
Sample records for barley rna-directed rna

  1. Identification and characterization of barley RNA-directed RNA polymerases

    DEFF Research Database (Denmark)

    Madsen, Christian Toft; Stephens, Jennifer; Hornyik, Csaba;


    in dicot species. In this report, we identi!ed and characterized HvRDR1, HvRDR2 and HvRDR6 genes in the monocot plant barley (Hordeum vulgare). We analysed their expression under various biotic and abiotic stresses including fungal and viral infections, salicylic acid treatment as well as during plant...... development. The different classes and subclasses of barley RDRs displayed contrasting expression patterns during pathogen challenge and development suggesting their involvement in speci!c regulatory pathways. Their response to heat and salicylic acid treatment suggests a conserved pattern of expression...

  2. RNA-directed DNA methylation and demethylation in plants

    Institute of Scientific and Technical Information of China (English)

    CHINNUSAMY; Viswanathan


    RNA-directed DNA methylation (RdDM) is a nuclear process in which small interfering RNAs (siRNAs) direct the cytosine methylation of DNA sequences that are complementary to the siRNAs. In plants, double stranded-RNAs (dsRNAs) generated by RNA-dependent RNA polymerase 2 (RDR2) serve as precursors for Dicer-like 3 dependent biogenesis of 24-nt siRNAs. Plant specific RNA polymerase IV (Pol IV) is presumed to generate the initial RNA transcripts that are substrates for RDR2. siRNAs are loaded onto an argonaute4-containing RISC (RNA-induced silencing complex) that targets the de novo DNA methyltransferase DRM2 to RdDM target loci. Nascent RNA transcripts from the target loci are generated by another plant-specific RNA polymerase, Pol V, and these transcripts help recruit com- plementary siRNAs and the associated RdDM effector complex to the target loci in a transcrip- tion-coupled DNA methylation process. Small RNA binding proteins such as ROS3 may direct tar- get-specific DNA demethylation by the ROS1 family of DNA demethylases. Chromatin remodeling en- zymes and histone modifying enzymes also participate in DNA methylation and possibly demethylation. One of the well studied functions of RdDM is transposon silencing and genome stability. In addition, RdDM is important for paramutation, imprinting, gene regulation, and plant development. Lo- cus-specific DNA methylation and demethylation, and transposon activation under abiotic stresses suggest that RdDM is also important in stress responses of plants. Further studies will help illuminate the functions of RdDM in the dynamic control of epigenomes during development and environmental stress responses.

  3. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.


    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

  4. RNA-directed DNA methylation and demethylation in plants

    Institute of Scientific and Technical Information of China (English)

    CHINNUSAMY Viswanathan; ZHU Jian-Kang


    A-dlrected DNA methylation (RdDM) Is a nuclear process in which small Interfering RNAs (siRNAs)direct the cytosine methylation of DNA sequences that are complementary to the siRNAs. In plants,double stranded-RNAs (dsRNAs) generated by RNA-dependent RNA polymerase 2 (RDR2) serve as precursors for Dicer-like 3 dependent biogenesis of 24-nt siRNAs. Plant specific RNA polymerase IV (Pol IV) is presumed to generate the initial RNA transcripts that are substrates for RDR2. siRNAs are loaded onto an argonaute4-containlng RlSC (RNA-induced silencing complex) that targets the de novo DNA methyltransferase DRM2 to RdDM target locl. Nascent RNA transcripts from the target loci are generated by another plant-specific RNA polymerase, Pol V, and these transcripts help recruit com-plementary siRNAs and the associated RdDM effector complex to the target loci in a transcrip-tion-coupled DNA methylation process. Small RNA binding proteins such as ROS3 may direct tar-get-specific DNA demethyiation by the ROS1 family of DNA demethylases. Chromatin remodeling en-zymes and histone modifying enzymes also participate in DNA methylation and possibly demethylation.One of the well studied functions of RdOM is transposon silencing and genome stability. In addition,RdDM is important for paramutation, imprinting, gene regulation, and plant development. Locus-specific DNA methylation and demethylation, and transposon activation under abiotic stresses suggest that RdDM is also important in stress responses of plants. Further studies will help illuminate the functions of RdDM in the dynamic control of epigenomes during development and environmental stress responses.

  5. Small RNA-directed epigenetic natural variation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jixian Zhai


    Full Text Available Progress in epigenetics has revealed mechanisms that can heritably regulate gene function independent of genetic alterations. Nevertheless, little is known about the role of epigenetics in evolution. This is due in part to scant data on epigenetic variation among natural populations. In plants, small interfering RNA (siRNA is involved in both the initiation and maintenance of gene silencing by directing DNA methylation and/or histone methylation. Here, we report that, in the model plant Arabidopsis thaliana, a cluster of approximately 24 nt siRNAs found at high levels in the ecotype Landsberg erecta (Ler could direct DNA methylation and heterochromatinization at a hAT element adjacent to the promoter of FLOWERING LOCUS C (FLC, a major repressor of flowering, whereas the same hAT element in ecotype Columbia (Col with almost identical DNA sequence, generates a set of low abundance siRNAs that do not direct these activities. We have called this hAT element MPF for Methylated region near Promoter of FLC, although de novo methylation triggered by an inverted repeat transgene at this region in Col does not alter its FLC expression. DNA methylation of the Ler allele MPF is dependent on genes in known silencing pathways, and such methylation is transmissible to Col by genetic crosses, although with varying degrees of penetrance. A genome-wide comparison of Ler and Col small RNAs identified at least 68 loci matched by a significant level of approximately 24 nt siRNAs present specifically in Ler but not Col, where nearly half of the loci are related to repeat or TE sequences. Methylation analysis revealed that 88% of the examined loci (37 out of 42 were specifically methylated in Ler but not Col, suggesting that small RNA can direct epigenetic differences between two closely related Arabidopsis ecotypes.

  6. IMP3 RNP safe houses prevent miRNA-directed HMGA2 mRNA decay in cancer and development

    DEFF Research Database (Denmark)

    Jønson, Lars; Christiansen, Jan; Hansen, Thomas van Overeem;


    The IMP3 RNA-binding protein is associated with metastasis and poor outcome in human cancer. Using solid cancer transcriptome data, we found that IMP3 correlates with HMGA2 mRNA expression. Cytoplasmic IMP3 granules contain HMGA2, and IMP3 dose-dependently increases HMGA2 mRNA. HMGA2 is regulated...... that IMP3 RNPs may function as cytoplasmic safe houses and prevent miRNA-directed mRNA decay of oncogenes during tumor progression....

  7. A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

    KAUST Repository

    Law, Julie A.


    DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

  8. RNA-directed DNA methylation enforces boundaries between heterochromatin and euchromatin in the maize genome. (United States)

    Li, Qing; Gent, Jonathan I; Zynda, Greg; Song, Jawon; Makarevitch, Irina; Hirsch, Cory D; Hirsch, Candice N; Dawe, R Kelly; Madzima, Thelma F; McGinnis, Karen M; Lisch, Damon; Schmitz, Robert J; Vaughn, Matthew W; Springer, Nathan M


    The maize genome is relatively large (∼ 2.3 Gb) and has a complex organization of interspersed genes and transposable elements, which necessitates frequent boundaries between different types of chromatin. The examination of maize genes and conserved noncoding sequences revealed that many of these are flanked by regions of elevated asymmetric CHH (where H is A, C, or T) methylation (termed mCHH islands). These mCHH islands are quite short (∼ 100 bp), are enriched near active genes, and often occur at the edge of the transposon that is located nearest to genes. The analysis of DNA methylation in other sequence contexts and several chromatin modifications revealed that mCHH islands mark the transition from heterochromatin-associated modifications to euchromatin-associated modifications. The presence of an mCHH island is fairly consistent in several distinct tissues that were surveyed but shows some variation among different haplotypes. The presence of insertion/deletions in promoters often influences the presence and position of an mCHH island. The mCHH islands are dependent upon RNA-directed DNA methylation activities and are lost in mop1 and mop3 mutants, but the nearby genes rarely exhibit altered expression levels. Instead, loss of an mCHH island is often accompanied by additional loss of DNA methylation in CG and CHG contexts associated with heterochromatin in nearby transposons. This suggests that mCHH islands and RNA-directed DNA methylation near maize genes may act to preserve the silencing of transposons from activity of nearby genes.

  9. Digital quantification of miRNA directly in plasma using integrated comprehensive droplet digital detection. (United States)

    Zhang, Kaixiang; Kang, Dong-Ku; Ali, M Monsur; Liu, Linan; Labanieh, Louai; Lu, Mengrou; Riazifar, Hamidreza; Nguyen, Thi N; Zell, Jason A; Digman, Michelle A; Gratton, Enrico; Li, Jinghong; Zhao, Weian


    Quantification of miRNAs in blood can be potentially used for early disease detection, surveillance monitoring and drug response evaluation. However, quantitative and robust measurement of miRNAs in blood is still a major challenge in large part due to their low concentration and complicated sample preparation processes typically required in conventional assays. Here, we present the 'Integrated Comprehensive Droplet Digital Detection' (IC 3D) system where the plasma sample containing target miRNAs is encapsulated into microdroplets, enzymatically amplified and digitally counted using a novel, high-throughput 3D particle counter. Using Let-7a as a target, we demonstrate that IC 3D can specifically quantify target miRNA directly from blood plasma at extremely low concentrations ranging from 10s to 10 000 copies per mL in ≤3 hours without the need for sample processing such as RNA extraction. Using this new tool, we demonstrate that target miRNA content in colon cancer patient blood is significantly higher than that in healthy donor samples. Our IC 3D system has the potential to introduce a new paradigm for rapid, sensitive and specific detection of low-abundance biomarkers in biological samples with minimal sample processing. PMID:26387763

  10. IDN2 and its paralogs form a complex required for RNA-directed DNA methylation.

    Directory of Open Access Journals (Sweden)

    Cui-Jun Zhang

    Full Text Available IDN2/RDM12 has been previously identified as a component of the RNA-directed DNA methylation (RdDM machinery in Arabidopsis thaliana, but how it functions in RdDM remains unknown. By affinity purification of IDN2, we co-purified two IDN2 paralogs IDP1 and IDP2 (IDN2 PARALOG 1 and 2. The coiled-coil domain between the XS and XH domains of IDN2 is essential for IDN2 homodimerization, whereas the IDN2 C-terminal XH domain but not the coiled-coil domain is required for IDN2 interaction with IDP1 and IDP2. By introducing the wild-type IDN2 sequence and its mutated derivatives into the idn2 mutant for complementation testing, we demonstrated that the previously uncharacterized IDN2 XH domain is required for the IDN2-IDP1/IDP2 complex formation as well as for IDN2 function. IDP1 is required for de novo DNA methylation, siRNA accumulation, and transcriptional gene silencing, whereas IDP2 has partially overlapping roles with IDP1. Unlike IDN2, IDP1 and IDP2 are incapable of binding double-stranded RNA, suggesting that the roles of IDP1 and IDP2 are different from those of IDN2 in the IDN2-IDP1/IDP2 complex and that IDP1 and IDP2 are essential for the functioning of the complex in RdDM.

  11. MiRNA-directed regulation of VEGF and other angiogenic factors under hypoxia.

    Directory of Open Access Journals (Sweden)

    Zhong Hua

    Full Text Available MicroRNAs (miRNAs are a class of 20-24 nt non-coding RNAs that regulate gene expression primarily through post-transcriptional repression or mRNA degradation in a sequence-specific manner. The roles of miRNAs are just beginning to be understood, but the study of miRNA function has been limited by poor understanding of the general principles of gene regulation by miRNAs. Here we used CNE cells from a human nasopharyngeal carcinoma cell line as a cellular system to investigate miRNA-directed regulation of VEGF and other angiogenic factors under hypoxia, and to explore the principles of gene regulation by miRNAs. Through computational analysis, 96 miRNAs were predicted as putative regulators of VEGF. But when we analyzed the miRNA expression profile of CNE and four other VEGF-expressing cell lines, we found that only some of these miRNAs could be involved in VEGF regulation, and that VEGF may be regulated by different miRNAs that were differentially chosen from 96 putative regulatory miRNAs of VEGF in different cells. Some of these miRNAs also co-regulate other angiogenic factors (differential regulation and co-regulation principle. We also found that VEGF was regulated by multiple miRNAs using different combinations, including both coordinate and competitive interactions. The coordinate principle states that miRNAs with independent binding sites in a gene can produce coordinate action to increase the repressive effect of miRNAs on this gene. By contrast, the competitive principle states when multiple miRNAs compete with each other for a common binding site, or when a functional miRNA competes with a false positive miRNA for the same binding site, the repressive effects of miRNAs may be decreased. Through the competitive principle, false positive miRNAs, which cannot directly repress gene expression, can sometimes play a role in miRNA-mediated gene regulation. The competitive principle, differential regulation, multi-miRNA binding sites, and false

  12. Interplay between active chromatin marks and RNA-directed DNA methylation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Maxim V C Greenberg


    Full Text Available DNA methylation is an epigenetic mark that is associated with transcriptional repression of transposable elements and protein-coding genes. Conversely, transcriptionally active regulatory regions are strongly correlated with histone 3 lysine 4 di- and trimethylation (H3K4m2/m3. We previously showed that Arabidopsis thaliana plants with mutations in the H3K4m2/m3 demethylase JUMONJI 14 (JMJ14 exhibit a mild reduction in RNA-directed DNA methylation (RdDM that is associated with an increase in H3K4m2/m3 levels. To determine whether this incomplete RdDM reduction was the result of redundancy with other demethylases, we examined the genetic interaction of JMJ14 with another class of H3K4 demethylases: lysine-specific demethylase 1-like 1 and lysine-specific demethylase 1-like 2 (LDL1 and LDL2. Genome-wide DNA methylation analyses reveal that both families cooperate to maintain RdDM patterns. ChIP-seq experiments show that regions that exhibit an observable DNA methylation decrease are co-incidental with increases in H3K4m2/m3. Interestingly, the impact on DNA methylation was stronger at DNA-methylated regions adjacent to H3K4m2/m3-marked protein-coding genes, suggesting that the activity of H3K4 demethylases may be particularly crucial to prevent spreading of active epigenetic marks. Finally, RNA sequencing analyses indicate that at RdDM targets, the increase of H3K4m2/m3 is not generally associated with transcriptional de-repression. This suggests that the histone mark itself--not transcription--impacts the extent of RdDM.

  13. An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

    KAUST Repository

    Gao, Zhihuan


    DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.

  14. A Pre-mRNA-splicing factor is required for RNA-directed DNA methylation in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Chao-Feng Huang

    Full Text Available Cytosine DNA methylation is a stable epigenetic mark that is frequently associated with the silencing of genes and transposable elements (TEs. In Arabidopsis, the establishment of DNA methylation is through the RNA-directed DNA methylation (RdDM pathway. Here, we report the identification and characterization of RDM16, a new factor in the RdDM pathway. Mutation of RDM16 reduced the DNA methylation levels and partially released the silencing of a reporter gene as well as some endogenous genomic loci in the DNA demethylase ros1-1 mutant background. The rdm16 mutant had morphological defects and was hypersensitive to salt stress and abscisic acid (ABA. Map-based cloning and complementation test led to the identification of RDM16, which encodes a pre-mRNA-splicing factor 3, a component of the U4/U6 snRNP. RNA-seq analysis showed that 308 intron retention events occurred in rdm16, confirming that RDM16 is involved in pre-mRNA splicing in planta. RNA-seq and mRNA expression analysis also revealed that the RDM16 mutation did not affect the pre-mRNA splicing of known RdDM genes, suggesting that RDM16 might be directly involved in RdDM. Small RNA expression analysis on loci showing RDM16-dependent DNA methylation suggested that unlike the previously reported putative splicing factor mutants, rdm16 did not affect small RNA levels; instead, the rdm16 mutation caused a decrease in the levels of Pol V transcripts. ChIP assays revealed that RDM16 was enriched at some Pol V target loci. Our results suggest that RDM16 regulates DNA methylation through influencing Pol V transcript levels. Finally, our genome-wide DNA methylation analysis indicated that RDM16 regulates the overall methylation of TEs and gene-surrounding regions, and preferentially targets Pol IV-dependent DNA methylation loci and the ROS1 target loci. Our work thus contributes to the understanding of RdDM and its interactions with active DNA demethylation.

  15. Efficient dual sgRNA-directed large gene deletion in rabbit with CRISPR/Cas9 system. (United States)

    Song, Yuning; Yuan, Lin; Wang, Yong; Chen, Mao; Deng, Jichao; Lv, Qingyan; Sui, Tingting; Li, Zhanjun; Lai, Liangxue


    The CRISPR RNA-guided Cas9 nuclease gene-targeting system has been extensively used to edit the genome of several organisms. However, most mutations reported to date have been are indels, resulting in multiple mutations and numerous alleles in targeted genes. In the present study, a large deletion of 105 kb in the TYR (tyrosinase) gene was generated in rabbit via a dual sgRNA-directed CRISPR/Cas9 system. The typical symptoms of albinism accompanied significantly decreased expression of TYR in the TYR knockout rabbits. Furthermore, the same genotype and albinism phenotype were found in the F1 generation, suggesting that large-fragment deletions can be efficiently transmitted to the germline and stably inherited in offspring. Taken together, our data demonstrate that mono and biallelic large deletions can be achieved using the dual sgRNA-directed CRISPR/Cas9 system. This system produces no mosaic mutations or off-target effects, making it an efficient tool for large-fragment deletions in rabbit and other organisms. PMID:26817461

  16. Synthetic Polymer Hybridization with DNA and RNA Directs Nanoparticle Loading, Silencing Delivery, and Aptamer Function. (United States)

    Zhou, Zhun; Xia, Xin; Bong, Dennis


    We report herein discrete triplex hybridization of DNA and RNA with polyacrylates. Length-monodisperse triazine-derivatized polymers were prepared on gram-scale by reversible addition-fragmentation chain-transfer polymerization. Despite stereoregio backbone heterogeneity, the triazine polymers bind T/U-rich DNA or RNA with nanomolar affinity upon mixing in a 1:1 ratio, as judged by thermal melts, circular dichroism, gel-shift assays, and fluorescence quenching. We call these polyacrylates "bifacial polymer nucleic acids" (bPoNAs). Nucleic acid hybridization with bPoNA enables DNA loading onto polymer nanoparticles, siRNA silencing delivery, and can further serve as an allosteric trigger of RNA aptamer function. Thus, bPoNAs can serve as tools for both non-covalent bioconjugation and structure-function nucleation. It is anticipated that bPoNAs will have utility in both bio- and nanotechnology. PMID:26138550

  17. Synthetic Polymer Hybridization with DNA and RNA Directs Nanoparticle Loading, Silencing Delivery, and Aptamer Function


    Zhou, Zhun; Xia, Xin; Bong, Dennis


    We report herein discrete triplex hybridization of DNA and RNA with polyacrylates. Length-monodisperse triazine-derivatized polymers were prepared on gram-scale by reversible addition–fragmentation chain-transfer polymerization. Despite stereoregio backbone heterogeneity, the triazine polymers bind T/U-rich DNA or RNA with nanomolar affinity upon mixing in a 1:1 ratio, as judged by thermal melts, circular dichroism, gel-shift assays, and fluorescence quenching. We call these polyacrylates “bi...

  18. CNP2 mRNA directs synthesis of both CNP1 and CNP2 polypeptides. (United States)

    O'Neill, R C; Minuk, J; Cox, M E; Braun, P E; Gravel, M


    The ribosome scanning model for translational initiation predicts that eukaryotic mRNAs should, as a rule, be monocistronic. However, cases have recently been described of eukaryotic mRNAs producing more than one protein through alternative translational initiation at several different AUG codons. The present work reports the occurrence of two translational start sites on the mRNA encoding isoform 2 of the myelin marker enzyme 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNP) in rat and mouse. We show that the CNP2 mRNA is able to direct synthesis of not only CNP2, but also CNP1 polypeptide. Immunoprecipitation experiments using a polyclonal antibody directed against CNP detect both CNP isoforms in tissues or cell lines expressing only the CNP2 transcript. Thus, the synthesis of CNP1 and CNP2 polypeptides must be encoded by the CNP2 transcript. In vitro translation of synthetic CNP2 mRNA demonstrates that both CNP isoforms are synthesized by initiation at different AUG codons. Furthermore, by introducing mutations to "switch off" translation from the second in-frame AUG codon in the CNP2 cDNA, and transfecting 293T cells with those constructs, we are able to correlate the production of CNP1 and CNP2 with different translational start sites. These results lead us to conclude that the CNP2 mRNA is able to produce both CNP1 and CNP2 polypeptides. This investigation has altered our understanding of the temporal expression of the CNP protein isoforms during development of the central nervous system (CNS). PMID:9373034

  19. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin


    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  20. Subcellular distribution of small interfering RNA: directed delivery through RNA polymerase III expression cassettes and localization by in situ hybridization. (United States)

    Paul, Cynthia P


    Reduction in the expression of specific genes through small interfering RNAs (siRNAs) is dependent on the colocalization of siRNAs with other components of the RNA interference (RNAi) pathways within the cell. The expression of siRNAs within cells from cassettes that are derived from genes transcribed by RNA polymerase III (pol III) and provide for selective subcellular distribution of their products can be used to direct siRNAs to the cellular pathways. Expression from the human U6 promoter, resulting in siRNA accumulation in the nucleus, is effective in reducing gene expression, whereas cytoplasmic and nucleolar localization of the siRNA when expressed from the 5S or 7 SL promoters is not effective. The distribution of siRNA within the cell is determined by fluorescence in situ hybridization. Although the long uninterrupted duplex of siRNA makes it difficult to detect with DNA oligonucleotide probes, labeled oligonucleotide probes with 2'-O-methyl RNA backbones provide the stability needed for a strong signal. These methods contribute to studies of the interconnected cellular RNAi pathways and are useful in adapting RNAi as a tool to determine gene function and develop RNA-based therapeutics. PMID:15644179

  1. Repression of callus initiation by the miRNA-directed interaction of auxin-cytokinin in Arabidopsis thaliana. (United States)

    Liu, Zhenhua; Li, Juan; Wang, Long; Li, Qiang; Lu, Qing; Yu, Yanchong; Li, Shuo; Bai, Ming-Yi; Hu, Yuxin; Xiang, Fengning


    In tissue culture systems plant cells can be induced to regenerate to whole plants. A particularly striking example of cellular reprogramming is seen in this regeneration process, which typically begins with the induction of an intermediate cell mass referred to as callus. The identity of the key genetic cues associated with callus formation is still largely unknown. Here a microRNA-directed phytohormonal interaction is described which represses callus initiation and formation in Arabidopsis thaliana. miR160 and ARF10 (At2g28350), a gene encoding an auxin response factor, were shown to exhibit a contrasting pattern of transcription during callus initiation from pericycle-like cells. The callus initiation is faster and more prolific in a miR160-resistant form of ARF10 (mARF10), but slower and less prolific in the transgenic line over-expressing miR160c (At5g46845), arf10 and arf10 arf16 mutants than that in the wild type. ARF10 repressed the expression of Arabidopsis Response Regulator15 (ARR15, At1g74890) via its direct binding to the gene's promoter. The loss of function of ARR15 enhanced callus initiation and partly rescued the phenotype induced by the transgene Pro35S:miR160c. Overexpression of ARR15 partly rescues the callus initiation defect of mARF10 plants. Our findings define miR160 as a key repressor of callus formation and reveal that the initiation of callus is repressed by miR160-directed interaction between auxin and cytokinin. PMID:27189514

  2. RNA Polymerase V Functions in Arabidopsis Interphase Heterochromatin Organization Independently of the 24-nt siRNA-Directed DNA Methylation Pathway

    Institute of Scientific and Technical Information of China (English)

    Olga Pontes; Pedro Costa-Nunes; Paul Vithayathil; Craig S.Pikaard


    In Arabidopsis,pericentromeric repeats,retroelements,and silenced rRNA genes are assembled into heterochromatin within nuclear structures known as chromocenters.The mechanisms governing higher-order heterochromatin organization are poorly understood but 24-nt small interfering RNAs (siRNAs) are known to play key roles in heterochromatin formation.Nuclear RNA polymerase IV (Pol IV),RNA-DEPENDENT RNA POLYMERASE 2 (RDR2),and DICER-LIKE 3 (DCL3) are required for biogenesis of 24-nt siRNAs that associate with ARGONAUTE 4 (AGO4).Nuclear RNA polymerase V (Pol V) collaborates with DRD1 (DEFICIENT IN RNA-DEPENDENT DNA METHYLATION 1) to generate transcripts at heterochromatic loci that are hypothesized to bind to siRNA-AGO4 complexes and subsequently recruit the de-novo DNA methylation and/or histone modifying machinery.Here,we report that decondensation of the major pericentromeric repeats and depletion of the heterochromatic mark histone H3 lysine 9 dimethylation at chromocenters occurs specifically in pol V and drd1 mutants.Disruption of pericentromeric repeats condensation is coincident with transcriptional reactivation of specific classes of pericentromeric 180-bp repeats.We further demonstrate that Pol V functions independently of Pol IV,RDR2,and DCL3-mediated siRNA production to affect interphase heterochromatin organization,possibly by involving RNAs that recruit structural or chromatin-modifying proteins.

  3. MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for arabidopsis lateral root development. (United States)

    Guo, Hui-Shan; Xie, Qi; Fei, Ji-Feng; Chua, Nam-Hai


    Although several plant microRNAs (miRNAs) have been shown to play a role in plant development, no phenotype has yet been associated with a reduction or loss of expression of any plant miRNA. Arabidopsis thaliana miR164 was predicted to target five NAM/ATAF/CUC (NAC) domain-encoding mRNAs, including NAC1, which transduces auxin signals for lateral root emergence. Here, we show that miR164 guides the cleavage of endogenous and transgenic NAC1 mRNA, producing 3'-specific fragments. Cleavage was blocked by NAC1 mutations that disrupt base pairing with miR164. Compared with wild-type plants, Arabidopsis mir164a and mir164b mutant plants expressed less miR164 and more NAC1 mRNA and produced more lateral roots. These mutant phenotypes can be complemented by expression of the appropriate MIR164a and MIR164b genomic sequences. By contrast, inducible expression of miR164 in wild-type plants led to decreased NAC1 mRNA levels and reduced lateral root emergence. Auxin induction of miR164 was mirrored by an increase in the NAC1 mRNA 3' fragment, which was not observed in the auxin-insensitive mutants auxin resistant1 (axr1-12), axr2-1, and transport inhibitor response1. Moreover, the cleavage-resistant form of NAC1 mRNA was unaffected by auxin treatment. Our results indicate that auxin induction of miR164 provides a homeostatic mechanism to clear NAC1 mRNA to downregulate auxin signals.

  4. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment. (United States)

    Kwasniewska, Jolanta; Jaskowiak, Joanna


    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  5. Analysis of single nucleotide polymorphisms based on RNA sequencing data of diverse bio-geographical accessions in barley (United States)

    Takahagi, Kotaro; Uehara-Yamaguchi, Yukiko; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo; Mochida, Keiichi; Saisho, Daisuke


    Barley is one of the founder crops of Old world agriculture and has become the fourth most important cereal worldwide. Information on genome-scale DNA polymorphisms allows elucidating the evolutionary history behind domestication, as well as discovering and isolating useful genes for molecular breeding. Deep transcriptome sequencing enables the exploration of sequence variations in transcribed sequences; such analysis is particularly useful for species with large and complex genomes, such as barley. In this study, we performed RNA sequencing of 20 barley accessions, comprising representatives of several biogeographic regions and a wild ancestor. We identified 38,729 to 79,949 SNPs in the 19 domesticated accessions and 55,403 SNPs in the wild barley and revealed their genome-wide distribution using a reference genome. Genome-scale comparisons among accessions showed a clear differentiation between oriental and occidental barley populations. The results based on population structure analyses provide genome-scale properties of sub-populations grouped to oriental, occidental and marginal groups in barley. Our findings suggest that the oriental population of domesticated barley has genomic variations distinct from those in occidental groups, which might have contributed to barley’s domestication. PMID:27616653

  6. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  7. Polycistronic artificial miRNA-mediated resistance to Wheat dwarf virus in barley is highly efficient at low temperature. (United States)

    Kis, András; Tholt, Gergely; Ivanics, Milán; Várallyay, Éva; Jenes, Barnabás; Havelda, Zoltán


    Infection of Wheat dwarf virus (WDV) strains on barley results in dwarf disease, imposing severe economic losses on crop production. As the natural resistance resources against this virus are limited, it is imperative to elaborate a biotechnological approach that will provide effective and safe immunity to a wide range of WDV strains. Because vector insect-mediated WDV infection occurs during cool periods in nature, it is important to identify a technology which is effective at lower temperature. In this study, we designed artificial microRNAs (amiRNAs) using a barley miRNA precursor backbone, which target different conservative sequence elements of the WDV strains. Potential amiRNA sequences were selected to minimize the off-target effects and were tested in a transient sensor system in order to select the most effective constructs at low temperature. On the basis of the data obtained, a polycistronic amiRNA precursor construct (VirusBuster171) was built expressing three amiRNAs simultaneously. The construct was transformed into barley under the control of a constitutive promoter. The transgenic lines were kept at 12-15 °C to mimic autumn and spring conditions in which major WDV infection and accumulation take place. We were able to establish a stable barley transgenic line displaying resistance to insect-mediated WDV infection. Our study demonstrates that amiRNA technology can be an efficient tool for the introduction of highly efficient resistance in barley against a DNA virus belonging to the Geminiviridae family, and this resistance is effective at low temperature where the natural insect vector mediates the infection process. PMID:26136043

  8. MicroRNA-21-3p, a berberine-induced miRNA, directly down-regulates human methionine adenosyltransferases 2A and 2B and inhibits hepatoma cell growth.

    Directory of Open Access Journals (Sweden)

    Ting-Fang Lo

    Full Text Available Methionine adenosyltransferase (MAT is the cellular enzyme that catalyzes the synthesis of S-adenosylmethionine (SAM, the principal biological methyl donor and a key regulator of hepatocyte proliferation, death and differentiation. Two genes, MAT1A and MAT2A, encode 2 distinct catalytic MAT isoforms. A third gene, MAT2B, encodes a MAT2A regulatory subunit. In hepatocellular carcinoma (HCC, MAT1A downregulation and MAT2A upregulation occur, known as the MAT1A:MAT2A switch. The switch is accompanied with an increasing expression of MAT2B, which results in decreased SAM levels and facilitates cancer cell growth. Berberine, an isoquinoline alkaloid isolated from many medicinal herbs such as Coptis chinensis, has a wide range of pharmacological effects including anti-cancer effects. Because drug-induced microRNAs have recently emerged as key regulators in guiding their pharmacological effects, we examined whether microRNA expression is differentially altered by berberine treatment in HCC. In this study, we used microRNA microarrays to find that the expression level of miR-21-3p (previously named miR-21* increased after berberine treatment in the HepG2 human hepatoma cell line. To predict the putative targets of miR-21-3p, we integrated the gene expression profiles of HepG2 cells after berberine treatment by comparing with a gene list generated from sequence-based microRNA target prediction software. We then confirmed these predictions through transfection of microRNA mimics and a 3' UTR reporter assay. Our findings provide the first evidence that miR-21-3p directly reduces the expression of MAT2A and MAT2B by targeting their 3' UTRs. In addition, an overexpression of miR-21-3p increased intracellular SAM contents, which have been proven to be a growth disadvantage for hepatoma cells. The overexpression of miR-21-3p suppresses growth and induces apoptosis in HepG2 cells. Overall, our results demonstrate that miR-21-3p functions as a tumor suppressor

  9. Phosphate utilization efficiency correlates with expression of low-affinity phosphate transporters and noncoding RNA, IPS1, in barley. (United States)

    Huang, Chun Y; Shirley, Neil; Genc, Yusuf; Shi, Bujun; Langridge, Peter


    Genetic variation in phosphorus (P) efficiency exists among wheat (Triticum aestivum) and barley (Hordeum vulgare) genotypes, but the underlying mechanisms for the variation remain elusive. High- and low-affinity phosphate (Pi) PHT1 transporters play an indispensable role in P acquisition and remobilization. However, little is known about genetic variation in PHT1 gene expression and association with P acquisition efficiency (PAE) and P utilization efficiency (PUE). Here, we present quantitative analyses of transcript levels of high- and low-affinity PHT1 Pi transporters in four barley genotypes differing in PAE. The results showed that there was no clear pattern in the expression of four paralogs of the high-affinity Pi transporter HvPHT1;1 among the four barley genotypes, but the expression of a low-affinity Pi transporter, HvPHT1;6, and its close homolog HvHPT1;3 was correlated with the genotypes differing in PUE. Interestingly, the expression of HvPHT1;6 and HvPHT1;3 was correlated with the expression of HvIPS1 (for P starvation inducible; noncoding RNA) but not with HvIPS2, suggesting that HvIPS1 plays a distinct role in the regulation of the low-affinity Pi transporters. In addition, high PUE was found to be associated with high root-shoot ratios in low-P conditions, indicating that high carbohydrate partitioning into roots occurs simultaneously with high PUE. However, high PUE accompanying high carbon partitioning into roots could result in low PAE. Therefore, the optimization of PUE through the modification of low-affinity Pi transporter expression may assist further improvement of PAE for low-input agriculture systems.

  10. Control of α-amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    International Nuclear Information System (INIS)

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA3) with or without 5 millimolar CaCl2 shows that α-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca2+. No difference was observed in α-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA3 with 5 millimolar CaCl2 and layers incubated in GA3 alone. RNA isolated from layers incubated for 12 hours in GA3 with and without CA2+. A cDNA clone for α-amylase was isolated and used to measure α-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca2+ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca2+ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for α-amylase synthesized in Ca2+-deprived aleurone layers was translatable. Ca2+ is required for the synthesis of α-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing

  11. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    Energy Technology Data Exchange (ETDEWEB)

    Deikman, J.; Jones, R.L.


    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  12. Over-expression of microRNA171 affects phase transitions and floral meristem determinancy in barley

    Directory of Open Access Journals (Sweden)

    Curaba Julien


    Full Text Available Abstract Background The transitions from juvenile to adult and adult to reproductive phases of growth are important stages in the life cycle of plants. The regulators of these transitions include miRNAs, in particular miR156 and miR172 which are part of a regulatory module conserved across the angiosperms. In Arabidopsis miR171 represses differentiation of axillary meristems by repressing expression of SCARECROW-LIKE(SCL transcription factors, however the role of miR171 has not been examined in other plants. Results To investigate the roles of mir171 and its target genes in a monocot, the Hvu pri-miR171a was over-expressed in barley (Hordeum vulgare L. cv. Golden promise leading to reduced expression of at least one HvSCL gene. The resulting transgenic plants displayed a pleiotropic phenotype which included branching defects, an increased number of short vegetative phytomers and late flowering. These phenotypes appear to be the consequence of changes in the organisation of the shoot meristem. In addition, the data show that miR171 over-expression alters the vegetative to reproductive phase transition by activating the miR156 pathway and repressing the expression of the TRD (THIRD OUTER GLUME and HvPLA1 (Plastochron1 genes. Conclusions Our data suggest that some of the roles of miR171 and its target genes that have been determined in Arabidopsis are conserved in barley and that they have additional functions in barley including activation of the miR156 pathway.

  13. Barley germination

    DEFF Research Database (Denmark)

    Daneri-Castro, Sergio N.; Svensson, Birte; Roberts, Thomas H.


    of germination in the context of industrial malting. For transcriptomics, recent advances in sequencing the barley genome allow next-generation sequencing approaches to reveal novel effects of variety and environment on germination. For proteomics, selection of the source tissue(s) and the protein extraction...... conditions continue to be key to discovering the roles of individual protein forms and posttranslational modifications, such as glycosylation. Activity-based proteomics, particularly in combination with new gene editing technologies, has great potential to elucidate the network of enzymes in barley...

