angiotensin II (Ang II) infusion, was used to confirm the effects of butyrate and gut barrier function on the cardiovascular system and BP. These results support our conclusion that intestinal barrier dysfunction and microbiome function are linked to HTN in humans. They suggest that manipulation of gut microbiome and its barrier functions could be the new therapeutic and diagnostic avenues for HTN. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Chaudhuri, R K; Bojanowski, K
2017-10-01
The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Epigenetic Regulation of Monocyte and Macrophage Function
Hoeksema, Marten A.; de Winther, Menno P. J.
2016-01-01
Monocytes and macrophages are key players in tissue homeostasis and immune responses. Epigenetic processes tightly regulate cellular functioning in health and disease. Recent Advances: Recent technical developments have allowed detailed characterizations of the transcriptional circuitry underlying
Kelly, John R.; Kennedy, Paul J.; Cryan, John F.; Dinan, Timothy G.; Clarke, Gerard; Hyland, Niall P.
2015-01-01
The emerging links between our gut microbiome and the central nervous system (CNS) are regarded as a paradigm shift in neuroscience with possible implications for not only understanding the pathophysiology of stress-related psychiatric disorders, but also their treatment. Thus the gut microbiome and its influence on host barrier function is positioned to be a critical node within the brain-gut axis. Mounting preclinical evidence broadly suggests that the gut microbiota can modulate brain development, function and behavior by immune, endocrine and neural pathways of the brain-gut-microbiota axis. Detailed mechanistic insights explaining these specific interactions are currently underdeveloped. However, the concept that a “leaky gut” may facilitate communication between the microbiota and these key signaling pathways has gained traction. Deficits in intestinal permeability may underpin the chronic low-grade inflammation observed in disorders such as depression and the gut microbiome plays a critical role in regulating intestinal permeability. In this review we will discuss the possible role played by the gut microbiota in maintaining intestinal barrier function and the CNS consequences when it becomes disrupted. We will draw on both clinical and preclinical evidence to support this concept as well as the key features of the gut microbiota which are necessary for normal intestinal barrier function. PMID:26528128
Scott, Kevin G-E; Meddings, Jonathon B; Kirk, David R; Lees-Miller, Susan P; Buret, André G
2002-10-01
Giardiasis causes malabsorptive diarrhea, and symptoms can be present in the absence of any significant morphologic injury to the intestinal mucosa. The effects of giardiasis on epithelial permeability in vivo remain unknown, and the role of T cells and myosin light chain kinase (MLCK) in altered intestinal barrier function is unclear. This study was conducted to determine whether Giardia spp. alters intestinal permeability in vivo, to assess whether these abnormalities are dependent on T cells, and to assess the role of MLCK in altered epithelial barrier function. Immunocompetent and isogenic athymic mice were inoculated with axenic Giardia muris trophozoites or sterile vehicle (control), then assessed for trophozoite colonization and gastrointestinal permeability. Mechanistic studies using nontransformed human duodenal epithelial monolayers (SCBN) determined the effects of Giardia on myosin light chain (MLC) phosphorylation, transepithelial fluorescein isothiocyanate-dextran fluxes, cytoskeletal F-actin, tight junctional zonula occludens-1 (ZO-1), and MLCK. Giardia infection caused a significant increase in small intestinal, but not gastric or colonic, permeability that correlated with trophozoite colonization in both immunocompetent and athymic mice. In vitro, Giardia increased permeability and phosphorylation of MLC and reorganized F-actin and ZO-1. These alterations were abolished with an MLCK inhibitor. Disruption of small intestinal barrier function is T cell independent, disappears on parasite clearance, and correlates with reorganization of cytoskeletal F-actin and tight junctional ZO-1 in an MLCK-dependent fashion.
Barriers for the introduction of bioenergy in the Netherlands
International Nuclear Information System (INIS)
Gerlagh, T.; Groenendaal, B.; Van Ree, R.; Dinkelbach, L.; Van Doorn, J.; Hemmes, K.
2000-01-01
The use of biomass for energy in the Netherlands is still limited despite the political incentives to make bio-energy a major source of renewable energy. The hesitation of many stake-holders is due to the limited insight into the potential of biomass in the Netherlands and the presence of numerous other barriers. Availability of biomass, emission regulation and waste treatment regulations are considered important barriers. Analyses of their current state show that these barriers are broadly recognised and possibilities to decrease their impact are present. Some barriers with a minor influence so far will be of increasing importance and could be a threat to the development of bio-energy in future. These are the fast liberalising of the energy market and sustainable energy market, the competition with other renewables and the unclear status of the current technology available. Future research should focus on the possibilities to overcome these new barriers. 5 refs
Innate lymphoid cells in autoimmunity: emerging regulators in rheumatic diseases
Shikhagaie, Medya M.; Germar, Kristine; Bal, Suzanne M.; Ros, Xavier Romero; Spits, Hergen
2017-01-01
Innate lymphoid cells (ILCs) are important in the regulation of barrier homeostasis. These cells do not express T cell receptors but share many functional similarities with T helper cells and cytotoxic CD8(+) T lymphocytes. ILCs are divided into three groups, namely group 1 ILCs, group 2 ILCs and
Barriers in EU retail financial markets
Micuda, Dan
2007-01-01
Looking at the retail financial markets and identifing a number of ‘‘natural’’ and ‘‘policy induced’’ obstacles to free trade. We use the term ‘‘natural’’ barriers to refer to those arising as a result of different cultures or consumer preferences, while different state tax policies or regulations are classified as ‘‘policy induced’’ barriers.
Therapeutic benefits of enhancing permeability barrier for atopic eczema
Directory of Open Access Journals (Sweden)
George Man
2015-06-01
Full Text Available The regulatory role of epidermal permeability barrier function in cutaneous inflammation has been well appreciated. While barrier disruption induces cutaneous inflammation, improvement of permeability barrier function alleviates inflammation. Studies have demonstrated that improvement of epidermal permeability barrier function not only prevents the development of atopic eczema, but also delays the relapse of these diseases. Moreover, enhancing the epidermal permeability barrier also alleviates atopic eczema. Furthermore, co-applications of barrier enhancing products with glucocorticoids can increase the therapeutic efficacy and reduce the adverse effects of glucocorticoids in the treatment of atopic eczema. Therefore, utilization of permeability barrier enhancing products alone or in combination with glucocorticoids could be a valuable approach in the treatment of atopic eczema. In this review, we discuss the benefits of improving the epidermal permeability barrier in the management of atopic eczema.
Phosphodiesterases regulate airway smooth muscle function in health and disease.
Krymskaya, Vera P; Panettieri, Reynold A
2007-01-01
On the basis of structure, regulation, and kinetic properties, phosphodiesterases (PDEs) represent a superfamily of enzymes divided into 11 subfamilies that catalyze cytosolic levels of 3',5'-cyclic adenosine monophosphate (cAMP) or 3',5'-cyclic guanosine monophosphate (cGMP) to 5'-AMP or 5'-GMP, respectively. PDE4 represents the major PDE expressed in inflammatory cells as well as airway smooth muscle (ASM), and selective PDE4 inhibitors provide a broad spectrum of anti-inflammatory effects such as abrogating cytokine and chemokine release from inflammatory cells and inhibiting inflammatory cell trafficking. Due to cell- and tissue-specific gene expression and regulation, PDEs modulate unique organ-based functions. New tools or compounds that selectively inhibit PDE subfamilies and genetically engineered mice deficient in selective isoforms have greatly enhanced our understanding of PDE function in airway inflammation and resident cell function. This chapter will focus on recent advances in our understanding of the role of PDE in regulating ASM function.
Ascorbate regulates haematopoietic stem cell function and leukaemogenesis.
Agathocleous, Michalis; Meacham, Corbin E; Burgess, Rebecca J; Piskounova, Elena; Zhao, Zhiyu; Crane, Genevieve M; Cowin, Brianna L; Bruner, Emily; Murphy, Malea M; Chen, Weina; Spangrude, Gerald J; Hu, Zeping; DeBerardinis, Ralph J; Morrison, Sean J
2017-09-28
Stem-cell fate can be influenced by metabolite levels in culture, but it is not known whether physiological variations in metabolite levels in normal tissues regulate stem-cell function in vivo. Here we describe a metabolomics method for the analysis of rare cell populations isolated directly from tissues and use it to compare mouse haematopoietic stem cells (HSCs) to restricted haematopoietic progenitors. Each haematopoietic cell type had a distinct metabolic signature. Human and mouse HSCs had unusually high levels of ascorbate, which decreased with differentiation. Systemic ascorbate depletion in mice increased HSC frequency and function, in part by reducing the function of Tet2, a dioxygenase tumour suppressor. Ascorbate depletion cooperated with Flt3 internal tandem duplication (Flt3 ITD ) leukaemic mutations to accelerate leukaemogenesis, through cell-autonomous and possibly non-cell-autonomous mechanisms, in a manner that was reversed by dietary ascorbate. Ascorbate acted cell-autonomously to negatively regulate HSC function and myelopoiesis through Tet2-dependent and Tet2-independent mechanisms. Ascorbate therefore accumulates within HSCs to promote Tet activity in vivo, limiting HSC frequency and suppressing leukaemogenesis.
Ren, Xiaomeng; Zhu, Yanyan; Gamallat, Yaser; Ma, Shenhao; Chiwala, Gift; Meyiah, Abdo; Xin, Yi
2017-10-01
Our research group previously isolated and identified a strain of pathogenic Escherichia coli from clinical samples called E. coli O124 K72. The present study was aimed at determining the potential effects of E. coli O124 K72 on intestinal barrier functions and structural proteins integrity in guinea pig. Guinea pigs were grouped into three groups; control (CG); E. coli O124 K72 (E. coli); and probiotics Lactobacillus rhamnosus (LGG). Initially, we create intestinal dysbiosis by giving all animals Levofloxacin for 10days, but the control group (CG) received the same volume of saline. Then, the animals received either E. coli O124 K72 (E. coli) or Lactobacillus rhamnosus (LGG) according to their assigned group. E. coli O124 K72 treatment significantly affected colon morphology and distorted intestinal barrier function by up-regulating Claudin2 and down-regulating Occludin. In addition, E. coli upregulated the mRNA expression of MUC1, MUC2, MUC13 and MUC15. Furthermore, suspected tumor was found in the E. coli treated animals. Our results suggested that E. coli O124 K72 strain has adverse effects on intestinal barrier functions and is capable of altering integrity of structural proteins in guinea pig model while at same time it may have a role in colon carcinogenesis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Selina Beasley
2014-01-01
Full Text Available We recently showed that caspase-14 is a novel molecule in retina with potential role in accelerated vascular cell death during diabetic retinopathy (DR. Here, we evaluated whether caspase-14 is implicated in retinal pigment epithelial cells (RPE dysfunction under hyperglycemia. The impact of high glucose (HG, 30 mM D-glucose on caspase-14 expression in human RPE (ARPE-19 cells was tested, which showed significant increase in caspase-14 expression compared with normal glucose (5 mM D-glucose + 25 mM L-glucose. We also evaluated the impact of modulating caspase-14 expression on RPE cells barrier function, phagocytosis, and activation of other caspases using ARPE-19 cells transfected with caspase-14 plasmid or caspase-14 siRNA. We used FITC-dextran flux assay and electric cell substrate impedance sensing (ECIS to test the changes in RPE cell barrier function. Similar to HG, caspase-14 expression in ARPE-19 cells increased FITC-dextran leakage through the confluent monolayer and decreased the transcellular electrical resistance (TER. These effects of HG were prevented by caspase-14 knockdown. Furthermore, caspase-14 knockdown prevented the HG-induced activation of caspase-1 and caspase-9, the only activated caspases by HG. Phagocytic activity was unaffected by caspase-14 expression. Our results suggest that caspase-14 contributes to RPE cell barrier disruption under hyperglycemic conditions and thus plays a role in the development of diabetic macular edema.
Directory of Open Access Journals (Sweden)
Rudolf eLucas
2013-08-01
Full Text Available The integrity of epithelial and endothelial barriers in the lower airspaces of the lungs has to be tightly regulated, in order to prevent leakage and to assure efficient gas exchange between the alveoli and capillaries. Both G- and G+ bacterial toxins, such as LPS and pneumolysin, respectively, can be released in high concentrations within the pulmonary compartments upon antibiotic treatment of patients suffering from acute respiratory distress syndrome (ARDS or severe pneumonia. These toxins are able to impair endothelial barrier function, either directly, or indirectly, by induction of pro-inflammatory mediators and neutrophil sequestration. Toxin-induced endothelial hyperpermeability can involve myosin light chain phosphorylation and/or microtubule rearrangement. Endothelial nitric oxide synthase (eNOS was proposed to be a guardian of basal barrier function, since eNOS knock-out mice display an impaired expression of inter-endothelial junction proteins and as such an increased vascular permeability, as compared to wild type mice. The enzyme arginase, the activity of which can be regulated by the redox status of the cell, exists in two isoforms - arginase 1 (cytosolic and arginase 2 (mitochondrial - both of which can be expressed in lung microvascular endothelial cells. Upon activation, arginase competes with eNOS for the substrate L-arginine, as such impairing eNOS-dependent NO generation and promoting ROS generation by the enzyme. This mini-review will discuss recent findings regarding the interaction between bacterial toxins and arginase during acute lung injury and will as such address the role of arginase in bacterial toxin-induced pulmonary endothelial barrier dysfunction.
Chung, Alexandra; Shill, Jane; Swinburn, Boyd; Mavoa, Helen; Lawrence, Mark; Loff, Bebe; Crammond, Bradley; Sacks, Gary; Allender, Steven; Peeters, Anna
2012-12-28
In Australia there have been many calls for government action to halt the effects of unhealthy food marketing on children's health, yet implementation has not occurred. The attitudes of those involved in the policy-making process towards regulatory intervention governing unhealthy food marketing are not well understood. The objective of this research was to understand the perceptions of senior representatives from Australian state and territory governments, statutory authorities and non-government organisations regarding the feasibility of state-level government regulation of television marketing of unhealthy food to children in Australia. Data from in-depth semi-structured interviews with senior representatives from state and territory government departments, statutory authorities and non-government organisations (n=22) were analysed to determine participants' views about regulation of television marketing of unhealthy food to children at the state government level. Data were analysed using content and thematic analyses. Regulation of television marketing of unhealthy food to children was supported as a strategy for obesity prevention. Barriers to implementing regulation at the state level were: the perception that regulation of television advertising is a Commonwealth, not state/territory, responsibility; the power of the food industry and; the need for clear evidence that demonstrates the effectiveness of regulation. Evidence of community support for regulation was also cited as an important factor in determining feasibility. The regulation of unhealthy food marketing to children is perceived to be a feasible strategy for obesity prevention however barriers to implementation at the state level exist. Those involved in state-level policy making generally indicated a preference for Commonwealth-led regulation. This research suggests that implementation of regulation of the television marketing of unhealthy food to children should ideally occur under the direction
Directory of Open Access Journals (Sweden)
Chung Alexandra
2012-12-01
Full Text Available Abstract Background In Australia there have been many calls for government action to halt the effects of unhealthy food marketing on children's health, yet implementation has not occurred. The attitudes of those involved in the policy-making process towards regulatory intervention governing unhealthy food marketing are not well understood. The objective of this research was to understand the perceptions of senior representatives from Australian state and territory governments, statutory authorities and non-government organisations regarding the feasibility of state-level government regulation of television marketing of unhealthy food to children in Australia. Method Data from in-depth semi-structured interviews with senior representatives from state and territory government departments, statutory authorities and non-government organisations (n=22 were analysed to determine participants' views about regulation of television marketing of unhealthy food to children at the state government level. Data were analysed using content and thematic analyses. Results Regulation of television marketing of unhealthy food to children was supported as a strategy for obesity prevention. Barriers to implementing regulation at the state level were: the perception that regulation of television advertising is a Commonwealth, not state/territory, responsibility; the power of the food industry and; the need for clear evidence that demonstrates the effectiveness of regulation. Evidence of community support for regulation was also cited as an important factor in determining feasibility. Conclusions The regulation of unhealthy food marketing to children is perceived to be a feasible strategy for obesity prevention however barriers to implementation at the state level exist. Those involved in state-level policy making generally indicated a preference for Commonwealth-led regulation. This research suggests that implementation of regulation of the television marketing of
Measuring solvent barrier properties of paper
International Nuclear Information System (INIS)
Bollström, Roger; Saarinen, Jarkko J; Toivakka, Martti; Räty, Jukka
2012-01-01
New methods for measuring barrier properties against solvents, acids and bases on dispersion coated paper were developed and investigated. Usability, reliability and repeatability were compared both between the new methods and with the standardized method for measuring barrier properties against water vapor. Barrier properties could be measured with all methods and the results obtained by the different methods were in correlation with each other. A qualitative method based on a trace color provided an indicative result, whereas further developed methods also took into account the durability. The effective barrier lifetime could be measured by measuring the conductivity through the substrate as a function of time, or by utilizing a glass prism where the change in refractive index caused by penetrated liquid was monitored, also as a function of time. Barrier properties against water and humidity were also measured and were found not to be predictors for barrier properties against either solvents, or acids or bases, which supports the need to develop new methods
Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.
Directory of Open Access Journals (Sweden)
Lianghua Bin
Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.
Fission excitation function for 19F + 194,196,198Pt at near and above barrier energies
Directory of Open Access Journals (Sweden)
Singh Varinderjit
2015-01-01
Full Text Available Fission excitation functions for 19F + 194,196,198Pt reactions populating 213,215,217Fr compound nuclei are reported. Out of these three compound nuclei, 213Fr is a shell closed (N=126 compound nucleus and the other two are away from the shell closure. From a comparison of the experimental fission cross-sections with the statistical model predictions, it is observed that the fission cross-sections are underestimated by the statistical model predictions using shell corrected finite range rotating liquid drop model (FRLDM fission barriers. Further the FRLDM fission barriers are reduced to fit the fission cross-sections over the entire measured energy range.
GABA_A receptor function is regulated by lipid bilayer elasticity
DEFF Research Database (Denmark)
Søgaard, Rikke; Werge, Thomas; Berthelsen, Camilla
2006-01-01
( s) underlying these effects are poorly understood. DHA and Triton X-100, at concentrations that affect GABAA receptor function, increase the elasticity of lipid bilayers measured as decreased bilayer stiffness using gramicidin channels as molecular force transducers. We have previously shown...... reduced the peak amplitude of the GABA-induced currents and increased the rate of receptor desensitization. The effects of the amphiphiles did not correlate with the expected changes in monolayer spontaneous curvature. We conclude that GABAA receptor function is regulated by lipid bilayer elasticity....... PUFAs may generally regulate membrane protein function by affecting the elasticity of the host lipid bilayer....
The Development of Self-Regulation and Executive Function in Young Children
McClelland, Megan M.; Tominey, Shauna L.
2014-01-01
Self-regulation lays the foundation for positive social relationships and academic success. In this article, we provide an overview of self-regulation and the key terms related to selfregulation, such as executive function. We discuss research on how self-regulation develops and connections between self-regulation and social and academic outcomes.…
Emotional functioning, barriers, and medication adherence in pediatric transplant recipients.
McCormick King, Megan L; Mee, Laura L; Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Blount, Ronald L
2014-04-01
This study assessed relationships among internalizing symptoms, barriers to medication adherence, and medication adherence in adolescents with solid organ transplants. The sample included 72 adolescents who had received solid organ transplants. Multiple mediator models were tested via bootstrapping methods. Bivariate correlations revealed significant relationships between barriers and internalizing symptoms of depression, anxiety, and posttraumatic stress, as well as between internalizing symptoms and medication adherence. Barriers indicative of adaptation to the medication regimen (e.g., forgetting, lack of organization) were related to medication adherence and mediated the relationship between internalizing symptoms and medication adherence. These findings indicate that barriers may serve as a more specific factor in the relationship between more general, pervasive internalizing symptoms and medication adherence. Results may help guide areas for clinical assessment, and the focus of interventions for adolescent transplant recipients who are experiencing internalizing symptoms and/or who are nonadherent to their medication regimen.
Palmitoylation as a Functional Regulator of Neurotransmitter Receptors
Directory of Open Access Journals (Sweden)
Vladimir S. Naumenko
2018-01-01
Full Text Available The majority of neuronal proteins involved in cellular signaling undergo different posttranslational modifications significantly affecting their functions. One of these modifications is a covalent attachment of a 16-C palmitic acid to one or more cysteine residues (S-palmitoylation within the target protein. Palmitoylation is a reversible modification, and repeated cycles of palmitoylation/depalmitoylation might be critically involved in the regulation of multiple signaling processes. Palmitoylation also represents a common posttranslational modification of the neurotransmitter receptors, including G protein-coupled receptors (GPCRs and ligand-gated ion channels (LICs. From the functional point of view, palmitoylation affects a wide span of neurotransmitter receptors activities including their trafficking, sorting, stability, residence lifetime at the cell surface, endocytosis, recycling, and synaptic clustering. This review summarizes the current knowledge on the palmitoylation of neurotransmitter receptors and its role in the regulation of receptors functions as well as in the control of different kinds of physiological and pathological behavior.
Alteration of intestinal barrier function during activity-based anorexia in mice.
Jésus, Pierre; Ouelaa, Wassila; François, Marie; Riachy, Lina; Guérin, Charlène; Aziz, Moutaz; Do Rego, Jean-Claude; Déchelotte, Pierre; Fetissov, Sergueï O; Coëffier, Moïse
2014-12-01
Anorexia nervosa is a severe eating disorder often leading to malnutrition and cachexia, but its pathophysiology is still poorly defined. Chronic food restriction during anorexia nervosa may induce gut barrier dysfunction, which may contribute to disease development and its complications. Here we have characterized intestinal barrier function in mice with activity-based anorexia (ABA), an animal model of anorexia nervosa. Male C57Bl/6 ABA or limited food access (LFA) mice were placed respectively in cages with or without activity wheel. After 5 days of acclimatization, both ABA and LFA mice had progressively limited access to food from 6 h/d at day 6 to 3 h/d at day 9 and until the end of experiment at day 17. A group of pair-fed mice (PF) was also compared to ABA. On day 17, food intake was lower in ABA than LFA mice (2.0 ± 0.18 g vs. 3.0 ± 0.14 g, p anorexia nervosa. The role of these alterations in the pathophysiology of anorexia nervosa should be further evaluated. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
DEFF Research Database (Denmark)
Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.
2017-01-01
Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....
Directory of Open Access Journals (Sweden)
William J Joiner
Full Text Available A robust, bistable switch regulates the fluctuations between wakefulness and natural sleep as well as those between wakefulness and anesthetic-induced unresponsiveness. We previously provided experimental evidence for the existence of a behavioral barrier to transitions between these states of arousal, which we call neural inertia. Here we show that neural inertia is controlled by processes that contribute to sleep homeostasis and requires four genes involved in electrical excitability: Sh, sss, na and unc79. Although loss of function mutations in these genes can increase or decrease sensitivity to anesthesia induction, surprisingly, they all collapse neural inertia. These effects are genetically selective: neural inertia is not perturbed by loss-of-function mutations in all genes required for the sleep/wake cycle. These effects are also anatomically selective: sss acts in different neurons to influence arousal-promoting and arousal-suppressing processes underlying neural inertia. Supporting the idea that anesthesia and sleep share some, but not all, genetic and anatomical arousal-regulating pathways, we demonstrate that increasing homeostatic sleep drive widens the neural inertial barrier. We propose that processes selectively contributing to sleep homeostasis and neural inertia may be impaired in pathophysiological conditions such as coma and persistent vegetative states.
van Buul, Jaap D.; Anthony, Eloise C.; Fernandez-Borja, Mar; Burridge, Keith; Hordijk, Peter L.
2005-01-01
Vascular endothelial-cadherin (VE-cadherin) controls endothelial cell-cell adhesion and preserves endothelial integrity. In order to maintain endothelial barrier function, VE-cadherin function is tightly regulated through mechanisms that involve protein phosphorylation and cytoskeletal dynamics.
The blood-brain barrier in migraine treatment
DEFF Research Database (Denmark)
Edvinsson, L; Tfelt-Hansen, P
2008-01-01
Salient aspects of the anatomy and function of the blood-barrier barrier (BBB) are reviewed in relation to migraine pathophysiology and treatment. The main function of the BBB is to limit the access of circulating substances to the neuropile. Smaller lipophilic substances have some access...
Directory of Open Access Journals (Sweden)
Ran Wei
2018-05-01
Full Text Available To solve the drawbacks of poor dispersion and weak interface in gas barrier nanocomposites, a novel epoxy-diamine adduct (DDA was synthesized by reacting epoxy monomer DGEBA with curing agent D400 to functionalize montmorillonite (MMT, which could provide complete compatibility and reactivity with a DGEBA/D400 epoxy matrix. Thereafter, sodium type montmorillonite (Na-MMT and organic-MMTs functionalized by DDA and polyether amines were incorporated with epoxy to manufacture nanocomposites. The effects of MMT functionalization on the morphology and gas barrier property of nanocomposites were evaluated. The results showed that DDA was successfully synthesized, terminating with epoxy and amine groups. By simulating the small-angle neutron scattering data with a sandwich structure model, the optimal dispersion/exfoliation of MMT was observed in a DDA-MMT/DGEBA nanocomposite with a mean radius of 751 Å, a layer thickness of 30.8 Å, and only two layers in each tactoid. Moreover, the DDA-MMT/DGEBA nanocomposite exhibited the best N2 barrier properties, which were about five times those of neat epoxy. Based on a modified Nielsen model, it was clarified that this excellent gas barrier property was due to the homogeneously dispersed lamellas with almost exfoliated structures. The improved morphology and barrier property confirmed the superiority of the adduct, which provides a general method for developing gas barrier nanocomposites.
MicroRNAs as regulators of beta-cell function and dysfunction
DEFF Research Database (Denmark)
Osmai, Mirwais; Osmai, Yama; Bang-Berthelsen, Claus Heiner
2016-01-01
, recent studies have demonstrated that miRNAs are important regulators of the islet transcriptome, controlling apoptosis, differentiation and proliferation, as well as regulating unique islet and beta-cell functions and pathways such as insulin expression, processing and secretion. Furthermore, a large...
Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.
Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee
2017-08-01
Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.
Treatment of barrier evolution: the SKB perspective
International Nuclear Information System (INIS)
Hedin, A.
2002-01-01
This paper serves as a point of departure for the discussions to be held within the Working Group of Technical Topic entitled 'Barriers and System Performances within a safety case: Their functioning and Evolution with Time'. The paper gives the SKB perspective of the issues to be discussed within the Working Group for this Topic. The following issues to be discussed by the Working Group are: What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? What is the requested or required performance versus the expected or realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? What is the issue associated with the geosphere stability for different geological systems? How is barriers and system performances as a function of time evaluated (and presented and communicated) in a safety case? What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)
Cangkrama, Michael; Darido, Charbel; Georgy, Smitha R; Partridge, Darren; Auden, Alana; Srivastava, Seema; Wilanowski, Tomasz; Jane, Stephen M
2016-07-01
The skin barrier is critical for mammalian survival in the terrestrial environment, affording protection against fluid loss, microbes, toxins, and UV exposure. Many genes indispensable for barrier formation in the embryo have been identified, but loss of these genes in adult mice does not induce barrier regression. We describe a complex regulatory network centered on two ancient gene families, the grainyhead-like (Grhl) transcription factors and the protein cross-linking enzymes (tissue transglutaminases [Tgms]), which are essential for skin permeability barrier maintenance in adult mice. Embryonic deletion of Grhl3 induces loss of Tgm1 expression, which disrupts the cornified envelope, thus preventing permeability barrier formation leading to neonatal death. However, gene deletion of Grhl3 in adult mice does not disrupt the preformed barrier, with cornified envelope integrity maintained by Grhl1 and Tgm5, which are up-regulated in response to postnatal loss of Grhl3. Concomitant deletion of both Grhl factors in adult mice induced loss of Tgm1 and Tgm5 expression, perturbation of the cornified envelope, and complete permeability barrier regression that was incompatible with life. These findings define the molecular safeguards for barrier function that accompany the transition from intrauterine to terrestrial life. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Liu, Hao-Yu; Roos, Stefan; Jonsson, Hans; Ahl, David; Dicksved, Johan; Lindberg, Jan Erik; Lundh, Torbjörn
2015-04-01
Heat shock proteins (HSPs) are a set of highly conserved proteins that can serve as intestinal gate keepers in gut homeostasis. Here, effects of a probiotic, Lactobacillus rhamnosus GG (LGG), and two novel porcine isolates, Lactobacillus johnsonii strain P47-HY and Lactobacillus reuteri strain P43-HUV, on cytoprotective HSP expression and gut barrier function, were investigated in a porcine IPEC-J2 intestinal epithelial cell line model. The IPEC-J2 cells polarized on a permeable filter exhibited villus-like cell phenotype with development of apical microvilli. Western blot analysis detected HSP expression in IPEC-J2 and revealed that L. johnsonii and L. reuteri strains were able to significantly induce HSP27, despite high basal expression in IPEC-J2, whereas LGG did not. For HSP72, only the supernatant of L. reuteri induced the expression, which was comparable to the heat shock treatment, which indicated that HSP72 expression was more stimulus specific. The protective effect of lactobacilli was further studied in IPEC-J2 under an enterotoxigenic Escherichia coli (ETEC) challenge. ETEC caused intestinal barrier destruction, as reflected by loss of cell-cell contact, reduced IPEC-J2 cell viability and transepithelial electrical resistance, and disruption of tight junction protein zonula occludens-1. In contrast, the L. reuteri treatment substantially counteracted these detrimental effects and preserved the barrier function. L. johnsonii and LGG also achieved barrier protection, partly by directly inhibiting ETEC attachment. Together, the results indicate that specific strains of Lactobacillus can enhance gut barrier function through cytoprotective HSP induction and fortify the cell protection against ETEC challenge through tight junction protein modulation and direct interaction with pathogens. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
CSIR Research Space (South Africa)
Angelstam, P
2017-05-01
Full Text Available . Based on expert knowledge at three scales, we analysed South Africa's opportunity to active adaptive management and to unlock investments that enhance functional ecological infrastructure. Barriers included lack of trust among actors, limited...
van Smeden, Jeroen; Bouwstra, Joke A
2016-01-01
Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to
Composite of microgels and lipids as biofilm to restore skin barrier function
Oudshoorn, M.H.M.
2008-01-01
The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential
A novel transgenic zebrafish model for blood-brain and blood-retinal barrier development
Directory of Open Access Journals (Sweden)
Sugimoto Masahiko
2010-07-01
Full Text Available Abstract Background Development and maintenance of the blood-brain and blood-retinal barrier is critical for the homeostasis of brain and retinal tissue. Despite decades of research our knowledge of the formation and maintenance of the blood-brain (BBB and blood-retinal (BRB barrier is very limited. We have established an in vivo model to study the development and maintenance of these barriers by generating a transgenic zebrafish line that expresses a vitamin D-binding protein fused with enhanced green fluorescent protein (DBP-EGFP in blood plasma, as an endogenous tracer. Results The temporal establishment of the BBB and BRB was examined using this transgenic line and the results were compared with that obtained by injection of fluorescent dyes into the sinus venosus of embryos at various stages of development. We also examined the expression of claudin-5, a component of tight junctions during the first 4 days of development. We observed that the BBB of zebrafish starts to develop by 3 dpf, with expression of claudin-5 in the central arteries preceding it at 2 dpf. The hyaloid vasculature in the zebrafish retina develops a barrier function at 3 dpf, which endows the zebrafish with unique advantages for studying the BRB. Conclusion Zebrafish embryos develop BBB and BRB function simultaneously by 3 dpf, which is regulated by tight junction proteins. The Tg(l-fabp:DBP-EGFP zebrafish will have great advantages in studying development and maintenance of the blood-neural barrier, which is a new application for the widely used vertebrate model.
Devices for overcoming biological barriers: the use of physical forces to disrupt the barriers.
Mitragotri, Samir
2013-01-01
Overcoming biological barriers including skin, mucosal membranes, blood brain barrier as well as cell and nuclear membrane constitutes a key hurdle in the field of drug delivery. While these barriers serve the natural protective function in the body, they limit delivery of drugs into the body. A variety of methods have been developed to overcome these barriers including formulations, targeting peptides and device-based technologies. This review focuses on the use of physical methods including acoustic devices, electric devices, high-pressure devices, microneedles and optical devices for disrupting various barriers in the body including skin and other membranes. A summary of the working principles of these devices and their ability to enhance drug delivery is presented. Copyright © 2012. Published by Elsevier B.V.
Stolwijk, Judith A; Matrougui, Khalid; Renken, Christian W; Trebak, Mohamed
2015-10-01
The past 20 years has seen significant growth in using impedance-based assays to understand the molecular underpinning of endothelial and epithelial barrier function in response to physiological agonists and pharmacological and toxicological compounds. Most studies on barrier function use G protein-coupled receptor (GPCR) agonists which couple to fast and transient changes in barrier properties. The power of impedance-based techniques such as electric cell-substrate impedance sensing (ECIS) resides in its ability to detect minute changes in cell layer integrity label-free and in real-time ranging from seconds to days. We provide a comprehensive overview of the biophysical principles, applications, and recent developments in impedance-based methodologies. Despite extensive application of impedance analysis in endothelial barrier research, little attention has been paid to data analysis and critical experimental variables, which are both essential for signal stability and reproducibility. We describe the rationale behind common ECIS data presentation and interpretation and illustrate practical guidelines to improve signal intensity by adapting technical parameters such as electrode layout, monitoring frequency, or parameter (resistance versus impedance magnitude). Moreover, we discuss the impact of experimental parameters, including cell source, liquid handling, and agonist preparation on signal intensity and kinetics. Our discussions are supported by experimental data obtained from human microvascular endothelial cells challenged with three GPCR agonists, thrombin, histamine, and sphingosine-1-phosphate.
Directory of Open Access Journals (Sweden)
Chen Sun
Full Text Available A variety of intestinal pathogens have virulence factors that target mitogen activated protein kinase (MAPK signaling pathways, including Bacillus anthracis. Anthrax lethal toxin (LT has specific proteolytic activity against the upstream regulators of MAPKs, the MAPK kinases (MKKs. Using a murine model of intoxication, we show that LT causes the dose-dependent disruption of intestinal epithelial integrity, characterized by mucosal erosion, ulceration, and bleeding. This pathology correlates with an LT-dependent blockade of intestinal crypt cell proliferation, accompanied by marked apoptosis in the villus tips. C57BL/6J mice treated with intravenous LT nearly uniformly develop systemic infections with commensal enteric organisms within 72 hours of administration. LT-dependent intestinal pathology depends upon its proteolytic activity and is partially attenuated by co-administration of broad spectrum antibiotics, indicating that it is both a cause and an effect of infection. These findings indicate that targeting of MAPK signaling pathways by anthrax LT compromises the structural integrity of the mucosal layer, serving to undermine the effectiveness of the intestinal barrier. Combined with the well-described immunosuppressive effects of LT, this disruption of the intestinal barrier provides a potential mechanism for host invasion via the enteric route, a common portal of entry during the natural infection cycle of Bacillus anthracis.
Emotion regulation ability varies in relation to intrinsic functional brain architecture.
