WorldWideScience

Sample records for barley rna-directed rna

  1. Identification and characterization of barley RNA-directed RNA polymerases

    DEFF Research Database (Denmark)

    Madsen, Christian Toft; Stephens, Jennifer; Hornyik, Csaba

    2009-01-01

    in dicot species. In this report, we identi!ed and characterized HvRDR1, HvRDR2 and HvRDR6 genes in the monocot plant barley (Hordeum vulgare). We analysed their expression under various biotic and abiotic stresses including fungal and viral infections, salicylic acid treatment as well as during plant...... development. The different classes and subclasses of barley RDRs displayed contrasting expression patterns during pathogen challenge and development suggesting their involvement in speci!c regulatory pathways. Their response to heat and salicylic acid treatment suggests a conserved pattern of expression...

  2. RNA-directed repair of DNA double-strand breaks.

    Science.gov (United States)

    Yang, Yun-Gui; Qi, Yijun

    2015-08-01

    DNA double-strand breaks (DSBs) are among the most deleterious DNA lesions, which if unrepaired or repaired incorrectly can cause cell death or genome instability that may lead to cancer. To counteract these adverse consequences, eukaryotes have evolved a highly orchestrated mechanism to repair DSBs, namely DNA-damage-response (DDR). DDR, as defined specifically in relation to DSBs, consists of multi-layered regulatory modes including DNA damage sensors, transducers and effectors, through which DSBs are sensed and then repaired via DNAprotein interactions. Unexpectedly, recent studies have revealed a direct role of RNA in the repair of DSBs, including DSB-induced small RNA (diRNA)-directed and RNA-templated DNA repair. Here, we summarize the recent discoveries of RNA-mediated regulation of DSB repair and discuss the potential impact of these novel RNA components of the DSB repair pathway on genomic stability and plasticity. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-07-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

  4. TARDIS, a targeted RNA directional sequencing method for rare RNA discovery.

    Science.gov (United States)

    Portal, Maximiliano M; Pavet, Valeria; Erb, Cathie; Gronemeyer, Hinrich

    2015-12-01

    High-throughput transcriptional analysis has unveiled a myriad of novel RNAs. However, technical constraints in RNA sequencing library preparation and platform performance hamper the identification of rare transcripts contained within the RNA repertoire. Herein we present targeted-RNA directional sequencing (TARDIS), a hybridization-based method that allows subsets of RNAs contained within the transcriptome to be interrogated independently of transcript length, function, the presence or absence of poly-A tracts, or the mechanism of biogenesis. TARDIS is a modular protocol that is subdivided into four main phases, including the generation of random DNA traps covering the region of interest, purification of input RNA material, DNA trap-based RNA capture, and finally RNA-sequencing library construction. Importantly, coupling RNA capture to strand-specific RNA sequencing enables robust identification and reconstruction of novel transcripts, the definition of sense and antisense RNA pairs and, by the concomitant analysis of long and natural small RNA pools, it allows the user to infer potential precursor-product relations. TARDIS takes ∼10 d to implement.

  5. Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection.

    Science.gov (United States)

    Shi, Chao; Shen, Xiaotong; Niu, Shuyan; Ma, Cuiping

    2015-11-04

    RNA detection has become one of the most robust parts in molecular biology, medical diagnostics and drug discovery. Conventional RNA detection methods involve an extra reverse transcription step, which limits their further application for RNA rapid detection. We herein report a novel finding that Bst and Klenow DNA polymerases possess innate reverse transcriptase activities, so that the reverse transcription step and next amplification reaction can be combined to one step in isothermal RNA detection. We have demonstrated that Bst and Klenow DNA polymerases could be successfully used to reverse transcribe RNA within 125-nt length by real time RT-PCR and polyacrylamide gel electrophoresis (PAGE). Our findings will spur the development of a myriad of simple and easy to use RNA detection technologies for isothermal RNA direct detection. This will just meet the future needs of bioanalysis and clinical diagnosis to RNA rapid detection in POC settings and inspection and quarantine.

  6. A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

    KAUST Repository

    Law, Julie A.

    2010-05-01

    DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

  7. Role of the DRM and CMT3 methyltransferases in RNA-directed DNA methylation.

    Science.gov (United States)

    Cao, Xiaofeng; Aufsatz, Werner; Zilberman, Daniel; Mette, M Florian; Huang, Michael S; Matzke, Marjori; Jacobsen, Steven E

    2003-12-16

    RNA interference is a conserved process in which double-stranded RNA is processed into 21-25 nucleotide siRNAs that trigger posttranscriptional gene silencing. In addition, plants display a phenomenon termed RNA-directed DNA methylation (RdDM) in which DNA with sequence identity to silenced RNA is de novo methylated at its cytosine residues. This methylation is not only at canonical CpG sites but also at cytosines in CpNpG and asymmetric sequence contexts. In this report, we study the role of the DRM and CMT3 DNA methyltransferase genes in the initiation and maintenance of RdDM. Neither drm nor cmt3 mutants affected the maintenance of preestablished RNA-directed CpG methylation. However, drm mutants showed a nearly complete loss of asymmetric methylation and a partial loss of CpNpG methylation. The remaining asymmetric and CpNpG methylation was dependent on the activity of CMT3, showing that DRM and CMT3 act redundantly to maintain non-CpG methylation. These DNA methyltransferases appear to act downstream of siRNAs, since drm1 drm2 cmt3 triple mutants show a lack of non-CpG methylation but elevated levels of siRNAs. Finally, we demonstrate that DRM activity is required for the initial establishment of RdDM in all sequence contexts including CpG, CpNpG, and asymmetric sites.

  8. The splicing machinery promotes RNA-directed DNA methylation and transcriptional silencing in Arabidopsis

    Science.gov (United States)

    Zhang, Cui-Jun; Zhou, Jin-Xing; Liu, Jun; Ma, Ze-Yang; Zhang, Su-Wei; Dou, Kun; Huang, Huan-Wei; Cai, Tao; Liu, Renyi; Zhu, Jian-Kang; He, Xin-Jian

    2013-01-01

    DNA methylation in transposons and other DNA repeats is conserved in plants as well as in animals. In Arabidopsis thaliana, an RNA-directed DNA methylation (RdDM) pathway directs de novo DNA methylation. We performed a forward genetic screen for suppressors of the DNA demethylase mutant ros1 and identified a novel Zinc-finger and OCRE domain-containing Protein 1 (ZOP1) that promotes Pol IV-dependent siRNA accumulation, DNA methylation, and transcriptional silencing. Whole-genome methods disclosed the genome-wide effects of zop1 on Pol IV-dependent siRNA accumulation and DNA methylation, suggesting that ZOP1 has both RdDM-dependent and -independent roles in transcriptional silencing. We demonstrated that ZOP1 is a pre-mRNA splicing factor that associates with several typical components of the splicing machinery as well as with Pol II. Immunofluorescence assay revealed that ZOP1 overlaps with Cajal body and is partially colocalized with NRPE1 and DRM2. Moreover, we found that the other development-defective splicing mutants tested including mac3a3b, mos4, mos12 and mos14 show defects in RdDM and transcriptional silencing. We propose that the splicing machinery rather than specific splicing factors is involved in promoting RdDM and transcriptional silencing. PMID:23524848

  9. Digital Quantification of miRNA directly in plasma using Integrated Comprehensive Droplet Digital Detection

    Science.gov (United States)

    Zhang, Kaixiang; Kang, Dong-Ku; Ali, M. Monsur; Liu, Linan; Labanieh, Louai; Lu, Mengrou; Riazifar, Hamidreza; Nguyen, Thi N.; Zell, Jason A.; Digman, Michelle A.; Gratton, Enrico

    2015-01-01

    Quantification of miRNAs in blood can be potentially used for early disease detection, surveillance monitoring and drug response evaluation. However, quantitative and robust measurement of miRNAs in blood is still a major challenge in large part due to their low concentration and complicated sample preparation processes typically required in conventional assays. Here, we present the ‘Integrated Comprehensive Droplet Digital Detection’ (IC 3D) system where the plasma sample containing target miRNAs is encapsulated into microdroplets, enzymatically amplified and digitally counted using a novel, high-throughput 3D particle counter. Using Let-7a as a target, we demonstrate that IC 3D can specifically quantify target miRNA directly from blood plasma at extremely low concentrations ranging from 10s to 10,000 copies/mL in ≤ 3 hours without the need for sample processing such as RNA extraction. Using this new tool, we demonstrate that target miRNA content in colon cancer patient blood is significantly higher than that in healthy donor samples. Our IC 3D system has the potential to introduce a new paradigm for rapid, sensitive and specific detection of low-abundance biomarkers in biological samples with minimal sample processing. PMID:26387763

  10. IDN2 and its paralogs form a complex required for RNA-directed DNA methylation.

    Directory of Open Access Journals (Sweden)

    Cui-Jun Zhang

    Full Text Available IDN2/RDM12 has been previously identified as a component of the RNA-directed DNA methylation (RdDM machinery in Arabidopsis thaliana, but how it functions in RdDM remains unknown. By affinity purification of IDN2, we co-purified two IDN2 paralogs IDP1 and IDP2 (IDN2 PARALOG 1 and 2. The coiled-coil domain between the XS and XH domains of IDN2 is essential for IDN2 homodimerization, whereas the IDN2 C-terminal XH domain but not the coiled-coil domain is required for IDN2 interaction with IDP1 and IDP2. By introducing the wild-type IDN2 sequence and its mutated derivatives into the idn2 mutant for complementation testing, we demonstrated that the previously uncharacterized IDN2 XH domain is required for the IDN2-IDP1/IDP2 complex formation as well as for IDN2 function. IDP1 is required for de novo DNA methylation, siRNA accumulation, and transcriptional gene silencing, whereas IDP2 has partially overlapping roles with IDP1. Unlike IDN2, IDP1 and IDP2 are incapable of binding double-stranded RNA, suggesting that the roles of IDP1 and IDP2 are different from those of IDN2 in the IDN2-IDP1/IDP2 complex and that IDP1 and IDP2 are essential for the functioning of the complex in RdDM.

  11. MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans

    NARCIS (Netherlands)

    Correa, R.L.; Steiner, F.A.; Berezikov, E.; Ketting, R.F.

    2010-01-01

    RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the

  12. MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Régis L Corrêa

    2010-04-01

    Full Text Available RNA interference (RNAi is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA, leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.

  13. MiRNA-directed regulation of VEGF and other angiogenic factors under hypoxia.

    Directory of Open Access Journals (Sweden)

    Zhong Hua

    Full Text Available MicroRNAs (miRNAs are a class of 20-24 nt non-coding RNAs that regulate gene expression primarily through post-transcriptional repression or mRNA degradation in a sequence-specific manner. The roles of miRNAs are just beginning to be understood, but the study of miRNA function has been limited by poor understanding of the general principles of gene regulation by miRNAs. Here we used CNE cells from a human nasopharyngeal carcinoma cell line as a cellular system to investigate miRNA-directed regulation of VEGF and other angiogenic factors under hypoxia, and to explore the principles of gene regulation by miRNAs. Through computational analysis, 96 miRNAs were predicted as putative regulators of VEGF. But when we analyzed the miRNA expression profile of CNE and four other VEGF-expressing cell lines, we found that only some of these miRNAs could be involved in VEGF regulation, and that VEGF may be regulated by different miRNAs that were differentially chosen from 96 putative regulatory miRNAs of VEGF in different cells. Some of these miRNAs also co-regulate other angiogenic factors (differential regulation and co-regulation principle. We also found that VEGF was regulated by multiple miRNAs using different combinations, including both coordinate and competitive interactions. The coordinate principle states that miRNAs with independent binding sites in a gene can produce coordinate action to increase the repressive effect of miRNAs on this gene. By contrast, the competitive principle states when multiple miRNAs compete with each other for a common binding site, or when a functional miRNA competes with a false positive miRNA for the same binding site, the repressive effects of miRNAs may be decreased. Through the competitive principle, false positive miRNAs, which cannot directly repress gene expression, can sometimes play a role in miRNA-mediated gene regulation. The competitive principle, differential regulation, multi-miRNA binding sites, and false

  14. An effector of RNA-directed DNA methylation in Arabidopsis is an ARGONAUTE 4- and RNA-binding protein

    Science.gov (United States)

    He, Xin-Jian; Hsu, Yi-Feng; Zhu, Shihua; Wierzbicki, Andrzej T.; Pontes, Olga; Pikaard, Craig S.; Liu, Hai-Liang; Wang, Co-Shine; Jin, Hailing; Zhu, Jian-Kang

    2009-01-01

    Summary DNA methylation is a conserved epigenetic mark in plants and mammals. In Arabidopsis, DNA methylation can be triggered by small interfering RNAs (siRNAs) through an RNA-directed DNA methylation (RdDM) pathway. Here we report the identification of a new RdDM effector, RDM3/KTF1. Loss-of-function mutations in RDM3/KTF1 reduce DNA methylation and release the silencing of RdDM target loci without abolishing the siRNA triggers. KTF1 has similarity to the transcription elongation factor SPT5 and contains a C-terminal extension rich in GW/WG repeats. KTF1 colocalizes with ARGONAUTE 4 (AGO4) in punctate nuclear foci, and binds AGO4 and RNA transcripts. Our results suggest KTF1 as an adaptor protein that binds scaffold transcripts generated by Pol V and recruits AGO4 and AGO4-bound siRNAs to form an RdDM effector complex. The dual interaction of an effector protein with AGO and small RNA target transcripts may be a general feature of RNA silencing effector complexes. PMID:19410546

  15. An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

    KAUST Repository

    Gao, Zhihuan

    2010-04-21

    DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.

  16. An Optimized Transient Dual Luciferase Assay for Quantifying MicroRNA Directed Repression of Targeted Sequences

    Directory of Open Access Journals (Sweden)

    Richard L. Moyle

    2017-09-01

    Full Text Available Studies investigating the action of small RNAs on computationally predicted target genes require some form of experimental validation. Classical molecular methods of validating microRNA action on target genes are laborious, while approaches that tag predicted target sequences to qualitative reporter genes encounter technical limitations. The aim of this study was to address the challenge of experimentally validating large numbers of computationally predicted microRNA-target transcript interactions using an optimized, quantitative, cost-effective, and scalable approach. The presented method combines transient expression via agroinfiltration of Nicotiana benthamiana leaves with a quantitative dual luciferase reporter system, where firefly luciferase is used to report the microRNA-target sequence interaction and Renilla luciferase is used as an internal standard to normalize expression between replicates. We report the appropriate concentration of N. benthamiana leaf extracts and dilution factor to apply in order to avoid inhibition of firefly LUC activity. Furthermore, the optimal ratio of microRNA precursor expression construct to reporter construct and duration of the incubation period post-agroinfiltration were determined. The optimized dual luciferase assay provides an efficient, repeatable and scalable method to validate and quantify microRNA action on predicted target sequences. The optimized assay was used to validate five predicted targets of rice microRNA miR529b, with as few as six technical replicates. The assay can be extended to assess other small RNA-target sequence interactions, including assessing the functionality of an artificial miRNA or an RNAi construct on a targeted sequence.

  17. A transcription fork model for Pol IV and Pol V-dependent RNA-directed DNA methylation.

    Science.gov (United States)

    Pikaard, C S; Haag, J R; Pontes, O M F; Blevins, T; Cocklin, R

    2012-01-01

    In Arabidopsis thaliana, nuclear multisubunit RNA polymerase IV (Pol IV) and RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) are required for the biogenesis of 24-nucleotide small interfering RNAs (siRNAs) that direct DNA methylation and transcriptional silencing at target loci transcribed by nuclear multisubunit RNA polymerase V (Pol V). Pol IV and RDR2 physically associate and RDR2's polymerase activity in vitro is dependent on Pol IV. RDR2 transcription of nascent Pol IV transcripts might result in discontinuous second strands, analogous to lagging-strand Okazaki fragments generated during DNA replication. In vitro, Pol V is unable to displace nontemplate DNA during transcriptional elongation. This suggests a need for DNA duplex unwinding by helper proteins, perhaps analogous to the helicase-mediated duplex unwinding that occurs at replication forks to enable leading strand synthesis by DNA polymerase ε. A multiprotein complex (DRD1, DMS3, DMS11, RDM1) known to enable Pol V transcription might facilitate duplex unwinding via ATP-dependent DNA translocase, single-stranded DNA binding, and cohesin-like strand capture activities. These considerations are discussed and incorporated into a "transcription fork" model for Pol IV and Pol V-dependent RNA-directed DNA methylation.

  18. Gene Editing With CRISPR/Cas9 RNA-Directed Nuclease.

    Science.gov (United States)

    Doetschman, Thomas; Georgieva, Teodora

    2017-03-03

    Genetic engineering of model organisms and cultured cells has for decades provided important insights into the mechanisms underlying cardiovascular development and disease. In the past few years the development of several nuclease systems has broadened the range of model/cell systems that can be engineered. Of these, the CRISPR (clustered regularly interspersed short palindromic repeats)/Cas9 (CRISPR-associated protein 9) system has become the favorite for its ease of application. Here we will review this RNA-guided nuclease system for gene editing with respect to its usefulness for cardiovascular studies and with an eye toward potential therapy. Studies on its off-target activity, along with approaches to minimize this activity will be given. The advantages of gene editing versus gene targeting in embryonic stem cells, including the breadth of species and cell types to which it is applicable, will be discussed. We will also cover its use in iPSC for research and possible therapeutic purposes; and we will review its use in muscular dystrophy studies where considerable progress has been made toward dystrophin correction in mice. The CRISPR/Ca9s system is also being used for high-throughput screening of genes, gene regulatory regions, and long noncoding RNAs. In addition, the CRISPR system is being used for nongene-editing purposes such as activation and inhibition of gene expression, as well as for fluorescence tagging of chromosomal regions and individual mRNAs to track their cellular location. Finally, an approach to circumvent the inability of post-mitotic cells to support homologous recombination-based gene editing will be presented. In conclusion, applications of the CRISPR/Cas system are expanding at a breath-taking pace and are revolutionizing approaches to gain a better understanding of human diseases. © 2017 American Heart Association, Inc.

  19. Determinants for association and gRNA-directed endonuclease cleavage by purified RNA editing complexes from Trypanosoma brucei

    OpenAIRE

    Hernandez, Alfredo; Panigrahi, Aswini; Cifuentes-Rojas, Catherine; Sacharidou, Anastasia; Stuart, Kenneth; Cruz-Reyes, Jorge

    2008-01-01

    U-insertion/deletion RNA editing in the single mitochondrion of ancient kinetoplastids is a unique mRNA maturation process needed for translation. Multi-subunit editing complexes recognize many pre-mRNA sites and modify them via cycles of three catalytic steps: guide-RNA (gRNA) mediated cleavage, insertion or deletion of uridylates at the 3’ terminus of the upstream cleaved piece, and ligation of the two mRNA pieces. While catalytic and many structural protein subunits of these complexes have...

  20. The de novo cytosine methyltransferase DRM2 requires intact UBA domains and a catalytically mutated paralog DRM3 during RNA-directed DNA methylation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Ian R Henderson

    2010-10-01

    Full Text Available Eukaryotic DNA cytosine methylation can be used to transcriptionally silence repetitive sequences, including transposons and retroviruses. This silencing is stable between cell generations as cytosine methylation is maintained epigenetically through DNA replication. The Arabidopsis thaliana Dnmt3 cytosine methyltransferase ortholog DOMAINS rearranged methyltransferase2 (DRM2 is required for establishment of small interfering RNA (siRNA directed DNA methylation. In mammals PIWI proteins and piRNA act in a convergently evolved RNA-directed DNA methylation system that is required to repress transposon expression in the germ line. De novo methylation may also be independent of RNA interference and small RNAs, as in Neurospora crassa. Here we identify a clade of catalytically mutated DRM2 paralogs in flowering plant genomes, which in A.thaliana we term domains rearranged methyltransferase3 (DRM3. Despite being catalytically mutated, DRM3 is required for normal maintenance of non-CG DNA methylation, establishment of RNA-directed DNA methylation triggered by repeat sequences and accumulation of repeat-associated small RNAs. Although the mammalian catalytically inactive Dnmt3L paralogs act in an analogous manner, phylogenetic analysis indicates that the DRM and Dnmt3 protein families diverged independently in plants and animals. We also show by site-directed mutagenesis that both the DRM2 N-terminal UBA domains and C-terminal methyltransferase domain are required for normal RNA-directed DNA methylation, supporting an essential targeting function for the UBA domains. These results suggest that plant and mammalian RNA-directed DNA methylation systems consist of a combination of ancestral and convergent features.

  1. Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

    Science.gov (United States)

    Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

    2014-10-01

    Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

  2. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  3. IMP3 RNP safe houses prevent miRNA-directed HMGA2 mRNA decay in cancer and development

    DEFF Research Database (Denmark)

    Jønson, Lars; Christiansen, Jan; Hansen, Thomas van Overeem

    2014-01-01

    by let-7, and let-7 antagomiRs make HMGA2 refractory to IMP3. Removal of let-7 target sites eliminates IMP3-dependent stabilization, and IMP3-containing bodies are depleted of Ago1-4 and miRNAs. The relationship between Hmga2 mRNA and IMPs also exists in the developing limb bud, where IMP1-deficient......The IMP3 RNA-binding protein is associated with metastasis and poor outcome in human cancer. Using solid cancer transcriptome data, we found that IMP3 correlates with HMGA2 mRNA expression. Cytoplasmic IMP3 granules contain HMGA2, and IMP3 dose-dependently increases HMGA2 mRNA. HMGA2 is regulated...

  4. De Novo Transcriptome Sequence Assembly from Coconut Leaves and Seeds with a Focus on Factors Involved in RNA-Directed DNA Methylation

    Science.gov (United States)

    Huang, Ya-Yi; Lee, Chueh-Pai; Fu, Jason L.; Chang, Bill Chia-Han; Matzke, Antonius J. M.; Matzke, Marjori

    2014-01-01

    Coconut palm (Cocos nucifera) is a symbol of the tropics and a source of numerous edible and nonedible products of economic value. Despite its nutritional and industrial significance, coconut remains under-represented in public repositories for genomic and transcriptomic data. We report de novo transcript assembly from RNA-seq data and analysis of gene expression in seed tissues (embryo and endosperm) and leaves of a dwarf coconut variety. Assembly of 10 GB sequencing data for each tissue resulted in 58,211 total unigenes in embryo, 61,152 in endosperm, and 33,446 in leaf. Within each unigene pool, 24,857 could be annotated in embryo, 29,731 could be annotated in endosperm, and 26,064 could be annotated in leaf. A KEGG analysis identified 138, 138, and 139 pathways, respectively, in transcriptomes of embryo, endosperm, and leaf tissues. Given the extraordinarily large size of coconut seeds and the importance of small RNA-mediated epigenetic regulation during seed development in model plants, we used homology searches to identify putative homologs of factors required for RNA-directed DNA methylation in coconut. The findings suggest that RNA-directed DNA methylation is important during coconut seed development, particularly in maturing endosperm. This dataset will expand the genomics resources available for coconut and provide a foundation for more detailed analyses that may assist molecular breeding strategies aimed at improving this major tropical crop. PMID:25193496

  5. De novo transcriptome sequence assembly from coconut leaves and seeds with a focus on factors involved in RNA-directed DNA methylation.

    Science.gov (United States)

    Huang, Ya-Yi; Lee, Chueh-Pai; Fu, Jason L; Chang, Bill Chia-Han; Matzke, Antonius J M; Matzke, Marjori

    2014-09-04

    Coconut palm (Cocos nucifera) is a symbol of the tropics and a source of numerous edible and nonedible products of economic value. Despite its nutritional and industrial significance, coconut remains under-represented in public repositories for genomic and transcriptomic data. We report de novo transcript assembly from RNA-seq data and analysis of gene expression in seed tissues (embryo and endosperm) and leaves of a dwarf coconut variety. Assembly of 10 GB sequencing data for each tissue resulted in 58,211 total unigenes in embryo, 61,152 in endosperm, and 33,446 in leaf. Within each unigene pool, 24,857 could be annotated in embryo, 29,731 could be annotated in endosperm, and 26,064 could be annotated in leaf. A KEGG analysis identified 138, 138, and 139 pathways, respectively, in transcriptomes of embryo, endosperm, and leaf tissues. Given the extraordinarily large size of coconut seeds and the importance of small RNA-mediated epigenetic regulation during seed development in model plants, we used homology searches to identify putative homologs of factors required for RNA-directed DNA methylation in coconut. The findings suggest that RNA-directed DNA methylation is important during coconut seed development, particularly in maturing endosperm. This dataset will expand the genomics resources available for coconut and provide a foundation for more detailed analyses that may assist molecular breeding strategies aimed at improving this major tropical crop. Copyright © 2014 Huang et al.

  6. Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer.

    Science.gov (United States)

    Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong

    2014-02-01

    The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

  7. Genome-wide identification of endogenous RNA-directed DNA methylation loci associated with abundant 21-nucleotide siRNAs in Arabidopsis.

    Science.gov (United States)

    Zhao, Jian-Hua; Fang, Yuan-Yuan; Duan, Cheng-Guo; Fang, Rong-Xiang; Ding, Shou-Wei; Guo, Hui-Shan

    2016-10-27

    In Arabidopsis, the 24-nucleotide (nt) small interfering RNAs (siRNAs) mediates RNA-directed DNA methylation (RdDM) and transcriptional gene silencing (TGS) of transposable elements (TEs). In the present study, we examined genome-wide changes in DNA methylation and siRNA accumulation in Arabidopsis induced by expression of the Cucumber mosaic virus silencing suppressor protein 2b known to directly bind to both the 21/24-nt siRNAs as well as their associated Argonaute proteins. We demonstrated a genome-wide reduction of CHH and CHG methylation in the 2b-transgenic plants. We found that 2b suppressed RdDM not only at the previously annotated loci directed by 24-nt siRNAs but also a new set of loci associated with 21/22-nt siRNAs. Further analysis showed that the reduced methylation of TEs and coding genes targeted by 21/22-nt siRNAs was associated with sequestration of the duplex siRNAs by the 2b protein but not with changes in either siRNA production or transcription. Notably, we detected both the deletion and/or the transposition of multicopy TEs associated with 2b-induced hypomethylation, suggesting potential TE reactivation. We propose that the silencing of many TEs in Arabidopsis is controlled by the 24- and 21-nt endogenous siRNAs analogous to Drosophila TE silencing by PIWI-interacting RNAs and siRNAs.

  8. Angiosperms Are Unique among Land Plant Lineages in the Occurrence of Key Genes in the RNA-Directed DNA Methylation (RdDM) Pathway.

    Science.gov (United States)

    Ma, Lu; Hatlen, Andrea; Kelly, Laura J; Becher, Hannes; Wang, Wencai; Kovarik, Ales; Leitch, Ilia J; Leitch, Andrew R

    2015-09-02

    The RNA-directed DNA methylation (RdDM) pathway can be divided into three phases: 1) small interfering RNA biogenesis, 2) de novo methylation, and 3) chromatin modification. To determine the degree of conservation of this pathway we searched for key genes among land plants. We used OrthoMCL and the OrthoMCL Viridiplantae database to analyze proteomes of species in bryophytes, lycophytes, monilophytes, gymnosperms, and angiosperms. We also analyzed small RNA size categories and, in two gymnosperms, cytosine methylation in ribosomal DNA. Six proteins were restricted to angiosperms, these being NRPD4/NRPE4, RDM1, DMS3 (defective in meristem silencing 3), SHH1 (SAWADEE homeodomain homolog 1), KTF1, and SUVR2, although we failed to find the latter three proteins in Fritillaria persica, a species with a giant genome. Small RNAs of 24 nt in length were abundant only in angiosperms. Phylogenetic analyses of Dicer-like (DCL) proteins showed that DCL2 was restricted to seed plants, although it was absent in Gnetum gnemon and Welwitschia mirabilis. The data suggest that phases (1) and (2) of the RdDM pathway, described for model angiosperms, evolved with angiosperms. The absence of some features of RdDM in F. persica may be associated with its large genome. Phase (3) is probably the most conserved part of the pathway across land plants. DCL2, involved in virus defense and interaction with the canonical RdDM pathway to facilitate methylation of CHH, is absent outside seed plants. Its absence in G. gnemon, and W. mirabilis coupled with distinctive patterns of CHH methylation, suggest a secondary loss of DCL2 following the divergence of Gnetales. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. NRPD4, a protein related to the RPB4 subunit of RNA polymerase II, is a component of RNA polymerases IV and V and is required for RNA-directed DNA methylation

    Science.gov (United States)

    He, Xin-Jian; Hsu, Yi-Feng; Pontes, Olga; Zhu, Jianhua; Lu, Jian; Bressan, Ray A.; Pikaard, Craig; Wang, Co-Shine; Zhu, Jian-Kang

    2009-01-01

    RNA-directed DNA methylation (RdDM) is an RNAi-based mechanism for establishing transcriptional gene silencing in plants. The plant-specific RNA polymerases IV and V are required for the generation of 24-nucleotide (nt) siRNAs and for guiding sequence-specific DNA methylation by the siRNAs, respectively. However, unlike the extensively studied multisubunit Pol II, our current knowledge about Pol IV and Pol V is restricted to only the two largest subunits NRPD1a/NRPD1 and NRPD1b/NRPE1 and the one second-largest subunit NRPD2a. It is unclear whether other subunits may be required for the functioning of Pol IV and Pol V in RdDM. From a genetic screen for second-site suppressors of the DNA demethylase mutant ros1, we identified a new component (referred to as RDM2) as well as seven known components (NRPD1, NRPE1, NRPD2a, AGO4, HEN1, DRD1, and HDA6) of the RdDM pathway. The differential effects of the mutations on two mechanistically distinct transcriptional silencing reporters suggest that RDM2, NRPD1, NRPE1, NRPD2a, HEN1, and DRD1 function only in the siRNA-dependent pathway of transcriptional silencing, whereas HDA6 and AGO4 have roles in both siRNA-dependent and -independent pathways of transcriptional silencing. In the rdm2 mutants, DNA methylation and siRNA accumulation were reduced substantially at loci previously identified as endogenous targets of Pol IV and Pol V, including 5S rDNA, MEA-ISR, AtSN1, AtGP1, and AtMU1. The amino acid sequence of RDM2 is similar to that of RPB4 subunit of Pol II, but we show evidence that RDM2 has diverged significantly from RPB4 and cannot function in Pol II. An association of RDM2 with both NRPD1 and NRPE1 was observed by coimmunoprecipitation and coimmunolocalization assays. Our results show that RDM2/NRPD4/NRPE4 is a new component of the RdDM pathway in Arabidopsis and that it functions as part of Pol IV and Pol V. PMID:19204117

  10. NRPD4, a Protein Related to the RPB4 Subunit of RNA Polymerase II, is a Component of RNA Polymerases IV and V and is Required for RNA-directed DNA methylation

    Energy Technology Data Exchange (ETDEWEB)

    He, Xin-Jian; Hsu, Yi-Feng; Pontes, Olga; Zhu, Jianhua; Lu, Jian; Bressan, Ray A.; Pikaard, Craig S.; Wang, Co-Shine; Zhu, Jian-Kang

    2009-01-01

    RNA-directed DNA methylation (RdDM) is an RNAi-based mechanism for establishing transcriptional gene silencing in plants. The plant-specific RNA polymerases IV and V are required for the generation of 24-nucleotide (nt) siRNAs and for guiding sequence-specific DNA methylation by the siRNAs, respectively. However, unlike the extensively studied multisubunit Pol II, our current knowledge about Pol IV and Pol V is restricted to only the two largest subunits NRPD1a/NRPD1 and NRPD1b/NRPE1 and the one second-largest subunit NRPD2a. It is unclear whether other subunits may be required for the functioning of Pol IV and Pol V in RdDM. From a genetic screen for second-site suppressors of the DNA demethylase mutant ros1, we identified a new component (referred to as RDM2) as well as seven known components (NRPD1, NRPE1, NRPD2a, AGO4, HEN1, DRD1, and HDA6) of the RdDM pathway. The differential effects of the mutations on two mechanistically distinct transcriptional silencing reporters suggest that RDM2, NRPD1, NRPE1, NRPD2a, HEN1, and DRD1 function only in the siRNA-dependent pathway of transcriptional silencing, whereas HDA6 and AGO4 have roles in both siRNA-dependent and -independent pathways of transcriptional silencing. In the rdm2 mutants, DNA methylation and siRNA accumulation were reduced substantially at loci previously identified as endogenous targets of Pol IV and Pol V, including 5S rDNA, MEA-ISR, AtSN1, AtGP1, and AtMU1. The amino acid sequence of RDM2 is similar to that of RPB4 subunit of Pol II, but we show evidence that RDM2 has diverged significantly from RPB4 and cannot function in Pol II. An association of RDM2 with both NRPD1 and NRPE1 was observed by coimmunoprecipitation and coimmunolocalization assays. Our results show that RDM2/NRPD4/NRPE4 is a new component of the RdDM pathway in Arabidopsis and that it functions as part of Pol IV and Pol V.

  11. Isolation and Translation of Hordein Messenger RNA from Wild Type and Mutant Endosperms in Barley

    DEFF Research Database (Denmark)

    Brandt, Anders Bøving; Ingwersen, J.

    1978-01-01

    of a different B1 hordein polypeptide, which is revealed by 21 nucleotide substitutions resulting in 9 amino acid changes. Messenger RNA has been isolated from developing barley endosperms by sucrose gradient sedimentation, Sepharose 4B gel filtration and preparative gel electrophoresis. Hordein messenger RNA...... was found to be a major constituent of the total messenger RNA population of the endosperm cell. Polyadenylated hordein messenger RNA sedimented at 11S in sucrose gradients and electrophoretic analysis reveals the presence of at least three RNA species with apparent molecular weights of 0.45, 0.36 and 0.......30 megadaltons. The 11S messenger RNA was translated in vitro into hordein precursor polypeptides which are 2–4 kilodaltons larger than the native hordein polypeptides. The endosperm cell of mutant No. 1508 contained twice as much RNA as the wild type endosperm cell but the same amount of polyadenylated 11S RNA...

  12. IBM1, a JmjC domain-containing histone demethylase, is involved in the regulation of RNA-directed DNA methylation through the epigenetic control of RDR2 and DCL3 expression in Arabidopsis.

    Science.gov (United States)

    Fan, Di; Dai, Yan; Wang, Xuncheng; Wang, Zhenjie; He, Hang; Yang, Hongchun; Cao, Ying; Deng, Xing Wang; Ma, Ligeng

    2012-10-01

    Small RNA-directed DNA methylation (RdDM) is an important epigenetic pathway in Arabidopsis that controls the expression of multiple genes and several developmental processes. RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and DICER-LIKE 3 (DCL3) are necessary factors in 24-nt small interfering RNA (siRNA) biogenesis, which is part of the RdDM pathway. Here, we found that Increase in BONSAI Methylation 1 (IBM1), a conserved JmjC family histone demethylase, is directly associated with RDR2 and DCL3 chromatin. The mutation of IBM1 induced the hypermethylation of H3K9 and DNA non-CG sites within RDR2 and DCL3, which repressed their expression. A genome-wide analysis suggested that the reduction in RDR2 and DCL3 expression affected siRNA biogenesis in a locus-specific manner and disrupted RdDM-directed gene repression. Together, our results suggest that IBM1 regulates gene expression through two distinct pathways: direct association to protect genes from silencing by preventing the coupling of histone and DNA methylation, and indirect silencing of gene expression through RdDM-directed repression.

  13. Arabidopsis RNASE THREE LIKE2 Modulates the Expression of Protein-Coding Genes via 24-Nucleotide Small Interfering RNA-Directed DNA Methylation.

    Science.gov (United States)

    Elvira-Matelot, Emilie; Hachet, Mélanie; Shamandi, Nahid; Comella, Pascale; Sáez-Vásquez, Julio; Zytnicki, Matthias; Vaucheret, Hervé

    2016-02-01

    RNaseIII enzymes catalyze the cleavage of double-stranded RNA (dsRNA) and have diverse functions in RNA maturation. Arabidopsis thaliana RNASE THREE LIKE2 (RTL2), which carries one RNaseIII and two dsRNA binding (DRB) domains, is a unique Arabidopsis RNaseIII enzyme resembling the budding yeast small interfering RNA (siRNA)-producing Dcr1 enzyme. Here, we show that RTL2 modulates the production of a subset of small RNAs and that this activity depends on both its RNaseIII and DRB domains. However, the mode of action of RTL2 differs from that of Dcr1. Whereas Dcr1 directly cleaves dsRNAs into 23-nucleotide siRNAs, RTL2 likely cleaves dsRNAs into longer molecules, which are subsequently processed into small RNAs by the DICER-LIKE enzymes. Depending on the dsRNA considered, RTL2-mediated maturation either improves (RTL2-dependent loci) or reduces (RTL2-sensitive loci) the production of small RNAs. Because the vast majority of RTL2-regulated loci correspond to transposons and intergenic regions producing 24-nucleotide siRNAs that guide DNA methylation, RTL2 depletion modifies DNA methylation in these regions. Nevertheless, 13% of RTL2-regulated loci correspond to protein-coding genes. We show that changes in 24-nucleotide siRNA levels also affect DNA methylation levels at such loci and inversely correlate with mRNA steady state levels, thus implicating RTL2 in the regulation of protein-coding gene expression. © 2016 American Society of Plant Biologists. All rights reserved.

  14. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  15. A high-throughput RNA extraction for sprouted single-seed malting barley (Hordeum vulgare L.) rich in polysaccharides

    Science.gov (United States)

    Germinated seed from cereal crops including barley (Hordeum vulgare L.) is an important tissue to extract RNA and analyze expression levels of genes that control aspects of germination. These tissues are rich in polysaccharides and most methods for RNA extraction are not suitable to handle the exces...

  16. The Barley stripe mosaic virus γb protein promotes chloroplast-targeted replication by enhancing unwinding of RNA duplexes.

    Directory of Open Access Journals (Sweden)

    Kun Zhang

    2017-04-01

    Full Text Available RNA viruses encode various RNA binding proteins that function in many steps of viral infection cycles. These proteins function as RNA helicases, methyltransferases, RNA-dependent RNA polymerases, RNA silencing suppressors, RNA chaperones, movement proteins, and so on. Although many of the proteins bind the viral RNA genome during different stages of infection, our knowledge about the coordination of their functions is limited. In this study, we describe a novel role for the Barley stripe mosaic virus (BSMV γb as an enhancer of αa RNA helicase activity, and we show that the γb protein is recruited by the αa viral replication protein to chloroplast membrane sites of BSMV replication. Mutagenesis or deletion of γb from BSMV resulted in reduced positive strand (+ RNAα accumulation, but γb mutations abolishing viral suppressor of RNA silencing (VSR activity did not completely eliminate genomic RNA replication. In addition, cis- or trans-expression of the Tomato bushy stunt virus p19 VSR protein failed to complement the γb replication functions, indicating that the direct involvement of γb in BSMV RNA replication is independent of VSR functions. These data support a model whereby two BSMV-encoded RNA-binding proteins act coordinately to regulate viral genome replication and provide new insights into strategies whereby double-stranded viral RNA unwinding is regulated, as well as formation of viral replication complexes.

  17. The Barley stripe mosaic virus γb protein promotes chloroplast-targeted replication by enhancing unwinding of RNA duplexes

    Science.gov (United States)

    Yang, Meng; Liu, Songyu; Li, Zhenggang; Wang, Xianbing; Han, Chenggui; Yu, Jialin

    2017-01-01

    RNA viruses encode various RNA binding proteins that function in many steps of viral infection cycles. These proteins function as RNA helicases, methyltransferases, RNA-dependent RNA polymerases, RNA silencing suppressors, RNA chaperones, movement proteins, and so on. Although many of the proteins bind the viral RNA genome during different stages of infection, our knowledge about the coordination of their functions is limited. In this study, we describe a novel role for the Barley stripe mosaic virus (BSMV) γb as an enhancer of αa RNA helicase activity, and we show that the γb protein is recruited by the αa viral replication protein to chloroplast membrane sites of BSMV replication. Mutagenesis or deletion of γb from BSMV resulted in reduced positive strand (+) RNAα accumulation, but γb mutations abolishing viral suppressor of RNA silencing (VSR) activity did not completely eliminate genomic RNA replication. In addition, cis- or trans-expression of the Tomato bushy stunt virus p19 VSR protein failed to complement the γb replication functions, indicating that the direct involvement of γb in BSMV RNA replication is independent of VSR functions. These data support a model whereby two BSMV-encoded RNA-binding proteins act coordinately to regulate viral genome replication and provide new insights into strategies whereby double-stranded viral RNA unwinding is regulated, as well as formation of viral replication complexes. PMID:28388677

  18. RNA-seq analysis of Brachypodium distachyon responses to Barley stripe mosaic virus infection

    Directory of Open Access Journals (Sweden)

    Guoxin Wang

    2017-02-01

    Full Text Available Barley stripe mosaic virus (BSMV is the type member of the genus Hordeivirus. Brachypodium distachyon line Bd3-1 shows resistance to the BSMV ND18 strain, but is susceptible to an ND18 double mutant (β NDTGB1R390K, T392K in which lysine is substituted for an arginine at position 390 and for threonine at position 392 of the triple gene block 1 (TGB1 protein. In order to understand differences in gene expression following infection with ND18 and double mutant ND18, Bd3-1 seedlings were subjected to RNA-seq analyses at 1, 6, and 14 days post inoculation (dpi. The results revealed that basal immunity genes involved in cellulose synthesis and pathogenesis-related protein biosynthesis were enhanced in incompatible interactions between Bd3-1 and ND18. Most of the differentially expressed transcripts are related to trehalose biosynthesis, ethylene, jasmonic acid metabolism, protein phosphorylation, protein ubiquitination, transcriptional regulation, and transport process, as well as pathogenesis-related protein biosynthesis. In compatible interactions between Bd3-1 and ND18 mutant, Bd3-1 developed weak basal resistance responses to the virus. Many genes involved in cellulose biosynthesis, protein amino acid phosphorylation, protein biosynthesis, protein glycosylation, glycolysis and cellular macromolecular complex assembly that may be related to virus replication, assembly and movement were up-regulated. Some genes involved in oxidative stress responses were also up-regulated at 14 dpi. BSMV ND18 mutant infection suppressed expression of genes functioning in regulation of transcription, protein kinase, cellular nitrogen compound biosynthetic process and photosynthesis. Differential expression patterns between compatible and incompatible interactions in Bd3-1 to the two BSMV strains provide important clues for understanding mechanism of resistance to BMSV in the model plant Brachypodium.

  19. Isolation of tissues and preservation of RNA from intact, germinated barley grain.

    Science.gov (United States)

    Betts, Natalie S; Berkowitz, Oliver; Liu, Ruijie; Collins, Helen M; Skadhauge, Birgitte; Dockter, Christoph; Burton, Rachel A; Whelan, James; Fincher, Geoffrey B

    2017-08-01

    Isolated barley (Hordeum vulgare L.) aleurone layers have been widely used as a model system for studying gene expression and hormonal regulation in germinating cereal grains. A serious technological limitation of this approach has been the inability to confidently extrapolate conclusions obtained from isolated tissues back to the whole grain, where the co-location of several living and non-living tissues results in complex tissue-tissue interactions and regulatory pathways coordinated across the multiple tissues. Here we have developed methods for isolating fragments of aleurone, starchy endosperm, embryo, scutellum, pericarp-testa, husk and crushed cell layers from germinated grain. An important step in the procedure involves the rapid fixation of the intact grain to freeze the transcriptional activity of individual tissues while dissection is effected for subsequent transcriptomic analyses. The developmental profiles of 19 611 gene transcripts were precisely defined in the purified tissues and in whole grain during the first 24 h of germination by RNA sequencing. Spatial and temporal patterns of transcription were validated against well-defined data on enzyme activities in both whole grain and isolated tissues. Transcript profiles of genes involved in mitochondrial assembly and function were used to validate the very early stages of germination, while the profiles of genes involved in starch and cell wall mobilisation matched existing data on activities of corresponding enzymes. The data will be broadly applicable for the interrogation of co-expression and differential expression patterns and for the identification of transcription factors that are important in the early stages of grain and seed germination. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  20. Aberrant mRNA processing of the maize Rp1-D rust resistance gene in wheat and barley.

    Science.gov (United States)

    Ayliffe, Michael A; Steinau, Martin; Park, Robert F; Rooke, Lee; Pacheco, Maria G; Hulbert, Scot H; Trick, Harold N; Pryor, Anthony J

    2004-08-01

    The maize Rp1-D gene confers race-specific resistance against Puccinia sorghi (common leaf rust) isolates containing a corresponding avrRp1-D avirulence gene. An Rp1-D genomic clone and a similar Rp1-D transgene regulated by the maize ubiquitin promoter were transformed independently into susceptible maize lines and shown to confer Rp1-D resistance, demonstrating that this resistance can be transferred as a single gene. Transfer of these functional transgenes into wheat and barley did not result in novel resistances when these plants were challenged with isolates of wheat stem rust (P. graminis), wheat leaf rust (P. triticina), or barley leaf rust (P. hordei). Regardless of the promoter employed, low levels of gene expression were observed. When constitutive promoters were used for transgene expression, a majority of Rp1-D transcripts were truncated in the nucleotide binding site-encoding region by premature polyadenylation. This aberrant mRNA processing was unrelated to gene function because an inactive version of the gene also generated such transcripts. These data demonstrate that resistance gene transfer between species may not be limited only by divergence of signaling effector molecules and pathogen avirulence ligands, but potentially also by more fundamental gene expression and transcript processing limitations.

  1. [EFFECTIVENESS OF POLYCATIONIC NANOPARTICLES OF POLYETHYLENEIMINE-POLYHYDROZIDE-CHITOSAN (PEI-PG-OCHG) AS A VECTOR FOR SMALL INTER- FERING RNA, DIRECTED TO SUPPRESS HERPES SIMPLEX TYPE 2 VIRUS REPLICATION].

    Science.gov (United States)

    2015-01-01

    Evaluation of an antiviral effect of miRNA in the nanoparticles of a polycationic compound against mRNA of vp16 protein (UL48 gene) of herpes simplex virus type 2 (HSV-2) in vitro. MATERIALS AND METHODS. 50% aqueous solution of polyethyleneimine (BDH, Great Britain), chitosan, containing approximately 15% of N-acetylated glucosamine chains (Sonat, Russia), hydrazine-hydrate and other chemical reagents (Chimmed, Russia); Vero continuous cell line, MS HSV-2 virus were used. Vero cells were cultivated in DMEM medium supplemented by 10% fetal bovine serum at 37°C in the atmosphere of 5% CO2. Cell viability was evaluated by using Neutral Red vital stain and MTT-test. Primers and probes for RT-PCR were modeled in Vector NTI 8.0 computer program according to the mRNA sequences of the studied genes (the sequences were obtained from GenBank) and synthesized in Sintol (Russia). RT-PCR tests were set using a standard procedure. Synthesis of PEI-PG-chitosan was carried out by Krivtsov G.G. et al. (2010). A design and synthesis of nucleotide sequences, that have interfering activity against this virus, was carried out to study the effect of siRNA on HSV-2 virus replication. During simultaneous addition of HSV-2 and specific siRNA to Vero cells in cell culture, a significant (by 4 lg) reduction of virus yield was observed. A level of UL48 mRNA expression level was determined after the influence of various siRNA variants. A S2 siRNA variant was shown to cause the most pronounced virus-inhibiting effect, aiming for the center of RNA-target (the level of expression of the studied gene decreased by 0.5 lg). siRNA in the PEI-PG-chitosan complexes were established to possess in vitro pronounced suppressive HSV-2 replication activity. The results obtained could be used in creation of new therapeutic preparation against herpes viruses.

  2. The ability of a bymovirus to overcome the rym4-mediated resistance in barley correlates with a codon change in the VPg coding region on RNA1.

    Science.gov (United States)

    Kühne, Thomas; Shi, Nongnong; Proeseler, Gerhard; Adams, Michael J; Kanyuka, Konstantin

    2003-10-01

    The genome difference(s) that enable the European pathotype 2 isolates of Barley yellow mosaic virus (BaYMV-2) to infect barley genotypes with the rym4 resistance gene were investigated. Stable deletions of different sizes occurred in RNA2 of laboratory isolates of the common pathotype (BaYMV-1) and BaYMV-2. After mechanical inoculation of susceptible or rym4 genotypes with a mixture of both isolates, immunocapture-RT-PCR with RNA2-specific primers flanking stable deletion regions was used to detect and distinguish the two pathotypes. Individual leaves contained RNA2 of either or both isolates, showing that RNA2 of BaYMV-1 can replicate and move systemically in rym4 plants when co-inoculated with BaYMV-2. In contrast, sequences of RNA1-specific RT-PCR fragments showed that in resistant plants these were always BaYMV-2, suggesting that the pathogenicity determinant was on RNA1. The complete ORFs of RNA1 of three BaYMV-1 and four BaYMV-2 isolates from the UK and Germany were sequenced, and the RNA2 sequences of one BaYMV-1 and two BaYMV-2 isolates from the UK were also determined. All sequences were very similar to one another and to the published German BaYMV-1 isolate. The only consistent amino acid difference between the BaYMV-1 and BaYMV-2 isolates was in the RNA1-encoded polyproteins and this was confirmed by sequencing the relevant region of eight further German isolates. All BaYMV-1 isolates had lysine at aa 1307, whereas BaYMV-2 isolates had asparagine (or, in one isolate, histidine). The polymorphism occurred in the central region of VPg, which has been shown to be required for pathogenicity on genotypes carrying recessive resistance genes in several potyvirus/dicotyledonous plant pathosystems.

  3. Acceleration of leaf senescence is slowed down in transgenic barley plants deficient in the DNA/RNA-binding protein WHIRLY1

    Science.gov (United States)

    Kucharewicz, Weronika; Distelfeld, Assaf; Bilger, Wolfgang; Müller, Maren; Munné-Bosch, Sergi; Hensel, Götz

    2017-01-01

    Abstract WHIRLY1 in barley was isolated as a potential regulator of the senescence-associated gene HvS40. In order to investigate whether the plastid–nucleus-located DNA/RNA-binding protein WHIRLY1 plays a role in regulation of leaf senescence, primary foliage leaves from transgenic barley plants with an RNAi-mediated knockdown of the WHIRLY1 gene were characterized by typical senescence parameters, namely pigment contents, function and composition of the photosynthetic apparatus, as well as expression of selected genes known to be either down- or up-regulated during leaf senescence. When the plants were grown at low light intensity, senescence progression was similar between wild-type and RNAi-W1 plants. Likewise, dark-induced senescence of detached leaves was not affected by reduction of WHIRLY1. When plants were grown at high light intensity, however, senescence was induced prematurely in wild-type plants but was delayed in RNAi-W1 plants. This result suggests that WHIRLY1 plays a role in light sensing and/or stress communication between chloroplasts and the nucleus. PMID:28338757

  4. Acceleration of leaf senescence is slowed down in transgenic barley plants deficient in the DNA/RNA-binding protein WHIRLY1.

    Science.gov (United States)

    Kucharewicz, Weronika; Distelfeld, Assaf; Bilger, Wolfgang; Müller, Maren; Munné-Bosch, Sergi; Hensel, Götz; Krupinska, Karin

    2017-02-01

    WHIRLY1 in barley was isolated as a potential regulator of the senescence-associated gene HvS40. In order to investigate whether the plastid-nucleus-located DNA/RNA-binding protein WHIRLY1 plays a role in regulation of leaf senescence, primary foliage leaves from transgenic barley plants with an RNAi-mediated knockdown of the WHIRLY1 gene were characterized by typical senescence parameters, namely pigment contents, function and composition of the photosynthetic apparatus, as well as expression of selected genes known to be either down- or up-regulated during leaf senescence. When the plants were grown at low light intensity, senescence progression was similar between wild-type and RNAi-W1 plants. Likewise, dark-induced senescence of detached leaves was not affected by reduction of WHIRLY1. When plants were grown at high light intensity, however, senescence was induced prematurely in wild-type plants but was delayed in RNAi-W1 plants. This result suggests that WHIRLY1 plays a role in light sensing and/or stress communication between chloroplasts and the nucleus. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  5. Barley germination

    DEFF Research Database (Denmark)

    Daneri-Castro, Sergio N.; Svensson, Birte; Roberts, Thomas H.

    2016-01-01

    Germination of barley grain is central to the malting industry and is a valuable model for cereal grain germination. Our current understanding of the complexity of germination at the molecular level is facilitated by access to genomic, transcriptomic, proteomic and metabolomic data. Here we review...... recent progress in barley germination research and discuss the factors to be considered when designing 'omics' experiments and interpreting the results. These factors include the structural and functional relationships between the various tissues of the barley caryopsis and the timing of the events...... of germination in the context of industrial malting. For transcriptomics, recent advances in sequencing the barley genome allow next-generation sequencing approaches to reveal novel effects of variety and environment on germination. For proteomics, selection of the source tissue(s) and the protein extraction...

  6. Barley metallothioneins

    DEFF Research Database (Denmark)

    Hegelund, Josefine Nymark; Schiller, Michaela; Kichey, Thomas

    2012-01-01

    and cadmium (Cd) in MT4, which was not the case for MT3. When complementary DNAs from barley MTs were expressed in Cu- or Cd-sensitive yeast mutants, MT3 provided a much stronger complementation than did MT4. We conclude that MT3 may play a housekeeping role in metal homeostasis, while MT4 may function in Zn...... storage in developing and mature grains. The localization of MT4 and its discrimination against Cd make it an ideal candidate for future biofortification strategies directed toward increasing food and feed Zn concentrations....

  7. Barley callus

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Blennow, Per Gunnar Andreas; Nielsen, Morten M.

    2012-01-01

    Background Starch is the most important source of calories for human nutrition and the majority of it is produced by cereal farming. Starch is also used as a renewable raw material in a range of industrial sectors. It can be chemically modified to introduce new physicochemical properties...... genes in planta. Results We explored the possibility to use transgenic barley callus generated from immature embryo for a fast test of transgenic modification strategies of starch biosynthesis. We found that this callus contains 4 % (w/w dw) starch granules, which we could modify by generating fully...... suggest that this method can be used as a time-efficient model system for fast screening of candidate genes for the generation of modified starch or new types of carbohydrate polymers....

  8. Brewing with fractionated barley

    NARCIS (Netherlands)

    Donkelaar, van L.H.G.

    2016-01-01

    Brewing with fractionated barley

    Beer is a globally consumed beverage, which is produced from malted barley, water, hops and yeast. In recent years, the use of unmalted barley and exogenous enzymes have become more popular because they enable simpler processing and reduced environmental

  9. Brewing with fractionated barley

    NARCIS (Netherlands)

    Donkelaar, van L.H.G.

    2016-01-01

    Brewing with fractionated barley Beer is a globally consumed beverage, which is produced from malted barley, water, hops and yeast. In recent years, the use of unmalted barley and exogenous enzymes have become more popular because they enable simpler processing and reduced environmental impact. Raw

  10. Bioactive phytochemicals in barley.

    Science.gov (United States)

    Idehen, Emmanuel; Tang, Yao; Sang, Shengmin

    2017-01-01

    Epidemiological studies have consistently shown that regular consumption of whole grain barley reduces the risk of developing chronic diseases. The presence of barley fiber, especially β-glucan in whole grain barley, has been largely credited for these health benefits. However, it is now widely believed that the actions of the fiber component alone do not explain the observed health benefits associated with the consumption of whole grain barley. Whole grain barley also contains phytochemicals including phenolic acids, flavonoids, lignans, tocols, phytosterols, and folate. These phytochemicals exhibit strong antioxidant, antiproliferative, and cholesterol lowering abilities, which are potentially useful in lowering the risk of certain diseases. Therefore, the high concentration of phytochemicals in barley may be largely responsible for its health benefits. This paper reviews available information regarding barley phytochemicals and their potential to combat common nutrition-related diseases including cancer, cardiovascular disease, diabetes, and obesity. Copyright © 2016. Published by Elsevier B.V.

  11. Construction of barley consensus map showing chromosomal ...

    African Journals Online (AJOL)

    In the past, it has been difficult to accurately determine the location of many types of barley molecular markers due to the lack of commonality between international barley linkage maps. In this study, a consensus map of barley was constructed from five different maps (OWB, VxHs, KxM, barley consensus 2 and barley ...

  12. Barley coleoptile peroxidases. Purification, molecular cloning, and induction by pathogens

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Bloch, H.; Rasmussen, Søren Kjærsgård

    1999-01-01

    -transcriptase polymerase chain reaction showed that the Prx7 protein and mRNA accumulated abundantly in barley coleoptiles and in leaf epidermis inoculated with powdery mildew fungus (Blumeria graminis). Two isoperoxidases with isoelectric points of 9.3 and 7.3 (P9.3 and P7.3, respectively) were purified to homogeneity...

  13. Transcriptome of barley under three different heavy metal stress reaction

    Czech Academy of Sciences Publication Activity Database

    Kintlová, Martina; Blavet, Nicolas; Cegan, R.; Hobza, Roman

    2017-01-01

    Roč. 13, SEP (2017), s. 15-17 ISSN 2213-5960 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:61389030 Keywords : plants * Barley * RNA-Seq * Transcriptome * Heavy metal * Copper * Zinc * Cadmium Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany

  14. Mla- and Rom1-mediated control of microRNA398 and chloroplast copper/zinc superoxide dismutase regulates cell death in response to the barley powdery mildew fungus

    Science.gov (United States)

    Barley Mla (Mildew resistance locus a) confers allele-specific interactions with natural variants of the ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh), causal agent of powdery mildew disease. Significant reprogramming of host gene expression occurs upon infection by this obligate biotrop...

  15. RNA

    African Journals Online (AJOL)

    SARAH

    30 nov. 2013 ... RÉSUMÉ. Objectif : La présente étude est conduite dans les régions de Maradi et Zinder situées dans le Centre-Sud du. Niger où la pratique de la régénération naturelle assistée des ligneux dans les champs (RNA) a permis de reverdir plus de 5 millions d'hectares. Le but de ce travail est d'évaluer ...

  16. Lactobacilli Are Prominent Members of the Microbiota Involved in the Ruminal Digestion of Barley and Corn

    Directory of Open Access Journals (Sweden)

    Hee E. Yang

    2018-04-01

    Full Text Available The chemical composition of barley grain can vary among barley varieties (Fibar, Xena, McGwire, and Hilose and result in different digestion efficiencies in the rumen. It is not known if compositional differences in barley can affect the microbiota involved in the ruminal digestion of barley. The objective of this study was to characterize the in situ rumen degradability and microbiota of four barley grain varieties and to compare these to corn. Three ruminally cannulated heifers were fed a low (60% barley silage, 37% barley grain, and 3% supplement or high grain (37% barley silage, 60% barley grain, and 3% supplement diet. One set of bags was used to estimate dry matter (DM, starch and crude protein (CP degradability. A second set was used to extract DNA from the adherent microbiota and visualize grain after incubation using scanning electron microscopy (SEM. DNA was subjected to amplicon 16S rRNA gene sequencing followed by analysis using QIIME. In the low grain diet, McGwire had the highest effective degradability (ED of DM (P < 0.01. The ED of starch was highest (P < 0.01 for Fibar, McGwire, and Xena, but the ED of CP was not affected by variety. For the high grain diet, Xena and McGwire had the highest ED of DM (P < 0.01. The ED of starch was highest (P < 0.01 for Xena and Fibar. The ED of protein was highest (P < 0.01 for Xena and McGwire. Although the microbiota did not differ among barley varieties, they did differ from corn and with incubation time. Lactobacilli were dominant members of the mature biofilms associated with corn and barley and were accompanied by a notable increase in the lactic acid utilizing genera, Megasphaera. As none of the cattle exhibited subclinical or clinical acidosis during the study, our results suggest that lactobacilli play a more prominent role in routine starch digestion than presently surmised.