  14. Stability of Barley stripe mosaic virus-induced gene silencing in barley

    DEFF Research Database (Denmark)

    Bruun-Rasmussen, Marianne; Madsen, Christian Toft; Jessing, Stine;


    for barley and wheat; however, silencing using this vector is generally transient, with efficient silencing often being confined to the first two or three systemically infected leaves. To investigate this further, part of the barley Phytoene desaturase (PDS) gene was inserted into BSMV and the...... length influenced stability but not efficiency of VIGS. Silencing was transient in most cases; however, the decrease in PDS mRNA levels measured by qRT-PCR began earlier and lasted longer than the photobleaching. Occasionally, silencing persisted and could be transmitted through seed as well as via......Virus-induced gene silencing (VIGS) can be used as a powerful tool for functional genomics studies in plants. With this approach, it is possible to target most genes and downregulate the messenger (m)RNA in a sequence-specific manner. Barley stripe mosaic virus (BSMV) is an established VIGS vector...

  15. Infection of barley protoplasts with rice hoja blanca tenuivirus. Brief report. (United States)

    Nguyen, M; Kormelink, R; Goldbach, R; Haenni, A L


    A barley protoplast system has been established that supports replication of Rice hoja blanca tenuivirus (RHBV). Following polyethylene glycol-mediated RHBV inoculation of barley protoplasts, newly synthesized viral RNAs and proteins could be detected. Time course analyses revealed de novo synthesis of genome length viral RNA4, as well as subgenomic-sized RNA4 molecules of both polarities. Two proteins, N and NS4, encoded by viral complementary RNA3 and viral RNA4 respectively, were detected by Western immunoblot analysis. The barley protoplast system thus constitutes a promising tool for in vivo studies of the sequential steps involved in the multiplication cycle of RHBV. PMID:10603179

  16. Self vs. non-self discrimination during CRISPR RNA-directed immunity


    Marraffini, Luciano A.; SONTHEIMER, ERIK J.


    All immune systems must distinguish self from non-self to repel invaders without inducing autoimmunity. Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci protect bacteria and archaea from invasion by phage and plasmid DNA through a genetic interference pathway1–9. CRISPR loci are present in ~ 40% and ~90% of sequenced bacterial and archaeal genomes respectively10 and evolve rapidly, acquiring new spacer sequences to adapt to highly dynamic viral populations1, 11–13. Imm...

  17. Barley peroxidase isozymes (United States)

    Laugesen, Sabrina; Bak-Jensen, Kristian Sass; Hägglund, Per; Henriksen, Anette; Finnie, Christine; Svensson, Birte; Roepstorff, Peter


    Thirteen peroxidase spots on two-dimensional gels were identified by comprehensive proteome analysis of the barley seed. Mass spectrometry tracked multiple forms of three different peroxidase isozymes: barley seed peroxidase 1, barley seed-specific peroxidase BP1 and a not previously identified putative barley peroxidase. The presence of multiple spots for each of the isozymes reflected variations in post-translational glycosylation and protein truncation. Complete sequence coverage was achieved by using a series of proteases and chromatographic resins for sample preparation prior to mass spectrometric analysis. Distinct peroxidase spot patterns divided the 16 cultivars tested into two groups. The distribution of the three isozymes in different seed tissues (endosperm, embryo, and aleurone layer) suggested the peroxidases to play individual albeit partially overlapping roles during germination. In summary, a subset of three peroxidase isozymes was found to occur in the seed, whereas products of four other barley peroxidase genes were not detected. The present analysis documents the selective expression profiles and post-translational modifications of isozymes from a large plant gene family.


    Directory of Open Access Journals (Sweden)

    Akula Annapurna


    Full Text Available Prevalence of lifestyle diseases is increasing day by day. Mostly the younger generation do not have much awareness about healthy nutritional supplements. One such important cereal grain not used mostly by youngsters is barley It is a good old grain with so many health benefits like weight reduction, decreasing blood pressure, blood cholesterol, blood glucose in Type 2 diabetes and preventing colon cancer. It is easily available and cheap grain. It contains both soluble and insoluble fiber, protein, vitamins B and E, minerals selenium, magnesium and iron, copper, flavonoids and anthocynins. Barley contains soluble fiber, beta glucan binds to bile acids in the intestines and thereby decreasing plasma cholesterol levels. Absorbed soluble fiber decreases cholesterol synthesis by liver and cleansing blood vessels. Insoluble fiber provides bulkiness in the intestines, thereby satiety. decreased appetite. It promotes intestinal movements relieving constipation, cleansing colonic harmful bacteria and reduced incidence of colonic cancer. It is a good source of niacin ,reducing LDL levels and increasing HDL levels. Selenium and vitamin E providing beneficial antioxidant effects. Magnesium, a cofactor for many carbohydrate metabolism enzymes and high fiber content contributes for its blood glucose reducing effect in Type 2 diabetes. It is having good diuretic activity and is useful in urinary tract infections. Barley contains gluten, contraindicated in celiac disease.

  19. Involvement of Alternative Splicing in Barley Seed Germination.

    Directory of Open Access Journals (Sweden)

    Qisen Zhang

    Full Text Available Seed germination activates many new biological processes including DNA, membrane and mitochondrial repairs and requires active protein synthesis and sufficient energy supply. Alternative splicing (AS regulates many cellular processes including cell differentiation and environmental adaptations. However, limited information is available on the regulation of seed germination at post-transcriptional levels. We have conducted RNA-sequencing experiments to dissect AS events in barley seed germination. We identified between 552 and 669 common AS transcripts in germinating barley embryos from four barley varieties (Hordeum vulgare L. Bass, Baudin, Harrington and Stirling. Alternative 3' splicing (34%-45%, intron retention (32%-34% and alternative 5' splicing (16%-21% were three major AS events in germinating embryos. The AS transcripts were predominantly mapped onto ribosome, RNA transport machineries, spliceosome, plant hormone signal transduction, glycolysis, sugar and carbon metabolism pathways. Transcripts of these genes were also very abundant in the early stage of seed germination. Correlation analysis of gene expression showed that AS hormone responsive transcripts could also be co-expressed with genes responsible for protein biosynthesis and sugar metabolisms. Our RNA-sequencing data revealed that AS could play important roles in barley seed germination.

  20. Involvement of Alternative Splicing in Barley Seed Germination. (United States)

    Zhang, Qisen; Zhang, Xiaoqi; Wang, Songbo; Tan, Cong; Zhou, Gaofeng; Li, Chengdao


    Seed germination activates many new biological processes including DNA, membrane and mitochondrial repairs and requires active protein synthesis and sufficient energy supply. Alternative splicing (AS) regulates many cellular processes including cell differentiation and environmental adaptations. However, limited information is available on the regulation of seed germination at post-transcriptional levels. We have conducted RNA-sequencing experiments to dissect AS events in barley seed germination. We identified between 552 and 669 common AS transcripts in germinating barley embryos from four barley varieties (Hordeum vulgare L. Bass, Baudin, Harrington and Stirling). Alternative 3' splicing (34%-45%), intron retention (32%-34%) and alternative 5' splicing (16%-21%) were three major AS events in germinating embryos. The AS transcripts were predominantly mapped onto ribosome, RNA transport machineries, spliceosome, plant hormone signal transduction, glycolysis, sugar and carbon metabolism pathways. Transcripts of these genes were also very abundant in the early stage of seed germination. Correlation analysis of gene expression showed that AS hormone responsive transcripts could also be co-expressed with genes responsible for protein biosynthesis and sugar metabolisms. Our RNA-sequencing data revealed that AS could play important roles in barley seed germination.

  1. Barley Transformation Using Biolistic Techniques (United States)

    Harwood, Wendy A.; Smedley, Mark A.

    Microprojectile bombardment or biolistic techniques have been widely used for cereal transformation. These methods rely on the acceleration of gold particles, coated with plasmid DNA, into plant cells as a method of directly introducing the DNA. The first report of the generation of fertile, transgenic barley plants used biolistic techniques. However, more recently Agrobacterium-mediated transformation has been adopted as the method of choice for most cereals including barley. Biolistic procedures are still important for some barley transformation applications and also provide transient test systems for the rapid checking of constructs. This chapter describes methods for the transformation of barley using biolistic procedures and also highlights the use of the technology in transient assays.

  2. Genomic Prediction in Barley

    DEFF Research Database (Denmark)

    Edriss, Vahid; Cericola, Fabio; Jensen, Jens D;

    Genomic prediction uses markers (SNPs) across the whole genome to predict individual breeding values at an early growth stage potentially before large scale phenotyping. One of the applications of genomic prediction in plant breeding is to identify the best individual candidate lines to contribute...... to next generation. The main goal of this study was to see the potential of using genomic prediction in a commercial Barley breeding program. The data used in this study was from Nordic Seed company which is located in Denmark. Around 350 advanced lines were genotyped with 9K Barely chip from...... Illumina. Traits used in this study were grain yield, plant height and heading date. Heading date is number days it takes after 1st June for plant to head. Heritabilities were 0.33, 0.44 and 0.48 for yield, height and heading, respectively for the average of nine plots. The GBLUP model was used for genomic...

  3. Genomic Prediction in Barley

    DEFF Research Database (Denmark)

    Edriss, Vahid; Cericola, Fabio; Jensen, Jens D;


    Genomic prediction uses markers (SNPs) across the whole genome to predict individual breeding values at an early growth stage potentially before large scale phenotyping. One of the applications of genomic prediction in plant breeding is to identify the best individual candidate lines to contribute...... to next generation. The main goal of this study was to see the potential of using genomic prediction in a commercial Barley breeding program. The data used in this study was from Nordic Seed company which is located in Denmark. Around 350 advanced lines were genotyped with 9K Barely chip from...... Illumina. Traits used in this study were grain yield, plant height and heading date. Heading date is number days it takes after 1st June for plant to head. Heritabilities were 0.33, 0.44 and 0.48 for yield, height and heading, respectively for the average of nine plots. The GBLUP model was used for genomic...

  4. Starch Bioengineering in Barley

    DEFF Research Database (Denmark)

    Shaik, Shahnoor Sultana

    by the amylolytic enzymes while the amylose-only endosperm starch exhibits high resistance to degradation and hence less available for degradation. With the aim to investigate the hypothesis, starch molecular structures were modulated with the above mentioned modifications and were studied for the effects....... This was achieved by endosperm-specific overexpression of Solanum tuberosum GWD to generate hyper-phosphorylated (HP) starch and endosperm-specific RNAi suppression of all three starch branching enzyme (SBE) isoforms to generate amylose-only (AO) starch in barley (cv. Golden Promise). In first and second study......Starch represents the most important carbohydrate used for food and feed purposes. Increasingly, it is also used as a renewable raw material, as a source of biofuel, and for many different industrial applications. Progress in understanding starch biosynthesis, and investigations of the genes...

  5. Functional proteomics of barley and barley chloroplasts – strategies, methods and perspectives

    DEFF Research Database (Denmark)

    Petersen, Jørgen; Rogowska-Wrzesinska, Adelina; Jensen, Ole Nørregaard


    tolerance, micronutrient utilization, and photosynthesis in barley. In the present review we present the current state of proteomics research for investigations of barley chloroplasts, i.e., the organelle that contain the photosynthetic apparatus in the plant. We describe several different proteomics...... strategies and discuss their applications in characterization of the barley chloroplast as well as future perspectives for functional proteomics in barley research....

  6. Combination of small interfering RNA-directed B cell lymphoma/leukemia-2 oncogene silencing and arsenic using a nanomedicine strategy for the enhanced cytotoxicity of acute myelogenous leukemia in vitro%载小干扰RNA纳米微粒沉默U937细胞B细胞淋巴瘤/白血病-2基因增加砷剂细胞毒效应的研究

    Institute of Scientific and Technical Information of China (English)

    曾林涓; 钟淑萍; 李学刚; 林忠; 黄开红; 陈茵婷


    目的 观察载小干扰RNA(siRNAs)纳米微粒沉默B细胞淋巴瘤/白血病-2(bcl-2)基因联合纳米砷剂协同抗急性髓性白血病效应.方法 凝胶阻滞电泳、荧光显微镜、流式细胞仪及噻唑蓝(MTT)法分别用于评估正聚乙二醇(PEG)-多聚赖氨酸(PLL)负载siRNAs能力、细胞转染效率及对细胞活力影响,Western blot法观察siRNAs沉默靶基因,MTT法评估siRNAs联合纳米砷剂对U937协同抑制效应.结果 N/P-10时,PEG-PLL和siRNAs基本复合,U937细胞活力为(85.06±5.80)%,转染效率为(83.70±0.37)%,转染后bcl-2蛋白表达下降为(44.1 l±4.39)%.空载体、纯砷单药、纳米As单药及联合用药组细胞活力分别为(99.44±1.45)%、(87.76±2.21)%、(92.98±4.34)%、(67.93±8.16)%(P<0.05)(砷1.25 μmol/L);(99.56±2.53)%、(54.08±4.46)%、(57.85±2.11)%、(38.60±6.24)%(P<0.05)(砷2.50 μmol/L); (98.88±1.59)%、(37.62±1.38)%、(51.31±3.14)%、(28.92±4.97)%(p<0.05)(砷5.00 μmol/L);(97.72±2.55)%、(29.44±4.14)%、(40.18±3.72)%、(20.56±4.97)%(P<0.05)(砷10.00 μmol/L); (96.65±2.03)%、(21.49±1.60)%、(26.34±0.97)%、(15.90±1.70)%(P<0.05)(砷20.00 μmol/L).结论 PEG-PLL对U937细胞毒性较低、转染效率较高,PEG-PLL/siRNAs沉默bel-2联合纳米As获得协同抗白血病效应.%Objective To observed the synergetic inhibitory effects on human acute myelogenous leukemia (AML) by nanoparticle-mediated small interfering RNA (siRNAs) and arsenic therapy in vitro.Methods Gel retardation assay,fluorescence microscopy,flow cytometry assay and methyl thiazol tetrazolium (MTT) assay was performed to evaluate siRNAs complexation capacity,transfection efficiency and in-fluence on cell viability of polyethylene glycol (PEG)-poly (L-lysine) (PLL).The down regulation of B cell lymphoma/leukemia-2 (bcl-2) gene expression was comfirmed by Western blotting assay.The MTT assay was further performed to evaluate the synergetic inhibitory

  7. The Swedish mutant barley collection

    International Nuclear Information System (INIS)

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  8. Messenger RNAs from the Scutellum and Aleurone of Germinating Barley Encode (1-->3,1-->4)-beta-d-Glucanase, alpha-Amylase and Carboxypeptidase

    DEFF Research Database (Denmark)

    Mundy, John; Brandt, Anders; Fincher, Geoffrey B


    Polyclonal antibodies raised against barley (1-->3,1-->4)-beta-d-glucanase, alpha-amylase and carboxypeptidase were used to detect precursor polypeptides of these hydrolytic enzymes among the in vitro translation products of mRNA isolated from the scutellum and aleurone of germinating barley. In ...

  9. Alanine aminotransferase controls seed dormancy in barley (United States)

    Sato, Kazuhiro; Yamane, Miki; Yamaji, Nami; Kanamori, Hiroyuki; Tagiri, Akemi; Schwerdt, Julian G.; Fincher, Geoffrey B.; Matsumoto, Takashi; Takeda, Kazuyoshi; Komatsuda, Takao


    Dormancy allows wild barley grains to survive dry summers in the Near East. After domestication, barley was selected for shorter dormancy periods. Here we isolate the major seed dormancy gene qsd1 from wild barley, which encodes an alanine aminotransferase (AlaAT). The seed dormancy gene is expressed specifically in the embryo. The AlaAT isoenzymes encoded by the long and short dormancy alleles differ in a single amino acid residue. The reduced dormancy allele Qsd1 evolved from barleys that were first domesticated in the southern Levant and had the long dormancy qsd1 allele that can be traced back to wild barleys. The reduced dormancy mutation likely contributed to the enhanced performance of barley in industrial applications such as beer and whisky production, which involve controlled germination. In contrast, the long dormancy allele might be used to control pre-harvest sprouting in higher rainfall areas to enhance global adaptation of barley. PMID:27188711

  10. Alanine aminotransferase controls seed dormancy in barley. (United States)

    Sato, Kazuhiro; Yamane, Miki; Yamaji, Nami; Kanamori, Hiroyuki; Tagiri, Akemi; Schwerdt, Julian G; Fincher, Geoffrey B; Matsumoto, Takashi; Takeda, Kazuyoshi; Komatsuda, Takao


    Dormancy allows wild barley grains to survive dry summers in the Near East. After domestication, barley was selected for shorter dormancy periods. Here we isolate the major seed dormancy gene qsd1 from wild barley, which encodes an alanine aminotransferase (AlaAT). The seed dormancy gene is expressed specifically in the embryo. The AlaAT isoenzymes encoded by the long and short dormancy alleles differ in a single amino acid residue. The reduced dormancy allele Qsd1 evolved from barleys that were first domesticated in the southern Levant and had the long dormancy qsd1 allele that can be traced back to wild barleys. The reduced dormancy mutation likely contributed to the enhanced performance of barley in industrial applications such as beer and whisky production, which involve controlled germination. In contrast, the long dormancy allele might be used to control pre-harvest sprouting in higher rainfall areas to enhance global adaptation of barley. PMID:27188711

  11. Resistance to Barley Leaf Stripe

    DEFF Research Database (Denmark)

    Nørgaard Knudsen, J. C.


    Ten barley [Hordeum vulgare] genotypes were inoculated with twelve isolates of Pyrenophora graminea of diverse European and North African origin. Race specific resistance occurred. Four, possibly five, genetically different sources of race-specific resistance were found, three of them occurring i...

  12. Identification and Characterization of MicroRNAs from Barley (Hordeum vulgare L. by High-Throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Song Weining


    Full Text Available MicroRNAs (miRNAs are a class of endogenous RNAs that regulates the gene expression involved in various biological and metabolic processes. Barley is one of the most important cereal crops worldwide and is a model organism for genetic and genomic studies in Triticeae species. However, the miRNA research in barley has lagged behind other model species in grass family. To obtain more information of miRNA genes in barley, we sequenced a small RNA library created from a pool of equal amounts of RNA from four different tissues using Solexa sequencing. In addition to 126 conserved miRNAs (58 families, 133 novel miRNAs belonging to 50 families were identified from this sequence data set. The miRNA* sequences of 15 novel miRNAs were also discovered, suggesting the additional evidence for existence of these miRNAs. qRT-PCR was used to examine the expression pattern of six randomly selected miRNAs. Some miRNAs involved in drought and salt stress response were also identified. Furthermore, the potential targets of these putative miRNAs were predicted using the psRNATarget tools. Our results significantly increased the number of novel miRNAs in barley, which should be useful for further investigation into the biological functions and evolution of miRNAs in barley and other species.

  13. Spatial and temporal regulation of DNA fragmentation in the aleurone of germinating barley

    NARCIS (Netherlands)

    Wang, M.; Oppedijk, B.J.; Caspers, M.P.M.; Lamers, G.E.M.; Boot, M.J.; Geerlings, D.N.G.; Bakhuizen, B.; Meijer, A.H.; Duijn, B. van


    During germination of barley grains, the appearance of DNA fragmentation started in aleurone cells near the embryo and extended to the distal end in a time-dependent manner. DNA fragmentation was demonstrated to occur only after the expression of α-amylase mRNA in the aleurone layer. In addition, ce

  14. Response of barley aleurone layers to abscisic acid

    Energy Technology Data Exchange (ETDEWEB)

    Ho, D.T.H.; Varner, J.E.


    Cordycepin, an inhibitor of RNA synthesis in barley (Hordeum vulgare L.) aleurone cells, does not inhibit the gibberellic acid-enhanced ..cap alpha..-amylase (EC synthesis in barley aleurone layers if it is added 12 hours or more after the addition of the hormone. However, the accumulation of ..cap alpha..-amylase activity after 12 hours of gibberellic acid can be decreased by abscisic acid. The accumulation of ..cap alpha..-amylase activity is sustained or quickly restored when cordycepin is added simultaneously or some time after abscisic acid, indicating that the response of aleurone layers to abscisic acid depends on the continuous synthesis of a short lived RNA. By analysis of the newly synthesized proteins by gel electrophoresis with sodium dodecylsulfate, it was observed that the synthesis of ..cap alpha..-amylase is decreased in the presence of abscisic acid while the synthesis of most of the other proteins remains unchanged. From the rate of resumption of ..cap alpha..-amylase production in the presence of cordycepin and abscisic acid, it appears that abscisic acid does not have a measurable effect on the stability of ..cap alpha..-amylase mRNA.

  15. Biologically active secondary metabolites of barley. I. Developing techniques and assessing allelopathy in barley. (United States)

    Liu, D L; Lovett, J V


    Allelopathic effects of barley (Hordeum vulgare L.) on white mustard (Sinapis alba L.) were assessed using modified bioassays that reduced other environmental influences. In a Petri dish bioassay, germination of white mustard was delayed and the radicle lengths were significantly inhibited at a density of 0.5 barley seed/cm(2). In a 'siphoning' bioassay apparatus, when the two species were sown together, radicle elongation of white mustard was not inhibited one day after sowing but became increasingly inhibited as bioassay time increased. Barley allelochemicals were released from the roots in a hydroponic system for at least 70 days after commencement of barley germination. Solutions removed from the hydroponic system of growing barley delayed germination and inhibited growth of white mustard. The allelopathic activity of barley was further confirmed at a density of 0.3 barley seed/cm(2) in a modified stairstep apparatus. PMID:24248571

  16. New leaf diseases of barley in Egypt. (United States)

    Mehiar, F F; El-Deen, E; Wasfy, H; El-Samra, I A


    Leaf diseases of barley were observed also in Egypt. From leaves of barley were isolated: Helminthosporium teres, H. gramineum, Stemphylium vesicarium, Alternaria triticina, Vlocladium chartarum, Acnemonium kiliense, Stemphylium spec. accompanied with the Pleospora stage. Inoculations on both attached and detached leaves showed that all the tested fungi were pathogenic, except Acremonium kiliense and Ulocladium chartarum. PMID:1037183

  17. Healthier cereal products: breadmaking with barley flour.


    Chaya Romero, Carolina; Novillo, Carmen; Rodríguez Badiola, Guillermo; Callejo González, Maria Jesús


    Promote consumption of barley breads, in order to improve intake of fibre and healthenhancing components: Instrumental evaluation of breads. Sensory consumer evaluation of breads. Bread-making performances of flours. Instrumental evaluation of barley substituted wheat Dough.

  18. Molecular characterization of two lipoxygenases from barley

    NARCIS (Netherlands)

    Mechelen, J.R. van; Schuurink, R.C.; Smits, M.; Graner, A.; Douma, A.C.; Sedee, N.J.A.; Schmitt, N.F.; Valk, B.E.


    Two full-length lipoxygenase cDNA sequences (LoxB and LoxC) from barley (Hordeum distichum cv. L. Triumph) are described. The cDNAs share high homology with the barley LoxA cDNA. Southern blotting experiments indicate single copy numbers of the three lipoxygenase genes. RFLP mapping revealed the pre

  19. Induction of beta-1,3-glucanase in barley in response to infection by fungal pathogens. (United States)

    Jutidamrongphan, W; Andersen, J B; Mackinnon, G; Manners, J M; Simpson, R S; Scott, K J


    The sequence of a partial cDNA clone corresponding to an mRNA induced in leaves of barley (Hordeum vulgare) by infection with fungal pathogens matched almost perfectly with that of a cDNA clone coding for beta-1,-3-glucanase isolated from the scutellum of barley. Western blot analysis of intercellular proteins from near-isogenic barley lines inoculated with the powdery mildew fungus (Erysiphe graminis f. sp. hordei) showed a strong induction of glucanase in all inoculated lines but was most pronounced in two resistant lines. These data were confirmed by beta-1,3-glucanase assays. The barley cDNA was used as a hybridization probe to detect mRNAs in barley, wheat (Triticum aestivum), rice (oryza sativus), and sorghum (Sorghum bicolor), which are induced by infection with the necrotrophic pathogen Bipolaris sorokiniana. These results demonstrate that activation of beta-1,3-glucanase genes may be a general response of cereals to infection by fungal pathogens.

  20. Calcium homeostasis in barley aleurone

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.L.


    Under the auspices of the Department of Energy we investigated calcium homeostasis in aleurone cells of barley. This investigation was initiated to explore the role played by extracellular Ca{sup 2+} in gibberellic acid (GA)-induced synthesis and secretion of hydrolases in the aleurone layer. We have focused our attention on four topics that relate to the role of Ca{sup 2+} in regulating the synthesis of {alpha}-amylase. First, we determined the stoichiometry of Ca{sup 2+} binding to the two principal classes of barley {alpha}-amylase and examined some of the biochemical and physical properties of the native and Ca{sup 2+}-depleted forms of the enzyme. Second, since {alpha}-amylase is a Ca{sup 2+} containing metalloenzyme that binds one atom of Ca{sup 2+} per molecule, we developed methods to determine the concentration of Ca{sup 2+} in the cytosol of the aleurone cell. We developed a technique for introducing Ca{sup 2+}-sensitive dyes into aleurone protoplasts that allows the measurement of Ca{sup 2+} in both cytosol and endoplasmic reticulum (ER). Third, because the results of our Ca{sup 2+} measurements showed higher levels of Ca{sup 2+} in the ER than in the cytosol, we examined Ca{sup 2+} transport into the ER of control and GA-treated aleurone tissue. And fourth, we applied the technique of patch-clamping to the barley aleurone protoplast to examine ion transport at the plasma membrane. Our results with the patch-clamp technique established the presence of K{sup +} channels in the plasma membrane of the aleurone protoplast, and they showed that this cell is ideally suited for the application of this methodology for studying ion transport. 34 refs.

  1. Antidepressant-like effects of young green barley leaf (Hordeum vulgare L. in the mouse forced swimming test

    Directory of Open Access Journals (Sweden)

    Katsunori Yamaura


    Full Text Available Background: Young green barley leaf is one of the richest sources of antioxidants and has been widely consumed for health management in Japan. In this study, we examined whether oral administration of young green barley leaf has an antidepressant effect on the forced swimming test in mice. Materials and Methods: Mice were individually forced to swim in an open cylindrical container, one hour after oral administration of young green barley leaf (400 or 1000 mg / kg or imipramine (100 mg / kg. Expression of mRNA for nerve growth factor (NGF, brain-derived neurotrophic factor, and glucocorticoid receptor in the brain was analyzed using real-time quantitative polymerase chain reaction (PCR. Results: There was a significant antidepressant-like effect in the forced swimming test; both 400 and 1000 mg / kg young green barley leaves, as well as the positive control imipramine (100 mg / kg, reduced the immobility duration compared to the vehicle group. The expression of mRNA for NGF detected in the hippocampus immediately after the last swimming test was higher than that in the non-swimming group (Nil. Oral administration of imipramine suppressed this increase to the level of the Nil group. Young green barley leaf (400 and 1000 mg / kg also showed a moderate decrease in the expression of mRNA for NGF, in a dose-dependent manner. Conclusion: Oral administration of young green barley leaf is able to produce an antidepressant-like effect in the forced swimming test. Consequently it is possible that the antidepressant-like effects of the young green barley leaf are, at least in part, mediated by an inhibition of the increase in the hippocampus levels of NGF.

  2. Two classes of short interfering RNA in RNA silencing


    Hamilton, Andrew; Voinnet, Olivier; Chappell, Louise; Baulcombe, David


    RNA silencing is a eukaryotic genome defence system that involves processing of double-stranded RNA (dsRNA) into 21–26 nt, short interfering RNA (siRNA). The siRNA mediates suppression of genes corresponding to the dsRNA through targeted RNA degradation. In some plant systems there are additional silencing processes, involving systemic spread of silencing and RNA-directed methylation/transcriptional suppression of homologous genomic DNA. We show here that siRNAs produced in plants from a gree...


    Directory of Open Access Journals (Sweden)

    Alžbeta Žofajová


    Full Text Available The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of  qualitative  raw material for maltinq and beer  industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the  new requirements of  malting and beer industry. As an example of the results obtained most recently description is made of the Ezer, Levan, Donaris, Sladar spring barley varieties with very good malting quality and effective resistance to  powdery mildew.  Cultivation of these varieties  and malting barley production with  reduced use  of pesticidies is environmentally friedly alternative. doi:10.5219/50

  4. Leaf stripe resistance of spring barley cultivars


    Pinnschmidt, Hans O; Nielsen, Bent J.


    Results of six years of screening trials clearly indicate that effective resistance against barley leaf stripe is available, also in modern cultivars. Among the spring barley cultivars that are currently most widely grown in Denmark, Cabaret, Troon, Sebastian, Justina and Brazil appear most resistant, but only Brazil combines a favourable resistance performance (= low mean and standard deviation of environment-adjusted leaf stripe incidence) with a high number of observations (= years of test...

  5. Transcriptional Responses to Gibberellin and Abscisic Acid in Barley Aleurone

    Institute of Scientific and Technical Information of China (English)

    Kegui Chen; Yong-Qiang Charles An


    Cereal aleurone has been established as a model system to investigate giberrellin (GA) and abscisic acid (ABA) responses. Using Barley 1 GeneChip, we examined the mRNA accumulation of over 22 000 genes in de-embryonated barley aleurone treated with GA and ABA. We observed that 1328 genes had more than a threefold change in response to GA treatment, whereas 206 genes had a more than threefold change in response to ABA treatment. Interestingly, approximately 2.5-fold more genes were up-regulated than downregulated by ABA. Eighty-three genes were differentially regulated by both GA and ABA. Most of the genes were subject to antagonistic regulation by ABA and GA, particularly for genes related to seed maturation and germination, such as genes encoding late embryogenesis abundant proteins and storage mobilization enzymes. This supports the antagonistic roles of GA and ABA in seed maturation and seed germination.Interestingly, we observed that a significant percentage of the genes were coordinately regulated by both GA and ABA. Some GA-responsive genes encoded proteins involved in ethylene, jasmonate, brassinosteroid and auxin metabolic and signaling transduction pathways, suggesting their potential interaction with the GA response. We also identified a group of transcription factor genes, such as MYB and Homeobox genes, that were differentially regulated by GA. In addition, a number of GA- and/or ABA-responsive genes encoded components potentially involved in GA and ABA signal transduction pathway. Overall, the present study provides a comprehensive and global view of transcript expression accompanying the GA and ABA response in barley aleurone and identifies a group of genes with potential regulatory functions in GA- and ABA-signaling pathways for future functional validation.

  6. Adaptation of aphid stylectomy for analyses of proteins and mRNAs in barley phloem sap


    Gaupels, Frank; Buhtz, Anja; Knauer, Torsten; Deshmukh, Sachin; Waller, Frank; van Bel, Aart J. E.; Kogel, Karl-Heinz; Kehr, Julia


    Sieve tubes are transport conduits not only for photoassimilates but also for macromolecules and other compounds that are involved in sieve tube maintenance and systemic signalling. In order to gain sufficient amounts of pure phloem exudates from barley plants for analyses of the protein and mRNA composition, a previously described stylectomy set-up was optimized. Aphids were placed in sealed cages, which, immediately after microcauterization of the stylets, were flooded with water-saturated ...

  7. Structure and Function of the Bacterial Root Microbiota in Wild and Domesticated Barley


    Bulgarelli, D.; Garrido Oter, R.; Muench, P.; Weiman, A.; Droege, J.; Pan, Y.; McHardy, A; Schulze-Lefert, P.


    Summary The microbial communities inhabiting the root interior of healthy plants, as well as the rhizosphere, which consists of soil particles firmly attached to roots, engage in symbiotic associations with their host. To investigate the structural and functional diversification among these communities, we employed a combination of 16S rRNA gene profiling and shotgun metagenome analysis of the microbiota associated with wild and domesticated accessions of barley (Hordeum vulgare). Bacterial f...

  8. A mutant homeobox gene created six-rowed spike in barley domestication

    International Nuclear Information System (INIS)

    Increased seed production has been a common goal during the domestication of cereal crops. Early cultivators of barley (Hordeum vulgare ssp. vulgare) selected a phenotype with a six-rowed spike that stably produced three times the usual grain number during domestication. We isolated the SIX-ROWED SPIKE 1 (Vrs1) from barley by chromosome walking. We discovered that Vrs1 encodes a homeodomain leucine zipper I-class protein (HD-ZIP I), a potential transcription factor. RNA in situ hybridization revealed that the Vrs1 is expressed only in lateral spikelet primordia. Sequencing alleles of 54 six-rowed mutant lines revealed a single amino acid substitution in 22 lines, creation of a new stop codon in 12 lines, a nucleotide substitution in the conserved splicing site in 3 lines, a frameshift mutation by a deletion in 5 lines, complete deletion of the gene region in 7 lines, and no DNA changes throughout the coding region with no gene expression detected in the remaining 5 lines. We found three haplotypes among six-rowed barley revealing loss-of-function mutation of the homeobox gene Vrs1. We found that two of them independently originated from two different type two-rowed barleys, but origin of the remaining one six-rowed allele remained unclear. (author)

  9. Structure and function of the bacterial root microbiota in wild and domesticated barley. (United States)

    Bulgarelli, Davide; Garrido-Oter, Ruben; Münch, Philipp C; Weiman, Aaron; Dröge, Johannes; Pan, Yao; McHardy, Alice C; Schulze-Lefert, Paul


    The microbial communities inhabiting the root interior of healthy plants, as well as the rhizosphere, which consists of soil particles firmly attached to roots, engage in symbiotic associations with their host. To investigate the structural and functional diversification among these communities, we employed a combination of 16S rRNA gene profiling and shotgun metagenome analysis of the microbiota associated with wild and domesticated accessions of barley (Hordeum vulgare). Bacterial families Comamonadaceae, Flavobacteriaceae, and Rhizobiaceae dominate the barley root-enriched microbiota. Host genotype has a small, but significant, effect on the diversity of root-associated bacterial communities, possibly representing a footprint of barley domestication. Traits related to pathogenesis, secretion, phage interactions, and nutrient mobilization are enriched in the barley root-associated microbiota. Strikingly, protein families assigned to these same traits showed evidence of positive selection. Our results indicate that the combined action of microbe-microbe and host-microbe interactions drives microbiota differentiation at the root-soil interface. PMID:25732064

  10. Assessment of genetic diversity in Brazilian barley using SSR markers


    Jéssica Rosset Ferreira; Jorge Fernando Pereira; Caroline Turchetto; Euclydes Minella; Luciano Consoli; Carla Andréa Delatorre


    Abstract Barley is a major cereal grown widely and used in several food products, beverage production and animal fodder. Genetic diversity is a key component in breeding programs. We have analyzed the genetic diversity of barley accessions using microsatellite markers. The accessions were composed of wild and domesticated barley representing genotypes from six countries and three breeding programs in Brazil. A total of 280 alleles were detected, 36 unique to Brazilian barley. The marker Bmag1...

  11. MS Based Imaging of Barley Seed Development

    Institute of Scientific and Technical Information of China (English)

    Manuela Peukert; Andrea Matros; Hans-Peter Mock


    Spatially resolved analysis of metabolites and proteins is essential to model compartmentalized cellular processes in plants.Within recent years,tremendous progress has been made in MS based imaging (MSI) techniques,mostly MALDI MSI.The technology has been pioneered and is now widely applied in medicinal and pharmacological studies,and in recent years found its way into plant science (Kaspar et al.,2011; Peukert etal.,2012).We are interested in the elucidation of spatially resolved metabolic networks related to barley grain development.An understanding of developmentally and ecologically regulated processes affecting agronomical traits such as final grain weight,seed quality and stress tolerance is of outmost importance,as barley provides one of the staple foods.Barley also serves as a model plant for other cereals such as wheat.The presentation will introduce an untargeted MALDI MSI approach to the analysis of me-tabolite patterns during barley grain development.We analyzed longitudinal and cross sections from developing barley grains (3,7,10 and 14 days after pollination).In the presentation we will address spatial resolution,sensitivity and identification of unknown compounds will also be discussed.A major task is to connect the metabolite patterns to distinct cellular and physiological events.As an example,particular metabolite distributions indicative for nutrient transport into the developing endosperm will be shown.

  12. Immigration of the barley mildew pathogen into field plots of barley

    DEFF Research Database (Denmark)

    O'Hara, R.B.; Brown, J.K.M.