Uchida, Mai; Biederman, Joseph; Gabrieli, John D E; Micco, Jamie; de Los Angeles, Carlo; Brown, Ariel; Kenworthy, Tara; Kagan, Elana; Whitfield-Gabrieli, Susan
2015-12-01
This study investigated the neural basis of individual variation in emotion regulation, specifically the ability to reappraise negative stimuli so as to down-regulate negative affect. Brain functions in young adults were measured with functional Magnetic Resonance Imaging during three conditions: (i) attending to neutral pictures; (ii) attending to negative pictures and (iii) reappraising negative pictures. Resting-state functional connectivity was measured with amygdala and dorsolateral prefrontal cortical (DLPFC) seed regions frequently associated with emotion regulation. Participants reported more negative affect after attending to negative than neutral pictures, and less negative affect following reappraisal. Both attending to negative vs neutral pictures and reappraising vs attending to negative pictures yielded widespread activations that were significantly right-lateralized for attending to negative pictures and left-lateralized for reappraising negative pictures. Across participants, more successful reappraisal correlated with less trait anxiety and more positive daily emotion, greater activation in medial and lateral prefrontal regions, and lesser resting-state functional connectivity between (a) right amygdala and both medial prefrontal and posterior cingulate cortices, and (b) bilateral DLPFC and posterior visual cortices. The ability to regulate emotion, a source of resilience or of risk for distress, appears to vary in relation to differences in intrinsic functional brain architecture. © The Author (2015). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Wang, Yang; Du, Wei; Lei, Kai; Wang, Baikui; Wang, Yuanyuan; Zhou, Yingshan; Li, Weifen
2017-09-01
Previous study showed that dietary Bacillus licheniformis (B. licheniformis) administration contributes to the improvement of laying performance and egg quality in laying hens. In this study, we aimed to further evaluate its underlying mechanisms. Three hundred sixty Hy-Line Variety W-36 hens (28 weeks of age) were randomized into four groups, each group with six replications (n = 15). The control group received the basal diet and the treatment groups received the same basal diets supplemented with 0.01, 0.03, and 0.06% B. licheniformis powder (2 × 10 10 cfu/g) for an 8-week trial. The results demonstrate that B. licheniformis significantly enhance the intestinal barrier functions via decreasing gut permeability, promoting mucin-2 transcription, and regulating inflammatory cytokines. The systemic immunity of layers in B. licheniformis treatment groups is improved through modulating the specific and non-specific immunity. In addition, gene expressions of hormone receptors, including estrogen receptor α, estrogen receptor β, and follicle-stimulating hormone receptor, are also regulated by B. licheniformis. Meanwhile, compared with the control, B. licheniformis significantly increase gonadotropin-releasing hormone level, but markedly reduce ghrelin and inhibin secretions. Overall, our data suggest that dietary inclusion of B. licheniformis can improve the intestinal barrier function and systemic immunity and regulate reproductive hormone secretions, which contribute to better laying performance and egg quality of hens.
Myostatin-like proteins regulate synaptic function and neuronal morphology.
Augustin, Hrvoje; McGourty, Kieran; Steinert, Joern R; Cochemé, Helena M; Adcott, Jennifer; Cabecinha, Melissa; Vincent, Alec; Halff, Els F; Kittler, Josef T; Boucrot, Emmanuel; Partridge, Linda
2017-07-01
Growth factors of the TGFβ superfamily play key roles in regulating neuronal and muscle function. Myostatin (or GDF8) and GDF11 are potent negative regulators of skeletal muscle mass. However, expression of myostatin and its cognate receptors in other tissues, including brain and peripheral nerves, suggests a potential wider biological role. Here, we show that Myoglianin (MYO), the Drosophila homolog of myostatin and GDF11, regulates not only body weight and muscle size, but also inhibits neuromuscular synapse strength and composition in a Smad2-dependent manner. Both myostatin and GDF11 affected synapse formation in isolated rat cortical neuron cultures, suggesting an effect on synaptogenesis beyond neuromuscular junctions. We also show that MYO acts in vivo to inhibit synaptic transmission between neurons in the escape response neural circuit of adult flies. Thus, these anti-myogenic proteins act as important inhibitors of synapse function and neuronal growth. © 2017. Published by The Company of Biologists Ltd.
International Nuclear Information System (INIS)
Fuller, J.L.; Wolford, J.
2001-01-01
Full text: An information barrier (IB) consists of procedures and technology that prevent the release of sensitive information during a joint inspection of a sensitive nuclear item, and provides confidence that the measurement system into which it has been integrated functions exactly as designed and constructed. Work in the U.S. on radiation detection system information barriers dates back at least to 1990, even though the terminology is more recent. In January 1999 the Joint DoD-DOE Information Barrier Working Group was formed in the United States to help coordinate technical efforts related to information barrier R and D. This paper presents an overview of the efforts of this group, by its Chairs, as well as recommendations for further information barrier R and D. Progress on the demonstration of monitoring systems containing IBs is also provided. From the U.S. perspective, the basic, top-level functional requirements for the information barrier portion of an integrated radiation signature-information barrier inspection system are twofold: The host must be assured that his classified information is protected from disclosure to the inspecting party; and The inspecting party must be confident that the integrated inspection system measures, processes, and presents the radiation-signature-based measurement conclusion in an accurate and reproducible manner. It is the position of the United States that in the absence of any agreement to share classified nuclear weapons design information in the conduct of an inspection regime, the requirement to protect host country classified warhead design information is paramount and admits no tradeoff versus the confidence provided to the inspecting party in the accuracy and reproducibility of the measurements. The U.S. has reached an internal consensus on several critical design elements that define a general standard for radiation signature information barrier design. These criteria have stood the test of time under intense
Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.
Liu, Xinxin; Zheng, Wei; Sivasankar, M Preeti
2016-01-01
Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3) expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001). Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (pacrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (pacrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.
Heteren, S. van
2015-01-01
Barrier-system dynamics are a function of antecedent topography and substrate lithology, Relative sea-level (RSL) changes, sediment availability and type, climate, vegetation type and cover, and various aero- and hydrodynamic processes during fair-weather conditions and extreme events. Global change
Lipid Bilayer – mediated Regulation of Ion Channel Function by Amphiphilic Drugs
DEFF Research Database (Denmark)
Lundbæk, Jens August
2008-01-01
that are transforming it into a subject of quantitative science. It is described how the hydrophobic interactions between a membrane protein and the host lipid bilayer provide the basis for a mechanism, whereby protein function is regulated by the bilayer physical properties. The use of gramicidin channels as single-molecule......Drugs that at pico- to nanomolar concentration regulate ion channel function by high-affi nity binding to their cognate receptor often have a “ secondary pharmacology, ” in which the same molecule at low micromolar concentrations regulates a diversity of membrane proteins in an apparently...... nonspecifi c manner. It has long been suspected that this promiscuous regulation of membrane protein function could be due to changes in the physical properties of the host lipid bilayer, but the underlying mechanisms have been poorly understood. Given that pharmacological research often involves drug...
Ohno, Yusuke
2017-01-01
The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.
Regulator Loss Functions and Hierarchical Modeling for Safety Decision Making.
Hatfield, Laura A; Baugh, Christine M; Azzone, Vanessa; Normand, Sharon-Lise T
2017-07-01
Regulators must act to protect the public when evidence indicates safety problems with medical devices. This requires complex tradeoffs among risks and benefits, which conventional safety surveillance methods do not incorporate. To combine explicit regulator loss functions with statistical evidence on medical device safety signals to improve decision making. In the Hospital Cost and Utilization Project National Inpatient Sample, we select pediatric inpatient admissions and identify adverse medical device events (AMDEs). We fit hierarchical Bayesian models to the annual hospital-level AMDE rates, accounting for patient and hospital characteristics. These models produce expected AMDE rates (a safety target), against which we compare the observed rates in a test year to compute a safety signal. We specify a set of loss functions that quantify the costs and benefits of each action as a function of the safety signal. We integrate the loss functions over the posterior distribution of the safety signal to obtain the posterior (Bayes) risk; the preferred action has the smallest Bayes risk. Using simulation and an analysis of AMDE data, we compare our minimum-risk decisions to a conventional Z score approach for classifying safety signals. The 2 rules produced different actions for nearly half of hospitals (45%). In the simulation, decisions that minimize Bayes risk outperform Z score-based decisions, even when the loss functions or hierarchical models are misspecified. Our method is sensitive to the choice of loss functions; eliciting quantitative inputs to the loss functions from regulators is challenging. A decision-theoretic approach to acting on safety signals is potentially promising but requires careful specification of loss functions in consultation with subject matter experts.
Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia
2017-08-01
Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Dublineau, I.; Lebrun, F.; Grison, S.; Griffiths, N.M.
2004-01-01
Irradiation of the digestive system leads to alterations of the small intestine. We have characterized the disruption of the barrier integrity in rat ileum from 1 to 14 days following irradiation ranging from 6 to 12 Gy. The intestinal permeability to 14 C-mannitol and 3 H-dextran 70,000 was measured in vitro in Ussing chambers. In parallel to these functional studies, immunohistochemical analyses of junctional proteins (ZO-1 and β-catenin) of ileal epithelium were performed by confocal microscopy. Irradiation with 10 Gy induced a marked decrease in epithelial tissue resistance at three days and a fivefold increase in mannitol permeability, without modifications of dextran permeability. A disorganization of the localization for ZO-1 and β-catenin was also observed. At 7 days after irradiation, we observed a recovery of the organization of junctional proteins in parallel to a return of intestinal permeability to control value. In addition to these time-dependent effects, a gradual effect on epithelial integrity of the radiation doses was observed 3 days after irradiation. This study shows a disruption of the integrity of the intestinal barrier in rat ileum following abdominal X-irradiation, depending on the time postirradiation and on the delivered dose. The loss of barrier integrity was characterized by a disorganization of proteins of tight and adherent junctions, leading to increased intestinal permeability to mannitol. (author)
Peptide regulators of peripheral taste function.
Dotson, Cedrick D; Geraedts, Maartje C P; Munger, Steven D
2013-03-01
The peripheral sensory organ of the gustatory system, the taste bud, contains a heterogeneous collection of sensory cells. These taste cells can differ in the stimuli to which they respond and the receptors and other signaling molecules they employ to transduce and encode those stimuli. This molecular diversity extends to the expression of a varied repertoire of bioactive peptides that appear to play important functional roles in signaling taste information between the taste cells and afferent sensory nerves and/or in processing sensory signals within the taste bud itself. Here, we review studies that examine the expression of bioactive peptides in the taste bud and the impact of those peptides on taste functions. Many of these peptides produced in taste buds are known to affect appetite, satiety or metabolism through their actions in the brain, pancreas and other organs, suggesting a functional link between the gustatory system and the neural and endocrine systems that regulate feeding and nutrient utilization. Copyright © 2013 Elsevier Ltd. All rights reserved.
LRRK2 regulates voltage-gated calcium channel function.
Directory of Open Access Journals (Sweden)
Cade eBedford
2016-05-01
Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how
Zhang, Xun E; Adderley, Shaquria P; Breslin, Jerome W
2016-01-01
Compromised endothelial barrier function is a hallmark of inflammation. Rho family GTPases are critical in regulating endothelial barrier function, yet their precise roles, particularly in sphingosine-1-phosphate (S1P)-induced endothelial barrier enhancement, remain elusive. Confluent cultures of human umbilical vein endothelial cells (HUVEC) or human dermal microvascular endothelial cells (HDMEC) were used to model the endothelial barrier. Barrier function was assessed by determining the transendothelial electrical resistance (TER) using an electrical cell-substrate impedance sensor (ECIS). The roles of Rac1 and RhoA were tested in S1P-induced barrier enhancement. The results show that pharmacologic inhibition of Rac1 with Z62954982 failed to block S1P-induced barrier enhancement. Likewise, expression of a dominant negative form of Rac1, or knockdown of native Rac1 with siRNA, failed to block S1P-induced elevations in TER. In contrast, blockade of RhoA with the combination of the inhibitors Rhosin and Y16 significantly reduced S1P-induced increases in TER. Assessment of RhoA activation in real time using a fluorescence resonance energy transfer (FRET) biosensor showed that S1P increased RhoA activation primarily at the edges of cells, near junctions. This was complemented by myosin light chain-2 phosphorylation at cell edges, and increased F-actin and vinculin near intercellular junctions, which could all be blocked with pharmacologic inhibition of RhoA. The results suggest that S1P causes activation of RhoA at the cell periphery, stimulating local activation of the actin cytoskeleton and focal adhesions, and resulting in endothelial barrier enhancement. S1P-induced Rac1 activation, however, does not appear to have a significant role in this process.
Directory of Open Access Journals (Sweden)
Xun E Zhang
Full Text Available Compromised endothelial barrier function is a hallmark of inflammation. Rho family GTPases are critical in regulating endothelial barrier function, yet their precise roles, particularly in sphingosine-1-phosphate (S1P-induced endothelial barrier enhancement, remain elusive. Confluent cultures of human umbilical vein endothelial cells (HUVEC or human dermal microvascular endothelial cells (HDMEC were used to model the endothelial barrier. Barrier function was assessed by determining the transendothelial electrical resistance (TER using an electrical cell-substrate impedance sensor (ECIS. The roles of Rac1 and RhoA were tested in S1P-induced barrier enhancement. The results show that pharmacologic inhibition of Rac1 with Z62954982 failed to block S1P-induced barrier enhancement. Likewise, expression of a dominant negative form of Rac1, or knockdown of native Rac1 with siRNA, failed to block S1P-induced elevations in TER. In contrast, blockade of RhoA with the combination of the inhibitors Rhosin and Y16 significantly reduced S1P-induced increases in TER. Assessment of RhoA activation in real time using a fluorescence resonance energy transfer (FRET biosensor showed that S1P increased RhoA activation primarily at the edges of cells, near junctions. This was complemented by myosin light chain-2 phosphorylation at cell edges, and increased F-actin and vinculin near intercellular junctions, which could all be blocked with pharmacologic inhibition of RhoA. The results suggest that S1P causes activation of RhoA at the cell periphery, stimulating local activation of the actin cytoskeleton and focal adhesions, and resulting in endothelial barrier enhancement. S1P-induced Rac1 activation, however, does not appear to have a significant role in this process.
International Nuclear Information System (INIS)
Kozulin, E. M.
2009-01-01
The subbarrier fusion enhancement in reactions with heavy ions were explained by taking into account coupling between relative motion and intrinsic degrees of freedom of interacting nuclei. The coupling of reaction channels manifests itself in the potential barrier between interacting nuclei giving rise to a distribution of fusion barrier instead of single barrier.Capture and quasi-elastic scattering excitation functions at backward angles were measured for 3 6S , 4 8C a, 6 4N i+2 38U reactions systems at energies close and below the Coulomb barrier (i.e. when the influence of the shell effects on the fusion and characteristics of the decay of the composite system is considerable). Representations of the barrier distributions were extracted from both capture and quasi-elastic data. The experimental representations of barrier distributions were compared with coupled-channel calculations using CCFULL code. The major part of these experiments has been performed at the U-400 accelerator of the Flerov Laboratory of Nuclear Reactions (JINR, Dubna); at the TANDEM-ALPI accelerator of the LNL (INFN, Legnaro, Italy) and at the Accelerator Laboratory of University of Jyvaeskylae (JYFL, Finland) using a time-of-flight spectrometer of fission fragments CORSET (CORrelation SET-up.) The extraction of the masses and Total Kinetic Energy (TKE) of the binary reaction products is based upon the analysis of the two-body velocity In the case of the fusion-fission and quasi-fission processes, the observed peculiarities of mass and energy distributions of the fragments, the ratio between the fusion-fission and quasi-fission cross sections are determined deformations of interaction nuclei and angular momentum carried in the di-nuclear system and the shell structure of the formed fragments. In this work, the high-precision capture and quasi-elastic scattering excitation function data are presented.The influence of projectile and target excitations and nucleon transfer on fusion barrier
Liu, Ping; Woda, Marcia; Ennis, Francis A.; Libraty, Daniel H.
2013-01-01
Background The morbidity and mortality resulting from dengue hemorrhagic fever (DHF) are largely caused by endothelial barrier dysfunction and a unique vascular leakage syndrome. The mechanisms that lead to the location and timing of vascular leakage in DHF are poorly understood. We hypothesized that direct viral effects on endothelial responsiveness to inflammatory and angiogenesis mediators can explain the DHF vascular leakage syndrome. Methods We used an in vitro model of human endothelium to study the combined effects of dengue virus (DENV) type 2 (DENV2) infection and inflammatory mediators on paracellular macromolecule permeability over time. Results Over the initial 72 h after infection, DENV2 suppressed tumor necrosis factor (TNF)–α–mediated hyperpermeability in human umbilical vein endothelial cell (HUVEC) monolayers. This suppressive effect was mediated by type I interferon (IFN). By 1 week, TNF-α stimulation of DENV2-infected HUVECs synergistically increased cell cycling, angiogenic changes, and macromolecule permeability. This late effect could be prevented by the addition of exogenous type I IFN. Conclusions DENV infection of primary human endothelial cells differentially modulates TNF-α–driven angiogenesis and hyperpermeability over time. Type I IFN plays a central role in this process. Our findings suggest a rational model for the DHF vascular leakage syndrome. PMID:19530939
Emotion regulation in Asperger's syndrome and high-functioning autism.
Samson, Andrea C; Huber, Oswald; Gross, James J
2012-08-01
It is generally thought that individuals with Asperger's syndrome and high-functioning autism (AS/HFA) have deficits in theory of mind. These deficits have been previously linked to problems with social cognition. However, we reasoned that AS/HFA individuals' Theory of Mind deficits also might lead to problems with emotion regulation. To assess emotional functioning in AS/HFA, 27 AS/HFA adults (16 women) and 27 age-, gender-, and education-matched typically developing (TD) participants completed a battery of measures of emotion experience, labeling, and regulation. With respect to emotion experience, individuals with AS/HFA reported higher levels of negative emotions, but similar levels of positive emotions, compared with TD individuals. With respect to emotion labeling, individuals with AS/HFA had greater difficulties identifying and describing their emotions, with approximately two-thirds exceeding the cutoff for alexithymia. With respect to emotion regulation, individuals with AS/HFA used reappraisal less frequently than TD individuals and reported lower levels of reappraisal self-efficacy. Although AS/HFA individuals used suppression more frequently than TD individuals, no difference in suppression self-efficacy was found. It is important to note that these differences in emotion regulation were evident even when controlling for emotion experience and labeling. Implications of these deficits are discussed, and future research directions are proposed.
Abnormal Default System Functioning in Depression: Implications for Emotion Regulation.
Messina, Irene; Bianco, Francesca; Cusinato, Maria; Calvo, Vincenzo; Sambin, Marco
2016-01-01
Depression is widely seen as the result of difficulties in regulating emotions. Based on neuroimaging studies on voluntary emotion regulation, neurobiological models have focused on the concept of cognitive control, considering emotion regulation as a shift toward involving controlled processes associated with activation of the prefrontal and parietal executive areas, instead of responding automatically to emotional stimuli. According to such models, the weaker executive area activation observed in depressed patients is attributable to a lack of cognitive control over negative emotions. Going beyond the concept of cognitive control, psychodynamic models describe the development of individuals' capacity to regulate their emotional states in mother-infant interactions during childhood, through the construction of the representation of the self, others, and relationships. In this mini-review, we link these psychodynamic models with recent findings regarding the abnormal functioning of the default system in depression. Consistently with psychodynamic models, psychological functions associated with the default system include self-related processing, semantic processes, and implicit forms of emotion regulation. The abnormal activation of the default system observed in depression may explain the dysfunctional aspects of emotion regulation typical of the condition, such as an exaggerated negative self-focus and rumination on self-esteem issues. We also discuss the clinical implications of these findings with reference to the therapeutic relationship as a key tool for revisiting impaired or distorted representations of the self and relational objects.
Regulation of immunological and inflammatory functions by biotin.
Kuroishi, Toshinobu
2015-12-01
Biotin is a water-soluble B-complex vitamin and is well-known as a co-factor for 5 indispensable carboxylases. Holocarboxylase synthetase (HLCS) catalyzes the biotinylation of carboxylases and other proteins, whereas biotinidase catalyzes the release of biotin from biotinylated peptides. Previous studies have reported that nutritional biotin deficiency and genetic defects in either HLCS or biotinidase induces cutaneous inflammation and immunological disorders. Since biotin-dependent carboxylases involve various cellular metabolic pathways including gluconeogenesis, fatty acid synthesis, and the metabolism of branched-chain amino acids and odd-chain fatty acids, metabolic abnormalities may play important roles in immunological and inflammatory disorders caused by biotin deficiency. Transcriptional factors, including NF-κB and Sp1/3, are also affected by the status of biotin, indicating that biotin regulates immunological and inflammatory functions independently of biotin-dependent carboxylases. An in-vivo analysis with a murine model revealed the therapeutic effects of biotin supplementation on metal allergies. The novel roles of biotinylated proteins and their related enzymes have recently been reported. Non-carboxylase biotinylated proteins induce chemokine production. HLCS is a nuclear protein involved in epigenetic and chromatin regulation. In this review, comprehensive knowledge on the regulation of immunological and inflammatory functions by biotin and its potential as a therapeutic agent is discussed.
Zivin, Kara; Yosef, Matheos; Levine, Debra S; Abraham, Kristen M; Miller, Erin M; Henry, Jennifer; Nelson, C Beau; Pfeiffer, Paul N; Sripada, Rebecca K; Harrod, Molly; Valenstein, Marcia
2016-03-15
Prior research found lower employment rates among working-aged patients who use the VA than among non-Veterans or Veterans who do not use the VA, with the lowest reported employment rates among VA patients with mental disorders. This study assessed employment status, employment functioning, and barriers to employment among VA patients treated in primary care settings, and examined how depression and anxiety were associated with these outcomes. The sample included 287 VA patients treated in primary care in a large Midwestern VA Medical Center. Bivariate and multivariable analyses were conducted examining associations between socio-demographic and clinical predictors of six employment domains, including: employment status, job search self-efficacy, work performance, concerns about job loss among employed Veterans, and employment barriers and likelihood of job seeking among not employed Veterans. 54% of respondents were employed, 36% were not employed, and 10% were economically inactive. In adjusted analyses, participants with depression or anxiety (43%) were less likely to be employed, had lower job search self-efficacy, had lower levels of work performance, and reported more employment barriers. Depression and anxiety were not associated with perceived likelihood of job loss among employed or likelihood of job seeking among not employed. Single VA primary care clinic; cross-sectional study. Employment rates are low among working-aged VA primary care patients, particularly those with mental health conditions. Offering primary care interventions to patients that address mental health issues, job search self-efficacy, and work performance may be important in improving health, work, and economic outcomes. Published by Elsevier B.V.
Protective barrier development: Overview
International Nuclear Information System (INIS)
Wing, N.R.; Gee, G.W.
1990-01-01
Protective barrier and warning marker systems are being developed to isolate wastes disposed of near the earth's surface at the Hanford Site. The barrier is designed to function in an arid to semiarid climate, to limit infiltration and percolation of water through the waste zone to near-zero, to be maintenance free, and to last up to 10,000 yr. Natural materials (e.g., fine soil, sand, gravel, riprap, clay, asphalt) have been selected to optimize barrier performance and longevity and to create an integrated structure with redundant features. These materials isolate wastes by limiting water drainage; reducing the likelihood of plant, animal, and human intrusion; controlling emission of noxious gases; and minimizing erosion. Westinghouse Hanford Company and Pacific Northwest Laboratory efforts to assess the performance of various barrier and marker designs will be discussed
DMPD: New insights into NF-kappaB regulation and function. [Dynamic Macrophage Pathway CSML Database
Lifescience Database Archive (English)
Full Text Available 18775672 New insights into NF-kappaB regulation and function. Sun SC, Ley SC. Trend...ction. PubmedID 18775672 Title New insights into NF-kappaB regulation and function....s Immunol. 2008 Oct;29(10):469-78. Epub 2008 Sep 3. (.png) (.svg) (.html) (.csml) Show New insights into NF-kappaB regulation and fun
Albertsen, Hans M; Ward, Kenneth
2017-06-01
Endometriosis, defined by the presence of ectopic endometrial lesions, is a common disease in reproductive-age women that profoundly affects patients' quality of life. Various pathogenic models have been proposed, but the origin of endometriosis remains elusive. In this article, we propose that the mesothelial barrier, which protects the underlying stroma from endometrial transplants present in retrograde menstrual fluid, can be compromised by activation of the epithelial to mesenchymal transition (EMT) repair mechanism that lead to temporary loss of barrier integrity. Absent of the mesothelial barrier, endometrial cells can more readily adhere to the underlying peritoneal stroma and establish endometrial lesions. The hypothesis is based on the clinical and experimental observations that correlate the location of endometrial lesions with areas of mesothelial damage, together with genetic evidence that 4 genes associated with endometriosis are direct regulators of the actin-cytoskeleton, which coordinates mesothelial barrier integrity. It supports past observations that implicate the peritoneum in the pathogenesis of endometriosis and unifies previously disparate theories that endometriosis may be triggered by infection, mechanical damage, and inflammation since each of these mechanisms can induce EMT in the mesothelium. If the hypothesis is correct, inhibition of EMT in the mesothelial barrier provides a novel paradigm for the prevention and treatment of endometriosis.
DEFF Research Database (Denmark)
Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana
2006-01-01
most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...
Regulation of Cross-holdings between European Companies
DEFF Research Database (Denmark)
Sørensen, Karsten Engsig
2003-01-01
Cross-holdings can be a barrier to takeovers, and they may have other disadvantages. This article analyses how cross-holdings may be regulated to avoid these negative effects.......Cross-holdings can be a barrier to takeovers, and they may have other disadvantages. This article analyses how cross-holdings may be regulated to avoid these negative effects....
The incremental role of trait emotional intelligence on perceived cervical screening barriers.
Costa, Sebastiano; Barberis, Nadia; Larcan, Rosalba; Cuzzocrea, Francesca
2018-02-13
Researchers have become increasingly interested in investigating the role of the psychological aspects related to the perception of cervical screening barriers. This study investigates the influence of trait EI on perceived cervical screening barriers. Furthermore, this study investigates the incremental validity of trait EI beyond the Big Five, as well as emotion regulation in the perceived barrier towards the Pap test as revealed in a sample of 206 Italian women that were undergoing cervical screening. Results have shown that trait EI is negatively related to cervical screening barriers. Furthermore, trait EI can be considered as a strong incremental predictor of a woman's perception of screening over and above the Big Five, emotion regulation, age, sexual intercourse experience and past Pap test. Detailed information on the study findings and future research directions are discussed.
Vasoinhibins regulate the inner and outer blood-retinal barrier and limit retinal oxidative stress.
Arredondo Zamarripa, David; Díaz-Lezama, Nundehui; Meléndez García, Rodrigo; Chávez Balderas, Jesús; Adán, Norma; Ledesma-Colunga, Maria G; Arnold, Edith; Clapp, Carmen; Thebault, Stéphanie
2014-01-01
Vasoinhibins are prolactin fragments present in the retina, where they have been shown to prevent the hypervasopermeability associated with diabetes. Enhanced bradykinin (BK) production contributes to the increased transport through the blood-retina barrier (BRB) in diabetes. Here, we studied if vasoinhibins regulate BRB permeability by targeting the vascular endothelium and retinal pigment epithelium (RPE) components of this barrier. Intravitreal injection of BK in male rats increased BRB permeability. Vasoinhibins prevented this effect, as did the B2 receptor antagonist Hoe-140. BK induced a transient decrease in mouse retinal and brain capillary endothelial monolayer resistance that was blocked by vasoinhibins. Both vasoinhibins and the nitric oxide (NO) synthase inhibitor L-NAME, but not the antioxidant N-acetyl cysteine (NAC), blocked the transient decrease in bovine umbilical vein endothelial cell (BUVEC) monolayer resistance induced by BK; this block was reversed by the NO donor DETANONOate. Vasoinhibins also prevented the BK-induced actin cytoskeleton redistribution, as did L-NAME. BK transiently decreased human RPE (ARPE-19) cell monolayer resistance, and this effect was blocked by vasoinhibins, L-NAME, and NAC. DETANONOate reverted the blocking effect of vasoinhibins. Similar to BK, the radical initiator Luperox induced a reduction in ARPE-19 cell monolayer resistance, which was prevented by vasoinhibins. These effects on RPE resistance coincided with actin cytoskeleton redistribution. Intravitreal injection of vasoinhibins reduced the levels of reactive oxygen species (ROS) in retinas of streptozotocin-induced diabetic rats, particularly in the RPE and capillary-containing layers. Thus, vasoinhibins reduce BRB permeability by targeting both its main inner and outer components through NO- and ROS-dependent pathways, offering potential treatment strategies against diabetic retinopathies.
Vasoinhibins regulate the inner and outer blood-retinal barrier and limit retinal oxidative stress
Directory of Open Access Journals (Sweden)
David eArredondo Zamarripa
2014-10-01
Full Text Available Vasoinhibins are prolactin fragments present in the retina, where they have been shown to prevent the hypervasopermeability associated with diabetes. Enhanced bradykinin (BK production contributes to the increased transport through the blood-retina barrier (BRB in diabetes. Here, we studied if vasoinhibins regulate BRB permeability by targeting the vascular endothelium and retinal pigment epithelium (RPE components of this barrier. Intravitreal injection of BK in male rats increased BRB permeability. Vasoinhibins prevented this effect, as did the B2 receptor antagonist Hoe-140. BK induced a transient decrease in mouse retinal and brain capillary endothelial monolayer resistance that was blocked by vasoinhibins. Both vasoinhibins and the nitric oxide (NO synthase inhibitor L-NAME, but not the antioxidant N-acetyl cysteine (NAC, blocked the transient decrease in bovine umbilical vein endothelial cell (BUVEC monolayer resistance induced by BK; this block was reversed by the NO donor DETANONOate. Vasoinhibins also prevented the BK-induced actin cytoskeleton redistribution, as did L-NAME. BK transiently decreased human RPE (ARPE-19 cell monolayer resistance, and this effect was blocked by vasoinhibins, L-NAME, and NAC. DETANONOate reverted the blocking effect of vasoinhibins. Similar to BK, the radical initiator Luperox induced a reduction in ARPE-19 cell monolayer resistance, which was prevented by vasoinhibins. These effects on RPE resistance coincided with actin cytoskeleton redistribution. Intravitreal injection of vasoinhibins reduced the levels of reactive oxygen species (ROS in retinas of streptozotocin-induced diabetic rats, particularly in the RPE and capillary-containing layers. Thus, vasoinhibins reduce BRB permeability by targeting both its main inner and outer components through NO- and ROS-dependent pathways, offering potential treatment strategies against diabetic retinopathies.
McPherson, Kerri E; Kerr, Susan; Casey, Beth; Marshall, John
2017-10-01
While Functional Family Therapy (FFT) is known to be effective in addressing adolescent behavioral problems, there has been little exploration of issues relevant to its transport from the tightly controlled setting of clinical trials into routine service delivery. This study sought the views of key stakeholders, clients, and practitioners, on barriers and facilitators to the successful implementation of FFT. Undertaken in a community setting in Scotland, interviews were carried out with 12 adolescents, 14 parents/caregivers, and 6 practitioners. Results focus on: Referral process and pre-intervention contact; Engagement of families; Structure and delivery; Organizational factors. Although barriers to engagement were identified, FFT was viewed as an acceptable, appropriate and feasible intervention with the potential to improve adolescent wellbeing in 'real-world' settings. © 2017 American Association for Marriage and Family Therapy.
Dynamic regulation of NMDAR function in the adult brain by the stress hormone corticosterone
Directory of Open Access Journals (Sweden)
Yiu Chung eTse
2012-03-01
Full Text Available Stress and corticosteroids dynamically modulate the expression of synaptic plasticity at glutamatergic synapses in the developed brain. Together with alpha-amino-3-hydroxy-methyl-4-isoxazole propionic acid receptors (AMPAR, N-methyl-D-aspartate receptors (NMDAR are critical mediators of synaptic function and are essential for the induction of many forms of synaptic plasticity. Regulation of NMDAR function by cortisol/corticosterone (CORT may be fundamental to the effects of stress on synaptic plasticity. Recent reports of the efficacy of NMDAR antagonists in treating certain stress-associated psychopathologies further highlight the importance of understanding the regulation of NMDAR function by CORT. Knowledge of how corticosteroids regulate NMDAR function within the adult brain is relatively sparse, perhaps due to a common belief that NMDAR function is relatively stable in the adult brain. We review recent results from our laboratory and others demonstrating dynamic regulation of NMDAR function by CORT in the adult brain. In addition, we consider the issue of how differences in the early life environment may program differential sensitivity to modulation of NMDAR function by CORT and how this may influence synaptic function during stress. Findings from these studies demonstrate that NMDAR function in the adult hippocampus remains sensitive to even brief exposures to CORT and that the capacity for modulation of NMDAR may be programmed, in part, by the early life environment. Modulation of NMDAR function may contribute to dynamic regulation of synaptic plasticity and adaptation in the face of stress, however enhanced NMDAR function may be implicated in mechanisms of stress related psychopathologies including depression.
An oncological view on the blood-testis barrier
Bart, J; Groen, HJM; van der Graaf, WTA; Hollema, H; Hendrikse, NH; Vaalburg, W; Sleijfer, DT; de Vries, EGE
The function of the blood-testis barrier is to protect germ cells from harmful influences; thus, it also impedes the delivery of chemotherapeutic drugs to the testis. The barrier has three components: first, a physicochemical barrier consisting of continuous capillaries, Sertoli cells in the tubular
Development, regulation, metabolism and function of bone marrow adipose tissues.
Li, Ziru; Hardij, Julie; Bagchi, Devika P; Scheller, Erica L; MacDougald, Ormond A
2018-05-01
Most adipocytes exist in discrete depots throughout the body, notably in well-defined white and brown adipose tissues. However, adipocytes also reside within specialized niches, of which the most abundant is within bone marrow. Whereas bone marrow adipose tissue (BMAT) shares many properties in common with white adipose tissue, the distinct functions of BMAT are reflected by its development, regulation, protein secretion, and lipid composition. In addition to its potential role as a local energy reservoir, BMAT also secretes proteins, including adiponectin, RANK ligand, dipeptidyl peptidase-4, and stem cell factor, which contribute to local marrow niche functions and which may also influence global metabolism. The characteristics of BMAT are also distinct depending on whether marrow adipocytes are contained within yellow or red marrow, as these can be thought of as 'constitutive' and 'regulated', respectively. The rBMAT for instance can be expanded or depleted by myriad factors, including age, nutrition, endocrine status and pharmaceuticals. Herein we review the site specificity, age-related development, regulation and metabolic characteristics of BMAT under various metabolic conditions, including the functional interactions with bone and hematopoietic cells. Copyright © 2018 Elsevier Inc. All rights reserved.
Claudin-11 and occludin are major contributors to Sertoli cell tight junction function, in vitro
Directory of Open Access Journals (Sweden)
Mark J McCabe
2016-01-01
Full Text Available The Sertoli cell tight junction (TJ is the key component of the blood-testis barrier, where it sequesters developing germ cells undergoing spermatogenesis within the seminiferous tubules. Hormonally regulated claudin-11 is a critical transmembrane protein involved in barrier function and its murine knockout results in infertility. We aimed to assess quantitatively the significance of the contribution of claudin-11 to TJ function, in vitro, using siRNA-mediated gene silencing. We also conducted an analysis of the contribution of occludin, another intrinsic transmembrane protein of the TJ. Silencing of claudin-11 and/or occludin was conducted using siRNA in an immature rat Sertoli cell culture model. Transepithelial electrical resistance was used to assess quantitatively TJ function throughout the culture. Two days after siRNA treatment, cells were fixed for immunocytochemical localization of junction proteins or lyzed for RT-PCR assessment of mRNA expression. Silencing of claudin-11, occludin, or both resulted in significant decreases in TJ function of 55% (P < 0.01, 51% (P < 0.01, and 62% (P < 0.01, respectively. Data were concomitant with significant decreases in mRNA expression and marked reductions in the localization of targeted proteins to the Sertoli cell TJ. We provide quantitative evidence that claudin-11 contributes significantly (P < 0.01 to Sertoli cell TJ function in vitro. Interestingly, occludin, which is hormonally regulated but not implicated in infertility until late adulthood, is also a significant (P < 0.01 contributor to barrier function. Our data are consistent with in vivo studies that clearly demonstrate a role for these proteins in maintaining normal TJ barrier structure and function.
Barriers to Business Model Innovation in Swedish Agriculture
Directory of Open Access Journals (Sweden)
Olof Sivertsson
2015-02-01
Full Text Available Swedish agricultural companies, especially small farms, are struggling to be profitable in difficult economic times. It is a challenge for Swedish farmers to compete with imported products on prices. The agricultural industry, however, supports the view that through business model innovation, farms can increase their competitive advantage. This paper identifies and describes some of the barriers Swedish small farms encounter when they consider business model innovation. A qualitative approach is used in the study. Agriculture business consultants were interviewed. In a focus group led by the researchers, farmers discussed business model innovation, including the exogenous and endogenous barriers to such innovation. The paper concludes many barriers exist when farmers consider innovation of agricultural business models. Some barriers are caused by human factors, such as individuals’ attitudes, histories, and traditions. Other barriers are more contextual in nature and relate to a particular industry or company setting. Still other barriers, such as government regulations, value chain position, and weather, are more abstract. All barriers, however, merit attention when Swedish agricultural companies develop new business models.
Hormones and the blood-brain barrier.