  17. Water uptake in barley grain: Physiology; genetics and industrial applications.

    Science.gov (United States)

    Cu, Suong; Collins, Helen M; Betts, Natalie S; March, Timothy J; Janusz, Agnieszka; Stewart, Doug C; Skadhauge, Birgitte; Eglinton, Jason; Kyriacou, Bianca; Little, Alan; Burton, Rachel A; Fincher, Geoffrey B

    2016-01-01

    Water uptake by mature barley grains initiates germination and is the first stage in the malting process. Here we have investigated the effects of starchy endosperm cell wall thickness on water uptake, together with the effects of varying amounts of the wall polysaccharide, (1,3;1,4)-β-glucan. In the latter case, we examined mutant barley lines from a mutant library and transgenic barley lines in which the (1,3;1,4)-β-glucan synthase gene, HvCslF6, was down-regulated by RNA interference. Neither cell wall thickness nor the levels of grain (1,3;1,4)-β-glucan were significantly correlated with water uptake but are likely to influence modification during malting. However, when a barley mapping population was phenotyped for rate of water uptake into grain, quantitative trait locus (QTL) analysis identified specific regions of chromosomes 4H, 5H and 7H that accounted for approximately 17%, 18% and 11%, respectively, of the phenotypic variation. These data indicate that variation in water uptake rates by elite malting cultivars of barley is genetically controlled and a number of candidate genes that might control the trait were identified under the QTL. The genomics data raise the possibility that the genetic variation in water uptake rates might be exploited by breeders for the benefit of the malting and brewing industries. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Barley yellow dwarf virus

    Science.gov (United States)

    Paulmann, Maria K; Kunert, Grit; Zimmermann, Matthias R; Theis, Nina; Ludwig, Anatoli; Meichsner, Doreen; Oelmüller, Ralf; Gershenzon, Jonathan; Habekuss, Antje; Ordon, Frank; Furch, Alexandra C U; Will, Torsten

    2018-01-01

    Barley yellow dwarf virus (BYDV) is a phloem limited virus that is persistently transmitted by aphids. Due to huge yield losses in agriculture, the virus is of high economic relevance. Since the control of the virus itself is not possible, tolerant barley genotypes are considered as the most effective approach to avoid yield losses. Although several genes and quantitative trait loci are known and used in barley breeding for virus tolerance, little is known about molecular and physiological backgrounds of this trait. Therefore, we compared the anatomy and early defense responses of a virus susceptible to those of a virus-tolerant cultivar. One of the very early defense responses is the transmission of electrophysiological reactions. Electrophysiological reactions to BYDV infection might differ between susceptible and tolerant cultivars, since BYDV causes disintegration of sieve elements in susceptible cultivars. The structure of vascular bundles, xylem vessels and sieve elements was examined using microscopy. All three were significantly decreased in size in infected susceptible plants where the virus causes disintegration of sieve elements. This could be associated with an uncontrolled ion exchange between the sieve-element lumen and apoplast. Further, a reduced electrophysiological isolation would negatively affect the propagation of electrophysiological reactions. To test the influence of BYDV infection on electrophysiological reactions, electropotential waves (EPWs) induced by leaf-tip burning were recorded using aphids as bioelectrodes. EPWs in infected susceptible plants disappeared already after 10 cm in contrast to those in healthy susceptible or infected tolerant or healthy tolerant plants. Another early plant defense reaction is an increase in reactive oxygen species (ROS). Using a fluorescent dye, we found a significant increase in ROS content in infected susceptible plants but not in infected tolerant plants. Similar results were found for the

  19. Barley Transformation Using Biolistic Techniques

    Science.gov (United States)

    Harwood, Wendy A.; Smedley, Mark A.

    Microprojectile bombardment or biolistic techniques have been widely used for cereal transformation. These methods rely on the acceleration of gold particles, coated with plasmid DNA, into plant cells as a method of directly introducing the DNA. The first report of the generation of fertile, transgenic barley plants used biolistic techniques. However, more recently Agrobacterium-mediated transformation has been adopted as the method of choice for most cereals including barley. Biolistic procedures are still important for some barley transformation applications and also provide transient test systems for the rapid checking of constructs. This chapter describes methods for the transformation of barley using biolistic procedures and also highlights the use of the technology in transient assays.

  20. Genomic Prediction in Barley

    DEFF Research Database (Denmark)

    Edriss, Vahid; Cericola, Fabio; Jensen, Jens D

    2015-01-01

    Genomic prediction uses markers (SNPs) across the whole genome to predict individual breeding values at an early growth stage potentially before large scale phenotyping. One of the applications of genomic prediction in plant breeding is to identify the best individual candidate lines to contribute...... to next generation. The main goal of this study was to see the potential of using genomic prediction in a commercial Barley breeding program. The data used in this study was from Nordic Seed company which is located in Denmark. Around 350 advanced lines were genotyped with 9K Barely chip from Illumina....... Traits used in this study were grain yield, plant height and heading date. Heading date is number days it takes after 1st June for plant to head. Heritabilities were 0.33, 0.44 and 0.48 for yield, height and heading, respectively for the average of nine plots. The GBLUP model was used for genomic...

  1. Boron Stress Responsive MicroRNAs and Their Targets in Barley

    Science.gov (United States)

    Ozhuner, Esma; Eldem, Vahap; Ipek, Arif; Okay, Sezer; Sakcali, Serdal; Zhang, Baohong; Boke, Hatice; Unver, Turgay

    2013-01-01

    Boron stress is an environmental factor affecting plant development and production. Recently, microRNAs (miRNAs) have been found to be involved in several plant processes such as growth regulation and stress responses. In this study, miRNAs associated with boron stress were identified and characterized in barley. miRNA profiles were also comparatively analyzed between root and leave samples. A total of 31 known and 3 new miRNAs were identified in barley; 25 of them were found to respond to boron treatment. Several miRNAs were expressed in a tissue specific manner; for example, miR156d, miR171a, miR397, and miR444a were only detected in leaves. Additionally, a total of 934 barley transcripts were found to be specifically targeted and degraded by miRNAs. In silico analysis of miRNA target genes demonstrated that many miRNA targets are conserved transcription factors such as Squamosa promoter-binding protein, Auxin response factor (ARF), and the MYB transcription factor family. A majority of these targets were responsible for plant growth and response to environmental changes. We also propose that some of the miRNAs in barley such as miRNA408 might play critical roles against boron exposure. In conclusion, barley may use several pathways and cellular processes targeted by miRNAs to cope with boron stress. PMID:23555702

  2. The Swedish mutant barley collection

    International Nuclear Information System (INIS)

    1989-01-01

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  3. Structure and molecular characterization of barley nudix hydrolase genes.

    Science.gov (United States)

    Tanaka, Sayuri; Kihara, Makoto; Sugimoto, Manabu

    2015-01-01

    Putative nudix hydrolase (NUDX) genes, which encode amino acid sequences showing homology with those of Arabidopsis NUDXs and conserve nudix motif, were identified from barley. The 14 deduced barley NUDXs (HvNUDX1-14) were classified into established subfamilies, except for 8-oxo-deoxyguanosine 5'-triphosphate (8-oxo-dGTP) pyrophosphohydrolase and mRNA decapping enzyme subfamilies, and three substrate-unknown subfamilies. Drought and UV-C stresses, respectively, up-regulated 7 and 4 HvNUDX genes, but some homologs of Arabidopsis NUDXs showed different responses to abiotic stress. HvNUDX12 gene, belonging to diadenosine tetraphosphates (Ap₄A) pyrophosphohydrolase subfamily gene and up-regulated by UV-C, was expressed in Escherichia coli cells. The recombinant protein showed 8-oxo-dGTP, Ap₄A, and guanosine-3',5'-tetraphosphate (ppGpp) pyrophosphohydrolase activities, and the suppression of the lacZ amber mutation in a mutT-deficient E. coli cells caused by the incorporation of 8-oxo-GTP into mRNA was prevented to a significant degree. These results suggest that barley NUDXs have unique constitution and response of NUDX to abiotic stress.

  4. Alanine aminotransferase controls seed dormancy in barley.

    Science.gov (United States)

    Sato, Kazuhiro; Yamane, Miki; Yamaji, Nami; Kanamori, Hiroyuki; Tagiri, Akemi; Schwerdt, Julian G; Fincher, Geoffrey B; Matsumoto, Takashi; Takeda, Kazuyoshi; Komatsuda, Takao

    2016-05-18

    Dormancy allows wild barley grains to survive dry summers in the Near East. After domestication, barley was selected for shorter dormancy periods. Here we isolate the major seed dormancy gene qsd1 from wild barley, which encodes an alanine aminotransferase (AlaAT). The seed dormancy gene is expressed specifically in the embryo. The AlaAT isoenzymes encoded by the long and short dormancy alleles differ in a single amino acid residue. The reduced dormancy allele Qsd1 evolved from barleys that were first domesticated in the southern Levant and had the long dormancy qsd1 allele that can be traced back to wild barleys. The reduced dormancy mutation likely contributed to the enhanced performance of barley in industrial applications such as beer and whisky production, which involve controlled germination. In contrast, the long dormancy allele might be used to control pre-harvest sprouting in higher rainfall areas to enhance global adaptation of barley.

  5. Androgenic switch in barley microspores

    NARCIS (Netherlands)

    de Faria Maraschin, Simone

    2005-01-01

    Barley androgenesis represents an attractive system to study stress-induced cell differentiation and is a valuable tool for efficient plant breeding. The switch from the pollen developmental pathway towards an androgenic route involves several well-described morphological changes. However, little is

  6. Identification and Expression Analysis of the Barley (Hordeum vulgare L. Aquaporin Gene Family.

    Directory of Open Access Journals (Sweden)

    Runyararo M Hove

    Full Text Available Aquaporins (AQPs are major intrinsic proteins (MIPs that mediate bidirectional flux of water and other substrates across cell membranes, and play critical roles in plant-water relations, dehydration stress responses and crop productivity. However, limited data are available as yet on the contributions of these proteins to the physiology of the major crop barley (Hordeum vulgare. The present work reports the identification and expression analysis of the barley MIP family. A comprehensive search of publicly available leaf mRNA-seq data, draft barley genome data, GenBank transcripts and sixteen new annotations together revealed that the barley MIP family is comprised of at least forty AQPs. Alternative splicing events were likely in two plasma membrane intrinsic protein (PIP AQPs. Analyses of the AQP signature sequences and specificity determining positions indicated a potential of several putative AQP isoforms to transport non-aqua substrates including physiological important substrates, and respond to abiotic stresses. Analysis of our publicly available leaf mRNA-seq data identified notable differential expression of HvPIP1;2 and HvTIP4;1 under salt stress. Analyses of other gene expression resources also confirmed isoform-specific responses in different tissues and/or in response to salinity, as well as some potentially inter-cultivar differences. The work reports systematic and comprehensive analysis of most, if not all, barley AQP genes, their sequences, expression patterns in different tissues, potential transport and stress response functions, and a strong framework for selection and/or development of stress tolerant barley varieties. In addition, the barley data would be highly valuable for genetic studies of the evolutionarily closely related wheat (Triticum aestivum L..

  7. Identification and Expression Analysis of the Barley (Hordeum vulgare L.) Aquaporin Gene Family.

    Science.gov (United States)

    Hove, Runyararo M; Ziemann, Mark; Bhave, Mrinal

    2015-01-01

    Aquaporins (AQPs) are major intrinsic proteins (MIPs) that mediate bidirectional flux of water and other substrates across cell membranes, and play critical roles in plant-water relations, dehydration stress responses and crop productivity. However, limited data are available as yet on the contributions of these proteins to the physiology of the major crop barley (Hordeum vulgare). The present work reports the identification and expression analysis of the barley MIP family. A comprehensive search of publicly available leaf mRNA-seq data, draft barley genome data, GenBank transcripts and sixteen new annotations together revealed that the barley MIP family is comprised of at least forty AQPs. Alternative splicing events were likely in two plasma membrane intrinsic protein (PIP) AQPs. Analyses of the AQP signature sequences and specificity determining positions indicated a potential of several putative AQP isoforms to transport non-aqua substrates including physiological important substrates, and respond to abiotic stresses. Analysis of our publicly available leaf mRNA-seq data identified notable differential expression of HvPIP1;2 and HvTIP4;1 under salt stress. Analyses of other gene expression resources also confirmed isoform-specific responses in different tissues and/or in response to salinity, as well as some potentially inter-cultivar differences. The work reports systematic and comprehensive analysis of most, if not all, barley AQP genes, their sequences, expression patterns in different tissues, potential transport and stress response functions, and a strong framework for selection and/or development of stress tolerant barley varieties. In addition, the barley data would be highly valuable for genetic studies of the evolutionarily closely related wheat (Triticum aestivum L.).

  8. Development of endosperm transfer cells in barley

    Directory of Open Access Journals (Sweden)

    Johannes eThiel

    2014-03-01

    Full Text Available Endosperm transfer cells (ETCs are positioned at the intersection of maternal and filial tissues in seeds of cereals and represent a bottleneck for apoplasmic transport of assimilates into the endosperm. Endosperm cellularization starts at the maternal-filial boundary and generates the highly specialized ETCs. During differentiation barley ETCs develop characteristic flange-like wall ingrowths to facilitate effective nutrient transfer. A comprehensive morphological analysis depicted distinct developmental time points in establishment of transfer cell morphology and revealed intracellular changes possibly associated with cell wall metabolism. Embedded inside the grain, ETCs are barely accessible by manual preparation. To get tissue-specific information about ETC specification and differentiation, laser microdissection(LM-based methods were used for transcript and metabolite profiling. Transcriptome analysis of ETCs at different developmental stages by microarrays indicated activated gene expression programs related to control of cell proliferation and cell shape, cell wall and carbohydrate metabolism reflecting the morphological changes during early ETC development. Transporter genes reveal distinct expression patterns suggesting a switch from active to passive modes of nutrient uptake with the onset of grain filling. Tissue-specific RNA-seq of the differentiating ETC region from the syncytial stage until functionality in nutrient transfer identified a high number of novel transcripts putatively involved in ETC differentiation. An essential role for two-component signaling (TCS pathways in transfer cell development of barley emerged from this analysis. Correlative data provide evidence for ABA and ethylene influences on ETC differentiation and hint at a crosstalk between hormone signal transduction and TCS phosphorelays. Collectively, the data expose a comprehensive view on ETC development, associated pathways and identified candidate genes for

  9. Spatial and temporal regulation of DNA fragmentation in the aleurone of germinating barley

    NARCIS (Netherlands)

    Wang, M.; Oppedijk, B.J.; Caspers, M.P.M.; Lamers, G.E.M.; Boot, M.J.; Geerlings, D.N.G.; Bakhuizen, B.; Meijer, A.H.; Duijn, B. van

    1998-01-01

    During germination of barley grains, the appearance of DNA fragmentation started in aleurone cells near the embryo and extended to the distal end in a time-dependent manner. DNA fragmentation was demonstrated to occur only after the expression of α-amylase mRNA in the aleurone layer. In addition,

  10. Secondary siRNAs result from unprimed RNA synthesis and form a distinct class.

    NARCIS (Netherlands)

    Sijen, L.M.T.; Steiner, F.A.; Thijssen, K.L.; Plasterk, R.H.A.

    2007-01-01

    In Caenorhabditis elegans, an effective RNA interference (RNAi) response requires the production of secondary short interfering RNAs (siRNAs) by RNA-directed RNA polymerases (RdRPs). We cloned secondary siRNAs from transgenic C. elegans lines expressing a single 22-nucleotide primary siRNA. Several

  11. Resistance of barley landraces and wild barley populations to powdery mildew in Jordan

    Directory of Open Access Journals (Sweden)

    Adel Abdel-Ghani

    2008-10-01

    Full Text Available Eleven barley (Hordeum vulgare L. landraces and 12 wild barley (H. spontaneum populations, collected from diverse eco-geographical regions of Jordan, were screened for resistance to powdery mildew. The average powdery mildew disease score (based on a 0 to 4 severity scale was <1 in all tested barley landraces. Disease scores in wild barley populations ranged from 1.2 to 3.8. Most barley landraces of all tested lines were highly resistant to powdery mildew. The percentage of wild barley lines exhibiting high resistance was 19%, while 45% of the lines were moderately resistant and 36% susceptible to powdery mildew. There was no significant correlation between weather variables (precipitation, temperature and altitude and the disease scores of either the barley landraces or the wild barley populations. However, resistance in wild barley was more common in humid districts and at higher altitudes. Both barley landrace and wild barley accessions could serve as potential donors for powdery mildew resistance genes to be transferred to barley varieties improved by plant breeding.

  12. Isozyme differences in barley mutants

    International Nuclear Information System (INIS)

    AI-Jibouri, A.A.M.; Dham, K.M.

    1990-01-01

    Full text: Thirty mutants (M 11 ) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  13. BARLEY BALANCE SHEET IN ROMANIA

    OpenAIRE

    Dragoş Mihai MEDELETE; Radu Lucian PÂNZARU

    2013-01-01

    Barley is one of the most important cereal grown in Romania, after corn and wheat. This is based, at least on considerations of cultivated area (413.4 thousand ha - average 2007-2009), but also because of the multiple uses it may have (Food, feed, industrial raw materials, etc.). Presentation of food balance we consider interesting in terms of supply and demand components: production, imports, stocks, exports, seeds, feed consumption, industrial raw materials, food and other useslosses. On th...

  14. Fermented Barley Supplementation Modulates the Expression of Hypothalamic Genes and Reduces Energy Intake and Weight Gain in Rats.

    Science.gov (United States)

    Pichiah, P B Tirupathi; Cho, Suk-Ho; Han, Seong-Kyu; Cha, Youn-Soo

    2016-04-01

    Dietary fiber and proteins are individually known to decrease feeding, but could result greater weight management benefit when both are combined. We hypothesized that supplementing the diet with fermented barley, being rich in both dietary fiber and proteins, could lower energy intake by modulating the mRNA expression level of hypothalamic genes associated with the regulation of feeding behavior and satiety; thereby decreasing body weight gain. To test our hypothesis, four groups of Sprague Dawley rats were arranged in a 2 × 2 factorial design (n = 6), low-fat diet with either guar gum (LFD-G) or fermented barley (LFD-FB) and high-fat diet with either guar gum (HFD-G) or fermented barley (HFD-FB). Using oral gavage, fermented barley was given at a dosage of 1500 mg/kg body weight and guar gum was supplemented in an equivalent quantity to that of the fiber in the fermented barley. After 19 weeks, the fermented barley-supplemented groups showed a significant reduction in energy intake, triglyceride, body weight gain, and serum leptin, compared to the guar gum-supplemented groups in both the low- and high-fat diet groups. Likewise, the anorexigenic gene proopiomelanocortin (POMC) and cocaine and amphetamine-regulated transcript (CART) mRNA level were significantly higher in the fermented barley-supplemented groups compared to the guar gum-supplemented groups in rats fed on both high- and low-fat diets. In conclusion, fermented barley supplementation upregulated hypothalamic POMC/CART, decreased energy intake in both low- and high-fat diet groups, and prevented excessive weight gain in rats.

  15. Roles of Hydroxynitrile Glucosides in Barley

    DEFF Research Database (Denmark)

    Roelsgaard, Pernille Sølvhøj

    that hydroxynitrile glucosides can act as carbohydrate and nitrogen storage compounds and as reactive oxygen species (ROS) quenching compounds. A positive correlation between the hydroxynitrile glucoside content in barley and susceptibility toward the barley powdery mildew fungus (Blumeria graminis f.sp. hordei, Bgh...

  16. Associated field mycobiota on malting barley

    DEFF Research Database (Denmark)

    Andersen, Birgitte; Thrane, Ulf; Svendsen, Anne

    1996-01-01

    in the composition of field mycobiota compared with the pesticide-free barley. The determining factor on the mycobiota was the location. The dominant species on barley was Alternaria infectoria Simmons. The most frequent Fusarium species detected were F. tricinctum (Corda) Sacc. and F. avenaceum (Fr.) Sacc. Results...... implied an interaction between Alternaria and Fusarium on the surface of the kernels....

  17. Molecular characterization of two lipoxygenases from barley

    NARCIS (Netherlands)

    Mechelen, J.R. van; Schuurink, R.C.; Smits, M.; Graner, A.; Douma, A.C.; Sedee, N.J.A.; Schmitt, N.F.; Valk, B.E.

    1999-01-01

    Two full-length lipoxygenase cDNA sequences (LoxB and LoxC) from barley (Hordeum distichum cv. L. Triumph) are described. The cDNAs share high homology with the barley LoxA cDNA. Southern blotting experiments indicate single copy numbers of the three lipoxygenase genes. RFLP mapping revealed the

  18. COMPARISON OF THE FROST RESISTANCE OF BARLEY ...

    African Journals Online (AJOL)

    Preferred Customer

    immediate recovery of the photosynthetic quantum yield after freezing. Landraces which showed the highest cold tolerance were found to acclimatize best. Key words/phrases: Barley, chlorophyll fluorescence, cold acclimation, Ethiopia, frost tolerance. INTRODUCTION. Barley (Hordeum vulgare L.) is a traditional crop.

  19. Fungal growth during malting of barley

    Directory of Open Access Journals (Sweden)

    Kocić-Tanackov Sunčica D.

    2005-01-01

    Full Text Available Fungi were isolated and identified in two samples of winter two-row barley (SSK3 and SSK6 harvested in 2003, Kragujevac location, during micromalting. Fungi were isolated and identified in barley before the micromalting, after the 1st, 2nd and 3rd day of steeping, the first day and after the germination after kilning and after malt degermination. The total fungi count was followed in both barley samples, during the mentioned phases. The total count of fungi was also determined in the steeping water, and the isolation and identification was performed after the steeping process. Change of the total count of fungi during barley micromalting was exponentional. During barley micromalting nine fungi genera were isolated: Phoma, Alternaria, Fusarium aspergillus, Cladosporium, Geotrichum, Scopulariopsis, Aureobasidium and Mucor. The most frequent genera were: Phoma, Alternaria and Fusarium. In water for steeping, five genera were identified: Geotrichum, Fusarium, Phoma Cladosporium and Mucor. The most frequent genera was Phoma.

  20. RNA captor: a tool for RNA characterization.

    Directory of Open Access Journals (Sweden)

    Christian Clepet

    Full Text Available BACKGROUND: In the genome era, characterizing the structure and the function of RNA molecules remains a major challenge. Alternative transcripts and non-protein-coding genes are poorly recognized by the current genome-annotation algorithms and efficient tools are needed to isolate the less-abundant or stable RNAs. RESULTS: A universal RNA-tagging method using the T4 RNA ligase 2 and special adapters is reported. Based on this system, protocols for RACE PCR and full-length cDNA library construction have been developed. The RNA tagging conditions were thoroughly optimized and compared to previous methods by using a biochemical oligonucleotide tagging assay and RACE PCRs on a range of transcripts. In addition, two large-scale full-length cDNA inventories relying on this method are presented. CONCLUSION: The RNA Captor is a straightforward and accessible protocol. The sensitivity of this approach was shown to be higher compared to previous methods, and applicable on messenger RNAs, non-protein-coding RNAs, transcription-start sites and microRNA-directed cleavage sites of transcripts. This strategy could also be used to study other classes of RNA and in deep sequencing experiments.

  1. Determination of Local Barley (Hordeum Vulgare) Crop Coefficient ...

    African Journals Online (AJOL)

    Bheema

    , 0.88 and. 0.68 kg m. -3 ... irrigated barley fields. This could be due to lack of information on water requirement of local barley. General crop coefficient values for various crops including for barley are available in ..... Soil salinity and barley.

  2. Resistance to Barley Leaf Stripe

    DEFF Research Database (Denmark)

    Nørgaard Knudsen, J. C.

    1986-01-01

    in well adapted Northwest European spring cultivars. Virulence matching two hitherto not overcome resistances was demonstrated. Differences in apparent race nonspecific or partial resistance were also present, changing the percentage of infected plants of susceptible genotypes from about 20 to 44 per cent.......Ten barley [Hordeum vulgare] genotypes were inoculated with twelve isolates of Pyrenophora graminea of diverse European and North African origin. Race specific resistance occurred. Four, possibly five, genetically different sources of race-specific resistance were found, three of them occurring...

  3. Esterase Isoenzyme Variants in Barley

    DEFF Research Database (Denmark)

    Hvid, S.; Nielsen, G.

    1977-01-01

    Gene symbols are proposed for 27 esterase isoenzyme alleles representing 10 loci in barley. Two new esterase loci, Est 9 and Est 10, each with an active and a silent allele, and three new alleles in previously described loci were found. A few chemical and physical characteristics of the different...... esterase isoenzyme systems were studied. The heat inactivation temperature differed for the isoenzymes coded by most of the loci, whereas the substrate and inhibitor specificity of the isoenzymes was less distinct. A possible relationship between some of the systems is discussed....

  4. Enumeration of fungi in barley

    CSIR Research Space (South Africa)

    Rabie

    1997-04-01

    Full Text Available stream_source_info rabie_1997.pdf.txt stream_content_type text/plain stream_size 26510 Content-Encoding ISO-8859-1 stream_name rabie_1997.pdf.txt Content-Type text/plain; charset=ISO-8859-1 hmatiod Journal of...FoodMiaubiology ELSEVIER International Journal of Food Microbiology 35 (1997) Il7- 127 Enumeration of fungi in barley C.J. Rabie*, A. Liibben, G.J. Marais, H. Jansen van Vuuren CSIR Food Scienw and Technology, P.0 Bos 395. Prrroria 0001...

  5. BARLEY BALANCE SHEET IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Dragoş Mihai MEDELETE

    2013-01-01

    Full Text Available Barley is one of the most important cereal grown in Romania, after corn and wheat. This is based, at least on considerations of cultivated area (413.4 thousand ha - average 2007-2009, but also because of the multiple uses it may have (Food, feed, industrial raw materials, etc.. Presentation of food balance we consider interesting in terms of supply and demand components: production, imports, stocks, exports, seeds, feed consumption, industrial raw materials, food and other useslosses. On the basis of total volume of supply and demand we could determine the balance sheet at nationa level for the product.

  6. The germinlike protein GLP4 exhibits superoxide dismutase activity and is an important component of quantitative resistance in wheat and barley

    DEFF Research Database (Denmark)

    Christensen, Anders Bentsen; Thordal-Christensen, Hans; Zimmermann, Grit

    2004-01-01

    to be expressed in pathogen-attacked epidermal tissue of barley and wheat leaves, and the corresponding proteins are proposed to accumulate in the apoplast. Here, the role of HvGLP4 and TaGLP4 in the defense of barley and wheat against Blumeria graminis (DC.) E. O. Speer, the cereal powdery mildew fungus...... overexpression of TaGLP4 and HvGLP4 enhanced resistance against B. graminis in wheat and barley, whereas transient silencing by RNA interference reduced basal resistance in both cereals. The effect of GLP4 overexpression or silencing was strongly influenced by the genotype of the plant. The data suggest...

  7. Barley grain for ruminants: A global treasure or tragedy

    OpenAIRE

    Nikkhah Akbar

    2012-01-01

    Abstract Barley grain (Hordeum vulgare L.) is characterized by a thick fibrous coat, a high level of ß-glucans and simply-arranged starch granules. World production of barley is about 30 % of that of corn. In comparison with corn, barley has more protein, methionine, lysine, cysteine and tryptophan. For ruminants, barley is the third most readily degradable cereal behind oats and wheat. Due to its more rapid starch fermentation rate compared with corn, barley also provides a more synchronous ...

  8. Global Identification of MicroRNAs and Their Targets in Barley under Salinity Stress

    Science.gov (United States)

    Cui, Licao; Feng, Kewei; Liu, Fuyan; Du, Xianghong; Tong, Wei; Nie, Xiaojun; Ji, Wanquan; Weining, Song

    2015-01-01

    Salinity is a major limiting factor for agricultural production worldwide. A better understanding of the mechanisms of salinity stress response will aid efforts to improve plant salt tolerance. In this study, a combination of small RNA and mRNA degradome sequencing was used to identify salinity responsive-miRNAs and their targets in barley. A total of 152 miRNAs belonging to 126 families were identified, of which 44 were found to be salinity responsive with 30 up-regulated and 25 down-regulated respectively. The majority of the salinity-responsive miRNAs were up-regulated at the 8h time point, while down-regulated at the 3h and 27h time points. The targets of these miRNAs were further detected by degradome sequencing coupled with bioinformatics prediction. Finally, qRT-PCR was used to validate the identified miRNA and their targets. Our study systematically investigated the expression profile of miRNA and their targets in barley during salinity stress phase, which can contribute to understanding how miRNAs respond to salinity stress in barley and other cereal crops. PMID:26372557

  9. Infidelity of translation of encephalomyocarditis viral RNA with tRNA from human malignant trophoblastic cells

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, O.K.; Kuchino, Y.

    1977-09-23

    We have investigated tRNA from the human malignant trophoblastic cells (BeWo cell) and human chorionic tissue for the translation of specific mRNAs, in a tRNA-dependent protein synthesizing system from Ehrlich ascites cells. BeWo cell tRNA and chorionic tRNA supported oviduct mRNA or encephalomyocarditis (EMC) viral RNA directed amino acid incorporation into polypeptides equally effectively. Polypeptides synthesized with oviduct mRNA and tRNA from both sources were identical upon sodium dodecylsulfate polyacrylamide gel electrophoresis. But the EMC RNA directed polypeptides synthesized with BeWo cell tRNA were different from those synthesized with chorionic tRNA. A polypeptide (molecular weight 58,000) was apparently not synthesized and the synthesis of a faster moving component (molecular weight, 14,000) was enhanced when BeWo cell tRNA was used. These results imply a functional difference in tRNA from human malignant cells compared to their normal counterpart.

  10. Roles of Hydroxynitrile Glucosides in Barley

    DEFF Research Database (Denmark)

    Roelsgaard, Pernille Sølvhøj

    Plants produce an impressive variety of bioactive natural products involved in defense, insect attraction and signaling. These compounds enable the plant to defend itself, communicate with the surroundings and survive in an environment with constant challenges and attackers. This study has focused...... that hydroxynitrile glucosides can act as carbohydrate and nitrogen storage compounds and as reactive oxygen species (ROS) quenching compounds. A positive correlation between the hydroxynitrile glucoside content in barley and susceptibility toward the barley powdery mildew fungus (Blumeria graminis f.sp. hordei, Bgh...... to regulate defense related genes in maize. Barley plants that are gene-silenced in the first step of hydroxynitrile glucoside biosynthesis have been generated to further investigate these results. It appears that hydroxynitrile glucosides in barley have a dual role; up to a certain level Bgh profits from...

  11. SPRING BARLEY BREEDING FOR MALTING QUALITY

    Directory of Open Access Journals (Sweden)

    Alžbeta Žofajová

    2010-05-01

    Full Text Available The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of  qualitative  raw material for maltinq and beer  industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the  new requirements of  malting and beer industry. As an example of the results obtained most recently description is made of the Ezer, Levan, Donaris, Sladar spring barley varieties with very good malting quality and effective resistance to  powdery mildew.  Cultivation of these varieties  and malting barley production with  reduced use  of pesticidies is environmentally friedly alternative. doi:10.5219/50

  12. Rpr1, a gene required for Rpg1-dependent resistance to stem rust in barley.

    Science.gov (United States)

    Zhang, L; Fetch, T; Nirmala, J; Schmierer, D; Brueggeman, R; Steffenson, B; Kleinhofs, A

    2006-09-01

    Rpg1 is a stem rust resistance gene that has protected barley from severe losses for over 60 years in the US and Canada. It confers resistance to many, but not all, pathotypes of the stem rust fungus Puccinia graminis f. sp. tritici. A fast neutron induced deletion mutant, showing susceptibility to stem rust pathotype Pgt-MCC, was identified in barley cv. Morex, which carries Rpg1. Genetic and Rpg1 mRNA and protein expression level analyses showed that the mutation was a suppressor of Rpg1 and was designated Rpr1 (Required for P. graminis resistance). Genome-wide expression profiling, using the Affymetrix Barley1 GeneChip containing approximately 22,840 probe sets, was conducted with Morex and the rpr1 mutant. Of the genes represented on the Barley1 microarray, 20 were up-regulated and 33 were down-regulated by greater than twofold in the mutant, while the Rpg1 mRNA level remained constant. Among the highly down-regulated genes (greater than fourfold), genomic PCR, RT-PCR and Southern analyses identified that three genes (Contig4901_s_at, HU03D17U_s_at, and Contig7061_s_at), were deleted in the rpr1 mutant. These three genes mapped to chromosome 4(4H) bin 5 and co-segregated with the rpr1-mediated susceptible phenotype. The loss of resistance was presumed to be due to a mutation in one or more of these genes. However, the possibility exists that there are other genes within the deletions, which are not represented on the Barley1 GeneChip. The Rpr1 gene was not required for Rpg5- and rpg4-mediated stem rust resistance, indicating that it shows specificity to the Rpg1-mediated resistance pathway.

  13. Functional Analysis of Barley Powdery Mildew Effector Candidates and Identification of their Barley Targets

    DEFF Research Database (Denmark)

    Ahmed, Ali Abdurehim

    The genome of barley powdery mildew fungus (Blumeria graminis f. sp. hordei, Bgh) encodes around 500 Candidate Secreted Effector Proteins (CSEPs), which are believed to be delivered to the barley cells either to interfere with plant defence and/or promote nutrient uptake. So far, little is known...

  14. 2015 nationwide survey revealed Barley stripe mosaic virus in Korean barley fields

    Science.gov (United States)

    A seed-transmitted virus has consistently caused significant economic damage to barley crops in Korea in recent years, and may be increasing because many farmers save seed for replanting. Because some barley seed is imported, there is the potential for introduction of new seed-transmitted viruses, c...

  15. Biochemical composition and nutritional evaluation of barley rihane ...

    African Journals Online (AJOL)

    glucan; bioactive compounds; functional food. Abbreviations: BR, Barley Rihane; LDL, low density lipoprotein; HDL, high density lipoprotein; AOM, azoxymethane; TBV, Tunisian barley varieties; TGW, thousand grain weight; SW, weight specific; TDF ...

  16. comparison of the frost resistance of barley (hordeum vulgare l.)

    African Journals Online (AJOL)

    Barley is the most important crop in the highlands of Ethiopia at altitudes above 2600 m, where its productivity is limited by cold stress. We studied 25 Ethiopian barley landraces in order to identify cold tolerant types and to describe characteristics and acclimation potentials of these landraces to cold stress. Barley plants ...

  17. [ Ustilago nuda (Jensen) Rostrup] of Barley ( Hordeum vulgare L.)

    African Journals Online (AJOL)

    Importance of loose Smut [ Ustilago nuda (Jensen) Rostrup] of Barley ( Hordeum vulgare L.) in western Amhara Region, Ethiopia. ... with selected fungicides need to be promoted to tackle loose smut and to sustain barley production. Keywords: Barley; Hordeum vulgare; Loose Smut; Seed Treatment; Ustilago nuda ...

  18. Amylolytic strains of Lactobacillus plantarum isolated from barley ...

    African Journals Online (AJOL)

    ... naturally present in barley, and produced cell-bound and cell-free α-amylase at alkaline conditions. The two strains may be developed into starter cultures to facilitate the germination of barley and produce malt with a higher fermentable sugar content. Key words: Lactobacillus plantarum, starch hydrolysis, barley, malting ...

  19. Evaluation of Barley as Human Food

    Directory of Open Access Journals (Sweden)

    Mehmet Köten

    2013-12-01

    Full Text Available Barley, as animal feed, raw material for malting and human food, constitute an important part among cereal sources in the world. Majority of barley that produced both in Turkey and other countries of the world, is being used as animal feed. Poor baking quality, taste and appearance of barley restricted its use in human nutrition. However, recently high protein, fiber, especially β-glucan and high starch content appeal to food industry. Many scientific researches established that β-glucan, a soluble fiber, has an effect in healing coronary-hearth diseases, lowering blood cholesterol level, balancing blood sugar level, preventing obesity. Being a healthy cereal that can be used in various purposes, and an additive in many food products, barley is considered a very promising cereal, and research to increase possibilities of its use in human nutrition is being increased. In the literature, there has been researches on making noodles, bulgur, kavut (roasted cereal, breakfast cereals. In this study the researches relating to evaluation of barley, importance of which is increased every day, as human food was reviewed.

  20. NJ cluster analysis of the SnRK2, PYR/PYL/RCAR, and ABF genes in Tibetan hulless barley.

    Science.gov (United States)

    Yuan, H J; Wang, Y L; Wei, Z X; Xu, Q J; Zeng, X Q; Tang, Y W; Nyima, T S

    2016-11-03

    The abscisic acid (ABA) signaling pathway is known as one of the most important signaling pathways in plants and is mediated by multiple regulators. The genes SnRK2, PYR/PYL/RCAR, and ABF are relevant to both ABA-dependent and -independent signaling pathways. To elucidate the profile of these genes from Tibetan hulless barley (Hordeum vulgare L. var. nudum Hook. f.), we collected available sequences from RNA-Seq data, together with NCBI data from five other model plant species (Arabidopsis thaliana, Brachypodium distachyon, Oryza sativa, Populus trichocarpa, and Sorghum bicolor). Gene trees of SnRK2, PYR/PYL/RCAR, and ABF were constructed using a neighbor joining (NJ) method. For all genes, we identified a dominant group in which all six species were represented. Three, four, and five groups were found in the NJ trees of SnRK2, PYR/PYL/RCAR, and ABF, respectively. For each gene, Tibetan hulless barley was divided into three groups. Our analyses indicated that Tibetan hulless barley was associated with B. distachyon. The NJ cluster analysis also suggested that Tibetan hulless barley was affiliated with S. bicolor (SnRK2), A. thaliana (PYR/PYL/RCAR), and O. sativa (ABF). These results illustrate a diverse expression of genes SnRK2, PYR/PYL/RCAR, and ABF, and suggest a relationship among the six species studied. Collectively, our characterization of the three components of the ABA signaling pathway may contribute to improve stress tolerance in Tibetan hulless barley.

  1. Immigration of the barley mildew pathogen into field plots of barley

    DEFF Research Database (Denmark)

    O'Hara, R.B.; Brown, J.K.M.

    1996-01-01

    Immigration of the barley powdery mildew pathogen (Erysiphe graminis f.sp. hordei) into field plots of the spring barley variety Tyra (carrying the resistance allele Mla1) was investigated. Spores were trapped from the top of the plot canopies, as well as from control plots of wheat with no barley...... nearby. Comparison of the frequencies of virulent and avirulent single-colony isolates showed that the amount of immigration, relative to the amount of inoculum being produced within the plot, reduced very rapidly, until it could not be detected in the middle of the growing season (mid-June)....

  2. The barley Jip23b gene

    DEFF Research Database (Denmark)

    Müller-Uri, Frieder; Cameron-Mills, Verena; Mundy, John

    2002-01-01

    The barley gene (Jip23) encoding a 23,000-Da protein of unknown function was isolated and shown to be induced by jasmonate methyl ester (MeJA) in leaves. 5'upstream Jip23 sequence was isolated and fused to the beta-glucuronidase gene (GUS), and this reporter was introduced by particle bombardment...... into barley leaves. With 1.8 kb of this Jip23 sequence, GUS expression was enhanced about threefold by jasmonate treatment. This indicates that the Jip23 regulation by jasmonate occurs at the level of transcription.......The barley gene (Jip23) encoding a 23,000-Da protein of unknown function was isolated and shown to be induced by jasmonate methyl ester (MeJA) in leaves. 5'upstream Jip23 sequence was isolated and fused to the beta-glucuronidase gene (GUS), and this reporter was introduced by particle bombardment...

  3. Winter barley mutants created in the Ukraine

    International Nuclear Information System (INIS)

    Zayats, O.M.

    2001-01-01

    Full text: Increasing fodder and protein production is one of the objectives of the development of agriculture in Ukraine. Higher productivity of fodder crops, due to new highly productive varieties, is the means to meet this aim. Winter barley is an important crop for fodder purposes. The climate of the Ukraine is favourable for growing this crop. The areas used for the growth of winter barley are however, small (500,000-550,000 ha) and there is a shortage of good quality varieties. The main aim of the work was therefore to create new varieties of highly productive winter barley, of good quality. The new varieties and mutation lines of winter barley were created under the influence of water solutions of N-nitroso-N-methylurea (NMH - 0,012, 0,005%), N-nitroso-N-ethylurea (NEH - 0,05; 0.025; 0,012%) ethyleneimine (EI - 0,02; 0,01; 0,005%) on winter barley seeds of the varieties of local and foreign selections. On the basis of many years of investigations (1984-94) the following mutations were described: hard-grained, winter-hardiness, earliness, middle-maturity, late-maturity, wide and large leaves, narrow leaves, multinodal, great number of leaves, great number of flowers, strong stem (lodging resistant), tallness, semi-dwarfness, dwarfness, and high productivity. Particularly valuable are mutants with high productivity of green bulk. Their potential yield is 70 t/ha. As a result of the work two varieties of winter barley 'Shyrokolysty' and 'Kormovy' were released into the State register of plant varieties of the Ukraine. The other valuable mutant genotypes are used in cross breeding programmes. (author)

  4. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

    OpenAIRE

    Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

    2016-01-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

  5. Barley Transformation Using Agrobacterium-Mediated Techniques

    Science.gov (United States)

    Harwood, Wendy A.; Bartlett, Joanne G.; Alves, Silvia C.; Perry, Matthew; Smedley, Mark A.; Leyland, Nicola; Snape, John W.

    Methods for the transformation of barley using Agrobacterium-mediated techniques have been available for the past 10 years. Agrobacterium offers a number of advantages over biolistic-mediated techniques in terms of efficiency and the quality of the transformed plants produced. This chapter describes a simple system for the transformation of barley based on the infection of immature embryos with Agrobacterium tumefaciens followed by the selection of transgenic tissue on media containing the antibiotic hygromycin. The method can lead to the production of large numbers of fertile, independent transgenic lines. It is therefore ideal for studies of gene function in a cereal crop system.

  6. CRISPR/gRNA-directed synergistic activation mediator (SAM) induces specific, persistent and robust reactivation of the HIV-1 latent reservoirs.

    Science.gov (United States)

    Zhang, Yonggang; Yin, Chaoran; Zhang, Ting; Li, Fang; Yang, Wensheng; Kaminski, Rafal; Fagan, Philip Regis; Putatunda, Raj; Young, Won-Bin; Khalili, Kamel; Hu, Wenhui

    2015-11-05

    Current antiretroviral therapy does not eliminate the integrated and transcriptionally silent HIV-1 provirus in latently infected cells. Recently, a "shock and kill" strategy has been extensively explored to eradicate the HIV-1 latent reservoirs for a permanent cure of AIDS. The therapeutic efficacy of currently used agents remains disappointing because of low efficiency, non-specificity and cellular toxicity. Here we present a novel catalytically-deficient Cas9-synergistic activation mediator (dCas9-SAM) technology to selectively, potently and persistently reactivate the HIV-1 latent reservoirs. By screening 16 MS2-mediated single guide RNAs, we identified long terminal repeat (LTR)-L and O that surround the enhancer region (-165/-145 for L and -92/-112 for O) and induce robust reactivation of HIV-1 provirus in HIV-1 latent TZM-bI epithelial, Jurkat T lymphocytic and CHME5 microglial cells. This compulsory reactivation induced cellular suicide via toxic buildup of viral proteins within HIV-1 latent Jurkat T and CHME5 microglial cells. These results suggest that this highly effective and target-specific dCas9-SAM system can serve as a novel HIV-latency-reversing therapeutic tool for the permanent elimination of HIV-1 latent reservoirs.

  7. Angiosperms Are Unique among Land Plant Lineages in the Occurrence of Key Genes in the RNA-Directed DNA Methylation (RdDM) Pathway

    Czech Academy of Sciences Publication Activity Database

    Ma, L.; Hatlen, A.; Kelly, L.J.; Becher, H.; Wang, W.C.; Kovařík, Aleš; Leitch, I. J.; Leitch, Andrew R.

    2015-01-01

    Roč. 7, č. 9 (2015), s. 2648-2662 ISSN 1759-6653 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : chromatin modification * DNA methylation * evolution Subject RIV: BO - Biophysics Impact factor: 4.098, year: 2015

  8. Differential Synthesis in Vitro of Barley Aleurone and Starchy Endosperm Proteins

    DEFF Research Database (Denmark)

    Mundy, John; Hejgaard, Jørn; Hansen, Annette

    1986-01-01

    RNAs from isolated endosperm and aleurone tissues (developing and mature grain) and from cultured (germinating) aleurone layers treated with abscisic acid (ABA) and GA(3). B and C hordein polypeptides and the salt-soluble proteins beta-amylase, protein Z, protein C, the chymotrypsin inhibitors (CI-1 and 2......, expression of genes encoding ASI, PSI, protein C, and PAPI is tissue and stage-specific during seed development. Only ASI, CI-1, and PAPI were synthesized in significant amounts with mRNA from cultured aleurone layers. The levels of synthesis of PAPI and CI-1 were independent of hormone treatment......To widen the selection of proteins for gene expression studies in barley seeds, experiments were performed to identify proteins whose synthesis is differentially regulated in developing and germinating seed tissues. The in vitro synthesis of nine distinct barley proteins was compared using m...

  9. Endoproteolytic activity assay in malting barley

    Directory of Open Access Journals (Sweden)

    Blanca Gómez Guerrero

    2013-12-01

    Full Text Available Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four classes of endo-proteases have been described: serine-proteases, cysteine-proteases, aspartic-proteases and metallo-proteases. The objective of this work was to develop a rapid and colorimetric enzymatic assay to determine the endo-proteolytic activity of the four endo-protease classes using two different substrates: azo-gelatin and azo-casein. Optimum conditions for the assays such as: pH,reaction time and temperature and absorbance scale were determined. Azo-gelatin presented several difficulties in standardizing an “in solution” assay. On the other hand, azo-casein allowed standardization of the assay for the four enzyme classes to produce consistent results. The endo-proteoteolytic method developed was applied to determine the endo-protease activity in barley, malt and wort.

  10. The Localization of Eceriferum Loci in Barley

    DEFF Research Database (Denmark)

    Søgaard, Bodil

    1974-01-01

    Three different 3-point tests have been made for gene distances on chromosome 1 in barley (Hordeum vulgare L.). In all cases eceriferum, cer-f9, and albina, ac2, were examined with erectoides as the third gene. The erectoides, ert, genes are ert-a23, ert-d33 and ert-m40, respectively. The analyses...

  11. Cisgenic Barley with Improved Phytase Activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik

    2010-01-01

    barley lambda library has been used to isolate the genomic clone of this phytase including 2.3 kb of the promoter region and 600 bp of the terminator region. The clone has been inserted into a cisgenic Agrobacterium vector where both the gene of interest and the selection gene are flanked by their own T...

  12. Barley Breeding for Quality Improvement in Tunisia

    African Journals Online (AJOL)

    TOSHIBA

    2012-11-06

    Deghais, 1991; El Felah, 1998). The consistent difficulties observed in the ... Atlas 46 (As46), improved material Arrivat (Avt) and Athenaïs. (Aths). It's now a widely grown variety (more than 40% of total barley cultivated areas in ...

  13. Thionin antifungal peptide synthesis in transgenic barley

    Science.gov (United States)

    In seeds and vegetative organs of barley and other cereals, thionins are processed into peptides with pronounced anti-microbial properties. In vitro studies demonstrated the toxicity of a- and ß-hordothionins (HTHs) to the fungal pathogen Fusarium graminearum. Increasing the expression of thionin g...

  14. Inhibition of barley grain germination by light

    NARCIS (Netherlands)

    Roth-Bejerano, N.; Meulen, R.M. van der; Wang, M.

    1996-01-01

    Intact grains of barley (Hordeum distichum cv. Triumph) germinated rapidly in the dark or when exposed to brief daily light breaks in the temperature range 15-25°C, although germination proceeded less rapidly at low temperatures. Prolonged illumination (16 h/day) or continuous light inhibited

  15. Protective effect of young green barley leaf (Hordeum vulgare L.) on restraint stress-induced decrease in hippocampal brain-derived neurotrophic factor in mice.

    Science.gov (United States)

    Yamaura, Katsunori; Tanaka, Riho; Bi, Yuanyuan; Fukata, Hideki; Oishi, Nobuo; Sato, Hiromi; Mori, Chisato; Ueno, Koichi

    2015-05-01

    Many health experts support the hypothesis that stressful lifestyles are the leading cause of illness, like depression. Therefore, from the standpoint of preventive medicine, it is important to reduce stress. Young green barley leaves are a good natural source of vitamins and minerals, and their juice is widely consumed as a functional food for health reasons in Japan. This study investigated the protective effect of young green barley leaves for stress control. ICR outbred mice were exposed to 3-h sessions of restraint stress. Young green barley leaves (400 and 1,000 mg/kg) were administered orally 1 h before the sessions for 5 days. To analyze voluntary behavior, wheel-running activity was monitored during the dark period. Brain-derived neurotrophic factor (BDNF) messenger RNA (mRNA) expression in the whole hippocampus was measured by real-time quantitative polymerase chain reaction. Restraint stress resulted in a significant decrease in voluntary wheel-running behavior, but this decrease was ameliorated by the administration of young green barley leaves. The leaves also enhanced the decreased levels of BDNF mRNA induced by restraint stress; in particular, a significant protective effect was shown in the exon IV variant as compared to vehicle control mice. The findings suggest that young green barley leaves have potent anti-stress properties, as evidenced by preventing decreases in the levels of voluntary wheel-running activity and hippocampal BDNF mRNA in response to restraint stress. Our findings support the possibility that supplementation with young green barley leaves might be beneficial for preventing stress-related psychiatric disorders like depression.

  16. Lipid and sugar profiles of various barley cultivars (Hordeum vulgare

    Directory of Open Access Journals (Sweden)

    Pastor Kristian A.

    2015-01-01

    Full Text Available The lipid components and soluble sugars in flour samples of different cultivars of barley (Hordeum vulgare, involving winter malting barley, winter forage barley, spring barley, and hulless barley, were identified. Fatty acids were extracted from flour samples with n-hexane, and derivatized into volatile methyl esters, using TMSH (trimethylsulfonium hydroxide in methanol. Soluble sugars were extracted from defatted and dried samples of barley flour with 96% ethanol, and further derivatized into the corresponding trimethylsilyl (TMS oximes, using hydroxylamine hydrochloride solution and BSTFA (N,O-bis-(trimethylsilyl-trifluoroacetamide. The hexane and alcoholic extracts of barley cultivars were analyzed by GC-MS system. Lipid and sugar compositions were very similar in all barley cultivars. Therefore, multivariate analysis was applied to numerical values of automatically integrated areas of the identified fatty acid methyl esters and TMS oximes of soluble sugars. The application of hierarchical cluster analysis showed a great similarity between the investigated flour samples of barley cultivars, according to their fatty acid content (0.96. Also, significant, but somewhat less similarity was observed regarding the content of soluble sugars (0.70. These preliminary results indicate the possibility of distinguishing flour made of barley, regardless of the variety, from flours made of other cereal species, just by the analysis of the contents of fatty acids and soluble sugars.[Projekat Ministarstva nauke Republike Srbije, br. TR 31066

  17. Cap- and initiator tRNA-dependent initiation of TYMV polyprotein synthesis by ribosomes: Evaluation of the Trojan horse model for TYMV RNA translation

    OpenAIRE

    Matsuda, Daiki; Dreher, Theo W.

    2007-01-01

    Turnip yellow mosaic virus (TYMV) RNA directs the translation of two overlapping open reading frames. Competing models have been previously published to explain ribosome access to the downstream polyprotein cistron. The Trojan horse model, based on cell-free experiments, proposes noncanonical cap-independent initiation in which the 3′-terminal tRNA-like structure (TLS) functionally replaces initiator tRNA, and the valine bound to the TLS becomes cis-incorporated into viral protein. The initia...

  18. Barley grain for ruminants: A global treasure or tragedy.

    Science.gov (United States)

    Nikkhah, Akbar

    2012-07-09

    Barley grain (Hordeum vulgare L.) is characterized by a thick fibrous coat, a high level of ß-glucans and simply-arranged starch granules. World production of barley is about 30 % of that of corn. In comparison with corn, barley has more protein, methionine, lysine, cysteine and tryptophan. For ruminants, barley is the third most readily degradable cereal behind oats and wheat. Due to its more rapid starch fermentation rate compared with corn, barley also provides a more synchronous release of energy and nitrogen, thereby improving microbial nutrient assimilation. As a result, feeding barley can reduce the need for feeding protected protein sources. However, this benefit is only realized if rumen acidity is maintained within an optimal range (e.g., > 5.8 to 6.0); below this range, microbial maintenance requirements and wastage increase. With a low pH, microbial endotoxines cause pro-inflammatory responses that can weaken immunity and shorten animal longevity. Thus, mismanagement in barley processing and feeding may make a tragedy from this treasure or pearl of cereal grains. Steam-rolling of barley may improve feed efficiency and post-rumen starch digestion. However, it is doubtful if such processing can improve milk production and feed intake. Due to the need to process barley less extensively than other cereals (as long as the pericarp is broken), consistent and global standards for feeding and processing barley could be feasibly established. In high-starch diets, barley feeding reduces the need for capacious small intestinal starch assimilation, subsequently reducing hindgut starch use and fecal nutrient loss. With its nutritional exclusivities underlined, barley use will be a factual art that can either matchlessly profit or harm rumen microbes, cattle production, farm economics and the environment.

  19. Barley grain for ruminants: A global treasure or tragedy

    Directory of Open Access Journals (Sweden)

    Nikkhah Akbar

    2012-07-01

    Full Text Available Abstract Barley grain (Hordeum vulgare L. is characterized by a thick fibrous coat, a high level of ß-glucans and simply-arranged starch granules. World production of barley is about 30 % of that of corn. In comparison with corn, barley has more protein, methionine, lysine, cysteine and tryptophan. For ruminants, barley is the third most readily degradable cereal behind oats and wheat. Due to its more rapid starch fermentation rate compared with corn, barley also provides a more synchronous release of energy and nitrogen, thereby improving microbial nutrient assimilation. As a result, feeding barley can reduce the need for feeding protected protein sources. However, this benefit is only realized if rumen acidity is maintained within an optimal range (e.g., > 5.8 to 6.0; below this range, microbial maintenance requirements and wastage increase. With a low pH, microbial endotoxines cause pro-inflammatory responses that can weaken immunity and shorten animal longevity. Thus, mismanagement in barley processing and feeding may make a tragedy from this treasure or pearl of cereal grains. Steam-rolling of barley may improve feed efficiency and post-rumen starch digestion. However, it is doubtful if such processing can improve milk production and feed intake. Due to the need to process barley less extensively than other cereals (as long as the pericarp is broken, consistent and global standards for feeding and processing barley could be feasibly established. In high-starch diets, barley feeding reduces the need for capacious small intestinal starch assimilation, subsequently reducing hindgut starch use and fecal nutrient loss. With its nutritional exclusivities underlined, barley use will be a factual art that can either matchlessly profit or harm rumen microbes, cattle production, farm economics and the environment.

  20. Evaluation of fermented whole crop wheat and barley feeding on ...

    African Journals Online (AJOL)

    Evaluation of fermented whole crop wheat and barley feeding on growth performance, nutrient digestibility, faecal volatile fatty acid emission, blood constituents, and faecal microbiota in growing pigs.

  1. Implementation of biochemical screening to improve baking quality of barley

    DEFF Research Database (Denmark)

    Vincze, Éva; Dionisio, Giuseppe; Aaslo, Per

    2011-01-01

    Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact on the phys......Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact...... on the physical chemical properties of the bread products due to the poor baking properties of barley flour. As a consequence, the nutritional advantages of barley are not fully exploited. The inferior leavening and baking properties of barley can, in part, be attributed to the physical properties of the storage...... proteins. Changing the storage protein composition can lessen this problem. Our working hypothesis was that exploiting the substantial genetic variation within the gene pool for storage proteins could enable improving the baking qualities of barley flour. We characterised forty-nine barley cultivars...

  2. The Barley Chromosome 5 Linkage Map

    DEFF Research Database (Denmark)

    Jensen, J.; Jørgensen, Jørgen Helms

    1975-01-01

    The literature is surveyed for data on recombination between loci on chromosome 5 of barley; 13 loci fall into the category “mapped” loci, more than 20 into the category “associated” loci and nine into the category “loci once suggested to be on chromosome 5”. A procedure was developed for estimat......The literature is surveyed for data on recombination between loci on chromosome 5 of barley; 13 loci fall into the category “mapped” loci, more than 20 into the category “associated” loci and nine into the category “loci once suggested to be on chromosome 5”. A procedure was developed...... data are utilized jointly, and (3) omission of inconsistent data and determination of the most likely order of the loci. This procedure was applied to the 42 recombination percentages available for the 13 “mapped” loci. Due to inconsistencies 14 of the recombination percentages and, therefore, two...

  3. Cisgenic barley with improved phytase activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik

    2010-01-01

    copies of the genomic phytase gene and the selection gene to identify segregation between the two genes. Presently, we have identified two cisgenic T1 plants without vector backbone and selection gene but with an extra copy of the genomic phytase gene....... are accordingly very similar to those generated by conventional breeding. The cisgenesis concept allows for the introduction of extra gene copies of a particular gene to accentuate the trait. We are using a barley purple acid phosphatase expressed during grain filling as candidate gene for cisgenesis. A genomic...... barley lambda library has been used to isolate the genomic clone of this phytase including 2.3 kb of the promoter region and 600 bp of the terminator region. The clone has been inserted into a cisgenic Agrobacterium vector where both the gene of interest and the selection gene are flanked by their own T...

  4. Biosorption of nickel with barley straw.

    Science.gov (United States)

    Thevannan, Ayyasamy; Mungroo, Rubeena; Niu, Catherine Hui

    2010-03-01

    Wastewater containing nickel sulphate generated from a nickel plating industry is of great concern. In the present work, biosorption of nickel by barley straw from nickel sulphate solution was investigated. Nickel uptake at room temperature (23+/-0.5 degrees C) was very sensitive to solution pH, showing a better uptake value at a pH of 4.85+/-0.10 among the tested values. The nickel biosorption isotherm fitted well the Langmuir equation. When the ionic strength (IS) of the solution was increased from less than 0.02-0.6M, nickel uptake was reduced to 12% of that obtained at IS of less than 0.02 M. Barley straw showed a higher nickel uptake (0.61 mmol/g) than acid washed crab shells (0.04 mmol/g), demonstrating its potential as an adsorbent for removal of nickel. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  5. Enhancement of methane production from barley waste

    OpenAIRE

    Neves, L.; Ribeiro, R.; Oliveira, Rosário; Alves, M. M.

    2006-01-01

    Two different approaches were attempted to try and enhance methane production from an industrial waste composed of 100% barley, which results from production of instant coffee substitutes. In previous work, this waste was co-digested with an excess of activated sludge produced in the wastewater treatment plant located in same industrial unit, resulting in a very poor methane yield (25LCH4(STP)/ kgVSinitial), and low reductions in total solids (31%) and in volatile solids (40%). Wh...

  6. Search for endophytic diazotrophs in barley seeds

    Directory of Open Access Journals (Sweden)

    Myriam S. Zawoznik

    2014-06-01

    Full Text Available Eight endophytic isolates assigned to Pseudomonas, Azospirillum, and Bacillus genera according to pheno-genotypic features were retrieved from barley seeds under selective pressure for nitrogen-fixers. Genetic relationships among related isolates were investigated through RAPD. Six isolates displayed nitrogen-fixing ability, while all could biosynthesize indolacetic acid in vitro and showed no antibiosis effects against Azospirillum brasilense Az39, a recognized PGPR.