    Immigration of the barley powdery mildew pathogen (Erysiphe graminis f.sp. hordei) into field plots of the spring barley variety Tyra (carrying the resistance allele Mla1) was investigated. Spores were trapped from the top of the plot canopies, as well as from control plots of wheat with no barley...... nearby. Comparison of the frequencies of virulent and avirulent single-colony isolates showed that the amount of immigration, relative to the amount of inoculum being produced within the plot, reduced very rapidly, until it could not be detected in the middle of the growing season (mid-June)....

  13. The Genetic Basis of Composite Spike Form in Barley and 'Miracle-Wheat'. (United States)

    Poursarebani, Naser; Seidensticker, Tina; Koppolu, Ravi; Trautewig, Corinna; Gawroński, Piotr; Bini, Federica; Govind, Geetha; Rutten, Twan; Sakuma, Shun; Tagiri, Akemi; Wolde, Gizaw M; Youssef, Helmy M; Battal, Abdulhamit; Ciannamea, Stefano; Fusca, Tiziana; Nussbaumer, Thomas; Pozzi, Carlo; Börner, Andreas; Lundqvist, Udda; Komatsuda, Takao; Salvi, Silvio; Tuberosa, Roberto; Uauy, Cristobal; Sreenivasulu, Nese; Rossini, Laura; Schnurbusch, Thorsten


    Inflorescences of the tribe Triticeae, which includes wheat (Triticum sp. L.) and barley (Hordeum vulgare L.) are characterized by sessile spikelets directly borne on the main axis, thus forming a branchless spike. 'Compositum-Barley' and tetraploid 'Miracle-Wheat' (T. turgidum convar. compositum (L.f.) Filat.) display noncanonical spike-branching in which spikelets are replaced by lateral branch-like structures resembling small-sized secondary spikes. As a result of this branch formation 'Miracle-Wheat' produces significantly more grains per spike, leading to higher spike yield. In this study, we first isolated the gene underlying spike-branching in 'Compositum-Barley,' i.e., compositum 2 (com2). Moreover, we found that COM2 is orthologous to the branched head(t) (bh(t)) locus regulating spike branching in tetraploid 'Miracle-Wheat.' Both genes possess orthologs with similar functions in maize BRANCHED SILKLESS 1 (BD1) and rice FRIZZY PANICLE/BRANCHED FLORETLESS 1 (FZP/BFL1) encoding AP2/ERF transcription factors. Sequence analysis of the bh(t) locus in a collection of mutant and wild-type tetraploid wheat accessions revealed that a single amino acid substitution in the DNA-binding domain gave rise to the domestication of 'Miracle-Wheat.' mRNA in situ hybridization, microarray experiments, and independent qRT-PCR validation analyses revealed that the branch repression pathway in barley is governed through the spike architecture gene Six-rowed spike 4 regulating COM2 expression, while HvIDS1 (barley ortholog of maize INDETERMINATE SPIKELET 1) is a putative downstream target of COM2. These findings presented here provide new insights into the genetic basis of spike architecture in Triticeae, and have disclosed new targets for genetic manipulations aiming at boosting wheat's yield potential. PMID:26156223

  14. Fast neutron mutagenesis in barley

    International Nuclear Information System (INIS)

    Full text: In order to conduct a deletion mutant analysis of the barley genome, seeds of cultivar 'Steptoe' were irradiated in 1992 with two doses of fast neutrons, 3.5 Gy and 4.0 Gy at the FAO/IAEA Seibersdorf SNIF facility by Dr. H. Brunner. M1 seeds were grown at Pullman, Washington, USA in the field. Approximately 500 M2 spikes were picked from each treatment and the remainder harvested in bulk. Mutation rates were determined on 1000 bulk M2 seedlings (chlorophyll deficient) and 500 M2 head rows (chlorophyll deficient and morphological) per treatment. Chlorophyll-deficient mutations were observed at a frequency of 8.1% and 9.4% on M1 spike basis and 2.2% and 2.6% on M2 seedling basis for the 3.5 and 4.0 Gy treatments, respectively. Total mutations observed in the field were 19.0% and 20.8% on M1 spike basis for the two treatments. Approximately 2,500 M2 seedlings were assayed for nitrate reductasedeficient mutants and 12,000 M2 seeds screened for waxy mutants. Although several putative mutants were identified, none have been confirmed to date. The mutation frequencies observed are similar for both treatments and appear to be approximately the same as what we have previously observed with γ-radiation treatments. The absence of nitrate reductase-deficient and waxy mutants is most likely due to the small population size screened. The morphological mutants recovered include dwarfs, sterile, necrotic, glossy, elongated outer glume, winter type and some very interesting floral mutants such as multi-ovary and branched inflorescence. Mutants affecting functions of genes for which cloned DNA segments are available will be sought in order to identify specific molecular changes that have been induced by fast neutron radiation. (author)

  15. Implementation of biochemical screening to improve baking quality of barley

    DEFF Research Database (Denmark)

    Vincze, Éva; Dionisio, Giuseppe; Aaslo, Per;


    Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact...... on the physical chemical properties of the bread products due to the poor baking properties of barley flour. As a consequence, the nutritional advantages of barley are not fully exploited. The inferior leavening and baking properties of barley can, in part, be attributed to the physical properties of the storage...... proteins. Changing the storage protein composition can lessen this problem. Our working hypothesis was that exploiting the substantial genetic variation within the gene pool for storage proteins could enable improving the baking qualities of barley flour. We characterised forty-nine barley cultivars...

  16. Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens


    Wenjun Zha; Xinxin Peng; Rongzhi Chen; Bo Du; Lili Zhu; Guangcun He


    BACKGROUND: RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. METHODOLOGY/PRINCIPAL FINDINGS: The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder s...

  17. Single-cell transcript profiling of barley attacked by the powdery mildew fungus

    DEFF Research Database (Denmark)

    Gjetting, Torben; Hagedorn, Peter; Schweizer, Patrick;


    attacked at the same time may resist fungal penetration. To date, the mixed cellular responses seen even in susceptible host leaves have made it difficult to relate induced changes in gene expression to resistance or susceptibility in bulk leaf samples. By microextraction of cell-specific m......RNA and subsequent cDNA array analysis, we have successfully obtained separate gene expression profiles for specific mildew-resistant and -infected barley cells. Thus, for the first time, it is possible to identify genes that are specifically regulated in infected cells and, presumably, involved in fungal...... establishment. Further, although much is understood about the genetic basis of effective papilla resistance associated with mutant mlo barley, we provide here the first evidence for gene regulation associated with effective papilla-based nonspecific resistance expressed in nominally "susceptible" wild...

  18. Endoproteolytic activity assay in malting barley

    Directory of Open Access Journals (Sweden)

    Blanca Gómez Guerrero


    Full Text Available Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four classes of endo-proteases have been described: serine-proteases, cysteine-proteases, aspartic-proteases and metallo-proteases. The objective of this work was to develop a rapid and colorimetric enzymatic assay to determine the endo-proteolytic activity of the four endo-protease classes using two different substrates: azo-gelatin and azo-casein. Optimum conditions for the assays such as: pH,reaction time and temperature and absorbance scale were determined. Azo-gelatin presented several difficulties in standardizing an “in solution” assay. On the other hand, azo-casein allowed standardization of the assay for the four enzyme classes to produce consistent results. The endo-proteoteolytic method developed was applied to determine the endo-protease activity in barley, malt and wort.

  19. The barley Jip23b gene

    DEFF Research Database (Denmark)

    Müller-Uri, Frieder; Cameron-Mills, Verena; Mundy, John


    The barley gene (Jip23) encoding a 23,000-Da protein of unknown function was isolated and shown to be induced by jasmonate methyl ester (MeJA) in leaves. 5'upstream Jip23 sequence was isolated and fused to the beta-glucuronidase gene (GUS), and this reporter was introduced by particle bombardment...

  20. Adaptation of barley to harsh Mediterranean environments.

    NARCIS (Netherlands)

    Oosterom, van E.


    Research ObjectivesBarley is in Syria the dominant crop in areas receiving less than 300 mm annual precipitation. Grain yield is often below 1 ton ha -1, and is reduced by low temperatures in winter and terminal drought stress in spring. Variation i

  1. Transgenic barley: a prospective tool for biotechnology and agriculture. (United States)

    Mrízová, Katarína; Holasková, Edita; Öz, M Tufan; Jiskrová, Eva; Frébort, Ivo; Galuszka, Petr


    Barley (Hordeum vulgare L.) is one of the founder crops of agriculture, and today it is the fourth most important cereal grain worldwide. Barley is used as malt in brewing and distilling industry, as an additive for animal feed, and as a component of various food and bread for human consumption. Progress in stable genetic transformation of barley ensures a potential for improvement of its agronomic performance or use of barley in various biotechnological and industrial applications. Recently, barley grain has been successfully used in molecular farming as a promising bioreactor adapted for production of human therapeutic proteins or animal vaccines. In addition to development of reliable transformation technologies, an extensive amount of various barley genetic resources and tools such as sequence data, microarrays, genetic maps, and databases has been generated. Current status on barley transformation technologies including gene transfer techniques, targets, and progeny stabilization, recent trials for improvement of agricultural traits and performance of barley, especially in relation to increased biotic and abiotic stress tolerance, and potential use of barley grain as a protein production platform have been reviewed in this study. Overall, barley represents a promising tool for both agricultural and biotechnological transgenic approaches, and is considered an ancient but rediscovered crop as a model industrial platform for molecular farming.

  2. The role of alpha-glucosidase in germinating barley grains. (United States)

    Stanley, Duncan; Rejzek, Martin; Naested, Henrik; Smedley, Mark; Otero, Sofía; Fahy, Brendan; Thorpe, Frazer; Nash, Robert J; Harwood, Wendy; Svensson, Birte; Denyer, Kay; Field, Robert A; Smith, Alison M


    The importance of α-glucosidase in the endosperm starch metabolism of barley (Hordeum vulgare) seedlings is poorly understood. The enzyme converts maltose to glucose (Glc), but in vitro studies indicate that it can also attack starch granules. To discover its role in vivo, we took complementary chemical-genetic and reverse-genetic approaches. We identified iminosugar inhibitors of a recombinant form of an α-glucosidase previously discovered in barley endosperm (ALPHA-GLUCOSIDASE97 [HvAGL97]), and applied four of them to germinating grains. All four decreased the Glc-to-maltose ratio in the endosperm 10 d after imbibition, implying inhibition of maltase activity. Three of the four inhibitors also reduced starch degradation and seedling growth, but the fourth did not affect these parameters. Inhibition of starch degradation was apparently not due to inhibition of amylases. Inhibition of seedling growth was primarily a direct effect of the inhibitors on roots and coleoptiles rather than an indirect effect of the inhibition of endosperm metabolism. It may reflect inhibition of glycoprotein-processing glucosidases in these organs. In transgenic seedlings carrying an RNA interference silencing cassette for HvAgl97, α-glucosidase activity was reduced by up to 50%. There was a large decrease in the Glc-to-maltose ratio in these lines but no effect on starch degradation or seedling growth. Our results suggest that the α-glucosidase HvAGL97 is the major endosperm enzyme catalyzing the conversion of maltose to Glc but is not required for starch degradation. However, the effects of three glucosidase inhibitors on starch degradation in the endosperm indicate the existence of unidentified glucosidase(s) required for this process.

  3. Cloning and characterization of a gibberellin-induced RNase expressed in barley aleurone cells

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, S.W.; Rogers, J.C. (Washington State Univ., Pullman, WA (United States). Inst. of Biological Chemistry)


    The authors cloned a cDNA for a gibberellin-induced ribonuclease (RNase) expressed in barley (Hordeum vulgare) aleurone and the gene for a second barley RNase expressed in leaf tissue. The protein encoded by the cDNA is unique among RNases described to date in that it contains a novel 23-amino acid insert between the C2 and C3 conserved sequences. Expression of the recombinant protein in tobacco (Ncotiana tabacum) suspension-cultured protoplasts gave an active RNase of the expected size, confirming the enzymatic activity of the protein. Analyses of hormone regulation of re-expression of mRNA for the aleurone RNase revealed that, like the pattern for [alpha]-amylase, mRNA levels increased in the presence of gibberellic acid, and its antagonist abscisic acid prevented this effect. Quantitative studies at early times demonstrated that cycloheximide treatment of aleurone layers increased mRNA levels 4-fold, whereas a combination of gibberellin plus cycloheximide treatment was required to increase [alpha]-amylase mRNA levels to the same extent. These results are consistent with loss of repression as an initial effect of gibberellic acid on transcription of those genes, although the regulatory pathways for the two genes may differ.

  4. Barley grain for ruminants: A global treasure or tragedy

    Directory of Open Access Journals (Sweden)

    Nikkhah Akbar


    Full Text Available Abstract Barley grain (Hordeum vulgare L. is characterized by a thick fibrous coat, a high level of ß-glucans and simply-arranged starch granules. World production of barley is about 30 % of that of corn. In comparison with corn, barley has more protein, methionine, lysine, cysteine and tryptophan. For ruminants, barley is the third most readily degradable cereal behind oats and wheat. Due to its more rapid starch fermentation rate compared with corn, barley also provides a more synchronous release of energy and nitrogen, thereby improving microbial nutrient assimilation. As a result, feeding barley can reduce the need for feeding protected protein sources. However, this benefit is only realized if rumen acidity is maintained within an optimal range (e.g., > 5.8 to 6.0; below this range, microbial maintenance requirements and wastage increase. With a low pH, microbial endotoxines cause pro-inflammatory responses that can weaken immunity and shorten animal longevity. Thus, mismanagement in barley processing and feeding may make a tragedy from this treasure or pearl of cereal grains. Steam-rolling of barley may improve feed efficiency and post-rumen starch digestion. However, it is doubtful if such processing can improve milk production and feed intake. Due to the need to process barley less extensively than other cereals (as long as the pericarp is broken, consistent and global standards for feeding and processing barley could be feasibly established. In high-starch diets, barley feeding reduces the need for capacious small intestinal starch assimilation, subsequently reducing hindgut starch use and fecal nutrient loss. With its nutritional exclusivities underlined, barley use will be a factual art that can either matchlessly profit or harm rumen microbes, cattle production, farm economics and the environment.

  5. Genetic Diversity in A Core Subset of Wild Barley Germplasm


    Fu, Yong-Bi; Horbach, Carolee


    Wild barley [Hordeum vulgare ssp. spontaneum (C. Koch) Thell.] is a part of the primary gene pool with valuable sources of beneficial genes for barley improvement. This study attempted to develop a core subset of 269 accessions representing 16 countries from the Plant Gene Resources of Canada (PGRC) collection of 3,782 accessions, and to characterize them using barley simple sequence repeat (SSR) markers. Twenty-five informative primer pairs were applied to screen all samples and 359 alleles ...

  6. Genetic Diversity in A Core Subset of Wild Barley Germplasm


    Yong-Bi Fu; Carolee Horbach


    Wild barley [Hordeum vulgare ssp. spontaneum (C. Koch) Thell.] is a part of the primary gene pool with valuable sources of beneficial genes for barley improvement. This study attempted to develop a core subset of 269 accessions representing 16 countries from the Plant Gene Resources of Canada (PGRC) collection of 3,782 accessions, and to characterize them using barley simple sequence repeat (SSR) markers. Twenty-five informative p...

  7. Dissection of Barley Landraces Originated From Twelve Different


    Sipahi, Hülya; Yumurtacı, Ayşen


    Landraces, as an important source of genetic diversity, are important for improvement of crop species. Investigating of genetic diversity among landraces is necessary to conserve genetic resources and develop future strategies on barley breeding. In this study, genetic diversity in barley landraces originating from twelve countries was studied using simple sequence repeat (SSR) markers. Sixteen SSR markers belong to the seven barley linkage groups revealed high genetic diversity. A total of 9...

  8. Agrobacterium-mediated transformation of barley (Hordeum vulgare L.). (United States)

    Ismagul, Ainur; Mazonka, Iryna; Callegari, Corinne; Eliby, Serik


    Barley biotechnology requires efficient genetic engineering tools for producing transgenic plants necessary for conducting reverse genetics analyses in breeding and functional genomics research. Agrobacterium-mediated genetic transformation is an important technique for producing barley transgenics with simple low-copy number transgenes. This chapter reports a refined protocol for the systematic high-throughput transformation of the advanced Australian spring barley breeding line WI4330.

  9. Changes of Limiting Dextrinase in Germinating Process of Malting Barley

    Institute of Scientific and Technical Information of China (English)

    LIANG Xiu-mei; LI Fen; WANG Hong-zhen; WANG Xing-zhi


    Based on five different species of barley, the foot layer analytic method was used to examine the activity and heat-resistance of the limiting dextrinase. The study was conducted on the dynamic changes of several types of the dextrinase in barley germinating process, the effect of temperature on the dextrinase and the divergence of dextrinase in different barley variety. The probability of the dextrinase that as reference index is used for screening and evaluating beer barley was discussed. The importance of dextrinase in brewing and its significant function was also discussed.

  10. Replication of DNA during barley endosperm development

    DEFF Research Database (Denmark)

    Giese, H.


    The incorporation of [6-H-3]-thymidine into DNA of developing barley end sperm was examined by autoradiography of cross sections of seeds and DNA analysis. The majority of nuclear divisions took place in the very young endosperm, but as late as 25 days after anthesis there was evidence for DNA re...... replication. The DNA content of the endosperm increases during development and in response to nitrogen application in parallel to the storage protein synthesis profile. The hordein genes were hypersensitive to DNase I treatment throughout development.......The incorporation of [6-H-3]-thymidine into DNA of developing barley end sperm was examined by autoradiography of cross sections of seeds and DNA analysis. The majority of nuclear divisions took place in the very young endosperm, but as late as 25 days after anthesis there was evidence for DNA...

  11. Roles of Hydroxynitrile Glucosides in Barley

    DEFF Research Database (Denmark)

    Roelsgaard, Pernille Sølvhøj

    Plants produce an impressive variety of bioactive natural products involved in defense, insect attraction and signaling. These compounds enable the plant to defend itself, communicate with the surroundings and survive in an environment with constant challenges and attackers. This study has focused...... to regulate defense related genes in maize. Barley plants that are gene-silenced in the first step of hydroxynitrile glucoside biosynthesis have been generated to further investigate these results. It appears that hydroxynitrile glucosides in barley have a dual role; up to a certain level Bgh profits from...... the hydroxynitrile glucosides as recognition factors and nutrition compounds. Above this threshold hydroxynitrile glucosides or their breakdown or turn-over products reach toxic levels which lead to a stunted Bgh phenotype and abortion of colonies. A putative ROS quenching role of hydroxynitrile glucosides...

  12. FERTILIZING BREWING BARLEY (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    I. Kádár


    Full Text Available Four levels of N, P and K nutrition (poor, moderate, satisfactory and high and all their possible combinations with 64 treatments in two replications (128 plots were studied in a long term field trial on barley yield and malting quality. A standard East-European spring barley "Opal" (bred in Czechoslovakia was grown in 1986, 13th year of the agricultural experiment, involving various crops in previous years, on a calcareous loamy chernozem soil. The optimum fertility levels for yield enhancement resulted in the poorest malting quality: low modification and extract but long saccharification time and high protein. To solve this problem the brewing industry will have to apply the well-known technological methods available since growers are not likely to give up their fertilizers. Applying soil and plant analysis data, having knowledge about both soil and plant optimum values, the danger of the excessive use of fertilizers can be realized and decreased.

  13. Barley seed proteomics from spots to structures

    DEFF Research Database (Denmark)

    Finnie, Christine; Svensson, Birte


    with information from rice and other cereals facilitate identification of barley proteins. Several hundred barley seed proteins are identified and lower abundance proteins including membrane proteins are now being analysed. In the present review we focus on variation in protein profiles of seed tissues during...... grain filling, maturation, germination and radicle elongation. Cultivar comparisons and genetic mapping of polymorphic protein spots in doubled haploid populations provide a means to link the genome to the proteome and identify proteins that can influence grain quality. Many proteins appear in multiple...... forms on 2D-gels. Specific protein families, including peroxidases and alpha-amylases have been subjected to in-depth analysis resulting in characterisation of different isozymes, post-translational. modifications and processing. A functional proteomics study focusing on the seed thioredoxin system has...

  14. Enhancement of methane production from barley waste


    L. Neves; Ribeiro, R.; Oliveira, Rosário; Alves, M. M.


    Two different approaches were attempted to try and enhance methane production from an industrial waste composed of 100% barley, which results from production of instant coffee substitutes. In previous work, this waste was co-digested with an excess of activated sludge produced in the wastewater treatment plant located in same industrial unit, resulting in a very poor methane yield (25LCH4(STP)/ kgVSinitial), and low reductions in total solids (31%) and in volatile solids (40%). Wh...

  15. Transgenic Wheat, Barley and Oats: Future Prospects (United States)

    Dunwell, Jim M.

    Following the success of transgenic maize and rice, methods have now been developed for the efficient introduction of genes into wheat, barley and oats. This review summarizes the present position in relation to these three species, and also uses information from field trial databases and the patent literature to assess the future trends in the exploitation of transgenic material. This analysis includes agronomic traits and also discusses opportunities in expanding areas such as biofuels and biopharming.

  16. Search for endophytic diazotrophs in barley seeds

    Directory of Open Access Journals (Sweden)

    Myriam S. Zawoznik


    Full Text Available Eight endophytic isolates assigned to Pseudomonas, Azospirillum, and Bacillus genera according to pheno-genotypic features were retrieved from barley seeds under selective pressure for nitrogen-fixers. Genetic relationships among related isolates were investigated through RAPD. Six isolates displayed nitrogen-fixing ability, while all could biosynthesize indolacetic acid in vitro and showed no antibiosis effects against Azospirillum brasilense Az39, a recognized PGPR.

  17. Search for endophytic diazotrophs in barley seeds. (United States)

    Zawoznik, Myriam S; Vázquez, Susana C; Díaz Herrera, Silvana M; Groppa, María D


    Eight endophytic isolates assigned to Pseudomonas, Azospirillum, and Bacillus genera according to pheno-genotypic features were retrieved from barley seeds under selective pressure for nitrogen-fixers. Genetic relationships among related isolates were investigated through RAPD. Six isolates displayed nitrogen-fixing ability, while all could biosynthesize indolacetic acid in vitro and showed no antibiosis effects against Azospirillum brasilense Az39, a recognized PGPR.

  18. Functional Analysis of Barley Powdery Mildew Effector Candidates and Identification of their Barley Targets

    DEFF Research Database (Denmark)

    Ahmed, Ali Abdurehim

    to the cytosol and the nucleus of barley epidermal cells. Furthermore, CSEP0162 and CSEP0254 accumulated in the extrahaustorial matrix in Bgh-infected cells. This implies that their virulence targets may localize in the same cellular compartments. Using yeast two-hybrid screens, two barley small heat shock...... proteins (sHsps), Hsp16.9 and Hsp17.5, were identified as interactors for both CSEP0105 and CSEP0162. These interactions were confirmed in planta by BiFC and co-localization studies. Small heat shock proteins are highly conserved ATP-independent chaperones that protect the cell from stress-induced protein...... into the barley cell cytosol, nucleus and/or extrahaustorial matrix to interfere with the function of small heat shock protein machinery and other defence components to suppress plant immunity....

  19. Effect Of Barley Fibres And Barley Intake On The Ileal Endogenous Nitrogen Losses In Piglets


    Leterme, Pascal; Souffrant, Wb.; Thewis, André


    Ileal endogenous N losses (ENL) were measured, using the 15N isotope dilution technique, in piglets (17 kg) fed different barley genotypes (naked, spring, winter with low/high beta-glucan content) or diets containing 330, 530, 730 or 930 g of a blend of barleys/kg diet. The apparent protein and amino acid digestibilities of the naked variety and the winter variety with a high beta-glucan content were, on average, significantly higher than those for the other two varieties. The ENL were invers...

  20. Cloning and characterization of four B-hordein genes from Tibetan hull-less barley (Hordeum vulgare subsp. vulgare). (United States)

    Han, Zhao-Xue; Qian, Gang; Pan, Zhi-Fen; Deng, Guang-Bing; Wu, Fang; Tang, Ya-Wei; Qiang, Xiao-Lin; Yu, Mao-Qun


    Four B-hordein genes, designated BH1-BH4, were cloned using PCR amplification from two hull-less barley cultivars, ZQ7239 and ZQ148, collected from Tibet. The results of sequencing indicated that BH1-BH4 contained complete open reading frames (ORFs). Comparison of their predicted polypeptide sequences with the published sequences suggested that they all share the same basic protein structure. Phylogenetic analysis indicated that the deduced amino-acid sequences of BH1-BH4 genes were more closely related to B-hordeins from cultivated barley (Hordeum vulgare L.) than to any other prolamins from wild barley and Aegilops tauschii. Comparison of the coding regions of BH1-BH4 genes showed that BH1 had a lower sequence identity to other previously published B-hordeins than the other three B-hordeins obtained in this study. BH1 was then cloned in a bacterial expression vector based on bacteriophage T7 RNA polymerase. The resulting plasmid produced a 28.15 kDa protein in Escherichia coli. The potential value of B-hordein genes in grain quality improvement of hull-less barley has been discussed. PMID:17046594

  1. Expression of Ethylene Biosynthesis Genes in Barley Tissue Culture (United States)

    The plant hormone ethylene influences green plant regeneration rates from barley callus cultures. Our studies have focused on the effects of short treatments of an ethylene inhibitor or an ethylene precursor on green plant regeneration from two barley cultivars and the expression patterns of two eth...

  2. Cytological, genetic and agronomic characterization of a barley reciprocal translocation

    NARCIS (Netherlands)

    Farré Martinez, A.


    Reciprocal translocations (RT) are one of the most common structural chromosomal rearrangements occurring in plant species. Spontaneous RT are extremely uncommon in cultivated barley. In fact, ‘Albacete’ is the only extensively cultivated barley variety known to carry a RT without any ma

  3. Lysine metabolism in antisense C-hordein barley grains

    DEFF Research Database (Denmark)

    Schmidt, Daiana; Rizzi, Vanessa; Gaziola, Salete A;


    The grain proteins of barley are deficient in lysine and threonine due to their low concentrations in the major storage protein class, the hordeins, especially in the C-hordein subgroup. Previously produced antisense C-hordein transgenic barley lines have an improved amino acid composition, with ...

  4. Genetic diversity analysis of Tibetan wild barley using SSR markers. (United States)

    Feng, Zong-Yun; Liu, Xian-Jun; Zhang, Yi-Zheng; Ling, Hong-Qing


    One hundred and six accessions of wild barley collected from Tibet, China, including 50 entries of the two-rowed wild barley Hordeum vulgare ssp. spontaneum (HS), 29 entries of the six-rowed wild barley Hordeum vulgare ssp. agriocrithon (HA), and 27 entries of the six-rowed wild barley Hordeum vulgare ssp. agriocrithon var. lagunculiforme (HL), were analyzed using 30 SSR markers selected from the seven barley linkage groups for studying genetic diversity and evolutionary relationship of the three subspecies of Tibetan wild barley to cultivated barley in China. Over the 30 genetic loci that were studied, 229 alleles were identified among the 106 accessions, of which 70 were common alleles. H. vulgare ssp. spontaneum possesses about thrice more private alleles (2.83 alleles/locus) than HS (0.93 alleles/locus), whereas almost no private alleles were detected in HL. The genetic diversity among-subspecies is much higher than that within-subspecies. Generally, the genetic diversity among the three subspecies is of the order HS > HL > HA. Phylogenetic analysis of the 106 accessions showed that all the accessions of HS and HA was clustered in their own groups, whereas the 27 accessions of HL were separated into two groups (14 entries with group HS and the rest with group HA). This indicated that HL was an intermediate form between HS and HA. Based on this study and previous works, we suggested that Chinese cultivated barley might evolve from HS via HL to HA. PMID:17046592

  5. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.


    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  6. Giemsa C-banding of Barley Chromosomes. IV. Chromosomal Constitution of Autotetraploid Barley

    DEFF Research Database (Denmark)

    Linde-Laursen, Ib


    The progeny of an autotetraploid barley plant (C1) consisted of 45 tetraploids and 33 aneuploids. Giemsa C-banding was used to identify each of the chromosomes in 20 euploid and 31 aneuploid C2--seedlings, and in 11 C3--offspring of aneuploid C2--plants. The euploid C2--seedlings all had four hom...

  7. The International Barley Sequencing Consortium — At the Threshold of Efficient Access to the Barley Genome (United States)

    Sequencing the genome of barley, an agriculturally and industrially important cereal crop and a useful diploid model for bread wheat, has become a realistic undertaking. Important steps have been initiated to improve genomics tools, build and anchor a physical map, develop a high-density genetic ma...

  8. Application of proteomics to investigate barley-Fusarium graminearum interaction

    DEFF Research Database (Denmark)

    Yang, Fen

    proteases which could be responsible for proteolysis of β-amylases in the infected barley. In Chapter 4, the in vitro secretome of F. graminearum on the 2-D gels in the presence of substrates of barley or wheat grain was studied. Totally 69 unique fungal proteins identified were mainly cell......Due to the great loss of barley grain yield and quality in addition to mycotoxins contamination caused by Fusarium head blight (FHB), it is essential to understand the molecular interaction between barley and Fusarium graminearum, one of the primary Fusarium species causing FHB, in order to control...... the disease. Due to the advantages of gel-based proteomics that differentially expressed proteins involved in the interaction can be directly detected by comparing protein profiles displayed on 2-D gels, it is used as a tool for studying the barley- Fusarium graminearum interaction form three different...

  9. Cross-protection among strains of barley yellow dwarf virus. (United States)

    Wen, F; Lister, R M; Fattouh, F A


    ELISA, cDNA dot blot hybridization and transmission by vector aphids were used to investigate the occurrence and degree of cross-protection produced in oat plants by virus isolates representing five strains or serotypes of barley yellow dwarf virus, namely PAV, MAV, SGV, RPV and RMV. Generally, the degree of cross-protection was positively correlated with the serological relatedness between the isolates. A high degree of cross-protection occurred between NY-MAV and MAV-PS1, two isolates of the MAV serotype; cross-protection was moderate between MAV-PS1 and either P-PAV (a Purdue isolate of the PAV serotype) or NY-SGV; cross-protection between P-PAV and NY-SGV was low. Cross-protection did not occur in other paired inoculations and did not persist in some plants, the challenge virus eventually becoming detectable. The persistence of cross-protection depended on the interval between inoculations with protecting and challenge viruses; longer inoculation intervals enhanced the persistence of cross-protection. Results obtained by ELISA and dot blot hybridization were usually consistent, indicating that cross-protection affected both viral capsid and RNA synthesis. PMID:2016594

  10. The Barley Chromosome 5 Linkage Map

    DEFF Research Database (Denmark)

    Jensen, J.; Jørgensen, Jørgen Helms


    The distances between nine loci on barley chromosome 5 have been studied in five two-point tests, three three-point tests, and one four-point test. Our previous chromosome 5 linkage map, which contained eleven loci mapped from literature data (Jensen and Jørgensen 1975), is extended with four loci......-position is fixed on the map by a locus (necl), which has a good marker gene located centrally in the linkage group. The positions of the other loci are their distances in centimorgans from the 0-position; loci in the direction of the short chromosome arm are assigned positive values and those...

  11. Transglycosylation by barley α-amylase 1

    DEFF Research Database (Denmark)

    Mótyán, János A.; Fazekas, Erika; Mori, Haruhide;


    The transglycosylation activity of barley α-amylase 1 (AMY1) and active site AMY1 subsite mutant enzymes was investigated. We report here the transferase ability of the V47A, V47F, V47D and S48Y single mutants and V47K/S48G and V47G/S48D double mutant AMY1 enzymes in which the replaced amino acids...... DP 2, DP 3 and DP 5 were successfully applied to detect activity of Bacillus stearothermophilus maltogenic α-amylase, human salivary α-amylase and Bacillus licheniformis α-amylase, respectively in a fast and simple fluorometric assay....

  12. Implementation of biochemical screening to improve baking quality of barley

    DEFF Research Database (Denmark)

    Vincze, Éva; Dionisio, Giuseppe; Aaslo, Per;


    Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact on the phys......Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact...... proteins. Changing the storage protein composition can lessen this problem. Our working hypothesis was that exploiting the substantial genetic variation within the gene pool for storage proteins could enable improving the baking qualities of barley flour. We characterised forty-nine barley cultivars...... spectrometry (Q-TOF) proved the identity of the HMW proteins and sequencing the digested peptides also revealed possible post translational modifications of the identified HMW hordeins. Our results strongly indicate that the variations in the relative proportions of the storage proteins of barley affect both...

  13. Influence of Temperature on the Extractibility of Polysaccharides in Barley

    Directory of Open Access Journals (Sweden)

    Rodica Căpriţă


    Full Text Available Barley contains substantial amounts of both soluble and insoluble non-starch polysaccharides (NSP. The main watersoluble NSP in barley are highly viscous β-glucans. Monogastric animals, including humans and birds, cannotsynthesize β-glucanase, and the amount of β-glucanase derived from barley grain and bacteria in the gastrointestinaltract is insufficient to completely hydrolyze β-glucans. In the present investigation, we have studied the influence oftemperature and heating time on the extractibility of soluble polysaccharides in barley. Heating the barley samples at60°C and 80°C before extraction has the effect of lowering the soluble fraction of the polysaccharides. The dynamicviscosity values of water extracts from barley decreased up to 21.68% when heating at 60ºC for 15 minutes, and upto 25.30% when heating at 80ºC for 15 minutes, when the determinations were made immediately after extractseparation. Heating the barley samples for 15 minutes at 80°C deactivates the endogenous hydrolytic enzymes.

  14. Barley mutant line with high protein yield

    International Nuclear Information System (INIS)

    Mutation breeding was initiated in 1969 at the Agricultural Research Institute, Nicosia, aiming at developing high yielding barley lines having also high protein or lysine content. The final results were reported at the FAO/IAEA Research Co-ordination Meeting at Nicosia in 1980. At that time some lines were superior to their mother line in grain yield, protein content or protein yield. However, high yield is essential for feed-barley as there is no premium price for protein content or quality. In the experiments reported earlier, the mean grain yield of mutant M-Att-73-337-1 was 3202 kg/ha, 9.9% higher than the mother variety 'Attiki'. The Kjeldahl protein content was 12.7% for the mutant line and 13.4% for the mother variety. The mutant line was further evaluated in field trials (11 m2 plots and 6 replications) during 1983-88, along with other promising material from the breeding programme. The mutant line outyielded its mother variety by 9.7% in grain yield and 16% in straw yield. These increases are apparently the result of increased 1000-grain weight and a higher number of culms per m2. Protein content of the mutant line was slightly lower, but its protein yield was 5.5% higher. The yield of the mutant line over 16 trials during 1983-88 was also 4% higher than the yield of the main commercially grown variety Athenais

  15. Methane emissions from feedlot cattle fed barley or corn diets. (United States)

    Beauchemin, K A; McGinn, S M


    Methane emitted from the livestock sector contributes to greenhouse gas emissions worldwide. Understanding the variability in enteric methane production related to diet is essential to decreasing uncertainty in greenhouse gas emission inventories and to identifying viable greenhouse gas reduction strategies. Our study focused on measuring methane in growing beef cattle fed corn- or barley-based diets typical of those fed to cattle in North American feedlots. The experiment was designed as a randomized complete block (group) design with two treatments, barley and corn. Angus heifer calves (initial BW = 328 kg) were allocated to two groups (eight per group), with four cattle in each group fed a corn or barley diet. The experiment was conducted over a 42-d backgrounding phase, a 35-d transition phase and a 32-d finishing phase. Backgrounding diets consisted of 70% barley silage or corn silage and 30% concentrate containing steam-rolled barley or dry-rolled corn (DM basis). Finishing diets consisted of 9% barley silage and 91% concentrate containing barley or corn (DM basis). All diets contained monensin (33 mg/kg of DM). Cattle were placed into four large environmental chambers (two heifers per chamber) during each phase to measure enteric methane production for 3 d. During the backgrounding phase, DMI was greater by cattle fed corn than for those fed barley (10.2 vs. 7.6 kg/d, P methane emissions (g/d) reported may underestimate those of the feedlot industry. Methane emissions per kilogram of DMI and as a percentage of GE intake were not affected by grain source during the backgrounding phase (24.6 g/kg of DMI; 7.42% of GE), but were less (P methane emissions of cattle fed high-forage backgrounding diets and barley-based finishing diets. Mitigating methane losses from cattle will have long-term environmental benefits by decreasing agriculture's contribution to greenhouse gas emissions. PMID:15705762

  16. Direct RNA sequencing mediated identification of mRNA localized in protrusions of human MDA-MB-231 metastatic breast cancer cells

    DEFF Research Database (Denmark)

    Jakobsen, Kristine Raaby; Sørensen, Emilie; Brøndum, Karin Kathrine;


    localized transcripts represents novel candidates to mediate cancer cell subcellular region specific functions through mRNA direction to protrusions. We included a further characterization of p0071, an armadillo repeat protein of adherence junctions and desmosomes, in MDA-MB-231 and non-metastatic MCF7...