Hampl, Richard; Bičíková, Marie; Sosvorová, Lucie
2015-03-01
Hormones exert many actions in the brain, and brain cells are also hormonally active. To reach their targets in brain structures, hormones must overcome the blood-brain barrier (BBB). The BBB is a unique device selecting desired/undesired molecules to reach or leave the brain, and it is composed of endothelial cells forming the brain vasculature. These cells differ from other endothelial cells in their almost impermeable tight junctions and in possessing several membrane structures such as receptors, transporters, and metabolically active molecules, ensuring their selection function. The main ways how compounds pass through the BBB are briefly outlined in this review. The main part concerns the transport of major classes of hormones: steroids, including neurosteroids, thyroid hormones, insulin, and other peptide hormones regulating energy homeostasis, growth hormone, and also various cytokines. Peptide transporters mediating the saturable transport of individual classes of hormones are reviewed. The last paragraph provides examples of how hormones affect the permeability and function of the BBB either at the level of tight junctions or by various transporters.
Tunnelling through a Gaussian random barrier
International Nuclear Information System (INIS)
Bezak, Viktor
2008-01-01
A thorough analysis of the tunnelling of electrons through a laterally inhomogeneous rectangular barrier is presented. The barrier height is defined as a statistically homogeneous Gaussian random function. In order to simplify calculations, we assume that the electron energy is low enough in comparison with the mean value of the barrier height. The randomness of the barrier height is defined vertically by a constant variance and horizontally by a finite correlation length. We present detailed calculations of the angular probability density for the tunnelled electrons (i.e. for the scattering forwards). The tunnelling manifests a remarkably diffusive character if the wavelength of the electrons is comparable with the correlation length of the barrier
YY1 regulates melanocyte development and function by cooperating with MITF.
Directory of Open Access Journals (Sweden)
Juying Li
Full Text Available Studies of coat color mutants have greatly contributed to the discovery of genes that regulate melanocyte development and function. Here, we generated Yy1 conditional knockout mice in the melanocyte-lineage and observed profound melanocyte deficiency and premature gray hair, similar to the loss of melanocytes in human piebaldism and Waardenburg syndrome. Although YY1 is a ubiquitous transcription factor, YY1 interacts with M-MITF, the Waardenburg Syndrome IIA gene and a master transcriptional regulator of melanocytes. YY1 cooperates with M-MITF in regulating the expression of piebaldism gene KIT and multiple additional pigmentation genes. Moreover, ChIP-seq identified genome-wide YY1 targets in the melanocyte lineage. These studies mechanistically link genes implicated in human conditions of melanocyte deficiency and reveal how a ubiquitous factor (YY1 gains lineage-specific functions by co-regulating gene expression with a lineage-restricted factor (M-MITF-a general mechanism which may confer tissue-specific gene expression in multiple lineages.
Diacylglycerol Kinases: Regulated Controllers of T Cell Activation, Function, and Development
Directory of Open Access Journals (Sweden)
Gary A. Koretzky
2013-03-01
Full Text Available Diacylglycerol kinases (DGKs are a diverse family of enzymes that catalyze the conversion of diacylglycerol (DAG, a crucial second messenger of receptor-mediated signaling, to phosphatidic acid (PA. Both DAG and PA are bioactive molecules that regulate a wide set of intracellular signaling proteins involved in innate and adaptive immunity. Clear evidence points to a critical role for DGKs in modulating T cell activation, function, and development. More recently, studies have elucidated factors that control DGK function, suggesting an added complexity to how DGKs act during signaling. This review summarizes the available knowledge of the function and regulation of DGK isoforms in signal transduction with a particular focus on T lymphocytes.
de Vallière, Cheryl; Vidal, Solange; Clay, Ieuan; Jurisic, Giorgia; Tcymbarevich, Irina; Lang, Silvia; Ludwig, Marie-Gabrielle; Okoniewski, Michal; Eloranta, Jyrki J; Kullak-Ublick, Gerd A; Wagner, Carsten A; Rogler, Gerhard; Seuwen, Klaus
2015-09-15
The pH-sensing receptor ovarian cancer G protein-coupled receptor 1 (OGR1; GPR68) is expressed in the gut. Inflammatory bowel disease is typically associated with a decrease in local pH, which may lead to altered epithelial barrier function and subsequent gastrointestinal repair involving epithelial cell adhesion and migration. As the mechanisms underlying the response to pH changes are not well understood, we have investigated OGR1-mediated, pH-dependent signaling pathways in intestinal epithelial cells. Caco-2 cells stably overexpressing OGR1 were created and validated as tools to study OGR1 signaling. Barrier function, migration, and proliferation were measured using electric cell-substrate impedance-sensing technology. Localization of the tight junction proteins zonula occludens protein 1 and occludin and the rearrangement of cytoskeletal actin were examined by confocal microscopy. Paracellular permeability and protein and gene expression analysis using DNA microarrays were performed on filter-grown Caco-2 monolayers. We report that an acidic pH shift from pH 7.8 to 6.6 improved barrier function and stimulated reorganization of filamentous actin with prominent basal stress fiber formation. Cell migration and proliferation during in vitro wound healing were inhibited. Gene expression analysis revealed significant upregulation of genes related to cytoskeleton remodeling, cell adhesion, and growth factor signaling. We conclude that acidic extracellular pH can have a signaling function and impact the physiology of intestinal epithelial cells. The deconstruction of OGR1-dependent signaling may aid our understanding of mucosal inflammation mechanisms. Copyright © 2015 the American Physiological Society.
International Nuclear Information System (INIS)
Ellison, M.D.B.
1985-01-01
The blood-brain barrier (BBB) selectively restricts the blood-to-brain passage of many solutes owing to unique properties of cerebrovascular endothelial cell membranes. To date, experimental study of the BBB has been accomplished primarily through the use of two different methodological approaches. Morphological studies have mostly employed large molecular weight (MW) tracers to detect morphological alterations underlying increased permeability. Physiological studies, employing smaller, more physiologic tracers have successfully described, quantitatively, certain functional aspects of blood-to-brain transfer. The current work attempts to merge these two approaches and to consider barrier function/dysfunction from both a morphological and a functional perspective. Specifically, the study compares in rats, following acute hypertension, the cerebrovascular passage of 14 C-alpha-aminoisobutyric acid (AIB) and that of horseradish peroxidase (HRP). The blood-to-brain passage of AIB and HRP were compared following acute hypertension, with regard to both the distributions of the tracer extravasation patterns and the magnitude of tracer extravasation. The results of this study suggest that traditional morphological barrier studies alone do not reveal all aspects of altered barrier status and that multiple mechanisms underlying increased BBB permeability may operate simultaneously during BBB dysfunction
International Nuclear Information System (INIS)
Baig, M N; Khalid, F A
2014-01-01
Thermal barrier coatings (TBCs) are employed to protect hot section components in industrial and aerospace gas turbine engines. Conventional TBCs frequently fail due to high residual stresses and difference between coefficient of thermal expansion (CTE) of the substrate and coatings. Functionally graded thermal barrier coatings (FG-TBCs) with gradual variation in composition have been proposed to minimize the problem. In this work, a five layered functionally graded thermal barrier coating system was deposited by atmospheric plasma spray (APS) technique on Nimonic 90 substrates using Ni-5Al as bond coat (BC) and magnesia stabilized zirconia as top coat (TC). The coatings were characterized by SEM, EDS, XRD and optical profilometer. Microhardness and coefficient of thermal expansion of the five layers deposited as individual coatings were also measured. The deposited coating system was oxidized at 800°C. SEM analysis showed that five layers were successfully deposited by APS to produce a FG-TBC. The results also showed that roughness (Ra) of the individual layers decreased with an increase in TC content in the coatings. It was found that microhardness and CTE values gradually changed from bond coat to cermet layers to top coat. The oxidized coated sample revealed parabolic behavior and changes in the surface morphology and composition of coating
Jäger, B; Schmid-Ott, G; Ernst, G; Dölle-Lange, E; Sack, M
2012-06-01
The aim of this study was to construct and validate a short self-rating questionnaire for the assessment of ego functions and ability of self regulation. An item pool of 120 items covering 6 postulated dimensions was reduced by two steps in independent samples (n = 136 + 470) via factor and item analyses to the final version consisting of 35 items. The 5 resulting questionnaire scales "interpersonal disturbances", "frustration tolerance and impulse control", "identity disturbances", "affect differentiation and affect tolerance" and "self-esteem" were well interpretable and showed in confirmatory factor analysis the best fit to the data (CHI²/df = 3.48; RMSEA = 0.73). Total scores were found to differentiate well between diagnostic groups of patients with more or less ego pathology (FANOVA = 9.8; df = 11; p self-regulation questionnaire" (HSRQ) evidently is an appropriate and reliable screening instrument in order to assess ego functions and capacities of self regulation in an economic and user-friendly means. The scale structure allows differentiated diagnostics of weak vs. stable ego functions and may be used for detailed therapy planning. © Georg Thieme Verlag KG Stuttgart · New York.
Jiang, Wenqing; Li, Yan; Du, Yasong; Fan, Juan
2016-01-01
Objective This study aims to explore the feature of emotional regulation and executive functions in oppositional defiant disorder (ODD) children. Methods The emotional regulation and executive functions of adolescents with ODD, as well as the relationship between the two factors were analyzed using tools including Adolescent Daily Emotional Regulation Questionnaire (ADERQ), Wisconsin Card Sorting Test (WCST) and Cambridge Neuropsychological Test Automated Battery (CANTAB), in comparison with ...
Safety barriers on oil and gas platforms. Means to prevent hydrocarbon releases
Energy Technology Data Exchange (ETDEWEB)
Sklet, Snorre
2005-12-15
The main objective of the PhD project has been to develop concepts and methods that can be used to define, illustrate, analyse, and improve safety barriers in the operational phase of offshore oil and gas production platforms. The main contributions of this thesis are; Clarification of the term safety barrier with respect to definitions, classification, and relevant attributes for analysis of barrier performance Development and discussion of a representative set of hydrocarbon release scenarios Development and testing of a new method, BORA-Release, for qualitative and quantitative risk analysis of hydrocarbon releases Safety barriers are defined as physical and/or non-physical means planned to prevent, control, or mitigate undesired events or accidents. The means may range from a single technical unit or human actions, to a complex socio-technical system. It is useful to distinguish between barrier functions and barrier systems. Barrier functions describe the purpose of safety barriers or what the safety barriers shall do in order to prevent, control, or mitigate undesired events or accidents. Barrier systems describe how a barrier function is realized or executed. If the barrier system is functioning, the barrier function is performed. If a barrier function is performed successfully, it should have a direct and significant effect on the occurrence and/or consequences of an undesired event or accident. It is recommended to address the following attributes to characterize the performance of safety barriers; a) functionality/effectiveness, b) reliability/ availability, c) response time, d) robustness, and e) triggering event or condition. For some types of barriers, not all the attributes are relevant or necessary in order to describe the barrier performance. The presented hydrocarbon release scenarios include initiating events, barrier functions introduced to prevent hydrocarbon releases, and barrier systems realizing the barrier functions. Both technical and human
Protective barrier systems for final disposal of Hanford Waste Sites
International Nuclear Information System (INIS)
Phillips, S.J.; Hartley, J.N.
1986-01-01
A protecting barrier system is being developed for potential application in the final disposal of defense wastes at the Hanford Site. The functional requirements for the protective barrier are control of water infiltration, wind erosion, and plant and animal intrusion into the waste zone. The barrier must also be able to function without maintenance for the required time period (up to 10,000 yr). This paper summarizes the progress made and future plans in this effort to design and test protective barriers at the Hanford Site
Electron transmission through a periodically driven graphene magnetic barrier
Energy Technology Data Exchange (ETDEWEB)
Biswas, R., E-mail: rbiswas.pkc@gmail.com [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Maiti, S. [Ajodhya Hills G.S.A.T High School, Ajodhya, Purulia, West Bengal – 723152 (India); Mukhopadhyay, S. [Purulia Zilla School, Dulmi Nadiha, Purulia, West Bengal – 723102 (India); Sinha, C. [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Department of Theoretical Physics, Indian Association for the Cultivation of Science, Jadavpur – 700032 (India)
2017-05-10
Electronic transport through graphene magnetic barriers is studied theoretically in presence of an external time harmonic scalar potential in the framework of non-perturbative Landau–Floquet Formalism. The oscillating field mostly suppresses the transmission for rectangular magnetic barrier structure and exhibits the Fano resonance for multiphoton processes due to the presence of bound state inside the barrier. While, for a pair of delta function barriers of larger separation, the oscillating potential suppresses the usual Fabry–Perot oscillations in the transmission and a new type of asymmetric Fano resonance is noted for smaller separation, occurring due to extended states between the barriers. - Highlights: • Tunnelling of the Dirac Fermions through oscillating pure magnetic barriers is reported for the first time. • The high energy transmission through a graphene magnetic barrier is suppressed by the application of time periodic modulation. • Suppression of the Fabry Perot transmission is noted due to the application of an external time harmonic potential. • Two kinds of the Fano resonances are noted in transmission through a pair of modulated δ-function magnetic barriers.
Universal potential-barrier penetration by initially confined wave packets
International Nuclear Information System (INIS)
Granot, Er'el; Marchewka, Avi
2007-01-01
The dynamics of an initially sharp-boundary wave packet in the presence of an arbitrary potential barrier is investigated. It is shown that the penetration through the barrier is universal in the sense that it depends only on the values of the wave function and its derivatives at the boundary. The dependence on the derivatives vanishes at long distances from the barrier, where the dynamics is governed solely by the initial value of the wave function at the boundary
Universal potential-barrier penetration by initially confined wave packets
Granot, Er'El; Marchewka, Avi
2007-07-01
The dynamics of an initially sharp-boundary wave packet in the presence of an arbitrary potential barrier is investigated. It is shown that the penetration through the barrier is universal in the sense that it depends only on the values of the wave function and its derivatives at the boundary. The dependence on the derivatives vanishes at long distances from the barrier, where the dynamics is governed solely by the initial value of the wave function at the boundary.
Overcoming natural replication barriers: differential helicase requirements.
Anand, Ranjith P; Shah, Kartik A; Niu, Hengyao; Sung, Patrick; Mirkin, Sergei M; Freudenreich, Catherine H
2012-02-01
DNA sequences that form secondary structures or bind protein complexes are known barriers to replication and potential inducers of genome instability. In order to determine which helicases facilitate DNA replication across these barriers, we analyzed fork progression through them in wild-type and mutant yeast cells, using 2-dimensional gel-electrophoretic analysis of the replication intermediates. We show that the Srs2 protein facilitates replication of hairpin-forming CGG/CCG repeats and prevents chromosome fragility at the repeat, whereas it does not affect replication of G-quadruplex forming sequences or a protein-bound repeat. Srs2 helicase activity is required for hairpin unwinding and fork progression. Also, the PCNA binding domain of Srs2 is required for its in vivo role of replication through hairpins. In contrast, the absence of Sgs1 or Pif1 helicases did not inhibit replication through structural barriers, though Pif1 did facilitate replication of a telomeric protein barrier. Interestingly, replication through a protein barrier but not a DNA structure barrier was modulated by nucleotide pool levels, illuminating a different mechanism by which cells can regulate fork progression through protein-mediated stall sites. Our analyses reveal fundamental differences in the replication of DNA structural versus protein barriers, with Srs2 helicase activity exclusively required for fork progression through hairpin structures.
Follmer, D. Jake; Sperling, Rayne A.
2016-01-01
Background: Researchers have demonstrated significant relations among executive function, metacognition, and self-regulated learning. However, prior research emphasized the use of indirect measures of executive function and did not evaluate how specific executive functions are related to participants' self-regulated learning. Aims: The primary…
The role of plants on isolation barrier systems
International Nuclear Information System (INIS)
Link, S.O.; Downs, J.L.; Waugh, W.J.
1994-11-01
Surface barriers are used to isolate buried wastes from the environment. Most have been built for short-term isolation. The need to isolate radioactive wastes from the environment requires that the functional integrity of a barrier be maintained for thousands of years. Barrier function strongly depends on vegetation. Plants reduce wind and water erosion and minimize drainage, but may transport contaminants if roots extend into buried wastes. Our review of the function of plants on surface barriers focuses on the role of plants across mesic to arid environments and gives special consideration to studies done at Hanford. The Hanford Barrier Development Program was created to design and test an earthen cover system to inhibit water infiltration, plant and animal intrusion, and wind and water erosion, while isolating buried wastes for at least 1000 years. Studies at the Hanford have shown that plants will significantly interact with the barrier. Plants transpire soil water back into the atmosphere. Deep-rooted perennials best recycle water; soil water may drain through the root zone of shallow-rooted annuals. Lysimeter studies indicate that a surface layer of fine soil with deep-rooted plants precludes drainage even with three times normal precipitation. The presence of vegetation greatly reduces water and wind erosion, but deep-rooted plants pose a threat of biointrusion and contaminant transport. The Hanford barrier includes a buried rock layer and asphalt layer to prevent biointrusion
Intestinal epithelial barrier function and tight junction proteins with heat and exercise
DEFF Research Database (Denmark)
Dokladny, Karol; Zuhl, Micah N; Moseley, Pope L
2016-01-01
A single layer of enterocytes and tight junctions (intercellular multiprotein complexes) form the intestinal epithelial barrier that controls transport of molecules through transcellular and paracellular pathways. A dysfunctional or "leaky" intestinal tight junction barrier allows augmented perme...
DEFF Research Database (Denmark)
Gomes, Maria João; Kennedy, Patrick J; Martins, Susana
2017-01-01
AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...
Zhang, Hai-Tao; Zhang, Ping; Gao, Yi; Li, Chen-Long; Wang, Hong-Jun; Chen, Ling-Chao; Feng, Yan; Li, Rui-Yan; Li, Yong-Li; Jiang, Chuan-Lu
2017-01-01
Vascular endothelial growth factor (VEGF) inhibition has been demonstrated to be an effective strategy in preserving the integrity of the blood-brain barrier (BBB) in patients with acute ischemic stroke. Loss of the BBB is the key event associated with morbidity and mortality in these patients. However, the underlying mechanisms remain poorly understood. In the present study, the effects of VEGF inhibition and the possible mechanism that underlies acute cerebral ischemia in rats was investigated. Following the induction of transient middle cerebral artery occlusion for a 90‑min period, either an anti‑VEGF neutralizing antibody (RB‑222; 5 or 10 µg), or IgG (control), was administered by intracerebroventricular injection at 1 h following reperfusion. Functional outcomes, BBB leakage, brain edema, microvessel numbers and the relative protein levels of VEGF, matrix metalloproteinase (MMP)-2, MMP-9, occludin and collagen-IV were then determined using neurological assessments, Evans Blue staining, brain water content, CD31 staining and western blotting. Treatment with RB‑222 at a dose of 5 and 10 µg significantly improved neurological functional outcomes and diminished infarct size, BBB leakage and brain edema compared with the MCAO and IgG groups at 24 h following reperfusion; 10 µg RB‑222 was more effective than a 5 µg dose of the antibody. In addition, RB‑222 reduced the number of immature microvessels, which subsequently attenuated BBB permeability. RB‑222 significantly repressed VEGF expression as well as decreased MMP‑2 and MMP‑9 expression. However, it enhanced occludin and collagen‑IV levels in the ischemic rat brain compared with the MCAO and IgG groups. Taken together, the results indicate that early inhibition of VEGF may have significant potential against cerebral ischemia, partly by regulating the expression of MMPs.
Visser, J. T. J.; Lammers, K.; Hoogendijk, A.; Boer, M. W.; Brugman, S.; Beijer-Liefers, S.; Zandvoort, A.; Harmsen, H.; Welling, G.; Stellaard, F.; Bos, N. A.; Fasano, A.; Rozing, J.
2010-01-01
Aims/hypothesis Impaired intestinal barrier function is observed in type I diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading
Boels, D.; Beest, te H.; Zweers, H.; Groeneveld, P.
2003-01-01
Trisoplastr is a mixture of sand, bentonite and a polymer, used amongst others as landfill cover as well as barriers. Its permeability is generally lower than 1-2 x 10-11 m/s. Trisoplast keeps its functionality even in contact with different kinds of liquids, is not susceptible to cyclic drying and
Kwon, Kyongboon; Hanrahan, Amanda R.; Kupzyk, Kevin A.
2017-01-01
We examined emotional expressivity (i.e., happiness, sadness, and anger) and emotion regulation (regulation of exuberance, sadness, and anger) as they relate to academic functioning (motivation, engagement, and achievement). Also, we tested the premise that emotional expressivity and emotion regulation are indirectly associated with achievement…
Functional analysis of PGRP-LA in Drosophila immunity.
Directory of Open Access Journals (Sweden)
Mathilde Gendrin
Full Text Available PeptidoGlycan Recognition Proteins (PGRPs are key regulators of the insect innate antibacterial response. Even if they have been intensively studied, some of them have yet unknown functions. Here, we present a functional analysis of PGRP-LA, an as yet uncharacterized Drosophila PGRP. The PGRP-LA gene is located in cluster with PGRP-LC and PGRP-LF, which encode a receptor and a negative regulator of the Imd pathway, respectively. Structure predictions indicate that PGRP-LA would not bind to peptidoglycan, pointing to a regulatory role of this PGRP. PGRP-LA expression was enriched in barrier epithelia, but low in the fat body. Use of a newly generated PGRP-LA deficient mutant indicates that PGRP-LA is not required for the production of antimicrobial peptides by the fat body in response to a systemic infection. Focusing on the respiratory tract, where PGRP-LA is strongly expressed, we conducted a genome-wide microarray analysis of the tracheal immune response of wild-type, Relish, and PGRP-LA mutant larvae. Comparing our data to previous microarray studies, we report that a majority of genes regulated in the trachea upon infection differ from those induced in the gut or the fat body. Importantly, antimicrobial peptide gene expression was reduced in the tracheae of larvae and in the adult gut of PGRP-LA-deficient Drosophila upon oral bacterial infection. Together, our results suggest that PGRP-LA positively regulates the Imd pathway in barrier epithelia.
Structure information from fusion barriers
Indian Academy of Sciences (India)
Pb, using the coupled reaction channel (CRC) method and correct structure information, have been analysed. The barrier distributions derived from these excitation functions including many of the significant channels are featureless, although these channels have considerable effects on the fusion excitation function.
Fingolimod promotes blood-nerve barrier properties in vitro.
Nishihara, Hideaki; Maeda, Toshihiko; Sano, Yasuteru; Ueno, Maho; Okamoto, Nana; Takeshita, Yukio; Shimizu, Fumitaka; Koga, Michiaki; Kanda, Takashi
2018-04-01
The main effect of fingolimod is thought to be functional antagonism of lymphocytic S1P1 receptors and the prevention of lymphocyte egress from lymphoid tissues, thereby reducing lymphocyte infiltration into the nervous system. However, a growing number of reports suggest that fingolimod also has a direct effect on several cell types in the nervous system. Although we previously reported that fingolimod enhances blood-brain barrier (BBB) functions, there have been no investigations regarding the blood-nerve barrier (BNB). In this study, we examine how fingolimod affects the BNB. An immortalized human peripheral nerve microvascular endothelial cell line (HPnMEC) was used to evaluate BNB barrier properties. We examined tight junction proteins and barrier functions of HPnMECs in conditioned medium with or without fingolimod-phosphate and blood sera from patients with typical chronic inflammatory demyelinating polyneuropathy (CIDP). Incubation with fingolimod-phosphate increased levels of claudin-5 mRNA and protein as well as TEER values in HPnMECs. Conversely, typical CIDP sera decreased claudin-5 mRNA/protein levels and TEER values in HPnMECs; however, pretreatment with fingolimod-phosphate inhibited the effects of the typical CIDP sera. Fingolimod-phosphate directly modifies the BNB and enhances barrier properties. This mechanism may be a viable therapeutic target for CIDP, and fingolimod may be useful in patients with typical CIDP who have severe barrier disruption.
Conserved properties of Drosophila Insomniac link sleep regulation and synaptic function.
Li, Qiuling; Kellner, David A; Hatch, Hayden A M; Yumita, Tomohiro; Sanchez, Sandrine; Machold, Robert P; Frank, C Andrew; Stavropoulos, Nicholas
2017-05-01
Sleep is an ancient animal behavior that is regulated similarly in species ranging from flies to humans. Various genes that regulate sleep have been identified in invertebrates, but whether the functions of these genes are conserved in mammals remains poorly explored. Drosophila insomniac (inc) mutants exhibit severely shortened and fragmented sleep. Inc protein physically associates with the Cullin-3 (Cul3) ubiquitin ligase, and neuronal depletion of Inc or Cul3 strongly curtails sleep, suggesting that Inc is a Cul3 adaptor that directs the ubiquitination of neuronal substrates that impact sleep. Three proteins similar to Inc exist in vertebrates-KCTD2, KCTD5, and KCTD17-but are uncharacterized within the nervous system and their functional conservation with Inc has not been addressed. Here we show that Inc and its mouse orthologs exhibit striking biochemical and functional interchangeability within Cul3 complexes. Remarkably, KCTD2 and KCTD5 restore sleep to inc mutants, indicating that they can substitute for Inc in vivo and engage its neuronal targets relevant to sleep. Inc and its orthologs localize similarly within fly and mammalian neurons and can traffic to synapses, suggesting that their substrates may include synaptic proteins. Consistent with such a mechanism, inc mutants exhibit defects in synaptic structure and physiology, indicating that Inc is essential for both sleep and synaptic function. Our findings reveal that molecular functions of Inc are conserved through ~600 million years of evolution and support the hypothesis that Inc and its orthologs participate in an evolutionarily conserved ubiquitination pathway that links synaptic function and sleep regulation.
X-linked inhibitor of apoptosis regulates T cell effector function
DEFF Research Database (Denmark)
Zehntner, Simone P; Bourbonnière, Lyne; Moore, Craig S
2007-01-01
To understand how the balance between pro- and anti-apoptotic signals influences effector function in the immune system, we studied the X-linked inhibitor of apoptosis (XIAP), an endogenous regulator of cellular apoptosis. Real-time PCR showed increased XIAP expression in blood of mice with exper......To understand how the balance between pro- and anti-apoptotic signals influences effector function in the immune system, we studied the X-linked inhibitor of apoptosis (XIAP), an endogenous regulator of cellular apoptosis. Real-time PCR showed increased XIAP expression in blood of mice...... dramatically reduced within the CNS. Flow cytometry showed an 88-93% reduction in T cells. The proportion of TUNEL(+) apoptotic CD4(+) T cells in the CNS was increased from Neurons...... and oligodendrocytes were not affected; neither did apoptosis increase in liver, where XIAP knockdown also occurred. ASO-XIAP increased susceptibility of T cells to activation-induced apoptosis in vitro. Our results identify XIAP as a critical controller of apoptotic susceptibility of effector T cell function...
Tan, Suiyi; Duan, Heng; Xun, Tianrong; Ci, Wei; Qiu, Jiayin; Yu, Fei; Zhao, Xuyan; Wu, Linxuan; Li, Lin; Lu, Lu; Jiang, Shibo; Liu, Shuwen
2014-07-01
The breakdown of human retinal pigment epithelial (HRPE) barrier is considered as the etiology of retinopathy, which affects the quality of life of HIV/AIDS patients. Here we demonstrate that HIV-1 could directly impair HRPE barrier function, which leads to the translocation of HIV-1 and bacteria. HRPE cells (D407) were grown to form polarized, confluent monolayers and treated with different HIV-1 infectious clones. A significant increase of monolayer permeability, as measured by trans-epithelial electrical resistance (TEER) and apical-basolateral movements of sodium fluorescein, was observed. Disrupted tightness of HRPE barrier was associated with the downregulation of several tight junction proteins in D407 cells, including ZO-1, Occludin, Claudin-1, Claudin-2, Claudin-3, Claudin-4, and Claudin-5, after exposure to HIV-1, without affecting the viability of cells. HIV-1 gp120 was shown to participate in the alteration of barrier properties, as evidenced by decreased TEER and weakened expression of tight junction proteins in D407 monolayers after exposure to pseudotyped HIV-1, UV-inactivated HIV-1, and free gp120, but not to an envelope (Env)-defective mutant of HIV. Furthermore, exposure to HIV-1 particles could induce the release of pro-inflammatory cytokines in D407, including IL-6 and MCP-1, both of which downregulated the expression of ZO-1 in the HRPE barrier. Disrupted HRPE monolayer allowed translocation of HIV-1 and bacteria across the epithelium. Overall, these findings suggest that HIV-1 may exploit its Env glycoprotein to induce an inflammatory state in HRPE cells, which could result in impairment of HRPE monolayer integrity, allowing virus and bacteria existing in ocular fluids to cross the epithelium and penetrate the HRPE barrier. Our study highlights the role of HIV-1 in the pathogenesis of HIV/AIDS-related retinopathy and suggests potential therapeutic targets for this ocular complication.
Structure and function of the cystic fibrosis transmembrane conductance regulator
Directory of Open Access Journals (Sweden)
M.M. Morales
1999-08-01
Full Text Available Cystic fibrosis (CF is a lethal autosomal recessive genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR. Mutations in the CFTR gene may result in a defective processing of its protein and alter the function and regulation of this channel. Mutations are associated with different symptoms, including pancreatic insufficiency, bile duct obstruction, infertility in males, high sweat Cl-, intestinal obstruction, nasal polyp formation, chronic sinusitis, mucus dehydration, and chronic Pseudomonas aeruginosa and Staphylococcus aureus lung infection, responsible for 90% of the mortality of CF patients. The gene responsible for the cellular defect in CF was cloned in 1989 and its protein product CFTR is activated by an increase of intracellular cAMP. The CFTR contains two membrane domains, each with six transmembrane domain segments, two nucleotide-binding domains (NBDs, and a cytoplasmic domain. In this review we discuss the studies that have correlated the role of each CFTR domain in the protein function as a chloride channel and as a regulator of the outwardly rectifying Cl- channels (ORCCs.
The Blood-Brain Barrier: An Engineering Perspective
Directory of Open Access Journals (Sweden)
Andrew eWong
2013-08-01
Full Text Available It has been more than 100 years since Paul Ehrlich reported that various water-soluble dyes injected into the circulation did not enter the brain. Since Ehrlich’s first experiments, only a small number of molecules, such as alcohol and caffeine have been found to cross the blood-brain barrier, and it remains the major roadblock to treatment of many central nervous system diseases. At the same time, many central nervous system diseases are associated with disruption of the blood-brain barrier that can lead to changes in permeability, modulation of immune cell transport, and trafficking of pathogens into the brain. Therefore advances in our understanding of the structure and function of the blood-brain barrier are key to advances in treatment of a wide range of central nervous system diseases. Over the past 10 years it has become recognized that the blood-brain barrier is a complex dynamic system that involves biomechanical and biochemical signaling between the vascular system and the brain. Here we reconstruct the structure, function, and transport properties of the blood-brain barrier from an engineering perspective. New insight into the physics of the blood-brain barrier could ultimately lead to clinical advances in the treatment of central nervous system diseases.
Haskett, Mary E.; Stelter, Rebecca; Proffit, Katie; Nice, Rachel
2012-01-01
Objective Identifying factors associated with school functioning of abused children is important in prevention of long-term negative outcomes associated with school failure. The purpose of this study was to examine the degree to which parent emotional expressiveness and children's self-regulation predicted early school behavior of abused children. Methods The sample included 92 physically abused children ages 4-7 and one of their parents (95.7% mothers). Parents completed a measure of their own emotional expressiveness, and parents and teachers provided reports of children's self-regulatory skills. Children's school functioning was measured by observations of playground aggression and teacher reports of aggression and classroom behavior. Results Parents’ expression of positive and negative emotions was associated with various aspects of children's self-regulation and functioning in the school setting. Links between self-regulation and children's school adjustment were robust; poor self-regulation was associated with higher aggression and lower cooperation and self-directed behavior in the classroom. There was minimal support for a mediating role of children's self-regulation in links between parent expressiveness and children's behavior. Practice implications Findings point to the relevance of parent emotional expressivity and children's self-regulatory processes in understanding physically abused children's functioning at the transition to school. Although further research is needed, findings indicate that increasing parental expression of positive emotion should be a focus in treatment along with reduction in negativity of abusive parents. Further, addressing children's self-regulation could be important in efforts to reduce aggression and enhance children's classroom competence. PMID:22565040
Safety barriers to prevent release of hydrocarbons during production of oil and gas
Sklet, Snorre; Hauge, Stein
2004-01-01
This report documents a set of scenarios related to release of hydrocarbons during production on oil and gas platforms. For each release scenario, initiating events, barrier functions aimed to prevent loss of containment, and barrier systems that realize these barrier functions are identified and described. Safety barriers to prevent release of hydrocarbons during production of oil and gas
Becerra, Rodrigo; Cruise, Kate; Harms, Craig; Allan, Alfred; Bassett, Darryl; Hood, Sean; Murray, Greg
2015-01-01
This study explores the predictive value of various clinical, neuropsychological, functional, and emotion regulation processes for recovery in Bipolar Disorder. Clinical and demographic information was collected for 27 euthymic or residually depressed BD participants. Seventy one percent of the sample reported some degree of impairment in psychosocial functioning. Both residual depression and problems with emotion regulation were identified as significant predictors of poor psychosocial funct...
Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de
2005-01-01
The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of
The Effects of Fire on the Function of the 200-BP-1 Engineered Surface Barrier
Energy Technology Data Exchange (ETDEWEB)
Ward, Anderson L.; Link, Steven O.; Hasan, Nazmul; Draper, Kathryn E.
2009-09-01
A critical unknown in use of barrier technology for long-term waste isolation is performance after a major disturbance especially when institutional controls are intact, but there are no resources to implement corrective actions. The objective of this study was to quantify the effects of wild fire on alterations the function of an engineered barrier. A controlled burn September 26, 2008 was used to remove all the vegetation from the north side of the barrier. Flame heights exceeded 9 m and temperatures ranged from 250 oC at 1.5 cm below the surface to over 700 oC at 1 m above the surface. Post-fire analysis of soil properties show significant decreases in wettability, hydraulic conductivity, air entry pressure, organic matter, and porosity relative to pre-fire conditions whereas dry bulk density increased. Decreases in hydraulic conductivity and wettabilty immediately after the fire are implicated in a surface runoff event that occurred in January 2009, the first in 13 years. There was a significant increase in macro-nutrients, pH, and electrical conductivity. After one year, hydrophobicity has returned to pre-burn levels with only 16% of samples still showing signs of decreased wettability. Over the same period, hydraulic conductivity and air entry pressure returned to pre-burn levels at one third of the locations but remained identical to values recorded immediately after the fire at the other two thirds. Soil nutrients, pH, and electrical conductivity remain elevated after 1 year. Species composition on the burned surface changed markedly from prior years and relative to the unburned surface and two analog sites. An increase in the proportion of annuals and biennials is characteristic of burned surfaces that have become dominated by ruderal species. Greenhouse seedling emergence tests conducted to assess the seed bank of pre- and post-burn soils and of two analog sites at the McGee Ranch show no difference in the number of species emerging from soils collected
Tight junction proteins contribute to barrier properties in human pleura.
Markov, Alexander G; Voronkova, Maria A; Volgin, George N; Yablonsky, Piotr K; Fromm, Michael; Amasheh, Salah
2011-03-15
The permeability of pleural mesothelium helps to control the volume and composition of the liquid lubricating pleural surfaces. Information on pleural barrier function in health and disease, however, is scarce. Tissue specimens of human pleura were mounted in Ussing chambers for measurement of transmesothelial resistance. Expression of tight junction (TJ) proteins was studied by Western blots and immune fluorescence confocal microscopy. Both visceral and parietal pleura showed barrier properties represented by transmesothelial resistance. Occludin, claudin-1, -3, -5, and -7, were detected in visceral pleura. In parietal pleura, the same TJ proteins were detected, except claudin-7. In tissues from patients with pleural inflammation these tightening claudins were decreased and in visceral pleura claudin-2, a paracellular channel former, became apparent. We report that barrier function in human pleura coincides with expression of claudins known to be key determinants of epithelial barrier properties. In inflamed tissue, claudin expression indicates a reduced barrier function. Copyright © 2010 Elsevier B.V. All rights reserved.