  7. Barley: From Brittle to Stable Harvest.

    Science.gov (United States)

    Haberer, Georg; Mayer, Klaus F X

    2015-07-30

    Selection and domestication of plants with genes that prevent grains from shattering in cereals was essential for human civilization's transition to agriculture-based societies. In this issue, Pourkheirandish et al. show that domestication of barley required evolution of a molecular system distinct from other grains, such as rice and maize, and reveal that present-day cultivars derive from two ancient domestication centers. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Radiation induced early maturing mutants in barley

    International Nuclear Information System (INIS)

    Kumar, R.; Chauhan, S.V.S.; Sharma, R.P.

    1978-01-01

    In M 2 generation, two early maturing plants were screened from a single spike progeny of a plant obtained from 20 kR of gamma-ray irradiation of a six-rowed barley (Hordeum vulgare L. var. Jyoti). Their true breeding nature was confirmed in M 3 generation. These mutants flower and mature 38 and 22 days earlier than those of control. (auth.)

  9. Radiosensitivity study of cultured barley (hordeum vulgare)

    International Nuclear Information System (INIS)

    Wang Cailian; Shen Mei; Xu Gang; Zhao Kongnan; Chen Qiufang

    1991-07-01

    For studying the radioactivity, forty seven varieties of dormant barley seeds were irradiated with various doses (0 ∼ 400 Gy) of 137 Cs γ-rays. The results showed that the dose-effects relations of seedling growth inhibition could be fitted by an equation of F(D) = 1 - (1 - e -a 1 D ) N , and the dose-effects of cell-nucleus, the frequency of root tip cell with chromosome aberations and peroxidase isoenzyme band could be expressed by a linear regression equation Y = A + B · X. The radioactivity of naked barley was much higher than of covered barley. According to different radiosensitivities the varieties studied could be divided into five types i.e. extreme resistant, resistant, intermediate, sensitive, and extreme sensitive. The results also showed that there was close relationship between the DNA content of cell-nucleus, peroxidase isoenzyme zymogram and radioactivity. The radiosensitivty was proportional to the DNA content. The volume of cell-nucleus varied inversly as D 50 of nucleus volume and no obvious correlation with the D 50 of seedling growth inhibition

  10. Respiratory burst oxidase homologue A of barley contributes to penetration by the powdery mildew fungus Blumeria graminis f. sp. hordei.

    Science.gov (United States)

    Trujillo, Marco; Altschmied, Lothar; Schweizer, Patrick; Kogel, Karl-Heinz; Hückelhoven, Ralph

    2006-01-01

    Reactive oxygen intermediates (ROI) are closely related to defence reactions of plants against pathogens. A prominent role in the production of ROI has been attributed to the plant respiratory burst oxidase homologues (RBOH) of the human phagocyte GP91(phox). A barley RBOH, which encodes a putative superoxide (O2*-)) producing NADPH oxidase, is described here. Histochemical analysis of the barley-Blumeria graminis f. sp. hordei (Bgh) interaction showed that O(2*-) is produced locally at the site of penetration. In contrast, hydrogen peroxide (H2O2) is produced in non-penetrated cell wall appositions. A barley RBOHA cDNA was isolated and a minor induction of expression of RBOHA was observed during the interactions of barley with Bgh. Transient RNA interference-mediated gene silencing of HvRBOHA during the penetration process of Bgh led to an increase of basal penetration resistance. The results support a potential role of HvRBOHA in cellular accessibility to Blumeria graminis.

  11. Investigation of the somaclonal and mutagen induced variability in barley by the application of protein and DNA markers

    International Nuclear Information System (INIS)

    Atanassov, A.; Todorovska, E.; Trifonova, A.; Petrova, M.; Marinova, E.; Gramatikova, M.; Valcheva, D.; Zaprianov, S.; Mersinkov, N.

    1998-01-01

    Barley, Hordeum vulgare L., is one of the most important crop species for Bulgaria. The characterisation of the genetic pool is of great necessity for the Bulgarian barley breeding programme which is directed toward improving quantitative and qualitative traits. Molecular markers [protein, restriction fragment length polymorphisms (RFLP) and randomly amplified polymorphic DNA (RAPD)] have been applied to characterise the Bulgarian barley cultivars and their regenerants. The changes in DNA loci coding for 26S, 5.8S and 18S rRNA repeats, C hordein locus and mitochondrial DNA organisation have been investigated. The potential for ribosomal DNA length polymorphism in Bulgarian barley cultivars appear to be limited to three different repeat lengths (10.2, 9.5 and 9.0kb) and three plant rDNA phenotypes. Polymorphism was not observed in ribosomal DNA repeat units in somaclonal variants. Variation concerning C hordein electrophoretic pattern was observed in one line from cultivar Jubiley. Analysis of the HorI locus reveals RFLPs in sequences coding for C hordeins in this line. Mitochondrial molecular markers are convenient for detection of DNA polymorphisms in the variant germplasm as well as for the somaclonal variants derived from it. Two lines from Ruen revealed polymorphic bands after hybridisation with mitochondrial DNA probe. RAPD assays have been carried out by using 20 different 10-mer primers. Heritable polymorphism in several tissue culture derived (TCD) lines was observed. RAPD assay is a sensitive and representative approach to distinguish the variability created by tissue culture and mutagenesis

  12. Transcript profiling in the barley mildew pathogen Blumeria graminis by serial analysis of gene expression (SAGE).

    Science.gov (United States)

    Thomas, Stephen W; Glaring, Mikkel A; Rasmussen, Søren W; Kinane, Julia T; Oliver, Richard P

    2002-08-01

    The fungal pathogen Blumeria graminis f. sp. hordei develops on the barley leaf via distinct, morphologically well-defined stages. After landing on a host plant, the conidia rapidly germinate to form a primary germ tube. Subsequently, an appressorial germ tube emerges from the conidium and differentiates an appressorium from which penetration of the host cell wall is attempted. We have used serial analysis of gene expression to provide a measurement of messenger RNA contents in ungerminated conidia, during conidial germination, and during appressorium formation. The resulting data provide a resource for the characterization of changes in transcript accumulation during early development of B. graminis.

  13. Barley yellow dwarf virus in barley crops in Tunisia: prevalence and molecular characterization

    OpenAIRE

    Asma NAJAR; Imen HAMDI; Arvind VARSANI

    2017-01-01

    A field survey was conducted in Tunisia in the North-Eastern regions (Bizerte, CapBon and Zaghouan), the North-Western region (Kef) and the Central-Eastern region (Kairouan) during the 2011/2012 growing season, in order to determine the incidence and the geographic distribution of Barley yellow dwarf virus (BYDVs) in barley fields. Tissue blot immunoassays (TBIA) showed that BYDV was most common in Zaghouan (incidence 14%), Cap Bon (14%) and Bizerte (35%), in randomly collected samples from t...

  14. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  15. Exploiting regulatory variation to identify genes underlying quantitative resistance to the wheat stem rust pathogen Puccinia graminis f. sp. tritici in barley.

    Science.gov (United States)

    Druka, Arnis; Potokina, Elena; Luo, Zewei; Bonar, Nicola; Druka, Ilze; Zhang, Ling; Marshall, David F; Steffenson, Brian J; Close, Timothy J; Wise, Roger P; Kleinhofs, Andris; Williams, Robert W; Kearsey, Michael J; Waugh, Robbie

    2008-07-01

    We previously mapped mRNA transcript abundance traits (expression-QTL or eQTL) using the Barley1 Affymetrix array and 'whole plant' tissue from 139 progeny of the Steptoe x Morex (St/Mx) reference barley mapping population. Of the 22,840 probesets (genes) on the array, 15,987 reported transcript abundance signals that were suitable for eQTL analysis, and this revealed a genome-wide distribution of 23,738 significant eQTLs. Here we have explored the potential of using these mRNA abundance eQTL traits as surrogates for the identification of candidate genes underlying the interaction between barley and the wheat stem rust fungus Puccinia graminis f. sp. tritici. We re-analysed quantitative 'resistance phenotype' data collected on this population in 1990/1991 and identified six loci associated with barley's reaction to stem rust. One of these coincided with the major stem rust resistance locus Rpg1, that we had previously positionally cloned using this population. Correlation analysis between phenotype values for rust infection and mRNA abundance values reported by the 22,840 GeneChip probe sets placed Rpg1, which is on the Barley1 GeneChip, in the top five candidate genes for the major QTL on chromosome 7H corresponding to the location of Rpg1. A second co-located with the rpg4/Rpg5 stem rust resistance locus that has been mapped in a different population and the remaining four were novel. Correlation analyses identified candidate genes for the rpg4/Rpg5 locus on chromosome 5H. By combining our data with additional published mRNA profiling data sets, we identify a putative sensory transduction histidine kinase as a strong candidate for a novel resistance locus on chromosome 2H and compile candidate gene lists for the other three loci.

  16. WORLD MALT AND MALTING BARLEY: COMPETITION, MARKETING, AND TRADE

    OpenAIRE

    Satyanarayana, Vidyashankara; Wilson, William W.; Johnson, D. Demcey; Dooley, Frank J.

    1996-01-01

    Recent trends in production marketing, trade, and policies affecting world malting barley and malt sector are examined. A spatial equilibrium model of production and trade is used to assess the effects of alternative levels of supply, demand, and policy variables on composition and direction of malting barley and malt trade flows.

  17. Evaluation of genetic diversity in barley (Hordeum vulgare L.) from ...

    African Journals Online (AJOL)

    User

    2015-06-03

    Jun 3, 2015 ... Akdeniz H, Keskin B, Yılmaz I, Oral E (2004). A Research on yield and yield components of some barley cultivars. J. Agric. Sci. 14:119-125. Alemayehu F, Parlevliet JE (1997). Variation between and within. Ethiopian barley landraces Euphytica 94:183-189. Asfaw Z (1988). Variation in the morphology of the ...

  18. Lysine metabolism in antisense C-hordein barley grains

    DEFF Research Database (Denmark)

    Schmidt, Daiana; Rizzi, Vanessa; Gaziola, Salete A

    2015-01-01

    The grain proteins of barley are deficient in lysine and threonine due to their low concentrations in the major storage protein class, the hordeins, especially in the C-hordein subgroup. Previously produced antisense C-hordein transgenic barley lines have an improved amino acid composition, with ...

  19. Combining unmalted barley and pearling gives good quality brewing

    NARCIS (Netherlands)

    Donkelaar, van Laura H.G.; Hageman, Jos A.; Oguz, Serhat; Noordman, Tom R.; Boom, Remko M.; Goot, van der Atze Jan

    2016-01-01

    Brewing with unmalted barley can reduce the use of raw materials, thereby increasing the efficiency of the brewing process. However, unmalted barley contains several undesired components for brewing and has a low enzymatic activity. Pearling, an abrasive milling method, has been proposed as a

  20. Molecular characterization of barley ( Hordeum vulgare L.) genome ...

    African Journals Online (AJOL)

    The present work aimed to select drought tolerant barley (Hordeum vulgare L.) cultivars through identification of stress genes responsible for drought tolerance. Several barley genotypes were tested for drought resistance using specific molecular markers, nine out of all the genotypes were chosen for this study; five out of ...

  1. (GPx) activity in young barley seedlings enriched with selenium

    African Journals Online (AJOL)

    AJB_YOMI

    2011-09-21

    Sep 21, 2011 ... E-mail: guzx@njau.edu.cn. Tel/Fax: +86. 25 84396293. have been used for animal feeds and beer malts. Recently, young barley seedlings have been used as food material for people in Asian countries such as China,. Japan, and Korea. Young barley seedlings are rich in dietary fiber, chlorophyll, carotene ...

  2. Comparison of stability statistics for yield in barley ( Hordeum ...

    African Journals Online (AJOL)

    The objectives of this study were to assess interrelationship among these measures and to identify high-yield and stable barley (Hordeum vulgare L.) cultivars in 11 environments during 2001 - 2003 in the central Black Sea region of Turkey. Significant differences were observed among barley cultivars for grain yield, ...

  3. Revisit to Ethiopian traditional barley-based food

    Directory of Open Access Journals (Sweden)

    Jemal Mohammed

    2016-06-01

    Full Text Available Barley is the number one food crop in the highland parts of North Eastern Ethiopia produced by subsistence farmers grown as landraces. Barley producers in Ethiopia have given it the name gebs ye ehil nigus, which means barley is the king of crops, due to its suitability for preparing many of the known Ethiopians traditional dishes. Various barley foods and drinks play an important role in the socioeconomic and cultural life of Ethiopians, but detailed descriptions related to their preparation and their socioeconomic and cultural roles are not well-recorded and documented like most of the Ethiopian cultural foods. Foods such as ingera, kita, dabo, kolo, genfo, beso, chuko, shamet, tihlo, kinch, and shorba are the most commonly known traditional Ethiopian barley-based foods. These products are prepared from either roasted whole grain, raw and roasted-milled grain, or cracked grain as main, side, ceremonial, and recuperating dishes. The various barley-based traditional foods have perceived qualities and health benefits by the consumers. For example, genfo is served to breast-feeding mothers with the belief that it enhances breast milk production and serves as a good substitute for breast milk. Beso is claimed to be a remedy for gastritis, while genfo and kinche are used to heal broken bones and fractures. Considering the Western consumers' trend on functional foods and health benefits of barley, Ethiopian traditional barley-based foods are worth studying as functional foods, which can be appealing to Western consumers.

  4. Barley metallothioneins differ in ontogenetic pattern and response to metals

    DEFF Research Database (Denmark)

    Schiller, Michaela; Hegelund, Josefine Nymark; Pedas, Pai

    2014-01-01

    The barley genome encodes a family of 10 metallothioneins (MTs) that have not previously been subject to extensive gene expression profiling. We show here that expression of MT1a, MT2b1, MT2b2 and MT3 in barley leaves increased more than 50-fold during the first 10 d after germination. Concurrent...

  5. stability analysis of food barley genotypes in northern ethiopia

    African Journals Online (AJOL)

    ACSS

    Barley (Hordeum vulgare L.) is one of the founder crops of the old world agriculture and was one of the first domesticated cereals. The objective of this study was to estimate the magnitude of genotype x environment interaction and stability for barley grain yield and yield related traits in the growing areas of Tigray. Eight.

  6. A cathepsin F-like peptidase involved in barley grain protein mobilization, HvPap-1, is modulated by its own propeptide and by cystatins.

    Science.gov (United States)

    Cambra, Ines; Martinez, Manuel; Dáder, Beatriz; González-Melendi, Pablo; Gandullo, Jacinto; Santamaría, M Estrella; Diaz, Isabel

    2012-07-01

    Among the C1A cysteine proteases, the plant cathepsin F-like group has been poorly studied. This paper describes the molecular and functional characterization of the HvPap-1 cathepsin F-like protein from barley. This peptidase is N-glycosylated and has to be processed to become active by its own propeptide being an important modulator of the peptidase activity. The expression pattern of its mRNA and protein suggest that it is involved in different proteolytic processes in the barley plant. HvPap-1 peptidase has been purified in Escherichia coli and the recombinant protein is able to degrade different substrates, including barley grain proteins (hordeins, albumins, and globulins) stored in the barley endosperm. It has been localized in protein bodies and vesicles of the embryo and it is induced in aleurones by gibberellin treatment. These three features support the implication of HvPap-1 in storage protein mobilization during grain germination. In addition, a complex regulation exerted by the barley cystatins, which are cysteine protease inhibitors, and by its own propeptide, is also described.

  7. Functional proteomics of barley and barley chloroplasts – strategies, methods and perspectives

    DEFF Research Database (Denmark)

    Petersen, Jørgen; Rogowska-Wrzesinska, Adelina; Jensen, Ole Nørregaard

    2013-01-01

    Barley (Hordeum vulgare) is an important cereal grain that is used in a range of products for animal and human consumption. Crop yield and seed quality has been optimized during decades by plant breeding programs supported by biotechnology and molecular biology techniques. The recently completed...

  8. Effect of partial resistance to barley leaf rust, Puccinia hordei, on the yield of three barley cultivars

    NARCIS (Netherlands)

    Ochoa, J.; Parlevliet, J.E.

    2007-01-01

    Three barley cultivars, Shyri, Clipper and Terán, with different levels of partial resistance to barley leaf rust, caused by Puccinia hordei, were exposed to six levels of the pathogen. These levels were obtained by 5, 4, 3, 2, 1 and 0 fungicide (Propiconazol) applications respectively and occurred

  9. Mosaic genome structure of the barley powdery mildew pathogen and conservation of transcriptional programs in divergent hosts

    Science.gov (United States)

    Hacquard, Stéphane; Kracher, Barbara; Maekawa, Takaki; Vernaldi, Saskia; Schulze-Lefert, Paul; Ver Loren van Themaat, Emiel

    2013-01-01

    Barley powdery mildew, Blumeria graminis f. sp. hordei (Bgh), is an obligate biotrophic ascomycete fungal pathogen that can grow and reproduce only on living cells of wild or domesticated barley (Hordeum sp.). Domestication and deployment of resistant barley cultivars by humans selected for amplification of Bgh isolates with different virulence combinations. We sequenced the genomes of two European Bgh isolates, A6 and K1, for comparative analysis with the reference genome of isolate DH14. This revealed a mosaic genome structure consisting of large isolate-specific DNA blocks with either high or low SNP densities. Some of the highly polymorphic blocks likely accumulated SNPs for over 10,000 years, well before the domestication of barley. These isolate-specific blocks of alternating monomorphic and polymorphic regions imply an exceptionally large standing genetic variation in the Bgh population and might be generated and maintained by rare outbreeding and frequent clonal reproduction. RNA-sequencing experiments with isolates A6 and K1 during four early stages of compatible and incompatible interactions on leaves of partially immunocompromised Arabidopsis mutants revealed a conserved Bgh transcriptional program during pathogenesis compared with the natural host barley despite ∼200 million years of reproductive isolation of these hosts. Transcripts encoding candidate-secreted effector proteins are massively induced in successive waves. A specific decrease in candidate-secreted effector protein transcript abundance in the incompatible interaction follows extensive transcriptional reprogramming of the host transcriptome and coincides with the onset of localized host cell death, suggesting a host-inducible defense mechanism that targets fungal effector secretion or production. PMID:23696672

  10. Systemic responses of barley to the 3-hydroxy-decanoyl-homoserine lactone producing plant beneficial endophyte Acidovorax radicis N35

    Directory of Open Access Journals (Sweden)

    Shengcai Han

    2016-12-01

    Full Text Available Quorum sensing auto-inducers of the N-acyl homoserine lactone (AHL type produced by Gram-negative bacteria have different effects on plants including stimulation on root growth and/or priming or acquirement of systemic resistance in plants. In this communication the influence of AHL production of the plant growth promoting endophytic rhizosphere bacterium Acidovorax radicis N35 on barley seedlings was investigated. A. radicis N35 produces 3-hydroxy-C10-homoserine lactone (3-OH-C10-HSL as the major AHL compound. To study the influence of this QS autoinducer on the interaction with barley, the araI-biosynthesis gene was deleted. The comparison of inoculation effects of the A. radicis N35 wild type and the araI mutant resulted in remarkable differences. While the N35 wild type colonized plant roots effectively in microcolonies, the araI mutant occurred at the root surface as single cells. Furthermore, in a mixed inoculum the wild type was much more prevalent in colonization than the araI mutant documenting that the araI mutation affected root colonization. Nevertheless, a significant plant growth promoting effect could be shown after inoculation of barley with the wild type and the araI mutant in soil after two months cultivation. While A. radicis N35 wild type showed only a very weak induction of early defense responses in plant RNA expression analysis, the araI mutant caused increased expression of flavonoid biosynthesis genes. This was corroborated by the accumulation of several flavonoid compounds such as saponarin and lutonarin in leaves of root inoculated barley seedlings. Thus, although the exact role of the flavonoids in this plant response is not clear yet, it can be concluded, that the synthesis of AHLs by A. radicis has implications on the perception by the host plant barley and thereby contributes to the establishment and function of the bacteria-plant interaction.

  11. Genomic Prediction of Barley Hybrid Performance

    Directory of Open Access Journals (Sweden)

    Norman Philipp

    2016-07-01

    Full Text Available Hybrid breeding in barley ( L. offers great opportunities to accelerate the rate of genetic improvement and to boost yield stability. A crucial requirement consists of the efficient selection of superior hybrid combinations. We used comprehensive phenotypic and genomic data from a commercial breeding program with the goal of examining the potential to predict the hybrid performances. The phenotypic data were comprised of replicated grain yield trials for 385 two-way and 408 three-way hybrids evaluated in up to 47 environments. The parental lines were genotyped using a 3k single nucleotide polymorphism (SNP array based on an Illumina Infinium assay. We implemented ridge regression best linear unbiased prediction modeling for additive and dominance effects and evaluated the prediction ability using five-fold cross validations. The prediction ability of hybrid performances based on general combining ability (GCA effects was moderate, amounting to 0.56 and 0.48 for two- and three-way hybrids, respectively. The potential of GCA-based hybrid prediction requires that both parental components have been evaluated in a hybrid background. This is not necessary for genomic prediction for which we also observed moderate cross-validated prediction abilities of 0.51 and 0.58 for two- and three-way hybrids, respectively. This exemplifies the potential of genomic prediction in hybrid barley. Interestingly, prediction ability using the two-way hybrids as training population and the three-way hybrids as test population or vice versa was low, presumably, because of the different genetic makeup of the parental source populations. Consequently, further research is needed to optimize genomic prediction approaches combining different source populations in barley.

  12. The adsorption of α-amylase on barley proteins affects the in vitro digestion of starch in barley flour.

    Science.gov (United States)

    Yu, Wenwen; Zou, Wei; Dhital, Sushil; Wu, Peng; Gidley, Michael J; Fox, Glen P; Gilbert, Robert G

    2018-02-15

    The conversion of barley starch to sugars is a complex enzymic process. Most previous work concerned the biotechnical aspect of in situ barley enzymes. However, the interactions among the macromolecular substrates and their effects on enzymic catalysis has been little examined. Here, we explore the mechanisms whereby interactions of protein and starch in barley flour affect the kinetics of enzymatic hydrolysis of starch in an in vitro system, using digestion rate data and structural analysis by confocal microscopy. The degradation kinetics of both uncooked barley flour and of purified starches are found to be two-step sequential processes. Barley proteins, especially the water-soluble component, are found to retard the digestion of starch degraded by α-amylase: the enzyme binds with water-insoluble protein and with starch granules, leading to reduced starch hydrolysis. These findings are of potential industrial value in both the brewing and food industries. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Breeding of proanthocyanidin free malting barley

    International Nuclear Information System (INIS)

    Andersen, Anna Maria

    1990-01-01

    Full text: Haze formation in stored beer is due to colloidal precipitation of proteins with polyphenols of which proanthocyanidins are the most important group. 70-80% of proanthocyanidin in beer are from barley malt. Today breweries attain haze stability by using enzymes, additives or adsorbents. A better solution would be to remove proanthocyanidins. Carlsberg Plant Breeding uses induced mutations to breed proanthocyanidin-free malting barley. After mutagen treatment with sodium azide M1 seeds are planted in the field and M2 seeds are harvested in bulk. A single seed, non-destructive method has been developed to identify mutant kernels lacking proanthocyanidins in the testa. The method involves the inclusion of M2 seeds - 50 at a time - in semisolid clay blocks, whereafter a small part of the endosperm, testa and pericarp are exposed by sanding the seeds. The clay block is then placed in a vanillin-HCI solution so that the uncovered tissues can react with the solution. A red colour will develop in the testa of normal seeds, whereas the testa layers of proanthocyanid-free seeds remain colourless. So far, more than 600 mutants have been induced in over 100 barley varieties, spring as well as winter-types, from barley producing areas around the world. The mutants can be assigned to at least 7 loci, all of which can block the biosynthetic pathway for the proanthocyanidins. Mutants in the ant-18 and ant-19 loci show poor kernel development. Only a few mutants are known in the ant-12, ant-22 and ant-25 loci. Breeding work is focussed on mutants belonging to the ant-13 and ant-17 loci. Whereas the malting quality of ant-17 lines suffer from apparent abnormal enzyme development in the aleurone layer, this defect does not exist in ant-13 lines. Brewing trials with proanthocyanidin-free malt have shown excellent haze stability without changes in beer flavour. Breeding work based on the ant-13 lines led to disease resistant lines with good malting quality, while grain yield

  14. Transglycosylation by barley α-amylase 1

    DEFF Research Database (Denmark)

    Mótyán, János A.; Fazekas, Erika; Mori, Haruhide

    2011-01-01

    The transglycosylation activity of barley α-amylase 1 (AMY1) and active site AMY1 subsite mutant enzymes was investigated. We report here the transferase ability of the V47A, V47F, V47D and S48Y single mutants and V47K/S48G and V47G/S48D double mutant AMY1 enzymes in which the replaced amino acid...... DP 2, DP 3 and DP 5 were successfully applied to detect activity of Bacillus stearothermophilus maltogenic α-amylase, human salivary α-amylase and Bacillus licheniformis α-amylase, respectively in a fast and simple fluorometric assay....

  15. Replication of DNA during barley endosperm development

    DEFF Research Database (Denmark)

    Giese, H.

    1992-01-01

    The incorporation of [6-H-3]-thymidine into DNA of developing barley end sperm was examined by autoradiography of cross sections of seeds and DNA analysis. The majority of nuclear divisions took place in the very young endosperm, but as late as 25 days after anthesis there was evidence for DNA...... replication. The DNA content of the endosperm increases during development and in response to nitrogen application in parallel to the storage protein synthesis profile. The hordein genes were hypersensitive to DNase I treatment throughout development....

  16. Quinoxyfen perturbs signal transduction in barley powdery mildew (Blumeria graminis f.sp. hordei).

    Science.gov (United States)

    Wheeler, Ian E; Hollomon, Derek W; Gustafson, Gary; Mitchell, Jon C; Longhurst, Chris; Zhang, Ziguo; Gurr, Sarah J

    2003-05-01

    SUMMARY Quinoxyfen is a protectant fungicide which controls powdery mildew diseases by interfering with germination and/or appressorium formation. Mutants of barley powdery mildew, Blumeria graminis f.sp. hordei, which are resistant to quinoxyfen produce fewer conidia, which germinate and form appressoria more promiscuously than do the prolific numbers of wild-type spores. This suggests that resistance bypasses host recognition signals. RT-PCR profiles of signal transduction genes, recorded during wild-type germling morphogenesis, reveals that quinoxyfen alters the accumulation of Protein Kinase C (pkc), pkc-like and catalytic subunit of Protein Kinase A (cpka) transcripts. Differential display-reverse transcription PCR identified a gene transcript in wild-type conidia that was absent, or much less abundant, in conidia from quinoxyfen-resistant mutants. This mRNA was not detectable 24 h after wild-type conidia were inoculated on to barley. It encodes a GTPase activating protein (GAP), which may interact with a small molecular weight Ras-type GTP binding protein. In the presence of quinoxyfen, the gap mRNA remains throughout germling morphogenesis. The involvement of GAP in resistance suggests that quinoxyfen inhibits mildew infection by disrupting early cell signalling events.

  17. The Importance of Barley Varieties in terms of Production, Marketing and Processing

    Directory of Open Access Journals (Sweden)

    Rahmi Taşcı

    2017-08-01

    Full Text Available In this study, it is aimed to investigate the criteria affecting the marketing of barley in the stages of barley production, marketing and processing in Konya province. In the study; survey results were used which get from mixed feed (37 items and malt factory (1 item, traders (50 items purchasing and selling barley, and agricultural enterprises (107 items including barley production in agricultural activities operating in Konya province. It was determined that barley varieties were not an important criterion in the selling price, while the hectoliter and other plant species do not mix into barley are the main criteria considered by agricultural enterprises to affect the sale of barley. The most important criteria that traders keep in mind when buying barley is hectoliter of barley, which is followed by moisture, colour and foreign matter confusion rate of barley. The most important criteria that factories take into consideration when purchasing barley is determined as the moisture content of the barley, followed by the hectoliter of barley and the rate of foreign matter contamination. For the malt industry; Barley variety is a very important factor in the purchase criteria, followed by barley humidity and colour.

  18. Search for antisense copies of beta-globin mRNA in anemic mouse spleen

    Directory of Open Access Journals (Sweden)

    Taylor John M

    2001-03-01

    Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

  19. Physiological and molecular changes in barley and wheat under salinity.

    Science.gov (United States)

    Temel, Aslihan; Gozukirmizi, Nermin

    2015-03-01

    In this study, it was aimed to compare salinity-induced changes in barley (Hordeum vulgare L. cv. Bornova-92) and bread wheat (Triticum aestivum L. cv. Gerek-79). Seeds were germinated under saline conditions (0, 50, 100, 250, and 500 mM NaCl) for 2 days and recovered under non-saline conditions for 2 days. At the end of the salt treatment, germination, water content (WC), total soluble protein content, and catalase (CAT, EC 1.11.1.6) activity were affected in both species, while superoxide dismutase (SOD, EC 1.15.1.1) activity was affected in barley. Salinity affected WC, protein content, and CAT activity in both species, while it affected germination in barley and affected fresh weight and SOD activity in wheat after recovery. Physiological responses of both species were correlated. Expression of α-tubulin, Atls1, and Lls1 genes was down-regulated in barley after 250 mM NaCl treatment. HVA1 gene was highly (more than 50-fold) stimulated by salinity in barley. However, α-tubulin and Atls1 genes were down-regulated, and Lls1 gene was up-regulated in wheat after recovery from 250-mM NaCl treatment. Increase in HVA1 expression was not significant in wheat. The expression profiles of barley and wheat under salinity are different, and barley tended to regulate gene expression faster than wheat.

  20. Influence of Temperature on the Extractibility of Polysaccharides in Barley

    Directory of Open Access Journals (Sweden)

    Rodica Căpriţă

    2011-10-01

    Full Text Available Barley contains substantial amounts of both soluble and insoluble non-starch polysaccharides (NSP. The main watersoluble NSP in barley are highly viscous β-glucans. Monogastric animals, including humans and birds, cannotsynthesize β-glucanase, and the amount of β-glucanase derived from barley grain and bacteria in the gastrointestinaltract is insufficient to completely hydrolyze β-glucans. In the present investigation, we have studied the influence oftemperature and heating time on the extractibility of soluble polysaccharides in barley. Heating the barley samples at60°C and 80°C before extraction has the effect of lowering the soluble fraction of the polysaccharides. The dynamicviscosity values of water extracts from barley decreased up to 21.68% when heating at 60ºC for 15 minutes, and upto 25.30% when heating at 80ºC for 15 minutes, when the determinations were made immediately after extractseparation. Heating the barley samples for 15 minutes at 80°C deactivates the endogenous hydrolytic enzymes.

  1. DDR complex facilitates global association of RNA polymerase V to promoters and evolutionarily young transposons.

    Science.gov (United States)

    Zhong, Xuehua; Hale, Christopher J; Law, Julie A; Johnson, Lianna M; Feng, Suhua; Tu, Andy; Jacobsen, Steven E

    2012-09-01

    The plant-specific DNA-dependent RNA polymerase V (Pol V) evolved from Pol II to function in an RNA-directed DNA methylation pathway. Here, we have identified targets of Pol V in Arabidopsis thaliana on a genome-wide scale using ChIP-seq of NRPE1, the largest catalytic subunit of Pol V. We found that Pol V is enriched at promoters and evolutionarily recent transposons. This localization pattern is highly correlated with Pol V-dependent DNA methylation and small RNA accumulation. We also show that genome-wide chromatin association of Pol V is dependent on all members of a putative chromatin-remodeling complex termed DDR. Our study presents a genome-wide view of Pol V occupancy and sheds light on the mechanistic basis of Pol V localization. Furthermore, these findings suggest a role for Pol V and RNA-directed DNA methylation in genome surveillance and in responding to genome evolution.

  2. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.

    2005-01-01

    Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active site...

  3. Effects of n-butanol on barley microspore embryogenesis

    DEFF Research Database (Denmark)

    Castillo, Ana Maria; Nielsen, Nanna; Jensen, Anni

    2014-01-01

    Doubled haploid (DH) production is an efficient tool in barley breeding, but efficiency of DH methods is not consistent. Hence, the aim of this study was to study the effect of n-butanol application on DH barley plant production efficiency. Five elite cultivars of barley and thirteen breeding...... plants (from 1.7 to 3 times) in three low-responding cultivars: Albacete, Astoria and Majestic. No significant differences on microspore embryogenesis efficiency were observed in medium and high responding cultivars. The application of n-butanol treatment to isolated microspores from cold treated spikes...

  4. RNA topology

    OpenAIRE

    Frank-Kamenetskii, Maxim D.

    2013-01-01

    A new variety on non-coding RNA has been discovered by several groups: circular RNA (circRNA). This discovery raises intriguing questions about the possibility of the existence of knotted RNA molecules and the existence of a new class of enzymes changing RNA topology, RNA topoisomerases.

  5. Comparison of beer quality attributes between beers brewed with 100% barley malt and 100% barley raw material.

    Science.gov (United States)

    Steiner, Elisabeth; Auer, Andrea; Becker, Thomas; Gastl, Martina

    2012-03-15

    Brewing with 100% barley using the Ondea® Pro exogenous brewing enzyme product was compared to brewing with 100% barley. The use of barley, rather than malt, in the brewing process and the consequences for selected beer quality attributes (foam formation, colloidal stability and filterability, sensory differences, protein content and composition) was considered. The quality attributes of barley, malt, kettle-full-wort, cold wort, unfiltered beer and filtered beer were assessed. A particular focus was given to monitoring changes in the barley protein composition during the brewing process and how the exogenous OndeaPro® enzymes influenced wort protein composition. All analyses were based on standard brewing methods described in ASBC, EBC or MEBAK. To monitor the protein changes two-dimensional polyacrylamide gel electrophoresis was used. It was shown that by brewing beer with 100% barley and an appropriate addition of exogenous Ondea® Pro enzymes it was possible to efficiently brew beer of a satisfactory quality. The production of beers brewed with 100% barley resulted in good process efficiency (lautering and filtration) and to a final product whose sensory quality was described as light, with little body and mouthfeel, very good foam stability and similar organoleptic qualities compared to conventional malt beer. In spite of the sensory evaluation differences could still be seen in protein content and composition. Copyright © 2011 Society of Chemical Industry.

  6. Direct RNA sequencing mediated identification of mRNA localized in protrusions of human MDA-MB-231 metastatic breast cancer cells

    DEFF Research Database (Denmark)

    Jakobsen, Kristine Raaby; Sørensen, Emilie; Brøndum, Karin Kathrine

    2013-01-01

    To describe genome wide RNA localized in protrusions of the metastatic human breast cancer cell line MDA-MB-231 we used Boyden chamber based methodology followed by direct mRNA sequencing. Results In the hereby identified group of protrusion localized mRNA some previously were described to be localized...... localized transcripts represents novel candidates to mediate cancer cell subcellular region specific functions through mRNA direction to protrusions. We included a further characterization of p0071, an armadillo repeat protein of adherence junctions and desmosomes, in MDA-MB-231 and non-metastatic MCF7...... in protrusions of MDA-MB-231 metastatic cancer cells...

  7. Effect of phytase supplementation to barley-canola meal and barley-soybean meal diets on phosphorus and calcium balance in growing pigs

    NARCIS (Netherlands)

    Sauer, W.C.; Cervantes, M.; He, J.M.M.; Schulze, H.

    2003-01-01

    Two metabolism experiments were carried out, to determine the effect of microbial phytase addition to barley-canola meal and barley-soybean meal diets on P and Ca balance in growing. pigs; In experiment 1, six barrows (29.6kg: initial LW) were fed a barley-canola meal diet, without or. with phytase

  8. Rapid cultivar identification of barley seeds through disjoint principal component modeling.

    Science.gov (United States)

    Whitehead, Iain; Munoz, Alicia; Becker, Thomas

    2017-01-01

    Classification of barley varieties is a crucial part of the control and assessment of barley seeds especially for the malting and brewing industry. The correct classification of barley is essential in that a majority of decisions made regarding process specifications, economic considerations, and the type of product produced with the cereal are made based on the barley variety itself. This fact combined with the need to promptly assess the cereal as it is delivered to a malt house or production facility creates the need for a technique to quickly identify a barley variety based on a sample. This work explores the feasibility of differentiating between barley varieties based on the protein spectrum of barley seeds. In order to produce a rapid analysis of the protein composition of the barley seeds, lab-on-a-chip micro fluid technology is used to analyze the protein composition. Classification of the barley variety is then made using disjoint principle component models. This work included 19 different barley varieties. The varieties consisted of both winter and summer barley types. In this work, it is demonstrated that this system can identify the most likely barley variety with an accuracy of 95.9% based on cross validation and can screen summer barley with an accuracy of 95.2% and a false positive rate of 0.0% based on cross validation. This demonstrates the feasibility of the method to provide a rapid and relatively inexpensive method to verify the heritage of barley seeds.

  9. Application of proteomics to investigate barley-Fusarium graminearum interaction

    DEFF Research Database (Denmark)

    Yang, Fen

    that i) spots increasing in intensity in the infected plants included fungal proteins and proteolytic fragments of plant proteins, ii) spots decreasing in intensity contained plant proteins possibly degraded by fungal proteases, iii) greater spot volume changes in response to the fungus were observed......-wall-degrading enzymes and proteases. Besides Tri5 gene, ten selected genes encoding protein expressed in vitro were also expressed in the F. graminearum-infected wheat and barley from 2-6 day after inoculation (dai), suggesting the in vitro proteome approach may be an ideal strategy to discover pathogenicity factors....... In addition, sharper increase in fungal biomass was observed in barley than in wheat and fungal induced proteolytic fragments of - amylases were only observed in barley not in wheat. Furthermore, a barley PR17 protein and a fungal hypothetical protein were expressed in E. coli and purified in Chapter 5...

  10. Conserved Transcriptional Regulatory Programs Underlying Rice and Barley Germination

    Science.gov (United States)

    Lin, Li; Tian, Shulan; Kaeppler, Shawn; Liu, Zongrang; An, Yong-Qiang (Charles)

    2014-01-01

    Germination is a biological process important to plant development and agricultural production. Barley and rice diverged 50 million years ago, but share a similar germination process. To gain insight into the conservation of their underlying gene regulatory programs, we compared transcriptomes of barley and rice at start, middle and end points of germination, and revealed that germination regulated barley and rice genes (BRs) diverged significantly in expression patterns and/or protein sequences. However, BRs with higher protein sequence similarity tended to have more conserved expression patterns. We identified and characterized 316 sets of conserved barley and rice genes (cBRs) with high similarity in both protein sequences and expression patterns, and provided a comprehensive depiction of the transcriptional regulatory program conserved in barley and rice germination at gene, pathway and systems levels. The cBRs encoded proteins involved in a variety of biological pathways and had a wide range of expression patterns. The cBRs encoding key regulatory components in signaling pathways often had diverse expression patterns. Early germination up-regulation of cell wall metabolic pathway and peroxidases, and late germination up-regulation of chromatin structure and remodeling pathways were conserved in both barley and rice. Protein sequence and expression pattern of a gene change quickly if it is not subjected to a functional constraint. Preserving germination-regulated expression patterns and protein sequences of those cBRs for 50 million years strongly suggests that the cBRs are functionally significant and equivalent in germination, and contribute to the ancient characteristics of germination preserved in barley and rice. The functional significance and equivalence of the cBR genes predicted here can serve as a foundation to further characterize their biological functions and facilitate bridging rice and barley germination research with greater confidence. PMID

  11. The Barley Chromosome 5 Linkage Map

    DEFF Research Database (Denmark)

    Jensen, J.; Jørgensen, Jørgen Helms

    1975-01-01

    The distances between nine loci on barley chromosome 5 have been studied in five two-point tests, three three-point tests, and one four-point test. Our previous chromosome 5 linkage map, which contained eleven loci mapped from literature data (Jensen and Jørgensen 1975), is extended with four loci......: wst5 (white streaks), necl (necrotic leaf spots), Ml-nn (powdery mildew resistance), and Pa4 (leaf rust resistance). Further, the two sections of the map are united, and the precision of the map is improved. A system for designating the positions of the loci on the linkage map is proposed. A 0......-position is fixed on the map by a locus (necl), which has a good marker gene located centrally in the linkage group. The positions of the other loci are their distances in centimorgans from the 0-position; loci in the direction of the short chromosome arm are assigned positive values and those...

  12. Weed suppression ability of spring barley varieties

    DEFF Research Database (Denmark)

    Christensen, Svend

    1995-01-01

    Three years of experiments with spring barley showed significant differences in weed suppression ability among varieties. Weed dry matter in the most suppressive variety, Ida, was 48% lower than the mean weed dry matter of all varieties, whereas it was 31% higher in the least suppressive variety......, Grit. Ranking varietal responses to weed competition in terms of grain yield loss corresponded well to ranking weed dry matter produced in crop weed mixtures. There was no correspondence between the varietal grain yields in pure stands and their competitiveness, suggesting that breeding to optimize...... interception model was developed to describe the light interception profiles of the varieties. A study of the estimated parameters showed significant correlation between weed dry matter, rate of canopy height development and the light interception profile. However, when estimates were standardized to eliminate...

  13. High-throughput Agrobacterium-mediated barley transformation

    Directory of Open Access Journals (Sweden)

    Snape John W

    2008-09-01

    Full Text Available Abstract Background Plant transformation is an invaluable tool for basic plant research, as well as a useful technique for the direct improvement of commercial crops. Barley (Hordeum vulgare is the fourth most abundant cereal crop in the world. It also provides a useful model for the study of wheat, which has a larger and more complex genome. Most existing barley transformation methodologies are either complex or have low ( Results A robust, simple and reproducible barley transformation protocol has been developed that yields average transformation efficiencies of 25%. This protocol is based on the infection of immature barley embryos with Agrobacterium strain AGL1, carrying vectors from the pBract series that contain the hpt gene (conferring hygromycin resistance as a selectable marker. Results of large scale experiments utilising the luc (firefly luciferase gene as a reporter are described. The method presented here has been used to produce hundreds of independent, transgenic plant lines and we show that a large proportion of these lines contain single copies of the luc gene. Conclusion This protocol demonstrates significant improvements in both efficiency and ease of use over existing barley transformation methods. This opens up opportunities for the development of functional genomics resources in barley.

  14. ALTERATIONS IN BARLEY PROTEOME UPON FUNGAL INFECTION AND TRICYCLAZOLE TREATMENT

    Directory of Open Access Journals (Sweden)

    Manoj Kumar a,b

    2017-04-01

    Full Text Available The barley proteome was investigated upon fungal infection and subsequent treatment by tricyclazole (TCZ, which is known to have applications in spot blotch disease management in barley.Significantly enhanced chlorophyll content was recorded in TCZ treated plants. The disease severity was significantly reduced after TCZ application in pathogen inoculated plants by reducing the appressoria formation at infection site in barley leaves. Two-dimensional gel electrophoresis (2-DE revealed the expression profile of proteins from (I control plants (healthy barley leaves; application with sterile water,(II plants after foliar application of TCZ (100 µg/ml, (III plants inoculated with B. sorokiniana and (IV plants treated with TCZ (72 h after B. sorokiniana inoculation. A set of 33 proteins expressed differentially after TCZ treatment. Out of this 19 had known functions, while others were unknown or hypothetical proteins. These differentially expressed proteins were related to redox-activity and gene expression, electron transfer,cell division and chromosome partitioning, cell envelop biogenesis, energy metabolism and conversion, respiration and pathogenesis related functions in the barley plants. The study provides a platform and documents the proteins that might be involved in disease management in barley following TCZ application. It is expected that the study will provide boost in understanding proteome regulation upon fungal infection and subsequent anti-fungal treatment and will attract researchers for further validation leading to better pest management.

  15. Nematode assemblages in the rhizosphere of spring barley (Hordeum vulgare L.) depended on fertilisation and plant growth phase

    DEFF Research Database (Denmark)

    Madsen, Mette Vestergård

    2004-01-01

    rhizosphere; nitrogen and phosphorus fertilisation; nematode assemblages; plant parasites; barley......rhizosphere; nitrogen and phosphorus fertilisation; nematode assemblages; plant parasites; barley...

  16. HvPap-1 C1A Protease Participates Differentially in the Barley Response to a Pathogen and an Herbivore

    Directory of Open Access Journals (Sweden)

    Mercedes Diaz-Mendoza

    2017-09-01

    Full Text Available Co-evolutionary processes in plant–pathogen/herbivore systems indicate that protease inhibitors have a particular value in biotic interactions. However, little is known about the defensive role of their targets, the plant proteases. C1A cysteine proteases are the most abundant enzymes responsible for the proteolytic activity during different processes like germination, development and senescence in plants. To identify and characterize C1A cysteine proteases of barley with a potential role in defense, mRNA and protein expression patterns were analyzed in response to biotics stresses. A barley cysteine protease, HvPap-1, previously related to abiotic stresses and grain germination, was particularly induced by flagellin or chitosan elicitation, and biotic stresses such as the phytopathogenic fungus Magnaporthe oryzae or the phytophagous mite Tetranychus urticae. To elucidate the in vivo participation of this enzyme in defense, transformed barley plants overexpressing or silencing HvPap-1 encoding gene were subjected to M. oryzae infection or T. urticae infestation. Whereas overexpressing plants were less susceptible to the fungus than silencing plants, the opposite behavior occurred to the mite. This unexpected result highlights the complexity of the regulatory events leading to the response to a particular biotic stress.

  17. A high throughput barley stripe mosaic virus vector for virus induced gene silencing in monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Cheng Yuan

    Full Text Available Barley stripe mosaic virus (BSMV is a single-stranded RNA virus with three genome components designated alpha, beta, and gamma. BSMV vectors have previously been shown to be efficient virus induced gene silencing (VIGS vehicles in barley and wheat and have provided important information about host genes functioning during pathogenesis as well as various aspects of genes functioning in development. To permit more effective use of BSMV VIGS for functional genomics experiments, we have developed an Agrobacterium delivery system for BSMV and have coupled this with a ligation independent cloning (LIC strategy to mediate efficient cloning of host genes. Infiltrated Nicotiana benthamiana leaves provided excellent sources of virus for secondary BSMV infections and VIGS in cereals. The Agro/LIC BSMV VIGS vectors were able to function in high efficiency down regulation of phytoene desaturase (PDS, magnesium chelatase subunit H (ChlH, and plastid transketolase (TK gene silencing in N. benthamiana and in the monocots, wheat, barley, and the model grass, Brachypodium distachyon. Suppression of an Arabidopsis orthologue cloned from wheat (TaPMR5 also interfered with wheat powdery mildew (Blumeria graminis f. sp. tritici infections in a manner similar to that of the A. thaliana PMR5 loss-of-function allele. These results imply that the PMR5 gene has maintained similar functions across monocot and dicot families. Our BSMV VIGS system provides substantial advantages in expense, cloning efficiency, ease of manipulation and ability to apply VIGS for high throughput genomics studies.

  18. The role of the HvNAC6 transcription factor in response to biotic and abiotic stress in barley

    DEFF Research Database (Denmark)

    Chen, Yan-Jun

    the study of barley HvNAC6 TF in the barleyBlumeria graminis f. sp. hordei (Bgh) interaction and in relation to drought response. A reverse genetic approach was used to generate stable knock-down barley plants by RNA-interference (RNAi). Therefore, HvNAC6 RNAi plants generated by Agrobacterium......-mediated transformation methods could be used to study stress responses at the whole-plant level. The abscisic acid (ABA) and salicylic acid (SA) levels were measured during Bgh infection to investigate the involvement of these hormones and TF in the basal resistance. HvNAC6 RNAi plants were also subjected to dehydration....... Gene expression analysis was used to investigate the interaction of ABA and HvNAC6in response to drought stress. Recognition sequences in the promoter region of HvNAC6 were identified to gain insight into the regulation of HvNAC6. Thus, HvNAC6 promoter fused with GUS reporter transgenic plants were...

  19. Effect of Supplemental Dietary Fat and Processed Barley Grain on Performance of Lactating Dairy Cow

    Directory of Open Access Journals (Sweden)

    Y.A Alijoo

    2012-02-01

    Full Text Available The effect of barley grain processing and source of supplemental fat on performance of lactating dairy cows were studied in a replicated 4 × 4 Latin square design with 21-d periods and a 2 × 2 factorial arrangement. Eight Holstein cows with mean body weight (BW of 572 ± 71 kg and 45 ± 10 days in milk were allocated to 4 dietary treatments including 1 ground barley with cottonseed 2 pelleted barley with cottonseed 3 ground barley with canola seed 4 pelleted barley with canola seed. The nitrogen intake and fecal N were higher in cows fed ground barley in comparison with those fed pelleted barley. Source of supplemental fat or barley processing had no effect on milk fat and milk protein contents. Milk SNF yield was higher in cows fed canola as supplemental fat source and ground barley (P < 0.05. Milk yield was affected by method of barley grain processing and was 0.64 to 1.9 kg/d higher in cows fed ground barley compared with those fed pelleted barley (P = 0.04. Plasma concentrations of glucose, NEFA, BHBA, cholesterol, triglycerides and blood urea nitrogen were similar in all treatments. Dry matter intake was affected by barley grain processing. The cows fed ground barley consuming 1.15 to 2.18 kg/d more DM compared with those fed pelleted barley (P = 0.04.Total tract digestibilities of DM, crude fat, ADF, NDF and OM were not affected by the barley grain processing as well as source of oilseed. The results indicated that interactions between barley grain processing and source of supplemental dietary fat can improve the performance of lactating dairy cows, However, more detailed studies are required

  20. Effect of partially replacing a barley-based concentrate with flaxseed-based products on the rumen bacterial population of lactating Holstein dairy cows.

    Science.gov (United States)

    Castillo-Lopez, E; Moats, J; Aluthge, N D; Ramirez Ramirez, H A; Christensen, D A; Mutsvangwa, T; Penner, G B; Fernando, S C

    2018-01-01

    The effects of partial replacement of a barley-based concentrate with flaxseed-based products on the rumen bacterial population of lactating Holstein dairy cows were evaluated. Treatments fed were CONT, a normal diet that included barley silage, alfalfa hay and a barley-based concentrate that contained no flaxseed or faba beans; FLAX, inclusion of a nonextruded flaxseed-based product containing 55·0% flaxseed, 37·8% field peas and 6·9% alfalfa; EXT, similar to FLAX, but the product was extruded and EXTT, similar to FLAX, but product was extruded and field peas were replaced by high-tannin faba beans. The rumen bacterial population was evaluated by utilizing 16S rRNA gene sequencing. Most abundant phyla, families and genera were unaffected. However, some taxa were affected; for example, unsaturated fatty acid content was negatively correlated with Clostridiaceae, and tannin content was negatively correlated with BS11 and Paraprevotellaceae. Predominant rumen bacterial taxa were not affected, but the abundance of some taxa found in lower proportions shifted, possibly due to sensitivity to unsaturated fatty acids or tannins. Flaxseed-based products were effective for partially replacing barley-based concentrate in rations of lactating dairy cows. No negative effects of these products were observed on the abundance of predominant rumen bacterial taxa, with only minor shifts in less abundant bacteria. © 2017 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.

  1. The miR9863 family regulates distinct Mla alleles in barley to attenuate NLR receptor-triggered disease resistance and cell-death signaling.

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2014-12-01

    Full Text Available Barley (Hordeum vulgare L. Mla alleles encode coiled-coil (CC, nucleotide binding, leucine-rich repeat (NB-LRR receptors that trigger isolate-specific immune responses against the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh. How Mla or NB-LRR genes in grass species are regulated at post-transcriptional level is not clear. The microRNA family, miR9863, comprises four members that differentially regulate distinct Mla alleles in barley. We show that miR9863 members guide the cleavage of Mla1 transcripts in barley, and block or reduce the accumulation of MLA1 protein in the heterologous Nicotiana benthamiana expression system. Regulation specificity is determined by variation in a unique single-nucleotide-polymorphism (SNP in mature miR9863 family members and two SNPs in the Mla miR9863-binding site that separates these alleles into three groups. Further, we demonstrate that 22-nt miR9863s trigger the biogenesis of 21-nt phased siRNAs (phasiRNAs and together these sRNAs form a feed-forward regulation network for repressing the expression of group I Mla alleles. Overexpression of miR9863 members specifically attenuates MLA1, but not MLA10-triggered disease resistance and cell-death signaling. We propose a key role of the miR9863 family in dampening immune response signaling triggered by a group of MLA immune receptors in barley.

  2. Towards systems genetic analyses in barley: Integration of phenotypic, expression and genotype data into GeneNetwork

    Directory of Open Access Journals (Sweden)

    Druka Arnis

    2008-11-01

    Full Text Available Abstract Background A typical genetical genomics experiment results in four separate data sets; genotype, gene expression, higher-order phenotypic data and metadata that describe the protocols, processing and the array platform. Used in concert, these data sets provide the opportunity to perform genetic analysis at a systems level. Their predictive power is largely determined by the gene expression dataset where tens of millions of data points can be generated using currently available mRNA profiling technologies. Such large, multidimensional data sets often have value beyond that extracted during their initial analysis and interpretation, particularly if conducted on widely distributed reference genetic materials. Besides quality and scale, access to the data is of primary importance as accessibility potentially allows the extraction of considerable added value from the same primary dataset by the wider research community. Although the number of genetical genomics experiments in different plant species is rapidly increasing, none to date has been presented in a form that allows quick and efficient on-line testing for possible associations between genes, loci and traits of interest by an entire research community. Description Using a reference population of 150 recombinant doubled haploid barley lines we generated novel phenotypic, mRNA abundance and SNP-based genotyping data sets, added them to a considerable volume of legacy trait data and entered them into the GeneNetwork http://www.genenetwork.org. GeneNetwork is a unified on-line analytical environment that enables the user to test genetic hypotheses about how component traits, such as mRNA abundance, may interact to condition more complex biological phenotypes (higher-order traits. Here we describe these barley data sets and demonstrate some of the functionalities GeneNetwork provides as an easily accessible and integrated analytical environment for exploring them. Conclusion By

  3. Molecular characterization of barley 3H semi-dwarf genes.

    Directory of Open Access Journals (Sweden)

    Haobing Li

    Full Text Available The barley chromosome 3H accommodates many semi-dwarfing genes. To characterize these genes, the two-rowed semi-dwarf Chinese barley landrace 'TX9425' was crossed with the Australian barley variety 'Franklin' to generate a doubled haploid (DH population, and major QTLs controlling plant height have been identified in our previous study. The major QTL derived from 'TX9425' was targeted to investigate the allelism of the semi-dwarf gene uzu in barley. Twelve sets of near-isogenic lines and a large NILF2 fine mapping population segregating only for the dwarfing gene from 'TX9425' were developed. The semi-dwarfing gene in 'TX9425' was located within a 2.8 cM region close to the centromere on chromosome 3H by fine mapping. Molecular cloning and sequence analyses showed that the 'TX9425'-derived allele contained a single nucleotide substitution from A to G at position 2612 of the HvBRI1 gene. This was apparently the same mutation as that reported in six-rowed uzu barley. Markers co-segregating with the QTL were developed from the sequence of the HvBRI1 gene and were validated in the 'TX9425'/'Franklin' DH population. The other major dwarfing QTL derived from the Franklin variety was distally located on chromosome 3HL and co-segregated with the sdw1 diagnostic marker hv20ox2. A third dwarfing gene, expressed only in winter-sown trials, was identified and located on chromosome 3HS. The effects and interactions of these dwarfing genes under different growing conditions are discussed. These results improve our understanding of the genetic mechanisms controlling semi-dwarf stature in barley and provide diagnostic markers for the selection of semi-dwarfness in barley breeding programs.

  4. microRNAs participate in gene expression regulation and phytohormone cross-talk in barley embryo during seed development and germination.

    Science.gov (United States)

    Bai, Bin; Shi, Bo; Hou, Ning; Cao, Yanli; Meng, Yijun; Bian, Hongwu; Zhu, Muyuan; Han, Ning

    2017-09-06

    Small RNA and degradome sequencing have identified a large number of miRNA-target pairs in plant seeds. However, detailed spatial and temporal studies of miRNA-mediated regulation, which can reflect links between seed development and germination are still lacking. In this study, we extended our investigation on miRNAs-involved gene regulation by a combined analysis of seed maturation and germination in barley. Through bioinformatics analysis of small RNA sequencing data, a total of 1324 known miRNA families and 448 novel miRNA candidates were identified. Of those, 16 known miRNAs with 40 target genes, and three novel miRNAs with four target genes were confirmed based on degradome sequencing data. Conserved miRNA families such as miR156, miR168, miR166, miR167, and miR894 were highly expressed in embryos of developing and germinating seeds. A barley-specific miRNA, miR5071, which was predicted to target an OsMLA10-like gene, accumulated at a high level, suggesting its involvement in defence response during these two developmental stages. Based on target prediction and Kyoto Encyclopedia of Genes and Genomes analysis of putative targets, nine highly expressed miRNAs were found to be related to phytohormone signalling and hormone cross-talk. Northern blot and qRT-PCR analysis showed that these miRNAs displayed differential expression patterns during seed development and germination, indicating their different roles in hormone signalling pathways. In addition, we showed that miR393 affected seed development through targeting two genes encoding the auxin receptors TIR1/AFBs in barley, as over-expression of miR393 led to an increased length-width ratio of seeds, whereas target mimic (MIM393)-mediated inhibition of its activity decreased the 1000-grain weight of seeds. Furthermore, the expression of auxin-responsive genes, abscisic acid- and gibberellic acid-related genes was altered in miR393 misexpression lines during germination and early seedling growth. Our work

  5. Specificity and levels of nonhost resistance to nonadapted Blumeria graminis forms in barley

    NARCIS (Netherlands)

    Aghnoum, R.; Niks, R.E.

    2010-01-01

    • The genetic basis of nonhost resistance of barley to nonadapted formae speciales of Blumeria graminis is not known, as there is no barley line that is susceptible to these nonadapted formae speciales, such as the wheat powdery mildew pathogen, Blumeria graminis f.sp. tritici (Bgt). • Barley

  6. Effects of Net Blotch ( Pyrenophora teres ) on Malt Barley Yield and ...

    African Journals Online (AJOL)

    Barley (Hordeum vulgare L.) production is constrained by diseases such as net blotch caused by Pyrenophora teres Drechsl. The objectives of this study were to assess the effects of net blotch disease on malt barley yield and grain quality under natural infection. Four malt barley varieties (Beka, HB 120, HB 52 and Holker), ...

  7. Effect of Different Levels of Germinated Barley on Live Performance and Carcass Traits in Broiler Chickens

    Directory of Open Access Journals (Sweden)

    Dastar B

    2014-06-01

    Full Text Available An experiment was conducted to evaluate the effect of different levels of germinated barley (GB on live performance and carcass traits in broiler chickens. The experiment lasted for 5 weeks starting from 7 days of age and ending at 42 days of age. Chicks (Ross 308 were fed six dietary treatments including a corn–soy diet (corn diet, a barley–soy diet (barley diet, a barley diet plus enzymes (enzyme barley diet, and 3 other diets in which GB was replaced with barley at levels of 33%, 66%, and 100% in the barley diet (33% GB diet, 66% GB diet, and GB diet, respectively. Data were analyzed in a completely randomized design. Results indicated that birds fed a barley diet had significantly lower performance than those fed other diets (P. Supplementing of the barley diet with β-glucanase enzyme as well as replacing GB with barley improved the performance of broilers. Birds fed a GB diet had a significantly higher carcass yield those fed other diets (P. The lowest abdominal fat percentage was observed in birds fed a barley diet or a corn diet. Thus, it is concluded that replacing GB with barley, especially at 33% level, is more effective than supplementing barley diets with β-glucanase enzyme in improving live performance of broiler chickens.