  17. Wheat and barley differently affect porcine intestinal microbiota

    DEFF Research Database (Denmark)

    Weiss, Eva; Aumiller, Tobias; Spindler, Hanns K;


    Diet influences the porcine intestinal microbial ecosystem. Barrows were fitted with ileal T-cannulas to compare short-term effects of eight different wheat or barley genotypes and period-to-period effects on seven bacterial groups in ileal digesta and faeces by qPCR. Within genotypes of wheat.......001) in faeces of barley compared to wheat-fed pigs. Ileal eubacteria, Clostridium cluster IV and Roseburia spp. linearly increased from period 1 to 8 for both cereals (P intestine, with barley increasing...... the Lactobacillus spp.:Enterobacteriaceae ratio, underlining its potential to beneficially manipulate the intestinal microbial ecosystem....


    Directory of Open Access Journals (Sweden)

    T. Sheela


    Full Text Available This study evaluated that effect of prebiotic food containing oligosaccharide to enhance the growth and activity of probiotic strains. Barley grains probioticated using different strains of probiotics are Lactobacillus kefiranofaciens, Candida kefir,and saccharomyces boluradii. To select a suitable prebiotics like inulin for the development of Synbiotic barley and tested for antibacterial activity against diarrhoea causing pathogen such as Esherichia coli, Staphylococcus aureus, Salmonella paratyphi A, Shigella dysenteriae, Vibrio cholerae. Analysis of identified compound from synbiotic barley grain using GC-MS.

  19. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.;


    Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active site...

  20. 核糖核酸干扰%The RNA interference

    Institute of Scientific and Technical Information of China (English)

    孔祥平; LiXing W.Reneker


    The phenomenon of RNA interference (RNAi) is highly conserved mechanism in the organism evolution. As a immune system ,RNAi is a ubiquitous mechanism against invading microorganism in plant and animal cells. Recently, it has been found that RNAi is the process by which double-strand RNA(dsRNA) directs sequence-specific degradation of messenger RNA and the mediations of sequence specific messenger RNA degradation are 21-and 23-nucleotide small interfering RNAs that generate by ribonuclease from endogenous longer dsRNA or by transfectious technics from heterologous dsRNA. Over the past few years, the way in which cells respond to dsRNA by silencing homologous genes has revealed a new regulating paradigm in biology.

  1. Efficient production of tetraploid barley (Hordeum vulgare L.) by colchicine treatment of diploid barley


    Ayed Sourour; Bouharb Ameni; Cherif Mejda


    An experiment was conducted to induce tetraploidy in three diploid barley varieties (Martin, Rihane and Manel) through different colchicines treatments. Colchicine was added for three different concentrations at three different stages of plant development i.e. on seed (0.05% for 48 hours), on pre-germinated seeds (0.1% for 2 hours) and on three leaf stage (0.1% for 16 hours). Colchicine application reduced significantly germination percentage and viability of plants. Seed germinat...

  2. Resistance against barley leaf rust (Puccinia hordei) in West-European spring barley germplasm


    Niks, Rients; Walther, Ursula; Jaiser, Heidi; Martinez, Fernando; Rubiales, Diego


    International audience The level and type of resistance against leaf rust (Puccinia hordei) was determined in modern spring barley germplasm. In field trials all over Europe most accessions were in some locations and years significantly less infected than the moderately resistant reference ,Grit'. Differentiating P. hordei isolates indicated that most accessions carried hypersensitivity (Rph) genes. A virulence survey indicated that among the known resistance genes, only Rph7 is still full...

  3. Effect of phytase supplementation to barley-canola meal and barley-soybean meal diets on phosphorus and calcium balance in growing pigs

    NARCIS (Netherlands)

    Sauer, W.C.; Cervantes, M.; He, J.M.M.; Schulze, H.


    Two metabolism experiments were carried out, to determine the effect of microbial phytase addition to barley-canola meal and barley-soybean meal diets on P and Ca balance in growing. pigs; In experiment 1, six barrows (29.6kg: initial LW) were fed a barley-canola meal diet, without or. with phytase

  4. No effect of 5-fluorouracil on the properties of purified. cap alpha. -amylase from barley half-seeds

    Energy Technology Data Exchange (ETDEWEB)

    Rodaway, S.J.; Kende, H.


    Amylase has been purified from de-embryonated seeds of barley (Horedeum vulgare L. cv. Betzes) which have been incubated on 10/sup 6/M gibberellic acid (GA/sub 3/) following 3 days of imbibition in buffer. Incubation of the half-seeds in up to 10/sup -2/ M 5-fluorouracil (5-FU) during the entire incubation period, including imbibition, had no effect on any of the following characteristics of purified ..cap alpha..-amylase: thermal stability in the absence of calcium, molecular weight of the enzyme, isozyme composition, specific activity, or the amount of ..cap alpha..-amylase synthesized by the aleurone tissue. The synthesis of rRNA and tRNA was strongly inhibited by 5-FU, indicating that the analog had entered the aleurone cells. These results are not in agreement with those of Carlson (Nature New Biology 237: 39-41 (1972)) who found that treatment of barley aleurone with 10/sup -4/ M 5-FU to the addition of GA/sub 3/ resulted in decreased thermal stability of GA/sub 3/-induced ..cap alpha..-amylase and who interpreted this as evidence that the mRNA for ..cap alpha..-amylase was synthesized during the imbibition of the aleurone tissue and independently of gibberellin action. Results of the present experiments indicate that the thermal stability of highly purified ..cap alpha..-amylase is not altered by treatment of barley half-seeds with 5-FU, and that 5-FU cannot be used as a probe to examine the timing of ..cap alpha..-amylase mRNA synthesis.

  5. Barley stripe mosaic virus: Structure and relationship to the tobamoviruses

    International Nuclear Information System (INIS)

    Barley stripe mosaic virus (BSMV) is the type member of the genus Hordeivirus, rigid, rod-shaped viruses in the family Virgaviridae. We have used fiber diffraction and cryo-electron microscopy to determine the helical symmetry of BSMV to be 23.2 subunits per turn of the viral helix, and to obtain a low-resolution model of the virus by helical reconstruction methods. Features in the model support a structural relationship between the coat proteins of the hordeiviruses and the tobamoviruses. - Highlights: • We report a low-resolution structure of barley stripe mosaic virus. • Barley stripe mosaic virus has 23.2 subunits per turn of the viral helix. • We compare barley stripe mosaic virus with tobacco mosaic virus

  6. Barley starch bioengineering for high phosphate and amylose

    DEFF Research Database (Denmark)

    Blennow, Per Gunnar Andreas; Carciofi, Massimiliano; Shaik, Shahnoor Sultana;


    of the three genes encoding the starch-branching enzymes SBEI, SBEIIa, and SBEIIb using a triple RNAi chimeric hairpin construct we generated a virtually amylopectin-free barley. The grains of the transgenic lines were shrunken and had a yield of around 80% of the control line. The starch granules were......Starch is a biological polymer that can be industrially produced in massive amounts in a very pure form. Cereals is the main source for starch production and any improvement of the starch fraction can have a tremendous impact in food and feed applications. Barley ranks number four among cereal...... crops and barley is a genetically very well characterized. Aiming at producing new starch qualities in the cereal system, we used RNAi and overexpression strategies to produce pure amylose and high-phosphate starch, respectively, using the barley kernel as a polymer factory. By simultaneous silencing...

  7. Wheat and barley seed systems in Ethiopia and Syria


    Bishaw, Z.


    Keywords: Wheat,Triticumspp., Barley,Hordeumvulgare L., Seed Systems, Formal Seed Sector, Informal Seed Sector, National Seed Program, Seed Source, Seed Selection, Seed Management, Seed Quality, Genetic Diversity, Ethiopia, SyriaInEthiopiaandSyria, wheat and barley are the two most important principal cereal crops grown since ancient times.Manygenerations of natural and human selection led into highly adapted and diverse populations of local landraces. For most of the history of agriculture, ...

  8. Effects of drought stress on growth and yield of barley


    H. Samarah, Nezar


    International audience Barley (Hordeum vulgare) grown in Mediterranean regions undergoes drought stress during the grain-filling period. A greenhouse experiment was conducted to study the effect of drought stress on grain growth and yield of barley. Plants were exposed to three drought treatments at the beginning of grain filling: (1) well-watered at 100% field capacity, (2) mild drought stress at 60% field capacity, and (3) severe drought stress at 20% field capacity until grain maturity....

  9. Volatile organic compounds released by barley roots attract wireworms


    Barsics, Fanny; Fiers, Marie; Haubruge, Eric; Verheggen, François


    Wireworms are the soil dwelling larvae of click beetles and are pests of many crops worldwide. Alternatives to insecticide treatments are needed in order to develop integrated management strategies. Our work consists in elucidating the role of barley root-emitted volatile organic compounds on the orientation behaviour of Agriotes sordidus wireworms. Using a dual choice olfactometer we have evaluated the attractiveness of a variety of baits ranging from barley roots themselves to isolated root...

  10. Does boron affect hormone levels of barley cultivars?


    Muavviz Ayvaz; Mesut Koyuncu; Avni Guven; FAGERSTEDT, KURT V.


    Background: When mineral nutrients are present in excess or in inadequate amounts, their effects can be severe in plants and can be considered as abiotic stress. In this study, we report how hormonal levels in barley cultivars respond to the toxic effect of boron, an essential plant micronutrient. Material and methods: Two different barley (Hordeum vulgare) cultivars (Vamik Hoca and Efes 98) were used as a study material. Boron was applied in three different concentrations (0, 10, 20 ppm) ...

  11. The Barley Chromosome 5 Linkage Map

    DEFF Research Database (Denmark)

    Jensen, J.; Jørgensen, Jørgen Helms


    The literature is surveyed for data on recombination between loci on chromosome 5 of barley; 13 loci fall into the category “mapped” loci, more than 20 into the category “associated” loci and nine into the category “loci once suggested to be on chromosome 5”. A procedure was developed...... for estimating a linkage map; it involves (1) transformation by the Kosambi mapping function of the available recombination percentages to additive map distances, (2) calculations of a set of map distances from the transformed recombination percentages by a maximum likelihood method in which all the available...... data are utilized jointly, and (3) omission of inconsistent data and determination of the most likely order of the loci. This procedure was applied to the 42 recombination percentages available for the 13 “mapped” loci. Due to inconsistencies 14 of the recombination percentages and, therefore, two...

  12. The spontaneous chlorophyll mutation frequency in barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms; Jensen, Hans Peter


    A total of 1866 barley plants were progeny tested in the greenhouse. Twenty-five plants segregated for newly arisen, spontaneous chlorophyll mutant genes. Among the total of 470,129 seedlings screened there were 79 mutants (1.7 .+-. 0.6 .times. 10-4). The data are added to data from three similar...... materials and the resulting estimate of the chlorophyll mutant frequency is 1.6 .times. 10-4 in about 1.43 million seedlings. The estimate of the chlorophyll mutation rate per generation is close to 67.3 .times. 10-4 per diploid genome or in the order of 6 .times. 10-7 per locus and haploid genome....

  13. Comparative transcriptome profiling of two Tibetan wild barley genotypes in responses to low potassium.

    Directory of Open Access Journals (Sweden)

    Jianbin Zeng

    Full Text Available Potassium (K deficiency is one of the major factors affecting crop growth and productivity. Development of low-K tolerant crops is an effective approach to solve the nutritional deficiency in agricultural production. Tibetan annual wild barley is rich in genetic diversity and can grow normally under poor soils, including low-K supply. However, the molecular mechanism about low K tolerance is still poorly understood. In this study, Illumina RNA-Sequencing was performed using two Tibetan wild barley genotypes differing in low K tolerance (XZ153, tolerant and XZ141, sensitive, to determine the genotypic difference in transcriptome profiling. We identified a total of 692 differentially expressed genes (DEGs in two genotypes at 6 h and 48 h after low-K treatment, including transcription factors, transporters and kinases, oxidative stress and hormone signaling related genes. Meanwhile, 294 low-K tolerant associated DEGs were assigned to transporter and antioxidant activities, stimulus response, and other gene ontology (GO, which were mainly involved in starch and sucrose metabolism, lipid metabolism and ethylene biosynthesis. Finally, a hypothetical model of low-K tolerance mechanism in XZ153 was presented. It may be concluded that wild barley accession XZ153 has a higher capability of K absorption and use efficiency than XZ141 under low K stress. A rapid response to low K stress in XZ153 is attributed to its more K uptake and accumulation in plants, resulting in higher low K tolerance. The ethylene response pathway may account for the genotypic difference in low-K tolerance.

  14. Comparison of barley stripe mosaic virus strains. (United States)

    Hafez, Elsayed E; Abdel Aleem, Engy E; Fattouh, Faiza A


    BSMV (barley stripe mosaic virus) particles were obtained in a pure state from infected host plant tissues of Hordeum vulgare. The three genomic parities (alpha, beta and gamma) were amplified by PCR using specific primers for each particle; each was cloned. Partial sequence of the alpha, beta and gamma segments was determined for the Egyptian isolate of barley stripe mosaic virus (BSMV AE1). Alignment of nucleotide sequences with that of other known strains of the virus, BSMV type strains (CV17, ND18 and China), and the generation of phylogenetic trees was performed. A low level of homology was detected comparing 467 bp of the a and 643 bp of the segments to that of the other strains, and thus BSMV alpha and beta segments were in separate clusters. However, 1154 bp of the gamma segments of BSMV AE1 showed a high level of homology especially to strain BSMV ND18, as they both formed a distinct cluster. Northern blotting of pure BSMV AE1 virus and H. vulgare-infected tissue were compared using an alpha ND18 specific probe. Western blotting using antibodies specific for the coat protein (CP) and the triple gene block 1 (TGB1) protein, which are both encoded by the beta ND18 segment, still indicated a high level of similarity between proteins produced by BSMV ND18 and AE1. We suggest that the BSMV AE1 isolate is a distinct strain of BSMV which reflects the genetic evolutionary divergence among BSMV strains and members of the Hordeivirus group. PMID:18533473

  15. Influence of crop rotation and meteorological conditons on density and biomass of weeds in spring barley (Hordeum vulgare L.)


    Maria Wanic; Magdalena Jastrzębska; Marta K. Kostrzewska


    The paper presents the analysis of changes in weed infestation in spring barley cultivated in the years 1990-2004 in crop rotation with a 25% proportion of this cereal (potato - spring barley - sowing peas - winter triticale), when it was grown after potato, and in crop rotation with its 75% proportion (potato - spring barley - spring barley - spring barley), when it was grown once or twice after spring barley. In the experiment, no weed control was applied. Every year in the spring (at full ...

  16. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    DEFF Research Database (Denmark)

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren;


    Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...... obtained by these techniques are compared between experiments in which differences in growth rates, strains, or stress treatments occur, the normalization procedure may have a significant impact on the results. In this report we present a solution to the normalization problem in RNA slot blotting...

  17. Glycaemic response to barley porridge varying in dietary fibre content. (United States)

    Thondre, Pariyarath S; Wang, Ke; Rosenthal, Andrew J; Henry, Christiani J K


    The interest in barley as a food is increasing worldwide because of its high dietary fibre (DF) content and low glycaemic index (GI). DF in cereals may prove beneficial in improving blood glucose response in the long term. However, a dose-dependent effect of insoluble fibre on reducing postprandial blood glucose levels is yet to be proven. The objective of the present study was to determine the glycaemic response to two barley porridges prepared from whole barley grains varying in fibre content. In two separate non-blind randomised crossover trials, ten human subjects consumed barley porridge with 16 g/100 g and 10 g/100 g fibre content provided in different serving sizes (equivalent to 25 and 50 g available carbohydrate). The glycaemic response to both barley porridges was significantly lower than the reference glucose (P porridges. We concluded that irrespective of the difference in total fibre content or serving size of barley porridges, their GI values did not differ significantly.

  18. Constructing the barley model for genetic transformation in Triticeae

    Institute of Scientific and Technical Information of China (English)

    LÜ Bo; WU Jia-jie; FU Dao-lin


    Barley (Hordeum vulgare L.) is one of the oldest domesticated crops, showing dramatic adaptation to various climate and environmental conditions. As a major cereal crop, barley ranks the 4th after wheat, maize and rice in terms of planting area and production al over the world. Due to its diploid nature, the cultivated barley is considered as an ideal model to study the polyploid wheat and other Triticeae species. Here, we reviewed the development, optimization, and application of transgenic approaches in barley. The most efifcient and robust genetic transformation has been built on the Agrobacterium-mediated transfer in conjunction with the immature embryo-based regeneration. We then discussed future considerations of using more practical technologies in barley transformation, such as the T-DNA/transposon tagging and the genome editing. As a cereal crop amenable to genetic transformation, barley wil serve as the most valuable carrier for global functional genomics in Triticeae and is becoming the most practical model for generating value-added products.

  19. Nitrogen acquisition by pea and barley and the effect of their crop residues on available nitrogen for subsequent crops

    DEFF Research Database (Denmark)

    Jensen, E.S.


    using N-15-labelled residues. Field pea fixed 75% of its N requirement and the N-2 fixation almost balanced the N removed with the seeds. The barley crop recovered 80% of the N-15-labelled fertilizer N supplied and the N in the barley grain corresponded to 80% of the fertilizer N taken up by the crop....... The dry matter production and total N uptake of a spring barley crop following pea or barley, with a period of unplanted soil in the autumn/winter, were significantly higher after pea than after barley. The barley crop following pea and barley recovered 11% of the pea and 8% of the barley residue N...

  20. A high throughput barley stripe mosaic virus vector for virus induced gene silencing in monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Cheng Yuan

    Full Text Available Barley stripe mosaic virus (BSMV is a single-stranded RNA virus with three genome components designated alpha, beta, and gamma. BSMV vectors have previously been shown to be efficient virus induced gene silencing (VIGS vehicles in barley and wheat and have provided important information about host genes functioning during pathogenesis as well as various aspects of genes functioning in development. To permit more effective use of BSMV VIGS for functional genomics experiments, we have developed an Agrobacterium delivery system for BSMV and have coupled this with a ligation independent cloning (LIC strategy to mediate efficient cloning of host genes. Infiltrated Nicotiana benthamiana leaves provided excellent sources of virus for secondary BSMV infections and VIGS in cereals. The Agro/LIC BSMV VIGS vectors were able to function in high efficiency down regulation of phytoene desaturase (PDS, magnesium chelatase subunit H (ChlH, and plastid transketolase (TK gene silencing in N. benthamiana and in the monocots, wheat, barley, and the model grass, Brachypodium distachyon. Suppression of an Arabidopsis orthologue cloned from wheat (TaPMR5 also interfered with wheat powdery mildew (Blumeria graminis f. sp. tritici infections in a manner similar to that of the A. thaliana PMR5 loss-of-function allele. These results imply that the PMR5 gene has maintained similar functions across monocot and dicot families. Our BSMV VIGS system provides substantial advantages in expense, cloning efficiency, ease of manipulation and ability to apply VIGS for high throughput genomics studies.

  1. Search for antisense copies of beta-globin mRNA in anemic mouse spleen

    Directory of Open Access Journals (Sweden)

    Taylor John M


    Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

  2. Efficient production of tetraploid barley (Hordeum vulgare L. by colchicine treatment of diploid barley

    Directory of Open Access Journals (Sweden)

    Ayed Sourour


    Full Text Available An experiment was conducted to induce tetraploidy in three diploid barley varieties (Martin, Rihane and Manel through different colchicines treatments. Colchicine was added for three different concentrations at three different stages of plant development i.e. on seed (0.05% for 48 hours, on pre-germinated seeds (0.1% for 2 hours and on three leaf stage (0.1% for 16 hours. Colchicine application reduced significantly germination percentage and viability of plants. Seed germination was completely inhibited in Martin, while a reduction of 20% and 30% for germination percentage compared to control was recorded in varieties Manel and Rihane, respectively at 0.1% colchicine concentration. Ploidy evaluation showed no tetraploidy in all the three tested varieties by colchicine application of 0.05% for 48 hours on seeds and 0.1% for 2 hours on pre-germinated seeds. However, tetraploid plants were produced only by treatment with 0.1% for 16 hours of seedlings. The percentages of plants were 40%, 44% and 100% for Rihane, Manel and Martin, respectively. Cytological analyses showed the increase of chromosome numbers from 2n=2x=14 to 2n=4x=28. The increase of ploidy levels caused major changes in some morphological traits. In fact, the induced tetraploids in barley was accompanied by significant (P<0.01 decrease in plant height, tiller height, leaf number and leaf length compared to diploid control plants. colchicine treatment induce successfully the production of tetraploid barley plants and could be used in breeding programs.

  3. Analysis of pregerminated barley using hyperspectral image analysis. (United States)

    Arngren, Morten; Hansen, Per Waaben; Eriksen, Birger; Larsen, Jan; Larsen, Rasmus


    Pregermination is one of many serious degradations to barley when used for malting. A pregerminated barley kernel can under certain conditions not regerminate and is reduced to animal feed of lower quality. Identifying pregermination at an early stage is therefore essential in order to segregate the barley kernels into low or high quality. Current standard methods to quantify pregerminated barley include visual approaches, e.g. to identify the root sprout, or using an embryo staining method, which use a time-consuming procedure. We present an approach using a near-infrared (NIR) hyperspectral imaging system in a mathematical modeling framework to identify pregerminated barley at an early stage of approximately 12 h of pregermination. Our model only assigns pregermination as the cause for a single kernel's lack of germination and is unable to identify dormancy, kernel damage etc. The analysis is based on more than 750 Rosalina barley kernels being pregerminated at 8 different durations between 0 and 60 h based on the BRF method. Regerminating the kernels reveals a grouping of the pregerminated kernels into three categories: normal, delayed and limited germination. Our model employs a supervised classification framework based on a set of extracted features insensitive to the kernel orientation. An out-of-sample classification error of 32% (CI(95%): 29-35%) is obtained for single kernels when grouped into the three categories, and an error of 3% (CI(95%): 0-15%) is achieved on a bulk kernel level. The model provides class probabilities for each kernel, which can assist in achieving homogeneous germination profiles. This research can further be developed to establish an automated and faster procedure as an alternative to the standard procedures for pregerminated barley. PMID:21932866

  4. Genetic Diversity in A Core Subset of Wild Barley Germplasm

    Directory of Open Access Journals (Sweden)

    Yong-Bi Fu


    Full Text Available Wild barley [Hordeum vulgare ssp. spontaneum (C. Koch Thell.] is a part of the primary gene pool with valuable sources of beneficial genes for barley improvement. This study attempted to develop a core subset of 269 accessions representing 16 countries from the Plant Gene Resources of Canada (PGRC collection of 3,782 accessions, and to characterize them using barley simple sequence repeat (SSR markers. Twenty-five informative primer pairs were applied to screen all samples and 359 alleles were detected over seven barley chromosomes. Analyses of the SSR data showed the effectiveness of the stratified sampling applied in capturing country-wise SSR variation. The frequencies of polymorphic alleles ranged from 0.004 to 0.708 and averaged 0.072. More than 24% or 7% SSR variation resided among accessions of 16 countries or two regions, respectively. Accessions from Israel and Jordan were genetically most diverse, while accessions from Lebanon and Greece were most differentiated. Four and five optimal clusters of accessions were obtained using STRUCTURE and BAPS programs and partitioned 16.3% and 20.3% SSR variations, respectively. The five optimal clusters varied in size from 15 to 104 and two clusters had only country-specific accessions. A genetic separation was detected between the accessions east and west of the Zagros Mountains only at the country, not the individual, level. These SSR patterns enhance our understanding of the wild barley gene pool, and are significant for conserving wild barley germplasm and exploring new sources of useful genes for barley improvement.

  5. Molecular characterization of barley 3H semi-dwarf genes.

    Directory of Open Access Journals (Sweden)

    Haobing Li

    Full Text Available The barley chromosome 3H accommodates many semi-dwarfing genes. To characterize these genes, the two-rowed semi-dwarf Chinese barley landrace 'TX9425' was crossed with the Australian barley variety 'Franklin' to generate a doubled haploid (DH population, and major QTLs controlling plant height have been identified in our previous study. The major QTL derived from 'TX9425' was targeted to investigate the allelism of the semi-dwarf gene uzu in barley. Twelve sets of near-isogenic lines and a large NILF2 fine mapping population segregating only for the dwarfing gene from 'TX9425' were developed. The semi-dwarfing gene in 'TX9425' was located within a 2.8 cM region close to the centromere on chromosome 3H by fine mapping. Molecular cloning and sequence analyses showed that the 'TX9425'-derived allele contained a single nucleotide substitution from A to G at position 2612 of the HvBRI1 gene. This was apparently the same mutation as that reported in six-rowed uzu barley. Markers co-segregating with the QTL were developed from the sequence of the HvBRI1 gene and were validated in the 'TX9425'/'Franklin' DH population. The other major dwarfing QTL derived from the Franklin variety was distally located on chromosome 3HL and co-segregated with the sdw1 diagnostic marker hv20ox2. A third dwarfing gene, expressed only in winter-sown trials, was identified and located on chromosome 3HS. The effects and interactions of these dwarfing genes under different growing conditions are discussed. These results improve our understanding of the genetic mechanisms controlling semi-dwarf stature in barley and provide diagnostic markers for the selection of semi-dwarfness in barley breeding programs.

  6. Genetic diversity analysis of barley landraces and cultivars in the Shanghai region of China. (United States)

    Chen, Z-W; Lu, R-J; Zou, L; Du, Z-Z; Gao, R-H; He, T; Huang, J-H


    We analyzed the genetic diversity of 115 barley germplasms, including 112 landraces and three new barley cultivars grown in the Shanghai region, using a set of 11 SSR markers. Sixty-six alleles were observed at the 11 SSR loci, ranged from three to ten, with a mean of six alleles per locus. The polymorphism information content ranged from 0.568 to 0.853, with a mean of 0.732, indicating considerable genetic variation in barley in the Shanghai area. Clustering analysis indicated that these barley accessions could be divided into two categories (A and B). Ninety-seven six-rowed barley cultivars were classified in the A category; sixteen two-rowed and two six-rowed barley cultivars were classified in the B category. This demonstrated genetic differences between two-rowed and six-rowed barley varieties. In addition, we found that the three new barley cultivars are closely related. PMID:22535400

  7. Molecular Mechanisms Underlying Hull-Caryopsis Adhesion/Separation Revealed by Comparative Transcriptomic Analysis of Covered/Naked Barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Ruijun Duan


    Full Text Available The covered/naked caryopsis trait of barley is an important agronomic trait because it is directly linked to dietary use. The formation of covered/naked caryopsis is controlled by an NUD transcription factor, which is involved in pericarp cuticle development. However, the molecular mechanism underlying this trait remains so far largely unknown. In this study, comparative transcriptomes of grains three weeks after anthesis of Tibetan Hulless barley landrace Dulihuang and covered barley Morex were analyzed using RNA-seq technique. A total of 4031 differentially expressed genes (DEGs were identified. The Nud gene was overexpressed in Morex, with trace expression in Dulihuang. Among seventeen cuticle related DEGs, sixteen were down regulated and one up regulated in Morex. These results suggest that the Nud gene in covered caryopsis might down regulate cuticle related genes, which may cause a permeable cuticle over pericarp, leading to a hull-caryopsis organ fusion. A functional cuticle covering the pericarp of naked caryopsis might be the result of deletion or low expression level of the Nud gene. The functional cuticle defines a perfect boundary to separate the caryopsis from the hull in naked barley.

  8. The miR9863 family regulates distinct Mla alleles in barley to attenuate NLR receptor-triggered disease resistance and cell-death signaling.

    Directory of Open Access Journals (Sweden)

    Jie Liu


    Full Text Available Barley (Hordeum vulgare L. Mla alleles encode coiled-coil (CC, nucleotide binding, leucine-rich repeat (NB-LRR receptors that trigger isolate-specific immune responses against the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh. How Mla or NB-LRR genes in grass species are regulated at post-transcriptional level is not clear. The microRNA family, miR9863, comprises four members that differentially regulate distinct Mla alleles in barley. We show that miR9863 members guide the cleavage of Mla1 transcripts in barley, and block or reduce the accumulation of MLA1 protein in the heterologous Nicotiana benthamiana expression system. Regulation specificity is determined by variation in a unique single-nucleotide-polymorphism (SNP in mature miR9863 family members and two SNPs in the Mla miR9863-binding site that separates these alleles into three groups. Further, we demonstrate that 22-nt miR9863s trigger the biogenesis of 21-nt phased siRNAs (phasiRNAs and together these sRNAs form a feed-forward regulation network for repressing the expression of group I Mla alleles. Overexpression of miR9863 members specifically attenuates MLA1, but not MLA10-triggered disease resistance and cell-death signaling. We propose a key role of the miR9863 family in dampening immune response signaling triggered by a group of MLA immune receptors in barley.

  9. Towards systems genetic analyses in barley: Integration of phenotypic, expression and genotype data into GeneNetwork

    Directory of Open Access Journals (Sweden)

    Druka Arnis


    Full Text Available Abstract Background A typical genetical genomics experiment results in four separate data sets; genotype, gene expression, higher-order phenotypic data and metadata that describe the protocols, processing and the array platform. Used in concert, these data sets provide the opportunity to perform genetic analysis at a systems level. Their predictive power is largely determined by the gene expression dataset where tens of millions of data points can be generated using currently available mRNA profiling technologies. Such large, multidimensional data sets often have value beyond that extracted during their initial analysis and interpretation, particularly if conducted on widely distributed reference genetic materials. Besides quality and scale, access to the data is of primary importance as accessibility potentially allows the extraction of considerable added value from the same primary dataset by the wider research community. Although the number of genetical genomics experiments in different plant species is rapidly increasing, none to date has been presented in a form that allows quick and efficient on-line testing for possible associations between genes, loci and traits of interest by an entire research community. Description Using a reference population of 150 recombinant doubled haploid barley lines we generated novel phenotypic, mRNA abundance and SNP-based genotyping data sets, added them to a considerable volume of legacy trait data and entered them into the GeneNetwork GeneNetwork is a unified on-line analytical environment that enables the user to test genetic hypotheses about how component traits, such as mRNA abundance, may interact to condition more complex biological phenotypes (higher-order traits. Here we describe these barley data sets and demonstrate some of the functionalities GeneNetwork provides as an easily accessible and integrated analytical environment for exploring them. Conclusion By

  10. Heat shock causes destabilization of specific mRNAs and destruction of endoplasmic reticulum in barley aleurone cells.


    Belanger, F. C.; Brodl, M R; Ho, T H


    In response to a phytohormone, gibberellic acid, the aleurone layers of barley seeds synthesize and secrete alpha-amylases, which are coded by a set of stable mRNAs. When aleurone layers are subjected to heat shock treatment, the synthesis of alpha-amylase is suppressed while heat shock proteins are induced. The suppression of alpha-amylase synthesis is not the result of translational control as reported in several other systems. Rather, the sequences of alpha-amylase mRNA are rapidly degrade...

  11. Addition of Manas barley chromosome arms to the hexaploid wheat genome


    Türkösi, Edina; Cseh, András; Darkó, Éva; Molnár-Láng, Márta


    Background Cultivated barley belongs to the tertiary genepool of hexaploid wheat. Genes of interest can be transferred from barley into wheat through wide hybridization. The application of wheat-barley introgression lines could provide an excellent tool for the transfer of earliness, favourable amino acid composition, biotic stress resistance, abiotic stress tolerance, or good tillering ability into wheat. Results A set of 10 wheat-barley ditelosomic addition lines (2HS, 2HL, 3HS, 3HL, 4HS, 4...

  12. Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics.


    Saghai Maroof, M A; Biyashev, R M; Yang, G P; Zhang, Q.; Allard, R. W.


    This study was undertaken to assess the extent of genetic variation in barley simple sequence repeats (SSRs) and to study the evolutionary dynamics of SSR alleles. SSR polymorphisms were resolved by the polymerase chain reaction with four pairs of primers. In total, 71 variants were observed in a sample of 207 accessions of wild and cultivated barley. Analyses of wheat-barley addition lines and barley doubled haploids identified these variants (alleles) with four loci, each located on a diffe...

  13. Expression Analysis of Ethylene Biosynthesis and Receptor Genes From Barley Embryo and Tissue Culture (United States)

    Ethylene affects regeneration of green plants from barley tissue culture. With the availability of the HarvEST barley database and barley GeneChip, genome-wide expression studies have focused on differential development between Morex and Golden Promise at various stages of plant growth. The data f...

  14. Pearling barley to alter the composition of the raw material before brewing

    NARCIS (Netherlands)

    Donkelaar, van L.H.G.; Noordman, T.R.; Boom, R.M.; Goot, van der A.J.


    Partly replacing malt with unmalted barley is a trend in brewing. The use of unmalted barley, however, leads to issues such as haze and high mash viscosity, due to its higher content of undesired components. Pearling, an abrasive method to remove the outer layers of the barley kernels has been shown

  15. Transgressive segregation for very low and high levels of basal resistance to powdery mildew in barley

    NARCIS (Netherlands)

    Aghnoum, R.; Niks, R.E.


    Basal resistance of barley to powdery mildew is a quantitatively inherited trait that limits the growth and sporulation of barley powdery mildew pathogen by a non-hypersensitive mechanism of defense. Two experimental barley lines were developed with a very high (ErBgh) and low (EsBgh) level of basal

  16. The role of root hairs in cadmium acquisition by barley

    Energy Technology Data Exchange (ETDEWEB)

    Zheng Ruilun; Li Huafen [Key Laboratory of Plant-Soil Interactions of the Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100094 (China); Jiang Rongfeng, E-mail: [Key Laboratory of Plant-Soil Interactions of the Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100094 (China); Roemheld, Volker [Institute of Plant Nutrition, University of Hohenheim, D-70593 Stuttgart (Germany); Zhang Fusuo [Key Laboratory of Plant-Soil Interactions of the Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100094 (China); Zhao Fangjie [Soil Science Department, Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ (United Kingdom)


    The role of root hairs in Cd acquisition from soil was investigated in three pot experiments using a root hairless mutant (bald root barley, brb) and its wild-type (WT) cultivar of barley (Hordeum vulgare). brb had significantly lower concentrations and lower total amounts of Cd in shoots than WT. The Cd uptake efficiency based on total root length was 8-45% lower in brb than in WT. The difference between brb and WT increased with increasing extractable Cd in soil under the experimental conditions used. Additions of phosphate to soil decreased Cd extractability. Both soil and foliar additions of phosphate decreased root length, and root hair formation in WT. These effects resulted in decreased Cd uptake with increasing P supply. Cd uptake in WT correlated significantly with root length, root hair length and density, and soil extractable Cd. Root hairs contribute significantly to Cd uptake by barley. - Research highlights: The Cd uptake efficiency was significantly lower in brb than in WT. Additions of phosphate to soil decreased Cd extractability and Cd uptake. Both soil and foliar additions of phosphate decreased root length, and root hair formation in WT. Root hairs contribute significantly to Cd uptake by barley. - The Cd uptake efficiency based on total root length was 8-45% lower in a barley root hairless mutant than in its wild-type, indicating an important role of root hairs in Cd acquisition.