Crandall, AliceAnn; Ghazarian, Sharon R; Day, Randal D; Riley, Anne W
2016-11-01
Prior research links poor maternal emotion regulation to maladaptive parenting and child behaviors, but little research is available on these relationships during the adolescent period. We use structural equation modeling to assess the influence of poor maternal emotion regulation, measured as emotional reactivity and distancing, on adolescent behaviors (measured as aggression and prosocial behaviors) among 478 adolescents (53 % female; baseline age 10-13 years) and their mothers over a 5 year period. We also tested the possible mediating roles of family functioning and parenting behaviors between maternal emotion regulation and adolescent behaviors. Results indicated that higher baseline maternal emotional distancing and reactivity were not directly predictive of adolescents' behaviors, but they were indirectly related through family functioning and parenting. Specifically, indulgent parenting mediated the relationship between maternal emotional reactivity and adolescent aggression. Maternal-reported family functioning significantly mediated the relationship between maternal emotional distancing and adolescent aggression. Family functioning also mediated the relationship between emotional distancing and regulation parenting. The results imply that poor maternal emotion regulation during their child's early adolescence leads to more maladaptive parenting and problematic behaviors during the later adolescent period. However, healthy family processes may ameliorate the negative impact of low maternal emotion regulation on parenting and adolescent behavioral outcomes. The implications for future research and interventions to improve parenting and adolescent outcomes are discussed.
Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.
Directory of Open Access Journals (Sweden)
Xinxin Liu
Full Text Available Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3 expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001. Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (p<0.05 and a reduction in transepithelial electrical resistance (TEER by 180.0% (p<0.001. While the expression of tight junctional protein did not change in acrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (p<0.05. Taken together, these data provide evidence that acute acrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.
Levels of physical activity, motivation and barriers to participation in university students.
Sevil, Javier; Práxedes, Alba; Abarca-Sos, Alberto; Del Villar, Fernando; García-González, Luis
2016-10-01
Grounded in self-determination theory and trans-theoretical model applied to exercise, the aim of this study was to analyse the existing relationships between physical activity (PA) carried out by university students, perceived barriers to PA, motivation to PA and stages of change. 901 Spanish students took part in the study (408 men, 493 women; mean age 22.59±3.59), who completed the Behavioural Regulation in Exercise Questionnaire (BREQ-3), Scale of Barriers to PA, Stages of Change and the International Physical Activity Questionnaire - Short Form (IPAQ-SF). Noteworthy among the findings is the positive relationship between the more autonomous regulation forms, especially integrated regulation, and the moderate to vigorous PA (MVPA) levels. However, barriers to participatrion are negatively related to PA levels and the more self-determined forms of motivation. Finally, students in action and maintenance stages, and those who comply with the recommendations on PA present higher values in the more self-determined motivation forms and lower values in barriers to participation in PA. The study shows the importance of addressing the analysis of variables associated with engagement in PA in the university population to develop healthy policies and intervention programmes that can establish a series of healthy and more active habits in the youth-adult stage. The appropriateness of promoting more self-determined motivation forms is highlighted, especially integrated regulation, to have an impact on higher levels of MVPA.
Intestinal barrier integrity and inflammatory bowel disease
DEFF Research Database (Denmark)
Holmberg, Fredrik Eric Olof; Pedersen, Jannie; Jørgensen, Peter
2018-01-01
Disruption of normal barrier function is a fundamental factor in the pathogenesis of inflammatory bowel disease, which includes increased epithelial cell death, modified mucus configuration, altered expression and distribution of tight junction-proteins, along with a decreased expression of antim......Disruption of normal barrier function is a fundamental factor in the pathogenesis of inflammatory bowel disease, which includes increased epithelial cell death, modified mucus configuration, altered expression and distribution of tight junction-proteins, along with a decreased expression...... of antimicrobial peptides. Inflammatory bowel disease is associated with life-long morbidity for affected patients, and both the incidence and prevalence is increasing globally, resulting in substantial economic strain for society. Mucosal healing and re-establishment of barrier integrity is associated......, novel treatment strategies to accomplish mucosal healing and to re-establish normal barrier integrity in inflammatory bowel disease are warranted, and luminal stem cell-based approaches might have an intriguing potential. Transplantation of in vitro expanded intestinal epithelial stem cells derived...
Implementation status and barriers of good manufacturing practice ...
African Journals Online (AJOL)
Removal of implementation barriers could be considered, including strengthening personnel competence, improving the quality management system and enhancing the international communication with advanced GMP regulators. Keywords: good manufacturing practice, GMP, Chinese patent medicine, traditional Chinese ...
Directory of Open Access Journals (Sweden)
Raúl E. Cian
2015-08-01
Full Text Available Based on their composition, marine algae, and namely red seaweeds, are good potential functional foods. Intestinal mucosal barrier function refers to the capacity of the intestine to provide adequate containment of luminal microorganisms and molecules. Here, we will first outline the component of seaweeds and will summarize the effects of these on the regulation of mucosal barrier function. Special attention will be paid to unique components of red seaweeds: proteins and derived peptides (e.g., phycobiliproteins, glycoproteins that contain “cellulose binding domains”, phycolectins and the related mycosporine-like amino acids together with polysaccharides (e.g., floridean starch and sulfated galactans, such as carrageenans, agarans and “dl-hybrid” and minerals. These compounds have been shown to exert prebiotic effects, to regulate intestinal epithelial cell, macrophage and lymphocyte proliferation and differentiation and to modulate the immune response. Molecular mechanisms of action of peptides and polysaccharides are starting to be elucidated, and evidence indicating the involvement of epidermal growth factor receptor (EGFR, insulin-like growth factor receptor (IGFR, Toll-like receptors (TLR and signal transduction pathways mediated by protein kinase B (PKB or AKT, nuclear factor-κB (NF-κB and mitogen activated protein kinases (MAPK will also be summarized. The need for further research is clear, but in vivo experiments point to an overall antiinflammatory effect of these algae, indicating that they can reinforce membrane barrier function.
Directory of Open Access Journals (Sweden)
Adam J. Moeser
2017-12-01
Full Text Available The gastrointestinal (GI barrier serves a critical role in survival and overall health of animals and humans. Several layers of barrier defense mechanisms are provided by the epithelial, immune and enteric nervous systems. Together they act in concert to control normal gut functions (e.g., digestion, absorption, secretion, immunity, etc. whereas at the same time provide a barrier from the hostile conditions in the luminal environment. Breakdown of these critical GI functions is a central pathophysiological mechanism in the most serious GI disorders in pigs. This review will focus on the development and functional properties of the GI barrier in pigs and how common early life production stressors, such as weaning, can alter immediate and long-term barrier function and disease susceptibility. Specific stress-related pathophysiological mechanisms responsible for driving GI barrier dysfunction induced by weaning and the implications to animal health and performance will be discussed.
Floating convection barrier for evaporation source
International Nuclear Information System (INIS)
1975-01-01
A floating matrix of titanium in an uranium evaporation source, melted by an electron beam, serves as a barrier for preventing cooler material from reaching the evaporation area. This construction allows a big volume of melted uranium to be present and new uranium to be furnished in regulated intervals without manual intervention
Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.
2008-01-01
Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...
Insulin Action in Brain Regulates Systemic Metabolism and Brain Function
Kleinridders, Andr?; Ferris, Heather A.; Cai, Weikang; Kahn, C. Ronald
2014-01-01
Insulin receptors, as well as IGF-1 receptors and their postreceptor signaling partners, are distributed throughout the brain. Insulin acts on these receptors to modulate peripheral metabolism, including regulation of appetite, reproductive function, body temperature, white fat mass, hepatic glucose output, and response to hypoglycemia. Insulin signaling also modulates neurotransmitter channel activity, brain cholesterol synthesis, and mitochondrial function. Disruption of insulin action in t...
International Nuclear Information System (INIS)
Cheng, Jian; Zhang, Lin; Dai, Weiqi; Mao, Yuqing; Li, Sainan; Wang, Jingjie; Li, Huanqing; Guo, Chuanyong; Fan, Xiaoming
2015-01-01
Aim: This study aimed to investigate the effect and underlying mechanism of ghrelin on intestinal barrier dysfunction in dextran sulfate sodium (DSS)-induced colitis. Methods and results: Acute colitis was induced in C57BL/6J mice by administering 2.5% DSS. Saline or 25, 125, 250 μg/kg ghrelin was administrated intraperitoneally (IP) to mice 1 day before colitis induction and on days 4, 5, and 6 after DSS administration. IP injection of a ghrelin receptor antagonist, [D-lys 3 ]-GHRP-6, was performed immediately prior to ghrelin injection. Ghrelin (125 or 250 μg/kg) could reduce the disease activity index, histological score, and myeloperoxidase activities in experimental colitis, and also prevented shortening of the colon. Ghrelin could prevent the reduction of transepithelial electrical resistance and tight junction expression, and bolstered tight junction structural integrity and regulated cytokine secretion. Ultimately, ghrelin inhibited nuclear factor kappa B (NF-κB), inhibitory κB-α, myosin light chain kinase, and phosphorylated myosin light chain 2 activation. Conclusions: Ghrelin prevented the breakdown of intestinal barrier function in DSS-induced colitis. The protective effects of ghrelin on intestinal barrier function were mediated by its receptor GHSR-1a. The inhibition of NF-κB activation might be part of the mechanism underlying the effects of ghrelin that protect against barrier dysfunction. - Highlights: • Ghrelin ameliorates intestinal barrier dysfunction in experimental colitis. • The effect of ghrelin is mediated by GHSR-1a. • Inhibition of NF-κB activation
Energy Technology Data Exchange (ETDEWEB)
Cheng, Jian; Zhang, Lin [Department of Gastroenterology, Jinshan Hospital of Fudan University, Shanghai (China); Dai, Weiqi [Department of Gastroenterology, Shanghai Tenth People' s Hospital, Tongji University, Shanghai (China); Mao, Yuqing [Department of Gastroenterology, Jinshan Hospital of Fudan University, Shanghai (China); Li, Sainan [Department of Gastroenterology, Shanghai Tenth People' s Hospital, Tongji University, Shanghai (China); Wang, Jingjie; Li, Huanqing [Department of Gastroenterology, Jinshan Hospital of Fudan University, Shanghai (China); Guo, Chuanyong [Department of Gastroenterology, Shanghai Tenth People' s Hospital, Tongji University, Shanghai (China); Fan, Xiaoming, E-mail: xiaomingfan57@sina.com [Department of Gastroenterology, Jinshan Hospital of Fudan University, Shanghai (China)
2015-02-27
Aim: This study aimed to investigate the effect and underlying mechanism of ghrelin on intestinal barrier dysfunction in dextran sulfate sodium (DSS)-induced colitis. Methods and results: Acute colitis was induced in C57BL/6J mice by administering 2.5% DSS. Saline or 25, 125, 250 μg/kg ghrelin was administrated intraperitoneally (IP) to mice 1 day before colitis induction and on days 4, 5, and 6 after DSS administration. IP injection of a ghrelin receptor antagonist, [D-lys{sup 3}]-GHRP-6, was performed immediately prior to ghrelin injection. Ghrelin (125 or 250 μg/kg) could reduce the disease activity index, histological score, and myeloperoxidase activities in experimental colitis, and also prevented shortening of the colon. Ghrelin could prevent the reduction of transepithelial electrical resistance and tight junction expression, and bolstered tight junction structural integrity and regulated cytokine secretion. Ultimately, ghrelin inhibited nuclear factor kappa B (NF-κB), inhibitory κB-α, myosin light chain kinase, and phosphorylated myosin light chain 2 activation. Conclusions: Ghrelin prevented the breakdown of intestinal barrier function in DSS-induced colitis. The protective effects of ghrelin on intestinal barrier function were mediated by its receptor GHSR-1a. The inhibition of NF-κB activation might be part of the mechanism underlying the effects of ghrelin that protect against barrier dysfunction. - Highlights: • Ghrelin ameliorates intestinal barrier dysfunction in experimental colitis. • The effect of ghrelin is mediated by GHSR-1a. • Inhibition of NF-κB activation.
Han, Seung Hoon; Park, Ji Woong
2017-11-01
The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor
Directory of Open Access Journals (Sweden)
Hans Linde Nielsen
Full Text Available Campylobacter concisus infections of the gastrointestinal tract can be accompanied by diarrhea and inflammation, whereas colonization of the human oral cavity might have a commensal nature. We focus on the pathophysiology of C. concisus and the effects of different clinical oral and fecal C. concisus strains on human HT-29/B6 colon cells. Six oral and eight fecal strains of C. concisus were isolated. Mucus-producing HT-29/B6 epithelial monolayers were infected with the C. concisus strains. Transepithelial electrical resistance (R(t and tracer fluxes of different molecule size were measured in Ussing chambers. Tight junction (TJ protein expression was determined by Western blotting, and subcellular TJ distribution was analyzed by confocal laser-scanning microscopy. Apoptosis induction was examined by TUNEL-staining and Western blot of caspase-3 activation. All strains invaded confluent HT-29/B6 cells and impaired epithelial barrier function, characterized by a time- and dose-dependent decrease in R(t either after infection from the apical side but even more from the basolateral compartment. TJ protein expression changes were sparse, only in apoptotic areas of infected monolayers TJ proteins were redistributed. Solely the barrier-forming TJ protein claudin-5 showed a reduced expression level to 66±8% (P<0.05, by expression regulation from the gene. Concomitantly, Lactate dehydrogenase release was elevated to 3.1±0.3% versus 0.7±0.1% in control (P<0.001, suggesting cytotoxic effects. Furthermore, oral and fecal C. concisus strains elevated apoptotic events to 5-fold. C. concisus-infected monolayers revealed an increased permeability for 332 Da fluorescein (1.74±0.13 vs. 0.56±0.17 10(-6 cm/s in control, P<0.05 but showed no difference in permeability for 4 kDa FITC-dextran (FD-4. The same was true in camptothecin-exposed monolayers, where camptothecin was used for apoptosis induction.In conclusion, epithelial barrier dysfunction by oral and
Groundwater governance in Asia: present state and barriers to implementation of good governance
Tanaka, T.
2014-09-01
The present state of groundwater governance in Asia was reviewed. The main problem regarding groundwater resources in each Asian country is overexploitation, causing water level decline, land subsidence and salt water intrusion. For those groundwater hazards, many countries have established regulations such as laws and regulations as countermeasures. However, those laws and regulations are not the basic laws on groundwater resources, but only for countermeasures to prevent groundwater hazards. Common problems and barriers for implementing groundwater governance in Asian countries are that there is more than one institute with different and sometimes overlapping responsibilities in groundwater management. To overcome those conflicts among institutions and establishment of good governance, it is necessary to establish an agency in the government as one coordinate function reinforcing the direct coordination and facilitation of groundwater policy-making and management. As one such framework, the conceptual law called the Water Cycle Basic Law, which is under planning in Japan, is examined in this paper.
Role of Vitamin D in Maintaining Renal Epithelial Barrier Function in Uremic Conditions
Directory of Open Access Journals (Sweden)
Milos Mihajlovic
2017-11-01
Full Text Available As current kidney replacement therapies are not efficient enough for end-stage renal disease (ESRD treatment, a bioartificial kidney (BAK device, based on conditionally immortalized human proximal tubule epithelial cells (ciPTEC, could represent an attractive solution. The active transport activity of such a system was recently demonstrated. In addition, endocrine functions of the cells, such as vitamin D activation, are relevant. The organic anion transporter 1 (OAT-1 overexpressing ciPTEC line presented 1α-hydroxylase (CYP27B1, 24-hydroxylase (CYP24A1 and vitamin D receptor (VDR, responsible for vitamin D activation, degradation and function, respectively. The ability to produce and secrete 1α,25-dihydroxy-vitamin D3, was shown after incubation with the precursor, 25-hydroxy-vitamin D3. The beneficial effect of vitamin D on cell function and behavior in uremic conditions was studied in the presence of an anionic uremic toxins mixture. Vitamin D could restore cell viability, and inflammatory and oxidative status, as shown by cell metabolic activity, interleukin-6 (IL-6 levels and reactive oxygen species (ROS production, respectively. Finally, vitamin D restored transepithelial barrier function, as evidenced by decreased inulin-FITC leakage in biofunctionalized hollow fiber membranes (HFM carrying ciPTEC-OAT1. In conclusion, the protective effects of vitamin D in uremic conditions and proven ciPTEC-OAT1 endocrine function encourage the use of these cells for BAK application.
Modeling Safety Barriers and Defense in Depth with Mulitlevel Flow Modeling
DEFF Research Database (Denmark)
Lind, Morten
2012-01-01
in MFM is a barrier function. It is shown that other barrier types can be represented andthat their combination into barrier chains may be used to analyze and design levels of safety in automated processes.Suggestion for further research on barrier modeling with MFM are included....
Liu, Sen; Feng, Lin; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Wu, Pei; Zeng, Yun-Yun; Xu, Shu-De; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu
2016-08-01
This study investigated the effects of exogenous lipase supplementation on the growth performance, intestinal growth and function, immune response and physical barrier function, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella). A total of 450 grass carp (255.02 ± 0.34 g) were fed five diets for 60 days. There were 5 dietary treatments that included a normal protein and lipid diet containing 30% crude protein (CP) with 5% ether extract (EE), and the low-protein and high-lipid diets (28% CP, 6% EE) supplemented with graded levels of exogenous lipase supplementation activity at 0, 1193, 2560 and 3730 U/kg diet. The results indicated that compared with a normal protein and lipid diet (30% CP, 5% EE), a low-protein and high-lipid diet (28% CP, 6% EE) (un-supplemented lipase) improved lysozyme activities and complement component 3 contents in the distal intestine (DI), interleukin 10 mRNA expression in the proximal intestine (PI), and glutathione S-transferases activity and glutathione content in the intestine of young grass carp. In addition, in low-protein and high-lipid diets, optimal exogenous lipase supplementation significantly increased acid phosphatase (ACP) activities and complement component 3 (C3) contents (P exogenous lipase supplementation significantly decreased reactive oxygen species (ROS), malondialdehyde (MDA) and protein carbonyl (PC) contents (P exogenous lipase supplementation significantly elevated the mRNA levels of tight junction proteins (Occludin, zonula occludens 1, Claudin b, Claudin c and Claudin 3) (P exogenous lipase supplementation improved growth, intestinal growth and function, intestinal immunity, physical barrier, and regulated the mRNA expression of related signal molecules of fish. The optimal level of exogenous lipase supplementation in young grass carp (255-771 g) was estimated to be 1193 U kg(-1) diet. Copyright © 2016. Published by Elsevier Ltd.
Regulation of satellite cell function in sarcopenia
Directory of Open Access Journals (Sweden)
Stephen E Alway
2014-09-01
Full Text Available The mechanisms contributing to sarcopenia include reduced satellite cell (myogenic stem cell function that is impacted by the environment (niche of these cells. Satellite cell function is affected by oxidative stress, which is elevated in aged muscles, and this along with changes in largely unknown systemic factors, likely contribute to the manner in which satellite cells respond to stressors such as exercise, disuse or rehabilitation in sarcopenic muscles. Nutritional intervention provides one therapeutic strategy to improve the satellite cell niche and systemic factors, with the goal of improving satellite cell function in aging muscles. Although many elderly persons consume various nutraceuticals with the hope of improving health, most of these compounds have not been thoroughly tested, and the impacts that they might have on sarcopenia, and satellite cell function are not clear. This review discusses data pertaining to the satellite cell responses and function in aging skeletal muscle, and the impact that three compounds: resveratrol, green tea catechins and β-Hydroxy-β-methylbutyrate have on regulating satellite cell function and therefore contributing to reducing sarcopenia or improving muscle mass after disuse in aging. The data suggest that these nutraceutical compounds improve satellite cell function during rehabilitative loading in animal models of aging after disuse (i.e., muscle regeneration. While these compounds have not been rigorously tested in humans, the data from animal models of aging provide a strong basis for conducting additional focused work to determine if these or other nutraceuticals can offset the muscle losses, or improve regeneration in sarcopenic muscles of older humans via improving satellite cell function.
Regulation of Satellite Cell Function in Sarcopenia
Alway, Stephen E.; Myers, Matthew J.; Mohamed, Junaith S.
2014-01-01
The mechanisms contributing to sarcopenia include reduced satellite cell (myogenic stem cell) function that is impacted by the environment (niche) of these cells. Satellite cell function is affected by oxidative stress, which is elevated in aged muscles, and this along with changes in largely unknown systemic factors, likely contribute to the manner in which satellite cells respond to stressors such as exercise, disuse, or rehabilitation in sarcopenic muscles. Nutritional intervention provides one therapeutic strategy to improve the satellite cell niche and systemic factors, with the goal of improving satellite cell function in aging muscles. Although many elderly persons consume various nutraceuticals with the hope of improving health, most of these compounds have not been thoroughly tested, and the impacts that they might have on sarcopenia and satellite cell function are not clear. This review discusses data pertaining to the satellite cell responses and function in aging skeletal muscle, and the impact that three compounds: resveratrol, green tea catechins, and β-Hydroxy-β-methylbutyrate have on regulating satellite cell function and therefore contributing to reducing sarcopenia or improving muscle mass after disuse in aging. The data suggest that these nutraceutical compounds improve satellite cell function during rehabilitative loading in animal models of aging after disuse (i.e., muscle regeneration). While these compounds have not been rigorously tested in humans, the data from animal models of aging provide a strong basis for conducting additional focused work to determine if these or other nutraceuticals can offset the muscle losses, or improve regeneration in sarcopenic muscles of older humans via improving satellite cell function. PMID:25295003
Reflectionlessness, kurtosis and top curvature of potential barriers
International Nuclear Information System (INIS)
Ahmed, Zafar
2006-01-01
Apart from the rectangular barrier, other barriers having a single maximum generally display reflectivity, R(E), as a smoothly decreasing function of energy. We conjecture that symmetric potential barriers with a single maximum entail zeros or sharp minima in R(E) provided they have either their coefficient of kurtosis lying in the range (1.8, 3.0), or their top curvature as zero, or both
THE SYNTHESIS AND ANALYSIS INFORMATION TECHNOLOGY OF INTERACTIVE REGULATIONS FUNCTIONAL MODELS
Directory of Open Access Journals (Sweden)
Владимир Александрович ТИМОФЕЕВ
2016-02-01
Full Text Available A person has no ability to capture entirely and to estimate correctly the logical coherence and consistency of Regulations in the Text Form. It leads to mistakes in a work of an Enterprise Staff and to the impossibility of mastering of the Regulations with considerable volume. Presented Information Technology allows the Regulations Executor to receive on-line proper information of the Optimum Actions in any possible Situation, which can arise in the course of the work. Leading Experts of any Enterprise may create the full-fledged Expert System by themselves with the help of Specialized Software. Such a System will contain the knowledge in the Functional Model of Regulations (the Optimum Business Process. Stages of realization of the represented Information Technology and the peculiarities of on-line data displaying for the Regulations Executor are illustrated by the Pharmacy Customer Service Regulations.
Symmetry analysis of a model for the exercise of a barrier option
O'Hara, J. G.; Sophocleous, C.; Leach, P. G. L.
2013-09-01
A barrier option takes into account the possibility of an unacceptable change in the price of the underlying stock. Such a change could carry considerable financial loss. We examine one model based upon the Black-Scholes-Merton Equation and determine the functional forms of the barrier function and rebate function which are consistent with a solution of the underlying evolution partial differential equation using the Lie Theory of Extended Groups. The solution is consistent with the possibility of no rebate and the barrier function is very similar to one adopted on an heuristic basis.
Investment opportunities and barriers. The effects of government policy
International Nuclear Information System (INIS)
Terzic, B.
2002-01-01
The following concepts regarding energy investment opportunities and barriers are explained in depth: Regulation; Profit; Value; Revenue constraints; Expense and cost constrains; Recommending use of UK's more recent regulatory model. (R.P.)
Structural interaction and functional regulation of polycystin-2 by filamin.
Directory of Open Access Journals (Sweden)
Qian Wang
Full Text Available Filamins are important actin cross-linking proteins implicated in scaffolding, membrane stabilization and signal transduction, through interaction with ion channels, receptors and signaling proteins. Here we report the physical and functional interaction between filamins and polycystin-2, a TRP-type cation channel mutated in 10-15% patients with autosomal dominant polycystic kidney disease. Yeast two-hybrid and GST pull-down experiments demonstrated that the C-termini of filamin isoforms A, B and C directly bind to both the intracellular N- and C-termini of polycystin-2. Reciprocal co-immunoprecipitation experiments showed that endogenous polycystin-2 and filamins are in the same complexes in renal epithelial cells and human melanoma A7 cells. We then examined the effect of filamin on polycystin-2 channel function by electrophysiology studies with a lipid bilayer reconstitution system and found that filamin-A substantially inhibits polycystin-2 channel activity. Our study indicates that filamins are important regulators of polycystin-2 channel function, and further links actin cytoskeletal dynamics to the regulation of this channel protein.
Skottman, H; Muranen, J; Lähdekorpi, H; Pajula, E; Mäkelä, K; Koivusalo, L; Koistinen, A; Uusitalo, H; Kaarniranta, K; Juuti-Uusitalo, K
2017-10-01
Here we evaluated the effects of human retinal microvascular endothelial cells (hREC) on mature human embryonic stem cell (hESC) derived retinal pigment epithelial (RPE) cells. The hESC-RPE cells (Regea08/017, Regea08/023 or Regea11/013) and hREC (ACBRI 181) were co-cultured on opposite sides of transparent membranes for up to six weeks. Thereafter barrier function, small molecule permeability, localization of RPE and endothelial cell marker proteins, cellular fine structure, and growth factor secretion of were evaluated. After co-culture, the RPE specific CRALBP and endothelial cell specific von Willebrand factor were appropriately localized. In addition, the general morphology, pigmentation, and fine structure of hESC-RPE cells were unaffected. Co-culture increased the barrier function of hESC-RPE cells, detected both with TEER measurements and cumulative permeability of FD4 - although the differences varied among the cell lines. Co-culturing significantly altered VEGF and PEDF secretion, but again the differences were cell line specific. The results of this study showed that co-culture with hREC affects hESC-RPE functionality. In addition, co-culture revealed drastic cell line specific differences, most notably in growth factor secretion. This model has the potential to be used as an in vitro outer blood-retinal barrier model for drug permeability testing. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Watson, P Marc D; Paterson, Judy C; Thom, George; Ginman, Ulrika; Lundquist, Stefan; Webster, Carl I
2013-06-18
Modelling the blood-CNS barriers of the brain and spinal cord in vitro continues to provide a considerable challenge for research studying the passage of large and small molecules in and out of the central nervous system, both within the context of basic biology and for pharmaceutical drug discovery. Although there has been considerable success over the previous two decades in establishing useful in vitro primary endothelial cell cultures from the blood-CNS barriers, no model fully mimics the high electrical resistance, low paracellular permeability and selective influx/efflux characteristics of the in vivo situation. Furthermore, such primary-derived cultures are typically labour-intensive and generate low yields of cells, limiting scope for experimental work. We thus aimed to establish protocols for the high yield isolation and culture of endothelial cells from both rat brain and spinal cord. Our aim was to optimise in vitro conditions for inducing phenotypic characteristics in these cells that were reminiscent of the in vivo situation, such that they developed into tight endothelial barriers suitable for performing investigative biology and permeability studies. Brain and spinal cord tissue was taken from the same rats and used to specifically isolate endothelial cells to reconstitute as in vitro blood-CNS barrier models. Isolated endothelial cells were cultured to expand the cellular yield and then passaged onto cell culture inserts for further investigation. Cell culture conditions were optimised using commercially available reagents and the resulting barrier-forming endothelial monolayers were characterised by functional permeability experiments and in vitro phenotyping by immunocytochemistry and western blotting. Using a combination of modified handling techniques and cell culture conditions, we have established and optimised a protocol for the in vitro culture of brain and, for the first time in rat, spinal cord endothelial cells. High yields of both CNS
Dynamic energy landscapes of riboswitches help interpret conformational rearrangements and function.
Directory of Open Access Journals (Sweden)
Giulio Quarta
Full Text Available Riboswitches are RNAs that modulate gene expression by ligand-induced conformational changes. However, the way in which sequence dictates alternative folding pathways of gene regulation remains unclear. In this study, we compute energy landscapes, which describe the accessible secondary structures for a range of sequence lengths, to analyze the transcriptional process as a given sequence elongates to full length. In line with experimental evidence, we find that most riboswitch landscapes can be characterized by three broad classes as a function of sequence length in terms of the distribution and barrier type of the conformational clusters: low-barrier landscape with an ensemble of different conformations in equilibrium before encountering a substrate; barrier-free landscape in which a direct, dominant "downhill" pathway to the minimum free energy structure is apparent; and a barrier-dominated landscape with two isolated conformational states, each associated with a different biological function. Sharing concepts with the "new view" of protein folding energy landscapes, we term the three sequence ranges above as the sensing, downhill folding, and functional windows, respectively. We find that these energy landscape patterns are conserved in various riboswitch classes, though the order of the windows may vary. In fact, the order of the three windows suggests either kinetic or thermodynamic control of ligand binding. These findings help understand riboswitch structure/function relationships and open new avenues to riboswitch design.
Barriers to activity and participation for stroke survivors in rural China.
Zhang, Lifang; Yan, Tiebin; You, Liming; Li, Kun
2015-07-01
To investigate environmental barriers reported by stroke survivors in the rural areas of China and to determine the impact of environmental barriers on activity and participation relative to demographic characteristics and body functioning. Cross-sectional survey. Structured interviews in the participants' homes. Community-dwelling stroke survivors in the rural areas of China (N=639). Not applicable. Activity and participation (Chinese version of the World Health Organization Disability Assessment Schedule 2.0), environmental barriers (Craig Hospital Inventory of Environmental Factors), neurological function (Canadian Neurological Scale), cognitive function (Abbreviated Mental Test), and depression (6-item Hamilton Rating Scale for Depression). Physical/structural barriers are the major impediment to activity and participation for these participants (odds ratio, 1.86 and 1.99 for activity and participation, respectively; Penvironmental barriers to be decreased and eliminated first. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
Regulation of brain insulin signaling: A new function for tau.
Gratuze, Maud; Planel, Emmanuel
2017-08-07
In this issue of JEM, Marciniak et al. (https://doi.org/10.1084/jem.20161731) identify a putative novel function of tau protein as a regulator of insulin signaling in the brain. They find that tau deletion impairs hippocampal response to insulin through IRS-1 and PTEN dysregulation and suggest that, in Alzheimer's disease, impairment of brain insulin signaling might occur via tau loss of function. © 2017 Gratuze and Planel.
Kucukarslan, Suzan N; Thomas, Sheena; Bazzi, Abraham; Virant-Young, Deborah
2009-12-01
: Self-regulation theory predicts that patient behavior is determined by the patient's assessment of his/her condition (illness presentation) and related health goals. Patients will adapt their behavior to achieve those goals. However, there are multiple levels of goals. In such cases, those lower-level goals (health goals) that are strongly correlated with higher-level goals (i.e. quality of life [QOL]) are more likely to drive patient behavior. Medication non-compliance is a health behavior that challenges healthcare practitioners. Thus, the primary aim of this paper is to explore the relationship between the lower-level goals for taking medication with higher-level goals. This paper also identifies patient-perceived barriers and facilitators toward achieving goals as they may relate to patients' illness representation. : To identify lower- and higher-level goals associated with medication use for chronic conditions. To determine if there is a relationship between higher-level (global) goals and lower-level (health-related) goals. To identify patient-perceived facilitators and barriers to achieving those goals. : This was a prospective, observational study using a mailed survey. The setting was a US Midwestern state-wide survey. Participants were patients living in the community with hypertension, heart disease, diabetes mellitus, or arthritis, and taking prescription medication for any one of those conditions. The main outcome measures were lower- and higher-level goals related to medication use. The survey asked the participants if they had achieved their goals and to identify factors that may pose as barriers or facilitators to achieving them. Pearson correlation was used to test the relationship between the lower- and higher-level goals at p goals existed (p = 0.03). Preventing future health problems was the most important lower-level goal for almost half of the respondents. Approximately 43% of the respondents said 'improving or maintaining quality of
Lyra-Leite, Davi M; Andres, Allen M; Petersen, Andrew P; Ariyasinghe, Nethika R; Cho, Nathan; Lee, Jezell A; Gottlieb, Roberta A; McCain, Megan L
2017-10-01
Mitochondria in cardiac myocytes are critical for generating ATP to meet the high metabolic demands associated with sarcomere shortening. Distinct remodeling of mitochondrial structure and function occur in cardiac myocytes in both developmental and pathological settings. However, the factors that underlie these changes are poorly understood. Because remodeling of tissue architecture and extracellular matrix (ECM) elasticity are also hallmarks of ventricular development and disease, we hypothesize that these environmental factors regulate mitochondrial function in cardiac myocytes. To test this, we developed a new procedure to transfer tunable polydimethylsiloxane disks microcontact-printed with fibronectin into cell culture microplates. We cultured Sprague-Dawley neonatal rat ventricular myocytes within the wells, which consistently formed tissues following the printed fibronectin, and measured oxygen consumption rate using a Seahorse extracellular flux analyzer. Our data indicate that parameters associated with baseline metabolism are predominantly regulated by ECM elasticity, whereas the ability of tissues to adapt to metabolic stress is regulated by both ECM elasticity and tissue alignment. Furthermore, bioenergetic health index, which reflects both the positive and negative aspects of oxygen consumption, was highest in aligned tissues on the most rigid substrate, suggesting that overall mitochondrial function is regulated by both ECM elasticity and tissue alignment. Our results demonstrate that mitochondrial function is regulated by both ECM elasticity and myofibril architecture in cardiac myocytes. This provides novel insight into how extracellular cues impact mitochondrial function in the context of cardiac development and disease. NEW & NOTEWORTHY A new methodology has been developed to measure O 2 consumption rates in engineered cardiac tissues with independent control over tissue alignment and matrix elasticity. This led to the findings that matrix
Mucosal innate immune cells regulate both gut homeostasis and intestinal inflammation.
Kurashima, Yosuke; Goto, Yoshiyuki; Kiyono, Hiroshi
2013-12-01
Continuous exposure of intestinal mucosal surfaces to diverse microorganisms and their metabolites reflects the biological necessity for a multifaceted, integrated epithelial and immune cell-mediated regulatory system. The development and function of the host cells responsible for the barrier function of the intestinal surface (e.g., M cells, Paneth cells, goblet cells, and columnar epithelial cells) are strictly regulated through both positive and negative stimulation by the luminal microbiota. Stimulation by damage-associated molecular patterns and commensal bacteria-derived microbe-associated molecular patterns provokes the assembly of inflammasomes, which are involved in maintaining the integrity of the intestinal epithelium. Mucosal immune cells located beneath the epithelium play critical roles in regulating both the mucosal barrier and the relative composition of the luminal microbiota. Innate lymphoid cells and mast cells, in particular, orchestrate the mucosal regulatory system to create a mutually beneficial environment for both the host and the microbiota. Disruption of mucosal homeostasis causes intestinal inflammation such as that seen in inflammatory bowel disease. Here, we review the recent research on the biological interplay among the luminal microbiota, epithelial cells, and mucosal innate immune cells in both healthy and pathological conditions. © 2013 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Ricci J Haines
Full Text Available Since inflammatory bowel diseases (IBD represent significant morbidity and mortality in the US, the need for defining novel drug targets and inflammatory mechanisms would be of considerable benefit. Although protein tyrosine kinase 6 (PTK6, also known as breast tumor kinase BRK has been primarily studied in an oncogenic context, it was noted that PTK6 null mice exhibited significantly enhanced colonic epithelial barrier function. Considering that the inflammatory functions of PTK6 have not yet been explored, we hypothesized that cytokines responsible for mediating IBD, such as TNFα/IFNγ, may solicit the action of PTK6 to alter barrier function. After first assessing critical mediators of TNFα/IFNγ driven epithelial barrier dysfunction, we further explored the possibility of PTK6 in this inflammatory context. In this report, we showed that PTK6 siRNA and PTK6 null young adult mouse colonic epithelial cells (YAMC exhibited significant attenuation of TNFα/IFNγ induced barrier dysfunction as measured by electric cell-substrate impedance sensing (ECIS assay and permeability assays. In addition, PTK6 null cells transfected with PTK6 cDNA displayed restored barrier dysfunction in response to TNFα/IFNγ, while the cells transfected with vector alone showed similar attenuation of barrier dysfunction. Furthermore, using subcellular fractionation and immunocytochemistry experiments, we found that PTK6 plays a role in FoxO1 nuclear accumulation leading to down-regulation of claudin-3, a tight junction protein. Moreover, we searched for relevant miRNA candidates putative for targeting PTK6 in order to identify and assess the impact of microRNA that target PTK6 with respect to TNFα/IFNγ induced barrier dysfunction. Subsequently, we assayed likely targets and determined their effectiveness in attenuating PTK6 expression as well as cytokine induced barrier dysfunction. Results showed that miR-93 reduced PTK6 expression and attenuated TNF
Lifescience Database Archive (English)
Full Text Available 17667936 Structure, function and regulation of the Toll/IL-1 receptor adaptor prote... (.svg) (.html) (.csml) Show Structure, function and regulation of the Toll/IL-1 receptor adaptor proteins. ...PubmedID 17667936 Title Structure, function and regulation of the Toll/IL-1 recep
Flexible barrier film, method of forming same, and organic electronic device including same
Blizzard, John; Tonge, James Steven; Weidner, William Kenneth
2013-03-26
A flexible barrier film has a thickness of from greater than zero to less than 5,000 nanometers and a water vapor transmission rate of no more than 1.times.10.sup.-2 g/m.sup.2/day at 22.degree. C. and 47% relative humidity. The flexible barrier film is formed from a composition, which comprises a multi-functional acrylate. The composition further comprises the reaction product of an alkoxy-functional organometallic compound and an alkoxy-functional organosilicon compound. A method of forming the flexible barrier film includes the steps of disposing the composition on a substrate and curing the composition to form the flexible barrier film. The flexible barrier film may be utilized in organic electronic devices.