  8. Fusarium infection and trichothecenes in barley and its comparison with wheat

    NARCIS (Netherlands)

    Janssen, E.M.; Liu, C.; Fels, van der H.J.

    2018-01-01

    Barley is a small-grain cereal that can be infected by Fusarium spp. resulting in reduced quality and safety of harvested barley (products). Barley and other small-grain cereals are commonly studied together for Fusarium infection and related mycotoxin contamination, since the infection and its

  9. Aggressiveness of powdery mildew on 'ml-o'- resistant barley

    International Nuclear Information System (INIS)

    Andersen, Lars

    1990-01-01

    The ml-o genes in barley are important sources in breeding for resistance against the barley powdery mildew fungus (Erysiphe graminis). The resistance mechanism is a rapid formation of a large callose containing cell wall apposition at the site of the pathogen's infection attempt. This reduces the chances of infection to almost nil in all epidermal cells, except in the small subsidiary cells, in which appositions are rarely formed. Small mildew colonies from infections in subsidiary cells may be seen on the otherwise resistant leaf. This is described by the infection type 0/(4). Mildew isolate HL 3 selected by SCHWARZBACH has increased aggressiveness. No ml-o-virulent isolates are known. However, ml-o-resistant varieties when grown extensively in Europe, will introduce field selection for mildew pathotypes with aggressiveness or virulence to ml-o resistance. Studies on increased aggressiveness require new methods. The material comprises two powdery mildew isolates: GE 3 without ml-o aggressiveness and the aggressive HL 3/5; and two near-isogenic barley lines in Carlsberg II: Riso 5678(R) with the recessive mutant resistance gene ml-o5 and Riso 5678(S) with the wild-type gene for susceptibility. Latent period and disease efficiency show no significant differences between the two isolates on the susceptible barley line (S) but the isolates differ from each other on the resistant barley line

  10. Identification of a phytase gene in barley (Hordeum vulgare L..

    Directory of Open Access Journals (Sweden)

    Fei Dai

    Full Text Available BACKGROUND: Endogenous phytase plays a crucial role in phytate degradation and is thus closely related to nutrient efficiency in barley products. The understanding of genetic information of phytase in barley can provide a useful tool for breeding new barley varieties with high phytase activity. METHODOLOGY/PRINCIPAL FINDINGS: Quantitative trait loci (QTL analysis for phytase activity was conducted using a doubled haploid population. Phytase protein was purified and identified by the LC-ESI MS/MS Shotgun method. Purple acid phosphatase (PAP gene was sequenced and the position was compared with the QTL controlling phytase activity. A major QTL for phytase activity was mapped to chromosome 5 H in barley. The gene controlling phytase activity in the region was named as mqPhy. The gene HvPAP a was mapped to the same position as mqPhy, supporting the colinearity between HvPAP a and mqPhy. CONCLUSIONS/SIGNIFICANCE: It is the first report on QTLs for phytase activity and the results showed that HvPAP a, which shares a same position with the QTL, is a major phytase gene in barley grains.

  11. RNA Crystallization

    Science.gov (United States)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  12. 11C-methionine translocation in barley

    International Nuclear Information System (INIS)

    Nakanishi, Hiromi; Bughio, Naimatullah; Shigeta Ishioka, Noriko

    2000-01-01

    11 C-methionine was supplied to barley plants through a single leaf or via the roots and real time 11 C movement was monitored using a PETIS (positron emitting tracer imaging system). In Fe-deficient plants, 11 C-methionine was translocated from the tip of the absorbing leaf to the discrimination center' at the basal part of the shoot and then retranslocated to all the chlorotic leaves, while a negligible amount was retranslocated to the roots. In Fe-sufficient plants, methionine was translocated from the absorbing leaf to the discrimination center and then only to the newest leaf on the main shoot. A negligible amount was also retranslocated to the roots. Although, in Fe-sufficient plants, methionine translocation was observed from absorbing roots to shoots, in Fe-deficient plants, only a little amount was translocated from roots to shoots. In conclusion, methionine from the upper portion of a plant is not used as a precursor of mugineic acid under Fe-deficiency conditions. (author)

  13. The Genetic Architecture of Barley Plant Stature

    Science.gov (United States)

    Alqudah, Ahmad M.; Koppolu, Ravi; Wolde, Gizaw M.; Graner, Andreas; Schnurbusch, Thorsten

    2016-01-01

    Plant stature in temperate cereals is predominantly controlled by tillering and plant height as complex agronomic traits, representing important determinants of grain yield. This study was designed to reveal the genetic basis of tillering at five developmental stages and plant height at harvest in 218 worldwide spring barley (Hordeum vulgare L.) accessions under greenhouse conditions. The accessions were structured based on row-type classes [two- vs. six-rowed] and photoperiod response [photoperiod-sensitive (Ppd-H1) vs. reduced photoperiod sensitivity (ppd-H1)]. Phenotypic analyses of both factors revealed profound between group effects on tiller development. To further verify the row-type effect on the studied traits, Six-rowed spike 1 (vrs1) mutants and their two-rowed progenitors were examined for tiller number per plant and plant height. Here, wild-type (Vrs1) plants were significantly taller and had more tillers than mutants suggesting a negative pleiotropic effect of this row-type locus on both traits. Our genome-wide association scans further revealed highly significant associations, thereby establishing a link between the genetic control of row-type, heading time, tillering, and plant height. We further show that associations for tillering and plant height are co-localized with chromosomal segments harboring known plant stature-related phytohormone and sugar-related genes. This work demonstrates the feasibility of the GWAS approach for identifying putative candidate genes for improving plant architecture. PMID:27446200

  14. Chemical weed control in barley (hordeum vulgare)

    International Nuclear Information System (INIS)

    Sarwar, M.; Hassan, S.W.; Abid, A.A.

    2008-01-01

    Effect of two different pre-emergence herbicides i.e. Terbutryn (lgron-500FW) A, 1.01.25 kg a.t. ha/sup -1/ and Flurochloridone (Racer-25 CS) a 0.31, 0.37, 0.44, 0.50 and 0.56 Kg a.i. ha/sup -1/ on weeds and yield of barley wad studied under field conditions hb/sup -1/. All the herbicides significantly reduce the dry weight of weed Maximum reduction (70%) was observed in terbutryn a 1.0 Kg a.i. ha/sup -1/ Growth and yield parameters like number of spike lets per spike. Number of grams per spike. 1000-grain weight. Biological yield. Grain yield straw yield and harvest index showed significant response to various herbicides doses under study. Application of Flurochloridone (Racer-25 (CS) a 0.44 kg a.i. ha/sup -1/ and Terbutryn (lgran-500 FW) a 1.0 kg a.i). The data further revealed that in general all herbicide application treatments exhibited superior performance in respect of growth and yield over control. (author)

  15. Barley yellow dwarf virus in barley crops in Tunisia: prevalence and molecular characterization

    Directory of Open Access Journals (Sweden)

    Asma NAJAR

    2017-05-01

    Full Text Available A field survey was conducted in Tunisia in the North-Eastern regions (Bizerte, CapBon and Zaghouan, the North-Western region (Kef and the Central-Eastern region (Kairouan during the 2011/2012 growing season, in order to determine the incidence and the geographic distribution of Barley yellow dwarf virus (BYDVs in barley fields. Tissue blot immunoassays (TBIA showed that BYDV was most common in Zaghouan (incidence 14%, Cap Bon (14% and Bizerte (35%, in randomly collected samples from these three locations.Among the different BYDVs identified, BYDV-PAV (64% was the most common followed by BYDV-MAV (16% and CYDV-RPV (3%. The coat protein gene sequences of six isolates collected from different regions shared >98% pairwise similarity. In comparisons with other BYDV sequences from around the world, the Tunisian sequences shared greatest homology with isolates 109 and ASL1 from the United States of America and Germany (≈97%, and <90% with all other isolate sequences available in public databases.

  16. Down-regulation of the glucan synthase-like 6 gene (HvGsl6) in barley leads to decreased callose accumulation and increased cell wall penetration by Blumeria graminis f. sp. hordei.

    Science.gov (United States)

    Chowdhury, Jamil; Schober, Michael S; Shirley, Neil J; Singh, Rohan R; Jacobs, Andrew K; Douchkov, Dimitar; Schweizer, Patrick; Fincher, Geoffrey B; Burton, Rachel A; Little, Alan

    2016-10-01

    The recent characterization of the polysaccharide composition of papillae deposited at the barley cell wall during infection by the powdery mildew pathogen, Blumeria graminis f. sp. hordei (Bgh), has provided new targets for the generation of enhanced disease resistance. The role of callose in papilla-based penetration resistance of crop species is largely unknown because the genes involved in the observed callose accumulation have not been identified unequivocally. We have employed both comparative and functional genomics approaches to identify the functional orthologue of AtGsl5 in the barley genome. HvGsl6 (the barley glucan synthase-like 6 gene), which has the highest sequence identity to AtGsl5, is the only Bgh-induced gene among the HvGsls examined in this study. Through double-stranded RNA interference (dsRNAi)-mediated silencing of HvGsl6, we have shown that the down-regulation of HvGsl6 is associated with a lower accumulation of papillary and wound callose and a higher susceptibility to penetration of the papillae by Bgh, compared with control lines. The results indicate that the HvGsl6 gene is a functional orthologue of AtGsl5 and is involved in papillary callose accumulation in barley. The increased susceptibility of HvGsl6 dsRNAi transgenic lines to infection indicates that callose positively contributes to the barley fungal penetration resistance mechanism. © 2016 University of Adelaide. New Phytologist © 2016 New Phytologist Trust.

  17. The Plant Host Can Affect the Encapsidation of Brome Mosaic Virus (BMV) RNA; BMV Virions Are Surprisingly Heterogeneous

    Science.gov (United States)

    Ni, Peng; Vaughan, Robert C.; Tragesser, Brady; Hoover, Haley; Kao, C. Cheng

    2013-01-01

    Brome mosaic virus (BMV) packages its genomic and subgenomic RNAs into three separate viral particles. BMV purified from barley, wheat and tobacco have distinct relative abundances of the encapsidated RNAs. We seek to identify the basis for the host-dependent differences in viral RNA encapsidation. Sequencing of the viral RNAs revealed recombination events in the 3′ untranslated region of RNA1 of BMV purified from barley and wheat, but not from tobacco. However, the relative amounts of the BMV RNAs that accumulated in barley and wheat are similar and RNA accumulation is not sufficient to account for the difference in RNA encapsidation. Virions purified from barley and wheat were found to differ in their isoelectric points, resistance to proteolysis, and contacts between the capsid residues and the RNA. Mass spectrometric analyses revealed that virions from the three hosts had different post-translational modifications that should impact the physiochemical properties of the virions. Another major source of variation in RNA encapsidation was due to the purification of BMV particles to homogeneity. Highly enriched BMV present in lysates had a surprising range of sizes, buoyant densities, and distinct relative amounts of encapsidated RNAs. These results show that the encapsidated BMV RNAs reflect a combination of host effects on the physiochemical properties of the viral capsids and the enrichment of a subset of virions. The previously unexpected heterogeneity in BMV should influence the timing of the infection and also the host innate immune responses. PMID:24036424

  18. The plant host can affect the encapsidation of brome mosaic virus (BMV) RNA: BMV virions are surprisingly heterogeneous.

    Science.gov (United States)

    Ni, Peng; Vaughan, Robert C; Tragesser, Brady; Hoover, Haley; Kao, C Cheng

    2014-03-06

    Brome mosaic virus (BMV) packages its genomic and subgenomic RNAs into three separate viral particles. BMV purified from barley, wheat, and tobacco have distinct relative abundances of the encapsidated RNAs. We seek to identify the basis for the host-dependent differences in viral RNA encapsidation. Sequencing of the viral RNAs revealed recombination events in the 3' untranslated region of RNA1 of BMV purified from barley and wheat, but not from tobacco. However, the relative amounts of the BMV RNAs that accumulated in barley and wheat are similar and RNA accumulation is not sufficient to account for the difference in RNA encapsidation. Virions purified from barley and wheat were found to differ in their isoelectric points, resistance to proteolysis, and contacts between the capsid residues and the RNA. Mass spectrometric analyses revealed that virions from the three hosts had different post-translational modifications that should impact the physiochemical properties of the virions. Another major source of variation in RNA encapsidation was due to the purification of BMV particles to homogeneity. Highly enriched BMV present in lysates had a surprising range of sizes, buoyant densities, and distinct relative amounts of encapsidated RNAs. These results show that the encapsidated BMV RNAs reflect a combination of host effects on the physiochemical properties of the viral capsids and the enrichment of a subset of virions. The previously unexpected heterogeneity in BMV should influence the timing of the infection and also the host innate immune responses. © 2013.

  19. Improvement of quinoa and barley through induced mutations and biotechnology

    International Nuclear Information System (INIS)

    Siles, A.Z.; Miranda, L.S.

    2001-01-01

    The main cropping problems in the Bolivian highlands are the long growing period of barley, high degree of environmental influence on the performance of quinoa, and low soil moisture at sowing time, leading to low germination rate and poor stands, and frost or chilling damages. The program aimed to establish protocols for induction of mutations with X rays and chemical mutagens (NaN 3 , MNH, EMS) in quinoa, barley, native forage species and forest plants and to obtain mutant lines, especially in barley and quinoa; and to establish callus regeneration in quinoa and micropropagation of kenua (Polilepis). The project is still in its study stages, hence further evaluations are needed before firm conclusions are drawn. (author)

  20. Microgeographic Edaphic Differentiation in Hordein Polymorphisms of Wild Barley

    DEFF Research Database (Denmark)

    Nevo, E.; Beiles, A.; Storch, N.

    1983-01-01

    Genetic diversity in the storage protein hordein encoded by two loci, Horl and Hor2, was analyzed electrophoretically in seeds from 123 individual plants of wild barley, Hordeum spontaneum, the progenitor of cultivated barley. The test was conducted in two topographically different 100 meter...... transects in Israel, each equally divided into basalt and terra rossa soil types. Altogether 15 Horl and 16 Hor2 phenotypes were detected; 7 phenotypes in Horl and 5 in Hor2 were common. Significant differentiation of both Horl and Hor2 phenotypes and their associations was found with soil type...... and topography. Likewise, significant correlations were found between hordein phenotypes and allozyme types detected in a previous study. Our results suggest that at least part of the hordein polymorphisms in wild barley is adaptive and selected by soil and topographic differences over very short distances....

  1. RNA Origami

    DEFF Research Database (Denmark)

    Sparvath, Steffen Lynge

    introducerede vores gruppe den enkeltstrengede RNA-origami metode, der giver mulighed for cotranscriptional foldning af veldefinerede nanostrukturer, og er en central del af arbejdet præsenteret heri. Denne ph.d.-afhandling udforsker potentielle anvendelser af RNA-origami nanostrukturer, som nanomedicin eller...... biosensorer. Afhandlingen består af en introduktion til RNA-nanoteknologi feltet, en introduktion af enkeltstrenget RNA-origami design, og fire studier, der beskriver design, produktion og karakterisering af både strukturelle og funktionelle RNA-origamier. Flere RNA-origami designs er blevet undersøgt, og...... projekterne, der indgår i denne afhandling, inkluderer de nyeste fremskridt indenfor strukturel RNA-nanoteknologi og udvikling af funktionelle RNA-baserede enheder. Det første studie beskriver konstruktion og karakterisering af en enkeltstrenget 6-helix RNA-origami stuktur, som er den første demonstration af...

  2. INVITRO DIGESTIBILITY OF PROTEIN FROM BARLEY AND OTHER CEREALS

    DEFF Research Database (Denmark)

    Buchmann, N. B.

    1979-01-01

    An in vitro method for measuring barley protein digestibility is presented. Samples were first incubated with pepsin in HCl; pancreatin was then added concomitantly with a bacteriostatic borate buffer. After TCA-precipitation, soluble nitrogen was measured. The digestion was unaffected by accumul......An in vitro method for measuring barley protein digestibility is presented. Samples were first incubated with pepsin in HCl; pancreatin was then added concomitantly with a bacteriostatic borate buffer. After TCA-precipitation, soluble nitrogen was measured. The digestion was unaffected...

  3. Barley starch bioengineering for high phosphate and amylose

    DEFF Research Database (Denmark)

    Blennow, Per Gunnar Andreas; Carciofi, Massimiliano; Shaik, Shahnoor Sultana

    2011-01-01

    Starch is a biological polymer that can be industrially produced in massive amounts in a very pure form. Cereals is the main source for starch production and any improvement of the starch fraction can have a tremendous impact in food and feed applications. Barley ranks number four among cereal...... of the three genes encoding the starch-branching enzymes SBEI, SBEIIa, and SBEIIb using a triple RNAi chimeric hairpin construct we generated a virtually amylopectin-free barley. The grains of the transgenic lines were shrunken and had a yield of around 80% of the control line. The starch granules were...

  4. Biotin Carboxyl Carrier Protein in Barley Chloroplast Membranes

    DEFF Research Database (Denmark)

    Kannangara, C. G.; Jense, C J

    1975-01-01

    Biotin localized in barley chloroplast lamellae is covalently bound to a single protein with an approximate molecular weight of 21000. It contains one mole of biotin per mole of protein and functions as a carboxyl carrier in the acetyl-CoA carboxylase reaction. The protein was obtained...... by solubilization of the lamellae in phenol/acetic acid/8 M urea. Feeding barley seedlings with [14C]-biotin revealed that the vitamin is not degraded into respiratory substrates by the plant, but is specifically incorporated into biotin carboxyl carrier protein....

  5. The experience of induction of mutation on barley in Peru

    International Nuclear Information System (INIS)

    Romero Loli, M.; Pozo Cardenas, M.; Gomez Pando, L.

    1984-01-01

    Work on induced mutation of barley was started in 1978 under the Programme of Cereal Improvement. Barley was irradiated with gamma radiation at doses of 12, 15, 18, 21, and 24 Krad. Radiation doses of 18 and 21 Krad gave the highest frequency of albino and cloroticos mutants. Induced mutation is being carried out in different parts of the country to develop mutants having early germination property. These mutants will play an important role in the late cultivation in the mountain areas of Peru

  6. In Situ Localization of Barley Yellow Dwarf Virus-PAV 17-kDa Protein and Nucleic Acids in Oats.

    Science.gov (United States)

    Nass, P H; Domier, L L; Jakstys, B P; D'Arcy, C J

    1998-10-01

    ABSTRACT Barley yellow dwarf virus strain PAV (BYDV-PAV) RNA and the 17-kDa protein were localized in BYDV-PAV-infected oat cells using in situ hybridization and in situ immunolocalization assays, respectively. The in situ hybridization assay showed labeling of filamentous material in the nucleus, cytoplasm, and virus-induced vesicles with both sense and antisense nucleic acid probes, suggesting that the filamentous material found in BYDV-PAV-infected cells contains viral RNA. BYDV-PAV negative-strand RNA was detected before virus particles were observed, which indicates that RNA replication is initiated before synthesis of viral coat protein in the cytoplasm. The 17-kDa protein was associated with filamentous material in the cytoplasm, nucleus, and virus-induced vesicles. The labeling densities observed using antibodies against the 17-kDa protein were similar in the nucleus and cytoplasm. No labeling of the 17-kDa protein was observed in plasmodesmata, but filaments in the nuclear pores occasionally were labeled. Since BYDV-PAV RNA and 17-kDa protein colocalized within infected cells, it is possible that single-stranded viral RNA is always associated with the 17-kDa protein in vivo. The 17-kDa protein may be required for viral nucleic acid filaments to traverse the nuclear membrane or other membrane systems.

  7. Human 2'-phosphodiesterase localizes to the mitochondrial matrix with a putative function in mitochondrial RNA turnover

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave; Andersen, Kasper Røjkjær; Kjær, Karina Hansen

    2011-01-01

    . Interestingly, 2′-PDE shares both functionally and structurally characteristics with the CCR4-type exonuclease–endonuclease–phosphatase family of deadenylases. Here we show that 2′-PDE locates to the mitochondrial matrix of human cells, and comprise an active 3′–5′ exoribonuclease exhibiting a preference...... for oligo-adenosine RNA like canonical cytoplasmic deadenylases. Furthermore, we document a marked negative association between 2′-PDE and mitochondrial mRNA levels following siRNA-directed knockdown and plasmid-mediated overexpression, respectively. The results indicate that 2′-PDE, apart from playing...

  8. Some quality attributes of low fat ice cream substituted with hulless barley flour and barley ß-glucan

    OpenAIRE

    Abdel-Haleem, Amal M. H.; Awad, R. A.

    2015-01-01

    The purpose of this paper is to investigate some quality attributes of low fat ice cream (LFIC) substituted with hulless barley flour (HBF) and barley ß-glucan (BBG). The methodology included in this paper is based on adding HBF (1, 2, 3 and 4 %) as a partial substitution of skim milk powder (SMP) and BBG (0.40 %) as a complete substitution of carboxy methyl cellulose (CMC). All mixes and resultant ice cream samples were evaluated for their physicochemical properties as well as the sensory qu...

  9. Evaluation of Some Chemical Characteristics of barley Mutants induced by Gamma Irradiation

    International Nuclear Information System (INIS)

    Abdeldaiem, M.H.; Ali, H.G.M.

    2011-01-01

    This study aims to evaluate the antioxidant activity of acetonic extract from some barley mutations (P1, P2 and P3 varieties) induced by gamma irradiation as compared with local barley variety (Hordeum vulgare L.) as control. Barley samples were obtained from Plant Breeding Unit, Plant Research Department, Nuclear Research Centre, Atomic Energy Authority, Egypt. The measurements of the antioxidant activity using a radical scavenging capacity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ?-carotene bleaching assay were assessed in the barley acetonic extract. Furthermore, amino acids composition of barley mutant samples was determined. The results indicated that the acetonic extract of barley varieties under investigation possess marked antioxidant and anti radical capacities. The data showed that the acetonic extract of barley mutant P1 possessed the higher antioxidant activity as compared with the antioxidant activities of acetonic extract from control and other barley mutant samples. Meanwhile, the flour of barley mutations under investigation contained trace elements of iron, copper and manganese. GC and mass analyses were used to identify the active compound of extract of control and mutant barley samples. The results illustrated that the main components of the control sample of barely extract was pentane, 3 methyl (47.73%) while gamma irradiation caused noticeable change in the relative percentage of some components of acetonic extract from barley mutant samples. Moreover, the results presented that changes were disappeared, and some compounds of the acetonic extract from mutant barley samples were appeared. Furthermore, the results exhibited that barley flour supplemented with wheat flour at 30% level produced acceptable cookies. Accordingly, the phenolic constituents of barley acetonic extract induced by gamma irradiation, especially samples of P1 mutant, may have a future role as ingredients in the development of functional foods.

  10. Long noncoding RNA-mediated intrachromosomal interactions promote imprinting at the Kcnq1 locus

    Science.gov (United States)

    Zhang, He; Zeitz, Michael J.; Wang, Hong; Niu, Beibei; Ge, Shengfang; Li, Wei; Cui, Jiuwei; Wang, Guanjun; Qian, Guanxiang; Higgins, Michael J.

    2014-01-01

    Kcnq1ot1 is a long noncoding ribonucleic acid (RNA; lncRNA) that participates in the regulation of genes within the Kcnq1 imprinting domain. Using a novel RNA-guided chromatin conformation capture method, we demonstrate that the 5′ region of Kcnq1ot1 RNA orchestrates a long-range intrachromosomal loop between KvDMR1 and the Kcnq1 promoter that is required for maintenance of imprinting. PRC2 (polycomb repressive complex 2), which participates in the allelic repression of Kcnq1, is also recruited by Kcnq1ot1 RNA via EZH2. Targeted suppression of Kcnq1ot1 lncRNA prevents the creation of this long-range intrachromosomal loop and causes loss of Kcnq1 imprinting. These observations delineate a novel mechanism by which an lncRNA directly builds an intrachromosomal interaction complex to establish allele-specific transcriptional gene silencing over a large chromosomal domain. PMID:24395636

  11. Comparison of stability statistics for yield in barley (Hordeum vulgare ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-03-15

    Mar 15, 2010 ... Key words: Barley, genotype x environment interaction, parametric and nonparametric measures, dynamic and static stability. INTRODUCTION ... evaluated in multi-environment trials (METs) to test their performance over different ...... (2) in faba bean (Vicia faba L.) and pea (Pisum sativum. L.). Adugna and ...

  12. Genetic diversity of some Saudi barley (Hordeum Vulgare L ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... Full Length Research Paper. Genetic diversity of some Saudi barley (Hordeum. Vulgare L.) landraces based on microsatellite markers. El-Awady A. M. Mohamed 1,2 and El-Tarras A. E. Adel1,2. 1Biotechnology and Genetic Engineering Research Unit, Scientific Research Center, College of Medicine, Taif.

  13. The proteomic analysis of barley albumins and globulins

    Czech Academy of Sciences Publication Activity Database

    Laštovičková, Markéta; Bobálová, Janette

    2008-01-01

    Roč. 102, č. 15 (2008), s709-s711 ISSN 1803-2389. [Meeting on Chemistry and Life /4./. Brno, 09.09.2008-11.09.2008] R&D Projects: GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : barley * albumins * globulins Subject RIV: CB - Analytical Chemistry, Separation

  14. Resistance in winter barley against Ramularia leaf spot

    DEFF Research Database (Denmark)

    Hjortshøj, Rasmus Lund

    Ramularia leaf spot is an emerging disease in barley caused by R. collo-cygni. At present little is known about the resistance mechanisms carried out by the host plant to avoid disease development. Nor is the lifecycle of the fungus or its populations structure fully understood. To gain insight i...

  15. Durum wheat and barley productivity in saline-drought environments

    NARCIS (Netherlands)

    Katerji, N.; Mastrorilli, M.; Hoorn, van J.W.; Lahmer, F.Z.; Hamdy, A.; Oweis, T.

    2009-01-01

    In two Successive years, durum wheat (Triticum turgidum Desf.) and barley (Hodeum vulgare L.) were tested in a factorial salinity-drought experiment, combining three levels of salinity and two levels of drought. The two drought treatments were obtained by applying irrigation water when the pre-dawn

  16. Zinc biofortification of cereals: rice differs from wheat and barley

    NARCIS (Netherlands)

    Stomph, T.J.; Jiang, W.; Struik, P.C.

    2009-01-01

    In their review, mainly focused on bread wheat (Triticum aestivum), durum wheat (Triticum durum) and barley (Hordeum vulgare), Palmgren et al. 1 M.G. Palmgren et al., Zinc biofortification of cereals: problems and solutions, Trends Plant Sci. 13 (2008), pp. 464–473. Article | PDF (905 K) | View

  17. Genetic variability in barley (Hordeum vulgare L.) landraces from ...

    African Journals Online (AJOL)

    Data on 44 barley landraces comprising collections and farmers' cultivars from north Shewa, Ethiopia were studied for variability in morphological characters and Sodium Dodecyl Sulphate Polyacrylamide Gel Electophoresis (SDS-PAGE) of seed storage proteins. The phenotypic frequencies of morphological characters ...

  18. Barley breeding for quality improvement in Tunisia | Medimagh ...

    African Journals Online (AJOL)

    This study was initiated to assess the effectiveness of three selection procedures applied in the early segregating generations of barley crosses for quality traits. The selection procedures were pedigree selection (PS), bulk selection (BS) and single seed descent selection (SSD). Selection was operated in F2's crosses.

  19. Cadmium translocation and accumulation in developing barley grains

    DEFF Research Database (Denmark)

    Chen, Fei; Wu, Feibo; Dong, Jing

    2007-01-01

     Soil cadmium (Cd) contamination has posed a serious problem for safe food production and become a potential agricultural and environmental hazard worldwide. In order to study the transport of Cd into the developing grains, detached ears of two-rowed barley cv. ZAU 3 were cultured in Cd stressed ...

  20. Synthesis of the major storage protein, hordein, in barley

    DEFF Research Database (Denmark)

    Giese, Nanna Henriette; Andersen, B.; Doll, Hans

    1983-01-01

    A liquid culture system for culturing detached spikes of barley (Hordeum vulgare L.) at different nutritional levels was established. The synthesis of hordein polypeptides was studied by pulse-labeling with [14C]sucrose at different stages of development and nitrogen (N) nutrition. All polypeptid...

  1. Registration of Guta Barley (Hordeium vulgare L.) Variety for Bale ...

    African Journals Online (AJOL)

    Thus, the variety has shown high mean grain yield and relatively stable across locations and years. ... On the other hand, as observed during evaluation Guta possess resistance or tolerance to barley shoot fly insect than Shage; and exhibit compensatory growth after shootfly damage and these needs further research.

  2. Analysis of Pregerminated Barley Using Hyperspectral Image Analysis

    DEFF Research Database (Denmark)

    Arngren, Morten; Hansen, Per Waaben; Eriksen, Birger

    2011-01-01

    imaging system in a mathematical modeling framework to identify pregerminated barley at an early stage of approximately 12 h of pregermination. Our model only assigns pregermination as the cause for a single kernel’s lack of germination and is unable to identify dormancy, kernel damage etc. The analysis...

  3. Hydrothermal liquefaction of barley straw to bio-crude oil

    DEFF Research Database (Denmark)

    Zhu, Zhe; Rosendahl, Lasse; Toor, Saqib

    2015-01-01

    Hydrothermal liquefaction (HTL) of barley straw with K2CO3 at different temperatures (280–400 C) was conducted and compared to optimize its process conditions; the aqueous phase as a co-product from this process was recycled to explore the feasibility of implementing wastewater reuse for bio...

  4. Registration of ‘Muir’ spring feed barley

    Science.gov (United States)

    ‘Muir’ (Reg. No. CV-357, PI 674172) is a two-row, spring, hulled feed barley (Hordeum vulgare L.) cultivar developed and evaluated as 07WA-601.6, and released in 2013 by Washington State University (WSU). Muir was derived from the cross ‘Baronesse’/‘Bob’ and selected through singleseed descent from ...

  5. Analysis of Genetic diversity and reltionships in local Tunisian barley ...

    African Journals Online (AJOL)

    Yomi

    Genetic diversity and environmental associations of wild barley, Hordeum spontaneum, in Turkey. Genetica, 68: 203-213. Nagaoka T, Ogihara Y (1997). Applicability of inter-simple sequence repeat polymorphism in wheat for use as DNA markers in comparison to RFLP and RAPD markers. Theor. Appl. Genet. 94: 597-602.

  6. Two barley yellow dwarf luteovirus serotypes associated with ...

    African Journals Online (AJOL)

    Barley yellow dwarf luteovirus (BYDV) serotypes PAV and RPV were identified from irrigated wheat (Triticum aestivum L.) samples from three provinces of Zambia by double antibody sandwich enzyme-linked immunosorbent assay using polyclonal and monoclonal antisera. Nine wheat cultivars were surveyed in 11 wheat ...

  7. The Mutation Frequency in Different Spike Categories in Barley

    DEFF Research Database (Denmark)

    Frydenberg, O.; Doll, Hans; Sandfær, J.

    1964-01-01

    After gamma irradiation of barley seeds, a comparison has been made between the chlorophyll-mutant frequencies in X1 spikes that had multicellular bud meristems in the seeds at the time of treatment (denoted as pre-formed spikes) and X1 spikes having no recognizable meristems at the time...

  8. Genetic analysis on the competitive ability of barley ( Hordeum ...

    African Journals Online (AJOL)

    Genetic analysis on the competitive ability of barley ( Hordeum vulgare L.) recombinant inbred lines intercropped with oat ( Avena sativa L.) weeds. ... Furthermore, the commonly used herbicide price is soaring from time to time and out of the reach of the poor farmers in the developing countries. Therefore, this method is an ...

  9. GENETIC ANALYSIS ON THE COMPETITIVE ABILITY OF BARLEY ...

    African Journals Online (AJOL)

    ADMIN

    serious problem to control both in mechanical or chemical methods ... competition/suppressing ability. MATERIALS AND METHODS. Plant material. The plant materials used for this experiment were. 98 barley recombinant inbred lines including their two parents ... Randomised incomplete block design was used to layout ...

  10. Wheat and barley exposure to nanoceria: Implications for agricultural productivity

    Science.gov (United States)

    The impacts of man-made nanomaterials on agricultural productivity are not yet well understood. A soil microcosm study was performed to assess the physiological, phenological, and yield responses of wheat (Triticum aestivum) and barley (Hordeum vulgare L.) exposed to nanoceria (n...

  11. Grain Yield and Economic Benefit of Intercropping Barley and Faba ...

    African Journals Online (AJOL)

    Thus, a study was conducted during 2011 and 2012 years to evaluate the effect of barley (Ba)-faba bean (Fb) intercrop on yield, yield related traits and economic benefit in the highlands of southern Ethiopia. The treatments consisted of planting patterns of one (1Fb), two (2Fb) and three (3Fb) rows of faba bean combined ...

  12. Response of barley plants to foliar application of growth regulators ...

    African Journals Online (AJOL)

    The obtained results revealed that either foliar spraying by the growth regulators mixture or Zinc concentrations had a significant promotive effect on the studied growth and yield as well as the physiological and chemical parameters of barley when compared with the control treatment. While the highest values of the previous ...

  13. Registration of Food Barley (Hordeum vulgare L.) Variety HB 1307 ...

    African Journals Online (AJOL)

    Six-rowed food type barley, HB 1307, was developed by Holetta Agricultural Research Center (HARC) from a cross between a landrace line and exotic germplasm (Awra gebs-1 x IBON93/91) and released in 2006 for mid and high altitude areas. The three consecutive years\\' (2002-2004) tests proved its superiority in grain ...

  14. Evaluation of genetic diversity in barley ( Hordeum vulgare L.) from ...

    African Journals Online (AJOL)

    This study aimed to determine the genetic diversity and relationships among barley varieties (Hordeum vulgare L.) growing at Wollo Highland areas by using hordein and agro-morphological traits. Twenty (20) varieties were laid down in randomized complete block design (RCBD) design with three replications; they were ...

  15. Classification and salt tolerance analysis of barley varieties

    NARCIS (Netherlands)

    Katerji, N.; Hoorn, van J.W.; Hamdy, A.; Mastrorilli, M.; Fares, C.; Ceccarelli, S.; Grando, S.; Oweis, T.

    2006-01-01

    Six varieties of barley (Hordeum vulgare), five of which were provided by ICARDA, were tested in a green house experiment for their salt tolerance. Afterwards the ICARDA variety Melusine, selected from this experiment for its combination of high yield and salt tolerance, was compared in a lysimeter

  16. Inhibition of coagulation factors by recombinant barley serpin BSZx

    DEFF Research Database (Denmark)

    Dahl, Søren Weis; Rasmussen, S.K.; Petersen, L..C.

    1996-01-01

    Barley serpin BSZx is a potent inhibitor of trypsin and chymotrypsin at overlapping reactive sites (Dahl, S.W., Rasmussen, S.K. and Hejgaard, J. (1996) J. Biol, Chem., in press), We have now investigated the interactions of BSZx with a range of serine proteinases from human plasma, pancreas and l...

  17. Leaf rust of cultivated barley: pathology and control.

    Science.gov (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder

    2015-01-01

    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  18. Diversity analysis of the developed qingke (hulless barley) cultivars ...

    African Journals Online (AJOL)

    Genetic diversity among 68 accessions of the developed qingke (hulless barley) cultivars from Sichuan, Gansu, Tibet, Qinghai and Yunnan provinces of the Qinghai-Tibet Plateau in China was evaluated by using a newly developed sequence-related amplified polymorphism (SRAP) marker system. The results showed that, ...

  19. Reclamation of Sodic-Saline Soils. Barley Crop Response

    Directory of Open Access Journals (Sweden)

    Giovanna Cucci

    2008-12-01

    Full Text Available The research was aimed at assessing the salinity and sodicity effects of two soil types submitted to correction on barley crop. The two soils, contained in cylindrical pots (0.40 m in size and 0.60 m h supplied with a bottom valve for the collection of drainage water and located under shed to prevent the leaching action of rainfall, were clay-textured and saline and sodic-saline at barley seeding, as they had been cultivated for 4 consecutive years with different herbaceous species irrigated with 9 types of brackish water. In 2002-2003 the 2 salinized and sodium-affected soils (ECe and ESP ranging respectively from 5.84-20.27 dSm-1 to 2.83-11.19%, submitted to correction, were cultivated with barley cv Micuccio, and irrigated with fresh water (ECw = 0.5 dS m-1 and SAR = 0.45 whenever 30% of the maximum soil available moisture was lost by evapotranspiration. Barley was shown to be a salt-tolerant species and did not experience any salt stress when grown in soils with an initial ECe up to 11 dS m-1. When it was grown in more saline soils (initial ECe of about 20 dS m-1, despite the correction, it showed a reduction in shoot biomass and kernel yield by 26% and 36% respectively, as compared to less saline soils.

  20. Influence of ultrasonic stimulation on the germination of barley seed ...

    African Journals Online (AJOL)

    In this study, the influence of ultrasonic stimulation was investigated on the germination of barley and alpha-amylase activity grains in the dry state before steeping. All experiments have been performed using an ultrasonic horn operating at a fixed frequency of 20 KHz in 3 different ultrasonic power (20, 60 and 100% setting ...

  1. Wheat and barley seed systems in Ethiopia and Syria

    NARCIS (Netherlands)

    Bishaw, Z.

    2004-01-01

    Keywords: Wheat,Triticumspp., Barley,Hordeumvulgare L., Seed Systems, Formal Seed Sector, Informal Seed Sector, National Seed Program, Seed Source, Seed Selection, Seed Management, Seed Quality,

  2. 108-110 Registration of Guta Barley (Hordeium vulgare L.)

    African Journals Online (AJOL)

    adoption potential by the local farmers. Keywords: Guta; Barley (Hordeium vulgare L); Yield ... evaluated along with Aruso and Shage as the local and standard variety, respectively at altitudinal range of 2400- ... 6. Farmers Evaluation of the Variety. To evaluate the perception and preferences of the local farmers, farmers' ...

  3. Expression of lipoxygenase isoenzymes in developing barley grains

    NARCIS (Netherlands)

    Schmitt, N.F.; Mechelen, J.R. van

    1997-01-01

    Expression of lipoxygenase was studied in whole developing barley grains from 5 days after flowering (DAF) to full maturity. Lipoxygenase showed two distinct peaks of activity. The first peak of activity occurred in the early stages of grain development from 5 until 20 DAF, whereas the second peak

  4. Substituting maize grain with barley grain in concentrates fed to ...

    African Journals Online (AJOL)

    The aim of the study was to determine the effect of substituting maize grain with barley grain in the diet of lactating Jersey cows grazing kikuyu-ryegrass pasture. Sixty Jersey cows were blocked in terms of number of days in milk, lactation number, milk yield and live weight and randomly assigned to one of five treatments (n ...

  5. Isolating Barley (Hordeum vulgare L.) B1 Hordein Gene Promoter ...

    African Journals Online (AJOL)

    Yomi

    2012-04-10

    Apr 10, 2012 ... Isolating Barley (Hordeum vulgare L.) B1 Hordein Gene. Promoter and Using Sequencing Analaysis. For The Identification of Conserved Regulatory. Elements By Bioinformatic Tools. Kobra Nalbandi1, Bahram Baghban Kohnehrouz2*, Khalil Alami Saeed1 and Ashraf. Gholizadeh3. 1Ramin Agricultural ...

  6. Aspects of the barley seed proteome during development and germination

    DEFF Research Database (Denmark)

    Finnie, Christine; Maeda, K.; Østergaard, O.

    2004-01-01

    Analysis of the water-soluble barley seed proteome has led to the identification of proteins by MS in the major spots on two-dimensional gels covering the pi ranges 4-7 and 6-11. This provides the basis for in-depth studies of proteome changes during seed development and germination, tissue...

  7. Diversity analysis of the developed qingke (hulless barley) cultivars ...

    African Journals Online (AJOL)

    Jane

    2010-12-13

    Dec 13, 2010 ... Genetic diversity among 68 accessions of the developed qingke (hulless barley) cultivars from Sichuan,. Gansu, Tibet, Qinghai and Yunnan provinces of the Qinghai-Tibet Plateau in China was evaluated by using a newly developed sequence-related amplified polymorphism (SRAP) marker system.

  8. Effect of drought stress on barley-wheat intercropping

    NARCIS (Netherlands)

    Woldeamlak, A.; Kropff, M.J.; Struik, P.C.

    2006-01-01

    The effects of drought or moisture stress (MS1- no stress; MS2- stress at seedling stage and MS3- stress at heading stage) was studied for different crop ratios of barley (Hordeum vulgare) and wheat (Triticum aestivum) mixtures sown in additive and replacement series at Halhale Research Station

  9. Replacement of barley grains and dehydrated alfalfa by Sulla Hay ...

    African Journals Online (AJOL)

    Replacement of barley grains and dehydrated alfalfa by Sulla Hay (Hedysarum flexuosum) and common reed leaves (Phragmites australis) in fattening rabbits diet. S.A. Kadi, A. Mouhous, F. Djellal, ... was valuable for fattening rabbit. Keywords: Rabbit, Growth performances, Phragmites australis, Hedysarum flexuosum.

  10. analysis and correlation of stability parameters in malting barley

    African Journals Online (AJOL)

    Administrator

    Interaction principal component axis (IPCA) scores,. Additive .... TABLE 1. Additive main effects and multiplicative interactions (AMMI) analysis of variance for grain yield of 20 genotypes of ... BLE 2. Mean grain yield and genotypic stability parameters for 20 malting barley genotypes grown over 12 environments in Ethiopia.

  11. Brewing with 100 % unmalted grains: barley, wheat, oat and rye

    DEFF Research Database (Denmark)

    Zhuang, Shiwen; Shetty, Radhakrishna; Hansen, Mikkel

    2017-01-01

    Whilst beers have been produced using various levels of unmalted grains as adjuncts along with malt, brewing with 100 % unmalted grains in combination with added mashing enzymes remains mostly unknown. The aim of this study was to investigate the brewing potential of 100 % unmalted barley, wheat,...

  12. MS based proteomic approaches for analysis of barley malt

    Czech Academy of Sciences Publication Activity Database

    Laštovičková, Markéta; Bobálová, Janette

    2012-01-01

    Roč. 56, č. 3 (2012), s. 519-530 ISSN 0733-5210 R&D Projects: GA ČR(CZ) GPP503/12/P395 Institutional research plan: CEZ:AV0Z40310501 Keywords : barley * malt * mass spectrometry Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.088, year: 2012

  13. Allelopathic effects of barley straw on germination and seedling growth of corn, sugar beet and sunflower

    Directory of Open Access Journals (Sweden)

    mohamad taghi naseri poor yazdi

    2009-06-01

    Full Text Available Allelopathic effects of barley straw and root on germination and growth of maize, sugar beet, and sunflower were investigated under glasshouse and laboratory experiments in Faculty of Agriculture, Ferdowsi University of Mashhad in 2006. The glasshouse experiment was designed based on randomized complete block design with three replications, treatments included: 0, 200, 400, 600 g/m² of grounded barley straw and also 0 and 50 g/m2 barley root. A laboratory experiment was carried out in order to study the effect of different concentrations of barley water extracts on germination and seedling characteristics of corn, sugar beet and sunflower. Treatments in laboratory trial included 0, 33, 50 and 100 percent of barley extracts. Results showed that leaf area of corn was significantly affected by barley straw treatments. Shoot dry matter and seed weight per plant in corn , leaf and tuber weight in sugar beet and leaf , stem weights , plant per plant in corn , leaf and tuber weight in sugar beet and leaf, stem weights, plant height, head diameter, head weight and seed weight in sunflower were significantly higher in treatment of 50g/m² barley roots. Crop seed germination decreased with increasing the amount of barley straw. The best germination response to barley extract was observed in corn. Maize radicle weight was significantly decreased with increasing concentration of barley water extract.

  14. iTAG Barley: A 9-12 curriculum to explore inheritance of traits and genes using Oregon Wolfe barley

    Science.gov (United States)

    Segregating plants from the Informative & Spectacular Subset (ISS) of the Oregon Wolfe doubled haploid barley (OWB) population are easily grown on a lighted window bench in the classroom. These lines originate from a wide cross and have exceptionally diverse and dramatic phenotypes, making this an i...

  15. Heat Stress Affects Pi-related Genes Expression and Inorganic Phosphate Deposition/Accumulation in Barley

    Science.gov (United States)

    Pacak, Andrzej; Barciszewska-Pacak, Maria; Swida-Barteczka, Aleksandra; Kruszka, Katarzyna; Sega, Pawel; Milanowska, Kaja; Jakobsen, Iver; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

    2016-01-01

    Phosphorus (P) in plants is taken from soil as an inorganic phosphate (Pi) and is one of the most important macroelements in growth and development. Plants actively react to Pi starvation by the induced expression of Pi transporters, MIR399, MIR827, and miR399 molecular sponge – IPS1 genes and by the decreased expression of the ubiquitin-conjugating enzyme E2 (PHOSPHATE2 – PHO2) and Pi sensing and transport SPX-MFS genes. The PHO2 protein is involved in the degradation of Pi transporters PHT1;1 (from soil to roots) and PHO1 (from roots to shoots). The decreased expression of PHO2 leads to Pi accumulation in shoots. In contrast, the pho1 mutant shows a decreased level of Pi concentration in shoots. Finally, Pi starvation leads to decreased Pi concentration in all plant tissues. Little is known about plant Pi homeostasis in other abiotic stress conditions. We found that, during the first hour of heat stress, Pi accumulated in barley shoots but not in the roots, and transcriptomic data analysis as well as RT-qPCR led us to propose an explanation for this phenomenon. Pi transport inhibition from soil to roots is balanced by lower Pi efflux from roots to shoots directed by the PHO1 transporter. In shoots, the PHO2 mRNA level is decreased, leading to an increased Pi level. We concluded that Pi homeostasis in barley during heat stress is maintained by dynamic changes in Pi-related genes expression. PMID:27446155

  16. The Dynamics of Transcript Abundance during Cellularization of Developing Barley Endosperm.

    Science.gov (United States)

    Zhang, Runxuan; Tucker, Matthew R; Burton, Rachel A; Shirley, Neil J; Little, Alan; Morris, Jenny; Milne, Linda; Houston, Kelly; Hedley, Pete E; Waugh, Robbie; Fincher, Geoffrey B

    2016-03-01

    Within the cereal grain, the endosperm and its nutrient reserves are critical for successful germination and in the context of grain utilization. The identification of molecular determinants of early endosperm development, particularly regulators of cell division and cell wall deposition, would help predict end-use properties such as yield, quality, and nutritional value. Custom microarray data have been generated using RNA isolated from developing barley grain endosperm 3 d to 8 d after pollination (DAP). Comparisons of transcript abundance over time revealed 47 gene expression modules that can be clustered into 10 broad groups. Superimposing these modules upon cytological data allowed patterns of transcript abundance to be linked with key stages of early grain development. Here, attention was focused on how the datasets could be mined to explore and define the processes of cell wall biosynthesis, remodeling, and degradation. Using a combination of spatial molecular network and gene ontology enrichment analyses, it is shown that genes involved in cell wall metabolism are found in multiple modules, but cluster into two main groups that exhibit peak expression at 3 DAP to 4 DAP and 5 DAP to 8 DAP. The presence of transcription factor genes in these modules allowed candidate genes for the control of wall metabolism during early barley grain development to be identified. The data are publicly available through a dedicated web interface (https://ics.hutton.ac.uk/barseed/), where they can be used to interrogate co- and differential expression for any other genes, groups of genes, or transcription factors expressed during early endosperm development. © 2016 American Society of Plant Biologists. All Rights Reserved.

  17. Nitrogen acquisition by pea and barley and the effect of their crop residues on available nitrogen for subsequent crops

    DEFF Research Database (Denmark)

    Jensen, E.S.

    1996-01-01

    Nitrogen acquisition by field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) grown on a sandy loam soil and availability of N in three subsequent sequences of a cropping system were studied in an outdoor pot experiment. The effect of crop residues on the N availability was evaluated....... The uptake of soil-derived N by a test crop (N catch crop) of white mustard (Sinapis alba L.) grown in the autumn was higher after pea than after barley. The N uptake in the test crop was reduced by 27% and 34% after pea and barley residue incorporation, respectively, probably due to N immobilization....... The dry matter production and total N uptake of a spring barley crop following pea or barley, with a period of unplanted soil in the autumn/winter, were significantly higher after pea than after barley. The barley crop following pea and barley recovered 11% of the pea and 8% of the barley residue N...

  18. Prowashonupana barley dietary fibre reduces body fat and increases insulin sensitivity in Caenorhabditis elegans model

    Science.gov (United States)

    Gao, Chenfei; King, Michael L.; Fitzpatrick, Zachary L.; Wei, Wenqian; King, Jason F.; Wang, Mingming; Greenway, Frank L.; Finley, John W.; Burton, Jeffrey H.; Johnson, William D.; Keenan, Michael J.; Enright, Frederick M.; Martin, Roy J.; Zheng, Jolene

    2016-01-01

    Prowashonupana barley (PWB) is high in β-glucan with moderate content of resistant starch. PWB reduced intestinal fat deposition (IFD) in wild type Caenorhabditis elegans (C. elegans, N2), and in sir-2.1 or daf-16 null mutants, and sustained a surrogate marker of lifespan, pharyngeal pumping rate (PPR), in N2, sir-2.1, daf-16, or daf-16/daf-2 mutants. Hyperglycaemia (2% glucose) reversed or reduced the PWB effect on IFD in N2 or daf-16/daf-2 mutants with a sustained PPR. mRNA expression of cpt-1, cpt-2, ckr-1, and gcy-8 were dose-dependently reduced in N2 or daf-16 mutants, elevated in daf-16/daf-2 mutants with reduction in cpt-1, and unchanged in sir-2.1 mutants. mRNA expressions were increased by hyperglycaemia in N2 or daf-16/daf-2 mutants, while reduced in sir-2.1 or daf-16 mutants. The effects of PWB in the C. elegans model appeared to be primarily mediated via sir-2.1, daf-16, and daf-16/daf-2. These data suggest that PWB and β-glucans may benefit hyperglycaemia-impaired lipid metabolism. PMID:27721901

  19. Prowashonupana barley dietary fibre reduces body fat and increases insulin sensitivity in Caenorhabditis elegans model.

    Science.gov (United States)

    Gao, Chenfei; King, Michael L; Fitzpatrick, Zachary L; Wei, Wenqian; King, Jason F; Wang, Mingming; Greenway, Frank L; Finley, John W; Burton, Jeffrey H; Johnson, William D; Keenan, Michael J; Enright, Frederick M; Martin, Roy J; Zheng, Jolene

    2015-10-01

    Prowashonupana barley (PWB) is high in β-glucan with moderate content of resistant starch. PWB reduced intestinal fat deposition (IFD) in wild type Caenorhabditis elegans (C. elegans , N2), and in sir-2.1 or daf-16 null mutants, and sustained a surrogate marker of lifespan, pharyngeal pumping rate (PPR), in N2, sir-2.1, daf-16 , or daf-16/daf-2 mutants. Hyperglycaemia (2% glucose) reversed or reduced the PWB effect on IFD in N2 or daf-16/daf-2 mutants with a sustained PPR. mRNA expression of cpt-1, cpt-2, ckr-1 , and gcy-8 were dose-dependently reduced in N2 or daf-16 mutants, elevated in daf-16/daf-2 mutants with reduction in cpt-1 , and unchanged in sir-2.1 mutants. mRNA expressions were increased by hyperglycaemia in N2 or daf-16/daf-2 mutants, while reduced in sir-2.1 or daf-16 mutants. The effects of PWB in the C. elegans model appeared to be primarily mediated via sir-2.1, daf-16 , and daf-16/daf-2 . These data suggest that PWB and β-glucans may benefit hyperglycaemia-impaired lipid metabolism.

  20. Dynamics of molecular evolution and phylogeography of Barley yellow dwarf virus-PAV.

    Science.gov (United States)

    Wu, Beilei; Blanchard-Letort, Alexandra; Liu, Yan; Zhou, Guanghe; Wang, Xifeng; Elena, Santiago F

    2011-02-04

    Barley yellow dwarf virus (BYDV) species PAV occurs frequently in irrigated wheat fields worldwide and can be efficiently transmitted by aphids. Isolates of BYDV-PAV from different countries show great divergence both in genomic sequences and pathogenicity. Despite its economical importance, the genetic structure of natural BYDV-PAV populations, as well as of the mechanisms maintaining its high diversity, remain poorly explored. In this study, we investigate the dynamics of BYDV-PAV genome evolution utilizing time-structured data sets of complete genomic sequences from 58 isolates from different hosts obtained worldwide. First, we observed that BYDV-PAV exhibits a high frequency of homologous recombination. Second, our analysis revealed that BYDV-PAV genome evolves under purifying selection and at a substitution rate similar to other RNA viruses (3.158×10(-4) nucleotide substitutions/site/year). Phylogeography analyses show that the diversification of BYDV-PAV can be explained by local geographic adaptation as well as by host-driven adaptation. These results increase our understanding of the diversity, molecular evolutionary characteristics and epidemiological properties of an economically important plant RNA virus.

  1. Long-term reconstitution of dry barley increased phosphorus digestibility in pigs

    DEFF Research Database (Denmark)

    Ton Nu, Mai Anh; Blaabjerg, Karoline; Poulsen, Hanne Damgaard

    Introduction: Cereals are normally stored dry at low moisture content (digestible. The objective is to investigate the effect...... of reconstitution compared to dry stored barley on phosphorus (P) digestibility in pigs. Materials and Methods: Dry barley (13% moisture; phytate P, 1.7 g/kg DM) was rolled and stored directly or reconstituted with water to produce rolled barley with 35% moisture that was stored in air-tight conditions. After 49......: Reconstituted barley had higher soluble P (2.56 g/kg DM) and lower phytate P (0.93 g/ kg DM) compared with dry barley (0.78 and 1.7 g/kg DM, respectively). Pigs fed the reconstituted barley diet showed increased P absorption (52%) and decreased P excretion in feces (21%) (P

  2. Use of Barley for the Purification of Aquaculture Wastewater in a Hydroponics System

    OpenAIRE

    A. M. Snow; Abdel E. Ghaly

    2008-01-01

    Barley was examined for its ability to remove nutrients from aquaculture wastewater. The effects of seed sterilization using ethanol and bleach and seed density on germination and plant growth were investigated. Surface sterilization of barley seeds had a negative impact on germination. Increasing the ethanol concentration and/or the bleach concentration reduced the germination percentage. Barley seeds were first germinated in water in the hydroponics system. The seedlings then received waste...

  3. Volatile compound-mediated interactions between barley and pathogenic fungi in the soil.

    Science.gov (United States)

    Fiers, Marie; Lognay, Georges; Fauconnier, Marie-Laure; Jijakli, M Haïssam

    2013-01-01

    Plants are able to interact with their environment by emitting volatile organic compounds. We investigated the volatile interactions that take place below ground between barley roots and two pathogenic fungi, Cochliobolus sativus and Fusarium culmorum. The volatile molecules emitted by each fungus, by non-infected barley roots and by barley roots infected with one of the fungi or the two of them were extracted by head-space solid phase micro extraction and analyzed by gas chromatography mass spectrometry. The effect of fungal volatiles on barley growth and the effect of barley root volatiles on fungal growth were assessed by cultivating both organisms in a shared atmosphere without any physical contact. The results show that volatile organic compounds, especially terpenes, are newly emitted during the interaction between fungi and barley roots. The volatile molecules released by non-infected barley roots did not significantly affect fungal growth, whereas the volatile molecules released by pathogenic fungi decreased the length of barley roots by 19 to 21.5% and the surface of aerial parts by 15%. The spectrum of the volatiles released by infected barley roots had no significant effect on F. culmorum growth, but decreased C. sativus growth by 13 to 17%. This paper identifies the volatile organic compounds emitted by two pathogenic fungi and shows that pathogenic fungi can modify volatile emission by infected plants. Our results open promising perspectives concerning the biological control of edaphic diseases.

  4. Archaeogenetic evidence of ancient nubian barley evolution from six to two-row indicates local adaptation.

    Directory of Open Access Journals (Sweden)

    Sarah A Palmer

    Full Text Available BACKGROUND: Archaeobotanical samples of barley (Hordeum vulgare L. found at Qasr Ibrim display a two-row phenotype that is unique to the region of archaeological sites upriver of the first cataract of the Nile, characterised by the development of distinctive lateral bracts. The phenotype occurs throughout all strata at Qasr Ibrim, which range in age from 3000 to a few hundred years. METHODOLOGY AND FINDINGS: We extracted ancient DNA from barley samples from the entire range of occupancy of the site, and studied the Vrs1 gene responsible for row number in extant barley. Surprisingly, we found a discord between the genotype and phenotype in all samples; all the barley had a genotype consistent with the six-row condition. These results indicate a six-row ancestry for the Qasr Ibrim barley, followed by a reassertion of the two-row condition. Modelling demonstrates that this sequence of evolutionary events requires a strong selection pressure. CONCLUSIONS: The two-row phenotype at Qasr Ibrim is caused by a different mechanism to that in extant barley. The strength of selection required for this mechanism to prevail indicates that the barley became locally adapted in the region in response to a local selection pressure. The consistency of the genotype/phenotype discord over time supports a scenario of adoption of this barley type by successive cultures, rather than the importation of new barley varieties associated with individual cultures.

  5. The non-touching method of the malting barley quality evaluation

    Science.gov (United States)

    Raba, B.; Nowakowski, K.; Lewicki, A.; Przybył, K.; Zaborowicz, M.; Koszela, K.; Boniecki, P.; Mueller, W.

    2014-04-01

    The first important stage of the malt production processes is the malting barley quality evaluation. Presented project was focused on the visual features of malting barley grains. The principal aim was to elaborate complete methodology to determine the level of grains contamination. The article describes the mechanisms of choosing parameters which can distinguish useful for the malt production grains from defects and impurities. Original computer system 'Hordeum v 3.1' helped obtain graphical data from images of contaminated barley samples. Research carried out in this area can improve the quality evaluation process of malting barley.

  6. Volatile compound-mediated interactions between barley and pathogenic fungi in the soil.

    Directory of Open Access Journals (Sweden)

    Marie Fiers

    Full Text Available Plants are able to interact with their environment by emitting volatile organic compounds. We investigated the volatile interactions that take place below ground between barley roots and two pathogenic fungi, Cochliobolus sativus and Fusarium culmorum. The volatile molecules emitted by each fungus, by non-infected barley roots and by barley roots infected with one of the fungi or the two of them were extracted by head-space solid phase micro extraction and analyzed by gas chromatography mass spectrometry. The effect of fungal volatiles on barley growth and the effect of barley root volatiles on fungal growth were assessed by cultivating both organisms in a shared atmosphere without any physical contact. The results show that volatile organic compounds, especially terpenes, are newly emitted during the interaction between fungi and barley roots. The volatile molecules released by non-infected barley roots did not significantly affect fungal growth, whereas the volatile molecules released by pathogenic fungi decreased the length of barley roots by 19 to 21.5% and the surface of aerial parts by 15%. The spectrum of the volatiles released by infected barley roots had no significant effect on F. culmorum growth, but decreased C. sativus growth by 13 to 17%. This paper identifies the volatile organic compounds emitted by two pathogenic fungi and shows that pathogenic fungi can modify volatile emission by infected plants. Our results open promising perspectives concerning the biological control of edaphic diseases.

  7. DISTRIBUTION OF SPRING BARLEY VARIETIES WITH DIFFERENT POWDERY MILDEW RESISTANCES IN DENMARK FROM 1960 TO 1976

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms; Torp, J.