  17. The project of mutation breeding in barley (first report)

    International Nuclear Information System (INIS)

    Barley is a second main crop with the production of 7 million tons per year and 3,5 million hectare cultivation area in Turkey. Because of wateer deficiency, cereals cultivated in Central Anatolian region. Barley is well adapted to dry farming system besides it is basic food for animal husbandry and main raw material for brewery industry. the main problems in barley production are drought disease epidemic and increasing salinity gradually. Main purposes of our project is to increase resistance and tolerence to this stress factors. In order to reach to our aim we have been using mutation breeding techniques and conventional breeding methods. This Project has been started with irradiation of barley seeds with different gamma ray doses. After that resistant and tolerant mutant has been selected most of these mutanys have resistance and tolerance to different disease and stress conditions. During the selection procedure, hydroponics and tissue culture techniques have been applied to improve the selection efficiency. Up to now, promising barley mutant lines 71 that have earliness (30 days) than parents and because of that reason that escape from drought period. Disease tests of our mutant lines have been conducted under controlled conditions and tolerant lines have been determined under the high the high epidemic conditions. Salt tolerance studies have been applied under hydroponics conditions and salt tolerant mutant have been determined under 180-200mMolNaCl concentration. All mutant lines are carried out to preliminary yield trials for their evaluation

  18. Identification of a phytase gene in barley (Hordeum vulgare L..

    Directory of Open Access Journals (Sweden)

    Fei Dai

    Full Text Available BACKGROUND: Endogenous phytase plays a crucial role in phytate degradation and is thus closely related to nutrient efficiency in barley products. The understanding of genetic information of phytase in barley can provide a useful tool for breeding new barley varieties with high phytase activity. METHODOLOGY/PRINCIPAL FINDINGS: Quantitative trait loci (QTL analysis for phytase activity was conducted using a doubled haploid population. Phytase protein was purified and identified by the LC-ESI MS/MS Shotgun method. Purple acid phosphatase (PAP gene was sequenced and the position was compared with the QTL controlling phytase activity. A major QTL for phytase activity was mapped to chromosome 5 H in barley. The gene controlling phytase activity in the region was named as mqPhy. The gene HvPAP a was mapped to the same position as mqPhy, supporting the colinearity between HvPAP a and mqPhy. CONCLUSIONS/SIGNIFICANCE: It is the first report on QTLs for phytase activity and the results showed that HvPAP a, which shares a same position with the QTL, is a major phytase gene in barley grains.

  19. Breeding of value added barley by mutation and protein engineering

    International Nuclear Information System (INIS)

    Barley has been bred for food, feed and beverages over the past 5000 years by selecting for spontaneous mutations and random hybrids. Crosses with defined parents (since the turn of the century) and induced mutations (since 1927) have provided variability in selecting for novel varieties. Genetic transformation of barley has been a routine procedure since 1994 and permits the introduction of tailored genes for adding quality values to the grain. It complements, but does not replace, existing efficient breeding methods. Radiation and chemically induced mutations, as well as genes introduced by transformation, have to be fitted into the genome, which may take 50 years of breeding effort and testing for agronomic and industrial performance. The mutation breeding strategy for proanthocyanidin free malt barley, which has led to the commercial varieties Caminant and NFC 8808, is presented. As an example of the breeding strategy to improve barley endosperm cell wall degradation, a description is given of the protein engineering of a (1-3, 1-4)-β-glucanase towards heat stability and the insertion of the gene encoding this enzyme by genetic transformation. It is expected that such barley varieties will extend the use of the grain for beverage and feed uses as well as for the production of renewable raw materials by malting and mashing processes. (author). 34 refs, 1 tab

  20. Simulation of in situ Root Decomposition of Two Barley Cultivars

    Institute of Scientific and Technical Information of China (English)

    Xu Jing-gang; Duan Xue-jiao; Nooralla Juma


    Root C and root-released C are closely related to soil organic matter content and mechanistic simulation modeling has proven to be useful for studying root and soil organic C dynamics in plant-soil ecosystems. A computer model was designed in this study to simulate the dynamics of root C and root released C decomposition in situ and the dynamics of different forms of C in soil under two barley cultivars (Abee and Samson). The results showed that on the 15th day, about 48%of the total 14C fixed in roots was respired for Abee and 42%for Samson. This indicated that the turnover rate of root 14C of Abee was higher than that of Samson. The percentage of water-soluble organic 14C, active microbial 14C and stable 14C over the total fixed 14C were not different between two barley cultivars. From the analysis of the model for two barley cultivars, the total 14C transformed into different soil pools (excluding CO2-C and root C pools) for the two barley cultivars was similar (26%for Abee and 25%for Samson), but the difference of 14C remaining in soil between the two barley cultivars was mainly because of the difference of 14C remaining in roots which have not been yet decomposed. Some of the information which could not be measured in the laboratory conditions was obtained in this study.

  1. Assessment of genetic diversity in Brazilian barley using SSR markers. (United States)

    Ferreira, Jéssica Rosset; Pereira, Jorge Fernando; Turchetto, Caroline; Minella, Euclydes; Consoli, Luciano; Delatorre, Carla Andréa


    Barley is a major cereal grown widely and used in several food products, beverage production and animal fodder. Genetic diversity is a key component in breeding programs. We have analyzed the genetic diversity of barley accessions using microsatellite markers. The accessions were composed of wild and domesticated barley representing genotypes from six countries and three breeding programs in Brazil. A total of 280 alleles were detected, 36 unique to Brazilian barley. The marker Bmag120 showed the greatest polymorphism information content (PIC), with the highest mean value found on chromosome three, and the lowest on chromosomes four and six. The wild accessions presented the highest diversity followed by the foreign genotypes. Genetic analysis was performed using Principal Coordinates Analysis, UPGMA clustering, and Bayesian clustering analysis implemented in Structure. All results obtained by the different methods were similar. Loss of genetic diversity has occurred in Brazilian genotypes. The number of alleles detected in genotypes released in 1980s was higher, whereas most of the cultivars released thereafter showed lower PIC and clustered in separate subgroups from the older cultivars. The use of a more diverse panel of genotypes should be considered in order to exploit novel alleles in Brazilian barley breeding programs. PMID:27007902

  2. Assessment of genetic diversity in Brazilian barley using SSR markers

    Directory of Open Access Journals (Sweden)

    Jéssica Rosset Ferreira


    Full Text Available Abstract Barley is a major cereal grown widely and used in several food products, beverage production and animal fodder. Genetic diversity is a key component in breeding programs. We have analyzed the genetic diversity of barley accessions using microsatellite markers. The accessions were composed of wild and domesticated barley representing genotypes from six countries and three breeding programs in Brazil. A total of 280 alleles were detected, 36 unique to Brazilian barley. The marker Bmag120 showed the greatest polymorphism information content (PIC, with the highest mean value found on chromosome three, and the lowest on chromosomes four and six. The wild accessions presented the highest diversity followed by the foreign genotypes. Genetic analysis was performed using Principal Coordinates Analysis, UPGMA clustering, and Bayesian clustering analysis implemented in Structure. All results obtained by the different methods were similar. Loss of genetic diversity has occurred in Brazilian genotypes. The number of alleles detected in genotypes released in 1980s was higher, whereas most of the cultivars released thereafter showed lower PIC and clustered in separate subgroups from the older cultivars. The use of a more diverse panel of genotypes should be considered in order to exploit novel alleles in Brazilian barley breeding programs.

  3. Assessment of genetic diversity in Brazilian barley using SSR markers (United States)

    Ferreira, Jéssica Rosset; Pereira, Jorge Fernando; Turchetto, Caroline; Minella, Euclydes; Consoli, Luciano; Delatorre, Carla Andréa


    Abstract Barley is a major cereal grown widely and used in several food products, beverage production and animal fodder. Genetic diversity is a key component in breeding programs. We have analyzed the genetic diversity of barley accessions using microsatellite markers. The accessions were composed of wild and domesticated barley representing genotypes from six countries and three breeding programs in Brazil. A total of 280 alleles were detected, 36 unique to Brazilian barley. The marker Bmag120 showed the greatest polymorphism information content (PIC), with the highest mean value found on chromosome three, and the lowest on chromosomes four and six. The wild accessions presented the highest diversity followed by the foreign genotypes. Genetic analysis was performed using Principal Coordinates Analysis, UPGMA clustering, and Bayesian clustering analysis implemented in Structure. All results obtained by the different methods were similar. Loss of genetic diversity has occurred in Brazilian genotypes. The number of alleles detected in genotypes released in 1980s was higher, whereas most of the cultivars released thereafter showed lower PIC and clustered in separate subgroups from the older cultivars. The use of a more diverse panel of genotypes should be considered in order to exploit novel alleles in Brazilian barley breeding programs. PMID:27007902

  4. The Genetic Architecture of Barley Plant Stature. (United States)

    Alqudah, Ahmad M; Koppolu, Ravi; Wolde, Gizaw M; Graner, Andreas; Schnurbusch, Thorsten


    Plant stature in temperate cereals is predominantly controlled by tillering and plant height as complex agronomic traits, representing important determinants of grain yield. This study was designed to reveal the genetic basis of tillering at five developmental stages and plant height at harvest in 218 worldwide spring barley (Hordeum vulgare L.) accessions under greenhouse conditions. The accessions were structured based on row-type classes [two- vs. six-rowed] and photoperiod response [photoperiod-sensitive (Ppd-H1) vs. reduced photoperiod sensitivity (ppd-H1)]. Phenotypic analyses of both factors revealed profound between group effects on tiller development. To further verify the row-type effect on the studied traits, Six-rowed spike 1 (vrs1) mutants and their two-rowed progenitors were examined for tiller number per plant and plant height. Here, wild-type (Vrs1) plants were significantly taller and had more tillers than mutants suggesting a negative pleiotropic effect of this row-type locus on both traits. Our genome-wide association scans further revealed highly significant associations, thereby establishing a link between the genetic control of row-type, heading time, tillering, and plant height. We further show that associations for tillering and plant height are co-localized with chromosomal segments harboring known plant stature-related phytohormone and sugar-related genes. This work demonstrates the feasibility of the GWAS approach for identifying putative candidate genes for improving plant architecture. PMID:27446200

  5. In vitro culture in barley breeding

    International Nuclear Information System (INIS)

    One of the most useful biotechnics for plant breeders is in vitro culture of anthers or miscropores to induce haploids and homozygous diploids. High frequency of microspore-derived diploid plants could be produced by culturing anthers on Ficoll medium. The segregation ratios of certain morphological characters were not random and could be shifted by culture conditions. It was reported by a number of authors that true breeding and highly productive genotypes were obtained from microspore-derived diploid plants and doubled haploids derived from bulbosom techniques. There is a great possibility that a selective system for desirable characters can be built in an in vitro culture system. Where haploids can be induced in crop plants, they provide the most rapid technique for producing homozygous lines. Since the genetically controlled factors in homozygous lines are fixed and will be identical in the future generations, it becomes possible for a plant breeder to evaluate quantitative characters such as yield and quality very early in the breeding program. There are two methods which have been used extensively for production of homozygous diploid barley plants. They are bulbosum techniques and anther culture methods. (author). 14 refs, 5 tabs

  6. cDNA, amino acid carbohydrate sequence of barley seed-specific peroxidase BP 1

    DEFF Research Database (Denmark)

    Johansson, A.; Rasmussen, Søren Kjærsgård; Harthill, J.E.;


    The major peroxidase of barley seed BP 1 was characterized. Previous studies showed a low carbohydrate content, low specific activity and tissue-specific expression, and suggested that this basic peroxidase could be particularly useful in the elucidation of the structure-function relationship...... and in the study of the biological roles of plant peroxidases (S.K. Rasmussen, K.G. Welinder and J. Hejgaard (1991) Plant Mol Biol 16: 317-327). A cDNA library was prepared from mRNA isolated from seeds 15 days after flowering. Full-length clones were obtained and showed 3' end length variants, a G + C content...... is the first characterized plant peroxidase which is not blocked by pyroglutamate. BP 1 polymorphism was observed. BP 1 is less than 50% identical to other plant peroxidases which, taken together with its developmentally dependent expression in the endosperm 15-20 days after flowering, suggests a unique...

  7. Origin of worldwide cultivated barley revealed by NAM-1 gene and grain protein content

    Directory of Open Access Journals (Sweden)

    Yonggang eWang


    Full Text Available The origin, evolution and distribution of cultivated barley provides powerful insights into the historic origin and early spread of agrarian culture. Here, population-based genetic diversity and phylogenetic analyses were performed to determine the evolution and origin of barley and how domestication and subsequent introgression have affected the genetic diversity and changes in cultivated barley on a worldwide scale. A set of worldwide cultivated and wild barleys from Asia and Tibet of China were analyzed using the sequences for NAM-1 gene and gene-associated traits-GPC (grain protein content. Our results showed Tibetan wild barley distinctly diverged from Near Eastern barley, and confirmed that Tibet is one of the origin and domestication centers for cultivated barley, and in turn supported a polyphyletic origin of domesticated barley. Comparison of haplotype composition among geographic regions revealed gene flow between Eastern and Western barley populations, suggesting that the Silk Road might have played a crucial role in the spread of genes. The GPC in the 118 cultivated and 93 wild barley accessions ranged from 6.73% to 12.35% with a mean of 9.43%. Overall, wild barley had higher averaged GPC (10.44% than cultivated barley. Two unique haplotypes (Hap2 and Hap7 caused by a base mutations (at position 544 in the coding region of the NAM-1 gene might have a significant impact on the GPC. SNPs and haplotypes of NAM-1 associated with GPC in barley could provide a useful method for screening GPC in barley germplasm. The Tibetan wild accessions with lower GPC could be useful for malt barley breeding

  8. Barley coleoptile peroxidases. Purification, molecular cloning, and induction by pathogens

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Bloch, H.; Rasmussen, Søren Kjærsgård


    from barley coleoptiles. P9.3 and P7.3 had Reinheitszahl values of 3.31 and 2.85 and specific activities (with 2,2'-azino-di-[3-ethyl-benzothiazoline-6-sulfonic acid], pH 5.5, as the substrate) of 11 and 79 units/mg, respectively. N-terminal amino acid sequencing and matrix-assisted laser desorption....../ionization time-of-flight mass-spectrometry peptide analysis identified the P9.3 peroxidase activity as due to Prx7. Tissue and subcellular accumulation of Prx7 was studied using activity-stained isoelectric focusing gels and immunoblotting. The peroxidase activity due to Prx7 accumulated in barley leaves 24 h...... is responsible for the biosynthesis of antifungal compounds known as hordatines, which accumulate abundantly in barley coleoptiles....

  9. Improvement of quinoa and barley through induced mutations and biotechnology

    International Nuclear Information System (INIS)

    The main cropping problems in the Bolivian highlands are the long growing period of barley, high degree of environmental influence on the performance of quinoa, and low soil moisture at sowing time, leading to low germination rate and poor stands, and frost or chilling damages. The program aimed to establish protocols for induction of mutations with X rays and chemical mutagens (NaN3, MNH, EMS) in quinoa, barley, native forage species and forest plants and to obtain mutant lines, especially in barley and quinoa; and to establish callus regeneration in quinoa and micropropagation of kenua (Polilepis). The project is still in its study stages, hence further evaluations are needed before firm conclusions are drawn. (author)

  10. Reactive oxygen species are involved in gibberellin/abscisic acid signaling in barley aleurone cells. (United States)

    Ishibashi, Yushi; Tawaratsumida, Tomoya; Kondo, Koji; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Zheng, Shao-Hui; Yuasa, Takashi; Iwaya-Inoue, Mari


    Reactive oxygen species (ROS) act as signal molecules for a variety of processes in plants. However, many questions about the roles of ROS in plants remain to be clarified. Here, we report the role of ROS in gibberellin (GA) and abscisic acid (ABA) signaling in barley (Hordeum vulgare) aleurone cells. The production of hydrogen peroxide (H2O2), a type of ROS, was induced by GA in aleurone cells but suppressed by ABA. Furthermore, exogenous H2O2 appeared to promote the induction of α-amylases by GA. In contrast, antioxidants suppressed the induction of α-amylases. Therefore, H2O2 seems to function in GA and ABA signaling, and in regulation of α-amylase production, in aleurone cells. To identify the target of H2O2 in GA and ABA signaling, we analyzed the interrelationships between H2O2 and DELLA proteins Slender1 (SLN1), GA-regulated Myb transcription factor (GAmyb), and ABA-responsive protein kinase (PKABA) and their roles in GA and ABA signaling in aleurone cells. In the presence of GA, exogenous H2O2 had little effect on the degradation of SLN1, the primary transcriptional repressor mediating GA signaling, but it promoted the production of the mRNA encoding GAMyb, which acts downstream of SLN1 and involves induction of α-amylase mRNA. Additionally, H2O2 suppressed the production of PKABA mRNA, which is induced by ABA:PKABA represses the production of GAMyb mRNA. From these observations, we concluded that H2O2 released the repression of GAMyb mRNA by PKABA and consequently promoted the production of α-amylase mRNA, thus suggesting that the H2O2 generated by GA in aleurone cells is a signal molecule that antagonizes ABA signaling.



    LaFrance, Jeffrey T.; Watts, Myles J.


    The impact of the protein content of feed barley on the costs of feeding beef, dairy cattle, and swine in Montana is evaluated. A model of least-cost feed rations is constructed to analyze the marginal value of additional protein content in feed barley. The results indicate that increasing the protein content of feed barley above 12% will not substantially increase the value of barley to feeders. This implies that the establishment and maintenance of a protein premium in the feed barley marke...


    Directory of Open Access Journals (Sweden)



    Full Text Available This work is a review of author’s previous publications, unpublished results as well as available literature on barley responses to Cd contamination. The physiological backgrounds of the acute Cd toxicity in barley plants are briefly described. Some data characterizing the chronic Cd toxicity in barley have been also provided in relation to its possible use for seed production and Cd phytoextraction on Cd-contaminated agricultural soils. Information about the main physiological factors limiting growth of Cd-exposed barley plants and grain yield, seedling quality as well as Cd phytoextraction capacity of barley grown in Cd-contaminated soils is presented.

  13. Characterization of the entire cystatin gene family in barley and their target cathepsin L-like cysteine-proteases, partners in the hordein mobilization during seed germination. (United States)

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel


    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds.

  14. Biotin Carboxyl Carrier Protein in Barley Chloroplast Membranes

    DEFF Research Database (Denmark)

    Kannangara, C. G.; Jense, C J


    Biotin localized in barley chloroplast lamellae is covalently bound to a single protein with an approximate molecular weight of 21000. It contains one mole of biotin per mole of protein and functions as a carboxyl carrier in the acetyl-CoA carboxylase reaction. The protein was obtained by solubil......Biotin localized in barley chloroplast lamellae is covalently bound to a single protein with an approximate molecular weight of 21000. It contains one mole of biotin per mole of protein and functions as a carboxyl carrier in the acetyl-CoA carboxylase reaction. The protein was obtained...

  15. TOTAL IMPORTS AND IMPORT PATTERNS OF BARLEY INTO JAPAN: Implications of the 1988 Japanese Beef Market Access Agreement


    Lin, Biing-Hwan; Makus, Larry D.


    A two-stage budgeting procedure was employed to analyze (1) the Japanese import demand for barley and (2) allocation of Japanese barley imports between North America (Canada and the United States) and Australia. It was found that the import demand for barley was price inelastic and corn was a substitute for barley. Japanese barley imports were also influenced by size of the cattle herd and the number of cattle slaughtered. Price competition played a significant role in import allocation and b...

  16. [Influence of breads with use of barley, buckwheat and oat flours and barley flakes on postprandial glycaemia in patients with type 2 diabetes mellitus]. (United States)

    Sharafetdinov, Kh Kh; Gapparov, M M; Plotnikova, O A; Zykina, V V; Shlelenko, L A; Tiurina, O E; Rabotkin, Iu V


    It was investigated the influence of breads with use of barley, buckwheat and oat flours and barley flakes on postprandial glycaemia in patients with type 2 diabetes mellitus. It was shown that consumption of breads with use of barley and buckwheat flours is accompanied less marked postprandial glycaemic reaction in compared with standard loading of carbohydrates (wheat bread). Also it was noted greater increase of postprandial glycaemia in consumption of bread with use of barley flakes in compared with consumption of wheat bread inclusive equivalent amount of carbohydrates. PMID:19999818

  17. Synthesis of SP II albumin, β-amylase and chymotrypsin inhibitor CI-1 on polysomes from the endoplasmic reticulum of barley endosperm

    International Nuclear Information System (INIS)

    Free and initially membrane bound polysomes were isolated from 20 day old endosperms of Bomi and Hiproly barley and used as templates in an in vitro protein synthesizing system based on wheat germ extract. Three 35S--labelled translation products were identified as SP II albumin, β-amylase and chymotrypsin inhibitor CI-1 among the polypeptides synthesized by the polysomes of the endoplasmic reticulum. Identification employed immunoaffinity isolation. Protein Z was not detectable among the in vitro translation products of either initially membrane bound or free endosperm polysomes. Compared to Bomi barley the Hiproly endosperm is enriched for translatable mRNA coding SP II albumin, β-amylase and chymotrypsin inhibitor CI-1. In vitro and in vivo synthesized β-amylases have identical molecular weights. Only one form of SP II albumin is produced in vitro, confirming that the lower molecular weight SP II B albumin is a proteolytic cleavage product of the SP II A albumin. (author)

  18. Nonenzymatic microorganism identification based on ribosomal RNA (United States)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.


    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  19. The plant host can affect the encapsidation of brome mosaic virus (BMV) RNA: BMV virions are surprisingly heterogeneous. (United States)

    Ni, Peng; Vaughan, Robert C; Tragesser, Brady; Hoover, Haley; Kao, C Cheng


    Brome mosaic virus (BMV) packages its genomic and subgenomic RNAs into three separate viral particles. BMV purified from barley, wheat, and tobacco have distinct relative abundances of the encapsidated RNAs. We seek to identify the basis for the host-dependent differences in viral RNA encapsidation. Sequencing of the viral RNAs revealed recombination events in the 3' untranslated region of RNA1 of BMV purified from barley and wheat, but not from tobacco. However, the relative amounts of the BMV RNAs that accumulated in barley and wheat are similar and RNA accumulation is not sufficient to account for the difference in RNA encapsidation. Virions purified from barley and wheat were found to differ in their isoelectric points, resistance to proteolysis, and contacts between the capsid residues and the RNA. Mass spectrometric analyses revealed that virions from the three hosts had different post-translational modifications that should impact the physiochemical properties of the virions. Another major source of variation in RNA encapsidation was due to the purification of BMV particles to homogeneity. Highly enriched BMV present in lysates had a surprising range of sizes, buoyant densities, and distinct relative amounts of encapsidated RNAs. These results show that the encapsidated BMV RNAs reflect a combination of host effects on the physiochemical properties of the viral capsids and the enrichment of a subset of virions. The previously unexpected heterogeneity in BMV should influence the timing of the infection and also the host innate immune responses.

  20. Identifying and characterizing barley genes that protect against trichothecene mycotoxins (United States)

    Fusarium head blight of wheat and barley, caused by the fungal pathogen Fusarium graminearum, is a major disease problem around the world. During infection, trichothecene mycotoxins are produced and act as virulence factors, resulting in reduced grain yield and quality. There are two types of tricho...

  1. Physiological tests for drought tolerance in barley and durum wheat

    International Nuclear Information System (INIS)

    Physiological tests for characterizing drought tolerance in barley (H. vulgare L.) and durum wheat (T. durum L.) were evaluated. These tests involved: 1) germination in osmotic solution (-13 atm by d-mannitol); 2) thermal stress on seedlings (42 deg. C for 5 hours); 3) stability of the cellular membrane under osmotic stress (PEG 6000 at 43%). For both species genotypic variability which was associated with drought tolerance in the field was identified by the laboratory evaluation techniques. Based on these procedures, the two-row barley types were more drought tolerant than six-row types. In durum wheat, only some local populations and some varieties, bred in drought environments, showed high laboratory test values. Weak and not significant correlations were found between the physiological tests indicating that the genetic mechanisms which control these traits may be independent and process-specific. Yield trials, in barley, have been carried out in environments with drought conditions and the correlation between grain and physiological tests were significant. Of the three procedures evaluated in this study, the dry matter increase after a period of thermal stress and electrolyte leakage seemed to be most reliable and potentially useful for screening for drought tolerance in barley and durum wheat. (author). 13 refs, 6 tabs

  2. Implementation of biochemical screening to improve baking quality of Barley

    DEFF Research Database (Denmark)

    Aaslo, Per; Langkilde, Ane; Dionisio, Giuseppe;


    Barley (Hordeum vulgare) is mostly used in feed and malt production but has the ability to provide humans nutritional benefits. The current wheat based “barley” breads can unfortunately not exceed more than 20% barley flour mixed into the dough due to poor leavening properties. Therefore the obje...... modifications of the identified hordein which needs further investigation. Our results strongly indicate genetic variations in the relative proportions of the storage proteins affecting the amino acid compositions and baking quality.......Barley (Hordeum vulgare) is mostly used in feed and malt production but has the ability to provide humans nutritional benefits. The current wheat based “barley” breads can unfortunately not exceed more than 20% barley flour mixed into the dough due to poor leavening properties. Therefore...... the total AA composition and the hordein pattern indicated that there are genetic variations not only in the distributions of the hordein polypeptides but also in the relative proportions of the storage proteins affecting the AA compositions. The free AA composition in the grain may also provide us...

  3. Zinc biofortification of cereals: rice differs from wheat and barley

    NARCIS (Netherlands)

    Stomph, T.J.; Jiang, W.; Struik, P.C.


    In their review, mainly focused on bread wheat (Triticum aestivum), durum wheat (Triticum durum) and barley (Hordeum vulgare), Palmgren et al. 1 M.G. Palmgren et al., Zinc biofortification of cereals: problems and solutions, Trends Plant Sci. 13 (2008), pp. 464–473. Article | PDF (905 K) | View Reco

  4. Reclamation of Sodic-Saline Soils. Barley Crop Response

    Directory of Open Access Journals (Sweden)

    Giovanna Cucci


    Full Text Available The research was aimed at assessing the salinity and sodicity effects of two soil types submitted to correction on barley crop. The two soils, contained in cylindrical pots (0.40 m in size and 0.60 m h supplied with a bottom valve for the collection of drainage water and located under shed to prevent the leaching action of rainfall, were clay-textured and saline and sodic-saline at barley seeding, as they had been cultivated for 4 consecutive years with different herbaceous species irrigated with 9 types of brackish water. In 2002-2003 the 2 salinized and sodium-affected soils (ECe and ESP ranging respectively from 5.84-20.27 dSm-1 to 2.83-11.19%, submitted to correction, were cultivated with barley cv Micuccio, and irrigated with fresh water (ECw = 0.5 dS m-1 and SAR = 0.45 whenever 30% of the maximum soil available moisture was lost by evapotranspiration. Barley was shown to be a salt-tolerant species and did not experience any salt stress when grown in soils with an initial ECe up to 11 dS m-1. When it was grown in more saline soils (initial ECe of about 20 dS m-1, despite the correction, it showed a reduction in shoot biomass and kernel yield by 26% and 36% respectively, as compared to less saline soils.

  5. Wheat and barley seed systems in Ethiopia and Syria

    NARCIS (Netherlands)

    Bishaw, Z.


    Keywords: Wheat,Triticumspp., Barley,Hordeumvulgare L., Seed Systems, Formal Seed Sector, Informal Seed Sector, National Seed Program, Seed Source, Seed Selection, Seed Management, Seed Quality,

  6. Leaf senescence and nutrient remobilisation in barley and wheat

    DEFF Research Database (Denmark)

    Gregersen, P L; Holm, P B; Krupinska, K


    Extensive studies have been undertaken on senescence processes in barley and wheat and their importance for the nitrogen use efficiency of these crop plants. During the senescence processes, proteins are degraded and nutrients are re-mobilised from senescing leaves to other organs, especially the...

  7. A weed suppressive index for spring barley (Hordeum vulgare) varieties

    DEFF Research Database (Denmark)

    Hansen, P K; Kristensen, K; Willas, J


    A screening programme for crop variety competitiveness would ideally be based on only a few, non-destructive measurements of key growth traits. In this study we measured the weed suppressive ability of 79 varieties of spring barley in two ways: (i) directly, by weed coverage assessments under wee...

  8. Cadmium translocation and accumulation in developing barley grains

    DEFF Research Database (Denmark)

    Chen, Fei; Wu, Feibo; Dong, Jing;


     Soil cadmium (Cd) contamination has posed a serious problem for safe food production and become a potential agricultural and environmental hazard worldwide. In order to study the transport of Cd into the developing grains, detached ears of two-rowed barley cv. ZAU 3 were cultured in Cd stressed...

  9. Wheat and barley exposure to nanoceria: Implications for agricultural productivity (United States)

    The impacts of man-made nanomaterials on agricultural productivity are not yet well understood. A soil microcosm study was performed to assess the physiological, phenological, and yield responses of wheat (Triticum aestivum) and barley (Hordeum vulgare L.) exposed to nanoceria (n...

  10. Variation in In Vitro Digestibility of Barley Protein

    DEFF Research Database (Denmark)

    Buchmann, N. B.


    In vitro digestibility of protein was measured with pepsin/pancreatin in 321 spring barley lines grown in the field. The variation in digestibility was far less than the variation in the protein content. A small environmental influence on the digestibility was found. Two entries had slightly...


    DEFF Research Database (Denmark)

    Buchmann, N. B.


    , the field-grown barleys per se differed too little for the accuracy to be confirmed. The other cereals tested, oats, rye, maize, wheat, and rice, gave unsatisfactory results with pepsin/pancreatin, and also with pepsin, pancreatin, or pronase used separately. The ranking of the cereals according to in vitro...

  12. The Role of alpha-Glucosidase in Germinating Barley Grains

    DEFF Research Database (Denmark)

    Stanley, Duncan; Rejzek, Martin; Næsted, Henrik;


    The importance of alpha-glucosidase in the endosperm starch metabolism of barley (Hordeum vulgare) seedlings is poorly understood. The enzyme converts maltose to glucose (Glc), but in vitro studies indicate that it can also attack starch granules. To discover its role in vivo, we took complementa...

  13. The plasma membrane proteome of germinating barley embryos

    DEFF Research Database (Denmark)

    Hynek, Radovan; Svensson, Birte; Jensen, O.N.;


    with amphiphilicity and low abundance of membrane proteins. A fraction enriched in plasma membranes was prepared from embryos dissected from 18 h germinated barley seeds using aqueous two-phase partitioning. Reversed-phase chromatography on C-4 resin performed in micro-spin columns with stepwise elution by 2-propanol...

  14. Dormant barley aleurone shows heterogeneity and a specific cytodifferentiation

    NARCIS (Netherlands)

    Schuurink, R.C.; Bakhuizen, R.; Libbenga, K.R.; Boulanger, F.; Sinjorgo, K.M.C.


    In response to gibberellic acid, aleurone layers isolated from dormant barley (Hordeum distichum L. cv. Triumph) kernels produced significantly less alpha-amylase than aleurones from non-dormant kernels. Light microscopical investigations using the dye acridine orange as well as electron microscopic

  15. Aspects of the barley seed proteome during development and germination

    DEFF Research Database (Denmark)

    Finnie, Christine; Maeda, K.; Østergaard, O.;


    Analysis of the water-soluble barley seed proteome has led to the identification of proteins by MS in the major spots on two-dimensional gels covering the pi ranges 4-7 and 6-11. This provides the basis for in-depth studies of proteome changes during seed development and germination, tissue...

  16. Classification and salt tolerance analysis of barley varieties

    NARCIS (Netherlands)

    Katerji, N.; Hoorn, van J.W.; Hamdy, A.; Mastrorilli, M.; Fares, C.; Ceccarelli, S.; Grando, S.; Oweis, T.


    Six varieties of barley (Hordeum vulgare), five of which were provided by ICARDA, were tested in a green house experiment for their salt tolerance. Afterwards the ICARDA variety Melusine, selected from this experiment for its combination of high yield and salt tolerance, was compared in a lysimeter

  17. 7 CFR 457.118 - Malting barley crop insurance. (United States)


    ... accordance with 7 CFR part 400, subpart G. (b) Approved malting variety. A variety of barley specified as... and Drug Administration when determining concentrations of mycotoxins or other substances or... organization of the United States for substances or conditions, including mycotoxins, that are identified...

  18. Silencing structural and nonstructural genes in baculovirus by RNA interference. (United States)

    Flores-Jasso, C Fabian; Valdes, Victor Julian; Sampieri, Alicia; Valadez-Graham, Viviana; Recillas-Targa, Felix; Vaca, Luis


    We review several aspects of RNAi and gene silencing with baculovirus. We show that the potency of RNAi in Spodoptera frugiperda (Sf21) insect cells correlates well with the efficiency of transfection of the siRNA. Using a fluorescein-labeled siRNA we found that the siRNA localized in areas surrounding the endoplasmic reticulum (ER). Both long (700 nucleotides long) and small ( approximately 25 nucleotides long) interfering RNAs were equally effective in initiating RNA interference (RNAi), and the duration of the interfering effect was indistinguishable. Even though RNAi in Sf21 cells is very effective, in vitro experiments show that these cells fragment the long dsRNA into siRNA poorly, when compared to HEK cells. Finally, we show that in vivo inhibition of baculovirus infection with dsRNA homologous to genes that are essential for baculovirus infectivity depends strongly on the amount of dsRNA used in the assays. Five hundred nanogram of dsRNA directly injected into the haemolymph of insects prevent animal death to over 95%. In control experiments, over 96% of insects not injected with dsRNA or injected with an irrelevant dsRNA died within a week. These results demonstrate the efficiency of dsRNA for in vivo prevention of a viral infection by virus that is very cytotoxic and lytic in animals.

  19. New perspectives on the diversification of the RNA interference system: insights from comparative genomics and small RNA sequencing. (United States)

    Burroughs, Alexander Maxwell; Ando, Yoshinari; Aravind, L


    Our understanding of the pervasive involvement of small RNAs in regulating diverse biological processes has been greatly augmented by recent application of deep-sequencing technologies to small RNA across diverse eukaryotes. We review the currently known small RNA classes and place them in context of the reconstructed evolutionary history of the RNA interference (RNAi) protein machinery. This synthesis indicates that the earliest versions of eukaryotic RNAi systems likely utilized small RNA processed from three types of precursors: (1) sense-antisense transcriptional products, (2) genome-encoded, imperfectly complementary hairpin sequences, and (3) larger noncoding RNA precursor sequences. Structural dissection of PIWI proteins along with recent discovery of novel families (including Med13 of the Mediator complex) suggest that emergence of a distinct architecture with the N-terminal domains (also occurring separately fused to endoDNases in prokaryotes) formed via duplication of an ancestral unit was key to their recruitment as primary RNAi effectors and use of small RNAs of certain preferred lengths. Prokaryotic PIWI proteins are typically components of several RNA-directed DNA restriction or CRISPR/Cas systems. However, eukaryotic versions appear to have emerged from a subset that evolved RNA-directed RNAi. They were recruited alongside RNaseIII domains and RNA-dependent RNA polymerase (RdRP) domains, also from prokaryotic systems, to form the core eukaryotic RNAi system. Like certain regulatory systems, RNAi diversified into two distinct but linked arms concomitant with eukaryotic nucleocytoplasmic compartmentalization. Subsequent elaboration of RNAi proceeded via diversification of the core protein machinery through lineage-specific expansions and recruitment of new components from prokaryotes (nucleases and small RNA-modifying enzymes), allowing for diversification of associating small RNAs. PMID:24311560

  20. iTAG Barley: A 9-12 classroom module to explore gene expression and segregation using Oregon Wolfe Barley (United States)

    The Oregon Wolfe Barleys (OWBs) are a model resource for genetics research and instruction ( ; The population of 94 doubled haploid lines was developed from an F1 of a cross between dominant and reces...

  1. Tocopherols and tocotrienols in barley oil prepared from germ and other fractions from scarification and sieving of hulless barley (United States)

    Two cultivars of hulless barley (Doyce and Merlin), were scarified to abrade the outer layers of the kernels (germ, pericarp, and aleurone). The resulting scarification fines fractions were then separated into four particle size subfractions using sieves. Each of the size subfractions was then extr...