Jiang, Wenqing; Li, Yan; Du, Yasong; Fan, Juan
2016-05-01
This study aims to explore the feature of emotional regulation and executive functions in oppositional defiant disorder (ODD) children. The emotional regulation and executive functions of adolescents with ODD, as well as the relationship between the two factors were analyzed using tools including Adolescent Daily Emotional Regulation Questionnaire (ADERQ), Wisconsin Card Sorting Test (WCST) and Cambridge Neuropsychological Test Automated Battery (CANTAB), in comparison with attention deficit hyperactivity disorder (ADHD) children without behavioral problem and healthy children; the ADERQ assessed emotional regulation ability and others were used to assess executive function. Compared to normal children, the ODD group displayed significant differences in the scores of cognitive reappraisal, rumination, expressive suppression, and revealing of negative emotions, as well as in the score of cognitive reappraisal of positive emotions. WCST perseverative errors were well correlated with rumination of negative emotions (r=0.47). Logistic regression revealed that the minimum number of moves in the Stocking of Cambridge (SOC) test (one test in CANTAB) and negative emotion revealing, were strongly associated with ODD diagnosis. Children with ODD showed emotion dysregulation, with negative emotion dysregulation as the main feature. Emotion dysregulation and the lack of ability to plan lead to executive function deficits. The executive function deficits may guide us to understand the deep mechanism under ODD.
Market and policy barriers to energy storage deployment :
Energy Technology Data Exchange (ETDEWEB)
Bhatnagar, Dhruv; Currier, Aileen B.; Hernandez, Jacquelynne; Ma, Ookie; Kirby, Brendan
2013-09-01
Electric energy storage technologies have recently been in the spotlight, discussed as essential grid assets that can provide services to increase the reliability and resiliency of the grid, including furthering the integration of variable renewable energy resources. Though they can provide numerous grid services, there are a number of factors that restrict their current deployment. The most significant barrier to deployment is high capital costs, though several recent deployments indicate that capital costs are decreasing and energy storage may be the preferred economic alternative in certain situations. However, a number of other market and regulatory barriers persist, limiting further deployment. These barriers can be categorized into regulatory barriers, market (economic) barriers, utility and developer business model barriers, crosscutting barriers and technology barriers. This report, through interviews with stakeholders and review of regulatory filings in four regions roughly representative of the United States, identifies the key barriers restricting further energy storage development in the country. The report also includes a discussion of possible solutions to address these barriers and a review of initiatives around the country at the federal, regional and state levels that are addressing some of these issues. Energy storage could have a key role to play in the future grid, but market and regulatory issues have to be addressed to allow storage resources open market access and compensation for the services they are capable of providing. Progress has been made in this effort, but much remains to be done and will require continued engagement from regulators, policy makers, market operators, utilities, developers and manufacturers.
The role of multiple barriers in assuring waste package reliability
International Nuclear Information System (INIS)
Bradford, R.M.
1993-08-01
Yucca Mountain in southwestern Nevada is being studied as a potential repository site for the permanent storage of high-level nuclear waste. Regulators have set performance standards that the potential repository must meet in order to obtain regulatory approval. Nuclear Regulatory Commission (NRC) regulations state that containment of radioactivity must be ''substantially complete'' for the first 1000 years after closure of the facility. Thereafter, the acceptable annual limit on releases is 1/100,000 of each radionuclide remaining in the inventory after 1000 years. To demonstrate that the potential facility is in compliance with the regulations, it is necessary to obtain some understanding of the probability distribution of the cumulative quantity of releases by certain time points. This paper will discuss the probability distribution of waste container lifetimes and how the understanding of this distribution will play a role in finding the distribution of the release quantities over time. It will be shown that, for reasonable assumptions about the process of barrier failure, the reliability of a multiple-barrier container can be achieved and demonstrated much more readily than a container consisting of a single barrier. The discussion will focus primarily on the requirement of substantially complete containment for the first 1000 years
Regulation of Histone Acetyltransferase TIP60 Function by Histone Deacetylase 3
Yi, Jingjie; Huang, Xiangyang; Yang, Yuxia; Zhu, Wei-Guo; Gu, Wei; Luo, Jianyuan
2014-01-01
The key member of the MOZ (monocyticleukaemia zinc finger protein), Ybf2/Sas3, Sas2, and TIP60 acetyltransferases family, Tat-interactive protein, 60 kD (TIP60), tightly modulates a wide array of cellular processes, including chromatin remodeling, gene transcription, apoptosis, DNA repair, and cell cycle arrest. The function of TIP60 can be regulated by SIRT1 through deacetylation. Here we found that TIP60 can also be functionally regulated by HDAC3. We identified six lysine residues as its autoacetylation sites. Mutagenesis of these lysines to arginines completely abolishes the autoacetylation of TIP60. Overexpression of HDAC3 increases TIP60 ubiquitination levels. However, unlike SIRT1, HDAC3 increased the half-life of TIP60. Further study found that HDAC3 colocalized with TIP60 both in the nucleus and the cytoplasm, which could be the reason why HDAC3 can stabilize TIP60. The deacetylation of TIP60 by both SIRT1 and HDAC3 reduces apoptosis induced by DNA damage. Knockdown of HDAC3 in cells increased TIP60 acetylation levels and increased apoptosis after DNA damage. Together, our findings provide a better understanding of TIP60 regulation mechanisms, which is a significant basis for further studies of its cellular functions. PMID:25301942
microRNAs in the regulation of dendritic cell functions in inflammation and atherosclerosis.
Busch, Martin; Zernecke, Alma
2012-08-01
Atherosclerosis has been established as a chronic inflammatory disease of the vessel wall. Among the mononuclear cell types recruited to the lesions, specialized dendritic cells (DCs) have gained increasing attention, and their secretory products and interactions shape the progression of atherosclerotic plaques. The regulation of DC functions by microRNAs (miRNAs) may thus be of primary importance in disease. We here systematically summarize the biogenesis and functions of miRNAs and provide an overview of miRNAs in DCs, their targets, and potential implications for atherosclerosis, with a particular focus on the best characterized miRNAs in DCs, namely, miR-155 and miR-146. MiRNA functions in DCs range from regulation of lipid uptake to cytokine production and T cell responses with a complex picture emerging, in which miRNAs cooperate or antagonize DC behavior, thereby promoting or counterbalancing inflammatory responses. As miRNAs regulate key functions of DCs known to control atherosclerotic vascular disease, their potential as a therapeutic target holds promise and should be attended to in future research.
Novel Functionally Graded Thermal Barrier Coatings in Coal-Fired Power Plant Turbines
Energy Technology Data Exchange (ETDEWEB)
Zhang, Jing [Indiana Univ., Indianapolis, IN (United States)
2016-11-01
This project presents a detailed investigation of a novel functionally graded coating material, pyrochlore oxide, for thermal barrier coating (TBC) in gas turbines used in coal-fired power plants. Thermal barrier coatings are refractory materials deposited on gas turbine components, which provide thermal protection for metallic components at operating conditions. The ultimate goal of this research is to develop a manufacturing process to produce the novel low thermal conductivity and high thermal stability pyrochlore oxide based coatings with improved high-temperature durability. The current standard TBC, yttria stabilized zirconia (YSZ), has service temperatures limited to <1200°C, due to sintering and phase transition at higher temperatures. In contrast, pyrochlore oxide, e.g., lanthanum zirconate (La2Zr2O7, LZ), has demonstrated lower thermal conductivity and better thermal stability, which are crucial to high temperature applications, such as gas turbines used in coal-fired power plants. Indiana University – Purdue University Indianapolis (IUPUI) has collaborated with Praxair Surface Technologies (PST), and Changwon National University in South Korea to perform the proposed research. The research findings are critical to the extension of current TBCs to a broader range of high-temperature materials and applications. Several tasks were originally proposed and accomplished, with additional new opportunities identified during the course of the project. In this report, a description of the project tasks, the main findings and conclusions are given. A list of publications and presentations resulted from this research is listed in the Appendix at the end of the report.
Visser, J T J; Lammers, K; Hoogendijk, A; Boer, M W; Brugman, S; Beijer-Liefers, S; Zandvoort, A; Harmsen, H; Welling, G; Stellaard, F; Bos, N A; Fasano, A; Rozing, J
2010-12-01
Impaired intestinal barrier function is observed in type 1 diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading to type 1 diabetes. Since a hydrolysed casein (HC) diet prevents autoimmune diabetes onset in diabetes-prone (DP)-BioBreeding (BB) rats, we studied the role of the HC diet on intestinal barrier function and, therefore, prevention of autoimmune diabetes onset in this animal model. DP-BB rats were fed the HC diet from weaning onwards and monitored for autoimmune diabetes development. Intestinal permeability was assessed in vivo by lactulose-mannitol test and ex vivo by measuring transepithelial electrical resistance (TEER). Levels of serum zonulin, a physiological tight junction modulator, were measured by ELISA. Ileal mRNA expression of Myo9b, Cldn1, Cldn2 and Ocln (which encode the tight junction-related proteins myosin IXb, claudin-1, claudin-2 and occludin) and Il-10, Tgf-ß (also known as Il10 and Tgfb, respectively, which encode regulatory cytokines) was analysed by quantitative PCR. The HC diet reduced autoimmune diabetes by 50% in DP-BB rats. In DP-BB rats, prediabetic gut permeability negatively correlated with the moment of autoimmune diabetes onset. The improved intestinal barrier function that was induced by HC diet in DP-BB rats was visualised by decreasing lactulose:mannitol ratio, decreasing serum zonulin levels and increasing ileal TEER. The HC diet modified ileal mRNA expression of Myo9b, and Cldn1 and Cldn2, but left Ocln expression unaltered. Improved intestinal barrier function might be an important intermediate in the prevention of autoimmune diabetes by the HC diet in DP-BB rats. Effects on tight junctions, ileal cytokines and zonulin production might be important mechanisms for this effect.
Swelling-activated ion channels: functional regulation in cell-swelling, proliferation and apoptosis
DEFF Research Database (Denmark)
Stutzin, A; Hoffmann, E K
2006-01-01
Cell volume regulation is one of the most fundamental homeostatic mechanisms and essential for normal cellular function. At the same time, however, many physiological mechanisms are associated with regulatory changes in cell size meaning that the set point for cell volume regulation is under phys...... as key players in the maintenance of normal steady-state cell volume, with particular emphasis on the intracellular signalling pathways responsible for their regulation during hypotonic stress, cell proliferation and apoptosis....
Cdc42 regulates epithelial cell polarity and cytoskeletal function during kidney tubule development
DEFF Research Database (Denmark)
Elias, Bertha C; Das, Amrita; Parekh, Diptiben V
2015-01-01
The Rho GTPase Cdc42 regulates key signaling pathways required for multiple cell functions, including maintenance of shape, polarity, proliferation, migration, differentiation and morphogenesis. Although previous studies have shown that Cdc42 is required for proper epithelial development and main......The Rho GTPase Cdc42 regulates key signaling pathways required for multiple cell functions, including maintenance of shape, polarity, proliferation, migration, differentiation and morphogenesis. Although previous studies have shown that Cdc42 is required for proper epithelial development...
Regulatory barriers blocking standardization of interoperability.
Zhong, Daidi; Kirwan, Michael J; Duan, Xiaolian
2013-07-12
Developing and implementing a set of personal health device interoperability standards is key to cultivating a healthy global industry ecosystem. The standardization organizations, including the Institute of Electrical and Electronics Engineers 11073 Personal Health Device Workgroup (IEEE 11073-PHD WG) and Continua Health Alliance, are striving for this purpose. However, factors like the medial device regulation, health policy, and market reality have placed non-technical barriers over the adoption of technical standards throughout the industry. These barriers have significantly impaired the motivations of consumer device vendors who desire to enter the personal health market and the overall success of personal health industry ecosystem. In this paper, we present the affect that these barriers have placed on the health ecosystem. This requires immediate action from policy makers and other stakeholders. The current regulatory policy needs to be updated to reflect the reality and demand of consumer health industry. Our hope is that this paper will draw wide consensus amongst its readers, policy makers, and other stakeholders.
Quantum finance Hamiltonian for coupon bond European and barrier options.
Baaquie, Belal E
2008-03-01
Coupon bond European and barrier options are financial derivatives that can be analyzed in the Hamiltonian formulation of quantum finance. Forward interest rates are modeled as a two-dimensional quantum field theory and its Hamiltonian and state space is defined. European and barrier options are realized as transition amplitudes of the time integrated Hamiltonian operator. The double barrier option for a financial instrument is "knocked out" (terminated with zero value) if the price of the underlying instrument exceeds or falls below preset limits; the barrier option is realized by imposing boundary conditions on the eigenfunctions of the forward interest rates' Hamiltonian. The price of the European coupon bond option and the zero coupon bond barrier option are calculated. It is shown that, is general, the constraint function for a coupon bond barrier option can -- to a good approximation -- be linearized. A calculation using an overcomplete set of eigenfunctions yields an approximate price for the coupon bond barrier option, which is given in the form of an integral of a factor that results from the barrier condition times another factor that arises from the payoff function.
Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y
2010-01-01
Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.
Regulation of K-Cl cotransport: from function to genes.
Adragna, N C; Di Fulvio, M; Lauf, P K
2004-10-01
This review intends to summarize the vast literature on K-Cl cotransport (COT) regulation from a functional and genetic viewpoint. Special attention has been given to the signaling pathways involved in the transporter's regulation found in several tissues and cell types, and more specifically, in vascular smooth muscle cells (VSMCs). The number of publications on K-Cl COT has been steadily increasing since its discovery at the beginning of the 1980s, with red blood cells (RBCs) from different species (human, sheep, dog, rabbit, guinea pig, turkey, duck, frog, rat, mouse, fish, and lamprey) being the most studied model. Other tissues/cell types under study are brain, kidney, epithelia, muscle/smooth muscle, tumor cells, heart, liver, insect cells, endothelial cells, bone, platelets, thymocytes and Leishmania donovani. One of the salient properties of K-Cl-COT is its activation by cell swelling and its participation in the recovery of cell volume, a process known as regulatory volume decrease (RVD). Activation by thiol modification with N-ethylmaleimide (NEM) has spawned investigations on the redox dependence of K-Cl COT, and is used as a positive control for the operation of the system in many tissues and cells. The most accepted model of K-Cl COT regulation proposes protein kinases and phosphatases linked in a chain of phosphorylation/dephosphorylation events. More recent studies include regulatory pathways involving the phosphatidyl inositol/protein kinase C (PKC)-mediated pathway for regulation by lithium (Li) in low-K sheep red blood cells (LK SRBCs), and the nitric oxide (NO)/cGMP/protein kinase G (PKG) pathway as well as the platelet-derived growth factor (PDGF)-mediated mechanism in VSMCs. Studies on VSM transfected cells containing the PKG catalytic domain demonstrated the participation of this enzyme in K-Cl COT regulation. Commonly used vasodilators activate K-Cl COT in a dose-dependent manner through the NO/cGMP/PKG pathway. Interaction between the
Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura
2015-01-13
Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.
Ngkelo, Anta; Richart, Adèle; Kirk, Jonathan A; Bonnin, Philippe; Vilar, Jose; Lemitre, Mathilde; Marck, Pauline; Branchereau, Maxime; Le Gall, Sylvain; Renault, Nisa; Guerin, Coralie; Ranek, Mark J; Kervadec, Anaïs; Danelli, Luca; Gautier, Gregory; Blank, Ulrich; Launay, Pierre; Camerer, Eric; Bruneval, Patrick; Menasche, Philippe; Heymes, Christophe; Luche, Elodie; Casteilla, Louis; Cousin, Béatrice; Rodewald, Hans-Reimer; Kass, David A; Silvestre, Jean-Sébastien
2016-06-27
Acute myocardial infarction (MI) is a severe ischemic disease responsible for heart failure and sudden death. Inflammatory cells orchestrate postischemic cardiac remodeling after MI. Studies using mice with defective mast/stem cell growth factor receptor c-Kit have suggested key roles for mast cells (MCs) in postischemic cardiac remodeling. Because c-Kit mutations affect multiple cell types of both immune and nonimmune origin, we addressed the impact of MCs on cardiac function after MI, using the c-Kit-independent MC-deficient (Cpa3(Cre/+)) mice. In response to MI, MC progenitors originated primarily from white adipose tissue, infiltrated the heart, and differentiated into mature MCs. MC deficiency led to reduced postischemic cardiac function and depressed cardiomyocyte contractility caused by myofilament Ca(2+) desensitization. This effect correlated with increased protein kinase A (PKA) activity and hyperphosphorylation of its targets, troponin I and myosin-binding protein C. MC-specific tryptase was identified to regulate PKA activity in cardiomyocytes via protease-activated receptor 2 proteolysis. This work reveals a novel function for cardiac MCs modulating cardiomyocyte contractility via alteration of PKA-regulated force-Ca(2+) interactions in response to MI. Identification of this MC-cardiomyocyte cross-talk provides new insights on the cellular and molecular mechanisms regulating the cardiac contractile machinery and a novel platform for therapeutically addressable regulators. ©2016 Ngkelo et al.
Fusion barrier distributions and fission anisotropies
International Nuclear Information System (INIS)
Hinde, D.J.; Morton, C.R.; Dasgupta, M.; Leigh, J.R.; Lestone, J.P.; Lemmon, R.C.; Mein, J.C.; Newton, J.O.; Timmers, H.; Rowley, N.; Kruppa, A.T.
1995-01-01
Fusion excitation functions for 16,17 O+ 144 Sm have been measured to high precision. The extracted fusion barrier distributions show a double-peaked structure interpreted in terms of coupling to inelastic collective excitations of the target. The effect of the positive Q-value neutron stripping channel is evident in the reaction with 17 O. Fission and evaporation residue cross-sections and excitation functions have been measured for the reaction of 16 O+ 208 Pb and the fusion barrier distribution and fission anisotropies determined. It is found that the moments of the fusion l-distribution determined from the fusion and fission measurements are in good agreement. ((orig.))
Functional Two-Dimensional Coordination Polymeric Layer as a Charge Barrier in Li–S Batteries
Huang, Jing-Kai
2018-01-04
Ultrathin two-dimensional (2D) polymeric layers are capable of separating gases and molecules based on the reported size exclusion mechanism. What is equally important but missing today is an exploration of the 2D layers with charge functionality, which enables applications using the charge exclusion principle. This work demonstrates a simple and scalable method of synthesizing a free-standing 2D coordination polymer Zn2(benzimidazolate)2(OH)2 at the air–water interface. The hydroxyl (−OH) groups are stoichiometrically coordinated and implement electrostatic charges in the 2D structures, providing powerful functionality as a charge barrier. Electrochemical performance of the Li–S battery shows that the Zn2(benzimidazolate)2(OH)2 coordination polymer layers efficiently mitigate the polysulfide shuttling effects and largely enhance the battery capacity and cycle performance. The synthesis of the proposed coordination polymeric layers is simple, scalable, cost saving, and promising for practical use in batteries.
Thyroid hormone is required for hypothalamic neurons regulating cardiovascular functions
Mittag, J.; Lyons, D.J.; Sällström, J.; Vujoviv, M.; Dudazy-Gralla, S.; Warner, A.; Wallis, K.; Alkemade, A.; Nordström, K.; Monyer, H.; Broberger, C.; Arner, A.; Vennström, B.
2013-01-01
Thyroid hormone is well known for its profound direct effects on cardiovascular function and metabolism. Recent evidence, however, suggests that the hormone also regulates these systems indirectly through the central nervous system. While some of the molecular mechanisms underlying the hormone’s
The adventitia: essential regulator of vascular wall structure and function.
Stenmark, Kurt R; Yeager, Michael E; El Kasmi, Karim C; Nozik-Grayck, Eva; Gerasimovskaya, Evgenia V; Li, Min; Riddle, Suzette R; Frid, Maria G
2013-01-01
The vascular adventitia acts as a biological processing center for the retrieval, integration, storage, and release of key regulators of vessel wall function. It is the most complex compartment of the vessel wall and is composed of a variety of cells, including fibroblasts, immunomodulatory cells (dendritic cells and macrophages), progenitor cells, vasa vasorum endothelial cells and pericytes, and adrenergic nerves. In response to vascular stress or injury, resident adventitial cells are often the first to be activated and reprogrammed to influence the tone and structure of the vessel wall; to initiate and perpetuate chronic vascular inflammation; and to stimulate expansion of the vasa vasorum, which can act as a conduit for continued inflammatory and progenitor cell delivery to the vessel wall. This review presents the current evidence demonstrating that the adventitia acts as a key regulator of vascular wall function and structure from the outside in.
Pigrau, M; Rodiño-Janeiro, B K; Casado-Bedmar, M; Lobo, B; Vicario, M; Santos, J; Alonso-Cotoner, C
2016-04-01
Intestinal homeostasis is a dynamic process that takes place at the interface between the lumen and the mucosa of the gastrointestinal tract, where a constant scrutiny for antigens and toxins derived from food and microorganisms is carried out by the vast gut-associated immune system. Intestinal homeostasis is preserved by the ability of the mucus layer and the mucosal barrier to keep the passage of small-sized and antigenic molecules across the epithelium highly selective. When combined and preserved, immune surveillance and barrier's selective permeability, the host capacity of preventing the development of intestinal inflammation is optimized, and viceversa. In addition, the brain-gut-microbiome axis, a multidirectional communication system that integrates distant and local regulatory networks through neural, immunological, metabolic, and hormonal signaling pathways, also regulates intestinal function. Dysfunction of the brain-gut-microbiome axis may induce the loss of gut mucosal homeostasis, leading to uncontrolled permeation of toxins and immunogenic particles, increasing the risk of appearance of intestinal inflammation, mucosal damage, and gut disorders. Irritable bowel syndrome is prevalent stress-sensitive gastrointestinal disorder that shows a female predominance. Interestingly, the role of stress, sex and gonadal hormones in the regulation of intestinal mucosal and the brain-gut-microbiome axis functioning is being increasingly recognized. We aim to critically review the evidence linking sex, and stress to intestinal barrier and brain-gut-microbiome axis dysfunction and the implications for irritable bowel syndrome. © 2015 John Wiley & Sons Ltd.
Robinson, J M; Henderson, W A
2018-01-12
We report a method using functional-molecular databases and network modelling to identify hypothetical mRNA-miRNA interaction networks regulating intestinal epithelial barrier function. The model forms a data-analysis component of our cell culture experiments, which produce RNA expression data from Nanostring Technologies nCounter ® system. The epithelial tight-junction (TJ) and actin cytoskeleton interact as molecular components of the intestinal epithelial barrier. Upstream regulation of TJ-cytoskeleton interaction is effected by the Rac/Rock/Rho signaling pathway and other associated pathways which may be activated or suppressed by extracellular signaling from growth factors, hormones, and immune receptors. Pathway activations affect epithelial homeostasis, contributing to degradation of the epithelial barrier associated with osmotic dysregulation, inflammation, and tumor development. The complexity underlying miRNA-mRNA interaction networks represents a roadblock for prediction and validation of competing-endogenous RNA network function. We developed a network model to identify hypothetical co-regulatory motifs in a miRNA-mRNA interaction network related to epithelial function. A mRNA-miRNA interaction list was generated using KEGG and miRWalk2.0 databases. R-code was developed to quantify and visualize inherent network structures. We identified a sub-network with a high number of shared, targeting miRNAs, of genes associated with cellular proliferation and cancer, including c-MYC and Cyclin D.
OCA-B regulation of B-cell development and function.
Teitell, Michael A
2003-10-01
The transcriptional co-activator OCA-B [for Oct co-activator from B cells, also known as OBF-1 (OCT-binding factor-1) and Bob1] is not required for B-cell genesis but does regulate subsequent B-cell development and function. OCA-B deficient mice show strain-specific, partial blocks at multiple stages of B-cell maturation and a complete disruption of germinal center formation in all strains, causing humoral immune deficiency and susceptibility to infection. OCA-B probably exerts its effects through the regulation of octamer-motif controlled gene expression. The OCA-B gene encodes two proteins of distinct molecular weight, designated p34 and p35. The p34 isoform localizes in the nucleus, whereas the p35 isoform is myristoylated and is bound to the cytoplasmic membrane. p35 can traffic to the nucleus and probably activates octamer-dependent transcription, although this OCA-B isoform might regulate B cells through membrane-related signal transduction.
Transcription Factor Foxo1 Is a Negative Regulator of NK Cell Maturation and Function
Deng, Youcai; Kerdiles, Yann; Chu, Jianhong; Yuan, Shunzong; Wang, Youwei; Chen, Xilin; Mao, Hsiaoyin; Zhang, Lingling; Zhang, Jianying; Hughes, Tiffany; Deng, Yafei; Zhang, Qi; Wang, Fangjie; Zou, Xianghong; Liu, Chang-Gong; Freud, Aharon G.; Li, Xiaohui; Caligiuri, Michael A; Vivier, Eric; Yu, Jianhua
2015-01-01
SUMMARY Little is known about the role of negative regulators in controlling natural killer (NK) cell development and effector functions. Foxo1 is a multifunctional transcription factor of the forkhead family. Using a mouse model of conditional deletion in NK cells, we found that Foxo1 negatively controlled NK cell differentiation and function. Immature NK cells expressed abundant Foxo1 and little Tbx21 relative to mature NK cells, but these two transcription factors reversed their expression as NK cells proceeded through development. Foxo1 promoted NK cell homing to lymph nodes through upregulating CD62L expression, and impaired late-stage maturation and effector functions by repressing Tbx21 expression. Loss of Foxo1 rescued the defect in late-stage NK cell maturation in heterozygous Tbx21+/− mice. Collectively, our data reveal a regulatory pathway by which the negative regulator Foxo1 and the positive regulator Tbx21 play opposing roles in controlling NK cell development and effector functions. PMID:25769609
Permeability measurement of some barrier materials as a function of temperature and pressure
International Nuclear Information System (INIS)
Maqsood, M.; Faisal, S.; Ali, J.; Usman, A.; Alamgir, K.; Farooq, K.
2011-01-01
Barrier materials possess the ability to restrict the passage of gases, vapors, and organic liquids through their boundaries. These barrier materials have large number of applications in industry and scientific research. To measure the permeability of barrier materials, a specific gas flow system has been developed, pure helium gas is used to measure the back ground reading through SS-316. The permeability and break-through time has been measured through Inconel X-750, NBR and Viton below and above the atmospheric pressure and at different temperatures 20 deg. C, 40 deg. C and 70 deg. C. (author)
Occupational health regulations and health workers: protection or vulnerability?
Lethbridge, Jane
2008-01-01
Several trade agreements include occupational health and safety regulations but there are many barriers to implementation. Mechanisms for sanctions are often weak but the lack of political will is the biggest barrier.
Glucose regulation and cognitive function after bariatric surgery.
Galioto, Rachel; Alosco, Michael L; Spitznagel, Mary Beth; Strain, Gladys; Devlin, Michael; Cohen, Ronald; Crosby, Ross D; Mitchell, James E; Gunstad, John
2015-01-01
Obesity is associated with cognitive impairment, and bariatric surgery has been shown to improve cognitive functioning. Rapid improvements in glycemic control are common after bariatric surgery and likely contribute to these cognitive gains. We examined whether improvements in glucose regulation are associated with better cognitive function following bariatric surgery. A total of 85 adult bariatric surgery patients underwent computerized cognitive testing and fasting blood draw for glucose, insulin, and glycated hemoglobin (HbA1c) at baseline and 12 months postoperatively. Significant improvements in both cognitive function and glycemic control were observed among patients. After controlling for baseline factors, 12-month homeostatic model assessment of insulin resistance HOMA-IR predicted 12-month digits backward (β = -.253, p cognitive flexibility improved. Decreases in HbA1c were not associated with postoperative cognitive improvements. After controlling for baseline cognitive test performance, changes in body mass index (BMI) were also not associated with 12-month cognitive function. Small effects of improved glycemic control on improved aspects of attention and executive function were observed following bariatric surgery among severely obese individuals. Future research is needed to identify the underlying mechanisms for the neurocognitive benefits of these procedures.
Electron tunneling across a tunable potential barrier
International Nuclear Information System (INIS)
Mangin, A; Anthore, A; Rocca, M L Della; Boulat, E; Lafarge, P
2009-01-01
We present an experiment where the elementary quantum electron tunneling process should be affected by an independent gate voltage parameter. We have realized nanotransistors where the source and drain electrodes are created by electromigration inducing a nanometer sized gap acting as a tunnel barrier. The barrier potential shape is in first approximation considered trapezoidal. The application of a voltage to the gate electrode close to the barrier region can in principle affect the barrier shape. Simulations of the source drain tunnel current as a function of the gate voltage predict modulations as large as one hundred percent. The difficulty of observing the predicted behaviour in our samples might be due to the peculiar geometry of the realized tunnel junction.
Rac1 Regulates Endometrial Secretory Function to Control Placental Development
Davila, Juanmahel; Laws, Mary J.; Kannan, Athilakshmi; Li, Quanxi; Taylor, Robert N.; Bagchi, Milan K.; Bagchi, Indrani C.
2015-01-01
During placenta development, a succession of complex molecular and cellular interactions between the maternal endometrium and the developing embryo ensures reproductive success. The precise mechanisms regulating this maternal-fetal crosstalk remain unknown. Our study revealed that the expression of Rac1, a member of the Rho family of GTPases, is markedly elevated in mouse decidua on days 7 and 8 of gestation. To investigate its function in the uterus, we created mice bearing a conditional deletion of the Rac1 gene in uterine stromal cells. Ablation of Rac1 did not affect the formation of the decidua but led to fetal loss in mid gestation accompanied by extensive hemorrhage. To gain insights into the molecular pathways affected by the loss of Rac1, we performed gene expression profiling which revealed that Rac1 signaling regulates the expression of Rab27b, another GTPase that plays a key role in targeting vesicular trafficking. Consequently, the Rac1-null decidual cells failed to secrete vascular endothelial growth factor A, which is a critical regulator of decidual angiogenesis, and insulin-like growth factor binding protein 4, which regulates the bioavailability of insulin-like growth factors that promote proliferation and differentiation of trophoblast cell lineages in the ectoplacental cone. The lack of secretion of these key factors by Rac1-null decidua gave rise to impaired angiogenesis and dysregulated proliferation of trophoblast cells, which in turn results in overexpansion of the trophoblast giant cell lineage and disorganized placenta development. Further experiments revealed that RAC1, the human ortholog of Rac1, regulates the secretory activity of human endometrial stromal cells during decidualization, supporting the concept that this signaling G protein plays a central and conserved role in controlling endometrial secretory function. This study provides unique insights into the molecular mechanisms regulating endometrial secretions that mediate stromal
Rac1 Regulates Endometrial Secretory Function to Control Placental Development.
Directory of Open Access Journals (Sweden)
Juanmahel Davila
2015-08-01
Full Text Available During placenta development, a succession of complex molecular and cellular interactions between the maternal endometrium and the developing embryo ensures reproductive success. The precise mechanisms regulating this maternal-fetal crosstalk remain unknown. Our study revealed that the expression of Rac1, a member of the Rho family of GTPases, is markedly elevated in mouse decidua on days 7 and 8 of gestation. To investigate its function in the uterus, we created mice bearing a conditional deletion of the Rac1 gene in uterine stromal cells. Ablation of Rac1 did not affect the formation of the decidua but led to fetal loss in mid gestation accompanied by extensive hemorrhage. To gain insights into the molecular pathways affected by the loss of Rac1, we performed gene expression profiling which revealed that Rac1 signaling regulates the expression of Rab27b, another GTPase that plays a key role in targeting vesicular trafficking. Consequently, the Rac1-null decidual cells failed to secrete vascular endothelial growth factor A, which is a critical regulator of decidual angiogenesis, and insulin-like growth factor binding protein 4, which regulates the bioavailability of insulin-like growth factors that promote proliferation and differentiation of trophoblast cell lineages in the ectoplacental cone. The lack of secretion of these key factors by Rac1-null decidua gave rise to impaired angiogenesis and dysregulated proliferation of trophoblast cells, which in turn results in overexpansion of the trophoblast giant cell lineage and disorganized placenta development. Further experiments revealed that RAC1, the human ortholog of Rac1, regulates the secretory activity of human endometrial stromal cells during decidualization, supporting the concept that this signaling G protein plays a central and conserved role in controlling endometrial secretory function. This study provides unique insights into the molecular mechanisms regulating endometrial secretions
RNA-Mediated Regulation of HMGA1 Function
Directory of Open Access Journals (Sweden)
Arndt G. Benecke
2015-05-01
Full Text Available The high mobility group protein A1 (HMGA1 is a master regulator of chromatin structure mediating its major gene regulatory activity by direct interactions with A/T-rich DNA sequences located in the promoter and enhancer regions of a large variety of genes. HMGA1 DNA-binding through three AT-hook motifs results in an open chromatin structure and subsequently leads to changes in gene expression. Apart from its significant expression during development, HMGA1 is over-expressed in virtually every cancer, where HMGA1 expression levels correlate with tumor malignancy. The exogenous overexpression of HMGA1 can lead to malignant cell transformation, assigning the protein a key role during cancerogenesis. Recent studies have unveiled highly specific competitive interactions of HMGA1 with cellular and viral RNAs also through an AT-hook domain of the protein, significantly impacting the HMGA1-dependent gene expression. In this review, we discuss the structure and function of HMGA1-RNA complexes during transcription and epigenomic regulation and their implications in HMGA1-related diseases.
Regulation of Central Nervous System Myelination in Higher Brain Functions
Directory of Open Access Journals (Sweden)
Mara Nickel
2018-01-01
Full Text Available The hippocampus and the prefrontal cortex are interconnected brain regions, playing central roles in higher brain functions, including learning and memory, planning complex cognitive behavior, and moderating social behavior. The axons in these regions continue to be myelinated into adulthood in humans, which coincides with maturation of personality and decision-making. Myelin consists of dense layers of lipid membranes wrapping around the axons to provide electrical insulation and trophic support and can profoundly affect neural circuit computation. Recent studies have revealed that long-lasting changes of myelination can be induced in these brain regions by experience, such as social isolation, stress, and alcohol abuse, as well as by neurological and psychiatric abnormalities. However, the mechanism and function of these changes remain poorly understood. Myelin regulation represents a new form of neural plasticity. Some progress has been made to provide new mechanistic insights into activity-independent and activity-dependent regulations of myelination in different experimental systems. More extensive investigations are needed in this important but underexplored research field, in order to shed light on how higher brain functions and myelination interplay in the hippocampus and prefrontal cortex.
Mujagic, Zlatan; Vos, De Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm J.H.M.; Wit, De Nicole J.W.; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.
2017-01-01
The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein
Mujagic, Zlatan; Vos, de Paul; Boekschoten, Mark; Govers, Coen; Pieters, Harm J.H.M.; Wit, de Nicole; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.
2017-01-01
The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein rearrangement,
Mujagic, Zlatan; de Vos, Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm-Jan H M; de Wit, Nicole J. W.; Bron, Peter A.; Masclee, Ad A M; Troost, Freddy J
2017-01-01
The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein
Identification of raw as a regulator of glial development.