    1978-01-01

    In Denmark powdery mildew susceptible spring barley varieties were replaced by major gene resistant varieties in between 1963-1974. Varieties with resistance from Hordeum laevigatum covered about 1/3 of the barley area in 1968-1974, and 51 and 71% in 1975 and 1976, respectively. The severity...... each spring from overwintering barley crops in Germany and the UK, the distribution of the resistances on the barley area in Denmark, and the selective advantage of the matching virulences. Because the virulences matching the above 3 resistances apparently are present in the initial inoculum...

  8. Molecular Chemical Structure of Barley Proteins Revealed by Ultra-Spatially Resolved Synchrotron Light Sourced FTIR Microspectroscopy: Comparison of Barley Varieties

    International Nuclear Information System (INIS)

    Yu, P.

    2007-01-01

    Barley protein structure affects the barley quality, fermentation, and degradation behavior in both humans and animals among other factors such as protein matrix. Publications show various biological differences among barley varieties such as Valier and Harrington, which have significantly different degradation behaviors. The objectives of this study were to reveal the molecular structure of barley protein, comparing various varieties (Dolly, Valier, Harrington, LP955, AC Metcalfe, and Sisler), and quantify protein structure profiles using Gaussian and Lorentzian methods of multi-component peak modeling by using the ultra-spatially resolved synchrotron light sourced Fourier transform infrared microspectroscopy (SFTIRM). The items of the protein molecular structure revealed included protein structure α-helices, β-sheets, and others such as β-turns and random coils. The experiment was performed at the National Synchrotron Light Source in Brookhaven National Laboratory (BNL, US Department of Energy, NY). The results showed that with the SFTIRM, the molecular structure of barley protein could be revealed. Barley protein structures exhibited significant differences among the varieties in terms of proportion and ratio of model-fitted α-helices, β-sheets, and others. By using multi-component peaks modeling at protein amide I region of 1710-1576 cm -1 , the results show that barley protein consisted of approximately 18-34% of α-helices, 14-25% of β-sheets, and 44-69% others. AC Metcalfe, Sisler, and LP955 consisted of higher (P 0.05). The ratio of α-helices to others (0.3 to 1.0, P < 0.05) and that of β-sheets to others (0.2 to 0.8, P < 0.05) were different among the barley varieties. It needs to be pointed out that using a multi-peak modeling for protein structure analysis is only for making relative estimates and not exact determinations and only for the comparison purpose between varieties. The principal component analysis showed that protein amide I Fourier

  9. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.

    2015-01-01

    RNA modification has attracted increasing interest as it is realized that epitranscriptomics is important in disease development. In type 2 diabetes we have suggested that high urinary excretion of 8-oxo-2'-Guanosine (8oxoGuo), as a measure of global RNA oxidation, is associated with poor survival.......9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...... diabetes. In agreement with our previous finding, DNA oxidation did not show any prognostic value. RNA oxidation represents oxidative stress intracellularly, presumably predominantly in the cytosol. The mechanism of RNA oxidation is not clear, but hypothesized to result from mitochondrial dysfunction...

  10. Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    Directory of Open Access Journals (Sweden)

    Nilsson Lena

    2010-11-01

    Full Text Available Abstract Background Gene silencing vectors based on Barley stripe mosaic virus (BSMV are used extensively in cereals to study gene function, but nearly all studies have been limited to genes expressed in leaves of barley and wheat. However since many important aspects of plant biology are based on root-expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species have created a need for tools to study gene function in these species. Results Here we demonstrate the successful BSMV-mediated virus induced gene silencing (VIGS of three different genes in barley roots, i.e. the barley homologues of the IPS1, PHR1, and PHO2 genes known to participate in Pi uptake and reallocation in Arabidopsis. Attempts to silence two other genes, the Pi transporter gene HvPht1;1 and the endo-β-1,4-glucanase gene HvCel1, in barley roots were unsuccessful, probably due to instability of the plant gene inserts in the viral vector. In B. distachyon leaves, significant silencing of the PHYTOENE DESATURASE (BdPDS gene was obtained as shown by photobleaching as well as quantitative RT-PCR analysis. On the other hand, only very limited silencing of the oat AsPDS gene was observed in both hexaploid (A. sativa and diploid (A. strigosa oat. Finally, two modifications of the BSMV vector are presented, allowing ligation-free cloning of DNA fragments into the BSMV-γ component. Conclusions Our results show that BSMV can be used as a vector for gene silencing in barley roots and in B. distachyon leaves and possibly roots, opening up possibilities for using VIGS to study cereal root biology and to exploit the wealth of genome information in the new cereal model plant B. distachyon. On the other hand, the silencing induced by BSMV in oat seemed too

  11. The Role of alpha-Glucosidase in Germinating Barley Grains

    DEFF Research Database (Denmark)

    Stanley, Duncan; Rejzek, Martin; Næsted, Henrik

    2011-01-01

    The importance of alpha-glucosidase in the endosperm starch metabolism of barley (Hordeum vulgare) seedlings is poorly understood. The enzyme converts maltose to glucose (Glc), but in vitro studies indicate that it can also attack starch granules. To discover its role in vivo, we took complementary...... chemical-genetic and reverse-genetic approaches. We identified iminosugar inhibitors of a recombinant form of an alpha-glucosidase previously discovered in barley endosperm (ALPHA-GLUCOSIDASE97 [HvAGL97]), and applied four of them to germinating grains. All four decreased the Glc-to-maltose ratio...... in the endosperm 10 d after imbibition, implying inhibition of maltase activity. Three of the four inhibitors also reduced starch degradation and seedling growth, but the fourth did not affect these parameters. Inhibition of starch degradation was apparently not due to inhibition of amylases. Inhibition...

  12. Barley grain enrichement with essential elements by agronomic biofortification

    Directory of Open Access Journals (Sweden)

    Dragičević Vesna D.

    2016-01-01

    Full Text Available Barley grain is rich in mineral nutrients, but their bioavailability to humans depends on antinutrients that restrain bioavailability and promoters that promote bioavailability. The aim of this study was to examine composition of barley grain, including phytate and phenolics as antinutrients, carotenoids and glutathione as promoters and mineral elements, such as Ca, Mg, Fe, Si, Zn and Mn influenced by various non-standard foliar fertilizers (Zircon, Chitosan, Siliplant, Propikonazole, including some hormonal growth-stimulators (Epin Extra, Benzyladenine, as potential biofortification measure. Chitosan increased glutathione concentration in grain. Unfavorable meteorological conditions were partly mitigated by application of Benzyladenine and Siliplant, reflected through increased potential bioavailability of P, Mg, Ca and Fe. [Projekat Ministarstva nauke Republike Srbije, br. TR-31037

  13. Identification of Microbial Metabolites Elevating Vitamin Contents in Barley Seeds.

    Science.gov (United States)

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-08-19

    The current investigation analyzes metabolites of Acetobacter aceti to explore chemical compounds responsible for the induction of vitamins in barley seeds. A bioactivity guided assay of bacterial extracts and chromatographic analyses of barley produce revealed 13 chemical compounds, which were subjected to principal component analysis (PCA). PCA determined four chemical compounds (i.e., quinolinic acid, pyridoxic acid, p-aminobenzoate, and α-oxobutanoic acid) highly associated with increased quantities of vitamins. Further experimentations confirmed that quinolinic acid and p-aminobenzoate were the most efficient vitamin inducers. The results indicated chloroform/ethanol (4:1) as the best solvent system for the extraction of active compounds from crude metabolites of A. aceti. Significant quantities of mevalonic acid were detected in the extracted fraction, indicating the possible induction of the isoprenoid pathway. Altogether, the current investigation broadens the frontiers in plant-microbe interaction.

  14. Uptake and distribution of 232U in peas and barley

    International Nuclear Information System (INIS)

    Schreckhise, R.G.; Cline, J.F.

    1980-01-01

    The uptake of 232 U from soil and its distribution in peas and barley were examined under conditions which isolated root uptake from deposition on aboveground plant parts. Aboveground plant parts were harvested at maturity and analyzed for 232 U content by alpha-energy-analysis. The ratio of concentration (CR) of 232 U in the dry barley seeds to dry soil was 1.6 x 10 -4 while the CR values of the stem/leaf to dry soil fraction was 3.6 x 10 -3 . The Cr values for the pea seed, stem/pod and leaf components were 5.4 x 10 -4 , 3.3 x 10 -3 and 1.7 x 10 -2 , respectively. This indicates that the CR values used in certain radiological dose-assessment models may be high by about a factor of 100 when evaluating the consumption of seeds of legumes or cereal grains by man. (author)

  15. Variation in In Vitro Digestibility of Barley Protein

    DEFF Research Database (Denmark)

    Buchmann, N. B.

    1979-01-01

    In vitro digestibility of protein was measured with pepsin/pancreatin in 321 spring barley lines grown in the field. The variation in digestibility was far less than the variation in the protein content. A small environmental influence on the digestibility was found. Two entries had slightly...... impaired digestibilities; these findings were partially verified in a repeated field trial, but were not confirmed in vivo. In vitro digestibilities of barleys grown in pots at various N-levels were positively correlated with protein or hordein content. In vitro digestibility was negatively correlated...... with the fibre content in decortification fractions of Bomi and the high-lysine mutant Risø 1508. The digestibility was positively correlated with the hordein concentration for the Bomi fractions, but not for the 1508 fractions....

  16. Suppression of Zn stress on barley by irradiated chitosan

    International Nuclear Information System (INIS)

    Nagasawa, N.; Mitomo, H.; Ha, P.T.L.; Watanabe, S.; Ito, T.; Takeshita, H.; Yoshii, F.; Kume, T.

    2001-01-01

    Chitosan was irradiated up to 1000 kGy in solid state. Irradiation of chitosan caused the reduction of molecular weight. The molecular weight of the chitosan reduced from ca. 4 x 10 5 to ca. 6 x 10 3 by irradiation at 1000 kGy. For the barley growth promotion, irradiated chitosan showed the significant effect and 1000 kGy irradiated chitosan improved 20% of growth. Using the positron emitting tracer imaging system (PETIS), the effect of chitosan on uptake and transportation of 62 Zn in barley were investigated. It was found that the transportation of Zn from root to shoot and the damage of plant by Zn were suppressed with irradiated chitosan. (author)

  17. Suppression of Zn stress on barley by irradiated chitosan

    Energy Technology Data Exchange (ETDEWEB)

    Nagasawa, N.; Mitomo, H. [Gunma Univ., Faculty of Engineering, Department of Biological and Chemical Engineering, Kiryu, Gunma (Japan); Ha, P.T.L. [Nuclear Research Institute, Dalat (Viet Nam); Watanabe, S.; Ito, T.; Takeshita, H.; Yoshii, F.; Kume, T. [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment

    2001-03-01

    Chitosan was irradiated up to 1000 kGy in solid state. Irradiation of chitosan caused the reduction of molecular weight. The molecular weight of the chitosan reduced from ca. 4 x 10{sup 5} to ca. 6 x 10{sup 3} by irradiation at 1000 kGy. For the barley growth promotion, irradiated chitosan showed the significant effect and 1000 kGy irradiated chitosan improved 20% of growth. Using the positron emitting tracer imaging system (PETIS), the effect of chitosan on uptake and transportation of {sup 62}Zn in barley were investigated. It was found that the transportation of Zn from root to shoot and the damage of plant by Zn were suppressed with irradiated chitosan. (author)

  18. Radiation Hybrid Map of Barley Chromosome 3H

    Directory of Open Access Journals (Sweden)

    Mona Mazaheri

    2015-07-01

    Full Text Available Assembly of the barley ( L. genome is complicated by its large size (5.1 Gb and proportion of repetitive elements (84%. This process is facilitated by high resolution maps for aligning bacterial artificial chromosome (BAC contigs along chromosomes. Available genetic maps, however, do not provide accurate information on the physical position of a large portion of the genome located in recombination-poor regions. Radiation hybrid (RH mapping is an alternative approach, which is based on radiation-induced deletions along the length of chromosomes. In this study, the first RH map for barley chromosome 3H was developed. In total, 373 in vivo RH lines were generated by irradiating wheat ( L.–barley chromosome 3H addition lines and crossing them to a normal wheat cultivar. Each RH informative line (containing deletions had, on average, three deletions. The induced deletion size varied from 36.58 Kb to 576.00 Mb, with an average length of 52.42 Mb. This initial chromosome 3H radiation hybrid (3H-RH map had a 9.53× higher resolution than an analogous genetic map, reaching a maximum of >262.40× resolution in regions around the centromere. The final RH map was 3066.1 cR in length, with a 0.76 Mb resolution. It was estimated that the map resolution can be improved to an average of 30.34 Kb by saturating the 3H-RH map with molecular markers. The generated RH panel enabled alignment of BAC and sequenced contigs as small as 1.50 Kb in size. The high resolution and the coverage of poor-recombination regions make RH maps an ideal resource for barley genome assembly, as well as other genetic studies.

  19. Genomic Regions Influencing Seminal Root Traits in Barley

    Directory of Open Access Journals (Sweden)

    Hannah Robinson

    2016-03-01

    Full Text Available Water availability is a major limiting factor for crop production, making drought adaptation and its many component traits a desirable attribute of plant cultivars. Previous studies in cereal crops indicate that root traits expressed at early plant developmental stages, such as seminal root angle and root number, are associated with water extraction at different depths. Here, we conducted the first study to map seminal root traits in barley ( L.. Using a recently developed high-throughput phenotyping method, a panel of 30 barley genotypes and a doubled-haploid (DH population (ND24260 × ‘Flagship’ comprising 330 lines genotyped with diversity array technology (DArT markers were evaluated for seminal root angle (deviation from vertical and root number under controlled environmental conditions. A high degree of phenotypic variation was observed in the panel of 30 genotypes: 13.5 to 82.2 and 3.6 to 6.9° for root angle and root number, respectively. A similar range was observed in the DH population: 16.4 to 70.5 and 3.6 to 6.5° for root angle and number, respectively. Seven quantitative trait loci (QTL for seminal root traits (root angle, two QTL; root number, five QTL were detected in the DH population. A major QTL influencing both root angle and root number (/ was positioned on chromosome 5HL. Across-species analysis identified 10 common genes underlying root trait QTL in barley, wheat ( L., and sorghum [ (L. Moench]. Here, we provide insight into seminal root phenotypes and provide a first look at the genetics controlling these traits in barley.

  20. Aminopeptidases of Germinated and Non-Germinated Barley

    Directory of Open Access Journals (Sweden)

    Bojana Vukelić

    2009-01-01

    Full Text Available In processes of barley plant development, various endo- and exopeptidases are involved. To determine the type and number of aminopeptidases that could participate in barley seed germination and tissue growth, their activities in extracts of non-germinated and germinated barley (Hordeum vulgare L. cv. Angora grains and young tissues have been examined, and some of their properties determined. Aminopeptidases (AP hydrolysing 2-naphthylamides of various amino acids were present in dry and germinated grains, roots, seedlings and leaves, showing preferences for amino acids phenylalanine (Phe, arginine (Arg, leucine (Leu and methionine (Met, and lower activity towards alanine (Ala, proline (Pro, glycine (Gly and histidine (His. Levels and ratios of AP activities changed during germination and tissue development, indicating that APs of different specificities are required at different stages of germination and in young tissues. Thus, the increase of all aminopeptidase activities during the first 24 hours of germination and subsequent decrease show significant involvement in seed primary metabolism restoration. The activities of Arg- and HisAP are equally important in green malt. Seedlings and leaves have pronounced substrate specificity for Phe, Leu, Ala and Pro, while roots have the lowest AP specific activities. From the activities and determined properties, the presence of at least six aminopeptidases optimally active at pH=7.4–8.2 could be discerned in dry and germinated grains, and young tissues of Angora barley. Two aminopeptidases are most probably of broad substrate specificity, three show narrow preference with dominating Leu, Phe, or Pro/His, while one is specific for Arg.

  1. The Barley Grain Thioredoxin System – an Update

    Directory of Open Access Journals (Sweden)

    Per eHägglund

    2013-05-01

    Full Text Available Thioredoxin reduces disulfide bonds and play numerous important functions in plants. In cereal seeds, cytosolic h-type thioredoxin facilitates the release of energy reserves during the germination process and is recycled by NADPH-dependent thioredoxin reductase. This review presents a summary of the research conducted during the last ten years to elucidate the structure and function of the barley seed thioredoxin system at the molecular level combined with proteomic approaches to identify target proteins.

  2. Determination of Local Barley (Hordeum Vulgare) Crop Coefficient ...

    African Journals Online (AJOL)

    The average economic water productivity (EWP) of barley for the very wet, wet, normal, dry and very dry seasons scenario were 0.99, 0.7, 0.65, 0.57, and 0.44 USD m-3, respectively, whereas the corresponding crop water productivity (CWP) values for grain were 1.53, 1.08, 1.0, 0.88 and 0.68 kg m-3, respectively. The EWP ...

  3. Messenger RNAs from the Scutellum and Aleurone of Germinating Barley Encode (1-->3,1-->4)-beta-d-Glucanase, alpha-Amylase and Carboxypeptidase

    DEFF Research Database (Denmark)

    Mundy, John; Brandt, Anders; Fincher, Geoffrey B

    1985-01-01

    Polyclonal antibodies raised against barley (1-->3,1-->4)-beta-d-glucanase, alpha-amylase and carboxypeptidase were used to detect precursor polypeptides of these hydrolytic enzymes among the in vitro translation products of mRNA isolated from the scutellum and aleurone of germinating barley....... In the scutellum, mRNA encoding carboxypeptidase appeared to be relatively more abundant than that encoding alpha-amylase or (1-->3,1-->4)-beta-d-glucanase, while in the aleurone alpha-amylase and (1-->3,1-->4)-beta-d-glucanase mRNAs predominated. The apparent molecular weights of the precursors for (1......-->3,1-->4)-beta-d-glucanase, alpha-amylase, and carboxypeptidase were 33,000, 44,000, and 35,000, respectively. In each case these are slightly higher (1,500-5,000) than molecular weights of the mature enzymes. Molecular weights of precursors immunoprecipitated from aleurone and scutellum mRNA translation...

  4. Yield improvement in barley by using gamma-irradiation

    International Nuclear Information System (INIS)

    Benamer, Ibrahim Mohammed

    1990-01-01

    Breeding work for barley improvement in Libya is very rare. All varieties grown here are foreign varieties. Yield per hectare is low compared with other countries having similar climatic conditions. Productivity, lodging, disease resistance, drought and salt tolerance are the main characteristics that need to be improved. A mutation breeding programme for barley improvement was initiated at the Tajoura Nuclear Research Centre in 1983-1984. The objectives of this programme are the development of new lines that could be used directly or indirectly in the development of new varieties. The locally adapted barley (Hordeum vulgare L.) variety ''California Mariout'' was used as a parent material. Grains with 14% moisture were exposed to 200 Gy gamma-ray from 60 Co source at the Centre. Three experiments were conducted during 1986-1989. From the first experiment (1986-1987), 62 mutant lines were evaluated. From the second and third experiments (1987-1989), only seven mutant lines were evaluated. In the 1988-1989 experiment, the crop was irrigated and fertilised with 0, 100 and 200 kgN/ha. Lodging score was low in 0 kgN/ha and increased significantly by the increase in N level. None of the mutant lines more lodging resistant than the parent or the control. However, yield differences were significant and the application of 100 kgN/ha increased the grain yield

  5. Genetic analysis of aluminum tolerance in Brazilian barleys

    Directory of Open Access Journals (Sweden)

    Minella Euclydes

    2002-01-01

    Full Text Available Aluminum (Al toxicity is a major factor limiting barley growth in acid soils, and genotypes with adequate level of tolerance are needed for improving barley adaptation in Brazil. To study the inheritance of Al tolerance in Brazilian barleys, cultivars Antarctica 1, BR 1 and FM 404 were crossed to sensitive Kearney and PFC 8026, and intercrossed. Parental, F1, F2 and F6 generations were grown in nutrient solution containing 0.03, 0.05 and 0.07 mM of Al and classified for tolerance by the root tip hematoxylin staining assay. Tolerant by sensitive F2 progenies segregated three tolerant to one sensitive, fitting the 3:1 ratio expected for a single gene. The F6 populations segregated one tolerant to one sensitive also fitting a monogenic ratio. The F2 seedlings from crosses among tolerant genotypes scored the same as the parents. Since the population size used would allow detection of recombination as low as 7%, the complete absence of Al sensitive recombinants suggests that tolerance in these cultivars is most probably, controlled by the same gene. Thus, the potential for improving Al tolerance through recombination of these genotypes is very low and different gene sources should be evaluated.

  6. Screening of the aerodynamic and biophysical properties of barley malt

    Science.gov (United States)

    Ghodsvali, Alireza; Farzaneh, Vahid; Bakhshabadi, Hamid; Zare, Zahra; Karami, Zahra; Mokhtarian, Mohsen; Carvalho, Isabel. S.

    2016-10-01

    An understanding of the aerodynamic and biophysical properties of barley malt is necessary for the appropriate design of equipment for the handling, shipping, dehydration, grading, sorting and warehousing of this strategic crop. Malting is a complex biotechnological process that includes steeping; germination and finally, the dehydration of cereal grains under controlled temperature and humidity conditions. In this investigation, the biophysical properties of barley malt were predicted using two models of artificial neural networks as well as response surface methodology. Stepping time and germination time were selected as the independent variables and 1 000 kernel weight, kernel density and terminal velocity were selected as the dependent variables (responses). The obtained outcomes showed that the artificial neural network model, with a logarithmic sigmoid activation function, presents more precise results than the response surface model in the prediction of the aerodynamic and biophysical properties of produced barley malt. This model presented the best result with 8 nodes in the hidden layer and significant correlation coefficient values of 0.783, 0.767 and 0.991 were obtained for responses one thousand kernel weight, kernel density, and terminal velocity, respectively. The outcomes indicated that this novel technique could be successfully applied in quantitative and qualitative monitoring within the malting process.

  7. Variation in the agronomic and morphological traits in spring barley

    Directory of Open Access Journals (Sweden)

    N. Dyulgerov

    2017-12-01

    Full Text Available Abstract. The study was conducted to examine the variation in the agronomic and morphological traits in spring barley. For this purpose, 22 lines from the ICARDA High Input Barley Program for favorable environment and 3 check varieties (Rihane-03, VMorales and Veslets were tested in an alpha-lattice design with two replications at the Institute of Agriculture – Karnobat, Bulgaria in 2014 and 2015 growing season. The traits days to heading, plant height, number of tillers per plant, flag leaf length, flag leaf width, spike length, awn length, peduncle length, spikelet number per spike, grain number per spike, grain weight per spike, 1000 grains weight, grain yield, powdery mildew (Erysiphe graminis f. sp. hordei, net blotch (Pyrenophora teres f. teres and stripe rust (Puccinia striiformis f. sp. hordei infection were studied. Significant differences between lines for all studied traits were found. The number of fertile tillers per plant was significantly positively correlated with grain yield. Lines expressed higher grain yields, shorter stem, better tolerance to net blotch and stripe rust than Bulgarian check variety Veslets were identified. These genotypes can, therefore, be used as parents for the improvement of spring barley.

  8. Molecular characterization of barley yellow dwarf virus in Tunisia.

    Science.gov (United States)

    Bouallegue, M; Mezghani-Khemakhem, M; Bouktila, D; Makni, H; Makni, M

    2014-01-01

    Barley yellow dwarf disease is a worldwide ubiquitous virus disease of cereal crops. In order to characterize the B/CYDV isolates occurring in Tunisia, 240 barley leaves were randomly sampled from 6 fields following a North-South trend and analyzed by serological and molecular tests. DAS-ELISA results showed 40 positive samples with a prevalence of barley yellow dwarf virus (BYDV)-PAV (77.5%), followed by cereal yellow dwarf virus (CYDV)-RPV (25%) and BYDV-MAV (15%). Studies of the geographic distribution showed a high incidence of B/CYDV in the Tunisian Southern provinces. RT-PCR assays were performed to amplify the viral coat protein gene (CP) and sequence analyses revealed six BYDV-PAV haplotypes named PAV-TN1 to PAV-TN6. Phylogenetic analysis showed that the six Tunisian haplotypes were close to BYDV-PAV-II subspecies and had a strong similarity with Moroccan, Czech, French and German haplotypes. Although PAV-TN2 and PAV-TN5 showed up to 10% divergence from BYDV-PAV-II at the amino acid level, it seems to belong to the same subspecies but in a separated cluster. Our results will be important in developing appropriate control measures against BYDV disease in Tunisia.

  9. BarleyBase—an expression profiling database for plant genomics

    Science.gov (United States)

    Shen, Lishuang; Gong, Jian; Caldo, Rico A.; Nettleton, Dan; Cook, Dianne; Wise, Roger P.; Dickerson, Julie A.

    2005-01-01

    BarleyBase (BB) (www.barleybase.org) is an online database for plant microarrays with integrated tools for data visualization and statistical analysis. BB houses raw and normalized expression data from the two publicly available Affymetrix genome arrays, Barley1 and Arabidopsis ATH1 with plans to include the new Affymetrix 61K wheat, maize, soybean and rice arrays, as they become available. BB contains a broad set of query and display options at all data levels, ranging from experiments to individual hybridizations to probe sets down to individual probes. Users can perform cross-experiment queries on probe sets based on observed expression profiles and/or based on known biological information. Probe set queries are integrated with visualization and analysis tools such as the R statistical toolbox, data filters and a large variety of plot types. Controlled vocabularies for gene and plant ontologies, as well as interconnecting links to physical or genetic map and other genomic data in PlantGDB, Gramene and GrainGenes, allow users to perform EST alignments and gene function prediction using Barley1 exemplar sequences, thus, enhancing cross-species comparison. PMID:15608273

  10. Identification of Circular RNAs From the Parental Genes Involved in Multiple Aspects of Cellular Metabolism in Barley

    Directory of Open Access Journals (Sweden)

    Behrooz eDarbani

    2016-06-01

    Full Text Available RNA circularization made by head-to-tail back-splicing events is involved in the regulation of gene expression from transcriptional to post-translational levels. By exploiting RNA-Seq data and down-stream analysis, we shed light on the importance of circular RNAs in plants. The results introduce circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes including protein coding transcripts, microRNA, rRNA, and long non-coding/microprotein coding RNAs. The results shed light on the mitochondrial exonic circular RNAs and imply the importance of circular RNAs for regulation of mitochondrial genes. Importantly, we introduce circular RNAs in barley and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs' functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear transcripts.Keywords: circular RNAs, coding and non-coding transcripts, leaves, seeds, transfer cells, micronutrients, mitochondria

  11. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  12. Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    DEFF Research Database (Denmark)

    Pacak, Andrzej; Geisler, Katrin; Jørgensen, Bodil

    2010-01-01

    -expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species) have created...... a need for tools to study gene function in these species. Results Here we demonstrate the successful BSMV-mediated virus induced gene silencing (VIGS) of three different genes in barley roots, i.e. the barley homologues of the IPS1, PHR1, and PHO2 genes known to participate in Pi uptake and reallocation...... the wealth of genome information in the new cereal model plant B. distachyon. On the other hand, the silencing induced by BSMV in oat seemed too weak to be of practical use. The new BSMV vectors modified for ligation-free cloning will allow rapid insertion of plant gene fragments for future experiments....

  13. The wheat Lr34 gene provides resistance against multiple fungal pathogens in barley.

    Science.gov (United States)

    Risk, Joanna M; Selter, Liselotte L; Chauhan, Harsh; Krattinger, Simon G; Kumlehn, Jochen; Hensel, Goetz; Viccars, Libby A; Richardson, Terese M; Buesing, Gabriele; Troller, Anna; Lagudah, Evans S; Keller, Beat

    2013-09-01

    The Lr34 gene encodes an ABC transporter and has provided wheat with durable, broad-spectrum resistance against multiple fungal pathogens for over 100 years. Because barley does not have an Lr34 ortholog, we expressed Lr34 in barley to investigate its potential as a broad-spectrum resistance resource in another grass species. We found that introduction of the genomic Lr34 sequence confers resistance against barley leaf rust and barley powdery mildew, two pathogens specific for barley but not virulent on wheat. In addition, the barley lines showed enhanced resistance against wheat stem rust. Transformation with the Lr34 cDNA or the genomic susceptible Lr34 allele did not result in increased resistance. Unlike wheat, where Lr34-conferred resistance is associated with adult plants, the genomic Lr34 transgenic barley lines exhibited multipathogen resistance in seedlings. These transgenic barley lines also developed leaf tip necrosis (LTN) in young seedlings, which correlated with an up-regulation of senescence marker genes and several pathogenesis-related (PR) genes. In wheat, transcriptional expression of Lr34 is highest in adult plants and correlates with increased resistance and LTN affecting the last emerging leaf. The severe phenotype of transgenic Lr34 barley resulted in reduced plant growth and total grain weight. These results demonstrate that Lr34 provides enhanced multipathogen resistance early in barley plant development and implies the conservation of the substrate and mechanism of the LR34 transporter and its molecular action between wheat and barley. With controlled gene expression, the use of Lr34 may be valuable for many cereal breeding programmes, particularly given its proven durability. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Molecular phylogeography of domesticated barley traces expansion of agriculture in the Old World.

    Science.gov (United States)

    Saisho, Daisuke; Purugganan, Michael D

    2007-11-01

    Barley (Hordeum vulgare ssp. vulgare) was first cultivated 10,500 years ago in the Fertile Crescent and is one of the founder crops of Eurasian agriculture. Phylogeographic analysis of five nuclear loci and morphological assessment of two traits in >250 domesticated barley accessions reveal that landraces found in South and East Asia are genetically distinct from those in Europe and North Africa. A Bayesian population structure assessment method indicates that barley accessions are subdivided into six clusters and that barley landraces from 10 different geographical regions of Eurasia and North Africa show distinct patterns of distribution across these clusters. Using haplotype frequency data, it appears that the Europe/North Africa landraces are most similar to the Near East population (F ST = 0.15) as well as to wild barley (F ST = 0.11) and are strongly differentiated from all other Asian populations (F ST = 0.34-0.74). A neighbor-joining analysis using these F ST estimates also supports a division between European, North African, and Near East barley types from more easterly Asian accessions. There is also differentiation in the presence of a naked caryopsis and spikelet row number between eastern and western barley accessions. The data support the differential migration of barley from two domestication events that led to the origin of barley--one in the Fertile Crescent and another farther east, possibly at the eastern edge of the Iranian Plateau--with European and North African barley largely originating from the former and much of Asian barley arising from the latter. This suggests that cultural diffusion or independent innovation is responsible for the expansion of agriculture to areas of South and East Asia during the Neolithic revolution.

  15. 78 FR 44075 - Notice of Data Availability Concerning Renewable Fuels Produced From Barley Under the RFS Program

    Science.gov (United States)

    2013-07-23

    ... lifecycle GHG emissions of the 2005 gasoline baseline and of barley ethanol that is produced in 2022 in a... Availability Concerning Renewable Fuels Produced From Barley Under the RFS Program AGENCY: Environmental... is produced using barley as a feedstock. EPA's draft analysis indicates that ethanol produced from...

  16. Removal and isolation of germ-rich fractions from hull-less barley using a fitzpatrick comminuting mill

    Science.gov (United States)

    A process was developed to produce a germ-enriched fraction from hull-less barley using a Fitzpatrick Comminuting Mill followed by sieving. Hulled and hull-less barleys contain 1.5-2.5% oil and, like wheat kernels which contain wheat germ oil, much of the oil in barley kernels is in the germ fracti...

  17. A genome-wide association study of malting quality across eight U.S. barley breeding programs

    Science.gov (United States)

    This study leverages the breeding data of 1,862 breeding lines evaluated in 97 field trials for genome-wide association study of malting quality traits in barley. The breeding lines were six-row and two-row barley advanced breeding lines from eight barley breeding populations established at six pub...

  18. Quantitative Analysis of the Early Powdery Mildew Infection Stages on Resistant Barley Genotypes

    DEFF Research Database (Denmark)

    Andersen, J. B.; Torp, J.

    1986-01-01

    A classification system was developed, that allowed quantification of the leaf surface development of the barley powdery mildew fungus on barley. An experiment with Manchuria and Pallas as susceptible controls and 4 resistance gene each represented by three lines with different gene backgrounds s...

  19. Lysine Rich Proteins in the Salt-Soluble Protein Fraction of Barley

    DEFF Research Database (Denmark)

    Ingversen, J.; Køie, B.

    1973-01-01

    Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2.......Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2....

  20. 76 FR 61287 - Request for Public Comment on the United States Standards for Barley

    Science.gov (United States)

    2011-10-04

    ... barley marketing and define U.S. barley quality in the domestic and global marketplace. The standards define commonly used industry terms; contain basic principles governing the application of standards... standards using approved methodologies and can be applied at any point in the marketing chain. Furthermore...

  1. Characterizing the Pyrenophora teres f. maculata – barley interaction using pathogen genetics

    Science.gov (United States)

    Pyrenophora teres f. maculata is the cause of the foliar disease spot form net blotch (SFNB) on barley. To evaluate pathogen genetics underlying the P. teres f. maculata- barley interaction, we developed a 105-progeny population by crossing two globally diverse isolates, one from North Dakota, USA a...

  2. Transformation of Barley (Hordeum vulgar L.) by Agrobacterium tumefasciens Infection of In Vitro Cultured Ovules

    DEFF Research Database (Denmark)

    Holme, Inger Bæksted; Brinch-Pedersen, Henrik; Lange, Mette

    2012-01-01

    Agrobacterium-mediated transformation of in vitro cultured barley ovules is an attractive alternative to well-established barley transformation methods of immature embryos. The ovule culture system can be used for transformation with and without selection and has successfully been used to transform...

  3. The draft genome of Tibetan hulless barley reveals adaptive patterns to the high stressful Tibetan Plateau.

    Science.gov (United States)

    Zeng, Xingquan; Long, Hai; Wang, Zhuo; Zhao, Shancen; Tang, Yawei; Huang, Zhiyong; Wang, Yulin; Xu, Qijun; Mao, Likai; Deng, Guangbing; Yao, Xiaoming; Li, Xiangfeng; Bai, Lijun; Yuan, Hongjun; Pan, Zhifen; Liu, Renjian; Chen, Xin; WangMu, QiMei; Chen, Ming; Yu, Lili; Liang, Junjun; DunZhu, DaWa; Zheng, Yuan; Yu, Shuiyang; LuoBu, ZhaXi; Guang, Xuanmin; Li, Jiang; Deng, Cao; Hu, Wushu; Chen, Chunhai; TaBa, XiongNu; Gao, Liyun; Lv, Xiaodan; Abu, Yuval Ben; Fang, Xiaodong; Nevo, Eviatar; Yu, Maoqun; Wang, Jun; Tashi, Nyima

    2015-01-27

    The Tibetan hulless barley (Hordeum vulgare L. var. nudum), also called "Qingke" in Chinese and "Ne" in Tibetan, is the staple food for Tibetans and an important livestock feed in the Tibetan Plateau. The diploid nature and adaptation to diverse environments of the highland give it unique resources for genetic research and crop improvement. Here we produced a 3.89-Gb draft assembly of Tibetan hulless barley with 36,151 predicted protein-coding genes. Comparative analyses revealed the divergence times and synteny between barley and other representative Poaceae genomes. The expansion of the gene family related to stress responses was found in Tibetan hulless barley. Resequencing of 10 barley accessions uncovered high levels of genetic variation in Tibetan wild barley and genetic divergence between Tibetan and non-Tibetan barley genomes. Selective sweep analyses demonstrate adaptive correlations of genes under selection with extensive environmental variables. Our results not only construct a genomic framework for crop improvement but also provide evolutionary insights of highland adaptation of Tibetan hulless barley.

  4. Thioredoxin reductase from barley: Structure, recognition of thioredoxin, protein engineering and catalytic mechanism

    DEFF Research Database (Denmark)

    Kirkensgaard, Kristine Groth

    from barley and E. coli Finally, the expression levels of HvNTR1, HvNTR2, HvTrxh1, HvTrxh2 and α‐amylase during imbibition was examined in different tissues of barley seeds by Q‐PCR and micro‐ array data analysis. The effects of the plant hormone gibberellic acid, dormancy/after‐ ripening, light...

  5. Differential Synthesis in Vitro of Barley Aleurone and Starchy Endosperm Proteins

    DEFF Research Database (Denmark)

    Mundy, John; Hejgaard, Jørn; Hansen, Annette

    1986-01-01

    To widen the selection of proteins for gene expression studies in barley seeds, experiments were performed to identify proteins whose synthesis is differentially regulated in developing and germinating seed tissues. The in vitro synthesis of nine distinct barley proteins was compared using mRNAs ...

  6. Malt barley yield and quality affected by irrigation, tillage, crop rotation, and nitrogen fertilization

    Science.gov (United States)

    Little is known about the comparison of management practices on malt barley (Hordeum vulgare L.) yield and quality in irrigated and non-irrigated cropping systems. We evaluated the effects of irrigation, tillage, cropping system, and N fertilization on malt barley yield and quality in a sandy loam s...

  7. Microarray Analysis of Late Response to Boron Toxicity in Barley (Hordeum vulgare L.) Leaves

    NARCIS (Netherlands)

    Oz, M.T.; Yilmaz, R.; Eyidogan, F.; Graaff, de L.H.; Yucel, M.; Oktem, H.A.

    2009-01-01

    DNA microarrays, being high-density and high-throughput, allow quantitative analyses of thousands of genes and their expression patterns in parallel. In this study, Barley1 GereChip was used to investigate transcriptome changes associated with boron (B) toxicity in a sensitive barley cultivar

  8. Demarcation of mutant-carrying regions in barley plants after ethylmethane-sulfonate seed treatment

    DEFF Research Database (Denmark)

    Jacobsen, P.

    1966-01-01

    The branching pattern of the barley plant is analyzed and the anatomical structure of the resting barley embryo studied in longitudinal and cross-sections as well as by dissection techniques. The frequency and distribution of ethylmethane-sulfonate induced chloroplast and morphological seedling...

  9. Immunomodulatory properties of oat and barley β-glucan populations on bone marrow derived dendritic cells

    NARCIS (Netherlands)

    Rosch, Christiane; Meijerink, Marjolein; Delahaije, Roy J.B.M.; Taverne, Nico; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.

    2016-01-01

    Specific structures of oat and barley β(1,3)(1,4)-glucans induced different in vitro immunomodulatory effects in bone marrow derived dendritic cells (BMDC) from TLR2/4 knock out mice. All barley β-glucan fractions induced larger amounts of cytokines in BMDCs than their oat equivalents. The

  10. Effect of pulsed electric field on the germination of barley seeds

    DEFF Research Database (Denmark)

    Dymek, Katarzyna; Dejmek, Petr; Panarese, Valentina

    2012-01-01

    This study explores metabolic responses of germinating barley seeds upon the application of pulsed electric fields (PEF). Malting barley seeds were steeped in aerated water for 24 h and PEF-treated at varying voltages (0 (control), 110, 160, 240, 320, 400 and 480 V). The seeds were then allowed...

  11. Effect of microwave freeze drying on quality and energy supply in drying of barley grass.

    Science.gov (United States)

    Cao, Xiaohuang; Zhang, Min; Mujumdar, Arun S; Zhong, Qifeng; Wang, Zhushang

    2018-03-01

    Young barley grass leaves are well-known for containing the antioxidant substances flavonoid and chlorophyll. However, low product quality and energy efficiency exist with respect to the dehydration of barley grass leaves. To improve energy supply and the quality of barley grass, microwave heating instead of contact heat was applied for the freeze drying of barley grass at a pilot scale at 1, 1.5 and 2 W g -1 , respectively; After drying, energy supply and quality parameters of color, moisture content, chlorophyll, flavonoids, odors of dried barley grass were determined to evaluate the feasibility of the study. Microwave freeze drying (MFD) allowed a low energy supply and high contents of chlorophyll and flavonoids. A lightness value of 60.0, a green value of -11.5 and an energy supply of 0.61 kW h -1  g -1 were observed in 1.5 W g -1 MFD; whereas drying time (7 h) decreased by 42% compared to contact heating. Maximum content of flavonoid and chlorophyll was 11.7 and 12.8 g kg -1 barley grass. Microwave heating leads to an odor change larger than that for contact heating observed for the freeze drying of barley grass. MFD retains chlorophyll and flavonoids, as well as colors and odors of samples, and also decreases energy consumption in the freeze drying of barley grass. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. High-resolution mapping of the barley Ryd3 locus controlling tolerance to BYDV

    NARCIS (Netherlands)

    Lüpken, T.; Stein, N.; Perovic, D.; Habekuss, A.; Serfling, A.; Krämer, I.; Hähnel, U.; Steuernagel, B.; Scholz, U.; Ariyadasa, R.; Martis, M.; Mayer, K.; Niks, R.E.; Collins, N.C.; Friedt, W.; Ordon, F.

    2014-01-01

    Barley yellow dwarf disease (BYD) is transmitted by aphids and is caused by different strains of Barley yellow dwarf virus (BYDV) and Cereal yellow dwarf virus (CYDV). Economically it is one of the most important diseases of cereals worldwide. Besides chemical control of the vector, growing of

  13. Linkage disequilibrium mapping of morphological, resistance, and other agronomically relevant traits in modern spring barley cultivars

    NARCIS (Netherlands)

    Kraakman, A.T.W.; Martinez, F.; Mussiraliev, B.; Eeuwijk, van F.A.; Niks, R.E.

    2006-01-01

    A set of 148 modern spring barley cultivars was explored for the extent of linkage disequilibrium (LD) between genes governing traits and nearby marker alleles. Associations of agronomically relevant traits (days to heading, plant height), resistance traits (leaf rust, barley yellow dwarf virus

  14. Barley uptake of N deposited in the rhizosphere of associated field pea

    DEFF Research Database (Denmark)

    Jensen, E.S.

    1996-01-01

    vulgare L.) was determined in three pot experiments using a direct split-root N-15-labelling technique. The donor (pea) and receiver (barley) plants were grown with their root systems either mixed within the same soil compartment or separated by a 20 mu m mesh bag. Pea-derived N was detected in barley...

  15. Determinants of barley grain yield in a wide range of Mediterranean environments

    NARCIS (Netherlands)

    Francia, E.; Tondelli, A.; Rizza, F.; Badeck, F.W.; Li Destri Nicosia, O.; Akar, T.; Grando, S.; Al-Yassin, A.; Benkelkacim, A.; Thomas, W.T.B.; Eeuwijk, van F.A.; Romagosa, I.; Stanca, A.M.; Pechionni, N.

    2011-01-01

    Barley grain yield in rainfed Mediterranean regions can be largely influenced by terminal drought events. In this study the ecophysiological performance of the ‘Nure’ (winter) × ‘Tremois’ (spring) barley mapping population (118 Doubled Haploids, DHs) was evaluated in a multi-environment trial of

  16. Malt quality of 4 barley (Hordeum vulgare L.) grain varieties grown ...

    African Journals Online (AJOL)

    user

    2011-01-31

    Jan 31, 2011 ... (TKMWL) was 11 to 13% and is in the range for desirably modified barley grain on malting. The varieties ... Key words: Diastatic tendency, malt extract, FAN, malt barley qualities, net blotch, propiconazole, starch flour pasting. ... phate was applied at the rate of 100 kg/ha (blanket recommen- dation). Weeds ...

  17. Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Skau

    -glucans were compared in a human intervention study. The work first focussed on large-scale extraction and physico-chemical characterisation of barley and oat β-glucans. The second step was to investigate the in vitro health effects of barley and oat β-glucans in relation to their physico-chemical properties....... Finally, health effects from barley and oat β-glucans were studied in vivo in humans using traditional biomarkers and plasma metabolomics. Results from Papers I demonstrated that structural characteristics and viscous properties of barley and oat β-glucans dominate the functional traits over the presence...... studies were that small molecule interaction with barley and oat β-glucans is influenced by degree of polymerisation and β-glucan fine structure whereas β-glucan solubility and aggregation are key elements for understanding their immune modulating capacity. Results from the Paper V in vivo human study...

  18. Nitrogen immobilization and mineralization during initial decomposition of 15N-labelled pea and barley residues

    DEFF Research Database (Denmark)

    Jensen, E.S.

    1997-01-01

    The immobilization and mineralization of N following plant residue incorporation were studied in a sandy loam soil using N-15-labelled field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) straw. Both crop residues caused a net immobilization of soil-derived inorganic N during...... the complete incubation period of 84 days. The maximum rate of N immobilization was found to 12 and 18 mg soil-derived N g(-1) added C after incorporation of pea and barley residues, respectively. After 7 days of incubation, 21% of the pea and 17% of the barley residue N were assimilated by the soil microbial...... the decomposition of the barley residue. The net mineralization of residue-derived N was 2% in the barley and 22% in the pea residue treatment after 84 days of incubation. The results demonstrated that even if crop residues have a relative low C/N ratio (15), transient immobilization of soil N in the microbial...

  19. The fungal community structure of barley malts from diverse geographical regions correlates with malt quality parameters.

    Science.gov (United States)

    Kaur, Mandeep; Bowman, John P; Stewart, Doug C; Evans, David E

    2015-12-23

    Malt is a preferred base for fermentations that produce beer or whisky. Barley for malt is grown under diverse environments in different geographical locations. Malt provides an ecological niche for a varied range of microorganisms with both positive and negative effects on its quality for brewing. Little information exists in the literature on the microbial community structure of Australian malt as well as broader global geographical differences in the associated fungal and bacterial communities. The aims of the present study were to compare the bacterial and fungal community structures of Australian commercial malt with its international counterparts originating from different geographical regions using terminal restriction fragment length polymorphism (TRFLP) fingerprinting and clone library analyses of ribosomal RNA genes. Further, the relationship between malt associated microbial communities and conventional malt quality parameters was also compared. Results showed that differences in fungal communities of malts from different geographical location were more pronounced than bacterial communities. TRFLP analysis discriminated high quality commercial malts with low fungal loads from malts deliberately infected with fungal inocula (Fusarium/Penicillium). Malt moisture, beta-amylase, α-amylase and limit dextrinase contents showed significant correlations with fungal community structure. This investigation concluded that fungal community structure was more important to subsequent malt quality outcomes than bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Assessment of genetic diversity among barley cultivars and breeding lines adapted to the US Pacific Northwest, and its implications in breeding barley for imidazolinone-resistance.

    Directory of Open Access Journals (Sweden)

    Sachin Rustgi

    Full Text Available Extensive application of imidazolinone (IMI herbicides had a significant impact on barley productivity contributing to a continuous decline in its acreage over the last two decades. A possible solution to this problem is to transfer IMI-resistance from a recently characterized mutation in the 'Bob' barley AHAS (acetohydroxy acid synthase gene to other food, feed and malting barley cultivars. We focused our efforts on transferring IMI-resistance to barley varieties adapted to the US Pacific Northwest (PNW, since it comprises ∼23% (335,000 ha of the US agricultural land under barley production. To effectively breed for IMI-resistance, we studied the genetic diversity among 13 two-rowed spring barley cultivars/breeding-lines from the PNW using 61 microsatellite markers, and selected six barley genotypes that showed medium to high genetic dissimilarity with the 'Bob' AHAS mutant. The six selected genotypes were used to make 29-53 crosses with the AHAS mutant and a range of 358-471 F1 seeds were obtained. To make informed selection for the recovery of the recipient parent genome, the genetic location of the AHAS gene was determined and its genetic nature assessed. Large F2 populations ranging in size from 2158-2846 individuals were evaluated for herbicide resistance and seedling vigor. Based on the results, F3 lines from the six most vigorous F2 genotypes per cross combination were evaluated for their genetic background. A range of 20%-90% recovery of the recipient parent genome for the carrier chromosome was observed. An effort was made to determine the critical dose of herbicide to distinguish between heterozygotes and homozygotes for the mutant allele. Results suggested that the mutant can survive up to the 10× field recommended dose of herbicide, and the 8× and 10× herbicide doses can distinguish between the two AHAS mutant genotypes. Finally, implications of this research in sustaining barley productivity in the PNW are discussed.

  1. Effects of process parameters on the properties of barley containing snacks enriched with brewer's spent grain.

    Science.gov (United States)

    Kirjoranta, Satu; Tenkanen, Maija; Jouppila, Kirsi

    2016-01-01

    Brewer's spent grain (BSG), a by-product of malting of barley in the production of malt extract, was used as an ingredient in extruded barley-based snacks in order to improve the nutritional value of the snacks and widen the applications of this by-product in food sector. The effects of the extrusion parameters on the selected properties of the snacks were studied. Snacks with different ingredients including whole grain barley flour, BSG, whey protein isolate (WPI), barley starch and waxy corn starch were produced in 5 separate trials using a co-rotating twin-screw extruder. Extrusion parameters were water content of the mass (17-23 %), screw speed (200-500 rpm) and temperature of the last section and die (110-150 °C). Expansion, hardness and water content of the snacks were determined. Snacks containing barley flour and BSG (10 % of solids) had small expansion and high hardness. Addition of WPI (20 % of solids) increased expansion only slightly. Snacks with high expansion and small hardness were obtained when part of the barley flour was replaced with starch (barley or waxy corn). Yet, the highest expansion and the smallest hardness were achieved when barley flour was used with barley starch and WPI without BSG. Furthermore, expansion increased by increasing screw speed and decreasing water content of the mass in most of the trials. This study showed that BSG is a suitable material for extruded snacks rich in dietary fiber. Physical properties of the snacks could be improved by using barley or waxy corn starch and WPI.

  2. Soluble sugar availability of aerobically germinated barley, oat and rice coleoptiles in anoxia.

    Science.gov (United States)

    Kato-Noguchi, Hisashi; Yasuda, Yukihiro; Sasaki, Ryosuke

    2010-12-15

    Physiological and metabolic responses to anoxia were compared for aerobically germinated seedlings of barley (Hordeum vulgare), oat (Avena sativa) and rice (Oryza sativa). Coleoptile growth of barley, oat and rice seedlings was suppressed by a 24 h-anoxic stress, but the growth of the rice coleoptiles was much greater than that of the barley and oat coleoptiles. ATP concentration in the anoxic rice coleoptiles was greater than that in the anoxic barley and oat coleoptiles. Concentrations of ethanol and activity of alcohol dehydrogenase (ADH) in the anoxic rice coleoptiles were also greater than those of the anoxic barley and oat coleoptiles, suggesting that ethanolic fermentation may be more active in the rice coleoptiles than in the barley and oat coleoptiles, where glycolysis and ethanolic fermentation are the main source of ATP production. Soluble sugar concentration in the anoxic rice coleoptiles was greater than that of the anoxic barley and oat coleoptiles. However, α-amylase, which catabolizes reserve starch to soluble sugars, was active in anoxic barley, oat and rice endosperms, and soluble sugar concentration in the anoxic barley, oat and rice endosperms was not significantly different. Therefore, anoxia stress may inhibit soluble sugar transport from the endosperms to the coleoptiles in barley and oat more than in rice. Since the availability of soluble sugar is essential for operation of glycolysis and fermentation in plant cells, ability for sugar transport from the endosperms to the coleoptiles may be one means to distinguish the coleoptile growth of these plant species in anoxia and anoxia tolerance of these plants. Copyright © 2010 Elsevier GmbH. All rights reserved.

  3. Characterization of the Entire Cystatin Gene Family in Barley and Their Target Cathepsin L-Like Cysteine-Proteases, Partners in the Hordein Mobilization during Seed Germination1[W

    Science.gov (United States)

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-01-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340

  4. Effects of Pleurotus sapidus (Schulzer Sacc. treatment on nutrient composition and ruminal fermentability of barley straw, barley rootless, and a mixture of the two

    Directory of Open Access Journals (Sweden)

    Alfonso Soto-Sánchez

    2015-09-01

    Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.

  5. The barley apoptosis suppressor homologue BAX inhibitor-1 compromises nonhost penetration resistance of barley to the inappropriate pathogen Blumeria graminis f. sp. tritici.

    Science.gov (United States)

    Eichmann, Ruth; Schultheiss, Holger; Kogel, Karl-Heinz; Hückelhoven, Ralph

    2004-05-01

    BAX inhibitor-1 (BI-1) proteins have been characterized as suppressors of programmed cell death in mammals and plants. The barley BI-1 is a suppressor of nonspecific background resistance and mlo-mediated penetration resistance to the biotrophic fungal pathogen Blumeria graminis f. sp. hordei when overexpressed in epidermal cells of barley. We report here that BI-1 expression is also slightly up-regulated during interaction with the inappropriate wheat pathogen Blumeria graminis f. sp. tritici. Significantly, overexpression of BI-1 in single epidermal cells of barley by microprojectile-mediated transformation rendered cells susceptible to penetration by inappropriate B. graminis f. sp. tritici. The degree of transgene-induced accessibility to B. graminis f. sp. tritici was thereby similar to the effect achieved by overexpression of the defense suppressor gene Mlo and could not be further enhanced by double expression of both BI-1 and Mlo. Confocal laser scanning microscopy was used to locate a functional green fluorescing GFP:BI-1 fusion protein in endomembranes and the nuclear envelope of barley epidermal cells. Together, enhanced expression of barley BI-1 suppresses penetration resistance to B. graminis f. sp. tritici, linking barley nonhost resistance with cell death regulation.

  6. Breeding cultivars of barley and mustard containing biochemical mutants

    International Nuclear Information System (INIS)

    Oram, R.N.

    1990-01-01

    Full text: The inactivation of dominant and co-dominant alleles is becoming increasingly important in changing the composition of seed carbohydrates, protein, oil, fibre and secondary products to suit modern food and feed technologies. In barley, breeding lines adapted to south-eastern Australian conditions have been developed containing a waxy endosperm from the Japanese variety 'Sumire Mochi', the high lysine gene lys from cv. 'Hiproly' of Ethiopia, and the induced high lysine mutant gene lys 3a from 'Risoe 1508'. The improved mutant lines yield 12-34% less than the highest yielding feed barley. The lys and lys 3a alleles suppress the formation of prolamins, the waxy allele inhibits the formation of amylose. It seems difficult to modify the background genotype to fully compensate for the reduction of major storage carbohydrate or protein compounds. However, waxy barleys have uses in some human foods and a premium can be paid to producers. The grain of the provisionally-patented waxy cultivar Wasiro is suitable for pearling. It contains 5% β-glucan (soluble fibre) and therefore should be as effective as oat bran for reducing blood cholesterol. In Indian mustard (Brassica juncea), three cultivars differing in date of maturity, each containing the spontaneous mutant alleles for low erucic acid levels in the seed oil, have been developed to produce a high quality, mildly flavoured cooking/salad oil. The concentration of glucosinolates in the seed meal must be reduced to make it palatable and non-toxic to pigs and poultry. Three B. juncea lines were treated in up to four successive generations with gamma rays or EMS. 60,000 seed samples were analysed in subsequent generations. Two induced mutants with reduced glucosinolate concentrations are now available besides 4 naturally-occurring sources with only little reduced yields. Recombination may give a high-yielding low erucic acid and low glucosinolate variety of B. juncea. (author)

  7. Thiamine treatments alleviate aphid infestations in barley and pea.

    Science.gov (United States)

    Hamada, Afaf M; Jonsson, Lisbeth M V

    2013-10-01

    Treatment of plants with thiamine (Vitamin B1) has before been shown to activate plant defence against microorganisms. Here, we have studied the effects of thiamine treatments of plants on aphid reproduction and behaviour. The work was mainly carried out with bird cherry-oat aphid (Rhopalosiphum padi L.) on barley (Hordeum vulgare L.). Aphid population growth and aphid acceptance on plants grown from seeds soaked in a 150μM thiamine solution were reduced to ca. 60% of that on control plants. R. padi life span and the total number of offspring were reduced on barley plants treated with thiamine. Healthy aphids and aphids infected with the R. padi virus were similarly affected. Spraying or addition of thiamine at 150μM to nutrient solutions likewise resulted in reduced aphid population growth to ca. 60%, as did plant exposure to thiamine odour at 4mM. Thiamine treatments resulted in reduced aphid population growth also when tested with grain aphid (Sitobion avenae F.) on barley and pea aphid (Acyrthosiphon pisum H.) on pea (Pisum sativum L.). There was no direct effect of thiamine on aphid reproduction or thiamine odour on aphid behaviour, as evaluated using artificial diets and by olfactometer tests, respectively. Two gene sequences regulated by salicylic acid showed higher transcript abundance and one gene sequence regulated by methyl jasmonate showed lower transcript abundance in thiamine-treated plants but not in control plants after aphid infestation. These results suggest that the aphid antibiosis and antixenosis effects may be related to priming of defence, but more studies are needed to explain the effects against aphids. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Elevated phosphorus impedes manganese acquisition by barley plants

    Directory of Open Access Journals (Sweden)

    Pai ePedas

    2011-08-01

    Full Text Available The occurrence of manganese (Mn deficiency in cereal crops has increased in recent years. This coincides with increasing phosphorus (P status of many soils due to application of high levels of animal manure. In order to test the hypothesis that elevated P my lead to Mn deficiency we have here conducted a series of hydroponics and soil experiments examining how the P supply affects the Mn nutrition of barley. Evidence for a direct negative interaction between P and Mn during root uptake was obtained by online inductively coupled plasma mass spectrometry (ICP-MS. Addition of a pulse of KH2PO4 rapidly and significantly reduced root Mn uptake, while a similar concentration of KCl had no effect. Addition of a similar P pulse to the same nutrient solution without plants did not affect the concentration of Mn, revealing that no precipitation of Mn-P species was occurring. Barley plants growing at a high P supply in hydroponics with continuous replenishment of Mn had up to 50% lower Mn concentration in the youngest leaves than P limited plants. This P-induced depression of foliar Mn accelerated the development of Mn deficiency as evidenced by a marked change in the fluorescence induction kinetics of chlorophyll a. Also plants growing in soil exhibited lower leaf Mn concentrations in response to elevated P. In contrast, leaf concentrations of Fe, Cu and N increased with the P supply, supporting that the negative effect of P on Mn acquisition was specific rather than due to a general dilution effect. It is concluded that elevated P supply directly interferes with Mn uptake in barley roots and that this negative interaction can induce Mn deficiency in the shoot. This finding has major implications in commercial plant production where many soils have high P levels.

  9. Objectives and results of barley breeding in Australia

    International Nuclear Information System (INIS)

    Sparrow, D.H.B.

    1990-01-01

    An important current development in Australian barley improvement is the release of semi-dwarf cultivars. These are derived from Abed Deba, Triumph or Aapo which are believed to have an allelic series of mutant genes. A common problem with these genes is their association with relatively late maturity and small grain, limiting current cultivars to rainfall areas above 450mm per annum. The first release 'Skiff' (S.A., N.S.W. 1988) is to be followed by selections from 'Forrest' x 'Aapo' in Western Australia and 'Grimmett' x 'Triumph' in Queensland, whilst 'Triumph' is already being grown in Tasmania. (author)

  10. Salt Stress and Homobrassinosteroid Interactions during Germination in Barley Roots

    OpenAIRE

    Sevgi MARAKLI; Aslihan TEMEL; Nermin GOZUKIRMIZI

    2014-01-01

    Potential alleviation effects of Homobrassinosteroid (HBR) (0.5 and 1 µM HBR) on root germination, cell division and antioxidant system enzymes (superoxide dismutase and catalase) of barley (Hordeum vulgare L. cv. ‘Hilal’) roots grown under different salt concentrations (150 mM and 250 mM) were investigated during 48 and 72 h at dark with their controls. Salt applications decreased primary root lengths, seminal root lengths, number of roots from one seed, mitotic activity and induced mitotic ...