  2. iTAG Barley: A 9-12 curriculum to explore inheritance of traits and genes using Oregon Wolfe barley (United States)

    Segregating plants from the Informative & Spectacular Subset (ISS) of the Oregon Wolfe doubled haploid barley (OWB) population are easily grown on a lighted window bench in the classroom. These lines originate from a wide cross and have exceptionally diverse and dramatic phenotypes, making this an i...

  3. RNA Crystallization (United States)

    Golden, Barbara L.; Kundrot, Craig E.


    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  4. Luteibacter rhizovicinus MIMR1 promotes root development in barley (Hordeum vulgare L.) under laboratory conditions. (United States)

    Guglielmetti, Simone; Basilico, Roberto; Taverniti, Valentina; Arioli, Stefania; Piagnani, Claudia; Bernacchi, Andrea


    In order to preserve environmental quality, alternative strategies to chemical-intensive agriculture are strongly needed. In this study, we characterized in vitro the potential plant growth promoting (PGP) properties of a gamma-proteobacterium, named MIMR1, originally isolated from apple shoots in micropropagation. The analysis of the 16S rRNA gene sequence allowed the taxonomic identification of MIMR1 as Luteibacter rhizovicinus. The PGP properties of MIMR1 were compared to Pseudomonas chlororaphis subsp. aurantiaca DSM 19603(T), which was selected as a reference PGP bacterium. By means of in vitro experiments, we showed that L. rhizovicinus MIMR1 and P. chlororaphis DSM 19603(T) have the ability to produce molecules able to chelate ferric ions and solubilize monocalcium phosphate. On the contrary, both strains were apparently unable to solubilize tricalcium phosphate. Furthermore, the ability to produce 3-indol acetic acid by MIMR1 was approximately three times higher than that of DSM 19603(T). By using fluorescent recombinants of strains MIMR1 and DSM 19603(T), we also demonstrated that both bacteria are able to abundantly proliferate and colonize the barley rhizosphere, preferentially localizing on root tips and in the rhizoplane. Finally, we observed a negative effect of DSM 19603(T) on barley seed germination and plant growth, whereas MIMR1, compared to the control, determined a significant increase of the weight of aerial part (+22 %), and the weight and length of roots (+53 and +32 %, respectively). The results obtained in this work make L. rhizovicinus MIMR1 a good candidate for possible use in the formulation of bio-fertilizers. PMID:23653264

  5. Accumulation of genes for susceptibility to rust fungi for which barley is nearly a nonhost results in two barley lines with extreme multiple susceptibility

    NARCIS (Netherlands)

    Atienza, G.A.; Jafary, H.; Niks, R.E.


    Nonhost resistance is the most common type of resistance in plants. Understanding the factors that make plants susceptible or resistant may help to achieve durably effective resistance in crop plants. Screening of 109 barley (Hordeum vulgare L.) accessions in the seedling stage indicated that barley

  6. Inheritance of microsatellite alleles in pedigrees of Latvian barley varieties and related European ancestors. (United States)

    Sjakste, T G; Rashal, I; Röder, M S


    Genetic diversity and inheritance of 65 microsatellite (SSR) loci were studied in a set of 37 barley varieties involved in the pedigrees of seven Latvian barley varieties: Abava, Agra, Balga, Imula, Linga, Priekulu 1 and Stendes. Cluster analysis divided all the varieties into two large groups according to their geographic distribution. Moravian, Swedish and Danish varieties clustered separately from varieties from Norway and Finland. The pattern of subgroups of both European and Latvian varieties was in accordance with their pedigree information. Graphical genotypes of microsatellite alleles of all seven barley chromosomes were determined for all the 37 varieties studied. Parental inheritance and transmission of microsatellite alleles through the generations of the pedigrees were analysed. The results confirmed the importance and informative value of microsatellite markers for genetic studies in barley and their utility for barley breeding and other applications in fundamental and applied barley genetics. PMID:12589555

  7. Dynamics of molecular evolution and phylogeography of Barley yellow dwarf virus-PAV. (United States)

    Wu, Beilei; Blanchard-Letort, Alexandra; Liu, Yan; Zhou, Guanghe; Wang, Xifeng; Elena, Santiago F


    Barley yellow dwarf virus (BYDV) species PAV occurs frequently in irrigated wheat fields worldwide and can be efficiently transmitted by aphids. Isolates of BYDV-PAV from different countries show great divergence both in genomic sequences and pathogenicity. Despite its economical importance, the genetic structure of natural BYDV-PAV populations, as well as of the mechanisms maintaining its high diversity, remain poorly explored. In this study, we investigate the dynamics of BYDV-PAV genome evolution utilizing time-structured data sets of complete genomic sequences from 58 isolates from different hosts obtained worldwide. First, we observed that BYDV-PAV exhibits a high frequency of homologous recombination. Second, our analysis revealed that BYDV-PAV genome evolves under purifying selection and at a substitution rate similar to other RNA viruses (3.158×10(-4) nucleotide substitutions/site/year). Phylogeography analyses show that the diversification of BYDV-PAV can be explained by local geographic adaptation as well as by host-driven adaptation. These results increase our understanding of the diversity, molecular evolutionary characteristics and epidemiological properties of an economically important plant RNA virus. PMID:21326861

  8. Prowashonupana barley dietary fibre reduces body fat and increases insulin sensitivity in Caenorhabditis elegans model (United States)

    Gao, Chenfei; King, Michael L.; Fitzpatrick, Zachary L.; Wei, Wenqian; King, Jason F.; Wang, Mingming; Greenway, Frank L.; Finley, John W.; Johnson, William D.; Keenan, Michael J.; Enright, Frederick M.; Martin, Roy J.; Zheng, Jolene


    Prowashonupana barley (PWB) is high in β-glucan with moderate content of resistant starch. PWB reduced intestinal fat deposition (IFD) in wild type Caenorhabditis elegans (C. elegans, N2), and in sir-2.1 or daf-16 null mutants, and sustained a surrogate marker of lifespan, pharyngeal pumping rate (PPR), in N2, sir-2.1, daf-16, or daf-16/daf-2 mutants. Hyperglycaemia (2% glucose) reversed or reduced the PWB effect on IFD in N2 or daf-16/daf-2 mutants with a sustained PPR. mRNA expression of cpt-1, cpt-2, ckr-1, and gcy-8 were dose-dependently reduced in N2 or daf-16 mutants, elevated in daf-16/daf-2 mutants with reduction in cpt-1, and unchanged in sir-2.1 mutants. mRNA expressions were increased by hyperglycaemia in N2 or daf-16/daf-2 mutants, while reduced in sir-2.1 or daf-16 mutants. The effects of PWB in the C. elegans model appeared to be primarily mediated via sir-2.1, daf-16, and daf-16/daf-2. These data suggest that PWB and β-glucans may benefit hyperglycaemia-impaired lipid metabolism.

  9. Cultivar and Environmental Variation of β-glucan Content in Chinese Barleys

    Institute of Scientific and Technical Information of China (English)

    CHEN Jin-xin; Zhang Guo-ping; QIANG Xiao-lin; WANG Jun-mei; DING Shou-ren


    β-glucan is a polysaccharide compound closely related to the quality of barley used as malting,feed and food. Low β-glucan content is expected for brewing and feed barley, while high β-glucan content is desirable for food barley. The β-glucan content of barley genotypes collected from various areas of China as well as from Canada and Australia were assayed. Meanwhile a multi-locations trial was conducted to determineβ-glucan content of 10 barley cultivars in 8 locations for two successive planting years. The results showed that barley genotypes from Tibet and Xinjiang had higher β-glucan content and the genotypes with higher than 8%of β-glucan content were detected in Tibet barleys, being valuable for use in the development of healthy food.Barley cultivars being planted now in winter-sowing areas of China had basically the same β-glucan content as those from Canada and Australia. Barley seeds produced in Hangzhou had lower β-glucan content than seeds from the original areas. There was a highly significant difference in β-glucan content among 10 barleys, 8locations and between years. On an average of two years, Xiumei 3 and Kongpei 1 had the highest and lowestβ-glucan content, respectively, and Taian and Hangzhou produced the highest and lowest β-glucan content barley seeds, respectively. Analysis of AMMI model showed that interaction effect between cultivar and environment was highly significant in both experimental years, and was dependent on cuitivar, suggesting that it is important to plant the suitable cultivars in a particular area in order to obtain barley seeds with reasonableβ-glucan content.

  10. Effects of a Dietary Supplement with Barley Sprout Extract on Blood Cholesterol Metabolism


    A Ri Byun; Hyejin Chun; Jin Lee; Sang Wha Lee; Hong Soo Lee; Kyung Won Shim


    Objective. Barley sprout (Hordeum vulgare L.) contains 4.97% fat, 52.6% polysaccharide, and 34.1% protein along with a variety of vitamins, minerals, and polyphenolic compounds. Hexacosanol is one such compound from the barley leaf that might improve cholesterol metabolism by decreasing cholesterol synthesis. Method. Therefore, this study was conducted to investigate the effects of barley sprout extract on serum lipid metabolism in healthy volunteers (n = 51). Subjects were randomly divided i...

  11. Compared cycling in a soil-plant system of pea and barley residue nitrogen

    DEFF Research Database (Denmark)

    Jensen, E.S.


    Field experiments were carried out on a temperate soil to determine the decline rate, the stabilization in soil organic matter and the plant uptake of N from N-15-labelled crop residues. The fate of N from field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) residues was followed...... initial decomposition of residues was remineralized later in the barley than in the pea residue treatment. Balances were established for the amounts of barley and mature pea residue N remaining in the 0-10 cm soil layer and taken up in ryegrass after 2 years of decomposition. About 24% of the barley...

  12. Genotypic and Environmental Variations of Arabinoxylan Content and Endoxylanase Activity in Barley Grains

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xiao-qin; XUE Da-wei; WU Fei-bo; ZHANG Guo-ping


    Arabinoxylan (AX) content in barley grains is an important quality determinant when barley is used as raw material of malt or beer production. The cultivar and environmental variations of total arabinoxylan (TAX), water extractable arabinoxylan (WEAX) and endoxylanase activity (EA) were investigated using eight barley cultivars growing at seven locations with diverse environmental conditions. The results showed that both barley cultivar and location significantly affected the TAX, WEAX and EA levels, but the variations of TAX content and EA were mainly attributed to cultivar, while the impact of location on WEAX content was greater than that of cultivar. Correlation analysis indicated that TAX was significantly correlated to WUAX.

  13. Assessment of the Seedling Reactions of Some Hulless Barley Genotypes to Drechslera teres f. maculata


    Gerlegiz, Emine Tuba; KARAKAYA, Aziz; Celik Oguz, Arzu; MERT, Zafer; Sayim, İsmail; Ergun, Namuk; Aydogan, Sinan


    The seedling reactions of three barley cultivars, one hulless barley cultivar, two candidate hulless barley lines and nine hulless barley genotypes were determined under greenhouse conditions to ten isolates of Drechslera teres f. maculata, the causal agent of spot form of net blotch. Isolates were obtained from Ankara, Çankırı, Eskişehir, Kayseri, Konya and Şanlıurfa provinces. The reactions of the cultivars and hulless cultivar ranged between suscepible-resistant. The reactions of the hulle...

  14. Barley Sprouts Extract Attenuates Alcoholic Fatty Liver Injury in Mice by Reducing Inflammatory Response (United States)

    Lee, Yun-Hee; Kim, Joung-Hee; Kim, Sou Hyun; Oh, Ji Youn; Seo, Woo Duck; Kim, Kyung-Mi; Jung, Jae-Chul; Jung, Young-Suk


    It has been reported that barley leaves possess beneficial properties such as antioxidant, hypolipidemic, antidepressant, and antidiabetic. Interestingly, barley sprouts contain a high content of saponarin, which showed both anti-inflammatory and antioxidant activities. In this study, we evaluated the effect of barley sprouts on alcohol-induced liver injury mediated by inflammation and oxidative stress. Raw barley sprouts were extracted, and quantitative and qualitative analyses of its components were performed. The mice were fed a liquid alcohol diet with or without barley sprouts for four weeks. Lipopolysaccharide (LPS)-stimulated RAW 264.7 cells were used to study the effect of barley sprouts on inflammation. Alcohol intake for four weeks caused liver injury, evidenced by an increase in serum alanine aminotransferase and aspartate aminotransferase activities and tumor necrosis factor (TNF)-α levels. The accumulation of lipid in the liver was also significantly induced, whereas the glutathione (GSH) level was reduced. Moreover, the inflammation-related gene expression was dramatically increased. All these alcohol-induced changes were effectively prevented by barley sprouts treatment. In particular, pretreatment with barley sprouts significantly blocked inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2 expression in LPS-stimulated RAW 264.7. This study suggests that the protective effect of barley sprouts against alcohol-induced liver injury is potentially attributable to its inhibition of the inflammatory response induced by alcohol. PMID:27455313

  15. Archaeogenetic evidence of ancient nubian barley evolution from six to two-row indicates local adaptation.

    Directory of Open Access Journals (Sweden)

    Sarah A Palmer

    Full Text Available BACKGROUND: Archaeobotanical samples of barley (Hordeum vulgare L. found at Qasr Ibrim display a two-row phenotype that is unique to the region of archaeological sites upriver of the first cataract of the Nile, characterised by the development of distinctive lateral bracts. The phenotype occurs throughout all strata at Qasr Ibrim, which range in age from 3000 to a few hundred years. METHODOLOGY AND FINDINGS: We extracted ancient DNA from barley samples from the entire range of occupancy of the site, and studied the Vrs1 gene responsible for row number in extant barley. Surprisingly, we found a discord between the genotype and phenotype in all samples; all the barley had a genotype consistent with the six-row condition. These results indicate a six-row ancestry for the Qasr Ibrim barley, followed by a reassertion of the two-row condition. Modelling demonstrates that this sequence of evolutionary events requires a strong selection pressure. CONCLUSIONS: The two-row phenotype at Qasr Ibrim is caused by a different mechanism to that in extant barley. The strength of selection required for this mechanism to prevail indicates that the barley became locally adapted in the region in response to a local selection pressure. The consistency of the genotype/phenotype discord over time supports a scenario of adoption of this barley type by successive cultures, rather than the importation of new barley varieties associated with individual cultures.

  16. Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    Directory of Open Access Journals (Sweden)

    Nilsson Lena


    Full Text Available Abstract Background Gene silencing vectors based on Barley stripe mosaic virus (BSMV are used extensively in cereals to study gene function, but nearly all studies have been limited to genes expressed in leaves of barley and wheat. However since many important aspects of plant biology are based on root-expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species have created a need for tools to study gene function in these species. Results Here we demonstrate the successful BSMV-mediated virus induced gene silencing (VIGS of three different genes in barley roots, i.e. the barley homologues of the IPS1, PHR1, and PHO2 genes known to participate in Pi uptake and reallocation in Arabidopsis. Attempts to silence two other genes, the Pi transporter gene HvPht1;1 and the endo-β-1,4-glucanase gene HvCel1, in barley roots were unsuccessful, probably due to instability of the plant gene inserts in the viral vector. In B. distachyon leaves, significant silencing of the PHYTOENE DESATURASE (BdPDS gene was obtained as shown by photobleaching as well as quantitative RT-PCR analysis. On the other hand, only very limited silencing of the oat AsPDS gene was observed in both hexaploid (A. sativa and diploid (A. strigosa oat. Finally, two modifications of the BSMV vector are presented, allowing ligation-free cloning of DNA fragments into the BSMV-γ component. Conclusions Our results show that BSMV can be used as a vector for gene silencing in barley roots and in B. distachyon leaves and possibly roots, opening up possibilities for using VIGS to study cereal root biology and to exploit the wealth of genome information in the new cereal model plant B. distachyon. On the other hand, the silencing induced by BSMV in oat seemed too

  17. Epigenome Editing of Potato by Grafting Using Transgenic Tobacco as siRNA Donor. (United States)

    Kasai, Atsushi; Bai, Songling; Hojo, Hatsune; Harada, Takeo


    In plants, it is possible to induce heritable transcriptional gene silencing (TGS) via RNA-directed DNA methylation (RdDM) using artificially synthesized small RNA (siRNA) homologous to the 5'-flanking region of the target gene. As the siRNA signal with a specific RNA determinant moves through plasmodesmata and sieve elements, we attempted to induce TGS of a transgene and an endogenous gene of potato (Solanum tuberosum) rootstock by grafting using siRNA produced in a tobacco (Nicotiana benthamiana) scion. Our results provide evidence that this system can induce TGS of target genes in tubers formed on potato rootstock. The TGS is maintained in the progeny tubers lacking the transported siRNAs. Our findings reveal that epigenome editing using mobile RNA has the potential to allow breeding of artificial sport cultivars in vegetative propagation crops. PMID:27564864

  18. The promoter of the barley aleurone-specific gene encoding a putative 7 kDa lipid transfer protein confers aleurone cell-specific expression in transgenic rice. (United States)

    Kalla, R; Shimamoto, K; Potter, R; Nielsen, P S; Linnestad, C; Olsen, O A


    This paper describes the aleurone-specific gene Ltp2 from barley, which encodes a putative 7 kDa non-specific lipid transfer protein. As shown by Northern and in situ hybridization analyses, the Ltp2 transcript is present in barley aleurone cells shortly after the initiation of aleurone cell differentiation. The expression of Ltp2 increases until grain mid-maturity, but the mRNA is absent from mature grains. The Ltp2 transcript is undetectable in the embryo and vegetative tissues, confirming the aleurone specificity of the Ltp2 gene. The ability of the isolated 801 bp Ltp2 promoter to direct aleurone-specific expression in immature barley grains is demonstrated by particle bombardment experiments. In these experiments, the activity of the Ltp2 promoter is 5% of the activity of the strong constitutive Actin1 promoter from rice, as quantified by GUS activity measurements. In stably transformed rice plants containing the Ltp2 promoter-Gus construct, the specificity of the Ltp2 promoter is confirmed in vivo by the presence of GUS activity exclusively in the aleurone layer. This study demonstrates the conserved nature of the regulatory signals involved in aleurone-specific gene transcription in cereal grains.

  19. Suppression of Zn stress on barley by irradiated chitosan

    Energy Technology Data Exchange (ETDEWEB)

    Nagasawa, N.; Mitomo, H. [Gunma Univ., Faculty of Engineering, Department of Biological and Chemical Engineering, Kiryu, Gunma (Japan); Ha, P.T.L. [Nuclear Research Institute, Dalat (Viet Nam); Watanabe, S.; Ito, T.; Takeshita, H.; Yoshii, F.; Kume, T. [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment


    Chitosan was irradiated up to 1000 kGy in solid state. Irradiation of chitosan caused the reduction of molecular weight. The molecular weight of the chitosan reduced from ca. 4 x 10{sup 5} to ca. 6 x 10{sup 3} by irradiation at 1000 kGy. For the barley growth promotion, irradiated chitosan showed the significant effect and 1000 kGy irradiated chitosan improved 20% of growth. Using the positron emitting tracer imaging system (PETIS), the effect of chitosan on uptake and transportation of {sup 62}Zn in barley were investigated. It was found that the transportation of Zn from root to shoot and the damage of plant by Zn were suppressed with irradiated chitosan. (author)

  20. Resistance in winter barley against Ramularia leaf spot

    DEFF Research Database (Denmark)

    Hjortshøj, Rasmus Lund

    Ramularia leaf spot is an emerging disease in barley caused by R. collo-cygni. At present little is known about the resistance mechanisms carried out by the host plant to avoid disease development. Nor is the lifecycle of the fungus or its populations structure fully understood. To gain insight....... fulvum-tomato and S. tritici-wheat in order to find modelsystems to enhance interpretation of results from R. collo-cygni-barley interaction. Results from the mapping showed that resistance to Ramularia leaf spot is controlled by a number of QTL’s, some of which co-locate with other physiological traits....... The populations further segregated for physiological leaf spots, a phenomenon related to the leaf damage imposed by Rubellin, although, resistance to physiological leafspots appeared to come from the Ramularia leaf spot susceptible parent. The toxin assay further supported this result as the genotypes susceptible...

  1. Suppression of Zn stress on barley by irradiated chitosan

    International Nuclear Information System (INIS)

    Chitosan was irradiated up to 1000 kGy in solid state. Irradiation of chitosan caused the reduction of molecular weight. The molecular weight of the chitosan reduced from ca. 4 x 105 to ca. 6 x 103 by irradiation at 1000 kGy. For the barley growth promotion, irradiated chitosan showed the significant effect and 1000 kGy irradiated chitosan improved 20% of growth. Using the positron emitting tracer imaging system (PETIS), the effect of chitosan on uptake and transportation of 62Zn in barley were investigated. It was found that the transportation of Zn from root to shoot and the damage of plant by Zn were suppressed with irradiated chitosan. (author)

  2. Effect of ozone pretreatment on hydrogen production from barley straw. (United States)

    Wu, Jiangning; Ein-Mozaffari, Farhad; Upreti, Simant


    Application of ozone technology to lignocellulosic biohydrogen production was explored with a barley straw. Ozone pretreatment effectively degraded the straw lignin and increased reducing sugar yield. A simultaneous enzyme hydrolysis and dark fermentation experiment was conducted using a mixed anaerobic consortium together with saccharification enzymes. Both untreated and ozonated samples produced hydrogen. Compared to the untreated group, hydrogen produced by the groups ozonated for 15, 30, 45 and 90 min increased 99%, 133%, 166% and 94%, respectively. Some inhibitory effect on hydrogen production was observed with the samples ozonated for 90 min, and the inhibition was on the fermentative microorganisms, not the saccharification enzymes. These results demonstrate that production of biohydrogen from barley straw, a lignocellulosic biomass, can be significantly enhanced by ozone pretreatment.

  3. Study of fluorescence quenching of Barley α-amylase (United States)

    Bakkialakshmi, S.; Shanthi, B.; Bhuvanapriya, T.


    The fluorescence quenching of Barley α-amylase by acrylamide and succinimide has been studied in water using steady-state and time-resolved fluorescence techniques. The steady-state fluorescence quenching technique has been performed in three different pHs (i.e., 6, 7 and 8) of water. Ground state and excited state binding constants (Kg &Ke) have been calculated. From the calculated binding constants (Kg &Ke) the free energy changes for the ground (ΔGg) and excited (ΔGe) states have been calculated and are presented in tables. UV and FTIR spectra have also been recorded to prove the binding of Barley α-amylase with acrylamide and succinimide.

  4. Low GI Food with Barley in Space Foods (United States)

    Katayama, Naomi; Sugimoto, Manabu; Hashimoto, Hirofumi; Kihara, Makoto; Yamashita, Masamichi; Space Agriculture Task Force

    The construction of the life-support system to perform space, moon base, Mars emigration is demanded. The space foods will play a very important role of life support on this occasion. Particularly, in environment of the microgravity, our metabolism becomes less than the face of the Earth. The management of the blood sugar level is very important. We need to eat the meal which will be rise in blood sugar level slowly. The barley which includes much water-soluble dietary fibers is helpful to make low GI space food. After eating 30% barley with unpolished rice, blood sugar level was rise slowly. The cooking process is very important to our body in thinking about digestion and absorption. Soft foods, long-heated foods and grind-foods are easy to digest. After eating these-foods, our blood sugar level will rise, easily. We introduce the space foods with 30% wheat that the blood sugar level is hard to rising.

  5. Hydrothermal liquefaction of barley straw to bio-crude oil

    DEFF Research Database (Denmark)

    Zhu, Zhe; Rosendahl, Lasse; Toor, Saqib;


    Hydrothermal liquefaction (HTL) of barley straw with K2CO3 at different temperatures (280–400 C) was conducted and compared to optimize its process conditions; the aqueous phase as a co-product from this process was recycled to explore the feasibility of implementing wastewater reuse for bio......, and reached 38.4 wt% after three cycles. The HHVs of bio-crude oil from HTL with aqueous phase were 28.4–29.4 MJ/kg, slightly higher than those from HTL with fresh water. While no obvious differences in elemental distribution can be found after aqueous phase recirculation. In conclusion, this study gives...... a detailed insight into the HTL behavior of barley straw, and offers potential opportunities and benefits for bio-crude oil production through the reuse of aqueous phase....

  6. Analysis of Pregerminated Barley Using Hyperspectral Image Analysis

    DEFF Research Database (Denmark)

    Arngren, Morten; Hansen, Per Waaben; Eriksen, Birger;


    imaging system in a mathematical modeling framework to identify pregerminated barley at an early stage of approximately 12 h of pregermination. Our model only assigns pregermination as the cause for a single kernel’s lack of germination and is unable to identify dormancy, kernel damage etc. The analysis...... is based on more than 750 Rosalina barley kernels being pregerminated at 8 different durations between 0 and 60 h based on the BRF method. Regerminating the kernels reveals a grouping of the pregerminated kernels into three categories: normal, delayed and limited germination. Our model employs a supervised...... classification framework based on a set of extracted features insensitive to the kernel orientation. An out-of-sample classification error of 32% (CI95%: 29–35%) is obtained for single kernels when grouped into the three categories, and an error of 3% (CI95%: 0–15%) is achieved on a bulk kernel level. The model...

  7. Microbes in the tailoring of barley malt properties


    Laitila, Arja


    Microbes have a decisive role in the barley-malt-beer chain. A major goal of this thesis was to study the relationships between microbial communities and germinating grains during malting. Furthermore, the study provided a basis for tailoring of malt properties with natural, malt-derived microbes. The malting ecosystem is a dynamic process, exhibiting continous change. The first hours of steeping and kilning were the most important steps in the process with regard to microbiological qual...

  8. Nutritional assessment of barley, talbina and their germinated products

    Directory of Open Access Journals (Sweden)

    Mohamed kamal El-Sayed Youssef


    Full Text Available Talbina is a food product with high potential applications as a functional food. Talbina was prepared from two barley varieties namely: Giza126 and Giza130 by adding whole barley flour to water (1:10 w/v and (1:5 w/v for germinated barley then heating at  80° C for 5 minutes with continuous stirring until reaching a porridge like texture. The present investigation was carried out in an attempt to clearly the nutritional assessment of talbina as a functional food. The study included the determination of gross chemical composition, caloric value, mineral composition, vitamins composition and the amino acids composition. Meanwhile, computation of the chemical scores (CS and A/E ratios were carried out for raw, germinated barley, talbina, germinated talbina and commercial talbina. The data revealed that protein content of the all raw studied and processing treatments ranged from 8.75-18.34g/100g on dry weight basis. Besides, the all treatments recorded rather slight decrease in crude fat content. Likewise, ash and carbohydrates ranged between 2.29-2.86 and 73.40-82.66%, respectively. Whereas crude fiber had an increase after treatments and it ranged from 3.83-4.37%. On the other hand by making talbina iron, manganese, copper and zinc increased especially zinc, which recorded higher value than that recommended daily. Furthermore, germinated talbina130 recorded the highest amounts of vitamins B2, Nicotinic acid, B6 and folic acid. Moreover, the present study indicated that phenylalanine was the highest essential amino acid, followed by leucine.



    I.G. Shirokikh; S.Yu. Ogorodnikova; O.N. Shupletsova; I.N. Shchennikova


    In barley callus culture on acid selective media with aluminum the authors selected the resistant lines, from which the regenerated plants were obtained. During a growing on acid sod-podzol soil the seed progeny of regenerated lines was compared with initial varieties on biochemical parameters, on determinants of productivity and yield. It was revealed, that hereditable in regenerated progeny the determinants of somaclonal variability can be used for creation of high productive and resistant ...

  10. Drivers of Phosphorus Uptake by Barley Following Secondary Resource Application. (United States)

    Brod, Eva; Øgaard, Anne Falk; Krogstad, Tore; Haraldsen, Trond Knapp; Frossard, Emmanuel; Oberson, Astrid


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake is still poorly understood. Using radioactive-labeling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal, and wood ash were studied as P uptake by barley after 44 days and compared with those of water-soluble mineral P (MinP) and an unfertilized control (NoP) in a pot experiment with an agricultural soil containing little available P at two soil pH levels, approximately pH 5.3 (unlimed soil) and pH 6.2 (limed soil). In a parallel incubation experiment, the effects of the secondary resources on physicochemical and microbial soil processes were studied. The results showed that the relative agronomic efficiency compared with MinP decreased in the order: manure ≥fish sludge ≥wood ash ≥meat bone meal. The solubility of inorganic P in secondary resources was the main driver for P uptake by barley (Hordeum vulgare). The effects of secondary resources on physicochemical and microbial soil processes were of little overall importance. Application of organic carbon with manure resulted in microbial P immobilization and decreased uptake by barley of P derived from the soil. On both soils, P uptake by barley was best explained by a positive linear relationship with the H2O + NaHCO3-soluble inorganic P fraction in fertilizers or by a linear negative relationship with the HCl-soluble inorganic P fraction in fertilizers. PMID:27243015

  11. Alcohol Yield of Oat, Barley and Wheat Hydrolysates


    PIKL, Miroslav


    Major part of ethanol production for industrial use in Czech Republic is made from cereals. Effect of acid, alkali and enzymatic hydrolysis after thermopressure preparation takes part in the paper. The most promising alternative is enzymatic hydrolysis. Especially efficiency of different hydrolytic enzymes towards different species of cereals takes the main part of the simulations. Local farm products, oats, barley and wheat were prepaired by steam explosion in different pressure. After hydro...

  12. Drivers of Phosphorus Uptake by Barley Following Secondary Resource Application


    Brod, Eva; Øgaard, Anne Falk; Krogstad, Tore; Haraldsen, Trond Knapp; Frossard, Emmanuel; Oberson, Astrid


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake is still poorly understood. Using radioactive-labeling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal, and wood ash were studied as P uptake by barley after 44 days and compared with...

  13. Drivers of phosphorus uptake by barley following secondary resource application


    Eva eBrod; Anne Falk Øgaard; Tore eKrogstad; Trond Knapp Haraldsen; Emmanuel eFrossard; Astrid eOberson


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake are still poorly understood. Using radioactive labelling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal and wood ash were studied as P uptake by barley after 44 days and compared wit...

  14. Drivers of phosphorus uptake by barley following secondary resource application

    Directory of Open Access Journals (Sweden)

    Eva eBrod


    Full Text Available Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake are still poorly understood. Using radioactive labelling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal and wood ash were studied as P uptake by barley after 44 days and compared with those of water-soluble mineral P (MinP and an unfertilized control (NoP in a pot experiment with an agricultural soil containing little available P at two soil pH levels, approximately pH 5.3 (unlimed soil and pH 6.2 (limed soil. In a parallel incubation experiment, the effects of the secondary resources on physicochemical and microbial soil processes were studied. The results showed that the relative agronomic efficiency compared with MinP decreased in the order: manure ≥ fish sludge ≥ wood ash ≥ meat bone meal. The solubility of inorganic P in secondary resources was the main driver for P uptake by barley (Hordeum vulgare. The effects of secondary resources on physicochemical and microbial soil processes were of little overall importance. Application of organic carbon with manure resulted in microbial P immobilisation and decreased uptake by barley of P derived from the soil. On both soils, P uptake by barley was best explained by a positive linear relationship with the H2O + NaHCO3-soluble inorganic P fraction in fertilizers, or by a linear negative relationship with the HCl-soluble inorganic P fraction in fertilizers.

  15. Environmental and transgene expression effects on the barley seed proteome

    DEFF Research Database (Denmark)

    Finnie, Christine; Steenholdt, T.; Noguera, O.R.;


    with extra nitrogen. Finally, the fate of transgene products in barley seeds was followed. Spots containing two green fluorescent protein constructs and the herbicide resistance marker phosphinothricin acetyltransferase were observed in 2D-gel patterns of transgenic seeds and identified by mass spectrometry....... Phosphinothricin acetyltransferase was observed in three spots differing in pI suggesting that post-translational modification of the transgene product had occurred....

  16. New Starch Phenotypes Produced by TILLING in Barley


    Francesca Sparla; Giuseppe Falini; Ermelinda Botticella; Claudia Pirone; Valentina Talamè; Riccardo Bovina; Silvio Salvi; Roberto Tuberosa; Francesco Sestili; Paolo Trost


    Barley grain starch is formed by amylose and amylopectin in a 1:3 ratio, and is packed into granules of different dimensions. The distribution of granule dimension is bimodal, with a majority of small spherical B-granules and a smaller amount of large discoidal A-granules containing the majority of the starch. Starch granules are semi-crystalline structures with characteristic X-ray diffraction patterns. Distinct features of starch granules are controlled by different enzymes and are relevant...

  17. The Barley Grain Thioredoxin System – an Update

    Directory of Open Access Journals (Sweden)

    Per eHägglund


    Full Text Available Thioredoxin reduces disulfide bonds and play numerous important functions in plants. In cereal seeds, cytosolic h-type thioredoxin facilitates the release of energy reserves during the germination process and is recycled by NADPH-dependent thioredoxin reductase. This review presents a summary of the research conducted during the last ten years to elucidate the structure and function of the barley seed thioredoxin system at the molecular level combined with proteomic approaches to identify target proteins.

  18. Molecular and structural characterization of barley vernalization genes. (United States)

    von Zitzewitz, Jarislav; Szucs, Péter; Dubcovsky, Jorge; Yan, Liuling; Francia, Enrico; Pecchioni, Nicola; Casas, Ana; Chen, Tony H H; Hayes, Patrick M; Skinner, Jeffrey S


    Vernalization, the requirement of a period of low temperature to induce transition from the vegetative to reproductive state, is an evolutionarily and economically important trait in the Triticeae. The genetic basis of vernalization in cultivated barley (Hordeum vulgare subsp. vulgare) can be defined using the two-locus VRN-H1/VRN-H2 model. We analyzed the allelic characteristics of HvBM5A, the candidate gene for VRN-H1, from ten cultivated barley accessions and one wild progenitor accession (subsp. spontaneum), representing the three barley growth habits - winter, facultative, and spring. We present multiple lines of evidence, including sequence, linkage map location, and expression, that support HvBM5A being VRN-H1. While the predicted polypeptides from different growth habits are identical, spring accessions contain a deletion in the first intron of HvBM5A that may be important for regulation. While spring HvBM5A alleles are typified by the intron-localized deletion, in some cases, the promoter may also determine the allele type. The presence/absence of the tightly linked ZCCT-H gene family members on chromosome 4H perfectly correlates with growth habit and we conclude that one of the three ZCCT-H genes is VRN-H2. The VRN-H2 locus is present in winter genotypes and deleted from the facultative and spring genotypes analyzed in this study, suggesting the facultative growth habit (cold tolerant, vernalization unresponsive) is a result of deletion of the VRN-H2 locus and presence of a winter HvBM5A allele. All reported barley vernalization QTLs can be explained by the two-locus VRN-H1/VRN-H2 model based on the presence/absence of VRN-H2 and a winter vs. spring HvBM5A allele. PMID:16235110

  19. Pysicochemical properties of Tibetan hull-less barley starch. (United States)

    Yangcheng, Hanyu; Gong, Lingxiao; Zhang, Ying; Jane, Jay-lin


    Objectives of this study were to (1) determine the starch physicochemical properties of two commercial Tibetan hull-less barley varieties, Beiqing (BQ) and Kangqing (KQ); and (2) understand the relationship between unique properties of the starches, their structures, and impacts of growing conditions. The BQ barleys were grown at a location with lower temperature and less rainfall compared with the KQ barleys. The BQ starches showed significantly lower onset-gelatinization temperature (54.1-54.9 °C), larger gelatinization-temperature range (9.4-10.6 °C), and higher peak-viscosities (138.9-153.9RVU) than the KQ starches (55.1-56.1 °C, 7.4-8.8 °C, and 63.4-64.7RVU, respectively). After a treatment with 2% sodium-dodecyl-sulphate solution, the KQ starches showed substantially greater increases in peak viscosities than the BQ starches. Annealing of starch and enhanced amylose-lipid complex formation, resulting from higher growing temperature during the development of the KQ starches, likely contributed to the differences in thermal and pasting properties between the BQ and KQ starches.