Directory of Open Access Journals (Sweden)
Diana Luong
Full Text Available Glial cells perform numerous functions to support neuron development and function, including axon wrapping, formation of the blood brain barrier, and enhancement of synaptic transmission. We have identified a novel gene, raw, which functions in glia of the central and peripheral nervous systems in Drosophila. Reducing Raw levels in glia results in morphological defects in the brain and ventral nerve cord, as well as defects in neuron function, as revealed by decreased locomotion in crawling assays. Examination of the number of glia along peripheral nerves reveals a reduction in glial number upon raw knockdown. The reduced number of glia along peripheral nerves occurs as a result of decreased glial proliferation. As Raw has been shown to negatively regulate Jun N-terminal kinase (JNK signaling in other developmental contexts, we examined the expression of a JNK reporter and the downstream JNK target, matrix metalloproteinase 1 (mmp1, and found that raw knockdown results in increased reporter activity and Mmp1 levels. These results are consistent with previous studies showing increased Mmp levels lead to nerve cord defects similar to those observed upon raw knockdown. In addition, knockdown of puckered, a negative feedback regulator of JNK signaling, also causes a decrease in glial number. Thus, our studies have resulted in the identification of a new regulator of gliogenesis, and demonstrate that increased JNK signaling negatively impacts glial development.
Huet, Eric; Vallée, Benoit; Delbé, Jean; Mourah, Samia; Prulière-Escabasse, Virginie; Tremouilleres, Magali; Kadomatsu, Kenji; Doan, Serge; Baudouin, Christophe; Menashi, Suzanne; Gabison, Eric E
2011-09-01
Dry eye is a common disease that develops as a result of alteration of tear fluid, leading to osmotic stress and a perturbed epithelial barrier. Matrix metalloproteinase-9 (MMP-9) may be important in dry eye disease, as its genetic knockout conferred resistance to the epithelial disruption. We show that extracellular matrix metalloproteinase inducer (EMMPRIN; also termed CD147), an inducer of MMP expression, participates in the pathogenesis of dry eye through MMP-mediated cleavage of occludin, an important component of tight junctions. EMMPRIN expression was increased on the ocular surface of dry eye patients and correlated with those of MMP-9. High osmolarity in cell culture, mimicking dry eye conditions, increased both EMMPRIN and MMP-9 and resulted in the disruption of epithelial junctions through the cleavage of occludin. Exogenously added recombinant EMMPRIN had similar effects that were abrogated in the presence of the MMP inhibitor marimastat. Membrane occludin immunostaining was markedly increased in the apical corneal epithelium of both EMMPRIN and MMP-9 knock-out mice. Furthermore, an inverse correlation between EMMPRIN and occludin membrane staining was consistently observed both in vitro and in vivo as a function of corneal epithelial cells differentiation. These data suggest a possible role of EMMPRIN in regulating the amount of occludin at the cell surface in homeostasis beyond pathological situations such as dry eye disease, and EMMPRIN may be essential for the formation and maintenance of organized epithelial structure. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice
Yang, Siming; Gu, Changping; Mandeville, Emiri T.; Dong, Yuanlin; Esposito, Elga; Zhang, Yiying; Yang, Guang; Shen, Yuan; Fu, Xiaobing; Lo, Eng H.; Xie, Zhongcong
2017-01-01
Blood–brain barrier (BBB) dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy) under 1.4% isoflurane anesthesia (anesthesia/surgery) for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL)-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification), and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium. PMID:28848542
Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice
Directory of Open Access Journals (Sweden)
Siming Yang
2017-08-01
Full Text Available Blood–brain barrier (BBB dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy under 1.4% isoflurane anesthesia (anesthesia/surgery for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification, and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium.
Establishment and function of tissue-resident innate lymphoid cells in the skin
Directory of Open Access Journals (Sweden)
Jie Yang
2017-03-01
Full Text Available ABSTRACT Innate lymphoid cells (ILCs are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.
Establishment and function of tissue-resident innate lymphoid cells in the skin.
Yang, Jie; Zhao, Luming; Xu, Ming; Xiong, Na
2017-07-01
Innate lymphoid cells (ILCs) are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.
The intestinal complement system in inflammatory bowel disease: Shaping intestinal barrier function.
Sina, Christian; Kemper, Claudia; Derer, Stefanie
2018-06-01
The complement system is part of innate sensor and effector systems such as the Toll-like receptors (TLRs). It recognizes and quickly systemically and/or locally respond to microbial-associated molecular patterns (MAMPs) with a tailored defense reaction. MAMP recognition by intestinal epithelial cells (IECs) and appropriate immune responses are of major importance for the maintenance of intestinal barrier function. Enterocytes highly express various complement components that are suggested to be pivotal for proper IEC function. Appropriate activation of the intestinal complement system seems to play an important role in the resolution of chronic intestinal inflammation, while over-activation and/or dysregulation may worsen intestinal inflammation. Mice deficient for single complement components suffer from enhanced intestinal inflammation mimicking the phenotype of patients with chronic inflammatory bowel disease (IBD) such as Crohn's disease (CD) or ulcerative colitis (UC). However, the mechanisms leading to complement expression in IECs seem to differ markedly between UC and CD patients. Hence, how IECs, intestinal bacteria and epithelial cell expressed complement components interact in the course of IBD still remains to be mostly elucidated to define potential unique patterns contributing to the distinct subtypes of intestinal inflammation observed in CD and UC. Copyright © 2018 Elsevier Ltd. All rights reserved.
Regulation of T cell differentiation and function by EZH2
Directory of Open Access Journals (Sweden)
THEODOROS KARANTANOS
2016-05-01
Full Text Available The enhancer of zeste homologue 2 (EZH2, one of the polycomb group (PcG proteins, is the catalytic subunit of Polycomb-repressive complex 2 (PRC2 and induces the trimethylation of the histone H3 lysine 27 (H3K27me3 promoting epigenetic gene silencing. EZH2 contains a SET domain promoting the methyltransferase activity while the three other protein components of PRC2, namely EED, SUZ12 and RpAp46/48 induce compaction of the chromatin permitting EZH2 enzymatic activity. Numerous studies highlight the role of this evolutionary conserved protein as a master regulator of differentiation in humans involved in the repression of the homeotic (Hox gene and the inactivation of X-chromosome. Through its effects in the epigenetic regulation of critical genes, EZH2 has been strongly linked to cell cycle progression, stem cell pluripotency and cancer biology. Most recently, EZH2 has been associated with hematopoietic stem cell proliferation and differentiation, thymopoiesis and lymphopoiesis. Several studies have evaluated the role of EZH2 in the regulation of T cell differentiation and plasticity as well as its implications in the development of autoimmune diseases and graft versus host disease (GvHD. In this review we will briefly summarize the current knowledge regarding the role of EZH2 in the regulation of T cell differentiation, effector function and homing in the tumor microenvironment and we will discuss possible therapeutic targeting of EZH2 in order to alter T cell immune functions.
Franz, R
2002-01-01
Stimulated by new ecology-driven European and national regulations, news routes of recycling waste appear on the market. Since food packages represent a large percentage of the plastics consumption and since they have a short lifetime, an important approach consists in making new packages from post-consumer used packages. On the other hand, food-packaging regulations in Europe require that packaging materials must be safe. Therefore, potential mass transfer (migration) of harmful recycling-related substances to the food must be excluded and test methods to ensure the safety-in-use of recycled materials for food packaging are needled. As a consequence of this situation, a European research project FAIR-CT98-4318, with the acronym 'Recyclability', was initiated. The project consists of three sections each focusing on a different class of recycled materials: polyethylene terephthalate (PET), paper and board, and plastics covered by functional barriers. The project consortium consists of 28 project members from 11 EU countries. In addition, the project is during its lifetime in discussion with the US Food and Drug Administrations (FDA) to consider also US FDA regulatory viewpoints and to aim, as a consequence, to harmonizable conclusions and recommendations. The paper introduces the project and presents an overview of the project work progress.
Functioning of spontaneous and induced Con A regulators of T-cell proliferation. Modifying factors
International Nuclear Information System (INIS)
Kuz'mina, E.G.
1989-01-01
It is shown that active spontaneous non-specific regulators of T-cell proliferation are activated in peripheral blood ''in vivo'' by endogenous metabolites; non-specific regulator action can be induced ''in vitro'' by Con A, FGA. Non-specific regulators suppress and increase lymphocyte proliferation. Cyclic character of their functioning is revealed. 4 refs.; 1 tab
Barriers to guideline-compliant psoriasis care: analyses and concepts.
Eissing, L; Radtke, M A; Zander, N; Augustin, M
2016-04-01
Despite the availability of effective therapeutics and evidence-based treatment guidelines, a substantial proportion of patients with moderate-to-severe psoriasis does not receive appropriate care. This under-provision of health care may cause further worsening of health, remarkable limitations of the patient's quality of life, and indirect costs for the health care system. In order to provide guideline-compliant care for every psoriasis patient, it is important to identify barriers obstructing optimal care. Studies have identified various barriers on the physician's and on the patient's side; however, respective studies approached only single barriers, and not all of them in the context of psoriasis. Other publications that describe barriers systematically did not focus on psoriasis either. The objective of this literature review was to identify barriers and facilitators, based on studies analysing quality of care and single barriers, resulting in a comprehensive model of causal factors. Our analyses revealed three categories of barriers - patient-related, physician-related and external factors: On the patient side, we found non-adherence to therapies to be an important barrier, often in close association with psychiatric factors. Barriers on the physician's side predominantly are incomplete knowledge of the guidelines as well as the complexity of psoriasis comorbidity. In some countries, payment for patients with complex disease status is poor and inconsistent reimbursement regulations potentially interfere with optimal care. The current analysis indicates that most barriers are interdependent. Thus, measures approaching related barriers simultaneously are required. To improve care for psoriasis patients, further studies systematically addressing all potentially relevant barriers in conjoint are needed. © 2015 European Academy of Dermatology and Venereology.
A theoretical study of resonant tunneling characteristics in triangular double-barrier diodes
International Nuclear Information System (INIS)
Wang Hongmei; Xu Huaizhe; Zhang Yafei
2006-01-01
Resonant tunneling characteristics of triangular double-barrier diodes have been investigated systematically in this Letter, using Airy function approach to solve time-independent Schroedinger function in triangular double-barrier structures. Originally, the exact analytic expressions of quasi-bound levels and quasi-level lifetime in symmetrical triangular double-barrier structures have been derived within the effective-mass approximation as a function of structure parameters including well width, slope width and barrier height. Based on our derived analytic expressions, numerical results show that quasi-bound levels and quasi-level lifetime vary nearly linearly with the structure parameters except that the second quasi-level lifetime changes parabolically with slope width. Furthermore, according to our improved transmission coefficient of triangular double-barrier structures under external electric field, the current densities of triangular double-barrier diodes with different slope width at 0 K have been calculated numerically. The results show that the N-shaped negative differential resistance behaviors have been observed in current-voltage characteristics and current-voltage characteristics depend on the slope width
International Nuclear Information System (INIS)
Heiser, J.; Siskind, B.
1993-01-01
One of the options for control of contaminant migration from buried waste sites is the construction of a subsurface barrier that consists of a wall of low permeability material. Subsurface barriers will improve remediation performance by removing pathways for contaminant transport due to groundwater movement, meteorological water infiltration, vapor- and gas-phase transport, transpiration, etc. Subsurface barriers may be used to open-quotes directclose quotes contaminant movement to collection sumps/lysimeters in cases of unexpected remediation failures or transport mechanisms, to contain leakage from underground storage tanks, and to restrict in-situ soil cleanup operation and chemicals. Brookhaven National Laboratory is currently investigating advanced polymer materials for subsurface barriers. This report addresses the regulatory aspects of using of non-traditional polymer materials as well as soil-bentonite or cement-bentonite mixtures for such barriers. The regulatory issues fall into two categories. The first category consists of issues associated with the acceptability of subsurface barriers to the Environmental Protection Agency (EPA) as a method for achieving waste site performance improvement. The second category encompasses those regulatory issues concerning health, safety and the environment which must be addressed regarding barrier installation and performance, especially if non-traditional materials are to be used. Since many of EPA's concerns regarding subsurface barriers focus on the chemicals used during installation of these barriers the authors discuss the results of a search of the Federal Register and the Code of Federal Regulations for references in Titles 29 and 40 pertaining to key chemicals likely to be utilized in installing non-traditional barrier materials. The use of polymeric materials in the construction industry has been accomplished with full compliance with the applicable health, safety, and environmental regulations
DEFF Research Database (Denmark)
Ballesteros-Martinez, Constanza; Mendez-Barbero, Nerea; Montalvo-Yuste, Alma
2017-01-01
Anaphylaxis, the most serious and life-threatening allergic reaction, produces the release of inflammatory mediators by mast cells and basophils. Regulator of calcineurin 1 (Rcan1) is a negative regulator of mast-cell degranulation. The action of mediators leads to vasodilation and an increase in...
Markers for blood-brain barrier integrity
DEFF Research Database (Denmark)
Saunders, Norman R; Dziegielewska, Katarzyna M; Møllgård, Kjeld
2015-01-01
In recent years there has been a resurgence of interest in brain barriers and various roles their intrinsic mechanisms may play in neurological disorders. Such studies require suitable models and markers to demonstrate integrity and functional changes at the interfaces between blood, brain......, and cerebrospinal fluid. Studies of brain barrier mechanisms and measurements of plasma volume using dyes have a long-standing history, dating back to the late nineteenth-century. Their use in blood-brain barrier studies continues in spite of their known serious limitations in in vivo applications. These were well...... known when first introduced, but seem to have been forgotten since. Understanding these limitations is important because Evans blue is still the most commonly used marker of brain barrier integrity and those using it seem oblivious to problems arising from its in vivo application. The introduction...
Phosphorylation regulates SIRT1 function.
Directory of Open Access Journals (Sweden)
Tsutomu Sasaki
Full Text Available BACKGROUND: SIR2 is an NAD(+-dependent deacetylase [1]-[3] implicated in the regulation of lifespan in species as diverse as yeast [4], worms [5], and flies [6]. We previously reported that the level of SIRT1, the mammalian homologue of SIR2 [7], [8], is coupled to the level of mitotic activity in cells both in vitro and in vivo[9]. Cells from long-lived mice maintained SIRT1 levels of young mice in tissues that undergo continuous cell replacement by proliferating stem cells. Changes in SIRT1 protein level were not associated with changes in mRNA level, suggesting that SIRT1 could be regulated post-transcriptionally. However, other than a recent report on sumoylation [10] and identification of SIRT1 as a nuclear phospho-protein by mass spectrometry [11], post-translational modifications of this important protein have not been reported. METHODOLOGY/PRINCIPAL FINDINGS: We identified 13 residues in SIRT1 that are phosphorylated in vivo using mass spectrometry. Dephosphorylation by phosphatases in vitro resulted in decreased NAD(+-dependent deacetylase activity. We identified cyclinB/Cdk1 as a cell cycle-dependent kinase that forms a complex with and phosphorylates SIRT1. Mutation of two residues phosphorylated by Cyclin B/Cdk1 (threonine 530 and serine 540 disturbs normal cell cycle progression and fails to rescue proliferation defects in SIRT1-deficient cells [12], [13]. CONCLUSIONS/SIGNIFICANCE: Pharmacological manipulation of SIRT1 activity is currently being tested as a means of extending lifespan in mammals. Treatment of obese mice with resveratrol, a pharmacological activator of SIRT1, modestly but significantly improved longevity and, perhaps more importantly, offered some protection against the development of type 2 diabetes mellitus and metabolic syndrome [14]-[16]. Understanding the endogenous mechanisms that regulate the level and activity of SIRT1, therefore, has obvious relevance to human health and disease. Our results identify
Overcoming regulatory barriers: DOE environmental technology development program
International Nuclear Information System (INIS)
Kurtyka, B.M.; Clodfelter-Schumack, K.; Evans, T.T.
1995-01-01
The potential to improve environmental conditions via compliance or restoration is directly related to the ability to produce and apply innovative technological solutions. However, numerous organizations, including the US General Accounting Office (GAO), the EPA National Advisory Council for Environmental Policy and Technology (NACEPT), the DOE Environmental Management Advisory Board (EMAB), and the National Science and Technology Council (NSTC) have determined that significant regulatory barriers exist that inhibit the development and application of these technologies. They have noted the need for improved efforts in identifying and rectifying these barriers for the purpose of improving the technology development process, providing innovative alternatives, and enhancing the likelihood of technology acceptance by all. These barriers include, among others, regulator and user bias against ''unknown/unproven'' technologies; multi-level/multi-media permit disincentives; potential liability of developers and users for failed implementation; wrongly defined or inadequate data quality objectives: and lack of customer understanding and input. The ultimate goal of technology development is the utilization of technologies. This paper will present information on a number of regulatory barriers hindering DOE's environmental technology development program and describe DOE efforts to address these barriers
International Nuclear Information System (INIS)
Kharab, Rajesh; Chahal, Rajiv; Kumar, Rajiv
2017-01-01
In the present work we have analyzed the fusion excitation function for CF process using the simple Wong’s formula in conjunction with the energy dependent Woods-Saxon potential (EDWSP) in near barrier energy region for 7 Li+ 152 Sm, 197 Au and 209 Bi reactions
Functions and regulation of the multitasking FANCM family of DNA motor proteins.
Xue, Xiaoyu; Sung, Patrick; Zhao, Xiaolan
2015-09-01
Members of the conserved FANCM family of DNA motor proteins play key roles in genome maintenance processes. FANCM supports genome duplication and repair under different circumstances and also functions in the ATR-mediated DNA damage checkpoint. Some of these roles are shared among lower eukaryotic family members. Human FANCM has been linked to Fanconi anemia, a syndrome characterized by cancer predisposition, developmental disorder, and bone marrow failure. Recent studies on human FANCM and its orthologs from other organisms have provided insights into their biological functions, regulation, and collaboration with other genome maintenance factors. This review summarizes the progress made, with the goal of providing an integrated view of the functions and regulation of these enzymes in humans and model organisms and how they advance our understanding of genome maintenance processes. © 2015 Xue et al.; Published by Cold Spring Harbor Laboratory Press.
Lorentz, C Adam; Liang, Zhe; Meng, Mei; Chen, Ching-Wen; Yoseph, Benyam P; Breed, Elise R; Mittal, Rohit; Klingensmith, Nathan J; Farris, Alton B; Burd, Eileen M; Koval, Michael; Ford, Mandy L; Coopersmith, Craig M
2017-06-07
Sepsis-induced intestinal hyperpermeability is mediated by disruption of the epithelial tight junction, which is closely associated with the peri-junctional actin-myosin ring. Myosin light chain kinase (MLCK) phosphorylates the myosin regulatory light chain, resulting in increased permeability. The purpose of this study was to determine whether genetic deletion of MLCK would alter gut barrier function and survival from sepsis. MLCK -/- and wild type (WT) mice were subjected to cecal ligation and puncture and assayed for both survival and mechanistic studies. Survival was significantly increased in MLCK -/- mice (95% vs. 24%, p<0.0001). Intestinal permeability increased in septic WT mice compared to unmanipulated mice. In contrast, permeability in septic MLCK -/- mice was similar to that seen in unmanipulated animals. Improved gut barrier function in MLCK -/- mice was associated with increases in the tight junction mediators ZO-1 and claudin 15 without alterations in claudin 1, 2, 3, 4, 5, 7, 8, 13, occludin or JAM-A. Other components of intestinal integrity (apoptosis, proliferation and villus length) were unaffected by MLCK deletion as were local peritoneal inflammation and distant lung injury. Systemic IL-10 was decreased greater than 10-fold in MLCK -/- mice; however, survival was similar between septic MLCK -/- mice given exogenous IL-10 or vehicle. These data demonstrate that deletion of MLCK improves survival following sepsis, associated with normalization of intestinal permeability and selected tight junction proteins.
Directory of Open Access Journals (Sweden)
D. R. Staines
2008-01-01
Full Text Available Vasoactive neuropeptides (VNs such as pituitary adenylate cyclase-activating polypeptide (PACAP and vasoactive intestinal peptide (VIP have critical roles as neurotransmitters, vasodilators including perfusion and hypoxia regulators, as well as immune and nociception modulators. They have key roles in blood vessels in the central nervous system (CNS including maintaining functional integrity of the blood brain barrier (BBB and blood spinal barrier (BSB. VNs are potent activators of adenylate cyclase and thus also have a key role in cyclic AMP production affecting regulatory T cell and other immune functions. Virchow-Robin spaces (VRSs are perivascular compartments surrounding small vessels within the CNS and contain VNs. Autoimmunity of VNs or VN receptors may affect BBB and VRS function and, therefore, may contribute to the aetiology of neurological-related conditions including multiple sclerosis, Parkinson's disease, and amyotrophic lateral sclerosis. VN autoimmunity will likely affect CNS and immunological homeostasis. Various pharmacological and immunological treatments including phosphodiesterase inhibitors and plasmapheresis may be indicated.
Talaei-Khoei, Mojtaba; Nemati-Rezvani, Hora; Fischerauer, Stefan F; Ring, David; Chen, Neal; Vranceanu, Ana-Maria
2017-05-01
The Gross process model of emotion regulation holds that emotion-eliciting situations (e.g. musculoskeletal illness) can be strategically regulated to determine the final emotional and behavioral response. Also, there is some evidence that innate emotional traits may predispose an individual to a particular regulating coping style. We enrolled 107 patients with upper extremity musculoskeletal illness in this cross-sectional study. They completed self-report measures of positive and negative affect, emotion regulation strategies (cognitive reappraisal and expressive suppression), upper extremity physical function, pain intensity, and demographics. We used Preacher and Hayes' bootstrapping approach to process analysis to infer the direct effect of positive and negative affect on physical function as well as their indirect effects through activation of emotion regulation strategies. Negative affect was associated with decreased physical function. The association was partly mediated by expressive suppression (b (SE)=-.10 (.05), 95% BCa CI [-.21, -.02]). Positive affect was associated with increased physical function. Cognitive reappraisal partially mediated this association (b (SE)=.11 (.05), 95% BCa CI [.03, .24]). After controlling for pain intensity, the ratio of the mediated effect to total effect grew even larger in controlled model comparing to uncontrolled model (33% vs. 26% for expressive suppression and 32% vs. 30% for cognitive reappraisal). The relationships between affect, emotion regulation strategies and physical function appear to be more dependent on the emotional response to an orthopedic condition rather than the intensity of the nociceptive stimulation of the pain. Findings support integration of emotion regulation training in skill-based psychotherapy in this population to mitigate the effect of negative affect and enhance the influence of positive affect on physical function. Copyright © 2017 Elsevier Inc. All rights reserved.
Loss of guanylyl cyclase C (GCC signaling leads to dysfunctional intestinal barrier.
Directory of Open Access Journals (Sweden)
Xiaonan Han
2011-01-01
Full Text Available Guanylyl Cyclase C (GCC signaling via uroguanylin (UGN and guanylin activation is a critical mediator of intestinal fluid homeostasis, intestinal cell proliferation/apoptosis, and tumorigenesis. As a mechanism for some of these effects, we hypothesized that GCC signaling mediates regulation of intestinal barrier function.Paracellular permeability of intestinal segments was assessed in wild type (WT and GCC deficient (GCC-/- mice with and without lipopolysaccharide (LPS challenge, as well as in UGN deficient (UGN-/- mice. IFNγ and myosin light chain kinase (MLCK levels were determined by real time PCR. Expression of tight junction proteins (TJPs, phosphorylation of myosin II regulatory light chain (MLC, and STAT1 activation were examined in intestinal epithelial cells (IECs and intestinal mucosa. The permeability of Caco-2 and HT-29 IEC monolayers, grown on Transwell filters was determined in the absence and presence of GCC RNA interference (RNAi. We found that intestinal permeability was increased in GCC-/- and UGN-/- mice compared to WT, accompanied by increased IFNγ levels, MLCK and STAT1 activation in IECs. LPS challenge promotes greater IFNγ and STAT1 activation in IECs of GCC-/- mice compared to WT mice. Claudin-2 and JAM-A expression were reduced in GCC deficient intestine; the level of phosphorylated MLC in IECs was significantly increased in GCC-/- and UGN-/- mice compared to WT. GCC knockdown induced MLC phosphorylation, increased permeability in IEC monolayers under basal conditions, and enhanced TNFα and IFNγ-induced monolayer hyperpermeability.GCC signaling plays a protective role in the integrity of the intestinal mucosal barrier by regulating MLCK activation and TJ disassembly. GCC signaling activation may therefore represent a novel mechanism in maintaining the small bowel barrier in response to injury.
The biological significance of brain barrier mechanisms
DEFF Research Database (Denmark)
Saunders, Norman R; Habgood, Mark D; Møllgård, Kjeld
2016-01-01
, but more work is required to evaluate the method before it can be tried in patients. Overall, our view is that much more fundamental knowledge of barrier mechanisms and development of new experimental methods will be required before drug targeting to the brain is likely to be a successful endeavor......Barrier mechanisms in the brain are important for its normal functioning and development. Stability of the brain's internal environment, particularly with respect to its ionic composition, is a prerequisite for the fundamental basis of its function, namely transmission of nerve impulses....... In addition, the appropriate and controlled supply of a wide range of nutrients such as glucose, amino acids, monocarboxylates, and vitamins is also essential for normal development and function. These are all cellular functions across the interfaces that separate the brain from the rest of the internal...
Functionally gradient materials for thermal barrier coatings in advanced gas turbine systems
Energy Technology Data Exchange (ETDEWEB)
Banovic, S.W.; Barmak, K.; Chan, H.M. [Lehigh Univ., Bethlehem, PA (United States)] [and others
1995-10-01
New designs for advanced gas turbine engines for power production are required to have higher operating temperatures in order to increase efficiency. However, elevated temperatures will increase the magnitude and severity of environmental degradation of critical turbine components (e.g. combustor parts, turbine blades, etc{hor_ellipsis}). To offset this problem, the usage of thermal barrier coatings (TBCs) has become popular by allowing an increase in maximum inlet temperatures for an operating engine. Although thermal barrier technology is over thirty years old, the principle failure mechanism is the spallation of the ceramic coating at or near the ceramic/bond coat interface. Therefore, it is desirable to develop a coating that combines the thermal barrier qualities of the ceramic layer and the corrosion protection by the metallic bond coat without the detrimental effects associated with the localization of the ceramic/metal interface to a single plane.
L-tyrosine and L-DOPA as hormone-like regulators of melanocytes functions
Slominski, Andrzej; Zmijewski, Michal; Pawelek, John
2011-01-01
Summary Evidence reveals that L-tyrosine and L-DOPA, besides serving as substrates and intermediates of melanogenesis, are also bioregulatory agents acting not only as inducers and positive regulators of melanogenesis but also as regulators of other cellular functions. These can be mediated through action on specific receptors or through non-receptor mediated mechanisms. The substrate induced (L-tyrosine and/or L-DOPA) melanogenic pathway would autoregulate itself as well as it would regulate the melanocyte functions through activity of its structural or regulatory proteins and through intermediates of melanogenesis and melanin itself. Dissection of regulatory and autoregulatory elements of this process may elucidate how substrate induced autoregulatory pathways have evolved from prokaryotic or simple eukaryotic organisms to complex systems in vertebrates. This could substantiate older theory proposing that receptors for amino-acid derived hormones arose from the receptors for those amino acids, and that nuclear receptors evolved from primitive intracellular receptors binding nutritional factors or metabolic intermediates. PMID:21834848
Cellular regulation of the structure and function of aortic valves
Directory of Open Access Journals (Sweden)
Ismail El-Hamamsy
2010-01-01
Full Text Available The aortic valve was long considered a passive structure that opens and closes in response to changes in transvalvular pressure. Recent evidence suggests that the aortic valve performs highly sophisticated functions as a result of its unique microscopic structure. These functions allow it to adapt to its hemodynamic and mechanical environment. Understanding the cellular and molecular mechanisms involved in normal valve physiology is essential to elucidate the mechanisms behind valve disease. We here review the structure and developmental biology of aortic valves; we examine the role of its cellular parts in regulating its function and describe potential pathophysiological and clinical implications.
Studying Executive Barriers on Rationalizing the Size of Iranian Government
Directory of Open Access Journals (Sweden)
Mohammad Hussein Rahmati
2012-01-01
Full Text Available To rationalize the size of government, Act on adjusting a part of government‟s financial rules is approved and the government is obliged to assign a part of its activities through (1 services by nonpublic sector, (2 partnership with nonpublic sector, and (3 assigning the management to nonpublic sector. There are many barriers in executing this law. The present study derived from a field study tries to provide a report on the performance of various organs in Qom province on executing this law and identifies the executive barriers and provides practical proposals to remove them.Overall, seventeen organs in Qom are subjected to this law of which five organs are selected as our sample. In this respect, different documents were studied, ten interviews were conducted and one hundred and four executive barriers and forty seven operational proposals including twenty three barriers and eleven proposals in organization and structure area, sixteen barriers and five proposals in administrative technology and working processes area, thirty two barriers and twelve proposals in human resources area, twenty one barriers and eight proposals in laws and regulations area and twelve barriers and eleven proposals in management area have been analyzed and summarized regarding their contents.
Zonulin, regulation of tight junctions, and autoimmune diseases.
Fasano, Alessio
2012-07-01
Recent studies indicate that besides digestion and absorption of nutrients and water and electrolytes homeostasis, another key function of the intestine is to regulate the trafficking of environmental antigens across the host mucosal barrier. Intestinal tight junctions (TJs) create gradients for the optimal absorption and transport of nutrients and control the balance between tolerance and immunity to nonself antigens. To meet diverse physiological challenges, intestinal epithelial TJs must be modified rapidly and in a coordinated fashion by regulatory systems that orchestrate the state of assembly of the TJ multiprotein network. While considerable knowledge exists about TJ ultrastructure, relatively little is known about their physiological and pathophysiological regulation. Our discovery of zonulin, the only known physiologic modulator of intercellular TJs described so far, has increased our understanding of the intricate mechanisms that regulate the intestinal epithelial paracellular pathway and has led us to appreciate that its upregulation in genetically susceptible individuals leads to autoimmune diseases. © 2012 New York Academy of Sciences.
Directory of Open Access Journals (Sweden)
Peter Kraft
2010-12-01
Full Text Available Stroke-induced brain edema formation is a frequent cause of secondary infarct growth and deterioration of neurological function. The molecular mechanisms underlying edema formation after stroke are largely unknown. Vasodilator-stimulated phosphoprotein (VASP is an important regulator of actin dynamics and stabilizes endothelial barriers through interaction with cell-cell contacts and focal adhesion sites. Hypoxia has been shown to foster vascular leakage by downregulation of VASP in vitro but the significance of VASP for regulating vascular permeability in the hypoxic brain in vivo awaits clarification.Focal cerebral ischemia was induced in Vasp(-/- mice and wild-type (WT littermates by transient middle cerebral artery occlusion (tMCAO. Evan's Blue tracer was applied to visualize the extent of blood-brain-barrier (BBB damage. Brain edema formation and infarct volumes were calculated from 2,3,5-triphenyltetrazolium chloride (TTC-stained brain slices. Both mouse groups were carefully controlled for anatomical and physiological parameters relevant for edema formation and stroke outcome. BBB damage (p0.05 towards worse neurological outcomes.Our study identifies VASP as critical regulator of BBB maintenance during acute ischemic stroke. Therapeutic modulation of VASP or VASP-dependent signalling pathways could become a novel strategy to combat excessive edema formation in ischemic brain damage.
TAK1 regulates skeletal muscle mass and mitochondrial function
Hindi, Sajedah M.; Sato, Shuichi; Xiong, Guangyan; Bohnert, Kyle R.; Gibb, Andrew A.; Gallot, Yann S.; McMillan, Joseph D.; Hill, Bradford G.
2018-01-01
Skeletal muscle mass is regulated by a complex array of signaling pathways. TGF-β–activated kinase 1 (TAK1) is an important signaling protein, which regulates context-dependent activation of multiple intracellular pathways. However, the role of TAK1 in the regulation of skeletal muscle mass remains unknown. Here, we report that inducible inactivation of TAK1 causes severe muscle wasting, leading to kyphosis, in both young and adult mice.. Inactivation of TAK1 inhibits protein synthesis and induces proteolysis, potentially through upregulating the activity of the ubiquitin-proteasome system and autophagy. Phosphorylation and enzymatic activity of AMPK are increased, whereas levels of phosphorylated mTOR and p38 MAPK are diminished upon inducible inactivation of TAK1 in skeletal muscle. In addition, targeted inactivation of TAK1 leads to the accumulation of dysfunctional mitochondria and oxidative stress in skeletal muscle of adult mice. Inhibition of TAK1 does not attenuate denervation-induced muscle wasting in adult mice. Finally, TAK1 activity is highly upregulated during overload-induced skeletal muscle growth, and inactivation of TAK1 prevents myofiber hypertrophy in response to functional overload. Overall, our study demonstrates that TAK1 is a key regulator of skeletal muscle mass and oxidative metabolism. PMID:29415881
Directory of Open Access Journals (Sweden)
Brian L Weiss
Full Text Available Tsetse flies (Glossina spp. vector pathogenic African trypanosomes, which cause sleeping sickness in humans and nagana in domesticated animals. Additionally, tsetse harbors 3 maternally transmitted endosymbiotic bacteria that modulate their host's physiology. Tsetse is highly resistant to infection with trypanosomes, and this phenotype depends on multiple physiological factors at the time of challenge. These factors include host age, density of maternally-derived trypanolytic effector molecules present in the gut, and symbiont status during development. In this study, we investigated the molecular mechanisms that result in tsetse's resistance to trypanosomes. We found that following parasite challenge, young susceptible tsetse present a highly attenuated immune response. In contrast, mature refractory flies express higher levels of genes associated with humoral (attacin and pgrp-lb and epithelial (inducible nitric oxide synthase and dual oxidase immunity. Additionally, we discovered that tsetse must harbor its endogenous microbiome during intrauterine larval development in order to present a parasite refractory phenotype during adulthood. Interestingly, mature aposymbiotic flies (Gmm(Apo present a strong immune response earlier in the infection process than do WT flies that harbor symbiotic bacteria throughout their entire lifecycle. However, this early response fails to confer significant resistance to trypanosomes. Gmm(Apo adults present a structurally compromised peritrophic matrix (PM, which lines the fly midgut and serves as a physical barrier that separates luminal contents from immune responsive epithelial cells. We propose that the early immune response we observe in Gmm(Apo flies following parasite challenge results from the premature exposure of gut epithelia to parasite-derived immunogens in the absence of a robust PM. Thus, tsetse's PM appears to regulate the timing of host immune induction following parasite challenge. Our results
Intestinal permeability and its regulation by zonulin: diagnostic and therapeutic implications.
Fasano, Alessio
2012-10-01
One of the most important and overlooked functions of the gastrointestinal tract is to provide a dynamic barrier to tightly controlled antigen trafficking through both the transcellular and paracellular pathways. Intercellular tight junctions (TJ) are the key structures regulating paracellular trafficking of macromolecules. Although steady progress has been made in understanding TJ ultrastructure, relatively little is known about their pathophysiological regulation. Our discovery of zonulin, the only known physiological modulator of intercellular TJ described so far, increased understanding of the intricate mechanisms that regulate gut permeability and led us to appreciate that its up-regulation in genetically susceptible individuals may lead to immune-mediated diseases. This information has translational implications, because the zonulin pathway is currently exploited to develop both diagnostic and therapeutic applications pertinent to a variety of immune-mediated diseases. Copyright © 2012 AGA Institute. Published by Elsevier Inc. All rights reserved.
de Klerk, Onno L.; Willemsen, Antoon T. M.; Bosker, Fokko J.; Bartels, Anna L.; Hendrikse, N. Harry; den Boer, Johan A.; Dierckx, Rudy A.
2010-01-01
P-glycoprotein (P-gp), a major efflux pump in the blood-brain barrier (BBB) has a profound effect on entry of drugs, peptides and other substances into the central nervous system (CNS). The brain's permeability can be negatively influenced by modulation of the transport function of P-gp.
A framework for understanding semi-permeable barrier effects on migratory ungulates
Sawyer, Hall; Kauffman, Matthew J.; Middleton, Arthur D.; Morrison, Thomas A.; Nielson, Ryan M.; Wyckoff, Teal B.