  11. Enzymatic hydrolysis of pretreated barley and wheat straw

    DEFF Research Database (Denmark)

    Rosgaard, Lisa

    2007-01-01

    feeding strategy to increase the substrate loading in the hydrolysis reaction. The substrate for the enzymatic hydrolysis was primarily steam pretreated wheat and barley straw since these substrates were the primary feedstocks for the Babilafuente Bioethanol process. The initial work showed...... addition of hemicellulase activities to complement the cellulase activities found in Celluclast. Further improving the hydrolysis process in relation to the Babilafuente Bioethanol process might be achieved applying a substrate fed-batch strategy, if optimised in relation to timing of the substrate...

  12. Obtaining barley haploid embryos and seedlings using anther culture technique

    International Nuclear Information System (INIS)

    Arabi, M.I.E.; Al-Safadi, B.; Mir Ali, N.

    2000-01-01

    The effect of three barley genotypes (Igri, Arabi abiad, and Taqa 76), three irradiation doses (0, 5, and 10 Gy), and two media (FW, modified FW), on the number of formed embryos, and the ratio between regenerated embryos to green seedlings and albinos, were studied using anther culture. Also the study involved the compatibility between seedling morphology and chromosome number. results indicated significant differences among the genotypes, and media in callus and embryos formation and also in the ratio and albino seedlings. However, the effect of gamma rays dose was significant only on embryos regeneration. A high percentage of compatibility (90%) was obtained between the seedling morphology and chromosome number. (author)

  13. Decision Support System for Optimized Herbicide Dose in Spring Barley

    DEFF Research Database (Denmark)

    Sønderskov, Mette; Kudsk, Per; Mathiassen, Solvejg K

    2014-01-01

    for herbicide application in spring barley in Denmark were validated through field experiments targeting three levels of weed control requirement. Satisfactory weed control levels at harvest were achieved by a medium control level requirement generating substantial herbicide reductions ( 60% measured...... as the Treatment Frequency Index (TFI)) compared to a high level of required weed control. The observations indicated that the current level of weed control required is robust for a range of weed scenarios. Weed plant numbers 3 wk after spraying indicated that the growth of the weed species were inhibited...

  14. Genetic diversity and structure analysis in wild and landraces of barley from Jordan by using ISJ markers

    International Nuclear Information System (INIS)

    Baloch, A. W.; Balogh, M. J.; Baloch, M.; Baloch, I. A.

    2016-01-01

    The present experiment was carried out to estimate genetic diversity and genetic structure in cultivated and wild barley populations collected from Jordan which is considered as primary gene pool of barley. In a total, 94 cultivated barley accessions composed of 4 populations and 52 wild barley accessions consisted of 3 populations were used for genetic analysis using 7 Intron Splice Junction (ISJ) markers. The genetic diversity index (He) of cultivated barley ranged between 0.049 and 0.060; whereas that of wild barley populations ranged between 0.084 and 0.146, suggesting that wild resources of barley harbored greater genetic diversity than its domesticated counterpart, reflecting that barley domestication occurred with genetic bottleneck. Analysis of molecular variance showed high genetic variations among rather than within populations, referring that high genetic differentiation of barley populations caused by genetic and geographical separation of the populations in the harsh growing conditions of Fertile Crescent. Principal coordinate, clustering and structure analysis not only separated cultivated and wild barley, but also each single population, showing their genetic basis and original sample site. The obtained Results also revealed that there is lesser genetic communication between cultivated and wild barley under natural environments. The current findings can better be exploited for collection and utilization of plant germplasms. (author)

  15. Classification of Fusarium-Infected Korean Hulled Barley Using Near-Infrared Reflectance Spectroscopy and Partial Least Squares Discriminant Analysis.

    Science.gov (United States)

    Lim, Jongguk; Kim, Giyoung; Mo, Changyeun; Oh, Kyoungmin; Yoo, Hyeonchae; Ham, Hyeonheui; Kim, Moon S

    2017-09-30

    The purpose of this study is to use near-infrared reflectance (NIR) spectroscopy equipment to nondestructively and rapidly discriminate Fusarium -infected hulled barley. Both normal hulled barley and Fusarium -infected hulled barley were scanned by using a NIR spectrometer with a wavelength range of 1175 to 2170 nm. Multiple mathematical pretreatments were applied to the reflectance spectra obtained for Fusarium discrimination and the multivariate analysis method of partial least squares discriminant analysis (PLS-DA) was used for discriminant prediction. The PLS-DA prediction model developed by applying the second-order derivative pretreatment to the reflectance spectra obtained from the side of hulled barley without crease achieved 100% accuracy in discriminating the normal hulled barley and the Fusarium -infected hulled barley. These results demonstrated the feasibility of rapid discrimination of the Fusarium -infected hulled barley by combining multivariate analysis with the NIR spectroscopic technique, which is utilized as a nondestructive detection method.

  16. Small RNA profiling reveals regulation of Arabidopsis miR168 and heterochromatic siRNA415 in response to fungal elicitors.

    Science.gov (United States)

    Baldrich, Patricia; Kakar, Klementina; Siré, Christelle; Moreno, Ana Beatriz; Berger, Angélique; García-Chapa, Meritxell; López-Moya, Juan José; Riechmann, José Luis; San Segundo, Blanca

    2014-12-10

    Small RNAs (sRNAs), including small interfering RNAs (siRNAs) and microRNAs (miRNAs), have emerged as important regulators of eukaryotic gene expression. In plants, miRNAs play critical roles in development, nutrient homeostasis and abiotic stress responses. Accumulating evidence also reveals that sRNAs are involved in plant immunity. Most studies on pathogen-regulated sRNAs have been conducted in Arabidopsis plants infected with the bacterial pathogen Pseudomonas syringae, or treated with the flagelin-derived elicitor peptide flg22 from P. syringae. This work investigates sRNAs that are regulated by elicitors from the fungus Fusarium oxysporum in Arabidopsis. Microarray analysis revealed alterations on the accumulation of a set of sRNAs in response to elicitor treatment, including miRNAs and small RNA sequences derived from massively parallel signature sequencing. Among the elicitor-regulated miRNAs was miR168 which regulates ARGONAUTE1, the core component of the RNA-induced silencing complex involved in miRNA functioning. Promoter analysis in transgenic Arabidopsis plants revealed transcriptional activation of MIR168 by fungal elicitors. Furthermore, transgenic plants expressing a GFP-miR168 sensor gene confirmed that the elicitor-induced miR168 is active. MiR823, targeting Chromomethylase3 (CMT3) involved in RNA-directed DNA methylation (RdDM) was also found to be regulated by fungal elicitors. In addition to known miRNAs, microarray analysis allowed the identification of an elicitor-inducible small RNA that was incorrectly annotated as a miRNA. Studies on Arabidopsis mutants impaired in small RNA biogenesis demonstrated that this sRNA, is a heterochromatic-siRNA (hc-siRNA) named as siRNA415. Hc-siRNAs are known to be involved in RNA-directed DNA methylation (RdDM). SiRNA415 is detected in several plant species. Results here presented support a transcriptional regulatory mechanism underlying MIR168 expression. This finding highlights the importance of miRNA

  17. Barley fibre and wet distillers' solubles in the diet of growing cattle

    Directory of Open Access Journals (Sweden)

    T. ROOT

    2008-12-01

    Full Text Available Twenty-eight bulls were used in a 3 × 2 factorial design to study the effects of two by-products from the integrated starch-ethanol process, barley fibre and distillers' solubles, as supplements for grass silage. The animals were divided into five blocks and slaughtered when the average live weight (LW of each block reached 500 kg. The three energy supplements were barley (B, a mixture (1:1 on a dry matter (DM basis of barley and barley fibre (BF, and barley fibre (F, fed without (DS- or with (DS+ wet distillers' solubles (200 g kg-1 concentrate on DM basis. Concentrates were given at the rate of 95 g DM kg-1 LW0.6. Including barley fibre in the diet did not affect feed intake, but distillers' solubles tended to increase both silage and total DM intakes as well as amino acids absorbed in the intestine and energy intake. The protein balance in the rumen increased with the inclusion of barley fibre (P

  18. Physiological basis of barley yield under near optimal and stress conditions

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2004-01-01

    Full Text Available Average barley yield fall below its potential due to incidence of stresses. Water stress is the main environmental factor limiting yield. The component a priori more sensitive to most stresses is the amount of radiation absorbed. The effect of stresses influence on the total amount of radiation absorbed by barley crop during its vegetation and the photosynthetic efficiency of radiation conversion. Growth inhibition is accompanied by reductions in leaf and cell wall extensibility. Grain yield under drought conditions is source limited. Supply of assimilates to the developing inflorescence plays a critical role in establishing final grain number and grain size. Grain weight is negatively affected by drought, high temperature, and any other factors that may reduce grain filling duration and grain filling rate. Awns and glaucousness confer better performance of barley under drought stress conditions. Barley responds with an increased accumulation of a number of proteins when subjected to different stress inducing cell dehydration. Screening techniques that are able to identify desirable genotypes based on the evaluation of physiological traits related to stress evasion and stress resistance maybe useful in breeding barley for resistance to stress, particularly drought stress. Crop management and breeding can reduce the incidence of stress on yield. The effect of these practices is sustained by an understanding of their physiology. In this paper the physiological basis of the processes determining barley yield and the incidence of stresses on photosynthetic metabolism that determine grain yield of barley is discussed. .

  19. A fermented barley and soybean formula enhances skin hydration.

    Science.gov (United States)

    Lee, Sein; Kim, Jong-Eun; Suk, Sujin; Kwon, Oh Wook; Park, Gaeun; Lim, Tae-Gyu; Seo, Sang Gwon; Kim, Jong Rhan; Kim, Dae Eung; Lee, Miyeong; Chung, Dae Kyun; Jeon, Jong Eun; Cho, Dong Woon; Hurh, Byung Serk; Kim, Sun Yeou; Lee, Ki Won

    2015-09-01

    Skin hydration is one of the primary aims of beauty and anti-aging treatments. Barley (Hordeum vulgare) and soybean (Glycine max) are major food crops, but can also be used as ingredients for the maintenance of skin health. We developed a natural product-based skin treatment using a barley and soybean formula (BS) incorporating yeast fermentation, and evaluated its skin hydration effects as a dietary supplement in a clinical study. Participants ingested a placebo- (n = 33) or BS- (3 g/day) containing drink (n = 32) for 8 weeks. A significant increase in hydration in the BS group as compared to the placebo group was observed on the faces of subjects after 4 and 8 weeks, and on the forearm after 4 weeks. Decreases in stratum corneum (SC) thickness were also observed on the face and forearm. BS enhanced hyaluronan (HA) and skin barrier function in vitro and reduced Hyal2 expression in human dermal fibroblasts (HDF). BS also recovered ultraviolet (UV) B-induced downregulation of HA in HaCaT cells. These results suggest that BS has promising potential for development as a health functional food to enhance skin health.

  20. Estimating Leaching Requirements for Barley Growth under Saline Irrigation

    Directory of Open Access Journals (Sweden)

    Ahmed Al-Busaidi

    2012-01-01

    Full Text Available The utilization of marginal water resources for agriculture is receiving considerable attention. The lands irrigated with saline water are required to reduce salt accumulations through leaching and/or drainage practices. A field experiment was carried out to investigate the effect of saline irrigation and leaching fraction on barley (Hordeum vulgare L. growth. For this purpose highly saline water was diluted to the salinity levels of 3, 6 and 9 dS m-1 and applied by drip irrigation at 0.0, 0.15, 0.20 and 0.25 leaching fractions (LF. The results of the experiment showed that both quantity and quality of water regulated salts distribution within the soil in the following manner: a the salts were found higher near or immediate below the soil surface; b an enhanced LF carried more salts down the soil horizon but there was no significant difference in plant yield between different treatments of leaching fractions. Salinity of water significantly impaired barley growth. The good drainage of sandy soil enhanced the leaching process and minimized the differences between leaching fractions. The increment in saline treatments (3, 6 and 9 dS m-1 added more salts and stressed plant growth. However, the conjunctive use of marginal water at proportional LF could be effective in enhancing the yield potential of crops in water-scarce areas.

  1. Physiological responses in barley to applications of lanthanum

    International Nuclear Information System (INIS)

    Reddy, N.; Maheswaran, J.; Peverill, K.; Meehan, B.

    1998-01-01

    Full text: Chinese research and glasshouse investigations carried out in Victoria by the authors have shown that several plant species, when treated with Rare Earth Elements (REEs), retain greater amounts of moisture under water stressed conditions. The physiological adaptation of the plant to retain moisture in response to REE treatment however, has not been investigated. A glasshouse trial is currently in progress to study the physiological and agronomic responses of barley (cv. Schooner) grown in pots to application of lanthanum (0, 5 and 10 kg/ha), at a concentration of 0.05%, under well-watered (field capacity) and water-deficit (25 - 30% field capacity) conditions. Lanthanum was applied both directly to the soil and as a foliar spray. The physiological measurements include, photosynthetic rate, leaf water potential, osmotic potential, relative water content, stomatal conductance and water use efficiency. Measured agronomic parameters include plant height, tiller production, leaf area development, total grain weight, total biomass, root and shoot ratio and harvest index. Analysis of plant tissue for N, P, K, Ca, Mg, Zn and La to study the relationship between application of REE and nutrient uptake is also being carried out. The paper discusses physiological and agronomic changes in barley plants in response to treatment with lanthanum, under conditions of water stress

  2. Modelling phytate degradation kinetics in soaked wheat and barley

    DEFF Research Database (Denmark)

    Blaabjerg, Karoline; Strathe, A B; Poulsen, Hanne Damgaard

    2012-01-01

    The objective of this study was to identify an appropriate mathematical function describing the in vitro phytate degradation profile of soaked wheat or barley (20 °C; 1 cereal: 2.75 water (w/w)) as affected by heat-treatment (stem pelleting at 90 °C) and phytase addition (Phytase 1: 0, 250, 500......) function, a first-order (FO) function and a Generalised Michaelis Menten (GMM) function were considered. The GMM fitted the data best. The GMM function was used to derive the relative instantaneously degradable fraction of phytate (F0) and the half-life (t1/2) of phytate in hours (K). Addition of Phytase 1...... or Phytase 2 had no effect on the degradation of phytate. The F0 was greater in the heat-treated barley compared with the heat-treated wheat (0.19 vs. 0.14; P=0.02; Phytase 1). Heat-treatment of the cereals increased the F0 from 0.05 to 0.15 (P=0.0007; Phytase 2). The K was lower in the non...

  3. Barley: a translational model for adaptation to climate change.

    Science.gov (United States)

    Dawson, Ian K; Russell, Joanne; Powell, Wayne; Steffenson, Brian; Thomas, William T B; Waugh, Robbie

    2015-05-01

    Barley (Hordeum vulgare ssp. vulgare) is an excellent model for understanding agricultural responses to climate change. Its initial domestication over 10 millennia ago and subsequent wide migration provide striking evidence of adaptation to different environments, agro-ecologies and uses. A bottleneck in the selection of modern varieties has resulted in a reduction in total genetic diversity and a loss of specific alleles relevant to climate-smart agriculture. However, extensive and well-curated collections of landraces, wild barley accessions (H. vulgare ssp. spontaneum) and other Hordeum species exist and are important new allele sources. A wide range of genomic and analytical tools have entered the public domain for exploring and capturing this variation, and specialized populations, mutant stocks and transgenics facilitate the connection between genetic diversity and heritable phenotypes. These lay the biological, technological and informational foundations for developing climate-resilient crops tailored to specific environments that are supported by extensive environmental and geographical databases, new methods for climate modelling and trait/environment association analyses, and decentralized participatory improvement methods. Case studies of important climate-related traits and their constituent genes - including examples that are indicative of the complexities involved in designing appropriate responses - are presented, and key developments for the future highlighted. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  4. Barley Stem Rust Resistance Genes: Structure and Function

    Directory of Open Access Journals (Sweden)

    Andris Kleinhofs

    2009-07-01

    Full Text Available Rusts are biotrophic pathogens that attack many plant species but are particularly destructive on cereal crops. The stem rusts (caused by have historically caused severe crop losses and continue to threaten production today. Barley ( L. breeders have controlled major stem rust epidemics since the 1940s with a single durable resistance gene . As new epidemics have threatened, additional resistance genes were identified to counter new rust races, such as the complex locus against races QCCJ and TTKSK. To understand how these genes work, we initiated research to clone and characterize them. The gene encodes a unique protein kinase with dual kinase domains, an active kinase, and a pseudokinase. Function of both domains is essential to confer resistance. The and genes are closely linked and function coordinately to confer resistance to several wheat ( L. stem rust races, including the race TTKSK (also called Ug99 that threatens the world's barley and wheat crops. The gene encodes typical resistance gene domains NBS, LRR, and protein kinase but is unique in that all three domains reside in a single gene, a previously unknown structure among plant disease resistance genes. The gene encodes an actin depolymerizing factor that functions in cytoskeleton rearrangement.

  5. Genomic Prediction of Manganese Efficiency in Winter Barley

    Directory of Open Access Journals (Sweden)

    Florian Leplat

    2016-07-01

    Full Text Available Manganese efficiency is a quantitative abiotic stress trait controlled by several genes each with a small effect. Manganese deficiency leads to yield reduction in winter barley ( L.. Breeding new cultivars for this trait remains difficult because of the lack of visual symptoms and the polygenic features of the trait. Hence, Mn efficiency is a potential suitable trait for a genomic selection (GS approach. A collection of 248 winter barley varieties was screened for Mn efficiency using Chlorophyll (Chl fluorescence in six environments prone to induce Mn deficiency. Two models for genomic prediction were implemented to predict future performance and breeding value of untested varieties. Predictions were obtained using multivariate mixed models: best linear unbiased predictor (BLUP and genomic best linear unbiased predictor (G-BLUP. In the first model, predictions were based on the phenotypic evaluation, whereas both phenotypic and genomic marker data were included in the second model. Accuracy of predicting future phenotype, , and accuracy of predicting true breeding values, , were calculated and compared for both models using six cross-validation (CV schemes; these were designed to mimic plant breeding programs. Overall, the CVs showed that prediction accuracies increased when using the G-BLUP model compared with the prediction accuracies using the BLUP model. Furthermore, the accuracies [] of predicting breeding values were more accurate than accuracy of predicting future phenotypes []. The study confirms that genomic data may enhance the prediction accuracy. Moreover it indicates that GS is a suitable breeding approach for quantitative abiotic stress traits.

  6. Comparison of agrobacterium mediated wheat and barley transformation with nucleoside diphosphate kinase 2 (NDPK2) gene

    International Nuclear Information System (INIS)

    Waheed, U.; Shah, M.M.; Smedley, M.; Harwood, W.

    2016-01-01

    An efficient and reliable transformation system is imperative for improvement of important crop species like barley and wheat. Wheat transformation is complex due to larger genome size and polyploidy while barley has a limitation of genotypic dependency. The objective of current study was to compare the relative transformation efficiency of wheat and barley using specific expression vector pBRACT 214-NDPK2 constructed through gateway cloning carrying Nucleoside Diphosphate Kinase 2 (NDPK2) gene. The vector was used to compare the transformation response in both crops using immature embryos through Agrobacterium mediated transformation. Both wheat and barley showed different responses towards callus induction and regeneration. Immature embryos of 1.5 to 2 mm in diameter was found optimum for wheat callus induction while 1 to 1.5 mm for barley. Both embryogenic and non-embryogenic calli were found in wheat with significantly greater tendency for embryogenecity in barley. The overall regeneration response was found different for all transformed wheat and barley cultivars. Wheat cultivars showed good response initially that drastically slowed down in later stages with the exception of Fielder that reached to the green shoots with good roots. The barley transformed lines showed good regeneration response as compared to wheat. PCR analysis of putative transformants using genomic DNA showed a maximum of 27% transformation efficiency in barely. No true transformation response was obtained in all cultivars of wheat used in this study. The protocol developed for wheat and barley transformation will greatly be helpful in crop improvement programme through genetic engineering especially in diploid relatives of cereals. (author)

  7. Spring Barley Yield Parameters after Lignite, Sodium Humate and Nitrogen Utilization

    Directory of Open Access Journals (Sweden)

    Kováčik Peter

    2016-10-01

    Full Text Available The existence of a small number of publications dealing with the impact of solid sodium humate and lignite on the quantity and quality of grown crops was the reason for establishing the field experiment. The objective of this experiment was to detect the impact of solid lignite and solid sodium humate on the quantity and quality of spring barley yield. These substances were applied into the soil either independently or along with nitrogen fertiliser. The next objective was to determine the impact of foliar application of sodium humate water solution applied either independently or along with nitrogen fertiliser on the quality and quantity of spring barley yield. The achieved results showed that the autumn application of solid lignite and the presowing application of solid sodium humate into the soil tended to decrease the yield of both grain and straw of spring barley, crude protein content in grain, proportion of the first-class grains and volume weight of grain, whereas the impact of humate was more negative. Lignite and sodium humate in the solid form should be used along with nitrogen fertiliser. The application of sodium humate in liquid form during the growth season of barley tended to increase the yield of both grain and straw. The joint application of nitrogen and liquid sodium humate during the growth season of barley increased the grain yield of barley significantly. A lower dose of nitrogen, applied during the growth season of barley (growth season BBCH 23, increased the grain yield of barley considerably more than a higher N dose, applied into the soil before barley sowing.

  8. Structural Basis for Specificity of Propeptide-Enzyme Interaction in Barley C1A Cysteine Peptidases

    Science.gov (United States)

    Cambra, Inés; Hernández, David; Diaz, Isabel; Martinez, Manuel

    2012-01-01

    C1A cysteine peptidases are synthesized as inactive proenzymes. Activation takes place by proteolysis cleaving off the inhibitory propeptide. The inhibitory capacity of propeptides from barley cathepsin L and B-like peptidases towards commercial and barley cathepsins has been characterized. Differences in selectivity have been found for propeptides from L-cathepsins against their cognate and non cognate enzymes. Besides, the propeptide from barley cathepsin B was not able to inhibit bovine cathepsin B. Modelling of their three-dimensional structures suggests that most propeptide inhibitory properties can be explained from the interaction between the propeptide and the mature cathepsin structures. Their potential use as biotechnological tools is discussed. PMID:22615948

  9. Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Skau

    showed that consumption of 3.3 g/day extracted barley and oat β-glucan for 3 weeks does not significantly lower total and LDL cholesterol levels in young and healthy adults. However, an indicated potential effect of oat suggests the importance of solubility for β-glucan interference with the cholesterol....... Finally, health effects from barley and oat β-glucans were studied in vivo in humans using traditional biomarkers and plasma metabolomics. Results from Papers I demonstrated that structural characteristics and viscous properties of barley and oat β-glucans dominate the functional traits over the presence...

  10. Distinct developmental defense activations in barley embryos identified by transcriptome profiling

    DEFF Research Database (Denmark)

    Nielsen, ME; Lok, F; Nielsen, Henrik Bjørn

    2006-01-01

    analyses of > 22,000 genes, which together with measurements of jasmonic acid and salicylic acid during embryo development provide new information on the initiation in the developing barley embryo of at least two distinct types of developmental defense activation (DDA). Early DDA is characterized by the up......-regulation of several PR genes is notable. Throughout barley embryo development, there are no indications of an increased biosynthesis of either jasmonic acid or salicylic acid. Collectively, the results help explain how the proposed DDA enables protection of the developing barley embryo and grain for purposes...

  11. Structural basis for specificity of propeptide-enzyme interaction in barley C1A cysteine peptidases.

    Science.gov (United States)

    Cambra, Inés; Hernández, David; Diaz, Isabel; Martinez, Manuel

    2012-01-01

    C1A cysteine peptidases are synthesized as inactive proenzymes. Activation takes place by proteolysis cleaving off the inhibitory propeptide. The inhibitory capacity of propeptides from barley cathepsin L and B-like peptidases towards commercial and barley cathepsins has been characterized. Differences in selectivity have been found for propeptides from L-cathepsins against their cognate and non cognate enzymes. Besides, the propeptide from barley cathepsin B was not able to inhibit bovine cathepsin B. Modelling of their three-dimensional structures suggests that most propeptide inhibitory properties can be explained from the interaction between the propeptide and the mature cathepsin structures. Their potential use as biotechnological tools is discussed.

  12. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  13. Differential expression of microRNAs and other small RNAs in barley between water and drought conditions

    Science.gov (United States)

    Hackenberg, Michael; Gustafson, Perry; Langridge, Peter; Shi, Bu-Jun

    2015-01-01

    Drought is a major constraint to crop production, and microRNAs (miRNAs) play an important role in plant drought tolerance. Analysis of miRNAs and other classes of small RNAs (sRNAs) in barley grown under water and drought conditions reveals that drought selectively regulates expression of miRNAs and other classes of sRNAs. Low-expressed miRNAs and all repeat-associated siRNAs (rasiRNAs) tended towards down-regulation, while tRNA-derived sRNAs (tsRNAs) had the tendency to be up-regulated, under drought. Antisense sRNAs (putative siRNAs) did not have such a tendency under drought. In drought-tolerant transgenic barley overexpressing DREB transcription factor, most of the low-expressed miRNAs were also down-regulated. In contrast, tsRNAs, rasiRNAs and other classes of sRNAs were not consistently expressed between the drought-treated and transgenic plants. The differential expression of miRNAs and siRNAs was further confirmed by Northern hybridization and quantitative real-time PCR (qRT-PCR). Targets of the drought-regulated miRNAs and siRNAs were predicted, identified by degradome libraries and confirmed by qRT-PCR. Their functions are diverse, but most are involved in transcriptional regulation. Our data provide insight into the expression profiles of miRNAs and other sRNAs, and their relationship under drought, thereby helping understand how miRNAs and sRNAs respond to drought stress in cereal crops. PMID:24975557

  14. Expression of Nudix hydrolase genes in barley under UV irradiation

    Science.gov (United States)

    Tanaka, Sayuri; Sugimoto, Manabu; Kihara, Makoto

    Seed storage and cultivation should be necessary to self-supply foods when astronauts would stay and investigate during long-term space travel and habitation in the bases on the Moon and Mars. Thought the sunlight is the most importance to plants, both as the ultimate energy source and as an environmental signal regulating growth and development, UV presenting the sunlight can damage many aspects of plant processes at the physiological and DNA level. Especially UV-C, which is eliminated by the stratospheric ozone layer, is suspected to be extremely harmful and give a deadly injury to plants in space. However, the defense mechanism against UV-C irradiation damage in plant cells has not been clear. In this study, we investigated the expression of Nudix hydrolases, which defense plants from biotic / abiotic stress, in barley under UV irradiation. The genes encoding the amino acid sequences, which show homology to those of 28 kinds of Nudix hydrolases in Arabidopsis thaliana, were identified in the barley full-length cDNA library. BLAST analysis showed 14 kinds of barley genes (HvNUDX1-14), which encode the Nudix motif sequence. A phylogenetic tree showed that HvNUDX1, HvNUDX7, HvNUDX9 and HvNUDX11 belonged to the ADP-ribose pyrophosphohydrolase, ADP-sugar pyrophosphohydrolase, NAD(P)H pyrophosphohydrolase and FAD pyrophosphohydrolase subfamilies, respectively, HvNUDX3, HvNUDX6, and HvNUDX8 belonged to the Ap _{n}A pyrophosphohydrolase subfamilies, HvNUDX5 and HvNUDX14 belonged to the coenzyme A pyrophosphohydrolase subfamilies, HvNUDX12 and HvNUDX13 belonged to the Ap _{4}A pyrophosphohydrolase subfamilies. Induction of HvNUDX genes by UV-A (340nm), UV-B (312nm), and UV-C (260nm) were analyzed by quantitative RT-PCR. The results showed that HvNUDX4 was induced by UV-A and UV-B, HvNUDX6 was induced by UV-B and UV-C, and HvNUDX7 and HvNUDX14 were induced by UV-C, significantly. Our results suggest that the response of HvNUDXs to UV irradiation is different by UV

  15. Demarcation of mutant-carrying regions in barley plants after ethylmethane-sulfonate seed treatment

    DEFF Research Database (Denmark)

    Jacobsen, P.

    1966-01-01

    The branching pattern of the barley plant is analyzed and the anatomical structure of the resting barley embryo studied in longitudinal and cross-sections as well as by dissection techniques. The frequency and distribution of ethylmethane-sulfonate induced chloroplast and morphological seedling...... was obtained.The absence of cluster sharing allows the recognition in the barley plant of 8 mutually exclusive mutant sectors which never had a mutant cluster in common. The anatomical analysis proves that the barley embryo contains at least 6 separate shoot meristems or prospective shoot meristems, which...... in the embryo of the seed. These will, however, not appear in plants under normal development.There are, according to the present analysis, 6 spikes for which 1 or 2 functional initial cells for their sporogenous tissue are already established in the embryo, i.e. at the time of mutagenic treatment. Except...

  16. The enhanced callose deposition in barley with ml-o powdery mildew resistance genes

    DEFF Research Database (Denmark)

    Skou, Jens-Peder

    1985-01-01

    Carborundum treatment of barley leaves induced a callose deposition which was detected as diffuse blotches in the epidermal cells of susceptible barleys and as deeply stained tracks along the scratches in barleys with the ml-o powdery mildew resistance gene. Subsequent inoculation with powdery...... mildew resulted in appositions that enlarged inversely to their size in the respective varieties when inoculated without carborundum treatment. Aphids sucking the leaves resulted in rows of callose containing spots along the anticlinal cell walls. The spots were larger in the ml-o mutant than...... in the mother variety. Callose was deposited in connection with the pleiotropic necrotic spotting in barleys with the ml-o gene. Modification of the necrotic spotting by crossing the ml-o gene into other gene backgrounds did not result in any change in the size of appositions upon inoculation with powdery...

  17. Proteome analysis of dissected barley seed tissue during germination and radicle elongation

    DEFF Research Database (Denmark)

    Bønsager, Birgit Christine

    2007-01-01

    by mass spectrometry based on the 2D gel pattern of APX in germinated barley embryos, which indicated the presence of several APX forms with different pI values. The barley limit dextrinase inhibitor (LDI) is thought to be at least partly responsible for the presence of non-fermentable branched dextrins...... at the protein or the DNA level. In addition, germination of barley seeds is of interest for the brewing industry since this process corresponds to the steeping process that starts the industrial malting. In the present study a proteomics approach was employed to understand the initial changes in the water...... elongation. These proteins had different tissue distribution and most of them either remained constant or decreased in abundance during radicle elongation, except for ascorbate peroxidase (APX) which was only present in the germinating barley embryo after 24 h. Other proteins involved in osmotic and salinity...

  18. Expression of a defence-related intercellular barley peroxidase in transgenic tobacco

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Brandt, J.; Bojsen, K.

    1997-01-01

    Tobacco plants (Nicotiana benthamiana L.) have been transformed with a T-DNA vector construct carrying the cDNA pBH6-301, encoding the major pathogen induced leaf peroxidase (Prx8) of barley, under control of an enhanced CaMV 35S promoter. Progeny from three independent transformants were analyzed...... genetically, phenotypically and biochemically. The T-DNA was steadily inherited through three generations. The barley peroxidase is expressed and sorted to the intercellular space in the transgenic tobacco plants. The peroxidase can be extracted from the intercellular space in two molecular forms from both...... barley and transgenic tobacco. The tobacco expressed forms are indistinguishable from the barley expressed forms as determined by analytical isoelectric focusing (pI 8.5) and Western-blotting. Staining for N-glycosylation showed that one form only was glycosylated. The N-terminus of purified Prx8 from...

  19. A study on the qualitative and quantitative traits of barley ( Hordeum ...

    African Journals Online (AJOL)

    A study on the qualitative and quantitative traits of barley ( Hordeum vulgare L.) and narbon vetch ( Vicia narbonensis L.) in intercropping and sole cropping system under the interference and control of weeds in dry land farming...

  20. Functional and structural characterization of plastidic starch phosphorylase during barley endosperm development

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Ruzanski, Christian; Krucewicz, Katarzyna

    2017-01-01

    (HvPho1) for starch biosynthesis in barley endosperm, we analyzed HvPho1 protein production and enzyme activity levels throughout barley endosperm development and characterized structure-function relationships of HvPho1. The molecular mechanisms underlying the initiation of starch granule biosynthesis......,4-glucans using HvPho1 from G1P as the sole substrate. The structural properties of HvPho1 provide insights into the low affinity of HvPho1 for large polysaccharides like starch or amylopectin. Our results suggest that HvPho1 may play a role during the initiation of starch biosynthesis in barley.......The production of starch is essential for human nutrition and represents a major metabolic flux in the biosphere. The biosynthesis of starch in storage organs like barley endosperm operates via two main pathways using different substrates: starch synthases use ADP-glucose to produce amylose...

  1. miR393-Mediated Auxin Signaling Regulation is Involved in Root Elongation Inhibition in Response to Toxic Aluminum Stress in Barley.

    Science.gov (United States)

    Bai, Bin; Bian, Hongwu; Zeng, Zhanghui; Hou, Ning; Shi, Bo; Wang, Junhui; Zhu, Muyuan; Han, Ning

    2017-03-01

    High-throughput small RNA sequencing has identified several potential aluminum (Al)-responsive microRNAs (miRNAs); however, their regulatory role remains unknown. Here, we identified two miR393 family members in barley, and confirmed two target genes-HvTIR1 and HvAFB-through a modified form of 5'-RACE (rapid amplification of cDNA ends) as well as degradome data analysis. Furthermore, we investigated the biological function of the miR393/target module in root development and its Al stress response. The investigation showed that miR393 affected root growth and adventitious root number by altering auxin sensitivity. Al3+ exposure suppressed miR393 expression in root apex, while overexpression of miR393 counteracted Al-induced inhibition of root elongation and alleviated reactive oxygen species (ROS)-induced cell death. Target mimic (MIM393)-mediated inhibition of miR393's activity enhanced root sensitivity to Al toxicity. We also confirmed that auxin enhanced Al-induced root growth inhibition in barley via application of exogenous 1-naphthaleneacetic acid (NAA), and the expression of auxin-responsive genes in the root apex was induced upon Al treatment. Overexpression of miR393 attenuated the effect of exogenous NAA on Al-induced root growth inhibition, and down-regulated the expression of auxin-responsive genes under Al stress, implying that miR393 regulates root sensitivity to Al through the alteration of auxin signaling output in barley. Therefore, these data indicate that miR393 acts as an integrator of environmental cues in auxin signaling, and suggest a new strategy to improve plant resistance to Al toxicity. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid

    2015-01-01

    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  3. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Science.gov (United States)

    Zahid, Kiran; Zhao, Jian-Hua; Smith, Neil A; Schumann, Ulrike; Fang, Yuan-Yuan; Dennis, Elizabeth S; Zhang, Ren; Guo, Hui-Shan; Wang, Ming-Bo

    2015-01-01

    Satellite RNAs (satRNAs) are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS) transgene fused with a Cucumber mosaic virus (CMV) Y satellite RNA (Y-Sat) sequence (35S-GUS:Sat) was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM) to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  4. Linkage mapping of putative regulator genes of barley grain development characterized by expression profiling

    Directory of Open Access Journals (Sweden)

    Wobus Ulrich

    2009-01-01

    Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference

  5. Identification and Expression Analysis of the Barley (Hordeum vulgare L.) Aquaporin Gene Family

    OpenAIRE

    Hove, Runyararo M.; Ziemann, Mark; Bhave, Mrinal

    2015-01-01

    Aquaporins (AQPs) are major intrinsic proteins (MIPs) that mediate bidirectional flux of water and other substrates across cell membranes, and play critical roles in plant-water relations, dehydration stress responses and crop productivity. However, limited data are available as yet on the contributions of these proteins to the physiology of the major crop barley (Hordeum vulgare). The present work reports the identification and expression analysis of the barley MIP family. A comprehensive se...

  6. Expression of stress/defense-related genes in barley grown under space environment

    Science.gov (United States)

    Sugimoto, Manabu; Shagimardanova, Elena; Gusev, Oleg; Bingham, Gail; Levinskikh, Margarita; Sychev, Vladimir

    Plants are exposed to the extreme environment in space, especially space radiation is suspected to induce oxidative stress by generating high-energy free radicals and microgravity would enhance the effect of space radiation, however, current understandings of plant growth and responses on this synergistic effect of radiation and microgravity is limited to a few experiments. In this study, expression of stress/defense-related genes in barley grown under space environment was analyzed by RT-PCR and DNA microarray experiments to understand plant responses and adaptation to space environment and to develop the space stress-tolerant plants. The seeds of barley, Hordeum vulgare L. cv. Haruna nijo, kept in the international space station (ISS) over 4 months, were germinated after 3 days of irrigation in LADA plant growth chamber onboard Russian segment of ISS and the final germination ratio was over 90 %. The height of plants was about 50 to 60 cm and flag leaf has been opened after 26 days of irrigation under 24 hr lighting, showing the similar growth to ground-grown barley. Expression levels of stress/defense-related genes in space-grown barley were compared to those in ground-grown barley by semi-quantitative RT-PCR. In 17 stress/defense-related genes that are up-regulated by oxidative stress or other abiotic stress, only catalase, pathogenesis-related protein 13, chalcone synthase, and phenylalanine ammonia-lyase genes were increased in space-grown barley. DNA microarrya analysis with the GeneChip Barley Genome Array showed the similar expression profiles of the stress/defense-related genes to those by RT-PCR experiment, suggesting that the barley germinated and grown in LADA onboard ISS is not damaged by space environment, especially oxidative stress induced by space radiation and microgravity.

  7. Mechanistic and genetic overlap of barley host and non-host resistance to Blumeria graminis.

    Science.gov (United States)

    Trujillo, Marco; Troeger, Marcus; Niks, Rients E; Kogel, Karl-Heinz; Hückelhoven, Ralph

    2004-09-01

    SUMMARY Non-host resistance of barley to Blumeria graminis f.sp. tritici (Bgt), an inappropriate forma specialis of the grass powdery mildew fungus, is associated with formation of cell wall appositions (papillae) at sites of attempted fungal penetration and a hypersensitive cell death reaction (HR) of single attacked cells. Penetration resistance and HR are also typical features of race-non-specific and race-specific resistance of barley to the appropriate Blumeria graminis f.sp. hordei (Bgh), raising the question of whether genotypic differences in the cellular response of barley to Bgt are detectable. First, we analysed fungal penetration frequencies and HR in different barley accessions known to show altered non-host resistance. In genotypes with limited resistance to inappropriate cereal rust fungi, we concomitantly detected low penetration resistance to Bgt and significant differences of HR rates during attack from Bgt. Second, we tested barley mutants known to show altered host responses to Bgh. The rar1-mutation that suppresses many types of race-cultivar-specific resistances did not influence the non-host response of the Bgt-isolate used in this study. However, mutants of Ror1 and Ror2, two genes required for full race non-specific penetration resistance of mlo-barley to barley powdery mildew fungus, exhibited altered defence response to Bgt, including higher frequencies of fungal penetration. On these mutants, growth of the inappropriate fungus was arrested subsequent to penetration by HR. Together, the data show that barley defence response to the wheat powdery mildew fungus is determined by similar factors as race-specific and race-non-specific resistance to appropriate Bgh.

  8. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

    1991-01-01

    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

  9. LINE'S OF MANUFACTURE OF KISSELS ON THE BASIS OF BUCKWHEAT AND BARLEY STARCH

    Directory of Open Access Journals (Sweden)

    J. J. Ermolaev

    2012-01-01

    Full Text Available This work is devoted to development of a production line of kissels on the basis of grechishny and barley крахмалов, allowing to use their structural and mechanical and chemical properties, investigating rheological characteristics of solutions buckwheat and barley крахмалов, to receive the dry granulated drinks on the basis of vegetative raw materials which will partially solve problems of equation of a food.

  10. Localization to Chromosomes of Structural Genes for the Major Protease Inhibitors of Barley Grains

    DEFF Research Database (Denmark)

    Hejgaard, Jørn; Bjørn, S.E.; Nielsen, Gunnar Gissel

    1984-01-01

    Wheat-barley chromosome addition lines were compared by isoelectric focusing of protein extracts to identify chromosomes carrying loci for the major immunochemically distinct protease inhibitors of barley grains. Structural genes for the following inhibitors were localized: an inhibitor of both...... endogenous α-amylase 2 and subtilisin (ASI) on chromosome 2, two chymotrypsin/subtilisin inhibitors (CI-1 and CI-2) on chromosome 5 (long arm) and the major trypsin inhibitor (TI-1) on chromosome 3....

  11. Preventive and Therapeutic Role of Functional Ingredients of Barley Grass for Chronic Diseases in Human Beings

    Directory of Open Access Journals (Sweden)

    Yawen Zeng

    2018-01-01

    Full Text Available Barley grass powder is the best functional food that provides nutrition and eliminates toxins from cells in human beings; however, its functional ingredients have played an important role as health benefit. In order to better cognize the preventive and therapeutic role of barley grass for chronic diseases, we carried out the systematic strategies for functional ingredients of barley grass, based on the comprehensive databases, especially the PubMed, Baidu, ISI Web of Science, and CNKI, between 2008 and 2017. Barley grass is rich in functional ingredients, such as gamma-aminobutyric acid (GABA, flavonoids, saponarin, lutonarin, superoxide dismutase (SOD, K, Ca, Se, tryptophan, chlorophyll, vitamins (A, B1, C, and E, dietary fiber, polysaccharide, alkaloid, metallothioneins, and polyphenols. Barley grass promotes sleep; has antidiabetic effect; regulates blood pressure; enhances immunity; protects liver; has anti-acne/detoxifying and antidepressant effects; improves gastrointestinal function; has anticancer, anti-inflammatory, antioxidant, hypolipidemic, and antigout effects; reduces hyperuricemia; prevents hypoxia, cardiovascular diseases, fatigue, and constipation; alleviates atopic dermatitis; is a calcium supplement; improves cognition; and so on. These results support that barley grass may be one of the best functional foods for preventive chronic diseases and the best raw material of modern diet structure in promoting the development of large health industry and further reveal that GABA, flavonoids, SOD, K-Ca, vitamins, and tryptophan mechanism of barley grass have preventive and therapeutic role for chronic diseases. This paper can be used as a scientific evidence for developing functional foods and novel drugs for barley grass for preventive chronic diseases.

  12. Epigenetic chromatin modifications in barley after mutagenic treatment.

    Science.gov (United States)

    Braszewska-Zalewska, Agnieszka; Tylikowska, Marta; Kwasniewska, Jolanta; Szymanowska-Pulka, Joanna

    2014-11-01

    In addition to their normal developmental processes, plants have evolved complex genetic and epigenetic regulatory mechanisms to cope with various environmental stresses. It has been shown that both DNA methylation and histone modifications are involved in DNA damage response to various types of stresses. In this study, we focused on the involvement of two mutagenic agents, chemical (maleic acid hydrazide; MH) and physical (gamma rays), on the global epigenetic modifications of chromatin in barley. Our results indicate that both mutagens strongly influence the level of histone methylation and acetylation. Moreover, we found that gamma irradiation, in contrast to MH, has a more robust influence on the DNA methylation level. This is the first study that brings together mutagenic treatment along with its impact at the level of epigenetic modifications examined using the immunohistochemical method.

  13. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian

    2016-01-01

    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...... and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has...

  14. Biomechanics of Wheat/Barley Straw and Corn Stover

    Energy Technology Data Exchange (ETDEWEB)

    Christopher T. Wright; Peter A. Pryfogle; Nathan A. Stevens; Eric D. Steffler; J. Richard Hess; Thomas H. Ulrich

    2005-03-01

    The lack of understanding of the mechanical characteristics of cellulosic feedstocks is a limiting factor in economically collecting and processing crop residues, primarily wheat and barley stems and corn stover. Several testing methods, including compression, tension, and bend have been investigated to increase our understanding of the biomechanical behavior of cellulosic feedstocks. Biomechanical data from these tests can provide required input to numerical models and help advance harvesting, handling, and processing techniques. In addition, integrating the models with the complete data set from this study can identify potential tools for manipulating the biomechanical properties of plant varieties in such a manner as to optimize their physical characteristics to produce higher value biomass and more energy efficient harvesting practices.

  15. Approaches to improving the nutritional quality of barley seed proteins

    International Nuclear Information System (INIS)

    Shewry, P.R.; Bright, S.W.J.; Burgess, S.R.; Miflin, B.J.

    1984-01-01

    The poor nutritional quality of barley grain is determined by the low level of lysine in the prolamin storage proteins (hordein). These account for between 35 to 50% of the total grain nitrogen, depending on the nutritional status of the plant. There is a reduced proportion of hordein in mutant high lysine lines but these also have reduced synthesis of storage carbohydrates and hence low yields. Three strategies for improvement are discussed. Increases in the lysine content of hordein may be difficult to achieve because of the presence of complex families of structural genes. It would also be necessary to insert a large number of additional lysine residues. Two more promising approaches are to increase the level of expression of genes coding for lysine-rich globulin storage proteins and to increase the pool of free lysine by selecting mutant lines with relaxed feedback regulation of lysine synthesis. (author)

  16. Micro-PIXE evaluation of Fe distribution in barley roots

    International Nuclear Information System (INIS)

    Schneider, T.; Povh, B.; Strasser, O.; Gierth, M.; Przybylowicz, W.; Mesjasz-Przybylowicz, J.; Churms, C.; Schuessler, A.

    1999-01-01

    High Fe concentrations were reported from roots of plants grown in soil. This has been discussed as a possible Fe source for plants, since the concentrations shown in the roots were much higher than in the shoots. There are, however, also some indications that soil contamination at the root surface of soil grown plants could have led to an overestimation of the Fe concentration in roots. Fe distribution in root cross sections of barley (Hordeum vulgare L. cv. Alexis) has been studied to investigate this hypothesis. Micro-PIXE analyses in point and mapping mode were complemented by the STIM technique. Based on the correlation between Fe and soil-related elements (Ti, Al and Si), most of Fe located at the root surface could be attributed to soil contamination. It could also be shown that this soil contamination leads to an overestimation of Fe concentration in roots. (author)

  17. Efflux of inorganic substances from young barley roots, (2)

    International Nuclear Information System (INIS)

    Fujimoto, Hiroshi; Kojima, Shigeru

    1977-01-01

    The root system of young barley was almost halved, and the two portions were planted in culture grounds with different composition after severing the capillary connection between both root groups. With one portion in the acid medium solution of various compositions and the other in the 22 Na-absorbing medium solution, the sodium absorbed from one root group moved to and flowed out from the other root group, and this state was observed. Also, the efflux of potassium from the root was observed. (1) The Na efflux was small in the culture ground with dilute hydrochloric acid, and larger in that with AlCl 3 or phosphate. (2) The K efflux was large under short-day condition. (3) Under short-day condition, in the culture ground with soluble Al, the K efflux was promoted by nitrogen-source addition, but the Na efflux was suppressed. (Mori, K.)

  18. Cyclitols in maturing grains of wheat, triticale and barley

    Directory of Open Access Journals (Sweden)

    Lesław B. Lahuta

    2011-01-01

    Full Text Available In the present study, the feeding of stem-flag leaf-ear explants of wheat, triticale and barley with d-chiro-inositol and d-pinitol was used for modification of the composition of soluble carbohydrates in grains without genetic transformation of plants. Maturing grains indicated ability to uptake exogenously applied cyclitols, not occurring naturally in cereal plants, and synthesized their a-d-galactosides. The pattern of changes in soluble carbohydrates during grain maturation and germination was not disturbed by the uptake and accumulation of cyclitols. Both, d-chiro-inositol and d-pinitol as well as their a-d-galactosides can be an additional pool of soluble carbohydrates accumulated by maturing grains, without decreasing seeds viability. This is the first report indicating the possibility of introduction of cyclitols with potentially human health benefits properties into cereal grains.

  19. Evolution and Intensity of Hail in Wheat and Barley

    Science.gov (United States)

    Bernaldo de Quirós, I.; Saa Requejo, A.; Tarquis, A. M.; Burgaz, F.

    2009-04-01

    The cereals have represented a very important place in the agriculture along the history. The current expansion and growth of the energetic markets are changing the role of the agriculture. The cereals, with other crops, are becoming more significant as suppliers of raw material for the production of biofuels. The purpose of the present project is to carry out a study about the hail in cereals. The survey is focus in wheat and barley as they both represent the highest cereal production of Spain. Four provinces have been chosen (those with the values of production are higher): Burgos and Zaragoza for the wheat and Cuenca and Valladolid for the barley. The materials and methods that we had available for the study of the evolution and intensity of the damages for hail include an analysis of the correlation between the ratios of agricultural insurances provided by ENESA and the number of days of annual hail (from 1981 to 2007). At the same time, one weather station per province was selected by the longest more complete data recorded (from 1963 to 2007) to perform an analysis of monthly time series of the number of hail days (HD). The results of the study show us that there is no relation between the ratio of the agricultural insurances and the number of hail days. This can be due to the large area of which the ratio refers to and the low density of meteorological stations to cover the hail that is registered in every of the four provinces. On the other hand, it is observed that monthly HD time series don't show a change in pattern except in one of the stations studied. Therefore with the information available we cannot state that there are clear changes in the evolution of the hail registered for each province.

  20. Early maturing mutations as germplasm stocks for barley breeding

    International Nuclear Information System (INIS)

    Ukai, Yasuo

    1985-01-01

    A total of 102 early maturing mutations have been isolated after various treatments of seeds or plants with ionizing radiations or chemicals from a barley cultivar 'Chikurin Ibaraki 1' or its mutants. Fifty of them were evaluated as regards responses to internal physiological factors. The mutants were found to have a mutational alteration in vernalization and/or photoperiodic response. Earliness in a narrow sense was not noticeably changed. The original genotype is a winter and long-day type. By mutation four different degrees of change in vernalization requirement i.e. complete (V 1 ) and incomplete (V 2 ) spring habit and winter habit with reduced requirement to varying degrees (V 3 , V 4 ) have been produced. Photoperiodic response was also changed into at least three types i.e. complete (P 1 ) and incomplete (P 2 ) loss of sensitivity to short photoperiod and a slight reduction in critical daylength for heading. P 1 and P 2 type mutants were all characterized by marked earliness in heading time in field. Thirty seven mutants were located in seven separate loci. Allelism test of the mutated genes to spontaneous ones revealed that the genes carried by P 1 type mutants were all allelic to an earliness gene ea sub(k) on chromosome 5 and the gene involved in P 2 type mutants to ea 7 on chromosome 6. On the contrary, the gene commonly involved in all V 1 type mutants and one V 2 type mutant was not allelic to spring habit gene Sh 2 or Sh 3 . It seemed likely that the gene was not allelic to, either, but closely linked with sh on chromosome 4. The diversity in terms of genetic and physiological properties of the early maturing mutants arising from common ancestry emphasizes the importance of induced mutation in broadening of germplasm of barley breeding. (author)

  1. Meat bone meal as fertiliser for barley and oat

    Directory of Open Access Journals (Sweden)

    L. CHEN

    2008-12-01

    Full Text Available The traditional production of mineral N and P fertilisers is unsustainable due its reliance on fossil fuels in the case of N, and on limited mineral resource stocks in the case of P. The use of alternative or complementary fertilisers that originate from organic waste materials is gaining interest. Organic farms, especially arable organic farms without livestock, need usable sources of plant nutrients. Meat bone meal (MBM, a potential organic fertiliser for agricultural crops, contains considerable amounts of nutrients (on average 8% N, 5% P, 1% K and 10% Ca. In EU countries, Commission regulation (EC No 181/2006 authorised the use of MBM as an organic fertiliser. In this study, MBM was compared to conventional mineral NPK fertiliser. Two randomised complete block split-plot field experiments were conducted: one with spring barley (Hordeum vulgare in two years; and another with oat (Avena sativa for three years, including a fourth year of testing for residual effect. Compared to mineral fertiliser (20% N, 3% P and 9% K, MBM was applied at three N levels: 60, 90 and 120 kg N ha-1. The grain yield of both cereal species supported by MBM, did not differ from the yield obtained with the mineral fertiliser at any N level. At 120 kg N ha-1, the grain yield level with either type was ca. 4500 kg ha-1 of barley and 5000 kg ha-1 of oat, representing fair averages for Finnish conditions. Moreover, MBM and mineral fertilisation showed no differences in quality in terms of 1000-grain weight, test-weight, protein content and protein yield. Since MBM has a low N/P ratio, P was applied in surplus to attain comparable N levels. Therefore MBM fertilisation should be fitted for crop rotation and for meeting environmental requirements.;

  2. Combinatorial pooling enables selective sequencing of the barley gene space.

    Directory of Open Access Journals (Sweden)

    Stefano Lonardi

    2013-04-01

    Full Text Available For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.

  3. Apparent and standardized ileal digestibility of amino acids in diverse barley cultivars fed to growing pigs.

    Science.gov (United States)

    Wang, Hongliang; Ma, Xiaokang; Xu, Xiao; Shi, Meng; Piao, Xiangshu

    2017-12-01

    The objectives of this study were to determine the chemical composition, ileal amino acid (AA) digestibility of barley varieties and to develop equations to predict the AA digestibility based on the chemical characteristics of individual barley. A wide selection of nine barley varieties in the main growing regions of China was used in the experiment. Ten crossbred pigs (30.9 ± 1.8 kg) were allotted to a 6 × 10 Youden Square. The treatments included a nitrogen-free diet and nine barley test diets. Considerable variation was observed in the content of neutral detergent fiber, acid detergent fiber, crude protein (CP) and all AAs among the barley samples. The standardized ileal digestibility (SID) of indispensable AAs with the exception of arginine, phenylalanine and threonine were different (P digestibility of CP and AAs among barley varieties. It is difficult to predict the SID of most of the amino acids in barely based upon chemical characteristics. © 2017 Japanese Society of Animal Science.

  4. Effect of barley flour on the physical and sensory characteristics of chocolate chip cookies.

    Science.gov (United States)

    Frost, Diana June; Adhikari, Koushik; Lewis, Douglas S

    2011-10-01

    The present study explored the possibility of using barley flour as an ingredient to incorporate soluble fibre (β-glucan) in chocolate-chip cookies. Some clinical studies have shown that β-glucan might reduce the serum cholesterol levels. The objective of this study was to determine the physical and sensory characteristics of chocolate chip cookies partly substituted with barley flour at different levels. Physical characteristics (water activity and L*a*b* colour) and sensory characteristics (descriptive and consumer analysis) were evaluated on the experimental cookies substituted with 0, 30, 40, 50, 60 and 70% barley flour for all-purpose flour. There were increases in the baked-barley aroma and flavour, thickness, colour intensity, dryness and graininess with increasing barley flour content. Consumer data showed that cookies made with 30% (0.5 g β-glucan/serving) and 50% (0.8 g β-glucan/serving) barley flour substitution were comparable in liking to the control (0% substitution) cookie and a commercial cookie. The presence of β-glucan in our chocolate-chip cookies might make them a healthier option for many consumers.

  5. Divergence of barley and oat varieties according to their content of β-glucan

    Directory of Open Access Journals (Sweden)

    Marković Stefan M.

    2017-01-01

    Full Text Available Barley and oat have been promoted for years as good sources of dietary fiber, especially β-glucan. Studies have shown a positive effect of barley and oat β-glucan on human health and as a result, there has been an increasing demand for β-glucans in the past decade. Thus, the variability of the β-glucan content was investigated in the grain of 10 barley and 10 oat varieties. The β-glucan contents were determined by the ICC Standard Method No 168. The content of β-glucan in the analyzed barley varieties were within the range 3.52–7.81% and in analyzed oat varieties, the content of β-glucan were within the range of 3.15–7.28%. Among analyzed barley varieties, Novosadski 314 contained the highest content of β-glucan (7.81%, while Tomba had the highest content of β-glucan (7.28% in the analyzed oat varieties. Based on the results, it could be concluded that there is genetic diversity of oat and barley varieties with respect to their β-glucan content. This fact enables varieties with a high a nutritional capacity to be selected.

  6. Diversity for seedling vigor in wild barley (hordeum vulgare L. subs. simpatina) germplasm

    International Nuclear Information System (INIS)

    Tyagi, K.; Park, M.R.; Lee, H.J.; Lee, C.A.; Rehman, S.; Steffenson, B.; Lee, K.J.; Yun, S.J.

    2011-01-01

    Seedling vigor is important for improving stand establishment of barley crops, particularly in arid regions and areas where the soil temperature is low at sowing time. Three hundred and fifteen wild barley accessions from the Wild Barley Diversity Collection (WBDC) were evaluated for nine seedling vigor traits in a poly house and growth chamber under hydroponic conditions. The accessions exhibited significant differences for all traits investigated. Traits showing greatest phenotypic variation were seedling visual score, plant height, shoot fresh weight, shoot dry weight and shoot length. Seed weight exhibited the least variation. Seed weight was significantly correlated with visual seedling score and shoot and seedling fresh and dry weight. Correlation analysis showed that the visual seedling score was a reliable method for estimating seedling vigor in wild barley. The first three principal components (PC) explained 82.3% of the variation present in the WBDC with PC1(54.0%) associated with shoot fresh weight, shoot dry weight, seedling dry weight, seedling fresh weight, shoot length and seedling length. Accessions from the southwest portion of the Fertile Crescent, like WBDC020 (Turkey), WBDC238 (Jordan) and WBDC244 (Jordan) exhibited the highest positive values for most of the plant vigor traits investigated. These wild barley accessions likely carry alleles that will be useful for the improvement of plant vigor traits in cultivated barley. (author)

  7. Heterogeneity of Powdery Mildew Resistance Revealed in Accessions of the ICARDA Wild Barley Collection

    Science.gov (United States)

    Dreiseitl, Antonin

    2017-01-01

    The primary genepool of barley comprises two subspecies – wild barley (Hordeum vulgare subsp. spontaneum) and cultivated barley H. vulgare. subsp. vulgare. The former originated 5.5 million years ago in southwest Asia and is the immediate ancestor of cultivated barley, which arose around 10,000 years ago. In this study, the specific resistance of a set of 146 wild barley accessions, maintained by the International Center for Agriculture Research in the Dry Areas (ICARDA), to 32 isolates of barley powdery mildew caused by Blumeria graminis f. sp. hordei was evaluated. The set comprised 146 heterogeneous accessions of a previously tested collection. Seed was obtained by single seed descent and each accession was usually represented by five single plant progenies. In total, 687 plant progenies were tested. There were 211 phenotypes of resistance among the accessions, 87 of which were found in single plants, while 202 plants contained the eight most common phenotypes. The most frequent phenotype was found in 56 plants that were susceptible to all pathogen isolates, whereas the second most frequent phenotype, which occurred in 46 plants, was resistant to all isolates. The broad resistance diversity that was revealed is of practical importance and is an aid to determining the extent and role of resistance in natural ecosystems. PMID:28261253

  8. Survey of Barley and Wheat Diseases in the Central Highlands of Eritrea

    Directory of Open Access Journals (Sweden)

    A.H. Yahyaoui

    2004-04-01

    Full Text Available Annual surveys of barley and wheat diseases were conducted in Eritrea from 2000 to 2002. The surveys covered six zones of the central highlands where barley and wheat are grown. The main diseases of barley were netform net blotch, spot-form net blotch, leaf rust and scald. Other, less important diseases were loose smut, covered smut, barley stripe and septoria leaf blotch. Wheat was mainly affected by yellow rust and leaf rust. Loose smut, septoria leaf spot and tan spot diseases were less prevalent. The average incidence of these diseases varied according to the zone. Among barley diseases, net blotch incidence was high in four of the six zones surveyed. Leaf rust occurred at medium incidence in five zones. Loose smut was more severe in the southern highland plains, while covered smut was more common in the south-eastern highland terraces. For wheat, yellow rust incidence was high in two zones. Areas with a high incidence of yellow rust were not necessarily those with a high incidence of leaf rust. Leaf rust was important in the south-eastern and western highland terraces and in the western highland plains. The number of diseases found in the same field varied from 2 to 5. The south eastern highland terraces, the western highland terraces and the northern highland terraces had the highest proportions of individual barley fields with three or more diseases.