  20. The effect of lanthanum applications on drought tolerance in barley

    International Nuclear Information System (INIS)

    Full text: Glasshouse investigations carried out by the authors on both perlite and soil, have repeatedly shown that several plant species, when treated with lanthanum, retain greater amounts of moisture under water stressed conditions. Dry matter increases under water stress have been observed in some cases. Barley plants watered to 50% field capacity, and show-ing signs of water stress, yielded 18% more dry matter when treated with 5 kg/ha and 10 kg/ha of lanthanum than control plants (P<0.05). The results of these experiments suggest that increased dry matter production in crops under periods of water stress, is likely when previously treated with lanthanum. Consequently, it is conceivable that lanthanum may have potential as an agent that induces drought tolerance in grain crops, grown in low rainfall areas. Subsequent field trials using barley as a test crop at Walpeup, in the Mallee region of Victoria have shown that in a below average rainfall year, combined soil and foliar applications of lanthanum can significantly increase grain yield. This effect was not evident when barley grown on the same soil type was treated with lanthanum under above average rainfall conditions

  1. Genetic analysis of aluminum tolerance in Brazilian barleys

    Directory of Open Access Journals (Sweden)

    Minella Euclydes


    Full Text Available Aluminum (Al toxicity is a major factor limiting barley growth in acid soils, and genotypes with adequate level of tolerance are needed for improving barley adaptation in Brazil. To study the inheritance of Al tolerance in Brazilian barleys, cultivars Antarctica 1, BR 1 and FM 404 were crossed to sensitive Kearney and PFC 8026, and intercrossed. Parental, F1, F2 and F6 generations were grown in nutrient solution containing 0.03, 0.05 and 0.07 mM of Al and classified for tolerance by the root tip hematoxylin staining assay. Tolerant by sensitive F2 progenies segregated three tolerant to one sensitive, fitting the 3:1 ratio expected for a single gene. The F6 populations segregated one tolerant to one sensitive also fitting a monogenic ratio. The F2 seedlings from crosses among tolerant genotypes scored the same as the parents. Since the population size used would allow detection of recombination as low as 7%, the complete absence of Al sensitive recombinants suggests that tolerance in these cultivars is most probably, controlled by the same gene. Thus, the potential for improving Al tolerance through recombination of these genotypes is very low and different gene sources should be evaluated.

  2. Alleviation of Al Toxicity in Barley by Addition of Calcium

    Institute of Scientific and Technical Information of China (English)

    GUO Tian-rong; CHEN Ying; ZHANG Yan-hua; JIN Ye-fei


    The potential mechanism by which Ca alleviates Al toxicity was investigated in barley seedlings. It was found that 100 μM Al-alone treatment inhibited barley plant growth and thereby reduced shoot height and root length, and dry weights of root, shoot and leaf; promoted Al accumulation but inhibited Ca absorption in plant tissues; and induced an increase in the activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) and in the level of lipid peroxidation (MDA content) in leaves. Except for the increase in Ca concentration in plant tissues, treatment with 0.5 mM Ca in the absence of Al had less effect on the above-mentioned parameters, compared with the control. Addition of Ca efficiently reduced Al toxicity, which is reflected by the promotion of plant growth, reduction in Al concentration and MDA content,increase in Ca concentration and in SOD, POD, and CAT activities compared with the Al-alone-treatment; with increase in Ca level (3.0 mM), the ameliorative effect became more dominant. This indicated that the alleviation of aluminum toxicity in barley seedlings with Ca supplementation could be associated with less absorption of Al and the enhancement of the protective ability of the cell because of increased activity of the antioxidative enzyme.

  3. Nitrate Uptake into Barley (Hordeum vulgare) Plants 1 (United States)

    Deane-Drummond, Celia E.; Glass, Anthony D. M.


    Evidence is presented that chlorate is an extremely good analog for nitrate during nitrate uptake by intact barley (Hordeum vulgare cv. Fergus) roots. The depletion of ClO3− or NO3− from uptake media over 2 to 6 hours by seedlings was found to be dependent on combined NO3− plus ClO3− concentrations, and total anion uptake was equivalent at different NO3−/ClO3− ratios. After loading barley seedlings with 36ClO3− for 6 hours, kinetic parameters were derived from the analysis of efflux of [36Cl] chlorate into unlabeled solution. On the basis of this analysis, the half times for exchange for the cytoplasmic and vacuolar phases were 17 minutes and 20 hours, respectively. Data pooled from a number of different experiments were used to calculate kinetic constants (Km and Vmax) for 36ClO3− influx into barley roots at different external ClO3−/NO3− ratios, using short (10 minutes) influx times. There appeared to be no discrimination by the root cells between ClO3− and NO3−. Lineweaver-Burk analysis of the interaction between nitrate and chlorate were characteristic of competitive inhibition at low nitrate concentrations (0-0.5 mm). At higher concentrations, in the range of >1 mm, similar interactions between these ions were evident. PMID:16662478

  4. Barley metallothioneins differ in ontogenetic pattern and response to metals

    DEFF Research Database (Denmark)

    Schiller, Michaela; Hegelund, Josefine Nymark; Pedas, Pai;


    pollination. However, among the MT grain transcripts MT2c was the most abundant, whereas MT4 was the least abundant. Excess Cu up-regulated three out of the six MTs expressed in leaves of young barley plants. In contrast, most MTs were down-regulated by excess Zn or Cd. Zn starvation led to up-regulation of......, the root-specific gene MT1b1 was 1000-fold up-regulated. Immunolocalizations provided the first evidence for accumulation of MT1a and MT2a proteins in planta, with correlation to transcript levels. In developing grains, MT2a and MT4 expression increased 4- and 300-fold over a 28-day-period after...... MT1a, whereas Cu starvation up-regulated MT2a, which has two copper-responsive elements in the promoter. Arabidopsis lines constitutively overexpressing barley MT2a showed increased sensitivity to excess Cd and Zn but no Cu-induced response. We suggest that barley MTs are differentially involved in...

  5. The wheat Lr34 gene provides resistance against multiple fungal pathogens in barley. (United States)

    Risk, Joanna M; Selter, Liselotte L; Chauhan, Harsh; Krattinger, Simon G; Kumlehn, Jochen; Hensel, Goetz; Viccars, Libby A; Richardson, Terese M; Buesing, Gabriele; Troller, Anna; Lagudah, Evans S; Keller, Beat


    The Lr34 gene encodes an ABC transporter and has provided wheat with durable, broad-spectrum resistance against multiple fungal pathogens for over 100 years. Because barley does not have an Lr34 ortholog, we expressed Lr34 in barley to investigate its potential as a broad-spectrum resistance resource in another grass species. We found that introduction of the genomic Lr34 sequence confers resistance against barley leaf rust and barley powdery mildew, two pathogens specific for barley but not virulent on wheat. In addition, the barley lines showed enhanced resistance against wheat stem rust. Transformation with the Lr34 cDNA or the genomic susceptible Lr34 allele did not result in increased resistance. Unlike wheat, where Lr34-conferred resistance is associated with adult plants, the genomic Lr34 transgenic barley lines exhibited multipathogen resistance in seedlings. These transgenic barley lines also developed leaf tip necrosis (LTN) in young seedlings, which correlated with an up-regulation of senescence marker genes and several pathogenesis-related (PR) genes. In wheat, transcriptional expression of Lr34 is highest in adult plants and correlates with increased resistance and LTN affecting the last emerging leaf. The severe phenotype of transgenic Lr34 barley resulted in reduced plant growth and total grain weight. These results demonstrate that Lr34 provides enhanced multipathogen resistance early in barley plant development and implies the conservation of the substrate and mechanism of the LR34 transporter and its molecular action between wheat and barley. With controlled gene expression, the use of Lr34 may be valuable for many cereal breeding programmes, particularly given its proven durability.


    The fungal plant pathogen, F. graminearum, causes Fusarium head blight disease of wheat and barley. To understand the early infection cycle of this organism, we monitored the RNA expression profiles in newly formed spores (macroconidia), in maturing spores and during the early stages of spore germin...

  7. Identification of Circular RNAs from the Parental Genes Involved in Multiple Aspects of Cellular Metabolism in Barley (United States)

    Darbani, Behrooz; Noeparvar, Shahin; Borg, Søren


    RNA circularization made by head-to-tail back-splicing events is involved in the regulation of gene expression from transcriptional to post-translational levels. By exploiting RNA-Seq data and down-stream analysis, we shed light on the importance of circular RNAs in plants. The results introduce circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes including protein coding transcripts, microRNA, rRNA, and long non-coding/microprotein coding RNAs. The results shed light on the mitochondrial exonic circular RNAs and imply the importance of circular RNAs for regulation of mitochondrial genes. Importantly, we introduce circular RNAs in barley and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs' functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear transcripts. PMID:27375638

  8. Identification of Circular RNAs From the Parental Genes Involved in Multiple Aspects of Cellular Metabolism in Barley

    Directory of Open Access Journals (Sweden)

    Behrooz eDarbani


    Full Text Available RNA circularization made by head-to-tail back-splicing events is involved in the regulation of gene expression from transcriptional to post-translational levels. By exploiting RNA-Seq data and down-stream analysis, we shed light on the importance of circular RNAs in plants. The results introduce circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes including protein coding transcripts, microRNA, rRNA, and long non-coding/microprotein coding RNAs. The results shed light on the mitochondrial exonic circular RNAs and imply the importance of circular RNAs for regulation of mitochondrial genes. Importantly, we introduce circular RNAs in barley and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs' functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear transcripts.Keywords: circular RNAs, coding and non-coding transcripts, leaves, seeds, transfer cells, micronutrients, mitochondria

  9. Effect of Barleys Having Different Liter Weights on Performance, Economic Value, Ruminal Fermentation of Lambs, and Nutrient Digestibility


    GÜLER, Talat; ŞAHİN, Kazım; ÇERÇİ, İ.Halil; ERTAS, O. Nihat


    This experiment was conducted to determine the effects of diets containing barleys having different liter weights (It wt) on average daily gain, feed efficiency, profit margins, ruminal fermentation, and carcass characteristics of lambs and diet digestibility. 16 Akkaraman lambs approximately 8 mo old (averaging 30 kg) were used in a randomized design. Treatment groups consisting of barley grains and barley grains were classified to liter weights as follows: 1. Barley has 643 g lt wt (Grou...

  10. A genome-wide association study of malting quality across eight U.S. barley breeding programs (United States)

    This study leverages the breeding data of 1,862 breeding lines evaluated in 97 field trials for genome-wide association study of malting quality traits in barley. The breeding lines were six-row and two-row barley advanced breeding lines from eight barley breeding populations established at six pub...

  11. Agronomic effects of a reciprocal translocation in a widely grown Spanish barley variety

    NARCIS (Netherlands)

    Farré, A.; Visioni, A.; Lacasa-Benito, I.; Cistué, L.; Jansen, J.


    A large spontaneous reciprocal translocation is present in a widely grown Spanish barley cv. ‘Albacete’. It has been hypothesized that high popularity of ‘Albacete’ with farmers, particularly in semi-arid areas where barley is grown under rainfed conditions, may be due to the presence of this transl

  12. Comparison of Pretreatment Strategies for Enzymatic Saccharification and Fermentation of Barley Straw to Ethanol (United States)

    Barley straw used in this study contained 34.1±0.6% cellulose, 22.6±0.4% hemicellulose, and 13.3±0.2% lignin (moisture, 6.5±0.0%). Several pretreatments (dilute acid, lime, and alkaline peroxide) and enzymatic saccharification procedures were evaluated for the conversion of barley straw to monomeri...


    Directory of Open Access Journals (Sweden)

    Temiraev R. B.


    Full Text Available The article presents experimental data indicating that for the optimization of biological and food processing meat value at risk of aflatoxicosis in feeding chicken-broilers with barley-wheat and sunflower type one should include hullless barley grain at exposure of ozone of 3.0 hour complex with Bifidumbacterinum probiotics

  14. A promising low beta-glucan barley mutation of m351 for better bioethanol production use (United States)

    Bioethanol is an important liquid fuel complement. Barley is an alternative raw material for ethanol production and its byproduct is a nutritious feed. The barley m351mutant line, which has a mutation for low beta-glucan content, was tested for its ethanol production efficiency and feed fraction qua...

  15. Influence of alkali catalyst on product yield and properties via hydrothermal liquefaction of barley straw

    DEFF Research Database (Denmark)

    Zhu, Z.; Toor, Saqib; Rosendahl, Lasse;


    Barley straw was successfully converted to bio-crude by hydrothermal liquefaction at temperature of 280 e400 C using an alkali catalyst (K2CO3) in our previous work, and the maximum bio-crude yield was obtained at 300 C. This paper extends previous work on studying liquefaction behavior of barley...

  16. Quantifying relationships between rooting traits and water uptake under drought in Mediterranean barley and durum wheat

    Institute of Scientific and Technical Information of China (English)

    Pedro Carvalho; Sayed AzamAli; M. John Foulkes


    In Mediterranean regions drought is the major factor limiting spring barley and durum wheat grain yields. This study aimed to compare spring barley and durum wheat root and shoot responses to drought and quantify relationships between root traits and water uptake under terminal drought. One spring barley (Hordeum vulgare L. cv. Rum) and two durum wheat Mediterranean cultivars (Triticum turgidum L. var durum cvs Hourani and Karim) were examined in soil-column experi-ments under wel watered and drought conditions. Root system architecture traits, water uptake, and plant growth were measured. Barley aerial biomass and grain yields were higher than for durum wheat cultivars in wel watered conditions. Drought decreased grain yield more for barley (47%) than durum wheat (30%, Hourani). Root-to-shoot dry matter ratio increased for durum wheat under drought but not for barley, and root weight increased for wheat in response to drought but decreased for barley. The critical root length density (RLD) and root volume density (RVD) for 90%available water capture for wheat were similar to (cv. Hourani) or lower than (cv. Karim) for barley depending on wheat cultivar. For both species, RVD accounted for a slightly higher proportion of phenotypic variation in water uptake under drought than RLD.

  17. Molecular mapping of greenbug (Schizaphis graminum) resistance gene Rsg1 in barley (United States)

    The greenbug, Schizaphis graminum (Rondani) is an extremely damaging aphid pest of barley (Hordeum vulgare L., 2n = 2x =14 L.) particularly in the southern Great Plains of the US. The simply inherited, dominant resistance gene Rsg1 is presented in all greenbug-resistant US barley cultivars, includi...

  18. Secretomics identifies Fusarium graminearum proteins involved in the interaction with barley and wheat

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, Jens D.; Svensson, Birte;


    Fusarium graminearum is a phytopathogenic fungus primarily infecting small grain cereals, including barley and wheat. Secreted enzymes play important roles in the pathogenicity of many fungi. In order to access the secretome of F. graminearum, the fungus was grown in liquid culture with barley...... secreted proteins which may be involved in Fusarium head blight....

  19. Investigation of the effect of nitrogen on severity of Fusarium Head Blight in barley

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, J.D.; Spliid, N.H.;


    The effect of nitrogen on Fusarium Head Blight (FHB) in a susceptible barley cultivar was investigated using gel-based proteomics. Barley grown with either 15 or 100 kg ha(-1)N fertilizer was inoculated with Fusarium graminearum (Fg). The storage protein fraction did not change significantly...

  20. Regrowth in Barley (Hordeum vulgare L.) and Rye (Secale cereale L.)

    DEFF Research Database (Denmark)

    Christiansen, J L; Jørgensen, Johannes Ravn; Jørnsgård, B;


    Regrowth after cutting at four development stages, from heading to grain maturity, was investigated in a pot experiment containing three rye and four barley varieties (including 2 Hordeum spontaneum lines). Regrowth in the barley varieties decreased strongly from heading to grain maturity. Rye ge...

  1. Complex Interspecific Hybridization in Barley (Hordeum vulgare L.) and the Possible Occurrence of Apomixis

    DEFF Research Database (Denmark)

    Bothmer, R. von; Bengtsson, M.; Flink, J.;


    Several complex hybrids were produced from the combination [(Hordeum lechleri, 6 .times. .times. H. procerum, 6 .times.) .times. H. vulgare, 2 .times.]. Crosses with six diploid barley lines resulted in triple hybrids, most of which had a full complement of barley chromosomes (no. 1-7), but were...

  2. Barley (Hordeum vulgare L.) cysteine proteases: heterologous expression, purification and characterization

    DEFF Research Database (Denmark)

    Rosenkilde, Anne Lind; Dionisio, Giuseppe; Holm, Preben Bach;


    During germination of barley seeds, mobilization of protein is essential and cysteine proteases accounts for more than 90 % of the total proteolytic activity in the degradation of barley seed storage proteins. Cysteine proteases exist as pro-enzyme and is activated through reduction of the active...

  3. Lysine Rich Proteins in the Salt-Soluble Protein Fraction of Barley

    DEFF Research Database (Denmark)

    Ingversen, J.; Køie, B.


    Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2.......Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2....

  4. Dilute-acid pretreatment of barley straw for biological hydrogen production using Caldicellulosiruptor saccharolyticus

    NARCIS (Netherlands)

    Panagiotopoulos, I.A.; Bakker, R.R.C.; Vrije, de G.J.; Claassen, P.A.M.; Koukios, E.G.


    The main objective of this study was to use the fermentability test to investigate the feasibility of applying various dilute acids in the pretreatment of barley straw for biological hydrogen production. At a fixed acid loading of 1% (w/w dry matter) 28-32% of barley straw was converted to soluble m

  5. Comparative analysis of genetic diversity between Qinghai-Tibetan wild and Chinese landrace barley. (United States)

    Gong, Xue; Westcott, Sharon; Li, Chengdao; Yan, Guijun; Lance, Reg; Sun, Dongfa


    Fifty-two SSR markers were used to evaluate the genetic diversity of 33 Qinghai-Tibetan wild barley accessions, 56 landraces collected primarily from other parts of China, and 1 Israeli wild barley accession. At the 52 SSR loci, 206 alleles were detected for the 90 accessions, among which 111 were common alleles. The number of alleles per locus ranged from 1 to 9, with an average of 4.0. Polymorphism information content (PIC) values ranged from 0 to 0.856 among all the markers, with an average of 0.547. The PIC value of Qinghai-Tibetan wild barley varied from 0 to 0.813 with an average of 0.543, while in landraces, the markers showed a range of 0 to 0.790 with an average of 0.490. The SSR markers could clearly differentiate the Qinghai-Tibetan wild barley from the landraces. Twenty-four unique alleles were observed in Qinghai-Tibetan wild barley, and the frequency of unique alleles in Qinghai-Tibetan wild barley was about 2.1 times higher than that in the landraces, on average. Five of the 7 chromosomes had more unique alleles in the Qinghai-Tibetan wild barley, but chromosome 2H had more unique alleles in the landraces. The presence of many unique alleles may reflect the adaptation of this barley germplasm to diverse environments and production systems. PMID:19935909

  6. Differential levels of mite infestation of wheat and barley in Czech grain stores

    Institute of Scientific and Technical Information of China (English)

    Jan Hubert; Zuzana Kucerova; Radek Aulicky; Marta Nesvoma; Vaclav Stejskal


    While mites are able to utilize numerous food sources, the suitability of the food strongly influences population growth. The different suitabilities of various stored agricultural products will thus affect the level of infestation. In this study, we compared field mite infestation rates in two stored cereals: wheat and barley. We analyzed mite abundance, frequency and species composition in samples of grain obtained from 79 selected Czech grain stores. Stored barley seemed to be more vulnerable to mite attack than wheat, as we consistently found more infested samples, more species and higher mean and median mite abundance per sample in barley as compared to wheat. The mean mite abundance per sample were 55 and 506 individuals for wheat and barley, respectively. In barley, 10% of samples exceeded allergen risk threshold (i.e., 1 000 individuals per kg of grain). Altogether, 25 species were identified from approximately 35 000 individuals. The most frequently identified species were the same in wheat and barley, that is, Tydeus interruptus Sig Thor, Acarus siro L., Tarsonemus granarius Lindquist, Lepidoglyphus destructor (Schrank) and 1),rophagusputrescentiae (Schrank). Based on principal components analysis, we found a closer association of T. interruptus, T. putrescentiae, L. destructor and Cheyletus eruditus (Schrank) with barley samples, corresponding to the high frequency and abundance values of these mites. The probable reasons for the higher infestation, especially mite abundance in barley, are discussed in relation to the higher proportion of crushed parts, which may release favorable nutrient sources and amplify the abundance values.

  7. Genetic characterization of a reciprocal translocation present in a widely grown barley variety

    NARCIS (Netherlands)

    Farré, A.; Cuadrado, A.; Lacasa-Benito, I.; Cistué, L.; Schubert, I.; Comadran, J.; Jansen, J.; Romagosa, I.


    Artificially induced translocation stocks have been used to physically map the barley genome; however, natural translocations are extremely uncommon in cultivated genotypes. Albacete is a barley variety widely grown in recent decades in Spain and carrying a reciprocal translocation which obviously d

  8. The discovery of resistant sources of spring barley, Hordeum vulgare ssp. spontaneum, and unique greenbug biotypes (United States)

    The genetic sources for host-plant resistance to the greenbug (Schiazphis graminum Ronani) in barley (Hordeum vulgare ssp. spontaneum) are limited in that only two single dominant genes Rsg1 and Rsg2 are available for resistance to greenbug biotypes. We evaluated four new barley lines from the Wild...

  9. Assessment of genetic diversity among barley cultivars and breeding lines adapted to the US Pacific Northwest, and its implications in breeding barley for imidazolinone-resistance.

    Directory of Open Access Journals (Sweden)

    Sachin Rustgi

    Full Text Available Extensive application of imidazolinone (IMI herbicides had a significant impact on barley productivity contributing to a continuous decline in its acreage over the last two decades. A possible solution to this problem is to transfer IMI-resistance from a recently characterized mutation in the 'Bob' barley AHAS (acetohydroxy acid synthase gene to other food, feed and malting barley cultivars. We focused our efforts on transferring IMI-resistance to barley varieties adapted to the US Pacific Northwest (PNW, since it comprises ∼23% (335,000 ha of the US agricultural land under barley production. To effectively breed for IMI-resistance, we studied the genetic diversity among 13 two-rowed spring barley cultivars/breeding-lines from the PNW using 61 microsatellite markers, and selected six barley genotypes that showed medium to high genetic dissimilarity with the 'Bob' AHAS mutant. The six selected genotypes were used to make 29-53 crosses with the AHAS mutant and a range of 358-471 F1 seeds were obtained. To make informed selection for the recovery of the recipient parent genome, the genetic location of the AHAS gene was determined and its genetic nature assessed. Large F2 populations ranging in size from 2158-2846 individuals were evaluated for herbicide resistance and seedling vigor. Based on the results, F3 lines from the six most vigorous F2 genotypes per cross combination were evaluated for their genetic background. A range of 20%-90% recovery of the recipient parent genome for the carrier chromosome was observed. An effort was made to determine the critical dose of herbicide to distinguish between heterozygotes and homozygotes for the mutant allele. Results suggested that the mutant can survive up to the 10× field recommended dose of herbicide, and the 8× and 10× herbicide doses can distinguish between the two AHAS mutant genotypes. Finally, implications of this research in sustaining barley productivity in the PNW are discussed.

  10. Patterns of genetic and eco-geographical diversity in Spanish barleys. (United States)

    Yahiaoui, S; Igartua, Ernesto; Moralejo, M; Ramsay, L; Molina-Cano, J L; Ciudad, F J; Lasa, J M; Gracia, M P; Casas, A M


    The pool of Western Mediterranean landraces has been under-utilised for barley breeding so far. The objectives of this study were to assess genetic diversity in a core collection of inbred lines derived from Spanish barley landraces to establish its relationship to barleys from other origins, and to correlate the distribution of diversity with geographical and climatic factors. To this end, 64 SSR were used to evaluate the polymorphism among 225 barley (Hordeum vulgare ssp. vulgare) genotypes, comprising two-row and six-row types. These included 159 landraces from the Spanish barley core collection (SBCC) plus 66 cultivars, mainly from European countries, as a reference set. Out of the 669 alleles generated, a large proportion of them were unique to the six-row Spanish barleys. An analysis of molecular variance revealed a clear genetic divergence between the six-row Spanish barleys and the reference cultivars, whereas this was not evident for the two-row barleys. A model-based clustering analysis identified an underlying population structure, consisting of four main populations for the whole genotype set, and suggested further possible subdivision within two of these populations. Most of the six-row Spanish landraces clustered into two groups that corresponded to geographic regions with contrasting environmental conditions. The existence of wide genetic diversity in Spanish germplasm, possibly related to adaptation to a broad range of environmental conditions, and its divergence from current European cultivars confirm its potential as a new resource for barley breeders, and make the SBCC a valuable tool for the study of adaptation in barley. PMID:18026712

  11. Kaposi's sarcoma-associated herpesvirus ORF57 protein binds and protects a nuclear noncoding RNA from cellular RNA decay pathways.

    Directory of Open Access Journals (Sweden)

    Brooke B Sahin


    Full Text Available The control of RNA stability is a key determinant in cellular gene expression. The stability of any transcript is modulated through the activity of cis- or trans-acting regulatory factors as well as cellular quality control systems that ensure the integrity of a transcript. As a result, invading viral pathogens must be able to subvert cellular RNA decay pathways capable of destroying viral transcripts. Here we report that the Kaposi's sarcoma-associated herpesvirus (KSHV ORF57 protein binds to a unique KSHV polyadenylated nuclear RNA, called PAN RNA, and protects it from degradation by cellular factors. ORF57 increases PAN RNA levels and its effects are greatest on unstable alleles of PAN RNA. Kinetic analysis of transcription pulse assays shows that ORF57 protects PAN RNA from a rapid cellular RNA decay process, but ORF57 has little effect on transcription or PAN RNA localization based on chromatin immunoprecipitation and in situ hybridization experiments, respectively. Using a UV cross-linking technique, we further demonstrate that ORF57 binds PAN RNA directly in living cells and we show that binding correlates with function. In addition, we define an ORF57-responsive element (ORE that is necessary for ORF57 binding to PAN RNA and sufficient to confer ORF57-response to a heterologous intronless beta-globin mRNA, but not its spliced counterparts. We conclude that ORF57 binds to viral transcripts in the nucleus and protects them from a cellular RNA decay pathway. We propose that KSHV ORF57 protein functions to enhance the nuclear stability of intronless viral transcripts by protecting them from a cellular RNA quality control pathway.

  12. Improvement of barley for drought tolerance by induced mutation

    International Nuclear Information System (INIS)

    Barley (cultivar Ardhaoui) is a traditional cereal adapted to the agroclimatic and abiotic stresses of South Tunisia. It is used by local communities as the food plant and source of proteins for animals. It is a heterogeneous mixtures of land races and represent the adapted natural germplasm which needs to be improved in yield, quality and tolerance to stress (especially drought). Irradiation technique is used in this work for the selection of barley lines tolerant to drought. Building on the obtained results, the technique will be used to develop barley lines matching specific environments prevailing in the south of Tunisia. The obtained mutants are characterized by the increased of grain yield and water use efficiency through a greater tolerance to drought. On the level of the physiological behavior, the mutants are more efficient regarding the values of rate of photosynthesis A, the stomatic conductance gs, the rate of transpiration E, chlorophyl rate and the internal CO2 concentration Ci. The content of proline shows that this amino acid is strongly concentrated at the irradiated lines. The analysis of nutritional behavior shows that the content of (Ca+Mg) in irradiated lines decreases by increasing the stress. The phosphorus content was also assigned by the water stress. On the contrary, the potassium content increases with the intensity of stress. Under water deficit, the growth parameter, the grain production and the number of spike and tillers are significantly reduced for the control (the reduction reached 42 to 50%). This reduction does not exceed 25% for the irradiated lines. The availability of these improved mutant seeds can contribute to increase food security for the local population. (author)

  13. Elevated phosphorus impedes manganese acquisition by barley plants. (United States)

    Pedas, Pai; Husted, Søren; Skytte, Kristian; Schjoerring, Jan Kofod


    The occurrence of manganese (Mn) deficiency in cereal crops has increased in recent years. This coincides with increasing phosphorus (P) status of many soils due to application of high levels of animal manure and P-fertilizers. In order to test the hypothesis that elevated P my lead to Mn deficiency we have here conducted a series of hydroponics and soil experiments examining how the P supply affects the Mn nutrition of barley. Evidence for a direct negative interaction between P and Mn during root uptake was obtained by on-line inductively coupled plasma mass spectrometry (ICP-MS). Addition of a pulse of KH(2)PO(4) rapidly and significantly reduced root Mn uptake, while a similar concentration of KCl had no effect. Addition of a P pulse to the same nutrient solution without plants did not affect the concentration of Mn, revealing that no precipitation of Mn-P species was occurring. Barley plants growing at a high P supply in hydroponics with continuous replenishment of Mn(2+) had up to 50% lower Mn concentration in the youngest leaves than P limited plants. This P-induced depression of foliar Mn accelerated the development of Mn deficiency as evidenced by a marked change in the fluorescence induction kinetics of chlorophyll a. Also plants growing in soil exhibited lower leaf Mn concentrations in response to elevated P. In contrast, leaf concentrations of Fe, Cu, and N increased with the P supply, supporting that the negative effect of P on Mn acquisition was specific rather than due to a general dilution effect. It is concluded that elevated P supply directly interferes with Mn uptake in barley roots and that this negative interaction can induce Mn deficiency in the shoot. This finding has major implications in commercial plant production where many soils have high P levels. PMID:22639592

  14. Mapping quantitative trait loci associated with barley net blotch resistance. (United States)

    Grewal, T S; Rossnagel, B G; Pozniak, C J; Scoles, G J


    Net blotch of barley, caused by Pyrenophora teres Drechs., is an important foliar disease worldwide. Deployment of resistant cultivars is the most economic and eco-friendly control method. This report describes mapping of quantitative trait loci (QTL) associated with net blotch resistance in a doubled-haploid (DH) barley population using diversity arrays technology (DArT) markers. One hundred and fifty DH lines from the cross CDC Dolly (susceptible)/TR251 (resistant) were screened as seedlings in controlled environments with net-form net blotch (NFNB) isolates WRS858 and WRS1607 and spot-form net blotch (SFNB) isolate WRS857. The population was also screened at the adult-plant stage for NFNB resistance in the field in 2005 and 2006. A high-density genetic linkage map of 90 DH lines was constructed using 457 DArT and 11 SSR markers. A major NFNB seedling resistance QTL, designated QRpt6, was mapped to chromosome 6H for isolates WRS858 and WRS1607. QRpt6 was associated with adult-plant resistance in the 2005 and 2006 field trials. Additional QTL for NFNB seedling resistance to the more virulent isolate WRS858 were identified on chromosomes 2H, 4H, and 5H. A seedling resistance QTL (QRpts4) for the SFNB isolate WRS857 was detected on chromosome 4H as was a significant QTL (QRpt7) on chromosome 7H. Three QTL (QRpt6, QRpts4, QRpt7) were associated with resistance to both net blotch forms and lines with one or more of these demonstrated improved resistance. Simple sequence repeat (SSR) markers tightly linked to QRpt6 and QRpts4 were identified and validated in an unrelated barley population. The major 6H QTL, QRpt6, may provide adequate NFNB field resistance in western Canada and could be routinely selected for using molecular markers in a practical breeding program. PMID:18071668

  15. Synthesis of the major storage protein, hordein, in barley

    DEFF Research Database (Denmark)

    Giese, Nanna Henriette; Andersen, B.; Doll, Hans


    A liquid culture system for culturing detached spikes of barley (Hordeum vulgare L.) at different nutritional levels was established. The synthesis of hordein polypeptides was studied by pulse-labeling with [14C]sucrose at different stages of development and nitrogen (N) nutrition. All polypeptides...... were synthesised at 10 d after anthesis and hercafter an increase was observed for all polypeptides. A fivefold increase in total hordein was observed within the N range tested. Hordein-1 increased considerably more than hordein-2 with increased N nutrition, and hordein-1 synthesis exceeded...

  16. Obtaining barley haploid embryos and seedlings using anther culture technique

    International Nuclear Information System (INIS)

    The effect of three barley genotypes (Igri, Arabi abiad, and Taqa 76), three irradiation doses (0, 5, and 10 Gy), and two media (FW, modified FW), on the number of formed embryos, and the ratio between regenerated embryos to green seedlings and albinos, were studied using anther culture. Also the study involved the compatibility between seedling morphology and chromosome number. results indicated significant differences among the genotypes, and media in callus and embryos formation and also in the ratio and albino seedlings. However, the effect of gamma rays dose was significant only on embryos regeneration. A high percentage of compatibility (90%) was obtained between the seedling morphology and chromosome number. (author)

  17. Peroxidase isoenzymes in germinating barley seeds and in seminal roots

    Directory of Open Access Journals (Sweden)

    A. Stroński


    Full Text Available Roots and germinating seeds of summer barley of the cv. Alsa, Antałek, Cebeco 7161, Lubuski, Skrzeszowicki and Union were found to differ in the number of peroxidase isoenzymes. In the germinating seeds from 5 to 8 isoenzymes were found whereas in the two-week-old roots – from 10 to 14 isoenzymes. Four isoenzymes in germinating seeds and eight isoenzymes in seminal roots appeared in all the cultivars tested. The cultivars differed also in the relative activity of the isoenzymes in the tested organs.

  18. Inhibition of Henipavirus infection by RNA interference. (United States)

    Mungall, Bruce A; Schopman, Nick C T; Lambeth, Luke S; Doran, Tim J


    Nipah virus (NiV) and Hendra virus (HeV) are recently emerged zoonotic paramyxoviruses exclusively grouped within a new genus, Henipavirus. These viruses cause fatal disease in a wide range of species, including humans. Both NiV and HeV have continued to re-emerge sporadically in Bangladesh and Australia, respectively. There are currently no therapeutics or vaccines available to treat Henipavirus infection and both are classified as BSL4 pathogens. RNA interference (RNAi) is a process by which double-stranded RNA directs sequence-specific degradation of messenger RNA in animal and plant cells. Small interfering RNAs (siRNAs) mediate RNAi by inhibiting gene expression of homologous mRNA and our preliminary studies suggest RNAi may be a useful approach to developing novel therapies for these highly lethal pathogens. Eight NiV siRNA molecules (four L and four N gene specific), two HeV N gene specific, and two non-specific control siRNA molecules were designed and tested for their ability to inhibit a henipavirus minigenome replication system (which does not require the use of live virus) in addition to live virus infections in vitro. In the minigenome assay three out of the four siRNAs that targeted the L gene of NiV effectively inhibited replication. In contrast, only NiV N gene siRNAs were effective in reducing live NiV replication, suggesting inhibition of early, abundantly expressed gene transcripts may be more effective than later, less abundant transcripts. Additionally, some of the siRNAs effective against NiV infection were only partially effective inhibitors of HeV infection. An inverse correlation between the number of nucleotide mismatches and the efficacy of siRNA inhibition was observed. The demonstration that RNAi effectively inhibits henipavirus replication in vitro, is a novel approach and may provide an effective therapy for these highly lethal, zoonotic pathogens. PMID:18687361

  19. Induction of Silencing Effect of Swedish Mutant Amyloid Precursor Protein by RNA interference

    Institute of Scientific and Technical Information of China (English)

    QIU Xin; CHEN Guohua; PAN Ji'an; CHEN Yu; ZHANG Suming


    Over-expression of APP and Swedish mutation could cause some familial early onset AD.In this study, a primary screening was conducted of effective small interference RNAs (siRNAs) targeted wild type APP (APPwt) and Swedish mutant APP (APPswe). One siRNA targeting APPwt and the other siRNA targeting APPswe were designed. All these siRNAs were endogenously expressed by siRNAs expressing plasmids. COS-7 cells were transiently co-transfected with APP-GFP recombinant plasmids and siRNA expression vector. The silencing effect of each siRNA was quantitatively assessed by the level of expression of green fluorescent protein (GFP). It was found that the siRNAs silenced APPwt and APPswe to different degrees. siRNA directed against APPswe was more effective in suppressing the expression of fusion gene of APPswe than that of APPwt. The silencing effect of siRNA directed against APPswe indicating allele-specific silencing property of the siRNAs. Therefore, siRNAs directed against APP play an important role both in the therapeutic study of Alzheimer disease and functional exploration of APP gene.