2013-01-01
1. Impermeable barriers to migration can greatly constrain the set of possible routes and ranges used by migrating animals. For ungulates, however, many forms of development are semi-permeable, and making informed management decisions about their potential impacts to the persistence of migration routes is difficult because our knowledge of how semi-permeable barriers affect migratory behaviour and function is limited. 2. Here, we propose a general framework to advance the understanding of barrier effects on ungulate migration by emphasizing the need to (i) quantify potential barriers in terms that allow behavioural thresholds to be considered, (ii) identify and measure behavioural responses to semi-permeable barriers and (iii) consider the functional attributes of the migratory landscape (e.g. stopovers) and how the benefits of migration might be reduced by behavioural changes. 3. We used global position system (GPS) data collected from two subpopulations of mule deer Odocoileus hemionus to evaluate how different levels of gas development influenced migratory behaviour, including movement rates and stopover use at the individual level, and intensity of use and width of migration route at the population level. We then characterized the functional landscape of migration routes as either stopover habitat or movement corridors and examined how the observed behavioural changes affected the functionality of the migration route in terms of stopover use. 4. We found migratory behaviour to vary with development intensity. Our results suggest that mule deer can migrate through moderate levels of development without any noticeable effects on migratory behaviour. However, in areas with more intensive development, animals often detoured from established routes, increased their rate of movement and reduced stopover use, while the overall use and width of migration routes decreased. 5. Synthesis and applications. In contrast to impermeable barriers that impede animal movement
Fries, Gabriel R; Gassen, Nils C; Rein, Theo
2017-12-05
Among the chaperones and co-chaperones regulating the glucocorticoid receptor (GR), FK506 binding protein (FKBP) 51 is the most intensely investigated across different disciplines. This review provides an update on the role of the different co-chaperones of Hsp70 and Hsp90 in the regulation of GR function. The development leading to the focus on FKBP51 is outlined. Further, a survey of the vast literature on the mechanism and function of FKBP51 is provided. This includes its structure and biochemical function, its regulation on different levels-transcription, post-transcription, and post-translation-and its function in signaling pathways. The evidence portraying FKBP51 as a scaffolding protein organizing protein complexes rather than a chaperone contributing to the folding of individual proteins is collated. Finally, FKBP51's involvement in physiology and disease is outlined, and the promising efforts in developing drugs targeting FKBP51 are discussed.
Vernon-Feagans, Lynne; Garrett-Peters, Patricia; Willoughby, Michael
2016-01-01
Behavioral regulation is an important school readiness skill that has been linked to early executive function (EF) and later success in learning and school achievement. Although poverty and related risks, as well as negative parenting, have been associated with poorer EF and behavioral regulation, chaotic home environments may also play a role in…
The Prohormone VGF Regulates β Cell Function via Insulin Secretory Granule Biogenesis
Directory of Open Access Journals (Sweden)
Samuel B. Stephens
2017-09-01
Full Text Available The prohormone VGF is expressed in neuroendocrine and endocrine tissues and regulates nutrient and energy status both centrally and peripherally. We and others have shown that VGF-derived peptides have direct action on the islet β cell as secretagogues and cytoprotective agents; however, the endogenous function of VGF in the β cell has not been described. Here, we demonstrate that VGF regulates secretory granule formation. VGF loss-of-function studies in both isolated islets and conditional knockout mice reveal a profound decrease in stimulus-coupled insulin secretion. Moreover, VGF is necessary to facilitate efficient exit of granule cargo from the trans-Golgi network and proinsulin processing. It also functions to replenish insulin granule stores following nutrient stimulation. Our data support a model in which VGF operates at a critical node of granule biogenesis in the islet β cell to coordinate insulin biosynthesis with β cell secretory capacity.
Directory of Open Access Journals (Sweden)
Silvia Gazzin
2011-01-01
Full Text Available Accumulation of unconjugated bilirubin (UCB in the brain causes bilirubin encephalopathy. Pgp (ABCb1 and Mrp1 (ABCc1, highly expressed in the blood-brain barrier (BBB and blood-cerebrospinal fluid barrier (BCSFB respectively, may modulate the accumulation of UCB in brain. We examined the effect of prolonged exposure to elevated concentrations of UCB on expression of the two transporters in homozygous, jaundiced (jj Gunn rats compared to heterozygous, not jaundiced (Jj littermates at different developmental stages (2, 9, 17 and 60 days after birth. BBB Pgp protein expression was low in both jj and Jj pups at 9 days (about 16-27% of adult values, despite the up-regulation in jj animals (2 and 1.3 fold higher than age matched Jj animals at P9 and P17-P60, respectively; Mrp1 protein expression was barely detectable. Conversely, at the BCSFB Mrp1 protein expression was rather high (60-70% of the adult values in both jj and Jj at P2, but was markedly (50% down-regulated in jj pups starting at P9, particularly in the 4(th ventricle choroid plexuses: Pgp was almost undetectable. The Mrp1 protein down regulation was accompanied by a modest up-regulation of mRNA, suggesting a translational rather than a transcriptional inhibition. In vitro exposure of choroid plexus epithelial cells obtained from normal rats to UCB, also resulted in a down-regulation of Mrp1 protein. These data suggest that down-regulation of Mrp1 protein at the BSCFB, resulting from a direct effect of UCB on epithelial cells, may impact the Mrp1-mediated neuroprotective functions of the blood-cerebrospinal fluid barrier and actually potentiate UCB neurotoxicity.
Strategies to improve drug delivery across the blood-brain barrier.
de Boer, Albertus G; Gaillard, Pieter J
2007-01-01
The blood-brain barrier (BBB), together with the blood-cerebrospinal-fluid barrier, protects and regulates the homeostasis of the brain. However, these barriers also limit the transport of small-molecule and, particularly, biopharmaceutical drugs such as proteins, genes and interference RNA to the brain, thereby limiting the treatment of many brain diseases. As a result, various drug delivery and targeting strategies are currently being developed to enhance the transport and distribution of drugs into the brain. In this review, we discuss briefly the biology and physiology of the BBB as the most important barrier for drug transport to the brain and, in more detail, the possibilities for delivering large-molecule drugs, particularly genes, by receptor-mediated nonviral drug delivery to the (human) brain. In addition, the systemic and intracellular pharmacokinetics of nonviral gene delivery, together with targeted brain imaging, are reviewed briefly.
Tyrosine Residues Regulate Multiple Nuclear Functions of P54nrb.
Lee, Ahn R; Hung, Wayne; Xie, Ning; Liu, Liangliang; He, Leye; Dong, Xuesen
2017-04-01
The non-POU-domain-containing octamer binding protein (NONO; also known as p54nrb) has various nuclear functions ranging from transcription, RNA splicing, DNA synthesis and repair. Although tyrosine phosphorylation has been proposed to account for the multi-functional properties of p54nrb, direct evidence on p54nrb as a phosphotyrosine protein remains unclear. To investigate the tyrosine phosphorylation status of p54nrb, we performed site-directed mutagenesis on the five tyrosine residues of p54nrb, replacing the tyrosine residues with phenylalanine or alanine, and immunoblotted for tyrosine phosphorylation. We then preceded with luciferase reporter assays, RNA splicing minigene assays, co-immunoprecipitation, and confocal microscopy to study the function of p54nrb tyrosine residues on transcription, RNA splicing, protein-protein interaction, and cellular localization. We found that p54nrb was not phosphorylated at tyrosine residues. Rather, it has non-specific binding affinity to anti-phosphotyrosine antibodies. However, replacement of tyrosine with phenylalanine altered p54nrb activities in transcription co-repression and RNA splicing in gene context-dependent fashions by means of differential regulation of p54nrb protein association with its interacting partners and co-regulators of transcription and splicing. These results demonstrate that tyrosine residues, regardless of phosphorylation status, are important for p54nrb function. J. Cell. Physiol. 232: 852-861, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
White, Amelia G; Santoro, Domenico; Ahrens, Kim; Marsella, Rosanna
2018-03-01
Ciclosporin (CsA) is a common treatment for canine atopic dermatitis (cAD). cAD is a very common skin disease with a multifactorial pathogenesis due to complex interactions between the host and the environment. The purpose of this study was to describe the physical and immunological effects of CsA in cAD using a canine model of AD. Fourteen beagles were enrolled; seven received CsA orally every 24 h for 28 days, and seven received placebo. All dogs were exposed to relevant allergens, house dust mite solution, one day prior to treatment and once weekly thereafter for 28 consecutive days. Canine atopic dermatitis extent and severity index-03 (CADESI-03) and skin biopsies were performed on day 0, 14, and 28. Quantitative RT-PCR was used to determine levels of cutaneous cytokines and barrier function markers. Indirect immunofluorescence was used to determine protein expression and distribution of nuclear messengers, barrier function and inflammatory [thymic stromal lymphopoietin (TSLP)] markers. The data were tested for normality and then the upaired two samples Student's t-test and the repeated measurements ANOVA, followed by the Dunnett's Multiple Comparison Test as post-hoc analysis, were performed. A P value of immunologic milieu or barrier markers despite evident improvement of physical signs in the treatment group. Although this study confirmed the usefulness of CsA for the treatment of cAD, a clear involvement of CsA on some of the currently known immunological alterations present in cAD was not determined. However, it is important to note that there was no measurable exacerbation of skin barrier dysfunction secondary to CsA administration in this model. Copyright © 2018 Elsevier B.V. All rights reserved.
Management-retrieval code system of fission barrier parameter sub-library
International Nuclear Information System (INIS)
Zhang Limin; Su Zongdi; Ge Zhigang
1995-01-01
The fission barrier parameter (FBP) library, which is a sub-library of Chinese Evaluated Nuclear Parameter library (CENPL), stores various popular used fission barrier parameters from different historical period, and could retrieve the required fission barrier parameters by using the management retrieval code system of the FBP sub-library. The function, feature and operation instruction of the code system are described briefly
Yao, Bao-Guo; Zhang, Shan; Zhang, De-Pin
2017-05-01
In order to evaluate the temperature regulating properties of thermal functional porous polymeric materials such as fabrics treated with phase change material microcapsules, a new apparatus was developed. The apparatus and the test method can measure the heat flux, temperature, and displacement signals during the dynamic contact and then quickly give an evaluation for the temperature regulating properties by simulating the dynamic heat transfer and temperature regulating process when the materials contact the body skin. A series of indices including the psychosensory intensity, regulating capability index, and relative regulating index were defined to characterize the temperature regulating properties. The measurement principle, the evaluation criteria and grading method, the experimental setup and the test results discussion, and the gage capability analysis of the apparatus are presented. The new apparatus provides a method for the objective measurement and evaluation of the temperature regulating properties of thermal functional porous polymeric materials.
Directory of Open Access Journals (Sweden)
Nerea Sanvisens
2013-04-01
Full Text Available Ribonucleotide reductases (RNRs are essential enzymes that catalyze the reduction of ribonucleotides to desoxyribonucleotides, thereby providing the building blocks required for de novo DNA biosynthesis. The RNR function is tightly regulated because an unbalanced or excessive supply of deoxyribonucleoside triphosphates (dNTPs dramatically increases the mutation rates during DNA replication and repair that can lead to cell death or genetic anomalies. In this review, we focus on Saccharomyces cerevisiae class Ia RNR as a model to understand the different mechanisms controlling RNR function and regulation in eukaryotes. Many studies have contributed to our current understanding of RNR allosteric regulation and, more recently, to its link to RNR oligomerization. Cells have developed additional mechanisms that restrict RNR activity to particular periods when dNTPs are necessary, such as the S phase or upon genotoxic stress. These regulatory strategies include the transcriptional control of the RNR gene expression, inhibition of RNR catalytic activity, and the subcellular redistribution of RNR subunits. Despite class Ia RNRs requiring iron as an essential cofactor for catalysis, little is known about RNR function regulation depending on iron bioavailability. Recent studies into yeast have deciphered novel strategies for the delivery of iron to RNR and for its regulation in response to iron deficiency. Taken together, these studies open up new possibilities to explore in order to limit uncontrolled tumor cell proliferation via RNR.
Market, Regulation, Market, Regulation
DEFF Research Database (Denmark)
Frankel, Christian; Galland, Jean-Pierre
2015-01-01
barriers to trade in Europe, realized the free movement of products by organizing progressively several orders of markets and regulation. Based on historical and institutional documents, on technical publications, and on interviews, this article relates how the European Commission and the Member States had......This paper focuses on the European Regulatory system which was settled both for opening the Single Market for products and ensuring the consumers' safety. It claims that the New Approach and Standardization, and the Global Approach to conformity assessment, which suppressed the last technical...... alternatively recourse to markets and to regulations, at the three main levels of the New Approach Directives implementation. The article focuses also more specifically on the Medical Devices sector, not only because this New Approach sector has long been controversial in Europe, and has recently been concerned...
Astrocytes in neurodegenerative diseases (I): function and molecular description.
Guillamón-Vivancos, T; Gómez-Pinedo, U; Matías-Guiu, J
2015-03-01
Astrocytes have been considered mere supporting cells in the CNS. However, we now know that astrocytes are actively involved in many of the functions of the CNS and may play an important role in neurodegenerative diseases. This article reviews the roles astrocytes play in CNS development and plasticity; control of synaptic transmission; regulation of blood flow, energy, and metabolism; formation of the blood-brain barrier; regulation of the circadian rhythms, lipid metabolism and secretion of lipoproteins; and in neurogenesis. Astrocyte markers and the functions of astrogliosis are also described. Astrocytes play an active role in the CNS. A good knowledge of astrocytes is essential to understanding the mechanisms of neurodegenerative diseases. Copyright © 2012 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.
Alloy Dependence of Electron-Phonon Interactions in Double Barrier Structures
National Research Council Canada - National Science Library
Wallis, Corinne
1996-01-01
...)As double barrier structures as a function of the alloy concentration in the barrier. We have measured current-voltage and conductance-voltage curves associated with phonon-assisted tunneling with magnetic fields from 0 to 6.8 Tesla...
Chemokines in the balance: maintenance of homeostasis and protection at CNS barriers
Directory of Open Access Journals (Sweden)
Jessica L Williams
2014-05-01
Full Text Available In the adult central nervous system (CNS, chemokines and their receptors are involved in developmental, physiological and pathological processes. Although most lines of investigation focus on their ability to induce the migration of cells, recent studies indicate that chemokines also promote cellular interactions and activate signaling pathways that maintain CNS homeostatic functions. Many homeostatic chemokines are expressed on the vasculature of the blood brain barrier including CXCL12, CCL19, CCL20, and CCL21. While endothelial cell expression of these chemokines is known to regulate the entry of leukocytes into the CNS during immunosurveillance, new data indicate that CXCL12 is also involved in diverse cellular activities including adult neurogenesis and neuronal survival, having an opposing role to the homeostatic chemokine, CXCL14, which appears to regulate synaptic inputs to neural precursors. Neuronal expression of CX3CL1, yet another homeostatic chemokine that promotes neuronal survival and communication with microglia, is partly regulated by CXCL12. Regulation of CXCL12 is unique in that it may regulate its own expression levels via binding to its scavenger receptor CXCR7/ACKR3. In this review, we explore the diverse roles of these and other homeostatic chemokines expressed within the CNS, including the possible implications of their dysfunction as a cause of neurologic disease.
A spectral blanking-out controller for demonstration of information barrier technology
International Nuclear Information System (INIS)
Liu Suping; Gong Jian; Hu Guangchun; Zhang Jianhua
2006-01-01
Information barrier technology has become more and more important in the R and D of radiation fingerprint verification associated with classified items such as nuclear warheads, nuclear components and military-used nuclear materials. The function of information barriers is two-fold: one is to prevent the classified information from leaking out; the other is to provide creditable verification. To fulfill these two functions, the information barriers for a viable verification system (including all its hardware and software) must be designed on the basic principles of protecting classified information and the ability to authenticate. The Spectral Blanking-out Controller (SBC) is developed to illustrate the two functions of the information barriers and to explore some practice measures to meet the required design fundamentals. This paper briefs the task assigned to the SBC, the specific design concerns and the practical information barrier measures. The R and D of the SBC embodies the concepts of information barrier technology and has to conform to the basic guidelines: If a verification system is expected to possess strict information barriers, the design of the system must be integrative with due considerations given to the factors such as the efficiency of the verification technique, the possible measures to protect the classified information from directly or indirectly leaking out, the complete openness in all aspects of the system for the inspectors to authenticate the system for the sake of achieving certain degree of confidence on the verification results. (authors)
Ruiz, Montse C; Haapanen, Saara; Tolvanen, Asko; Robazza, Claudio; Duda, Joan L
2017-08-01
This study examined the relationships between perceptions of the motivational climate, motivation regulations, and the intensity and functionality levels of athletes' pleasant and unpleasant emotional states. Specifically, we examined the hypothesised mediational role of motivation regulations in the climate-emotion relationship. We also tested a sequence in which emotions were assumed to be predicted by the motivational climate dimensions and then served as antecedents to variability in motivation regulations. Participants (N = 494) completed a multi-section questionnaire assessing targeted variables. Structural equation modelling (SEM) revealed that a perceived task-involving climate was a positive predictor of autonomous motivation and of the impact of functional anger, and a negative predictor of the intensity of anxiety and dysfunctional anger. Autonomous motivation was a partial mediator of perceptions of a task-involving climate and the impact of functional anger. An ego-involving climate was a positive predictor of controlled motivation, and of the intensity and impact of functional anger and the intensity of dysfunctional anger. Controlled motivation partially mediated the relationship between an ego-involving climate and the intensity of dysfunctional anger. Good fit to the data also emerged for the motivational climate, emotional states, and motivation regulations sequence. Findings provide support for the consideration of hedonic tone and functionality distinctions in the assessment of athletes' emotional states.
Cdkal1, a type 2 diabetes susceptibility gene, regulates mitochondrial function in adipose tissue
Directory of Open Access Journals (Sweden)
Colin J. Palmer
2017-10-01
Conclusions: Cdkal1 is necessary for normal mitochondrial morphology and function in adipose tissue. These results suggest that the type 2 diabetes susceptibility gene CDKAL1 has novel functions in regulating mitochondrial activity.
Electron optics with magnetic vector potential barriers in graphene
International Nuclear Information System (INIS)
Ghosh, Sankalpa; Sharma, Manish
2009-01-01
An analysis of electron transport in graphene in the presence of various arrangements of delta-function like magnetic barriers is presented. The motion through one such barrier gives an unusual non-specular refraction leading to asymmetric transmission. The symmetry is restored by putting two such barriers in opposite directions side by side. Periodic arrangements of such barriers can be used as Bragg reflectors whose reflectivity has been calculated using a transfer matrix formalism. Such Bragg reflectors can be used to make resonant cavities. We also analyze the associated band structure for the case of infinite periodic structures. (fast track communication)
Morello, Roy; Lee, Brendan
2002-05-01
In recent years, our understanding of the molecular basis of kidney development has benefited from the study of rare genetic diseases affecting renal function. This has especially been the case with the differentiation of the highly specialized podocyte in the pathogenesis of human disorders and mouse phenotypes affecting the renal filtration barrier. This filtration barrier represents the end product of a complex series of signaling events that produce a tripartite structure consisting of interdigitating podocyte foot processes with intervening slit diaphragms, the glomerular basement membrane, and the fenestrated endothelial cell. Dysregulation of unique cytoskeletal and extracellular matrix proteins in genetic forms of nephrotic syndrome has shown how specific structural proteins contribute to podocyte function and differentiation. However, much less is known about the transcriptional determinants that both specify and maintain this differentiated cell. Our studies of a skeletal malformation syndrome, nail-patella syndrome, have shown how the LIM homeodomain transcription factor, Lmx1b, contributes to transcriptional regulation of glomerular basement membrane collagen expression by podocytes. Moreover, they raise intriguing questions about more global transcriptional regulation of podocyte morphogenesis.
Regulatory Barriers Blocking Standardization of Interoperability
Zhong, Daidi; Kirwan, Michael J; Duan, Xiaolian
2013-01-01
Developing and implementing a set of personal health device interoperability standards is key to cultivating a healthy global industry ecosystem. The standardization organizations, including the Institute of Electrical and Electronics Engineers 11073 Personal Health Device Workgroup (IEEE 11073-PHD WG) and Continua Health Alliance, are striving for this purpose. However, factors like the medial device regulation, health policy, and market reality have placed non-technical barriers over the ad...
The Status of Industrial Ecology in Australia: Barriers and Enablers
Directory of Open Access Journals (Sweden)
Glen D. Corder
2014-03-01
Full Text Available Drawing on current international industrial ecology thinking and experiences with Australian initiatives, this article critically overviews the current status of industrial ecology in Australia and examines the barriers and potential strategies to realise greater uptake and application of the concept. The analysis is conducted across three categories: heavy industrial areas (including Kwinana and Gladstone, mixed industrial parks (Wagga Wagga and Port Melbourne, and waste exchange networks, and identifies the past and future significance of seven different types of barriers—regulation, information, community, economic, technical, cooperation and trust, commitment to sustainable development—for each of the three categories. The outcomes from this analysis highlight that regulation, information, and economic barriers for heavy industrial area and mixed industrial parks, and economic and technical barriers for waste exchange networks are the current and future focus for industrial ecology applications in Australia. These findings appear to be consistent with recently published frameworks and learnings. The authors propose key questions that could enhance greater adoption of industrial ecology applications in Australia and acknowledge that international research and experiences, while partly providing answers to these questions, need to be adapted and refined for the Australian context.
Systems pharmacology and blood-brain barrier functionality in Parkinson's disease
Ravenstijn, Paulien Gerarda Maria
2009-01-01
Parkinson’s disease is a progressive neurodegenerative disease, which is composed of many components, each caused by interplay of a number of genetic and nongenetic causes. As the blood-brain barrier (BBB) is a key player in the relationship between plasma and brain pharmacokinetics, the influences
Directory of Open Access Journals (Sweden)
Hiroshi Tanaka
2017-02-01
Full Text Available Summary: Cellular senescence is an irreversible growth arrest that contributes to development, tumor suppression, and age-related conditions. Senescent cells show active metabolism compared with proliferating cells, but the underlying mechanisms remain unclear. Here we show that the SETD8/PR-Set7 methyltransferase, which catalyzes mono-methylation of histone H4 at lysine 20 (H4K20me1, suppresses nucleolar and mitochondrial activities to prevent cellular senescence. SETD8 protein was selectively downregulated in both oncogene-induced and replicative senescence. Inhibition of SETD8 alone was sufficient to trigger senescence. Under these states, the expression of genes encoding ribosomal proteins (RPs and ribosomal RNAs as well as the cyclin-dependent kinase (CDK inhibitor p16INK4A was increased, with a corresponding reduction of H4K20me1 at each locus. As a result, the loss of SETD8 concurrently stimulated nucleolar function and retinoblastoma protein-mediated mitochondrial metabolism. In conclusion, our data demonstrate that SETD8 acts as a barrier to prevent cellular senescence through chromatin-mediated regulation of senescence-associated metabolic remodeling. : Tanaka et al. show that SETD8/PR-Set7 methyltransferase represses senescence-associated genes including ribosomal proteins, ribosomal RNAs, and p16INK4A by catalyzing mono-methylation of histone H4 at lysine 20. Depletion of SETD8 derepresses these genes, resulting in nucleolar and mitochondrial coactivation characteristic of senescence-associated metabolic remodeling. Keywords: SETD8/PR-Set7, H4K20 methylation, senescence-associated metabolic remodeling, nucleolus, mitochondria
Functional properties of Virus-Encoded and Virus-Regulated 7TM Receptors
DEFF Research Database (Denmark)
Spiess, Katja; Rosenkilde, Mette Marie
2014-01-01
During co-evolution with their hosts, viruses have developed several survival strategies that involve exploitation of 7TM receptors. These include virus-encoded 7TM receptors and ligands and viral regulation of endogenous receptors. Many functional properties have been ascribed to virus-exploited...
Sprache als Barriere (Language as a Barrier)
Mattheier, Klaus
1974-01-01
The concept of language barrier has its derivations in the fields of dialectology, sociology and psychology. In contemporary usage however, the concept has two meanings i.e. regional-cultural barrier and socio-cultural barrier. (Text is in German.) (DS)
Dalla Rosa, Ilaria; Zhang, Hongliang; Khiati, Salim; Wu, Xiaolin; Pommier, Yves
2017-12-08
Mitochondrial DNA (mtDNA) is essential for cell viability because it encodes subunits of the respiratory chain complexes. Mitochondrial topoisomerase IB (TOP1MT) facilitates mtDNA replication by removing DNA topological tensions produced during mtDNA transcription, but it appears to be dispensable. To test whether cells lacking TOP1MT have aberrant mtDNA transcription, we performed mitochondrial transcriptome profiling. To that end, we designed and implemented a customized tiling array, which enabled genome-wide, strand-specific, and simultaneous detection of all mitochondrial transcripts. Our technique revealed that Top1mt KO mouse cells process the mitochondrial transcripts normally but that protein-coding mitochondrial transcripts are elevated. Moreover, we found discrete long noncoding RNAs produced by H-strand transcription and encompassing the noncoding regulatory region of mtDNA in human and murine cells and tissues. Of note, these noncoding RNAs were strongly up-regulated in the absence of TOP1MT. In contrast, 7S DNA, produced by mtDNA replication, was reduced in the Top1mt KO cells. We propose that the long noncoding RNA species in the D-loop region are generated by the extension of H-strand transcripts beyond their canonical stop site and that TOP1MT acts as a topological barrier and regulator for mtDNA transcription and D-loop formation.
Steelant, Brecht; Farré, Ricard; Wawrzyniak, Paulina; Belmans, Jochen; Dekimpe, Emily; Vanheel, Hanne; van Gerven, Laura; Kortekaas Krohn, Inge; Bullens, Dominique M. A.; Ceuppens, Jan L.; Akdis, Cezmi A.; Boeckxstaens, Guy; Seys, Sven F.; Hellings, Peter W.
2016-01-01
Tight junction (TJ) defects have recently been associated with asthma and chronic rhinosinusitis. The expression, function, and regulation of nasal epithelial TJs remain unknown in patients with allergic rhinitis (AR). We investigated the expression, function, and regulation of TJs in the nasal
Directory of Open Access Journals (Sweden)
Valerie E. Ryman
2016-01-01
Full Text Available Inflammation is an essential host response during bacterial infections such as bovine mastitis. Endothelial cells are critical for an appropriate inflammatory response and loss of vascular barrier integrity is implicated in the pathogenesis of Streptococcus uberis-induced mastitis. Previous studies suggested that accumulation of linoleic acid (LA oxygenation products derived from 15-lipoxygenase-1 (15-LOX-1 metabolism could regulate vascular functions. The initial LA derivative from the 15-LOX-1 pathway, 13-hydroperoxyoctadecadienoic acid (HPODE, can induce endothelial death, whereas the reduced hydroxyl product, 13-hydroxyoctadecadienoic acid (HODE, is abundantly produced during vascular activation. However, the relative contribution of specific LA-derived metabolites on impairment of mammary endothelial integrity is unknown. Our hypothesis was that S. uberis-induced LA-derived 15-LOX-1 oxygenation products impair mammary endothelial barrier integrity by apoptosis. Exposure of bovine mammary endothelial cells (BMEC to S. uberis did not increase 15-LOX-1 LA metabolism. However, S. uberis challenge of bovine monocytes demonstrated that monocytes may be a significant source of both 13-HPODE and 13-HODE during mastitis. Exposure of BMEC to 13-HPODE, but not 13-HODE, significantly reduced endothelial barrier integrity and increased apoptosis. Changing oxidant status by coexposure to an antioxidant during 13-HPODE treatment prevented adverse effects of 13-HPODE, including amelioration of apoptosis. A better understanding of how the oxidant status of the vascular microenvironment impacts endothelial barrier properties could lead to more efficacious treatments for S. uberis mastitis.
Executive function and self-regulated exergaming adherence
Directory of Open Access Journals (Sweden)
Cay eAnderson-Hanley
2014-12-01
Full Text Available The rise in dementia and the evidence of cognitive benefits of exercise for the older adult population together make salient the research into variables affecting cognitive benefit and exercise behavior. One promising avenue for increasing exercise participation has been the introduction of exergaming, a type of exercise that works in combination with virtual reality to enhance both the exercise experience and health outcomes. Past research has revealed that executive function (EF was related to greater use of self-regulatory strategies, which in turn was related to greater adherence to exercise following an intervention (McAuley et al., 2011. Best et al. (2014 found improvement in EF related to adherence to exercise post- intervention. Anderson-Hanley et al. (2012 found that for older adults aerobic exergaming yielded greater cognitive benefit than traditional exercise alone; however, questions remain as to the possible impact of greater cognitive benefit and other factors on participants’ involvement in exercise following the end of an intervention. The current study presents follow-up data exploring the relationship between change in EF, self-regulation, and exercise adherence in the post-intervention (naturalistic period. Herein, it was predicted that improvement in EF during an exercise intervention, would predict subsequent exercise with an exergame during the naturalistic window. Contrary to expectations, results suggest that those with EF decline during the intervention used the exergame more frequently. The results of this study contradict previous literature, but suggest an interesting relationship between change in executive function, self-regulation, and exercise behaviors when exergaming is employed, particularly with older adults with some cognitive decline. We hypothesize that other factors may be at work; perhaps expectation of cognitive benefit might act as a unique motivator or caregivers may be instrumental in adherence.
Hinnant, J Benjamin; Nelson, Jackie A; O'Brien, Marion; Keane, Susan P; Calkins, Susan D
2013-01-01
We examined mother-child co-operative behaviour, children's emotion regulation and executive function, as well as combinations of these factors, as predictors of moral reasoning in 89 10-year-old children. Dyadic co-operation was coded from videotaped observations of laboratory puzzle and speech tasks. Emotion regulation was derived from maternal report, and executive functioning was assessed with the Tower of London task. Moral reasoning was coded during mother-child conversations about morally ambiguous, peer-conflict situations. Two significant interactions indicated that children from more co-operative dyads who also had higher executive function skills had higher moral reasoning scores than other children, and children lower in both emotion regulation and executive function had lower moral reasoning scores than other children. The results contribute to the literature on the multiple and interactive levels of influence on moral reasoning in childhood.
Hinnant, J. Benjamin; Nelson, Jackie A.; O’Brien, Marion; Keane, Susan P.; Calkins, Susan D.
2013-01-01
We examined mother-child cooperative behavior, children’s emotion regulation and executive function, as well as combinations of these factors, as predictors of moral reasoning in 89 10-year-old children. Dyadic cooperation was coded from videotaped observations of laboratory puzzle and speech tasks. Emotion regulation was derived from maternal report, and executive functioning was assessed with the Tower of London task. Moral reasoning was coded during mother-child conversations about morally ambiguous, peer-conflict situations. Two significant interactions indicated that children from more cooperative dyads who also had higher executive function skills had higher moral reasoning scores than other children, and children lower in both emotion regulation and executive function had lower moral reasoning scores than other children. The results contribute to the literature on the multiple and interactive levels of influence on moral reasoning in childhood. PMID:23650955
Bornman, Juan; Donohue, Dana K.
2013-01-01
This study examined teachers' attitudes toward learners with two types of barriers to learning: a learner with attention-deficit and hyperactivity disorder (ADHD), and a learner with little or no functional speech (LNFS). The results indicated that although teachers reported that the learner with ADHD would be more disruptive in class and have a…
Wallon, Conny; Söderholm, Johan D
2009-05-01
Corticotropin-releasing hormone (CRH) is an important neuro-endocrine mediator of the stress response. Local effects of CRH in the intestinal mucosa have become evident in recent years. We showed that CRH activates CRH receptor subtypes R1 and R2 on subepithelial mast cells, thereby inducing increased transcellular uptake of protein antigens in human colonic biopsies in Ussing chambers. Ongoing studies also implicate local cholinergic signaling in regulation of macromolecular permeability in the human colon. Since increased uptake of antigenic molecules is associated with mucosal inflammation, our findings may have implications for understanding stress-related intestinal disorders.
Shakeoff Ionization near the Coulomb Barrier Energy
Sharma, Prashant; Nandi, T.
2017-11-01
We measure the projectile K x-ray spectra as a function of the beam energies around the Coulomb barrier in different collision systems. The energy is scanned in small steps around the barrier aiming to explore the nuclear effects on the elastically scattered projectile ions. The variation of the projectile x-ray energy with the ion-beam energies exhibits an unusual increase in between the interaction barrier and fusion barrier energies. This additional contribution to the projectile ionization can be attributed to the shakeoff of outer-shell electrons of the projectile ions due to the sudden nuclear recoil (˜10-21 sec ) caused by the attractive nuclear potential, which gets switched on near the interaction barrier energy. In the sudden approximation limit, the theoretical shakeoff probability calculation due to the nuclear recoil explains the observed data well. In addition to its fundamental interest, such processes can play a significant role in dark matter detection through the possible mechanism of x-ray emissions, where the weakly interacting massive particle-nucleus elastic scattering can lead to the nuclear-recoil-induced inner-shell vacancy creations. Furthermore, the present work may provide new prospects for atomic physics research at barrier energies as well as provide a novel technique to perform barrier distribution studies for two-body systems.
Foote, A P; Penner, G B; Walpole, M E; Klotz, J L; Brown, K R; Bush, L P; Harmon, D L
2014-07-01
Ergot alkaloids in endophyte-infected (Neotyphodium coenophialum) tall fescue (Lolium arundinaceum) have been shown to cause a reduction in blood flow to the rumen epithelium as well as a decrease in volatile fatty acids (VFA) absorption from the washed rumen of steers. Previous data also indicates that incubating an extract of endophyte-infected tall fescue seed causes an increase in the amount of VFA absorbed per unit of blood flow, which could result from an alteration in the absorptive or barrier function of the rumen epithelium. An experiment was conducted to determine the acute effects of an endophyte-infected tall fescue seed extract (EXT) on total, passive or facilitated acetate and butyrate flux across the isolated bovine rumen as well as the barrier function measured by inulin flux and tissue conductance (G t ). Flux of ergovaline across the rumen epithelium was also evaluated. Rumen tissue from the caudal dorsal sac of Holstein steers (n=6), fed a common diet, was collected and isolated shortly after slaughter and mounted between two halves of Ussing chambers. In vitro treatments included vehicle control (80% methanol, 0.5% of total volume), Low EXT (50 ng ergovaline/ml) and High EXT (250 ng ergovaline/ml). Results indicate that there is no effect of acute exposure to ergot alkaloids on total, passive or facilitated flux of acetate or butyrate across the isolate bovine rumen epithelium (P>0.51). Inulin flux (P=0.16) and G t (P>0.17) were not affected by EXT treatment, indicating no alteration in barrier function due to acute ergot alkaloid exposure. Ergovaline was detected in the serosal buffer of the High EXT treatment indicating that the flux rate is ~0.25 to 0.44 ng/cm2 per hour. Data indicate that specific pathways for VFA absorption and barrier function of the rumen epithelium are not affected by acute exposure to ergot alkaloids from tall fescue at the concentrations tested. Ergovaline has the potential to be absorbed from the rumen of cattle that
Hydraulic performance of permeable barriers for in situ treatment of contaminated groundwater
International Nuclear Information System (INIS)
Smyth, D.J.A.; Shikaze, S.G.; Cherry, J.A.
1997-01-01
The passive interception and in situ treatment of dissolved contaminants in groundwater by permeable reactive barriers has recently gained favor at an increasing number of sites as an alternative to conventional approaches to groundwater remediation such as the pump-and-treat method. Permeable reactive barriers have two essential functions. The first is that the barriers must be installed in a position such that all of the plume passes through the reactive system. The second function is to achieve acceptable treatment of the contamination by physical, chemical or biological means within or downgradient of the barrier. In this paper, issues associated with the hydraulic performance of permeable reaction barriers are evaluated using a three-dimensional groundwater flow model. The efficiency of plume capture by permeable wall and funnel-and-gate systems is examined for some generic and for site-specific hydrogeologic systems. The results have important implications to decisions pertaining to the selection, design and installation of permeable reactive barrier systems
Toward a functional analysis of private verbal self-regulation.
Taylor, I; O'Reilly, M F
1997-01-01
We developed a methodology, derived from the theoretical literatures on rule-governed behavior and private events, to experimentally investigate the relationship between covert verbal self-regulation and nonverbal behavior. The methodology was designed to assess whether (a) nonverbal behavior was under the control of covert rules and (b) verbal reports of these rules were functionally equivalent to the covert rules that control non-verbal behavior. The research was conducted in the context of...
Cysteine regulation of protein function--as exemplified by NMDA-receptor modulation.