  9. Allelopathic effect of ryegrass (lolium persicum) and wild mustard (sinapis arvensis) on barley

    International Nuclear Information System (INIS)

    Baziar, M.R.; Farahvash, F.; Mirshekari, B.; Rashidi, V.

    2014-01-01

    Most crop plants and weeds have allelopathic effects and analysis of these effects on plants in crop alteration and successive planting is very important. In this research the allelopathic ability of different parts and concentrations of two weeds, Lolium Persicum (Ryegrass) and Sinapis arvensis (wild mustered), on growth characteristics of two barley varieties was studied in the greenhouse using a completely randomized design with four replications. Test factors consisted of two barley varieties (Valfajr and Rehane), three weed organs (root, stalk, leaf) and four concentrations of extracts of weed organs (25, 50, 75 and control or distilled water). After the preparation of extracts of different weed organs with different concentrations, their effect on growth characteristics of barley plant was evaluated. Finally, seedling length, rootlet length caulicle length, wet weight of seedling, dry weight of seedling were measured. Also, the above two seeds had significant effects on the two strains of barley and could influence growth characteristics of barley. Based on the results of present study, one can argue that Ryegrass (Lolium Persicum) and wild mustard (Sinapis arvensis) can strongly affect germination, growth and performance of barley through production of chemical materials with allelopathic properties, leading unfavorable growth and product yield. (author)

  10. Conserved generation of short products at piRNA loci

    Directory of Open Access Journals (Sweden)

    Khorshid Mohsen

    2011-01-01

    Full Text Available Abstract Background The piRNA pathway operates in animal germ lines to ensure genome integrity through retrotransposon silencing. The Piwi protein-associated small RNAs (piRNAs guide Piwi proteins to retrotransposon transcripts, which are degraded and thereby post-transcriptionally silenced through a ping-pong amplification process. Cleavage of the retrotransposon transcript defines at the same time the 5' end of a secondary piRNA that will in turn guide a Piwi protein to a primary piRNA precursor, thereby amplifying primary piRNAs. Although several studies provided evidence that this mechanism is conserved among metazoa, how the process is initiated and what enzymatic activities are responsible for generating the primary and secondary piRNAs are not entirely clear. Results Here we analyzed small RNAs from three mammalian species, seeking to gain further insight into the mechanisms responsible for the piRNA amplification loop. We found that in all these species piRNA-directed targeting is accompanied by the generation of short sequences that have a very precisely defined length, 19 nucleotides, and a specific spatial relationship with the guide piRNAs. Conclusions This suggests that the processing of the 5' product of piRNA-guided cleavage occurs while the piRNA target is engaged by the Piwi protein. Although they are not stabilized through methylation of their 3' ends, the 19-mers are abundant not only in testes lysates but also in immunoprecipitates of Miwi and Mili proteins. They will enable more accurate identification of piRNA loci in deep sequencing data sets.

  11. Barley ROP Binding Kinase1 Is Involved in Microtubule Organization and in Basal Penetration Resistance to the Barley Powdery Mildew Fungus1[W

    Science.gov (United States)

    Huesmann, Christina; Reiner, Tina; Hoefle, Caroline; Preuss, Jutta; Jurca, Manuela E.; Domoki, Mónika; Fehér, Attila; Hückelhoven, Ralph

    2012-01-01

    Certain plant receptor-like cytoplasmic kinases were reported to interact with small monomeric G-proteins of the RHO of plant (ROP; also called RAC) family in planta and to be activated by this interaction in vitro. We identified a barley (Hordeum vulgare) partial cDNA of a ROP binding protein kinase (HvRBK1) in yeast (Saccharomyces cerevisiae) two-hybrid screenings with barley HvROP bait proteins. Protein interaction of the constitutively activated (CA) barley HvROPs CA HvRACB and CA HvRAC1 with full-length HvRBK1 was verified in yeast and in planta. Green fluorescent protein-tagged HvRBK1 appears in the cytoplasm and nucleoplasm, but CA HvRACB or CA HvRAC1 can recruit green fluorescent protein-HvRBK1 to the cell periphery. Barley HvRBK1 is an active kinase in vitro, and activity is enhanced by CA HvRACB or GTP-loaded HvRAC1. Hence, HvRBK1 might act downstream of active HvROPs. Transient-induced gene silencing of barley HvRBK1 supported penetration by the parasitic fungus Blumeria graminis f. sp. hordei, suggesting a function of the protein in basal disease resistance. Transient knockdown of HvRBK1 also influenced the stability of cortical microtubules in barley epidermal cells. Hence, HvRBK1 might function in basal resistance to powdery mildew by influencing microtubule organization. PMID:22415513

  12. Classification of Fusarium-Infected Korean Hulled Barley Using Near-Infrared Reflectance Spectroscopy and Partial Least Squares Discriminant Analysis

    OpenAIRE

    Jongguk Lim; Giyoung Kim; Changyeun Mo; Kyoungmin Oh; Hyeonchae Yoo; Hyeonheui Ham; Moon S. Kim

    2017-01-01

    The purpose of this study is to use near-infrared reflectance (NIR) spectroscopy equipment to nondestructively and rapidly discriminate Fusarium-infected hulled barley. Both normal hulled barley and Fusarium-infected hulled barley were scanned by using a NIR spectrometer with a wavelength range of 1175 to 2170 nm. Multiple mathematical pretreatments were applied to the reflectance spectra obtained for Fusarium discrimination and the multivariate analysis method of partial least squares discri...

  13. Advances in the use of mutation induction for genetic improvement of barley and native grains in Peru

    International Nuclear Information System (INIS)

    Romero Loli, M.; Luz Gomez, P.; Jorge Jimenez, D.; Agripina Roldan, Ch.

    2001-01-01

    Barley seeds of two varieties were treated with several doses of gamma rays and sodium azide. Seeds of a quinoa (Chenopodium) variety were treated with three doses of gamma rays. Yield trials were conducted also for doubled haploid lines of barley derived from earlier mutagenic treatments. Some promising new barley mutant lines were identified in the yield trials. The results from the Chenopodium trials facilitate the determination of the optimum dose of gamma rays for the PRQ-22 variety. (author)

  14. Do 14-3-3 proteins and plasma membrane H+-AtPases interact in the barley epidermis in response to the barley powdery mildew fungus?

    DEFF Research Database (Denmark)

    Finni, Christine; Andersen, Claus H; Borch, Jonas

    2002-01-01

    , or treatment with fusicoccin, results in an increase in fusicoccin binding ability of barley leaf membranes. Overlay assays show a fungus-induced increase in binding of digoxygenin-labelled 14-3-3 protein to several proteins including a 100 kDa membrane protein, probably the plasma membrane H......14-3-3 proteins form a family of highly conserved proteins with central roles in many eukaryotic signalling networks. In plants, they bind to and activate the plasma membrane H+-ATPase, creating a binding site for the phytotoxin fusicoccin. Barley 14-3-3 transcripts accumulate in the epidermis upon...

  15. Some quality attributes of low fat ice cream substituted with hulless barley flour and barley ß-glucan.

    Science.gov (United States)

    Abdel-Haleem, Amal M H; Awad, R A

    2015-10-01

    The purpose of this paper is to investigate some quality attributes of low fat ice cream (LFIC) substituted with hulless barley flour (HBF) and barley ß-glucan (BBG). The methodology included in this paper is based on adding HBF (1, 2, 3 and 4 %) as a partial substitution of skim milk powder (SMP) and BBG (0.40 %) as a complete substitution of carboxy methyl cellulose (CMC). All mixes and resultant ice cream samples were evaluated for their physicochemical properties as well as the sensory quality attributes.The results indicated that substitution of SMP with HBF significantly increased total solids (TS), fat and crude fiber, while crude protein and ash significantly decreased in ice cream mixes. BBG exhibited the same manner of control. Specific gravity was gradually increased with adding HBFand BBG in the mixes and therefore the overrun percent was significantly changed in the resultant ice cream. Adding HBF in ice cream formula led to significant decrease in acidity with higher freezing point and the product showed higher ability to meltdown. BBG treatment showed the same trend of control. Values of flow time and viscosity significantly increased with increasing HBF in the ice cream mixes, but these values significantly decreased in BBG mix. The time required to freeze ice cream mixes was decreased with increasing the ratio of HBF but, increased in BBG treatment. The substitution of SMP with 1 and 2 % HBF significantly (P ≤ 0.05) enhanced sensory attributes of ice cream samples. While, BBG treatment achieved mild score and acceptability.

  16. Comparative transcriptome profile of the leaf elongation zone of wild barley (Hordeum spontaneum eibi1 mutant and its isogenic wild type

    Directory of Open Access Journals (Sweden)

    Qin Zhou

    2017-10-01

    Full Text Available Abstract The naturally occurring wild barley mutant eibi1/hvabcg31 suffers from severe water loss due to the permeable leaf cuticle. Eibi1/HvABCG31 encodes a full ATP-binding cassette (ABC transporter, HvABCG31, playing a role in cutin deposition in the elongation zone of growing barley leaves. The eibi1 allele has pleiotropic effects on the appearance of leaves, plant stature, fertility, spike and grain size, and rate of germination. Comparative transcriptome profile of the leaf elongation zone of the eibi1 mutant as well as its isogenic wild type showed that various pathogenesis-related genes were up-regulated in the eibi1 mutant. The known cuticle-related genes that we analyzed did not show significant expression difference between the mutant and wild type. These results suggest that the pleiotropic effects may be a compensatory consequence of the activation of defense genes in the eibi1 mutation. Furthermore, we were able to find the mutation of the eibi1/hvabcg31 allele by comparing transcript sequences, which indicated that the RNA-Seq is useful not only for researches on general molecular mechanism but also for the identification of possible mutant genes.

  17. HvPap-1 C1A Protease and HvCPI-2 Cystatin Contribute to Barley Grain Filling and Germination1

    Science.gov (United States)

    Velasco-Arroyo, Blanca; Cambra, Ines; Gonzalez-Melendi, Pablo; Lopez-Gonzalvez, Angeles; Garcia, Antonia

    2016-01-01

    Proteolysis is an essential process throughout the mobilization of storage proteins in barley (Hordeum vulgare) grains during germination. It involves numerous types of enzymes, with C1A Cys proteases the most abundant key players. Manipulation of the proteolytic machinery is a potential way to enhance grain yield and quality, and it could influence the mobilization of storage compounds along germination. Transgenic barley plants silencing or over-expressing the cathepsin F-like HvPap-1 Cys protease show differential accumulation of storage molecules such as starch, proteins, and free amino acids in the grain. It is particularly striking that the HvPap-1 artificial microRNA lines phenotype show a drastic delay in the grain germination process. Alterations to the proteolytic activities in the over-expressing and knock-down grains associated with changes in the level of expression of several C1A peptidases were also detected. Similarly, down-regulating cystatin Icy-2, one of the proteinaceous inhibitors of the cathepsin F-like protease, also has important effects on grain filling. However, the ultimate physiological influence of manipulating a peptidase or an inhibitor cannot be always predicted, since the plant tries to compensate the modified proteolytic effects by modulating the expression of some other peptidases or their inhibitors. PMID:26912343

  18. HvPap-1 C1A Protease and HvCPI-2 Cystatin Contribute to Barley Grain Filling and Germination.

    Science.gov (United States)

    Diaz-Mendoza, Mercedes; Dominguez-Figueroa, Jose D; Velasco-Arroyo, Blanca; Cambra, Ines; Gonzalez-Melendi, Pablo; Lopez-Gonzalvez, Angeles; Garcia, Antonia; Hensel, Goetz; Kumlehn, Jochen; Diaz, Isabel; Martinez, Manuel

    2016-04-01

    Proteolysis is an essential process throughout the mobilization of storage proteins in barley (Hordeum vulgare) grains during germination. It involves numerous types of enzymes, with C1A Cys proteases the most abundant key players. Manipulation of the proteolytic machinery is a potential way to enhance grain yield and quality, and it could influence the mobilization of storage compounds along germination. Transgenic barley plants silencing or over-expressing the cathepsin F-like HvPap-1 Cys protease show differential accumulation of storage molecules such as starch, proteins, and free amino acids in the grain. It is particularly striking that the HvPap-1 artificial microRNA lines phenotype show a drastic delay in the grain germination process. Alterations to the proteolytic activities in the over-expressing and knock-down grains associated with changes in the level of expression of several C1A peptidases were also detected. Similarly, down-regulating cystatin Icy-2, one of the proteinaceous inhibitors of the cathepsin F-like protease, also has important effects on grain filling. However, the ultimate physiological influence of manipulating a peptidase or an inhibitor cannot be always predicted, since the plant tries to compensate the modified proteolytic effects by modulating the expression of some other peptidases or their inhibitors. © 2016 American Society of Plant Biologists. All Rights Reserved.

  19. Triggering of RNA interference with RNA-RNA, RNA-DNA, and DNA-RNA nanoparticles.

    Science.gov (United States)

    Afonin, Kirill A; Viard, Mathias; Kagiampakis, Ioannis; Case, Christopher L; Dobrovolskaia, Marina A; Hofmann, Jen; Vrzak, Ashlee; Kireeva, Maria; Kasprzak, Wojciech K; KewalRamani, Vineet N; Shapiro, Bruce A

    2015-01-27

    Control over cellular delivery of different functionalities and their synchronized activation is a challenging task. We report several RNA and RNA/DNA-based nanoparticles designed to conditionally activate the RNA interference in various human cells. These nanoparticles allow precise control over their formulation, stability in blood serum, and activation of multiple functionalities. Importantly, interferon and pro-inflammatory cytokine activation assays indicate the significantly lower responses for DNA nanoparticles compared to the RNA counterparts, suggesting greater potential of these molecules for therapeutic use.

  20. Cap- and initiator tRNA-dependent initiation of TYMV polyprotein synthesis by ribosomes: evaluation of the Trojan horse model for TYMV RNA translation.

    Science.gov (United States)

    Matsuda, Daiki; Dreher, Theo W

    2007-01-01

    Turnip yellow mosaic virus (TYMV) RNA directs the translation of two overlapping open reading frames. Competing models have been previously published to explain ribosome access to the downstream polyprotein cistron. The Trojan horse model, based on cell-free experiments, proposes noncanonical cap-independent initiation in which the 3'-terminal tRNA-like structure (TLS) functionally replaces initiator tRNA, and the valine bound to the TLS becomes cis-incorporated into viral protein. The initiation coupling model, based on in vivo expression and ribosome toe-printing studies, proposes a variation of canonical leaky scanning. Here, we have re-examined the wheat germ extract experiments that led to the Trojan horse model, incorporating a variety of controls. We report that (1) translation in vitro from the polyprotein AUG of TYMV RNA is unchanged after removal of the 3' TLS but is stimulated by the presence of a 5'-cap; (2) the presence of free cap analog or edeine (which interferes with initiation at the ribosomal P site and its tRNA(i) (Met) involvement) inhibits translation from the polyprotein AUG; (3) the toe-prints of immediately post-initiation ribosomes on TYMV RNA are similar with and without an intact TLS; and (4) significant deacylation of valyl-TYMV RNA in wheat germ extract can complicate the detection of cis-incorporation. These results favor the initiation coupling model.

  1. Alpha-synuclein suppression by targeted small interfering RNA in the primate substantia nigra.

    Directory of Open Access Journals (Sweden)

    Alison L McCormack

    Full Text Available The protein alpha-synuclein is involved in the pathogenesis of Parkinson's disease and other neurodegenerative disorders. Its toxic potential appears to be enhanced by increased protein expression, providing a compelling rationale for therapeutic strategies aimed at reducing neuronal alpha-synuclein burden. Here, feasibility and safety of alpha-synuclein suppression were evaluated by treating monkeys with small interfering RNA (siRNA directed against alpha-synuclein. The siRNA molecule was chemically modified to prevent degradation by exo- and endonucleases and directly infused into the left substantia nigra. Results compared levels of alpha-synuclein mRNA and protein in the infused (left vs. untreated (right hemisphere and revealed a significant 40-50% suppression of alpha-synuclein expression. These findings could not be attributable to non-specific effects of siRNA infusion since treatment of a separate set of animals with luciferase-targeting siRNA produced no changes in alpha-synuclein. Infusion with alpha-synuclein siRNA, while lowering alpha-synuclein expression, had no overt adverse consequences. In particular, it did not cause tissue inflammation and did not change (i the number and phenotype of nigral dopaminergic neurons, and (ii the concentrations of striatal dopamine and its metabolites. The data represent the first evidence of successful anti-alpha-synuclein intervention in the primate substantia nigra and support further development of RNA interference-based therapeutics.

  2. Comparisons of modern United States and Canadian malting barley cultivars with those from pre-prohibition: III. Wort sugar production during mashing

    Science.gov (United States)

    This study was conducted to compare wort sugar production during mashing of barley malts of pre-Prohibition varieties and modern elite cultivars. Four of the five modern cultivars utilized were significantly higher (PProhibition barley varieties at al...

  3. Effects of Added Enzymes on Sorted, Unsorted and Sorted-Out Barley: A Model Study on Realtime Viscosity and Process Potentials Using Rapid Visco Analyser

    DEFF Research Database (Denmark)

    Shetty, Radhakrishna; Zhuang, Shiwen; Olsen, Rasmus Lyngsø

    2017-01-01

    Barley sorting is an important step for selecting grain of required quality for malting prior to brewing. However, brewing with unmalted barley with added enzymes has been thoroughly proven, raising the question of whether traditional sorting for high quality malting-barley is still necessary....... To gain more insight on this, we examine realtime viscosity of sorted-out and unsorted barley during downscaled mashing with added enzymes in comparison with malting quality sorted barley. A rapid visco analyser was used to simulate brewery mashing process at lab scale together with two commercial enzymes...... (Ondea®-Pro and Cellic®-CTec2). During downscaled mashing, viscosity profile of sorted-out barley was markedly different from others, irrespective of enzyme type, whereas a small difference was observed between the sorted and un-sorted barley. Furthermore, whilst sorted-out barley generated lowest sugar...

  4. A Genome Wide Association Study of arabinoxylan content in 2-row spring barley grain.

    Directory of Open Access Journals (Sweden)

    Ali Saleh Hassan

    Full Text Available In barley endosperm arabinoxylan (AX is the second most abundant cell wall polysaccharide and in wheat it is the most abundant polysaccharide in the starchy endosperm walls of the grain. AX is one of the main contributors to grain dietary fibre content providing several health benefits including cholesterol and glucose lowering effects, and antioxidant activities. Due to its complex structural features, AX might also affect the downstream applications of barley grain in malting and brewing. Using a high pressure liquid chromatography (HPLC method we quantified AX amounts in mature grain in 128 spring 2-row barley accessions. Amounts ranged from ~ 5.2 μg/g to ~ 9 μg/g. We used this data for a Genome Wide Association Study (GWAS that revealed three significant quantitative trait loci (QTL associated with grain AX levels which passed a false discovery threshold (FDR and are located on two of the seven barley chromosomes. Regions underlying the QTLs were scanned for genes likely to be involved in AX biosynthesis or turnover, and strong candidates, including glycosyltransferases from the GT43 and GT61 families and glycoside hydrolases from the GH10 family, were identified. Phylogenetic trees of selected gene families were built based on protein translations and were used to examine the relationship of the barley candidate genes to those in other species. Our data reaffirms the roles of existing genes thought to contribute to AX content, and identifies novel QTL (and candidate genes associated with them potentially influencing the AX content of barley grain. One potential outcome of this work is the deployment of highly associated single nucleotide polymorphisms markers in breeding programs to guide the modification of AX abundance in barley grain.

  5. Barley Leaf Area and Leaf Growth Rates Are Maximized during the Pre-Anthesis Phase

    Directory of Open Access Journals (Sweden)

    Ahmad M. Alqudah

    2015-04-01

    Full Text Available Leaf developmental traits are an important component of crop breeding in small-grain cereals. Surprisingly, little is known about the genetic basis for the differences in barley (Hordeum vulgare L. leaf development. The two barley row-type classes, i.e., two- and six-rowed, show clear-cut differences in leaf development. To quantify these differences and to measure the genetic component of the phenotypic variance for the leaf developmental differences in both row-type classes we investigated 32 representative spring barley accessions (14 two- and 18 six-rowed accessions under three independent growth conditions. Leaf mass area is lower in plants grown under greenhouse (GH conditions due to fewer, smaller, and lighter leaf blades per main culm compared to pot- and soil-grown field plants. Larger and heavier leaf blades of six-rowed barley correlate with higher main culm spike grain yield, spike dry weight, and harvest index; however, smaller leaf area (LA in two-rowed barley can be attributed to more spikes, tillers, and biological yield (aboveground parts. In general, leaf growth rate was significantly higher between awn primordium and tipping stages. Moderate to very high broad-sense heritabilities (0.67–0.90 were found under all growth conditions, indicating that these traits are predominantly genetically controlled. In addition, our data suggests that GH conditions are suitable for studying leaf developmental traits. Our results also demonstrated that LA impacts single plant yield and can be reconsidered in future breeding programs. Six-rowed spike 1 (Vrs1 is the major determinate of barley row-types, the differences in leaf development between two- and six-rowed barleys may be attributed to the regulation of Vrs1 in these two classes, which needs further testing.

  6. Comparison of different pretreatment strategies for enzymatic hydrolysis of wheat and barley straw.

    Science.gov (United States)

    Rosgaard, Lisa; Pedersen, Sven; Meyer, Anne S

    2007-12-01

    In biomass-to-ethanol processes a physico-chemical pretreatment of the lignocellulosic biomass is a critical requirement for enhancing the accessibility of the cellulose substrate to enzymatic attack. This report evaluates the efficacy on barley and wheat straw of three different pretreatment procedures: acid or water impregnation followed by steam explosion versus hot water extraction. The pretreatments were compared after enzyme treatment using a cellulase enzyme system, Celluclast 1.5 L from Trichoderma reesei, and a beta-glucosidase, Novozyme 188 from Aspergillus niger. Barley straw generally produced higher glucose concentrations after enzymatic hydrolysis than wheat straw. Acid or water impregnation followed by steam explosion of barley straw was the best pretreatment in terms of resulting glucose concentration in the liquid hydrolysate after enzymatic hydrolysis. When the glucose concentrations obtained after enzymatic hydrolyses were related to the potential glucose present in the pretreated residues, the highest yield, approximately 48% (g g-1), was obtained with hot water extraction pretreatment of barley straw; this pretreatment also produced highest yields for wheat straw, producing a glucose yield of approximately 39% (g g-1). Addition of extra enzyme (Celluclast 1.5 L+Novozyme 188) during enzymatic hydrolysis resulted in the highest total glucose concentrations from barley straw, 32-39 g L-1, but the relative increases in glucose yields were higher on wheat straw than on barley straw. Maldi-TOF MS analyses of supernatants of pretreated barley and wheat straw samples subjected to acid and water impregnation, respectively, and steam explosion, revealed that the water impregnated + steam-exploded samples gave a wider range of pentose oligomers than the corresponding acid-impregnated samples.

  7. Effect of Enzyme Supplementation and Irradiation of Barley on Broiler Chicks Performance

    International Nuclear Information System (INIS)

    Farag, D.H.M.; Abd El-Hakeim, N.F.

    1999-01-01

    The experiments were conducted to study the influence of irradiation treatment at dose levels of 0.20 and 60 kGy on barley beta-glucan and the effect of enzyme supplementation and irradiation of barley on broiler chicks performance. The amount of total and water-soluble beta-glucan in raw barley was 36 kg -1 , respectively. The effect of irradiation treatment on total beta-glucan was insignificant while the level of soluble beta-glucan was increased with increasing the dose levels of irradiation. The effect of irradiation treatment and enzyme supplementation of barley diets on growth and conversion performance of broiler chicks indicated that birds fed raw barley diet had lower body weight, body weight gain and feed conversion than those fed control diet throughout the experimental period. Irradiation of barley at dose of 20 kGy did not affect the chick performance (feed consumption, weight gain feed-gain ratio) that received the B 20 diet from 7 to 21 days of age, but when bird maintained on B 20 diet from 7 28 days of age, only feed-gain ratio was improved by 14.4%. The results indicate that there was a significant effect of irradiation of barley at 60 kGy (B 60) on feed -gain ratio of chicks when were fed B 60 diet from 7 to 21 days of age. The corresponding improvement in feed-gain ratio was 16.4%. When birds were fed B 60 diet from 7-28 days of age, the improvement in body weight and feed-gain ratio was 25.5 and 19.6%, respectively

  8. Small RNA Functions Are Required for Growth and Development of Magnaporthe oryzae.

    Science.gov (United States)

    Raman, Vidhyavathi; Simon, Stacey A; Demirci, Feray; Nakano, Mayumi; Meyers, Blake C; Donofrio, Nicole M

    2017-07-01

    RNA interference (RNAi) is conserved in eukaryotic organisms, and it has been well studied in many animal and plant species and some fungal species, yet it is not well studied in fungal plant pathogens. In the rice blast fungus Magnaporthe oryzae, we examined small RNA (sRNA) and their biogenesis in the context of growth and pathogenicity. Through genetic and genomic analyses, we demonstrate that loss of a single gene encoding Dicer, RNA-dependent RNA polymerase, or Argonaute reduces sRNA levels. These three proteins are required for the biogenesis of sRNA-matching genome-wide regions (coding regions, repeats, and intergenic regions). The loss of one Argonaute reduced both sRNA and fungal virulence on barley leaves. Transcriptome analysis of multiple mutants revealed that sRNA play an important role in transcriptional regulation of repeats and intergenic regions in M. oryzae. Together, these data support that M. oryzae sRNA regulate developmental processes including, fungal growth and virulence.

  9. Mapping genes in barley for resistance to Puccinia coronata from couch grass and to P. striiformis from brome, wheat and barley

    NARCIS (Netherlands)

    Niks, R.E.; Alemu, Sisay K.; Marcel, T.C.; Heyzen, van Skye

    2015-01-01

    Barley (Hordeum vulgare L.) mapping populations have been developed that are useful to study the inheritance of quantitative resistance to adapted and unadapted rust fungi. In a recent host range study, we found that the parents of those mapping populations also differed in their resistance to

  10. Do 14-3-3 proteins and plasma membrane H+-ATPases interact in the barley epidermis in response to the barley powdery mildew fungus?

    DEFF Research Database (Denmark)

    Finnie, C.; Andersen, C.H.; Borch, J.

    2002-01-01

    , or treatment with fusicoccin, results in an increase in fusicoccin binding ability of barley leaf membranes. Overlay assays show a fungus-induced increase in binding of digoxygenin-labelled 14-3-3 protein to several proteins including a 100 kDa membrane protein, probably the plasma membrane H...

  11. Barley yellow mosaic virus VPg is the determinant protein for breaking eIF4E-mediated recessive resistance in barley plants

    Directory of Open Access Journals (Sweden)

    Huangai Li

    2016-09-01

    Full Text Available In this study, we investigated the barley yellow mosaic virus (BaYMV, genus Bymovirus factor(s responsible for breaking eIF4E-mediated recessive resistance genes (rym4/5/6 in barley. Genome mapping analysis using chimeric infectious cDNA clones between rym5-breaking (JT10 and rym5-non-breaking (JK05 isolates indicated that genome-linked viral protein (VPg is the determinant protein for breaking the rym5 resistance. Likewise, VPg is also responsible for overcoming the resistances of rym4 and rym6 alleles. Mutational analysis identified that amino acids Ser-118, Thr-120 and His-142 in JT10 VPg are the most critical residues for overcoming rym5 resistance in protoplasts. Moreover, the rym5-non-breaking JK05 could accumulate in the rym5 protoplasts when eIF4E derived from a susceptible barley cultivar was expressed from the viral genome. Thus, the compatibility between VPg and host eIF4E determines the ability of BaYMV to infect barley plants.

  12. Observed and predicted changes over eight years in frequency of barley powdery mildew avirulent to spring barley in France and Denmark

    DEFF Research Database (Denmark)

    Bousset, L.; Hovmøller, M.S.; Caffier, V.

    2002-01-01

    Aerial populations of Blumeria graminis f.sp. hordei were studied in two French and two Danish regions from 1991 to 1999, at a time of year when only winter barley was present. A high frequency of genotypes not able to grow on the spring-sown crop of the previous growing season (denoted 'spring-a...

  13. Effect of feeding corn, hull-less or hulled barley on fermentation by mixed cultures of ruminal microorganisms.

    Science.gov (United States)

    Fellner, V; Burns, J C; Marshall, D S

    2008-05-01

    Increased demands for corn grain warrant the evaluation of alternative grain types for ruminant production systems. This study was conducted to determine the effects of hulled and hull-less barley (Hordeum vulgare L.) cultivars compared with corn (Zea mays L.) as an alternative grain type on fermentation in cultures of mixed ruminal microorganisms. Three continuous fermentors were fed 14 g of dry feed per day (divided equally between 2 feedings) consisting of alfalfa (Medicago sativa L.) hay pellets (40% of dry matter) and 1) ground corn, 2) hulled barley, or 3) hull-less barley concentrate (60% of dry matter) in each fermentor. Following an adaptation period of 5 d, culture samples were taken at 2 h after the morning feeding on d 6, 7, and 8 of each period for analysis. A second run of the fermentors followed the same treatment sequence to provide replication. Culture pH was reduced with corn (5.55) and did not differ between barley cultivars (average pH 5.89). Total volatile fatty acid concentration and acetate to propionate ratio were not different across grain type or barley cultivar with the exception of greater total volatile fatty acid concentrations with hull-less barley. Corn produced less methane (14.6 mmol/d) and ammonia-N (7.3 mg/100 mL) compared with barley (33.1 mmol/d and 22 mg/100 mL, respectively); methane was greater with hull-less barley but ammonia-N concentration was similar between the 2 barley cultivars. Hull-less barley had greater digestibility compared with hulled barley, and corn had reduced digestibility compared with barley. Concentrations of C18:0 were greater and those of C18:1 and C18:2 lesser in cultures fed hulled and hull-less barley compared with corn. Our data indicate that grain type and barley cultivar have an impact on ruminal fermentation. The lesser starch concentration of barley minimized the drop in culture pH and improved digestibility.

  14. Comparative energy content and amino acid digestibility of barley obtained from diverse sources fed to growing pigs

    Directory of Open Access Journals (Sweden)

    Hong Liang Wang

    2017-07-01

    Full Text Available Objective Two experiments were conducted to determine the content of digestible energy (DE and metabolizable energy (ME as well as the apparent ileal digestibility (AID and standardized ileal digestibility (SID of crude protein (CP and amino acids (AA in barley grains obtained from Australia, France or Canada. Methods In Exp. 1, 18 growing barrows (Duroc×Landrace×Yorkshire; 31.5±3.2 kg were individually placed in stainless-steel metabolism crates (1.4×0.7×0.6 m and randomly allotted to 1 of 3 test diets. In Exp. 2, eight crossbred pigs (30.9±1.8 kg were allotted to a replicate 3×4 Youden Square designed experiment with three periods and four diets. Two pigs received each diet during each test period. The diets included one nitrogen-free diet and three test diets. Results The relative amounts of gross energy (GE, CP, and all AA in the Canadian barley were higher than those in Australian and French barley while higher concentrations of neutral detergent fiber, acid detergent fiber, total dietary fiber, insoluble dietary fiber and β-glucan as well as lower concentrations of GE and ether extract were observed in the French barley compared with the other two barley sources. The DE and ME as well as the SID of histidine, isoleucine, leucine and phenylalanine in Canadian barley were higher (p<0.05 than those in French barley but did not differ from Australian barley. Conclusion Differences in the chemical composition, energy content and the SID and AID of AA were observed among barley sources obtained from three countries. The feeding value of barley from Canada and Australia was superior to barley obtained from France which is important information in developing feeding systems for growing pigs where imported grains are used.

  15. Extracellular RNA Communication (ExRNA)

    Data.gov (United States)

    Federal Laboratory Consortium — Until recently, scientists believed RNA worked mostly inside the cell that produced it. Some types of RNA help translate genes into proteins that are necessary for...

  16. Fermentation of barley by using Saccharomyces cerevisiae: examination of barley as a feedstock for bioethanol production and value-added products.

    Science.gov (United States)

    Gibreel, Amera; Sandercock, James R; Lan, Jingui; Goonewardene, Laksiri A; Zijlstra, Ruurd T; Curtis, Jonathan M; Bressler, David C

    2009-03-01

    The objective of this study was to examine the ethanol yield potential of three barley varieties (Xena, Bold, and Fibar) in comparison to two benchmarks, corn and wheat. Very high gravity (VHG; 30% solids) fermentations using both conventional and Stargen 001 enzymes for starch hydrolysis were carried out as simultaneous saccharification and fermentation. The grains and their corresponding dried distiller's grain with solubles (DDGS) were also analyzed for nutritional and value-added characteristics. A VHG traditional fermentation approach utilizing jet-cooking fermentation revealed that both dehulled Bold and Xena barley produced ethanol concentrations higher than that produced by wheat (12.3, 12.2, and 11.9%, respectively) but lower than that produced by corn (13.8%). VHG-modified Stargen-based fermentation of dehulled Bold barley demonstrated comparable performance (14.3% ethanol) relative to that of corn (14.5%) and wheat (13.3%). Several important components were found to survive fermentation and were concentrated in DDGS. The highest yield of phenolics was detected in the DDGS (modified Stargen 001, 20% solids) of Xena (14.6 mg of gallic acid/g) and Bold (15.0 mg of gallic acid/g) when the hull was not removed before fermentation. The highest concentration of sterols in DDGS from barley was found in Xena (3.9 mg/g) when the hull was included. The DDGS recovered from corn had the highest concentration of fatty acids (72.6 and 77.5 mg/g). The DDGS recovered from VHG jet-cooking fermentations of Fibar, dehulled Bold, and corn demonstrated similar levels of tocopherols and tocotrienols. Corn DDGS was highest in crude fat but was lowest in crude protein and in vitro energy digestibility. Wheat DDGS was highest in crude protein content, similar to previous studies. The barley DDGS was the highest in in vitro energy digestibility.

  17. Genetic Diversity in Barley and Wheat for Tolerance to Soil Constraints

    Directory of Open Access Journals (Sweden)

    Yash P. Dang

    2016-11-01

    Full Text Available Surface soil sodicity as well as subsoil salinity, acidity, and phytotoxic concentrations of chloride (Cl are major soil constraints to crop production in many soils of sub-tropical, north-eastern Australia. The identification of genotypes tolerant to these soil constraints may be an option to maintain and improve productivity on these soils. We evaluated performance of 11 barley and 17 wheat genotypes grown on two sites <0.5 km apart. Compared to the non-sodic site, the sodic site had significantly higher Cl concentration (>800 mg·Cl·kg−1 in the subsoil (0.9–1.3 m soil depth and higher exchangeable sodium percentage (ESP (>6% in the surface and subsoil. Barley grain yield and plant available water capacity (PAWC were reduced between 5%–25% and 40%–66%, respectively, for different genotypes at the sodic site as compared to the non-sodic site. For wheat genotypes, grain yield was between 8% and 33% lower at the sodic site compared to the non-sodic site and PAWC was between 3% and 37% lower. Most barley and wheat genotypes grown at the sodic site showed calcium (Ca deficiency symptoms on younger leaves. Analysis of the youngest fully mature leaf (YML confirmed that genotypes grown at the sodic site with Ca concentration < 0.2% exhibited deficiency symptoms. Grain yields of both barley and wheat genotypes grown on the sodic and non-sodic sites increased significantly with increasing Ca and K in YML and decreased significantly with increasing Na and Cl concentrations in YML. Sodium (Na concentrations in YML of wheat genotypes grown at the sodic site were 10-fold higher than those from the non-sodic site whereas this increase was only two-fold in barley genotypes. In step-wise regression, the PAWC of barley and wheat genotypes grown on sodic and non-sodic sites was the principal determinant of variability of barley and wheat grain yield. Including the Ca concentration in the YML of wheat genotypes and K:Na ratio in the YML of barley

  18. Production of Ethanol From Newly Developed and Improved Winter Barley Cultivars.

    Science.gov (United States)

    Nghiem, Nhuan P; Brooks, Wynse S; Griffey, Carl A; Toht, Matthew J

    2017-05-01

    Winter barley has attracted strong interest as a potential feedstock for fuel ethanol production in regions with mild winter climate such as the mid-Atlantic and northeastern USA. Ten recently developed and improved winter barley cultivars and breeding lines including five hulled and five hull-less lines were experimentally evaluated for potential ethanol production. The five hulled barley lines included three released cultivars (Thoroughbred, Atlantic, and Secretariat) and two breeding lines (VA09B-34 and VA11B-4). The five hull-less lines also included three released cultivars (Eve, Dan, and Amaze 10) and two breeding lines (VA08H-65 and VA13H-34). On the average, the hull-less barley cultivars produced more ethanol per unit mass because of their higher starch and β-glucan contents. However, since the hulled barley cultivars had higher agronomic yield, the potential ethanol production per acre of land for the two types were approximately equal. Among the ten cultivars tested, the hull-less cultivar Amaze 10 was the best one for ethanol production. The ethanol yield values obtained for this cultivar were 2.61 gal per bushel and 292 gal per acre.

  19. Effects of heating procedures on deoxynivalenol, nivalenol and zearalenone levels in naturally contaminated barley and wheat.

    Science.gov (United States)

    Yumbe-Guevara, B E; Imoto, T; Yoshizawa, T

    2003-12-01

    The influence of heating temperature and time on deoxynivalenol (DON), nivalenol (NIV) and zearalenone (ZEA) contents in naturally co-contaminated barley and wheat was investigated intending to establish the basis for a decontamination model of Fusarium mycotoxins in cereals. The standard toxins and whole barley powder samples were heated in a convection oven at 140, 160, 180, 200, or 220 degrees C, and kernel subsamples (200 g each) were roasted in an experimental rotary gas-fired roaster at 150, 180 or 220 degrees C. All treatments resulted in a time-temperature-dependent decomposition of the toxins; the logarithm of the toxin remaining % presented a linear relationship with heating time. The lines equations were used to estimate the half (H) and decimal (D) decomposition times (time required to destroy 50 or 90% of the toxin, respectively). DON and NIV H and D decomposition times were similar and 50% shorter for heated standards than for whole barley powder. ZEA standard values were considerably longer, while whole barley powder values were comparable with those of DON and NIV. At 220 degrees C, D decomposition times of DON, NIV and ZEA heated standards were 11, 10 and 85 min, respectively, while the values obtained in whole barley powder were the same for the three toxins (25 min). The determination of H and D decomposition values constitutes a basis to understand the heating stability nature of each toxin.

  20. Density Stress has Minimal Impacts on the Barley or Maize Seedling Transcriptome

    Directory of Open Access Journals (Sweden)

    Summer St. Pierre

    2011-03-01

    Full Text Available High planting density affects the morphology and productivity of many crop species. Our objectives were to examine the phenotypic and transcriptomic changes that occur during plant density stress in barley ( L. and maize ( L. seedlings. In maize and barley seedlings, density stress impacted several morphological traits. Gene expression profiles were examined in four barley and five maize genotypes grown at low and high plant densities. Only 221 barley and 35 maize genes exhibited differential expression in response to plant density stress. The majority of the gene expression changes were observed in a subset of the genotypes and reflected minor changes in the level of expression, indicating that the plant density stress imposed in this study did not result in major changes in gene expression. Also, little overlap was observed within barley or maize genotypes in gene expression during density stress, indicating that genotypic differences play a major role in the response to density stress. While it is clear that gene expression differences are involved in morphological changes induced by high plant densities, it is likely that many of these gene expression differences are subtle and restricted to particular tissues and developmental time.

  1. Grain Composition and Functional Ingredients of Barley Varieties Created in Latvia

    Directory of Open Access Journals (Sweden)

    Šterna Vita

    2015-09-01

    Full Text Available Cereals, including barley, have been recognised as functional foods that provide beneficial effect on the health of the consumer and decrease the risk of various diseases. The aim of investigation was to determine the grain composition of barley varieties and perspective breeding lines bred in Latvia and to evaluate its functional ingredients. The results of analysis showed that protein content among varieties ranged from 106.6-146.8 g·kg-1, total dietary fibre 187.4-208.2 g·kg-1, β-glucans 42.8 g-49.4 g·kg-1, and amount of α-tocopherol 6.03-8.93 mg·kg-1. The sum of essential amino acids in barley grain samples was from 32.90 g·kg-1 to 38.71 g·kg-1. All varieties of hulled and hulless barley grain were found to be sources of protein with high biological value. Comparison of barley varieties bred in Latvia suggests that variety ‘Kornelija’ outperforms others in protein, dietary fibre and micronutrient content.

  2. Specificity and levels of nonhost resistance to nonadapted Blumeria graminis forms in barley.

    Science.gov (United States)

    Aghnoum, Reza; Niks, Rients E

    2010-01-01

    The genetic basis of nonhost resistance of barley to nonadapted formae speciales of Blumeria graminis is not known, as there is no barley line that is susceptible to these nonadapted formae speciales, such as the wheat powdery mildew pathogen, Blumeria graminis f.sp. tritici (Bgt). Barley accessions with rudimentary susceptibility to an isolate of the nonadapted Bgt were identified. Those accessions were intercrossed in two cycles and two lines, called SusBgt(SC) and SusBgt(DC), with substantial susceptibility to Bgt at the seedling stage were selected. The quantitative variation among barley accessions and in the progenies after convergent crossing suggests a polygenic basis for this nonhost resistance. Both lines allowed an unusually high level of haustorium formation and colony development by Bgt. The SusBgt lines and their ancestor lines also allowed haustorium formation and conidiation by four out of seven isolates of other nonadapted B. graminis forms. Analysis of the infection process suggested that nonhost resistance factors are specific to the form and developmental stage of B. graminis. Resistances to establishment (first haustorium), colonization (subsequent haustoria) and conidiation are not associated. The lines developed will be of use in elucidating the genetic basis of nonhost resistance to Bgt in barley, and in gene expression and complementation studies on nonhost resistance.

  3. Enzymatic hydrolysis of barley and malt hemicellulose during brewing and mashing

    Energy Technology Data Exchange (ETDEWEB)

    Ogurtsov, V.E.; Lifshits, D.B.; Kondratenko, N.V.; Babicheva, L.K.; Yarovenko, V.L.

    1978-01-01

    A study was made of the hydrolysis of hemicellulose as beer wort is produced during the mashing of malt and barley. The hydrolysis of hemicellulose was found to be insignificant (5 to 6%) as the barley is mashed (fine and course grain) under the influence of its enzymes. The hydrolysis is more intense (by 30%) when endosperm is mashed. The hydrolysis of hemicellulose does not occur during the mashing of malt. The mashing of barley endosperm with enzymatic preparations containing hemicellulose (cytorosemin P10kh, xylonigrin P10kh, amylorisin P10kh, and amylosubtilin G10kh), increases the hydrolysis of hemicellulose by 10 to 20% depending on the amount of hemicellulose. The utilization of the raw material extract is simultaneously increased significantly. The mashing of barley with the same enzyme preparations increases the degree of hemicellulose hydrolysis by 6 to 18% and the use of the raw extract by 14 to 27% by 3 to 10% for the fine grain, and by 9 to 25% for the course grain. The degree of hemicellulose hydrolysis during the production of barley wort is influenced not only by the composition of the mash (endosperm or whole grain), but also by the degree of grain pulverization. 7 references, 5 tables.

  4. Structural comparison of arabinoxylans from two barley side-stream fractions.

    Science.gov (United States)

    Pitkänen, Leena; Tuomainen, Päivi; Virkki, Liisa; Aseyev, Vladimir; Tenkanen, Maija

    2008-07-09

    The structures of barley ( Hordeum vulgare) arabinoxylans isolated from two industrial side fractions, barley husks (BH) and barley fiber (BF), were characterized. Arabinoxylans were extracted with saturated barium hydroxide after enzymatic pretreatment. Barium hydroxide was selective toward arabinoxylans, and only a minor amount of glucose-containing material was coextracted. Acid methanolysis followed by gas chromatography, 1H NMR spectroscopy, and specific enzymatic treatments followed by anion exchange chromatography with pulse amperometric detection (HPAEC-PAD) revealed that the chemical structure of barley husk arabinoxylan (BHAX) clearly differed from that of barley fiber arabinoxylan (BFAX). BFAX was more branched, containing more beta-D-xylopyranosyl (beta-D-Xylp) residues carrying alpha-L-arabinofuranosyl (alpha-L-Araf) units at both O-2 and O-3 positions. BHAX, on the other hand, contained more 2-O-beta-D-Xyl p-alpha-L-Ara f substituents than BFAX. BHAX and BFAX also differed with respect to the hydrodynamic properties investigated with multidetector size exclusion chromatography. BFAX had a higher weight-average molar mass and larger hydrodynamic volume, the latter indicating less dense conformation than BHAX. Mn, Mw /Mn, Rh, and the Mark-Houwink a value were also determined for both arabinoxylans.

  5. Comparison of mobile and stationary spore-sampling techniques for estimating virulence frequencies in aerial barley powdery mildew populations

    DEFF Research Database (Denmark)

    Hovmøller, M.S.; Munk, L.; Østergård, Hanne

    1995-01-01

    Gene frequencies in samples of aerial populations of barley powdery mildew (Erysiphe graminis f.sp. hordei), which were collected in adjacent barley areas and in successive periods of time, were compared using mobile and stationary sampling techniques. Stationary samples were collected from trap ...

  6. Synthesis of Salt Soluble Proteins in Barley. Pulse-Labeling Study of Grain Filling in Liquid-Cultured Detached Spikes

    DEFF Research Database (Denmark)

    Giese, Nanna Henriette; Hejgaard, Jørn

    1984-01-01

    The accumulation of salt-soluble proteins in the endosperm of developing barley (Hordeum vulgare L.) grains was examined. Detached spikes of barley were cultured at different levels of nitrogen nutrition and pulse-labeled with [14C] sucrose at specific times after anthesis. Proteins were extracte...

  7. Association mapping of grain hardness, polyphenol oxidase, total phenolics, amylose content, and ß-glucan in US barley breeding germplasm

    Science.gov (United States)

    A renewed interest in breeding barley specifically for food end-uses is being driven by increased consumer interest in healthier foods. We conducted association mapping on physicochemical properties of barley that play a role in food quality and processing including, grain hardness, polyphenol oxid...

  8. Induction by chromium ions of chitinases and polyamines in barley (Hordeum vulgare L.) and rape (Brassica napus L. ssp. oleifera)

    DEFF Research Database (Denmark)

    Jacobsen, S.; Hauschild, M.Z.; Rasmussen, U.

    1992-01-01

    Barley and rape seedlings were grown in hydroponic culture with increasing concentrations of CrO3 (Cr(VI)) or CrCl3 (Cr(III)). The chitinase activity and the concentrations of putrescine, spennidine and spermine were determined in the third leaf of barley seed-lings and in the second leaf of rape...

  9. Haplotype divergence and multiple candidate genes at Rphq2, a partial resistance QTL of barley to Puccinia hordei

    NARCIS (Netherlands)

    Yeo Kuok San, Freddy; Wang, Y.; Vozabova, Tereza; Huneau, C.; Leroy, P.; Chalhoub, B.; Qi, X.Q.; Niks, R.E.; Marcel, T.C.

    2016-01-01

    Key message: Rphq2, a minor gene for partial resistance toPuccinia hordei, was physically mapped in a 188 kbp introgression with suppressed recombination between haplotypes ofrphq2andRphq2barley cultivars.Abstract: Partial and non-host resistances to rust fungi in barley (Hordeum vulgare) may be

  10. Genome-wide association mapping of barley yellow dwarf virus tolerance in spring oat (Avena sativa L.)

    Science.gov (United States)

    Barley yellow dwarf (BYD) is one of the most destructive diseases of cereal crops worldwide. Barley yellow dwarf viruses (BYDVs) are responsible for BYD and affect many cereals including oat (Avena sativa L.). Until recently, the molecular marker technology in oat has not allowed for many marker-t...

  11. Influence of diurnal photosynthetic activity on the morphology, structure, and thermal properties of normal and waxy barley starch

    DEFF Research Database (Denmark)

    Goldstein, Avi; Annor, George; Vamadevan, Varatharajan

    2017-01-01

    This study investigated the influence of diurnal photosynthetic activity on the morphology, molecular composition, crystallinity, and gelatinization properties of normal barley starch (NBS) and waxy barley starch (WBS) granules from plants cultivated in a greenhouse under normal diurnal (16h light...

  12. Isolate specificity and polygenic inheritance of resistance in barley to the heterologous rust pathogen Puccinia graminis f. sp. avenae

    NARCIS (Netherlands)

    Dracatos, P.M.; Nansamba, M.; Berlin, A.; Park, R.F.; Niks, R.E.

    2016-01-01

    Barley is a near-nonhost to numerous heterologous (nonadapted) rust pathogens because a small proportion of genotypes are somewhat susceptible. We assessed 66 barley accessions and three mapping populations (Vada x SusPtrit, Cebada Capa x SusPtrit, and SusPtrit x Golden Promise) for response to

  13. The untranslated leader sequence of the barley lipoxygenase 1 (Lox1) gene confers embryo-specific expression

    NARCIS (Netherlands)

    Rouster, J.; Mechelen J. van; Cameron-Mills, V.

    1998-01-01

    The barley lipoxygenase 1 (Lox1) gene encodes a protein expressed in embryos during grain development and germination and in leaves after methyl-jasmonate (MeJA) treatment. Transient gene expression assays in germinating barley embryos were used to identify cis-regulatory elements involved in the

  14. Regrowth in Barley (Hordeum vulgare L.) and Rye (Secale cereale L.)

    DEFF Research Database (Denmark)

    Christiansen, J L; Jørgensen, Johannes Ravn; Jørnsgård, B

    1998-01-01

    Regrowth after cutting at four development stages, from heading to grain maturity, was investigated in a pot experiment containing three rye and four barley varieties (including 2 Hordeum spontaneum lines). Regrowth in the barley varieties decreased strongly from heading to grain maturity. Rye...

  15. The viscoelastic properties of the protein-rich materials from the fermented hard wheat, soft wheat and barley flours

    Science.gov (United States)

    The linear and non-linear rheological properties of the suspensions for the hard red spring wheat (HRS) flour, soft wheat (Pastry) flour, barley flour, as well as the remain residues of HRS flour, Pastry flour, and barley flour after fermentation were investigated. The linear and non-linear rheologi...

  16. Registration of STARS 1501B and STARS 1502B barley germplasm with Rsg2 resistance to greenbug

    Science.gov (United States)

    STARS 1501B (Reg. No. GP- , PI 675335) greenbug-resistant, six-rowed, spring, feed barley (Hordeum vulgare L.) germplasm and STARS 1502B (Reg. No. GP-, PI 675336) greenbug-resistant, six-rowed, winter, feed barley germplasm, tested as GR 001 and GR 010 respectively, were developed and released by US...

  17. Biosynthesis of the leucine derived α-, β- and γ-hydroxynitrile glucosides in barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Knoch, Eva; Motawie, Mohammed Saddik; Olsen, Carl Erik

    2016-01-01

    Barley (Hordeum vulgare L.) produces five leucine-derived hydroxynitrile glucosides (HNGs), of which only epiheterodendrin is a cyanogenic glucoside. The four non-cyanogenic HNGs are the β-HNG epidermin and the γ-HNGs osmaronin, dihydroosmaronin and sutherlandin. By analyzing 247 spring barley...

  18. Effectiveness of rabbit manure biofertilizer in barley crop yield.

    Science.gov (United States)

    Islas-Valdez, Samira; Lucho-Constantino, Carlos A; Beltrán-Hernández, Rosa I; Gómez-Mercado, René; Vázquez-Rodríguez, Gabriela A; Herrera, Juan M; Jiménez-González, Angélica

    2017-11-01

    The quality of biofertilizers is usually assessed only in terms of the amount of nutrients that they supply to the crops and their lack of viable pathogens and phytotoxicity. The goal of this study was to determine the effectiveness of a liquid biofertilizer obtained from rabbit manure in terms of presence of pathogens, phytotoxicity, and its effect on the grain yield and other agronomic traits of barley (Hordeum vulgare L.). Environmental effects of the biofertilizer were also evaluated by following its influence on selected soil parameters. We applied the biofertilizer at five combinations of doses and timings each and in two application modes (foliar or direct soil application) within a randomized complete block design with three replicates and using a chemical fertilizer as control. The agronomic traits evaluated were plant height, root length, dry weight, and number of leaves and stems at three growth stages: tillering, jointing, and flowering. The effectiveness of the biofertilizer was significantly modified by the mode of application, the growth stage of the crop, and the dose of biofertilizer applied. The results showed that the foliar application of the biofertilizer at the tillering stage produced the highest increase in grain yield (59.7 %, p biofertilizer caused significant changes in soil, particularly concerning pH, EC, Ca, Zn, Mg, and Mn. It is our view that the production and use of biofertilizers are a reliable alternative to deal with a solid waste problem while food security is increased.

  19. The impact of stubble crop on spring barley weed infestation

    Directory of Open Access Journals (Sweden)

    Eleonora Wrzesińska

    2016-09-01

    Full Text Available The condition and degree of weed infestation were determined in a spring barely crop grown in a short-term monoculture after mulching the soil with plants grown as a stubble crop (the control treatment without cover crop – lacy phacelia, white mustard, sunflower. The field experiment was carried out in 2010–2013 on good rye soil complex using a split-block design in four replications. The obtained results (the mean from all years of the experiment showed that the stubble crop, especially sunflower, reduced the diversity of weed species without causing at the same time changes in weed species dominance. In all the control treatments of the experiment, Chenopodium album and Fallopia convolvulus were the dominant species. The degree of spring barley weed infestation depended on the species grown in the cover crop. White mustard and lacy phacelia slightly increased the number of weeds but their fresh matter significantly increased. However, the sunflower cover crop significantly increased the number of weeds without any substantial differentiation of their fresh mass.

  20. Growth curve registration for evaluating salinity tolerance in barley

    KAUST Repository

    Meng, Rui

    2017-03-23

    Background: Smarthouses capable of non-destructive, high-throughput plant phenotyping collect large amounts of data that can be used to understand plant growth and productivity in extreme environments. The challenge is to apply the statistical tool that best analyzes the data to study plant traits, such as salinity tolerance, or plant-growth-related traits. Results: We derive family-wise salinity sensitivity (FSS) growth curves and use registration techniques to summarize growth patterns of HEB-25 barley families and the commercial variety, Navigator. We account for the spatial variation in smarthouse microclimates and in temporal variation across phenotyping runs using a functional ANOVA model to derive corrected FSS curves. From FSS, we derive corrected values for family-wise salinity tolerance, which are strongly negatively correlated with Na but not significantly with K, indicating that Na content is an important factor affecting salinity tolerance in these families, at least for plants of this age and grown in these conditions. Conclusions: Our family-wise methodology is suitable for analyzing the growth curves of a large number of plants from multiple families. The corrected curves accurately account for the spatial and temporal variations among plants that are inherent to high-throughput experiments.

  1. Structural lability of Barley stripe mosaic virus virions.

    Directory of Open Access Journals (Sweden)

    Valentin V Makarov

    Full Text Available Virions of Barley stripe mosaic virus (BSMV were neglected for more than thirty years after their basic properties were determined. In this paper, the physicochemical characteristics of BSMV virions and virion-derived viral capsid protein (CP were analyzed, namely, the absorption and intrinsic fluorescence spectra, circular dichroism spectra, differential scanning calorimetry curves, and size distributions by dynamic laser light scattering. The structural properties of BSMV virions proved to be intermediate between those of Tobacco mosaic virus (TMV, a well-characterized virus with rigid rod-shaped virions, and flexuous filamentous plant viruses. The BSMV virions were found to be considerably more labile than expected from their rod-like morphology and a distant sequence relation of the BSMV and TMV CPs. The circular dichroism spectra of BSMV CP subunits incorporated into the virions, but not subunits of free CP, demonstrated a significant proportion of beta-structure elements, which were proposed to be localized mostly in the protein regions exposed on the virion outer surface. These beta-structure elements likely formed during virion assembly can comprise the N- and C-terminal protein regions unstructured in the non-virion CP and can mediate inter-subunit interactions. Based on computer-assisted structure modeling, a model for BSMV CP subunit structural fold compliant with the available experimental data was proposed.

  2. Dynamic viscosity study of barley malt and chicory concentrates

    Directory of Open Access Journals (Sweden)

    G. O. Magomedov

    2016-01-01

    Full Text Available The purpose of research is to find optimal conditions for dispersing and subsequent dehydration of liquid food environments in the nozzle spray drying chamber through the study of dynamic changes in viscosity according to temperature, velocities gradients and dry residue content. The objects of study were roasted chicory and malt barley concentrates with dry residue content of 20, 40, 60 and 80%. Research of dynamic viscosity were carried out at the measuring complex based on the rotational viscometer Rheotest II, analog-to-digital converter, module Laurent and a personal computer with a unique software that allows to record in real time (not only on a tape recorder, but also in the form of graphic files the behavior of the viscosity characteristics of concentrates. Registration of changes of dynamic viscosity was carried out at a shear rate gradient from 1,0 с -1 to 27,0 с -1 and the products temperature thermostating : 35, 55, 75˚ C. The research results are presented in the form of graphic dependences of effective viscosity on shear rate and flow curves (dependencies of shear stresses on the velocity gradient, which defined flow regimes, the optimal modes of dispersion concentrates into spray dryer chambers in obtaining of powdered semi-finished products and instanting were found: dry residue content - 40 %, concentrate temperature - 75 ˚C, velocity gradient in the air channel of the nozzle at least 20 c-1

  3. Plasma membrane and salinity tolerance of barley plants

    International Nuclear Information System (INIS)

    Al-Rahmani, F. H.; Al-Mashhadani, M. S.; Al-Delemee, N. H.

    1997-01-01

    Barley cultivar, California Mario ut, was grown in a nutrient solution containing increasing Nacl concentrations up to 250 mm. The effect of Nacl on growth, mineral compost ion ant integrity of the plasma membrane was studied. Growth of the shoot'and root was stimulated or little affected by 10 and 20 ml Nacl. Further increase in Nacl concentrations depressed the growth. The depression was conspicuous between 100 and 250 mm Nacl. Increasing Nacl concentration decreased potassium content in the shoots and roots and led to steep increase in sodium accumulation. The integrity of the plasma membrane was measured in term of potassium leakage from the root tips. Rapid leakage of potassium was obtained at Nacl concentrations ranging from 100 to 250 mm. At the same concentrations of Nacl, adenosine triphosphatase activity in the root tips was increased. Results indicate that the plasma membrane of root cells was damaged by the increased levels of salinity. It was concluded that the plasma membrane of root cells is the primary site of salinity toxicity. (authors). 40 refs., 5 tabs. 3 figs

  4. Golgi localized barley MTP8 proteins facilitate Mn transport

    DEFF Research Database (Denmark)

    Pedas, Pai Rosager; Schiller, Michaela; Hegelund, Josefine Nymark

    2014-01-01

    Many metabolic processes in plants are regulated by manganese (Mn) but limited information is available on the molecular mechanisms controlling cellular Mn homeostasis. In this study, a yeast assay was used to isolate and characterize two genes, MTP8.1 and MTP8.2 , which encode membrane-bound pro......Many metabolic processes in plants are regulated by manganese (Mn) but limited information is available on the molecular mechanisms controlling cellular Mn homeostasis. In this study, a yeast assay was used to isolate and characterize two genes, MTP8.1 and MTP8.2 , which encode membrane...... in yeast, MTP8.1 and MTP8.2 were found to be Mn transporters catalysing Mn efflux in a similar manner as the Golgi localized endogenous yeast protein Pmr1p. The level of MTP8.1 transcripts in barley roots increased with external Mn supply ranging from deficiency to toxicity, while MTP8.2 transcripts......8 proteins are involved in Mn loading to the Golgi apparatus and play a role in Mn homeostasis by delivering Mn to Mn-dependent enzymes and/or by facilitating Mn efflux via secretory vesicles. This study highlights the importance of MTP transporters in Mn homeostasis and is the first report of Golgi...