Lipton, Stuart A; Choi, Yun-Beom; Takahashi, Hiroto; Zhang, Dongxian; Li, Weizhong; Godzik, Adam; Bankston, Laurie A
2002-09-01
Until recently cysteine residues, especially those located extracellularly, were thought to be important for metal coordination, catalysis and protein structure by forming disulfide bonds - but they were not thought to regulate protein function. However, this is not the case. Crucial cysteine residues can be involved in modulation of protein activity and signaling events via other reactions of their thiol (sulfhydryl; -SH) groups. These reactions can take several forms, such as redox events (chemical reduction or oxidation), chelation of transition metals (chiefly Zn(2+), Mn(2+) and Cu(2+)) or S-nitrosylation [the catalyzed transfer of a nitric oxide (NO) group to a thiol group]. In several cases, these disparate reactions can compete with one another for the same thiol group on a single cysteine residue, forming a molecular switch composed of a latticework of possible redox, NO or Zn(2+) modifications to control protein function. Thiol-mediated regulation of protein function can also involve reactions of cysteine residues that affect ligand binding allosterically. This article reviews the basis for these molecular cysteine switches, drawing on the NMDA receptor as an exemplary protein, and proposes a molecular model for the action of S-nitrosylation based on recently derived crystal structures.
Regulation of intestinal health by branched-chain amino acids.
Zhou, Hua; Yu, Bing; Gao, Jun; Htoo, John Khun; Chen, Daiwen
2018-01-01
Besides its primary role in the digestion and absorption of nutrients, the intestine also interacts with a complex external milieu, and is the first defense line against noxious pathogens and antigens. Dysfunction of the intestinal barrier is associated with enhanced intestinal permeability and development of various gastrointestinal diseases. The branched-chain amino acids (BCAAs) are important nutrients, which are the essential substrates for protein biosynthesis. Recently, emerging evidence showed that BCAAs are involved in maintaining intestinal barrier function. It has been reported that dietary supplementation with BCAAs promotes intestinal development, enhances enterocyte proliferation, increases intestinal absorption of amino acids (AA) and glucose, and improves the immune defenses of piglets. The underlying mechanism of these effects is mediated by regulating expression of genes and proteins associate with various signaling pathways. In addition, BCAAs promote the production of beneficial bacteria in the intestine of mice. Compelling evidence supports the notion that BCAAs play important roles in both nutrition and intestinal health. Therefore, as functional amino acids with various physiological effects, BCAAs hold key roles in promoting intestinal development and health in animals and humans. © 2017 Japanese Society of Animal Science.
Vulnerability of multiple-barrier systems
International Nuclear Information System (INIS)
Lind, N.C.
1996-01-01
'Vulnerability' is defined as the ratio of the probability of failure of a damaged system to the probability of failure of the undamaged system. This definition applies to all engineered systems and can be specialized to particular system types. Some disastrous failures (e.g., Chernobyl) have shown that systems can be highly vulnerable. open-quotes Defense in depthclose quotes is a powerful design principle, reducing vulnerability when the consequences of failure can be catastrophic. In the nuclear industry, defense in depth is widely used in radiation protection, reactor control, and shutdown systems. A multiple-barrier system is a simple example of a system that has defense in depth. The idea is that the system is not vulnerable. It cannot fail if one barrier fails because there is another to take its place. This idea is untenable in waste management, but a quantified vulnerability of a system can help owners, designers, and regulators decide how much defense in depth is desirable or enough. Many multiple-barrier systems can be modeled as systems of components physically in a series, each individually able to prevent failure. Components typically have bimodal distributions of the service time to failure, as illustrated by an example of application to a hypothetical nuclear fuel waste repository
Noninvasive evaluation of the barrier properties of the skin
Directory of Open Access Journals (Sweden)
Utz S.R.
2014-09-01
Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Insulin action in brain regulates systemic metabolism and brain function.
Kleinridders, André; Ferris, Heather A; Cai, Weikang; Kahn, C Ronald
2014-07-01
Insulin receptors, as well as IGF-1 receptors and their postreceptor signaling partners, are distributed throughout the brain. Insulin acts on these receptors to modulate peripheral metabolism, including regulation of appetite, reproductive function, body temperature, white fat mass, hepatic glucose output, and response to hypoglycemia. Insulin signaling also modulates neurotransmitter channel activity, brain cholesterol synthesis, and mitochondrial function. Disruption of insulin action in the brain leads to impairment of neuronal function and synaptogenesis. In addition, insulin signaling modulates phosphorylation of tau protein, an early component in the development of Alzheimer disease. Thus, alterations in insulin action in the brain can contribute to metabolic syndrome, and the development of mood disorders and neurodegenerative diseases. © 2014 by the American Diabetes Association.
Role of lipids in the formation and maintenance of the cutaneous permeability barrier.
Feingold, Kenneth R; Elias, Peter M
2014-03-01
The major function of the skin is to form a barrier between the internal milieu and the hostile external environment. A permeability barrier that prevents the loss of water and electrolytes is essential for life on land. The permeability barrier is mediated primarily by lipid enriched lamellar membranes that are localized to the extracellular spaces of the stratum corneum. These lipid enriched membranes have a unique structure and contain approximately 50% ceramides, 25% cholesterol, and 15% free fatty acids with very little phospholipid. Lamellar bodies, which are formed during the differentiation of keratinocytes, play a key role in delivering the lipids from the stratum granulosum cells into the extracellular spaces of the stratum corneum. Lamellar bodies contain predominantly glucosylceramides, phospholipids, and cholesterol and following the exocytosis of lamellar lipids into the extracellular space of the stratum corneum these precursor lipids are converted by beta glucocerebrosidase and phospholipases into the ceramides and fatty acids, which comprise the lamellar membranes. The lipids required for lamellar body formation are derived from de novo synthesis by keratinocytes and from extra-cutaneous sources. The lipid synthetic pathways and the regulation of these pathways are described in this review. In addition, the pathways for the uptake of extra-cutaneous lipids into keratinocytes are discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Yue Yang
2011-01-01
Full Text Available The endothelial-blood/tissue barrier is critical for maintaining tissue homeostasis. The ear harbors a unique endothelial-blood/tissue barrier which we term "blood-labyrinth-barrier". This barrier is critical for maintaining inner ear homeostasis. Disruption of the blood-labyrinth-barrier is closely associated with a number of hearing disorders. Many proteins of the blood-brain-barrier and blood-retinal-barrier have been identified, leading to significant advances in understanding their tissue specific functions. In contrast, capillaries in the ear are small in volume and anatomically complex. This presents a challenge for protein analysis studies, which has resulted in limited knowledge of the molecular and functional components of the blood-labyrinth-barrier. In this study, we developed a novel method for isolation of the stria vascularis capillary from CBA/CaJ mouse cochlea and provided the first database of protein components in the blood-labyrinth barrier as well as evidence that the interaction of Na(+/K(+-ATPase α1 (ATP1A1 with protein kinase C eta (PKCη and occludin is one of the mechanisms of loud sound-induced vascular permeability increase.Using a mass-spectrometry, shotgun-proteomics approach combined with a novel "sandwich-dissociation" method, more than 600 proteins from isolated stria vascularis capillaries were identified from adult CBA/CaJ mouse cochlea. The ion transporter ATP1A1 was the most abundant protein in the blood-labyrinth barrier. Pharmacological inhibition of ATP1A1 activity resulted in hyperphosphorylation of tight junction proteins such as occludin which increased the blood-labyrinth-barrier permeability. PKCη directly interacted with ATP1A1 and was an essential mediator of ATP1A1-initiated occludin phosphorylation. Moreover, this identified signaling pathway was involved in the breakdown of the blood-labyrinth-barrier resulting from loud sound trauma.The results presented here provide a novel method for
2010-04-01
... the authority of the Departments of the Treasury and Homeland Security. 0.1 Section 0.1 Customs Duties... TRANSFERRED OR DELEGATED AUTHORITY § 0.1 Customs revenue function regulations issued under the authority of... authority to prescribe all CBP regulations relating to customs revenue functions, except that the Secretary...
Fire barrier penetration seals in nuclear power plants
International Nuclear Information System (INIS)
Bajwa, C.S.; West, K.S.
1996-07-01
NNPs are divided into separated fire areas by fire-rated structural barriers. Fire-rated penetration seals are installed to seal certain openings in these barriers, in order to provide reasonable assurance that a fire will be confined to the area where it started. The staff of the Fire Protection Engineering Section, Office of Nuclear Reactor Regulation, US NRC, conducted a comprehensive technical assessment of penetration seals to address reports of potential problems, to determine if there were any problems of safety significance, and to determine if NRC requirements, review guidance, and inspection procedures are adequate. It was concluded that the general condition of penetration seal programs in industry is satisfactory, and that the actions taken in 1988 and 1994 had increased industry awareness of potential problems and resulted in more thorough surveillances, maintenance, and corrective actions. These previous staff actions, together with continued licensee upkeep of existing penetration seal programs and continued NRC inspections, are adequate to maintain public health and safety. Several minor revisions to the NRC fire protection regulation and review guidance are recommended
Cheng, Huhu; Huang, Yaxin; Shi, Gaoquan; Jiang, Lan; Qu, Liangti
2017-07-18
Graphene, with large delocalized π electron cloud on a two-dimensional (2D) atom-thin plane, possesses excellent carrier mobility, large surface area, high light transparency, high mechanical strength, and superior flexibility. However, the lack of intrinsic band gap, poor dispersibility, and weak reactivity of graphene hinder its application scope. Heteroatom-doping regulation and surface modification of graphene can effectively reconstruct the sp 2 bonded carbon atoms and tailor the surface chemistry and interfacial interaction, while microstructure mediation on graphene can induce the special chemical and physical properties because of the quantum confinement, edge effect, and unusual mass transport process. Based on these regulations on graphene, series of methods and techniques are developed to couple the promising characters of graphene into the macroscopic architectures for potential and practical applications. In this Account, we present our effort on graphene regulation from chemical modification to microstructure control, from the morphology-designed macroassemblies to their applications in functional systems excluding the energy-storage devices. We first introduce the chemically regulative graphene with incorporated heteroatoms into the honeycomb lattice, which could open the intrinsic band gap and provide many active sites. Then the surface modification of graphene with functional components will improve dispersibility, prevent aggregation, and introduce new functions. On the other hand, microstructure mediation on graphene sheets (e.g., 0D quantum dots, 1D nanoribbons, and 2D nanomeshes) is demonstrated to induce special chemical and physical properties. Benefiting from the effective regulation on graphene sheets, diverse methods including dimension-confined strategy, filtration assembly, and hydrothermal treatment have been developed to assemble individual graphene sheets to macroscopic graphene fibers, films, and frameworks. These rationally
Barrier pillar between production panels in coal mine
Energy Technology Data Exchange (ETDEWEB)
Zingano, Andre Cezar; Koppe, Jair Carlos; Costa, Joao Felipe C.L. [Universidade Federal do Rio Grande do Sul, Porto Alegre (Brazil)
2007-07-01
The function of the barrier pillar is to protect the mining panel in activity from the abutment load of adjacent mining panels that were mined. In the case of underground mines in Santa Catarina State, the barrier pillar has functioned to protect the main entries of the mine against pillar failure from old mining panels. The objective of this paper is to verify the application of the empirical method to design barrier pillars as proposed by Peng (1986), using numerical simulation following the mining geometry of the coal mines in Santa Catarina State. Two-dimensional numerical models were built taking into account the geometry of the main entries and mining panels for different overburden thickness, and considering the geomechanical properties for the rock mass that forms the roof-pillar-floor system for the Bonito coal vein. The results of the simulations showed that the empirical method to determine the barrier pillar width is valid for the studied coal vein and considered mine geometry. Neither did the pillar at the main entry become overstressed due to adjacent mine panels, nor did the roof present any failure due to stress redistribution. 9 refs., 6 figs., 5 tabs.
Chapouly, Candice; Tadesse Argaw, Azeb; Horng, Sam; Castro, Kamilah; Zhang, Jingya; Asp, Linnea; Loo, Hannah; Laitman, Benjamin M; Mariani, John N; Straus Farber, Rebecca; Zaslavsky, Elena; Nudelman, German; Raine, Cedric S; John, Gareth R
2015-06-01
In inflammatory central nervous system conditions such as multiple sclerosis, breakdown of the blood-brain barrier is a key event in lesion pathogenesis, predisposing to oedema, excitotoxicity, and ingress of plasma proteins and inflammatory cells. Recently, we showed that reactive astrocytes drive blood-brain barrier opening, via production of vascular endothelial growth factor A (VEGFA). Here, we now identify thymidine phosphorylase (TYMP; previously known as endothelial cell growth factor 1, ECGF1) as a second key astrocyte-derived permeability factor, which interacts with VEGFA to induce blood-brain barrier disruption. The two are co-induced NFκB1-dependently in human astrocytes by the cytokine interleukin 1 beta (IL1B), and inactivation of Vegfa in vivo potentiates TYMP induction. In human central nervous system microvascular endothelial cells, VEGFA and the TYMP product 2-deoxy-d-ribose cooperatively repress tight junction proteins, driving permeability. Notably, this response represents part of a wider pattern of endothelial plasticity: 2-deoxy-d-ribose and VEGFA produce transcriptional programs encompassing angiogenic and permeability genes, and together regulate a third unique cohort. Functionally, each promotes proliferation and viability, and they cooperatively drive motility and angiogenesis. Importantly, introduction of either into mouse cortex promotes blood-brain barrier breakdown, and together they induce severe barrier disruption. In the multiple sclerosis model experimental autoimmune encephalitis, TYMP and VEGFA co-localize to reactive astrocytes, and correlate with blood-brain barrier permeability. Critically, blockade of either reduces neurologic deficit, blood-brain barrier disruption and pathology, and inhibiting both in combination enhances tissue preservation. Suggesting importance in human disease, TYMP and VEGFA both localize to reactive astrocytes in multiple sclerosis lesion samples. Collectively, these data identify TYMP as an
Berghoff, Martin; Hochberg, Alexandra; Schmid, Andreas; Schlegel, Jutta; Karrasch, Thomas; Kaps, Manfred; Schäffler, Andreas
2016-01-01
Adipokines bearing the potential to cross the blood-brain barrier (BBB) are promising candidates for the endocrine regulation of central nervous processes and of a postulated fat-brain axis. Resistin and progranulin concentrations in paired serum and cerebrospinal fluid (CSF) samples of patients undergoing neurological evaluation and spinal puncture were investigated. Samples of n = 270 consecutive patients with various neurological diseases were collected without prior selection. Adipokine serum and CSF concentrations were measured by enzyme-linked immunosorbent assay and serum and CSF routine parameters by standard procedures. Anthropometric data, medication and patient history were available. Serum levels of resistin and progranulin were positively correlated among each other, with respective CSF levels, low-density lipoprotein cholesterol levels and markers of systemic inflammation. CSF resistin concentrations were generally low. Progranulin CSF concentrations and CSF/serum progranulin ratio were significantly higher in patients with infectious diseases, with disturbed BBB function and with elevated CSF cell count and presence of oligoclonal bands. Both adipokines are able to cross the BBB depending on a differing patency that increases with increasing grade of barrier dysfunction. Whereas resistin represents a systemic marker of inflammation, CSF progranulin levels strongly depend on the underlying disease and dysfunction of blood-CSF barrier. Resistin and progranulin represent novel and putative regulators of the fat-brain axis by their ability to cross the BBB under physiological and pathophysiological conditions. The presented data provide insight into the characteristics of BBB function regarding progranulin and resistin and the basis for future establishment of normal values for CSF concentrations and CSF/serum ratios. © 2015 Stichting European Society for Clinical Investigation Journal Foundation.
Methamphetamine Effects on Blood-Brain Barrier Structure and Function
Directory of Open Access Journals (Sweden)
Nicole Alia Northrop
2015-03-01
Full Text Available Methamphetamine (Meth is a widely abuse psychostimulant. Traditionally, studies have focused on the neurotoxic effects of Meth on monoaminergic neurotransmitter terminals. Recently, both in vitro and in vivo studies have investigated the effects of Meth on the BBB and found that Meth produces a decrease in BBB structural proteins and an increase in BBB permeability to various molecules. Moreover, preclinical studies are validated by clinical studies in which human Meth users have increased concentrations of toxins in the brain. Therefore, this review will focus on the structural and functional disruption of the BBB caused by Meth and the mechanisms that contribute to Meth-induced BBB disruption. The review will reveal that the mechanisms by which Meth damages dopamine and serotonin terminals are similar to the mechanisms by which the blood-brain barrier (BBB is damaged. Furthermore, this review will cover the factors that are known to potentiate the effects of Meth on the BBB, such as stress and HIV, both of which are co-morbid conditions associated with Meth abuse. Overall, the goal of this review is to demonstrate that the scope of damage produced by Meth goes beyond damage to monoaminergic neurotransmitter systems to include BBB disruption as well as provide a rationale for investigating therapeutics to treat Meth-induced BBB disruption. Since a breach of the BBB can have a multitude of consequences, therapies directed towards the treatment of BBB disruption may help to ameliorate the long-term neurodegeneration and cognitive deficits produced by Meth and possibly even Meth addiction.
Eisenberg, N; Fabes, R A; Karbon, M; Murphy, B C; Wosinski, M; Polazzi, L; Carlo, G; Juhnke, C
1996-06-01
The purpose of this study was to examine the relations of a measure of children's dispositional prosocial behavior (i.e., peer nominations) to individual differences in children's negative emotionality, regulation, and social functioning. Children with prosocial reputations tended to be high in constructive social skills (i.e., socially appropriate behavior and constructive coping) and attentional regulation, and low in negative emotionality. The relations of children's negative emotionality to prosocial reputation were moderated by level of dispositional attentional regulation. In addition, the relations of prosocial reputation to constructive social skills and parent-reported negative emotionality (for girls) increased with age. Vagal tone, a marker of physiological regulation, was negatively related to girls' prosocial reputation.
Quantum coherence in the reflection of above barrier wavepackets
Petersen, Jakob; Pollak, Eli
2018-02-01
The quantum phenomenon of above barrier reflection is investigated from a time-dependent perspective using Gaussian wavepackets. The transition path time distribution, which in principle is experimentally measurable, is used to study the mean flight times ⟨t⟩R and ⟨t⟩T associated with the reflection and the transmission over the barrier paying special attention to their dependence on the width of the barrier. Both flight times, and their difference Δt, exhibit two distinct regimes depending on the ratio of the spatial width of the incident wavepacket and the length of the barrier. When the ratio is larger than unity, the reflection and transmission dynamics are coherent and dominated by the resonances above the barrier. The flight times ⟨t⟩R/T and the flight time difference Δt oscillate as a function of the barrier width (almost in phase with the transmission probability). These oscillations reflect a momentum filtering effect related to the coherent superposition of the reflected and transmitted waves. For a ratio less than unity, the barrier reflection and transmission dynamics are incoherent and the oscillations are absent. The barrier width which separates the coherent and incoherent regimes is identified analytically. The oscillatory structure of the time difference Δt as a function of the barrier width in the coherent regime is absent when considered in terms of the Wigner phase time delays for reflection and transmission. We conclude that the Wigner phase time does not correctly describe the temporal properties of above barrier reflection. We also find that the structure of the reflected and transmitted wavepackets depends on the coherence of the process. In the coherent regime, the wavepackets can have an overlapping peak structure, but the peaks are not fully resolved. In the incoherent regime, the wavepackets split in time into distinct separated Gaussian like waves, each one reflecting the number of times the wavepacket crosses the barrier
Lysosomal storage diseases and the blood-brain barrier.
Begley, David J; Pontikis, Charles C; Scarpa, Maurizio
2008-01-01
The blood-brain barrier becomes a crucial issue in neuronopathic lysosomal storage diseases for three reasons. Firstly, the function of the blood-brain barrier may be compromised in many of the lysosomal storage diseases and this barrier dysfunction may contribute to the neuropathology seen in the diseases and accelerate cell death. Secondly, the substrate reduction therapies, which successfully reduce peripheral lysosomal storage, because of the blood-brain barrier may not have as free an access to brain cells as they do to peripheral cells. And thirdly, enzyme replacement therapy appears to have little access to the central nervous system as the mannose and mannose-6-phosphate receptors involved in their cellular uptake and transport to the lysosome do not appear to be expressed at the adult blood-brain barrier. This review will discuss in detail these issues and their context in the development of new therapeutic strategies.
Containment analysis of the 9975 transportation package with multiple barriers
International Nuclear Information System (INIS)
Vinson, D.W.
2000-01-01
A containment analysis has been performed for the scenario of non-routine transfer of a damaged 9975 package containing plutonium metal from K-area monitored storage to F-area on the Savannah River Site. A multiple barrier system with each barrier having a defined leakage rate of less than 1times10 -3 cm 3 /sec of air at Standard Temperature and Pressure was analyzed to determine the number of barriers needed to transport the package under normal transportation conditions to meet transportation requirements for containment. The barrier system was analyzed parametrically to achieve a composite system that met the federal requirements for the maximum permissible release rate given in Title 10 of the Code of Federal Regulations, Part 71. The multiple barrier system acts to retard the release of radioactivity. That is, a build-up in the radioactivity release rate occurs with time. For example, a system with three barriers (e.g., sealed plastic barrier) with a total free volume of 4,500 cm 3 could be transported for a total time of up to approximately 10 days with a release rate within the permissible rate. Additional number of barriers, or volume of the barriers, or both, would extend to this period of time. For example, a system with seven barriers with a total free volume of 4,500 cm 3 could be transported for up to 100 days. Plastic bags are one type of barrier used in movement of radioactive materials and capable of achieving a leak rate of 1times10 -3 cm 3 /sec of air at STP. Low-density polyethylene bags can withstand high temperature (up to 180 degrees C); a barrier thickness of 10 mils should be suitable for the barrier system. Additional requirements for barriers are listed in Section 4.2 of this report. Container testing per ANSI N14.5 is required to demonstrate leak rates for the individual barriers of less than 1times10 -3 cm 3 /sec
Aghapour, Mahyar; Raee, Pourya; Moghaddam, Seyed Javad; Hiemstra, Pieter S; Heijink, Irene H
2018-02-01
The epithelial lining of the airway forms the first barrier against environmental insults, such as inhaled cigarette smoke, which is the primary risk factor for the development of chronic obstructive pulmonary disease (COPD). The barrier is formed by airway epithelial junctions, which are interconnected structures that restrict permeability to inhaled pathogens and environmental stressors. Destruction of the epithelial barrier not only exposes subepithelial layers to hazardous agents in the inspired air, but also alters the normal function of epithelial cells, which may eventually contribute to the development of COPD. Of note, disruption of epithelial junctions may lead to modulation of signaling pathways involved in differentiation, repair, and proinflammatory responses. Epithelial barrier dysfunction may be particularly relevant in COPD, where repeated injury by cigarette smoke exposure, pathogens, inflammatory mediators, and impaired epithelial regeneration may compromise the barrier function. In the current review, we discuss recent advances in understanding the mechanisms of barrier dysfunction in COPD, as well as the molecular mechanisms that underlie the impaired repair response of the injured epithelium in COPD and its inability to redifferentiate into a functionally intact epithelium.
Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation
DEFF Research Database (Denmark)
Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina
2007-01-01
12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...
International Nuclear Information System (INIS)
Davies, Lincoln L.; Uchitel, Kirsten; Ruple, John
2013-01-01
Although a potentially useful climate change mitigation tool, carbon capture and sequestration (CCS) efforts in the United States remain mired in demonstration and development. Prior studies suggest numerous reasons for this stagnation. This article empirically assesses those claims. Using an anonymous opinion survey completed by 229 CCS experts, we identified four primary barriers to CCS commercialization: (1) cost and cost recovery, (2) lack of a price signal or financial incentive, (3) long-term liability risks, and (4) lack of a comprehensive regulatory regime. These results give empirical weight to previous studies suggesting that CCS cost (and cost recovery) and liability risks are primary barriers to the technology. However, the need for comprehensive rather than piecemeal CCS regulation represents an emerging concern not previously singled out in the literature. Our results clearly show that the CCS community sees fragmented regulation as one of the most significant barriers to CCS deployment. Specifically, industry is united in its preference for a federal regulatory floor that is subject to state-level administration and sensitive to local conditions. Likewise, CCS experts share broad confidence in the technology's readiness, despite continued calls for commercial-scale demonstration projects before CCS is widely deployed. - Highlights: • We developed and distributed a unique CCS opinion survey. • Our analysis confirmed cost and liability as primary barriers to CCS deployment. • We identified regulatory barriers to CCS not previously singled out in the literature. • We address the need for comprehensive rather than piecemeal CCS regulation
Trends and barriers to lateral gene transfer in prokaryotes.
Popa, Ovidiu; Dagan, Tal
2011-10-01
Gene acquisition by lateral gene transfer (LGT) is an important mechanism for natural variation among prokaryotes. Laboratory experiments show that protein-coding genes can be laterally transferred extremely fast among microbial cells, inherited to most of their descendants, and adapt to a new regulatory regime within a short time. Recent advance in the phylogenetic analysis of microbial genomes using networks approach reveals a substantial impact of LGT during microbial genome evolution. Phylogenomic networks of LGT among prokaryotes reconstructed from completely sequenced genomes uncover barriers to LGT in multiple levels. Here we discuss the kinds of barriers to gene acquisition in nature including physical barriers for gene transfer between cells, genomic barriers for the integration of acquired DNA, and functional barriers for the acquisition of new genes. Copyright © 2011 Elsevier Ltd. All rights reserved.
Perception of barriers for expansion of electricity grids in the European Union
International Nuclear Information System (INIS)
Battaglini, Antonella; Komendantova, Nadejda; Brtnik, Patricia; Patt, Anthony
2012-01-01
Many of the scenarios for decarbonising the European energy system involve the integration of large-scale and decentralised renewable energy sources, such as wind and solar power. However, such integration requires substantial and rapid improvements to the existing transmission grids. Using a mix of qualitative and quantitative methods, we analysed the opinions and views of stakeholders concerning the main barriers and solutions to this problem. The results suggest two conclusions. The first is that primary barriers to the currently needed level of grid expansion are not technical or financial, but the lack of appropriate regulatory frameworks and public acceptance. The second is that major changes are needed in the overall regulatory process, rather than simply minor modifications or improved implementation of existing regulations. - Highlights: ► Estimations of perceptions on barriers for expansion of electricity grids in Europe. ► Recommendations on political process and level of acceptance among European population. ► Needs for better, simplified and standardized regulations. ► Strong and transparent consultation process in all stages.
Directory of Open Access Journals (Sweden)
Catarina Lopes Santos
Full Text Available LuxR regulators are a widely studied group of bacterial helix-turn-helix (HTH transcription factors involved in the regulation of many genes coding for important traits at an ecological and medical level. This regulatory family is particularly known by their involvement in quorum-sensing (QS mechanisms, i.e., in the bacterial ability to communicate through the synthesis and binding of molecular signals. However, these studies have been mainly focused on gram-negative organisms, and the presence of LuxR regulators in the gram-positive Actinobacteria phylum is still poorly explored. In this manuscript, the presence of LuxR regulators among Actinobacteria was assayed using a domain-based strategy. A total of 991 proteins having one LuxR domain were identified in 53 genome-sequenced actinobacterial species, of which 59% had an additional domain. In most cases (53% this domain was REC (receiver domain, suggesting that LuxR regulators in Actinobacteria may either function as single transcription factors or as part of two-component systems. The frequency, distribution and evolutionary stability of each of these sub-families of regulators was analyzed and contextualized regarding the ecological niche occupied by each organism. The results show that the presence of extra-domains in the LuxR-regulators was likely driven by a general need to physically uncouple the signal sensing from the signal transduction. Moreover, the total frequency of LuxR regulators was shown to be dependent on genetic, metabolic and ecological variables. Finally, the functional annotation of the LuxR regulators revealed that the bacterial ecological niche has biased the specialization of these proteins. In the case of pathogens, our results suggest that LuxR regulators can be involved in virulence and are therefore promising targets for future studies in the health-related biotechnology field.
Santos, Catarina Lopes; Correia-Neves, Margarida; Moradas-Ferreira, Pedro; Mendes, Marta Vaz
2012-01-01
LuxR regulators are a widely studied group of bacterial helix-turn-helix (HTH) transcription factors involved in the regulation of many genes coding for important traits at an ecological and medical level. This regulatory family is particularly known by their involvement in quorum-sensing (QS) mechanisms, i.e., in the bacterial ability to communicate through the synthesis and binding of molecular signals. However, these studies have been mainly focused on Gram-negative organisms, and the presence of LuxR regulators in the Gram-positive Actinobacteria phylum is still poorly explored. In this manuscript, the presence of LuxR regulators among Actinobacteria was assayed using a domain-based strategy. A total of 991 proteins having one LuxR domain were identified in 53 genome-sequenced actinobacterial species, of which 59% had an additional domain. In most cases (53%) this domain was REC (receiver domain), suggesting that LuxR regulators in Actinobacteria may either function as single transcription factors or as part of two-component systems. The frequency, distribution and evolutionary stability of each of these sub-families of regulators was analyzed and contextualized regarding the ecological niche occupied by each organism. The results show that the presence of extra-domains in the LuxR-regulators was likely driven by a general need to physically uncouple the signal sensing from the signal transduction. Moreover, the total frequency of LuxR regulators was shown to be dependent on genetic, metabolic and ecological variables. Finally, the functional annotation of the LuxR regulators revealed that the bacterial ecological niche has biased the specialization of these proteins. In the case of pathogens, our results suggest that LuxR regulators can be involved in virulence and are therefore promising targets for future studies in the health-related biotechnology field. PMID:23056438
Barriers to Liposomal Gene Delivery: from Application Site to the Target.
Saffari, Mostafa; Moghimi, Hamid Reza; Dass, Crispin R
2016-01-01
Gene therapy is a therapeutic approach to deliver genetic material into cells to alter their function in entire organism. One promising form of gene delivery system (DDS) is liposomes. The success of liposome-mediated gene delivery is a multifactorial issue and well-designed liposomal systems might lead to optimized gene transfection particularly in vivo. Liposomal gene delivery systems face different barriers from their site of application to their target, which is inside the cells. These barriers include presystemic obstacles (epithelial barriers), systemic barriers in blood circulation and cellular barriers. Epithelial barriers differ depending on the route of administration. Systemic barriers include enzymatic degradation, binding and opsonisation. Both of these barriers can act as limiting hurdles that genetic material and their vector should overcome before reaching the cells. Finally liposomes should overcome cellular barriers that include cell entrance, endosomal escape and nuclear uptake. These barriers and their impact on liposomal gene delivery will be discussed in this review.
DEFF Research Database (Denmark)
Bailey, D M; Evans, K A; James, P E
2008-01-01
We tested the hypothesis that dynamic cerebral autoregulation (CA) and blood-brain barrier (BBB) function would be compromised in acute mountain sickness (AMS) subsequent to a hypoxia-mediated alteration in systemic free radical metabolism. Eighteen male lowlanders were examined in normoxia (21% O...... developed clinical AMS (AMS+) and were more hypoxaemic relative to subjects without AMS (AMS-). A more marked increase in the venous concentration of the ascorbate radical (A(*-)), lipid hydroperoxides (LOOH) and increased susceptibility of low-density lipoprotein (LDL) to oxidation was observed during...
Vranken, Marjolein J M; Mantel-Teeuwisse, Aukje K; Schutjens, Marie-Hélène D B; Scholten, Willem K; Jünger, Saskia; Medic, Dr Rer; Leufkens, Hubert G M
2018-04-06
In 2011-2013, >95% of the global opioid analgesics consumption occurred in three regions, accounting for 15% of the world population. Despite abundant literature on barriers to access, little is known on the correlation between actual access to opioid analgesics and barriers to access, including legal and regulatory barriers. This study aimed to evaluate the correlation between access to strong opioid analgesics and barriers to access in national legislation and regulations in 11 central and eastern European countries that participated in the Access to Opioid Medication in Europe (ATOME) project. Two variables were contrasted to assess their correlation: the country level of access to strong opioid analgesics indicated by the Adequacy of Consumption Measure (ACM) and the number of potential legal and regulatory barriers identified by an external review of legislation and regulations. A linear correlation was evaluated using a squared linear correlation coefficient. Evaluation of the correlation between the ACM and the number of potential barriers produces an R 2 value of 0.023 and a correlation plot trend line gradient of -0.075, indicating no correlation between access to strong opioid analgesics and the number of potential barriers in national legislation and regulations in the countries studied. No correlation was found, which indicates that other factors besides potential legal and regulatory barriers play a critical role in withholding prescribers and patients essential pain medication in the studied countries. More research is needed toward better understanding of the complex interplay of factors that determine access to strong opioid analgesics.
Chrisikos, Taylor T; Zhou, Yifan; Slone, Natalie; Babcock, Rachel; Watowich, Stephanie S; Li, Haiyan S
2018-03-14
Dendritic cells (DCs) are the principal antigen-presenting cells of the immune system and play key roles in controlling immune tolerance and activation. As such, DCs are chief mediators of tumor immunity. DCs can regulate tolerogenic immune responses that facilitate unchecked tumor growth. Importantly, however, DCs also mediate immune-stimulatory activity that restrains tumor progression. For instance, emerging evidence indicates the cDC1 subset has important functions in delivering tumor antigens to lymph nodes and inducing antigen-specific lymphocyte responses to tumors. Moreover, DCs control specific therapeutic responses in cancer including those resulting from immune checkpoint blockade. DC generation and function is influenced profoundly by cytokines, as well as their intracellular signaling proteins including STAT transcription factors. Regardless, our understanding of DC regulation in the cytokine-rich tumor microenvironment is still developing and must be better defined to advance cancer treatment. Here, we review literature focused on the molecular control of DCs, with a particular emphasis on cytokine- and STAT-mediated DC regulation. In addition, we highlight recent studies that delineate the importance of DCs in anti-tumor immunity and immune therapy, with the overall goal of improving knowledge of tumor-associated factors and intrinsic DC signaling cascades that influence DC function in cancer. Copyright © 2018 Elsevier Ltd. All rights reserved.
Functions of TAM RTKs in regulating spermatogenesis and male fertility in mice.
Chen, Yongmei; Wang, Huizhen; Qi, Nan; Wu, Hui; Xiong, Weipeng; Ma, Jing; Lu, Qingxian; Han, Daishu
2009-10-01
Mice lacking TYRO3, AXL and MER (TAM) receptor tyrosine kinases (RTKs) are male sterile. The mechanism of TAM RTKs in regulating male fertility remains unknown. In this study, we analyzed in more detail the testicular phenotype of TAM triple mutant (TAM(-/-)) mice with an effort to understand the mechanism. We demonstrate that the three TAM RTKs cooperatively regulate male fertility, and MER appears to be more important than AXL and TYRO3. TAM(-/-) testes showed a progressive loss of germ cells from elongated spermatids to spermatogonia. Young adult TAM(-/-) mice exhibited oligo-astheno-teratozoospermia and various morphological malformations of sperm cells. As the mice aged, the germ cells were eventually depleted from the seminiferous tubules. Furthermore, we found that TAM(-/-) Sertoli cells have an impaired phagocytic activity and a large number of differentially expressed genes compared to wild-type controls. By contrast, the function of Leydig cells was not apparently affected by the mutation of TAM RTKs. Therefore, we conclude that the suboptimal function of Sertoli cells leads to the impaired spermatogenesis in TAM(-/-) mice. The results provide novel insight into the mechanism of TAM RTKs in regulating male fertility.
Kinetic and Thermodynamic Aspects of Cellular Thiol-Disulfide Redox Regulation
DEFF Research Database (Denmark)
Jensen, Kristine Steen; Hansen, Rosa Erritzøe; Winther, Jakob R
2009-01-01
. In the cytosol regulatory disulfide bonds are typically formed in spite of the prevailing reducing conditions and may thereby function as redox switches. Such disulfide bonds are protected from enzymatic reduction by kinetic barriers and are thus allowed to exist long enough to elicit the signal. Factors......Regulation of intracellular thiol-disulfide redox status is an essential part of cellular homeostasis. This involves the regulation of both oxidative and reductive pathways, production of oxidant scavengers and, importantly, the ability of cells to respond to changes in the redox environment...... that affect the rate of thiol-disulfide exchange and stability of disulfide bonds are discussed within the framework of the underlying chemical foundations. This includes the effect of thiol acidity (pKa), the local electrostatic environment, molecular strain and entropy. Even though a thiol-disulfide...