  5. MRI-assessed therapeutic effects of locally administered PLGA nanoparticles loaded with anti-inflammatory siRNA in a murine arthritis model

    DEFF Research Database (Denmark)

    Te Boekhorst, Bernard C M; Jensen, Linda B; Colombo, Stefano

    2012-01-01

    Rheumatoid arthritis is characterized by systemic inflammation of synovial joints leading to erosion and cartilage destruction. Although efficacious anti-tumor necrosis factor a (TNF-a) biologic therapies exist, there is an unmet medical need for safe and more efficient treatment regimens...... for disease remission. We evaluated the anti-inflammatory effects of poly(dl-lactide-co-glycolide acid) (PLGA) nanoparticles loaded with small interfering RNA (siRNA) directed against TNF-a in vitro and in vivo. The siRNA-loaded PLGA nanoparticles mediated a dose-dependent TNF-a silencing...... with nanoparticles loaded with TNF-a siRNA (1µg) resulted in a reduction in disease activity, evident by a significant decrease of the paw scores and joint effusions, as compared to treatment with PLGA nanoparticles loaded with non-specific control siRNA, whereas the degree of bone marrow edema in the tibial...

  6. A conformational switch in the DiGIR1 ribozyme involved in release and folding of the downstream I-DirI mRNA

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Einvik, Christer; Lentz, Thomas E

    2009-01-01

    DiGIR1 is a group I-like cleavage ribozyme found as a structural domain within a nuclear twin-ribozyme group I intron. DiGIR1 catalyzes cleavage by branching at an Internal Processing Site (IPS) leading to formation of a lariat cap at the 5'-end of the 3'-cleavage product. The 3'-cleavage product....... The role of HEG P1 in GIR1 branching is reminiscent of that of hairpin P-1 in splicing of the Tetrahymena rRNA group I intron and illustrates a general principle in RNA-directed RNA processing....... is subsequently processed into an mRNA encoding a homing endonuclease. By analysis of combinations of 5'- and 3'-deletions, we identify a hairpin in the 5'-UTR of the mRNA (HEG P1) that is formed by conformational switching following cleavage. The formation of HEG P1 inhibits the reversal of the branching...

  7. Long-term reconstitution with water of dry barley before feeding increases phosphorus digestibility in pigs1

    DEFF Research Database (Denmark)

    Ton Nu, Mai Anh; Blaabjerg, Karoline; Poulsen, Hanne Damgaard

    2016-01-01

    Cereals are normally stored dry at low moisture content (digestible. The objective was to investigate the effect of reconstitution...... compared to dry stored barley on apparent total tract digestibility (ATTD) of P in pigs. Dry barley (12% moisture; total P, 3.3 g/kg DM; phytate P, 1.7 g/kg DM) was rolled and stored directly or reconstituted with water to produce rolled barley with 35% moisture that was stored in air-tight conditions...... numerically more soluble P (2.56 g/kg DM) and less phytate P (0.93 g/kg DM) than dry barley (0.78 and 1.7 g/kg DM). Pigs fed the reconstituted barley diet showed an increase in P absorption (54%, P

  8. Genomic analysis of 6,000-year-old cultivated grain illuminates the domestication history of barley.

    Science.gov (United States)

    Mascher, Martin; Schuenemann, Verena J; Davidovich, Uri; Marom, Nimrod; Himmelbach, Axel; Hübner, Sariel; Korol, Abraham; David, Michal; Reiter, Ella; Riehl, Simone; Schreiber, Mona; Vohr, Samuel H; Green, Richard E; Dawson, Ian K; Russell, Joanne; Kilian, Benjamin; Muehlbauer, Gary J; Waugh, Robbie; Fahima, Tzion; Krause, Johannes; Weiss, Ehud; Stein, Nils

    2016-09-01

    The cereal grass barley was domesticated about 10,000 years before the present in the Fertile Crescent and became a founder crop of Neolithic agriculture. Here we report the genome sequences of five 6,000-year-old barley grains excavated at a cave in the Judean Desert close to the Dead Sea. Comparison to whole-exome sequence data from a diversity panel of present-day barley accessions showed the close affinity of ancient samples to extant landraces from the Southern Levant and Egypt, consistent with a proposed origin of domesticated barley in the Upper Jordan Valley. Our findings suggest that barley landraces grown in present-day Israel have not experienced major lineage turnover over the past six millennia, although there is evidence for gene flow between cultivated and sympatric wild populations. We demonstrate the usefulness of ancient genomes from desiccated archaeobotanical remains in informing research into the origin, early domestication and subsequent migration of crop species.

  9. Production and processing of siRNA precursor transcripts from the highly repetitive maize genome.

    Directory of Open Access Journals (Sweden)

    Christopher J Hale

    2009-08-01

    Full Text Available Mutations affecting the maintenance of heritable epigenetic states in maize identify multiple RNA-directed DNA methylation (RdDM factors including RMR1, a novel member of a plant-specific clade of Snf2-related proteins. Here we show that RMR1 is necessary for the accumulation of a majority of 24 nt small RNAs, including those derived from Long-Terminal Repeat (LTR retrotransposons, the most common repetitive feature in the maize genome. A genetic analysis of DNA transposon repression indicates that RMR1 acts upstream of the RNA-dependent RNA polymerase, RDR2 (MOP1. Surprisingly, we show that non-polyadenylated transcripts from a sampling of LTR retrotransposons are lost in both rmr1 and rdr2 mutants. In contrast, plants deficient for RNA Polymerase IV (Pol IV function show an increase in polyadenylated LTR RNA transcripts. These findings support a model in which Pol IV functions independently of the small RNA accumulation facilitated by RMR1 and RDR2 and support that a loss of Pol IV leads to RNA Polymerase II-based transcription. Additionally, the lack of changes in general genome homeostasis in rmr1 mutants, despite the global loss of 24 nt small RNAs, challenges the perceived roles of siRNAs in maintaining functional heterochromatin in the genomes of outcrossing grass species.

  10. Hamowanie syntezy chlorofilu i RNA w izolowanych liścieniach ogórka przez N-hydroksymocznik [Inhibition of chlorophyll and RNA synthesis by N-hydroxyurea in detached cucumber cotyledons

    Directory of Open Access Journals (Sweden)

    A. Rennert

    2015-01-01

    Full Text Available N-hydroxyurea (HU at the concentration of 5 x 10-4 M decreased the content of chlorophyll in detached cucumber cotyledons; at this concentration it has no inhibitory effect on growth. Benzylaminopurine, gibberelic acid and KCl partially reversed the inhibitory effect of HU on chlorophyll synthesis. HU stimulated yellowing of barley first leaf sections. The compound had little effect on leucine-14C incorporation to protein, and markedly inhibited uracil-14C incorporation in to RNA of the greening cucumber cotyledons. It is suggested that the inhibition of RNA and chlorophyll synthesis in HU-treated cucumber cotyledons follows the HU-dependent inhibition of DNA replication.

  11. Brome mosaic virus Infection of Rice Results in Decreased Accumulation of RNA1.

    Science.gov (United States)

    Kitayama, Masahiko; Hoover, Haley; Middleton, Stefani; Kao, C Cheng

    2015-05-01

    Brome mosaic virus (BMV) (the Russian strain) infects monocot plants and has been studied extensively in barley and wheat. Here, we report BMV can systemically infect rice (Oryza sativa var. japonica), including cultivars in which the genomes have been determined. The BMV capsid protein can be found throughout the inoculated plants. However, infection in rice exhibits delayed symptom expression or no symptoms when compared with wheat (Triticum aestivum). The sequences of BMV RNAs isolated from rice did not reveal any nucleotide changes in RNA1 or RNA2, while RNA3 had only one synonymous nucleotide change from the inoculum sequence. Preparations of purified BMV virions contained RNA1 at a significantly reduced level relative to the other two RNAs. Analysis of BMV RNA replication in rice revealed that minus-strand RNA1 was replicated at a reduced rate when compared with RNA2. Thus, rice appears to either inhibit RNA1 replication or lacks a sufficient amount of a factor needed to support efficient RNA1 replication.

  12. Silencing barley cystatins HvCPI-2 and HvCPI-4 specifically modifies leaf responses to drought stress.

    Science.gov (United States)

    Velasco-Arroyo, Blanca; Diaz-Mendoza, Mercedes; Gomez-Sanchez, Andrea; Moreno-Garcia, Beatriz; Santamaria, Maria Estrella; Torija-Bonilla, Miguel; Hensel, Goetz; Kumlehn, Jochen; Martinez, Manuel; Diaz, Isabel

    2018-02-27

    Protein breakdown and mobilization are some of the major metabolic features associated with abiotic stresses, essential for nutrient recycling and plant survival. Genetic manipulation of protease and/or protease inhibitors may contribute to modulate proteolytic processes and plant responses. The expression analysis of the whole cystatin family, inhibitors of C1A cysteine proteases, after water deprivation in barley leaves highlighted the involvement of Icy-2 and Icy-4 cystatin genes. Artificial microRNA lines independently silencing the two drought-induced cystatins were generated to assess their function in planta. Phenotype alterations at the final stages of the plant life cycle are represented by the stay-green phenotype of silenced cystatin 2 lines. Besides, the enhanced tolerance to drought and differential responses to water deprivation at the initial growing stages are observed. The mutual compensating expression of Icy-2 and Icy-4 genes in the silencing lines pointed to their cooperative role. Proteolytic patterns by silencing these cystatins were concomitant with modifications in the expression of potential target proteases, in particular, HvPap-1, HvPap-12, and HvPap-16 C1A proteases. Metabolomics analysis lines also revealed specific modifications in the accumulation of several metabolites. These findings support the use of plants with altered proteolytic regulation in crop improvement in the face of climate change. © 2018 John Wiley & Sons Ltd.

  13. Improvement of Barley yellow dwarf virus-PAV detection in single aphids using a fluorescent real time RT-PCR.

    Science.gov (United States)

    Fabre, Frédéric; Kervarrec, Christine; Mieuzet, Lucie; Riault, Gérard; Vialatte, Aude; Jacquot, Emmanuel

    2003-06-09

    One of the major factors determining the incidence of Barley yellow dwarf virus (BYDV) on autumn-sown cereals is the viruliferous state of immigrant winged aphids. This variable is assessed routinely using the enzyme-linked immunosorbant assay (ELISA). However, the threshold for virus detection by ELISA can lead to false negative results for aphids carrying less than 10(6) particles. Although molecular detection techniques enabling the detection of lower virus quantities in samples are available, the relatively laborious sample preparation and data analysis have restricted their use in routine applications. A gel-free real-time one-step reverse transcription polymerase chain reaction (RT-PCR) protocol is described for specific detection and quantitation of BYDV-PAV, the most widespread BYDV species in Western Europe. This new assay, based on TaqMan technology, detects and quantifies from 10(2) to 10(8) BYDV-PAV RNA copies. This test is 10 and 10(3) times more sensitive than the standard RT-PCR and ELISA assays published previously for BYDV-PAV detection and significantly improves virus detection in single aphids. Extraction of nucleic acids from aphids using either phenol/chloroform or chelatin resin-based protocols allow the use of pooled samples or of a small part (up to 1/1600th) of a single aphid extract for efficient BYDV-PAV detection.

  14. A Chinese isolate of barley yellow dwarf virus-PAV represents a third distinct species within the PAV serotype.

    Science.gov (United States)

    Liu, F; Wang, X; Liu, Y; Xie, J; Gray, S M; Zhou, G; Gao, B

    2007-01-01

    The complete nucleotide sequence of barley yellow dwarf virus (BYDV) PAV-CN genomic RNA was determined. This represents the seventh complete genome sequence of a BYDV-PAV serotype. The genome organization of PAV-CN was comparable to that of other BYDV-PAV serotypes, but the nucleotide sequence of full genome was only 76.9-80.3% similar. Sequence similarity of individual open reading frames and untranslated regions (UTR) between PAV-CN and other PAV isolates ranged from 37.9 to 98.2%. Overall, PAV-CN was most similar to BYDV-PAS, which belongs to one of two distinct species within the PAV serotype of BYDV, although the 5' UTR and ORF1 of PAV-CN was most similar to BYDV-GAV, another member of the genus Luteovirus that is not serologically related to BYDV-PAV. These data suggest that PAV-CN may have undergone a recombination event with GAV and that PAV-CN represents a third distinct species within the PAV serotype of BYDV.

  15. RNA Sequencing Analysis of Salivary Extracellular RNA.

    Science.gov (United States)

    Majem, Blanca; Li, Feng; Sun, Jie; Wong, David T W

    2017-01-01

    Salivary biomarkers for disease detection, diagnostic and prognostic assessments have become increasingly well established in recent years. In this chapter we explain the current leading technology that has been used to characterize salivary non-coding RNAs (ncRNAs) from the extracellular RNA (exRNA) fraction: HiSeq from Illumina® platform for RNA sequencing. Therefore, the chapter is divided into two main sections regarding the type of the library constructed (small and long ncRNA libraries), from saliva collection, RNA extraction and quantification to cDNA library generation and corresponding QCs. Using these invaluable technical tools, one can identify thousands of ncRNA species in saliva. These methods indicate that salivary exRNA provides an efficient medium for biomarker discovery of oral and systemic diseases.

  16. Identification of AFLP molecular linked to row- type gene in barley

    International Nuclear Information System (INIS)

    Sayed- Tabatabaei, B.E.

    2005-01-01

    Formation of the two-and six-rowed types in barley is predominantly controlled by alleles at a single locus (vrzl) which is located in long armn of chromosome 2H. This gene is a key character on the study of barley domestication and yield. Near-isogenic lines of barley were produced from crosses between Kanto Nakate Gold (tow-rowed) and Azumamugi (six-rowed). The selected lines were used for screening of AFLP polymorphic bands which are linked to vrs1 locus. After screening of a total of 1792 primer combination, five polymorphic bands were identified. A construction of high resolution map around the vrs1 locus was made using recombinant inbred lines. These markers can be used for a map-based cloning of the genes at the vrsl locus

  17. Comparison of different pretreatment strategies for enzymatic hydrolysis of wheat and barley straw

    DEFF Research Database (Denmark)

    Rosgaard, Lisa; Pedersen, Sven; Meyer, Anne Boye Strunge

    2007-01-01

    generally produced higher glucose concentrations after enzymatic hydrolysis than wheat straw. Acid or water impregnation followed by steam explosion of barley straw was the best pretreatment in terms of resulting glucose concentration in the liquid hydrolysate after enzymatic hydrolysis. When the glucose...... procedures: acid or water impregnation followed by steam explosion versus hot water extraction. The pretreatments were compared after enzyme treatment using a cellulase enzyme system, Celluclast 1.5 L (R) from Trichoderma reesei, and a beta-glucosidase, Novozyme 188 from Aspergillus niger. Barley straw...... concentrations obtained after enzymatic hydrolyses were related to the potential glucose present in the pretreated residues, the highest yield, similar to 48% (g g(-1)), was obtained with hot water extraction pretreatment of barley straw; this pretreatment also produced highest yields for wheat straw, producing...

  18. Improving nitrogen use efficiency in barley (Hordeum vulgare L.) through the cisgenic approach

    DEFF Research Database (Denmark)

    Kichey, Thomas; Holme, Inger; Møller, Inge Skrumsager

    2009-01-01

    Barley is one of the major crops cultivated worldwide and constitutes an important basis for animal feed. However, the production is facing a number of challenges that will be accentuated in the years to come, in particular restrictions on the use of nitrogen (N) fertilizer. In order to improve...... the N use efficiency in barley, we are developing a new generation of genetically modified plants based on the concept of cisgenesis. In this approach, plants are transformed only with their own genetic material. The genes encoding the cytosolic isoform of the glutamine synthetase (GS1...... into the pGreenII binary vector. The genes have been inserted into barley by Agrobacterium-mediated transformation using the hygromycin phosphotransferase gene for selection of transformed lines on hygromycin. In this system, the resistance gene is placed on the helper plasmid pSoup allowing for separate...

  19. [Hordein locus polymorphism in near eastern local populations of cultivated barley (Hordeum vulgare L.)].

    Science.gov (United States)

    Pomortsev, A A; Martynov, S P; Lialina, E V

    2008-06-01

    Electrophoresis in starch gel has been used to study the polymorphism of hordeins encoded by loci Hrd A, Hrd B, and Hrd F in 140 local barley populations from the Near East, including 60, 34, 33, 8, and 5 populations from Syria, Jordan, Iraq, Palestine, and Israel, respectively. Fifty-seven Hrd A, 87 Hrd B, and 5 Hrd F alleles have been found. The alleles of these loci considerably differ in frequencies and distribution in populations from different Near Eastern countries. Cluster analysis of the matrix of the frequencies of hordein locus alleles in barley populations from the Near East, North Africa, Ethiopia, and South Arabia has yielded two clusters. The first cluster includes barley populations from Israel, Palestine, Morocco, Tunisia, Algeria, and Egypt; the second cluster, populations from Iraq, Syria, Jordan, Yemen, and Ethiopia.

  20. Comparison of foliar anatomy of ten bread wheat (triticum, poaceae) and ten barley (hordeum, poaceae) cultivars

    International Nuclear Information System (INIS)

    Ardic, M.; Sezer, O.; Ozgdsd, K.; Yaylaci, O. K.; Koyuncu, O.; Olgun, M.; Bascdftcd, Z. B.; Ayter, N. G.

    2015-01-01

    The aim of this study is to determine anatomical differences and classification of leaf and leaf cell characteristics (cuticle thickness, upper epidermis thickness, lower epidermis thickness, mesophyll thickness, parenchyma thickness and leaf thickness) between 10 bread wheat cultivars (Triticum aestivum L.) and 10 barley cultivars (Hordeum vulgare L.). Classification of leaf characteristics in bread wheat and barley cultivars and relationship between leaf characteristics are made by principal component and correlation analyses. Highest thickness belongs to W8 Mufitbey cultivar in mesophyll and lower epidermis and W1 Sonmez 01 cultivar have the lowest thickness of upper epidermis in bread wheat. In Barley, B1 Ince cultivar has highest leaf thickness mesophyll and parenchyma; lowest thickness of cuticle is included B7 Cumhuriyet 50 cultivar. All other cultivars have homogenous contents of leaf characteristics. (author)

  1. Effect of crop density on competition by wheat and barley with Agrostemma githago and other weeds

    DEFF Research Database (Denmark)

    Doll, H.; Holm, U.; Søgaard, B.

    1995-01-01

    The effect of Agrostemma githago L. and other naturally occurring weeds on biomass production and grain yield was studied in winter wheat and winter barley. Naturally occurring weeds had only a negligible effect on barley, but reduced wheat grain yield by 10% at a quarter of normal crop density....... The interaction between the cereals and A. githago was studied in additive series employing different crop densities. Growth of this weed species was strongly dependent on crop density, which was more important for controlling weed growth than it was for obtaining a normal grain yield. Wheat and especially barley...... had a better competitive ability than A. githago. Wheat and A. githago utilized resources for growth better when grown in mixture than when grown in pure stands as the relative yield totals were significantly larger than unity....

  2. Cereal bioengineering: Amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Shaik, Shahnoor Sultana; Jensen, Susanne Langgård

    2011-01-01

    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were made by transgenic methods. Cereals producing these kind of starches have not been reported before. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch...... branching enzymes SBEIIa, SBEIIb and SBEI by a chimeric hairpin. The construct was inherited as a single locus with a distinct 1:3 segregation in consecutive generations. The transgenic grains were shrunken and the yield was around 80% of that found in wildtype. The starch granules were irregularly......, elongated and globose shaped. Transgenic grains also had a higher beta-glucan content. In order to increase barley starch phosphorylation, endosperm specific overexpression of glucan water dikinase from potato (StGWD) was conducted. The content of phosphate esters in starch from consecutive generations (T0...

  3. Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison

    DEFF Research Database (Denmark)

    Li, Chengdao; Ni, Peixiang; Francki, Michael

    2004-01-01

    Pre-harvest sprouting results in significant economic loss for the grain industry around the world. Lack of adequate seed dormancy is the major reason for pre-harvest sprouting in the field under wet weather conditions. Although this trait is governed by multiple genes it is also highly heritable....... A major QTL controlling both pre-harvest sprouting and seed dormancy has been identified on the long arm of barley chromosome 5H, and it explains over 70% of the phenotypic variation. Comparative genomics approaches among barley, wheat and rice were used to identify candidate gene(s) controlling seed...... dormancy and hence one aspect of pre-harvest sprouting. The barley seed dormancy/pre-harvest sprouting QTL was located in a region that showed good synteny with the terminal end of the long arm of rice chromosome 3. The rice DNA sequences were annotated and a gene encoding GA20-oxidase was identified...

  4. Identification Of Barley Grain Mycoflora By Next Generation Sequencing And Videometer Multispectral Imaging

    DEFF Research Database (Denmark)

    Jørgensen, Johannes Ravn; Carstensen, Jens Michael; Søren, Knudsen

    Seeds of Barley (Hordeum vulgare) are infected by a high number of fungi, including pathogens such as Fusarium graminearum, F. culmorum, F. poae, F. avenaceum and Pyrenophora teres. Fusarium spp. is a widely distributed fungus causing yield reduction in a range of agricultural crops and many...... species in the genus produce mycotoxins responsible for serious quality deterioration. In malting barley, Fusarium also has a negative effect by causing gushing in beer. A number of barley seeds (app. 200) assumed to be infected by fungal from different origins and years of cultivation were tested by NGS...... sequencing the ITS (Internal Transcribed Spacer) region from total DNA. Approximately 2-4000 sequences were obtained from each seed and these were subsequently identified to species level in order to give an exact identification of fungal genera on each seed. The main fungal genera identified were Fusarium...

  5. The effect of nitrogen fertilization and irradiation on barley susceptibility to net blotch disease

    International Nuclear Information System (INIS)

    Arabi, M.I.E.; Al-safadi, B.; Charbaji, T.

    2000-11-01

    Isolates of Drechslera teres f. sp. teres that cause net blotch symptoms on barley were collected from fields in different regions of Syria. there virulence spectra were determined using 11 barley cultivars. Cultivars exhibited a continuos range of response from very susceptible to moderately resistant. Isolate Raqa 13 had the highest mean virulence, then Halap 2, whereas ICARDA 3 was the lowest virulent. The effect of three concentrations (1000, 1500, 2000 ppm) of nitrogen (Urea 45%) fertilizer, and two doses of gamma ray (10 and 20 Gy), on susceptibility to infection by Drechslera teres were studied. Two barley cultivars (Thibaut and Furia) were used in this study. Results showed that 1000 ppm (N) and 15 Gy dose treatment had a positive effect on decreasing the susceptibility. (author)

  6. Pyricularia pennisetigena and P. zingibericola from invasive grasses infect signal grass, barley and wheat

    Directory of Open Access Journals (Sweden)

    Juliana Teodora de Assis Reges

    2016-06-01

    Full Text Available Fungal species from the Pyricularia genus are associated with blast disease in plants from the Poaceae family, causing losses in economically important crops such as rice, oat, rye, barley, wheat and triticale. This study aimed at characterizing the pathogenicity spectrum of P. pennisetigena and P. zingibericola to signal grass, barley and wheat, as well as comparing them with those from the species P. grisea and P. oryzae pathotype Triticum, which occur widely in the Brazilian agroecosystem. Twenty isolates of Pyricularia spp. were obtained from infected leaf samples of invasive plant species from wheat fields. The isolates classification into distinct Pyricularia species was done using molecular phylogeny based on actin and calmodulin genes. Pyricularia pennisetigena and P. zingibericola inoculated on plant leaves, at a concentration adjusted to 105 conidia mL-1, were pathogenic to signal grass, barley and wheat, with varying levels of aggressiveness.

  7. Evaluation of the Effect of Two Volatile Organic Compounds on Barley Pathogens

    Directory of Open Access Journals (Sweden)

    Amine Kaddes

    2016-08-01

    Full Text Available This study aimed to determine the effect of Volatile Organic Compounds (VOCs on some pathogens, these VOCs were emitted during interactions of barley with Fusarium culmorum Schltdl and/or Cochliobolus sativus Shoemaker, two common root rot pathogens. Our work shows that two organic esters: methyl propanoate (MP and methyl prop-2-enoate (MA significantly reduced the development of fungi in vitro. Additional tests showed that the esters significantly inhibited spore germination of these pathogens. The activity of these VOCs on a wide range of fungal and bacterial pathogens was also tested in vitro and showed inhibitory action. The effect of the VOCs on infected barley seeds also showed plantlets growing without disease symptoms. MA and MP seem to have potential value as alternative plant protection compounds against barley bioagressors.

  8. Programmed cell death: The life ambition of the barley aleurone layer

    DEFF Research Database (Denmark)

    Mark, Christina; Zor, Kinga; Heiskanen, Arto

    We have developed a 24-well multiplate tissue culture system with electrochemical and optical detection techniques for cultivation of immobilised barley aleurone layers. We have applied the system for the purpose of studying the underlying mechanisms of programmed cell death (PCD) in plants. We...... have optimised an electrochemical, intracellular, whole-cell redox activity assay [1] that probes the NAD(P):NAD(P)H ratio via a double-mediator system. Experiments show that redox activity changes depend on phytohormone activation or inactivation of aleurone layer metabolism and subsequent PCD. We...... have successfully applied a fluorescent double-probe system [2] to detect PCD to ensure that our redox activity data match with known responses of barley aleurone layers to phytohormones. We have also used the system for transformation of barley aleurone cells with α-amylase-GFP constructs...

  9. Structural basis for specificity of propeptide-enzyme interaction in barley C1A cysteine peptidases.

    Directory of Open Access Journals (Sweden)

    Inés Cambra

    Full Text Available C1A cysteine peptidases are synthesized as inactive proenzymes. Activation takes place by proteolysis cleaving off the inhibitory propeptide. The inhibitory capacity of propeptides from barley cathepsin L and B-like peptidases towards commercial and barley cathepsins has been characterized. Differences in selectivity have been found for propeptides from L-cathepsins against their cognate and non cognate enzymes. Besides, the propeptide from barley cathepsin B was not able to inhibit bovine cathepsin B. Modelling of their three-dimensional structures suggests that most propeptide inhibitory properties can be explained from the interaction between the propeptide and the mature cathepsin structures. Their potential use as biotechnological tools is discussed.

  10. Maize, Sunflower and Barley Sensitivity to the Residual Activity of Clomazone in Soil

    Directory of Open Access Journals (Sweden)

    Jelena Gajić Umiljendić

    2012-01-01

    Full Text Available Sensitivity of maize, sunflower and barley to clomazone residues in loamy soil wasassessed in the study using bioassay. Clomazone was applied at a series of concentrationsfrom 0.12 to 12 mg a.i./kg of soil. After 14 days, morphological (shoot height, fresh and dryweight and physiological (content of carotenoids, chlorophyll a and chlorophyll b parameterswere measured. The results showed that morphological parameters are not valid indicatorsof clomazone sensitivity. Based on the results showing inhibition of the physiologicalparameters, I50 values were calculated and used to estimate the difference in sensitivitybetween the species tested. Sunflower was the most sensitive species, while the differencein sensitivity between maize and barley was not significant.Nomenclature: clomazone (2-(2-chlorbenzyl-4,4-dimethyl-1,2-oxazolidin-3-one, maize(Zea mays L., sunflower (Helianthus annuus L., barley (Hordeum vulgare L.

  11. Ethnobotany, diverse food uses, claimed health benefits and implications on conservation of barley landraces in North Eastern Ethiopia highlands.

    Science.gov (United States)

    Shewayrga, Hailemichael; Sopade, Peter A

    2011-06-28

    Barley is the number one food crop in the highland parts of North Eastern Ethiopia produced by subsistence farmers grown as landraces. Information on the ethnobotany, food utilization and maintenance of barley landraces is valuable to design and plan germplasm conservation strategies as well as to improve food utilization of barley. A study, involving field visits and household interviews, was conducted in three administrative zones. Eleven districts from the three zones, five kebeles in each district and five households from each kebele were visited to gather information on the ethnobotany, the utilization of barley and how barley end-uses influence the maintenance of landrace diversity. According to farmers, barley is the "king of crops" and it is put for diverse uses with more than 20 types of barley dishes and beverages reportedly prepared in the study area. The products are prepared from either boiled/roasted whole grain, raw- and roasted-milled grain, or cracked grain as main, side, ceremonial, and recuperating dishes. The various barley traditional foods have perceived qualities and health benefits by the farmers. Fifteen diverse barley landraces were reported by farmers, and the ethnobotany of the landraces reflects key quantitative and qualitative traits. Some landraces that are preferred for their culinary qualities are being marginalized due to moisture shortage and soil degradation. Farmers' preference of different landraces for various end-use qualities is one of the important factors that affect the decision process of landraces maintenance, which in turn affect genetic diversity. Further studies on improving maintenance of landraces, developing suitable varieties and improving the food utilization of barley including processing techniques could contribute to food security of the area.

  12. phiC31 integrase-mediated site-specific recombination in barley.

    Directory of Open Access Journals (Sweden)

    Eszter Kapusi

    Full Text Available The Streptomyces phage phiC31 integrase was tested for its feasibility in excising transgenes from the barley genome through site-specific recombination. We produced transgenic barley plants expressing an active phiC31 integrase and crossed them with transgenic barley plants carrying a target locus for recombination. The target sequence involves a reporter gene encoding green fluorescent protein (GFP, which is flanked by the attB and attP recognition sites for the phiC31 integrase. This sequence disruptively separates a gusA coding sequence from an upstream rice actin promoter. We succeeded in producing site-specific recombination events in the hybrid progeny of 11 independent barley plants carrying the above target sequence after crossing with plants carrying a phiC31 expression cassette. Some of the hybrids displayed fully executed recombination. Excision of the GFP gene fostered activation of the gusA gene, as visualized in tissue of hybrid plants by histochemical staining. The recombinant loci were detected in progeny of selfed F(1, even in individuals lacking the phiC31 transgene, which provides evidence of stability and generative transmission of the recombination events. In several plants that displayed incomplete recombination, extrachromosomal excision circles were identified. Besides the technical advance achieved in this study, the generated phiC31 integrase-expressing barley plants provide foundational stock material for use in future approaches to barley genetic improvement, such as the production of marker-free transgenic plants or switching transgene activity.

  13. Proteins in intercellular washing fluid from noninoculated and rust-affected leaves of wheat and barley.

    Science.gov (United States)

    Holden, D W; Rohringer, R

    1985-08-01

    Proteins in intercellular washing fluid (IWF) from wheat (Triticum aestivum) and barley (Hordeum vulgare) leaves were separated by two-dimensional isoelectric focusing-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue (CBB) or silver. Intracellular protein from the cut ends of leaves accounted for only a small proportion of total protein in IWF from wheat leaves. When these were heavily infected with the stem rust fungus (Puccinia graminis f. sp. tritici) and grown at 19 degrees C, four infection-related CBB-stainable proteins were detected in IWF.To compare IWF proteins from wheat and barley leaves infected with the same pathogen, conditions were established that permitted luxuriant growth of stem rust of wheat in barley (exposure to chloroform before inoculation and maintenance at 25 degrees C thereafter). Under these conditions, at least 10 infection-related silver-stainable proteins were detected in IWF from infected wheat in addition to the more than 50 that were of host origin. The electrophoretic properties of 8 of the infection-related proteins were the same as those of 8 infection-related proteins in IWF from barley.IWF from wheat and barley grown under these conditions was analyzed for Concanavalin A-binding glycoproteins immobilized on nitrocellulose membrane replicas made from gels. Of the many infection-related glycoproteins that were detected in IWF from stem rust-affected wheat, approximately 20 occupied the same positions as those from stem rust-affected barley. The glycoprotein pattern of IWF prepared from wheat leaves grown at 19 degrees C and infected with the leaf rust fungus (P. recondita f. sp. tritici) was markedly different to that of IWF from the same host infected with the stem rust fungus. We conclude that IWF from rust-affected cereal leaves may be a useful source of surface or extracellular proteins from the parasitic mycelium.

  14. Post-prandial responses to cereal products enriched with barley beta-glucan.

    Science.gov (United States)

    Casiraghi, Maria Cristina; Garsetti, Marcella; Testolin, Giulio; Brighenti, Furio

    2006-08-01

    High amounts of soluble beta-glucan in barley products may exert beneficial effects on glucose tolerance and blood lipids. To investigate the acute postprandial response on plasma glucose, insulin and lipids after consumption of two experimental products made from barley flour enriched with beta-glucan in comparison with similar products made from whole-wheat flour. A group of 10 healthy volunteers (5 males, age 25.4 +/- 0.5 y, BMI 22.6 +/- 0.7 Kg/m(2)) received at breakfast, in random order and in different days, portions (40g of available carbohydrate) of different cereal products or white bread consumed together with a load of 90000 UI retinol. Products were crackers and cookies made either from barley or whole-wheat flour in a 2 x 2 design, where the two factors were the cereal source of dietary fiber (DF), and the food processing. Barley products supplied 12 g DF, 50% soluble, with 3.5 g of beta-glucan per portion. Whole-wheat products supplied about 14 g of dietary fiber, mainly in the insoluble form, with negligible amount of beta-glucan. Fasting and post-prandial glucose and insulin were evaluated for 180 min after the meals; retinyl-palmitate (RP) and triacylglycerol (TAG) were evaluated hourly over 8 hours. Glycemic (GI) and Insulinemic (II) indexes of products were also assessed, using white bread as reference. Glucose curves were significantly different between types of food processing (p whole-wheat crackers (WWCr), whole-wheat cookies (WWc), barley crackers (BCr) and barley cookies (Bc) respectively. Insulin curves were significantly different both between type of processing and fiber source (p flour enriched with beta-glucan exhibit favourable responses on glucose metabolism, and particularly on insulinemic responses. In general, cookies responded better to the addition of barley fiber than crackers. Our results highlight the complexity of the effect that barley fiber may exert when added to different food products in reducing postprandial metabolic

  15. Effect of Barley and Enzyme on Performance, Carcass, Enzyme Activity and Digestion Parameters of Broilers

    Directory of Open Access Journals (Sweden)

    majid kalantar

    2016-04-01

    Full Text Available Introduction Corn has been recently used for producing ethanol fuel in the major corn-producing countries such as the US and Brazil. Recent diversion of corn for biofuel production along with the increased world's demand for this feedstuff has resulted in unprecedented rise in feed cost for poultry worldwide. Alternative grains such as wheat and barley can be successfully replaced for corn in poultry diets. These cereal grains can locally grow in many parts of the world as they have remarkably lower water requirement than corn. Wheat and barley are generally used as major sources of energy in poultry diets. Though the major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls (Olukosi et al. 2007; Mirzaie et al. 2012. NSPs are generally considered as anti-nutritional factors (Jamroz et al. 2002. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value (Olukosi et al. 2007.Wheat and barley are generally used as major sources of energy in poultry diets. The major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls. NSPs are generally considered as anti-nutritional factors. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value. The major part of NSPs in barley comprises polymers of (1→3 (1→4-β- glucans which could impede growth factors and consequently carcass quality through lowering the rate and amount of available nutrients in the mucosal surface of the intestinal. Materials and Methods This experiment was conducted to evaluate the effect of corn and barley based diets supplemented with multi-enzyme on growth, carcass, pancreas enzyme activity and physiological characteristics of broilers. A total number of 375 one day old

  16. Structure and Composition of Protein Bodies from Wild-Type and High-Lysine Barley Endosperm

    DEFF Research Database (Denmark)

    Ingversen, J.

    1975-01-01

    Protein bodies were isolated from 13 and 28 day old endosperms of barley mutant 1508 and its wild type, Bomi barley. The fine structure of the isolated protein bodies was determined by electron microscopy, and the proteins present in the preparations characterized by amino-acid analysis and SDS...... with a granular component. Particles with the same structure were present in the protein body preparation from the mutant, where, however, the granular component was the most prominent. Amino-acid composition and SDS-polyacrylamide gel electrophoresis of the proteins from the protein body preparation revealed...

  17. Targeted modification of storage protein content resulting in improved amino acid composition of barley grain

    DEFF Research Database (Denmark)

    Sikdar, Md. Shafiqul Islam; Bowra, S; Schmidt, Daiana

    2016-01-01

    silencing technology directed towards C-hordein we obtained transgenic barley lines with up to 94.7 % reduction in the levels of C-hordein protein relative to the parental line. The composition of the prolamin fraction of the barley parental line cv. Golden Promise was resolved using SDS-PAGE...... electrophoresis, the protein band were excised and the proteins identified by quadrupole-time-of-flight mass spectrometry. Subsequent SDS-PAGE separation and analysis of the prolamin fraction of the transgenic lines revealed a reduction in the amounts of C-hordeins and increases in the content of other hordein...

  18. Vulnerability of Barley to African Pathotypes of Puccinia graminis f. sp. tritici and Sources of Resistance.

    Science.gov (United States)

    Steffenson, B J; Case, A J; Pretorius, Z A; Coetzee, V; Kloppers, F J; Zhou, H; Chai, Y; Wanyera, R; Macharia, G; Bhavani, S; Grando, S

    2017-08-01

    The emergence of widely virulent pathotypes (e.g., TTKSK in the Ug99 race group) of the stem rust pathogen (Puccinia graminis f. sp. tritici) in Africa threatens wheat production on a global scale. Although intensive research efforts have been advanced to address this threat in wheat, few studies have been conducted on barley, even though pathotypes such as TTKSK are known to attack the crop. The main objectives of this study were to assess the vulnerability of barley to pathotype TTKSK and identify possible sources of resistance. From seedling evaluations of more than 1,924 diverse cultivated barley accessions to pathotype TTKSK, more than 95% (1,844) were found susceptible. A similar high frequency (910 of 934 = 97.4%) of susceptibility was found for the wild progenitor (Hordeum vulgare subsp. spontaneum) of cultivated barley. Additionally, 55 barley lines with characterized or putative introgressions from various wild Hordeum spp. were also tested against pathotype TTKSK but none was found resistant. In total, more than 96% of the 2,913 Hordeum accessions tested were susceptible as seedlings, indicating the extreme vulnerability of the crop to the African pathotypes of P. graminis f. sp. tritici. In total, 32 (1.7% of accessions evaluated) and 13 (1.4%) cultivated and wild barley accessions, respectively, exhibited consistently highly resistant to moderately resistant reactions across all experiments. Molecular assays were conducted on these resistant accessions to determine whether they carried rpg4/Rpg5, the only gene complex known to be highly effective against pathotype TTKSK in barley. Twelve of the 32 (37.5%) resistant cultivated accessions and 11 of the 13 (84.6%) resistant wild barley accessions tested positive for a functional Rpg5 gene, highlighting the narrow genetic base of resistance in Hordeum spp. Other resistant accessions lacking the rpg4/Rpg5 complex were discovered in the evaluated germplasm and may possess useful resistance genes. Combining

  19. RFLP markers linked to the durable stem rust resistance gene Rpg1 in barley.

    Science.gov (United States)

    Kilian, A; Steffenson, B J; Saghai Maroof, M A; Kleinhofs, A

    1994-01-01

    The gene, Rpg1, conferring stable resistance in barley to the wheat stem rust pathogen (Puccinia graminis f. sp. tritici) was mapped using two doubled haploid populations. Rpg1 mapped to the extreme subteleomeric region of barley chromosome 1P 0.3 and 1.1 cM proximal from the molecular markers ABG704 and plastocyanin (Plc), respectively, and 2.2 cM distal from MWG036B. The closest marker, ABG704, was sequenced and PCR-based markers were developed.

  20. Comparative Studies on Callose Formation in Powdery Mildew Compatible and Incompatible Barley

    DEFF Research Database (Denmark)

    Skou, Jens-Peder; Jørgensen, Jørgen Helms; Lilholt, Ulla

    1984-01-01

    penetration Ml-(La) resistant varieties and near-isogenic lines in 'Manchuria' with resistance genes in 5 other loci showed only a tendency to a larger callose formation than their susceptible counterparts after inoculation with avirulent as well as virulent powdery mildew. The callose formation in ml......Callose formation in barley mutants, lines and varieties with different genes for resistance to powdery mildew in seven different loci was compared. Only barley with resistance genes in the ml-o locus showed so early a callose formation passing off at such a high rate that it prevented fungal...

  1. Subcritical hydrothermal liquefaction of barley straw in fresh water and recycled aqueous phase

    DEFF Research Database (Denmark)

    Zhu, Zhe; Toor, Saqib; Rosendahl, Lasse

    2014-01-01

    This project focuses on the investigation of addition of aqueous phase in the production of biofuel from biomass through hydrothermal liquefaction (HTL) technology. Hydrothermal liquefaction is a wet thermal conversion process, which can convert all kinds of biomass to fuels. In this study, barley....... With the addition of recycling aqueous phase in HTL process, it is expected that the amount of the waste water and energy consumption can be reduced. The effect of water recirculation on product yield and properties was investigated in this study. The results showed that bio-oil yield was 34.85 wt% when the barley...

  2. Cereal bioengineering: Amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Shaik, Shahnoor Sultana; Jensen, Susanne Langgård

    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were made by transgenic methods. Cereals producing these kind of starches have not been reported before. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch...... and T1) of transgenic grains was tenfold higher than from vector control and wild type grains. Amylose content was not affected in hyper-phosphorylated grains. Hyper-phosphorylated starch granules had several pores on the surfaces, similar to pores seen on enzymatically semi-degraded granules...

  3. Cereal bioengineering: Amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Shaik, Shahnoor Sultana; Jensen, Susanne Langgård

    2011-01-01

    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were made by transgenic methods. Cereals producing these kind of starches have not been reported before. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch...... and T1) of transgenic grains was tenfold higher than from vector control and wild type grains. Amylose content was not affected in hyper-phosphorylated grains. Hyper-phosphorylated starch granules had several pores on the surfaces, similar to pores seen on enzymatically semi-degraded granules...

  4. Barley alpha-amylase/subtilisin inhibitor: structure, biophysics and protein engineering

    DEFF Research Database (Denmark)

    Nielsen, P.K.; Bønsager, Birgit Christine; Fukuda, Kenji

    2004-01-01

    Bifunctional alpha-amylase/subtilisin inhibitors have been implicated in plant defence and regulation of endogenous alpha-amylase action. The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits the barley alpha-amylase 2 (AMY2) and subtilisin-type serine proteases. BASI belongs to the Kunitz...... Ca2+-modulated kinetics of the AMY2/BASl interaction and found that the complex formation involves minimal structural changes. The modulation of the interaction by calcium ions makes it unique among the currently known binding mechanisms of proteinaceous alpha-amylase inhibitors....

  5. A rapid non-destructive method for quantification of fungal infection on barley and malt

    DEFF Research Database (Denmark)

    Bodevin, Sabrina; Larsen, Tone Glarborg; Lok, Finn

    Description of topic: Barley harvest 2007 in Europe has seen the resurgence of crops highly infected by filamentous fungi. Hence the evaluation of fungal infection on barley and malt kernels by conventional optical measurement methods lacks accuracy and can be tedious. Here we are presenting a new...... vision system to rapidly perform this task using the VideometerLab®. This system provides a rapid colour, shape and texture measurement, ideal to analyze kernels surfaces. The principle employed is a high-intensity sphere illuminated by light emitting diodes together with a highresolution black and white...

  6. Effects of fenpropimorph on bacteria and fungi during decomposition of barley roots

    DEFF Research Database (Denmark)

    Thirup, L.; Johnsen, K.; Torsvik, V.

    2001-01-01

    fertility. The diversity of total bacterial DNA measured by denaturing gradient gel electrophoresis (DGGE) was unaffected by fenpropimorph treatment, there being a clear and highly reproducible succession in bacterial diversity during decomposition of the barley roots. The diversity in the hotspot......The study examined the effects of the fungicide fenpropimorph (in the formulation Corbel) on primary decomposer organisms in soil. Bacterial and fungal succession was followed on dead young barley roots buried in fungicide-treated or untreated soil, Fenpropimorph was added to the soil...

  7. Hordein polypeptide patterns in relation to malting quality in Brazilian barley varieties

    Directory of Open Access Journals (Sweden)

    Echart-Almeida Cinara

    2001-01-01

    Full Text Available Since there is evidence that malting quality is related to the storage protein (hordein fraction, in the present work the hordein polypeptide patterns from 13 barley (Hordeum vulgare L. varieties of different malting quality were analysed in order to explore the feasibility of using hordein electrophoresis to assist in the selection of malting barleys. The formation of clusters separating the varieties with higher malting quality from the others with lower quality suggests that there is a relationship between the general hordein polypeptide pattern and malting quality in the varieties analysed. By the Sperman's correlation test three hordein bands correlated negatively with malting quality in the germplasm studied.

  8. Oligosaccharide and Substrate Binding in the Starch Debranching Enzyme Barley Limit Dextrinase

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Windahl, Michael Skovbo; Sim, Lyann

    2015-01-01

    Complete hydrolytic degradation of starch requires hydrolysis of both the α-1,4- and α-1,6-glucosidic bonds in amylopectin. Limit dextrinase (LD) is the only endogenous barley enzyme capable of hydrolyzing the α-1,6-glucosidic bond during seed germination, and impaired LD activity inevitably...... reduces the maltose and glucose yields from starch degradation. Crystal structures of barley LD and active-site mutants with natural substrates, products and substrate analogues were sought to better understand the facets of LD-substrate interactions that αconfine high activity of LD to branched...... starch synthesis....

  9. Purification and characterization of recombinant high pI Barley α-Glucosidase

    DEFF Research Database (Denmark)

    Næsted, Henrik; Bojsen, Kirsten; Svensson, Birte

    (MACGREGOR & sissons). recently expression and characterization of the recombinant full length and fully functional barley high pi α-glucosidase in pichia pastoris has been achieved. in order to facilitate protein yield in the mg range, a clone representing an n-terminal hexa histidine tagged recombinant...... of the native enzyme purified from malt (frandsen et al.). the kinetic values km, vmax and kcat are determined to 1.7 mm, 139 nm s-1 and 85 s-1 using maltose as substrate. the presented data illustrate the first successful production of enzymatically active full length recombinant high pi barley α...

  10. Influence of tannin on protein utilization in feedstuffs with special reference to barley

    International Nuclear Information System (INIS)

    Eggum, Bj.O.; Christensen, K.D.

    1975-01-01

    To evaluate the effect of tannins on protein utilization, increasing amounts of tannin were added to diets fed to rats. Soybean meal was used as protein source. Tannin was found to exert a severe negative effect on protein digestibility. With tannin in the diet, availability of all amino acids decreased significantly, but to different degrees. Tannins are present in a number of plant materials at different levels, including barley. In feeding experiments using 29 barley samples varying in tannin content from 0.55 to 1.23%, tannin showed a significant negative correlation with protein digestibility. (author)

  11. Fermentation profile of Saccharomyces cerevisiae and Candida tropicalis as starter cultures on barley malt medium

    OpenAIRE

    Alloue-Boraud, Wazé Aimée Mireille; N’Guessan, Kouadio Florent; Djeni, N’Dédé Théodore; Hiligsmann, Serge; Djè, Koffi Marcellin; Delvigne, Franck

    2014-01-01

    Saccharomyces cerevisiae C8-5 and Candida tropicalis F0-5 isolated from traditional sorghum beer were tested for kinetic parameters on barley malt extract, YPD (863 medium) and for alcohol production. The results showed that C. tropicalis has the highest maximum growth rate and the lowest doubling time. Values were 0.22 and 0.32 h−1 for maximum growth rate, 3 h 09 min and 2 h 09 min for doubling time respectively on barley malt extract and YPD. On contrary, glucose consumption was the fastest...

  12. Influence of alkali catalyst on product yield and properties via hydrothermal liquefaction of barley straw

    DEFF Research Database (Denmark)

    Zhu, Z.; Toor, Saqib; Rosendahl, Lasse

    2015-01-01

    Barley straw was successfully converted to bio-crude by hydrothermal liquefaction at temperature of 280 e400 C using an alkali catalyst (K2CO3) in our previous work, and the maximum bio-crude yield was obtained at 300 C. This paper extends previous work on studying liquefaction behavior of barley...... straw without and with K2CO3 at 300 C. The effect of alkali catalyst on product distribution was investigated, and a detailed analysis of characteristic properties of bio-crude and solid residue has been performed by an elemental analyzer, FTIR (Fourier Transform infrared spectroscopy), TGA...

  13. Ancient and Novel Small RNA Pathways Compensate for the Loss of piRNAs in Multiple Independent Nematode Lineages

    Science.gov (United States)

    Sarkies, Peter; Selkirk, Murray E.; Jones, John T.; Blok, Vivian; Boothby, Thomas; Goldstein, Bob; Hanelt, Ben; Ardila-Garcia, Alex; Fast, Naomi M.; Schiffer, Phillip M.; Kraus, Christopher; Taylor, Mark J.; Koutsovoulos, Georgios; Blaxter, Mark L.; Miska, Eric A.

    2015-01-01

    Small RNA pathways act at the front line of defence against transposable elements across the Eukaryota. In animals, Piwi interacting small RNAs (piRNAs) are a crucial arm of this defence. However, the evolutionary relationships among piRNAs and other small RNA pathways targeting transposable elements are poorly resolved. To address this question we sequenced small RNAs from multiple, diverse nematode species, producing the first phylum-wide analysis of how small RNA pathways evolve. Surprisingly, despite their prominence in Caenorhabditis elegans and closely related nematodes, piRNAs are absent in all other nematode lineages. We found that there are at least two evolutionarily distinct mechanisms that compensate for the absence of piRNAs, both involving RNA-dependent RNA polymerases (RdRPs). Whilst one pathway is unique to nematodes, the second involves Dicer-dependent RNA-directed DNA methylation, hitherto unknown in animals, and bears striking similarity to transposon-control mechanisms in fungi and plants. Our results highlight the rapid, context-dependent evolution of small RNA pathways and suggest piRNAs in animals may have replaced an ancient eukaryotic RNA-dependent RNA polymerase pathway to control transposable elements. PMID:25668728

  14. T7-RNA Polymerase

    Science.gov (United States)

    1997-01-01

    T7-RNA Polymerase grown on STS-81. Structure-Function Relationships of RNA Polymerase: DNA-dependent RNA polymerase is the key enzyme responsible for the biosynthesis of RNA, a process known as transcription. Principal Investigator's include Dr. Dan Carter, Dr. B.C. Wang, and Dr. John Rose of New Century Pharmaceuticals.

  15. WHIRLY1 Functions in the Control of Responses to Nitrogen Deficiency But Not Aphid Infestation in Barley.

    Science.gov (United States)

    Comadira, Gloria; Rasool, Brwa; Kaprinska, Barbara; García, Belén Márquez; Morris, Jennifer; Verrall, Susan R; Bayer, Micha; Hedley, Peter E; Hancock, Robert D; Foyer, Christine H

    2015-07-01

    WHIRLY1 is largely targeted to plastids, where it is a major constituent of the nucleoids. To explore WHIRLY1 functions in barley (Hordeum vulgare), RNA interference-knockdown lines (W1-1, W1-7, and W1-9) that have very low levels of HvWHIRLY1 transcripts were characterized in plants grown under optimal and stress conditions. The WHIRLY1-1 (W1-1), W1-7, and W1-9 plants were phenotypically similar to the wild type but produced fewer tillers and seeds. Photosynthesis rates were similar in all lines, but W1-1, W1-7, and W1-9 leaves had significantly more chlorophyll and less sucrose than the wild type. Transcripts encoding specific subsets of chloroplast-localized proteins, such as ribosomal proteins, subunits of the RNA polymerase, and thylakoid nicotinamide adenine dinucleotide (reduced) and cytochrome b6/f complexes, were much more abundant in the W1-7 leaves than the wild type. Although susceptibility of aphid (Myzus persicae) infestation was similar in all lines, the WHIRLY1-deficient plants showed altered responses to nitrogen deficiency, maintaining higher photosynthetic CO2 assimilation rates than the wild type under limiting nitrogen. Although all lines showed globally similar low nitrogen-dependent changes in transcripts and metabolites, the increased abundance of FAR-RED IMPAIRED RESPONSE1-like transcripts in nitrogen-deficient W1-7 leaves infers that WHIRLY1 has a role in communication between plastid and nuclear genes encoding photosynthetic proteins during abiotic stress. © 2015 American Society of Plant Biologists. All Rights Reserved.

  16. HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

    Science.gov (United States)

    Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

    2012-11-07

    CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

  17. Genes involved in barley yellow dwarf virus resistance of maize.

    Science.gov (United States)

    Horn, Frederike; Habekuß, Antje; Stich, Benjamin

    2014-12-01

    The results of our study suggest that genes involved in general resistance mechanisms of plants contribute to variation of BYDV resistance in maize. With increasing winter temperatures in Europe, Barley yellow dwarf virus (BYDV) is expected to become a prominent problem in maize cultivation. Breeding for resistance is the best strategy to control the disease and break the transmission cycle of the virus. The objectives of our study were (1) to determine genetic variation with respect to BYDV resistance in a broad germplasm set and (2) to identify single nucleotide polymorphism (SNP) markers linked to genes that are involved in BYDV resistance. An association mapping population with 267 genotypes representing the world's maize gene pool was grown in the greenhouse. Plants were inoculated with BYDV-PAV using viruliferous Rhopalosiphum padi. In the association mapping population, we observed considerable genotypic variance for the trait virus extinction as measured by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and the infection rate. In a genome-wide association study, we observed three SNPs significantly [false discovery rate (FDR) = 0.05] associated with the virus extinction on chromosome 10 explaining together 25 % of the phenotypic variance and five SNPs for the infection rate on chromosomes 4 and 10 explaining together 33 % of the phenotypic variance. The SNPs significantly associated with BYDV resistance can be used in marker assisted selection and will accelerate the breeding process for the development of BYDV resistant maize genotypes. Furthermore, these SNPs were located within genes which were in other organisms described to play a role in general resistance mechanisms. This suggests that these genes contribute to variation of BYDV resistance in maize.

  18. Calcium and proton transport in membrane vesicles from barley roots

    International Nuclear Information System (INIS)

    DuPont, F.M.; Windle, J.J.; Bush, D.S.; Jones, R.L.

    1990-01-01

    Ca 2+ uptake by membrane fractions from barley (Hordeum vulgare L. cv CM72) roots was characterized. Uptake of 45 Ca 2+ was measured in membrane vesicles obtained from continuous and discontinuous sucrose gradients. A single, large peak of Ca 2+ uptake coincided with the peak of proton transport by the tonoplast H + -ATPase. Depending on the concentration of Ca 2+ in the assay, Ca 2+ uptake was inhibited 50 to 75% by those combinations of ionophores and solutes that eliminated the pH gradient and membrane potential. However, 25 to 50% of the Ca 2+ uptake in the tonoplast-enriched fraction was not sensitive to ionophores but was inhibited by vanadate. The results suggest that 45 Ca uptake was driven by the low affinity, high capacity tonoplast Ca 2+ /nH + antiporter and also by a high affinity, lower capacity Ca 2+ -ATPase. The Ca 2+ -ATPase may be associated with tonoplast, Golgi or contaminating vesicles of unknown origin. No Ca 2+ transport was specifically associated with the distinct peak of endoplasmic reticulum that was identified by NADH cytochrome c reductase, choline phosphotransferase, and dolichol-P-mannosyl synthase activities. A small shoulder of Ca 2+ uptake in the plasma membrane region of the gradient was inhibited by vanadate and erythrosin B and may represent the activity of a separate plasma membrane Ca 2+ -ATPase. Vesicle volumes were estimated using electron spin resonance techniques, and intravesicular Ca 2+ concentrations were estimated to be as high as 5 millimolar. ATP-driven uptake of Ca 2+ created 800- to 2,000-fold concentration gradients within minutes. Problems in interpreting the effects of Ca 2+ on ATP-generated pH gradients are discussed and the suggestion is made that Ca 2+ dissipates pH gradients by a different mechanism than is responsible for Ca 2+ uptake into tonoplast vesicles

  19. Uptake of proline by the scutellum of germinating barley grain

    International Nuclear Information System (INIS)

    Vaeisaenen, E.; Sopanen, T.

    1986-01-01

    Scutella separated from germinating grains of barley (Hordeum vulgare L. cv Himalaya) took up 1 millimolar L-[ 14 C]proline at an initial rate of about 6.5 micromoles gram -1 fresh weight hour -1 (pH 5, 30 0 C). The uptake had a pH optimum at 5. The bulk of the uptake (93%) was via carrier-mediated active transport. All of the 19 L-amino acids tested at 10 millimolar concentration inhibited the mediated uptake of 1 millimolar proline, the inhibitions varying from 18 to 76%. By studying how large a fraction of the mediated uptake was inhibitable by asparagine, alanine, glutamine, and leucine, the mediated uptake was shown to be due to three components. Two of these are most probably attributable to the two nonspecific uptake systems proposed earlier to act in the uptake of glutamine and leucine. The third component was not inhibited by glutamine, asparagine, or alanine, but was inhibited by unlabeled proline and leucine. The uptake by this system was apparently carrier-mediated active transport. D-Proline inhibited this system as strongly as L-proline. Nine of the 16 L-amino tested at 50 millimolar concentrations did not inhibit the uptake of 1 millimolar proline by this system. Valine, leucine, isoleucine, and the basic amino acids were inhibitory, but in spite of this, they did not appear to be taken up by this system. It seems therefore that in addition to two nonspecific amino acid uptake systems the scutella have an uptake system which is specific for proline. It is likely that this proline-specific system accounts for the bulk of proline uptake in a germinating grain

  20. Deciphering Mineral Homeostasis in Barley Seed Transfer Cells at Transcriptional Level.

    Directory of Open Access Journals (Sweden)

    Behrooz Darbani

    Full Text Available In addition to the micronutrient inadequacy of staple crops for optimal human nutrition, a global downtrend in crop-quality has emerged from intensive breeding for yield. This trend will be aggravated by elevated levels of the greenhouse gas carbon dioxide. Therefore, crop biofortification is inevitable to ensure a sustainable supply of minerals to the large part of human population who is dietary dependent on staple crops. This requires a thorough understanding of plant-mineral interactions due to the complexity of mineral homeostasis. Employing RNA sequencing, we here communicate transfer cell specific effects of excess iron and zinc during grain filling in our model crop plant barley. Responding to alterations in mineral contents, we found a long range of different genes and transcripts. Among them, it is worth to highlight the auxin and ethylene signaling factors Arfs, Abcbs, Cand1, Hps4, Hac1, Ecr1, and Ctr1, diurnal fluctuation components Sdg2, Imb1, Lip1, and PhyC, retroelements, sulfur homeostasis components Amp1, Hmt3, Eil3, and Vip1, mineral trafficking components Med16, Cnnm4, Aha2, Clpc1, and Pcbps, and vacuole organization factors Ymr155W, RabG3F, Vps4, and Cbl3. Our analysis introduces new interactors and signifies a broad spectrum of regulatory levels from chromatin remodeling to intracellular protein sorting mechanisms active in the plant mineral homeostasis. The results highlight the importance of storage proteins in metal ion toxicity-resistance and chelation. Interestingly, the protein sorting and recycling factors Exoc7, Cdc1, Sec23A, and Rab11A contributed to the response as well as the polar distributors of metal-transporters ensuring the directional flow of minerals. Alternative isoform switching was found important for plant adaptation and occurred among transcripts coding for identical proteins as well as transcripts coding for protein isoforms. We also identified differences in the alternative-isoform preference between