  20. Further molecular evidence for the Hordeum vulgare ssp. spontaneum in Tibet as ultimate progenitor of Chinese cultivated barley

    Institute of Scientific and Technical Information of China (English)


    106 accessions of Tibetan wild barley, including 50 accessions of the two-rowed wild barley Hordeum vulgare ssp. spontaneum(HS), 27 accessions of the six-rowed bottle-shaped wild barley H. lagunculiforme(HL) and 29 accessions of the six-rowed wild barley H. agriocrithon(HA) that separately represent different agrigeographical regions of Tibet, were used to study the genetic diversity and genetic differentiation using SSR markers selected from seven barley linkage groups. 229 allelic variants were identified with an average of 7.6 alleles/locus. The average of total number of alleles per locus in HA(6.4) is much higher than that in HS(3.9) and HL(3.4). The genetic diversity and its standard deviation among the three subspecies were in the order of HS>HL>HA. Very significant genetic differentiation was observed among the three subspecies of wild barley. Comparisons of the results from this and previous studies showed a strong Oriental-Occidental differentiation of barley, and that Shannan region of Tibet might be the center of origin of the Tibetan two-rowed wild barley, thus supporting not only the hypothesis of a mono-phyletic origin of cultivated barley but also the proposition that the Tibetan two-rowed wild barley as ultimate progenitor of Chinese cultivated barley.

  1. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.;


    RNA modification has attracted increasing interest as it is realized that epitranscriptomics is important in disease development. In type 2 diabetes we have suggested that high urinary excretion of 8-oxo-2'-Guanosine (8oxoGuo), as a measure of global RNA oxidation, is associated with poor survival.......9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...... diabetes. In agreement with our previous finding, DNA oxidation did not show any prognostic value. RNA oxidation represents oxidative stress intracellularly, presumably predominantly in the cytosol. The mechanism of RNA oxidation is not clear, but hypothesized to result from mitochondrial dysfunction...

  2. 大麦雄性不育的遗传研究%Genetic Study on Barley Male Sterility

    Institute of Scientific and Technical Information of China (English)

    张凤英; 刘志萍; 包海柱


    [Objective] The aim was to research the genetic mechanism of barley male sterility, and provide the theoretical reference for breeding strong heterosis hybrid of barley. [Method] Fertility segregation phenomenon, morphological characteristics and main agronomic characters of male sterility character of 4 kinds of barley male sterility materials 2001-17, 2001-37, 2001-84 and 2001-116 and their derived lines were observed and researched. [Result] Barley male sterility existed genetic phenomenon of single dominant nuclear gene caused by environmental stimulation, its sterility controlled by MS, the sterile genotype was MSms. There was stable nucleo-cytoplasmic inheritance on barley male sterility which was controlled by cytoplasmic male sterile gene S and nuclear gene rr, and its genotype was S(rr), this male sterility belonged to CMS type sterility. Temperature had no effect on fertility. [Conclusion] There was stable nucleo-cytoplasmic inheritance on barley male sterility, this result played a positively promoting role in barley practical production.

  3. Assessment of genetic diversity by simple sequence repeat markers among forty elite varieties in the germplasm for malting barley breeding. (United States)

    Wang, Jun-mei; Yang, Jian-ming; Zhu, Jing-huan; Jia, Qiao-jun; Tao, Yue-zhi


    The genetic diversity and relationship among 40 elite barley varieties were analyzed based on simple sequence repeat (SSR) genotyping data. The amplified fragments from SSR primers were highly polymorphic in the barley accessions investigated. A total of 85 alleles were detected at 35 SSR loci, and allelic variations existed at 29 SSR loci. The allele number per locus ranged from 1 to 5 with an average of 2.4 alleles per locus detected from the 40 barley accessions. A cluster analysis based on the genetic similarity coefficients was conducted and the 40 varieties were classified into two groups. Seven malting barley varieties from China fell into the same subgroup. It was found that the genetic diversity within the Chinese malting barley varieties was narrower than that in other barley germplasm sources, suggesting the importance and feasibility of introducing elite genotypes from different origins for malting barley breeding in China. PMID:20872987

  4. Assessment of genetic diversity by simple sequence repeat markers among forty elite varieties in the germplasm for malting barley breeding* (United States)

    Wang, Jun-mei; Yang, Jian-ming; Zhu, Jing-huan; Jia, Qiao-jun; Tao, Yue-zhi


    The genetic diversity and relationship among 40 elite barley varieties were analyzed based on simple sequence repeat (SSR) genotyping data. The amplified fragments from SSR primers were highly polymorphic in the barley accessions investigated. A total of 85 alleles were detected at 35 SSR loci, and allelic variations existed at 29 SSR loci. The allele number per locus ranged from 1 to 5 with an average of 2.4 alleles per locus detected from the 40 barley accessions. A cluster analysis based on the genetic similarity coefficients was conducted and the 40 varieties were classified into two groups. Seven malting barley varieties from China fell into the same subgroup. It was found that the genetic diversity within the Chinese malting barley varieties was narrower than that in other barley germplasm sources, suggesting the importance and feasibility of introducing elite genotypes from different origins for malting barley breeding in China. PMID:20872987

  5. The wide distribution of endornaviruses, large double-stranded RNA replicons with plasmid-like properties. (United States)

    Fukuhara, T; Koga, R; Aoki, N; Yuki, C; Yamamoto, N; Oyama, N; Udagawa, T; Horiuchi, H; Miyazaki, S; Higashi, Y; Takeshita, M; Ikeda, K; Arakawa, M; Matsumoto, N; Moriyama, H


    The International Committee on Taxonomy of Viruses (ICTV) recently accepted Endornavirus as a new genus of plant dsRNA virus. We have determined the partial nucleotide sequences of the RNA-dependent RNA polymerase regions from the large dsRNAs (about 14 kbp) isolated from barley (Hordeum vulgare), kidney bean (Phaseolus vulgaris), melon (Cucumis melo), bottle gourd (Lagenaria siceraria), Malabar spinach (Basella alba), seagrass (Zostera marina), and the fungus Helicobasidium mompa. Phylogenetic analyses of these seven dsRNAs indicate that these dsRNAs are new members of the genus Endornavirus that are widely distributed over the plant and fungal kingdoms. PMID:16341944

  6. Comparative Proteomic Analysis of Two Barley Cultivars (Hordeum vulgare L.) with Contrasting Grain Protein Content (United States)

    Guo, Baojian; Luan, Haiye; Lin, Shen; Lv, Chao; Zhang, Xinzhong; Xu, Rugen


    Grain protein contents (GPCs) of barley seeds are significantly different between feed and malting barley cultivars. However, there is still no insight into the proteomic analysis of seed proteins between feed and malting barley cultivars. Also, the genetic control of barley GPC is still unclear. GPCs were measured between mature grains of Yangsimai 3 and Naso Nijo. A proteome profiling of differentially expressed protein was established by using a combination of 2-DE and tandem mass spectrometry. In total, 502 reproducible protein spots in barley seed proteome were detected with a pH range of 4–7 and 6–11, among these 41 protein spots (8.17%) were detected differentially expressed between Yangsimai 3 and Naso Nijo. Thirty-four protein spots corresponding to 23 different proteins were identified, which were grouped into eight categories, including stress, protein degradation and post-translational modification, development, cell, signaling, glycolysis, starch metabolism, and other functions. Among the identified proteins, enolase (spot 274) and small subunit of ADP-glucose pyrophosphorylase (spot 271) are exclusively expressed in barley Yangsimai 3, which may be involved in regulating seed protein expression. In addition, malting quality is characterized by an accumulation of serpin protein, Alpha-amylase/trypsin inhibitor CMb and Alpha-amylase inhibitor BDAI-1. Most noticeably, globulin, an important storage protein in barley seed, undergoes post-translational processing in both cultivars, and also displays different expression patterns. PMID:27200019

  7. Effects of a Dietary Supplement with Barley Sprout Extract on Blood Cholesterol Metabolism. (United States)

    Byun, A Ri; Chun, Hyejin; Lee, Jin; Lee, Sang Wha; Lee, Hong Soo; Shim, Kyung Won


    Objective. Barley sprout (Hordeum vulgare L.) contains 4.97% fat, 52.6% polysaccharide, and 34.1% protein along with a variety of vitamins, minerals, and polyphenolic compounds. Hexacosanol is one such compound from the barley leaf that might improve cholesterol metabolism by decreasing cholesterol synthesis. Method. Therefore, this study was conducted to investigate the effects of barley sprout extract on serum lipid metabolism in healthy volunteers (n = 51). Subjects were randomly divided into two groups: one group consumed a single capsule of barley leaf extract daily (n = 25, 42.48 ± 13.58 years) and the other consumed placebo capsules (n = 26, 40.54 ± 11.1 years) for 12 weeks. Results. After 12 weeks, total cholesterol and low-density lipoprotein- (LDL-) cholesterol were not lower in the barley sprout extract group compared to the placebo group (p = 0.415 and p = 0.351, resp.) and no differences in clinical or laboratory findings were observed between both groups. Conclusion. Our study failed to show significant lipid-lowering effects of barley sprout extract, possibly due to dosage, duration of therapy, and small sample size. Despite our nonsignificant findings, barley sprout has a possibility as a functional health food; therefore future research is needed. PMID:26101533

  8. Effects of a Dietary Supplement with Barley Sprout Extract on Blood Cholesterol Metabolism

    Directory of Open Access Journals (Sweden)

    A Ri Byun


    Full Text Available Objective. Barley sprout (Hordeum vulgare L. contains 4.97% fat, 52.6% polysaccharide, and 34.1% protein along with a variety of vitamins, minerals, and polyphenolic compounds. Hexacosanol is one such compound from the barley leaf that might improve cholesterol metabolism by decreasing cholesterol synthesis. Method. Therefore, this study was conducted to investigate the effects of barley sprout extract on serum lipid metabolism in healthy volunteers (n=51. Subjects were randomly divided into two groups: one group consumed a single capsule of barley leaf extract daily (n=25, 42.48 ± 13.58 years and the other consumed placebo capsules (n=26, 40.54 ± 11.1 years for 12 weeks. Results. After 12 weeks, total cholesterol and low-density lipoprotein- (LDL- cholesterol were not lower in the barley sprout extract group compared to the placebo group (p=0.415 and p=0.351, resp. and no differences in clinical or laboratory findings were observed between both groups. Conclusion. Our study failed to show significant lipid-lowering effects of barley sprout extract, possibly due to dosage, duration of therapy, and small sample size. Despite our nonsignificant findings, barley sprout has a possibility as a functional health food; therefore future research is needed.

  9. How barley growing conditions and its output change in Hungary

    Directory of Open Access Journals (Sweden)

    Éva Erdélyi


    Full Text Available There is no doubt that climate change has started. It is very important to make effort in developing impact analyses and adaptation strategies. First we were investigated how theproduction risk of winter barley is changing with time using the E,V efficiency criterion. Based on the regional yearly production data of the crop, we can conclude that beside other non-climatic effects, the changing climate has considerable impact on crops yield; its variability is increasing with the variability of meteorological parameters. We have used production data from 1951 to nowadays. Next, using comparison analyses for climate scenarios, we predict what we can expect in the future. For detecting the reasons of risk increase in the past, and forecasting the potential main points of future risk we have analysed statistically whether the climate needs of winter barley will be satisfied ornot in its important periods of growing. Frequency calculations were made based on the daily meteorological data. The situation doesn’t show big change, but It is no doubt that the anomalies of the indicators have been becoming more and more frequent. The morefrequent the extreme weather events are, the more we can be convinced of uncertainty.

  10. Transfer of radiocaesium to barley, rye grass and pea

    International Nuclear Information System (INIS)

    In areas with intensive farming, as in Denmark, it is of great interest to identify possible countermeasures to be taken in order to reduce the longterm effects of radioactive contamination of arable land. The most important longer-lived radionuclides from the Chernobyl were 137Cs and 134Cs. The aim of the present project was to identify crops with relatively low or high root uptake of these two isotopes. Although such differences may be small, a shift in varieties might be a cost-effective way to reduce collective doses. The experiment was carried out at Risoe National Laboratory in the summer of 1988. The species used were: spring barley (Hordeum vulgare L) varieties: Golf, Apex, Anker, Sila; Perennial rye grass (Lolium perenne L.) varieties: Darbo (early) and Patoro (late); Italian rye-grass (Lolium multiflorum) variety: Prego; and pea (Pisum arvense L.) variety: Bodil. Each crop was grown in two types of soil, a clay-loam and an organic soil. 137Cs was added to the clay-loam. The organic soil, which was contaminated with 137Cs from the Chernobyl accident, was supplied with 134Cs. Sila barley and Italian rye-grass were identified among the species tested as plants with a relative high uptake of radio-caesium. (author)

  11. In Vitro Biochemical Characterization of All Barley Endosperm Starch Synthases

    Directory of Open Access Journals (Sweden)

    Jose Antonio Cuesta-Seijo


    Full Text Available Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs. While the overall starch synthase (SS reaction is known, the functional differences between the five SS classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes. Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has maltoligosaccharides and not polysaccharides as its preferred substrates.

  12. [Microsatellite markers and applications in the barley genome]. (United States)

    Feng, Zong-yun; Zhang, Yi-zheng; Ling, Hong-qing


    Microsatellites, also called simple sequence repeats (SSR), are simple, tandemly repeated DNA sequences with a repeat length of a few base pairs,and are very ideally used as molecular markers because of their abundance, high level of polymorphism, co-dominance and ease of assay with the polymerase chain reaction (PCR) by selecting primers as the conserved DNA sequences flanking the SSRs,as well as better stability. The experiments showed that SSRs are randomly distributed throughout the barley genome,and there are 3-18 alleles at a single SSR locus,up to 37 alleles/locus. SSR markers have being widely applied in the construction of molecular genetic map, the study of genetic diversity,the identification of germplasm, gene mapping for important traits and molecular marker-assisted selection. Meanwhile,most of markers are strongly clustered around the centromeric regions of all seven linkage groups. As a result of the clustering,genome coverage with SSRs remains incomplete with an obvious lack of markers on the long arms of chromosomes 1H and 5H and short arm of chromosome 6H. Therefore,it is very potential and necessary to further develop SSR markers in barley. PMID:15979979

  13. Single nucleotide polymorphism discovery in barley using autoSNPdb. (United States)

    Duran, Chris; Appleby, Nikki; Vardy, Megan; Imelfort, Michael; Edwards, David; Batley, Jacqueline


    Molecular markers are used to provide the link between genotype and phenotype, for the production of molecular genetic maps and to assess genetic diversity within and between related species. Single nucleotide polymorphisms (SNPs) are the most abundant molecular genetic marker. SNPs can be identified in silico, but care must be taken to ensure that the identified SNPs reflect true genetic variation and are not a result of errors associated with DNA sequencing. The SNP detection method autoSNP has been developed to identify SNPs from sequence data for any species. Confidence in the predicted SNPs is based on sequence redundancy, and haplotype co-segregation scores are calculated for a further independent measure of confidence. We have extended the autoSNP method to produce autoSNPdb, which integrates SNP and gene annotation information with a graphical viewer. We have applied this software to public barley expressed sequences, and the resulting database is available over the Internet. SNPs can be viewed and searched by sequence, functional annotation or predicted synteny with a reference genome, in this case rice. The correlation between SNPs and barley cultivar, expressed tissue type and development stage has been collated for ease of exploration. An average of one SNP per 240 bp was identified, with SNPs more prevalent in the 5' regions and simple sequence repeat (SSR) flanking sequences. Overall, autoSNPdb can provide a wealth of genetic polymorphism information for any species for which sequence data are available. PMID:19386041


    Directory of Open Access Journals (Sweden)

    Marián Tomka


    Full Text Available Identification and characterization of genotypes is essential for improving the quality of cultivated varieties in breeding programs. Information about the origin of varieties can help farmers in selecting appropriate varieties to specific growing conditions or end use of crops. A set of ten microsatellite markers was used to describe genetic diversity in a sample of 30 barley (Hordeum vulgare L. genotypes. A total of 55 different alleles were amplified using ten SSR markers localized on chromosomes 1H, 2H, 3H, 5H, 6H, 7H with an average number of 5.5 alleles per locus. On the basis of allele frequencies we have calculated diversity index, polymorphic information content and index of probability, which have mean values of 0.664; 0.643 and 0.126 respectively. These values indicate high differentiation ability of SSR markers. In the created dendrogram using hierarchical cluster analysis using UPGMA algorithm we were able to differentiate all 30 barley genotypes. The results show that DNA markers are suitable for the identification and differentiation of genotypes and indicated the effectiveness of microsatellite markers to describe genetic diversity.

  15. Does boron affect hormone levels of barley cultivars?

    Directory of Open Access Journals (Sweden)

    Muavviz Ayvaz


    Full Text Available Background: When mineral nutrients are present in excess or in inadequate amounts, their effects can be severe in plants and can be considered as abiotic stress. In this study, we report how hormonal levels in barley cultivars respond to the toxic effect of boron, an essential plant micronutrient. Material and methods: Two different barley (Hordeum vulgare cultivars (Vamik Hoca and Efes 98 were used as a study material. Boron was applied in three different concentrations (0, 10, 20 ppm to plants that had grown from seeds for four weeks. Plants were harvested, stem-root length and stem-root dry-fresh weight content were determined. For further analysis, chlorophyll, total protein, endogenic IAA and ABA content analyses were carried out. Results: According to the data obtained, plant growth and development decreased with increasing boron concentrations. With increasing boron concentrations, soluble total protein increased in both cultivars. Boron application led to increased endogenic IAA content in both cultivars. 10 and 20 ppm boron application led to increased endogenic ABA content in Vamik Hoca cultivar whereas endogenic ABA content decreased in Efes 98. Absence of boron application led to increased endogenic IAA and ABA content in both cultivars. Conclusion: As a result, the response to boron is different in the two cultivars and Efes 98 may be more resistant to the toxicity than Vamik Hoca cultivar.

  16. Analysis on Interaction between Genotype of Four Main Flavonoids of Barley Grain and Environment

    Institute of Scientific and Technical Information of China (English)

    Tao YANG; Chengli DUAN; Yawen ZENG; Juan DU; Shuming YANG; Xiaoying PU; Shengchao YANG


    [Objective] This study aimed to analyze the interaction between genotype of flavonoids of barley grain and environment, to increase the flavonoid content of barley grain in cultivation and breeding. [Method] In this study, the content of cate- chin, myricetin, quercetin and kaempferol of barley grain planted in Kunming, Qujing and Baoshan were determined by HPLC, and the genotype, environment, genotype- environment interaction of the flavonoid content of barley grain were analyzed. [Result] According to the experimental results, the genotype variance, environmental variance and G x E interaction variance of catechin and kaempferol contents show the same trend: genotype variation 〉 environmental variation 〉 G × E interaction variation, which all reach a extremely significant level; the genotype variance, envi- ronmental variance and G × E interaction variance of quercetin and total flavonoid contents show the same trend: genetype variation 〉 G × E interaction variation 〉 environmental variation, which all reach a extremely significant level; the genotype variance and environmental variance of myricetin content both reach a extremely sig- nificant level, while the G × E interaction variance reaches a significant level, showing an order of genotype variation 〉 environmental variation 〉 G × E interaction variation; the genotype variance, environmental variance and G x E interaction vari- ance of total flavonoid content show an order of genotype variation 〉 environmental variation 〉 G × E interaction variation. Among different barley varieties, Ziguang- mangluoerling and Kuanyingdamai in Qujing, Kunming and Baoshan have relatively high content of quercetin, while other barley varieties barely contain any quercetin. The grains of Ziguangmangluoerling and Kuanyingdamai are purple, while the grains of other barley varieties are yellow. [Conclusion] Four main flavonoids and the total flavonoids of barley grain are mainly under genetic control and

  17. Competition and dry matter yield in intercrops of barley and legume for forage

    Directory of Open Access Journals (Sweden)



    Full Text Available For increasing land use efficiency intercropping plays a pivotal role. Barley (Hordeum vulgare L., vetch (Vicia villosa, and grass pea (Lathyrus sativus L. monocultures as well as mixtures of barley with each of the above legumes, in three seeding ratios (i.e., barley: legume 75:25, 50:50 and 25:75, based on seed numbers were used to investigated forage yield and competition indices such as land equivalent ratio (LER,competitive ratio (CR, relative crowding coefficient (RCC, aggressivity (A, actual yield loss (AYL, monetary advantage index (MAI and intercropping advantage (IA.The experimental was arranged asa randomized complete block design (RCBD with three replications.The results showed that intercropping reduced the dry matter yield of the three component plants, compared with their respective monocrops. The greatest value of total dry matter yield was obtained from barley25-grass pea75 (5.44 t ha-1 mixture, followed by grass pea sole crop (4.99 t ha-1. The total AYL values were positive and greater than 0 in all mixtures, indicating an advantage from intercropping over sole crops. Intercropped barley had a higher relative crowding coefficient (K=1.64 than intercropped legumes (K=1.20, indicating that barley was more competitive than legumes in mixtures. Furthermore, grass pea was more competitive than vetch in mixtures with barley. The highest LER, SPI and MAI were obtained when barley was mixed at a rate of 25% with 75% seed rate of grass pea. It is concluded that intercropping of barley with grass pea has a good potential to improve the performance of forage with high land-use efficiency.

  18. High capacity of plant regeneration from callus of interspecific hybrids with cultivated barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Jensen, C. J.; Andersen, B.;


    Callus was induced from hybrids between cultivated barley (Hordeum vulgare L. ssp. vulgare) and ten species of wild barley (Hordeum L.) as well as from one backcross line ((H. lechleri .times. H. vulgare) .times. H. vulgare). Successful callus induction and regeneration of plants were achieved from...... explants of young spikes on the barley medium J 25-8. The capacity for plant regeneration was dependent on the wild parental species. In particular, combinations with four related wild species, viz. H. jubatum, H. roshevitzii, H. lechleri, and H. procerum, regenerated high numbers of plants from calli....

  19. Comparative Studies on Callose Formation in Powdery Mildew Compatible and Incompatible Barley

    DEFF Research Database (Denmark)

    Skou, Jens-Peder; Jørgensen, Jørgen Helms; Lilholt, Ulla


    -o resistant barley was independent of the powdery mildew culture applied. This supports the hypothesis set forth as to why the ml-o mutants are resistant against all known cultures or races of barley powdery mildew, and why this resistance may be more durable than other powdery mildew resistances....... This is the 1st case where the effect of callose refers to the action of a specific gene. Six susceptible Japanese varieties formed large appositions but they were initiated as late as in other susceptible varieties, and their color was paler than in other barleys. Nine Hordeum spp. [H. capense, H. chilense, H...

  20. Heterologous expression and purification of barley (Hordeum vulgare L.) cysteine protease in yeast

    DEFF Research Database (Denmark)

    Rosenkilde, Anne Lind; Dionisio, Giuseppe; Holm, Preben Bach;


    The mobilization of protein during germination of barley seeds is essential and Cysteine Proteases accounts for more than 90 % of the total proteolytic activity in the degradation of barley seed storage proteins [1]. Cysteine proteases exist as pro-enzyme until activated through reduction...... of the active site cysteines and via removal of the pro-domain. The complement of cysteine proteases is comprehensive and for detailed studies of the individual components of this complement, a fast and efficient eukaryotic expression platform is highly desirable. The barley key cysteine protease, endoprotease...

  1. Distinct developmental defense activations in barley embryos identified by transcriptome profiling

    DEFF Research Database (Denmark)

    Nielsen, ME; Lok, F; Nielsen, Henrik Bjørn


    analyses of > 22,000 genes, which together with measurements of jasmonic acid and salicylic acid during embryo development provide new information on the initiation in the developing barley embryo of at least two distinct types of developmental defense activation (DDA). Early DDA is characterized by the up......-regulation of several PR genes is notable. Throughout barley embryo development, there are no indications of an increased biosynthesis of either jasmonic acid or salicylic acid. Collectively, the results help explain how the proposed DDA enables protection of the developing barley embryo and grain for purposes...

  2. RNA interference-mediated inhibition of Hepatitis B Virus replication

    Institute of Scientific and Technical Information of China (English)

    TANG Ni; ZHANG Bingqiang; YAN Ge; PU Dan; GAO Xiaolin; Tong-Chuan He; HUANG Ailong


    Persistent and recurrent infection of hepatitis B virus (HBV) represents one of the most common and severe viral infections of humans, and has caused a formidable health problem in the affected countries. Currently used antiviral drugs have a very limited success on controlling HBV replication and infection. RNA interference (RNAi), a process by which double-stranded RNA (dsRNA) directs sequence-specific degradation of target mRNA in mammalian and plant cells, has recently been used to knockdown gene expression in various species. In this study, we sought to determine whether RNAi-mediated silencing of HBV viral gene expression could lead to the effective inhibition of HBV replication. We first developed RNAi vectors that expressed small interfering RNA (siRNA) and targeted the HBV core or surface gene sequence. Our results demonstrated that these specific siRNAs efficiently reduced the levels of corresponding viral RNAs and proteins, and thus suppressed viral replication. Treatment with siRNA gave the greatest reduction in the levels of HBsAg (92%) and in HBeAg (85%) respectively in the cultured cell medium. Our findings further demonstrated that the RNAi-mediated antiviral effect was sequence-specific and dose-dependent. Therefore, our findings strongly suggest that RNAi-mediated silencing of HBV viral genes could effectively inhibit the replication of HBV, hence RNAi-based strategy should be further explored as a more efficacious antiviral therapy of HBV infection.

  3. Screening for Barley Waterlogging Tolerance in Nordic Barley Cultivars (Hordeum vulgare L. Using Chlorophyll Fluorescence on Hydroponically-Grown Plants

    Directory of Open Access Journals (Sweden)

    Nils-Ove Bertholdsson


    Full Text Available Waterlogging can reduce crop yield by 20%–50% or more, and lack of efficient selection methods is an obstacle in plant breeding. The methods currently used are mainly indices based on germination ability in Petri dishes and leaf chlorosis in plants grown in waterlogged soils. Cultivation in oxygen-depleted nutrient solution is the ultimate waterlogging system. Therefore methods based on root growth inhibition and on fluorescence in plant material hydroponically grown in oxygen-depleted solution were evaluated against data on biomass accumulation in waterlogged soils. Both traits were correlated with waterlogging tolerance in soil, but since it was easier to measure fluorescence, this method was further evaluated. A selection of F2 plants with high and low fluorescence revealed a small but significant screening effect in F3 plants. A test of 175 Nordic cultivars showed large variations in chlorophyll fluorescence in leaves from oxygen-stressed seedlings, indicating that adaptation to waterlogging has gradually improved over the past 40–50 years with the introduction of new cultivars onto the market. However, precipitation also increased during the period and new cultivars may have inadvertently been adapted to this while breeding barley for grain yield. The results suggest that the hydroponic method can be used for screening barley populations, breeding lines or phenotyping of populations in developing markers for quantitative trait loci.

  4. Differential RNA expression of Bmy1 during seed development and the association with beta-amylase accumulation, activity, and total protein (United States)

    Four genotypes carrying different Bmy1 intron III alleles were analyzed for differences in Bmy1 RNA expression in developing seeds at 17, 19, and 21 days after anthesis (DAA). Ashqelon and PI 296897, wild barleys which carry the Bmy1.c and Bmy1.d intron III alleles, respectively, had 2.5 to 3- fold...

  5. Satellite RNAs interfere with the function of viral RNA silencing suppressors

    Directory of Open Access Journals (Sweden)

    Wanxia eShen


    Full Text Available Viral satellite RNAs (satRNAs are small subviral RNAs and depend on the helper virus for replication and spread. satRNAs can attenuate helper virus-induced symptoms, the mechanism of which remains unclear. Here, we show that two virus-encoded suppressors of RNA silencing (VSRs, Cucumber mosaic virus (CMV 2b and Tombusvirus P19, suppress hairpin RNA (hpRNA-induced silencing of a β-glucuronidase (GUS gene in Nicotiana benthamiana. This suppression can be overcome by CMV Y-satellite RNA (Y-Sat via the Y-Sat-derived small interfering RNAs (siRNAs, which bind to the VSRs and displace the bound hpGUS-derived siRNAs. We also show that microRNA target gene expression in N. tabacum was elevated by CMV infection, presumably due to function of the 2b VSR, but this upregulation of microRNA target genes was reversed in the presence of Y-Sat. These results suggest that satRNA infection minimizes the effect of VSRs on host siRNA and microRNA-directed silencing. Our results suggest that the high abundance of satRNA-derived siRNAs contributes to symptom attenuation by binding helper virus-encoded VSRs, minimizing the capacity of the VSRs to bind host siRNA and miRNA and interfere with their function.

  6. Satellite RNAs interfere with the function of viral RNA silencing suppressors. (United States)

    Shen, Wan-Xia; Au, Phil Chi Khang; Shi, Bu-Jun; Smith, Neil A; Dennis, Elizabeth S; Guo, Hui-Shan; Zhou, Chang-Yong; Wang, Ming-Bo


    Viral satellite RNAs (satRNAs) are small subviral RNAs and depend on the helper virus for replication and spread. satRNAs can attenuate helper virus-induced symptoms, the mechanism of which remains unclear. Here, we show that two virus-encoded suppressors of RNA silencing (VSRs), Cucumber mosaic virus (CMV) 2b and Tombusvirus P19, suppress hairpin RNA (hpRNA)-induced silencing of a β-glucuronidase (GUS) gene in Nicotiana benthamiana. This suppression can be overcome by CMV Y-satellite RNA (Y-Sat) via the Y-Sat-derived small interfering RNAs (siRNAs), which bind to the VSRs and displace the bound hpGUS-derived siRNAs. We also show that microRNA target gene expression in N. tabacum was elevated by CMV infection, presumably due to function of the 2b VSR, but this upregulation of microRNA target genes was reversed in the presence of Y-Sat. These results suggest that satRNA infection minimizes the effect of VSRs on host siRNA and microRNA-directed silencing. Our results suggest that the high abundance of satRNA-derived siRNAs contributes to symptom attenuation by binding helper virus-encoded VSRs, minimizing the capacity of the VSRs to bind host siRNA and miRNA and interfere with their function. PMID:25964791

  7. Pol II-directed short RNAs suppress the nuclear export of mRNA. (United States)

    Komarova, Tatiana V; Schwartz, Anton M; Frolova, Olga Y; Zvereva, Anna S; Gleba, Yuri Y; Citovsky, Vitaly; Dorokhov, Yuri L


    The synthesis and subsequent nuclear export of non-coding RNA (ncRNA) directed by RNA polymerase (Pol) II is very sensitive to abiotic and biotic external stimuli including pathogen challenges. To assess whether stress-induced ncRNAs may suppress the nuclear export of mRNA, we exploited the ability of Agrobacterium tumefaciens to co-deliver Pol I, II and III promoter-based vectors for the transcription of short (s) ncRNAs, GFP mRNA or genomic RNA of plant viruses (Tobacco mosaic virus, TMV; or Potato virus X, PVX) into the nucleus of Nicotiana benthamiana cells. We showed that, in contrast to Pol I- and Pol III-derived sncRNAs, all tested Pol II-derived sncRNAs (U6 RNA, tRNA or artificial RNAs) resulted in decreased expression of GFP and host mRNA. The level of this inhibitory effect depended on the non-coding transcript length and promoter strength. Short coding RNA (scRNA) can also compete with mRNA for nuclear export. We showed that scRNA, an artificial 117-nt short sequence encoding Elastin-Like peptide element tandems with FLAG sequence (ELF) and the 318-nt N. benthamiana antimicrobial peptide thionin (defensin) gene efficiently decreased GFP expression. The stress-induced export of Pol II-derived sncRNA and scRNA into the cytoplasm via the mRNA export pathway may block nucleocytoplasmic traffic including the export of mRNA responsible for antivirus protection. Consistent with this model, we observed that Pol II-derived sncRNAs as well as scRNA, thionin and ELF strongly enhanced the cytoplasmic reproduction of TMV and PVX RNA. PMID:20953971

  8. Predicting RNA-RNA Interactions Using RNAstructure. (United States)

    DiChiacchio, Laura; Mathews, David H


    RNA-RNA binding is a required step for many regulatory and catalytic processes in the cell. Identifying RNA-RNA hybridization sites is challenging because of the competition between intramolecular and intermolecular structure formation. A complete picture of RNA-RNA binding includes an understanding of single-stranded folding and binding site accessibility, and is strongly concentration-dependent. This chapter provides guidance for using RNAstructure to predict RNA-RNA binding sites and RNA-RNA structures, utilizing free energy minimization and partition function calculations. RNAstructure is freely available at . PMID:27665592

  9. Expression of Nudix hydrolase genes in barley under UV irradiation (United States)

    Tanaka, Sayuri; Sugimoto, Manabu; Kihara, Makoto

    Seed storage and cultivation should be necessary to self-supply foods when astronauts would stay and investigate during long-term space travel and habitation in the bases on the Moon and Mars. Thought the sunlight is the most importance to plants, both as the ultimate energy source and as an environmental signal regulating growth and development, UV presenting the sunlight can damage many aspects of plant processes at the physiological and DNA level. Especially UV-C, which is eliminated by the stratospheric ozone layer, is suspected to be extremely harmful and give a deadly injury to plants in space. However, the defense mechanism against UV-C irradiation damage in plant cells has not been clear. In this study, we investigated the expression of Nudix hydrolases, which defense plants from biotic / abiotic stress, in barley under UV irradiation. The genes encoding the amino acid sequences, which show homology to those of 28 kinds of Nudix hydrolases in Arabidopsis thaliana, were identified in the barley full-length cDNA library. BLAST analysis showed 14 kinds of barley genes (HvNUDX1-14), which encode the Nudix motif sequence. A phylogenetic tree showed that HvNUDX1, HvNUDX7, HvNUDX9 and HvNUDX11 belonged to the ADP-ribose pyrophosphohydrolase, ADP-sugar pyrophosphohydrolase, NAD(P)H pyrophosphohydrolase and FAD pyrophosphohydrolase subfamilies, respectively, HvNUDX3, HvNUDX6, and HvNUDX8 belonged to the Ap _{n}A pyrophosphohydrolase subfamilies, HvNUDX5 and HvNUDX14 belonged to the coenzyme A pyrophosphohydrolase subfamilies, HvNUDX12 and HvNUDX13 belonged to the Ap _{4}A pyrophosphohydrolase subfamilies. Induction of HvNUDX genes by UV-A (340nm), UV-B (312nm), and UV-C (260nm) were analyzed by quantitative RT-PCR. The results showed that HvNUDX4 was induced by UV-A and UV-B, HvNUDX6 was induced by UV-B and UV-C, and HvNUDX7 and HvNUDX14 were induced by UV-C, significantly. Our results suggest that the response of HvNUDXs to UV irradiation is different by UV

  10. Expression of a defence-related intercellular barley peroxidase in transgenic tobacco

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Brandt, J.; Bojsen, K.;


    Tobacco plants (Nicotiana benthamiana L.) have been transformed with a T-DNA vector construct carrying the cDNA pBH6-301, encoding the major pathogen induced leaf peroxidase (Prx8) of barley, under control of an enhanced CaMV 35S promoter. Progeny from three independent transformants were analyzed...... genetically, phenotypically and biochemically. The T-DNA was steadily inherited through three generations. The barley peroxidase is expressed and sorted to the intercellular space in the transgenic tobacco plants. The peroxidase can be extracted from the intercellular space in two molecular forms from both...... barley and transgenic tobacco. The tobacco expressed forms are indistinguishable from the barley expressed forms as determined by analytical isoelectric focusing (pI 8.5) and Western-blotting. Staining for N-glycosylation showed that one form only was glycosylated. The N-terminus of purified Prx8 from...

  11. The enhanced callose deposition in barley with ml-o powdery mildew resistance genes

    DEFF Research Database (Denmark)

    Skou, Jens-Peder


    Carborundum treatment of barley leaves induced a callose deposition which was detected as diffuse blotches in the epidermal cells of susceptible barleys and as deeply stained tracks along the scratches in barleys with the ml-o powdery mildew resistance gene. Subsequent inoculation with powdery...... mildew resulted in appositions that enlarged inversely to their size in the respective varieties when inoculated without carborundum treatment. Aphids sucking the leaves resulted in rows of callose containing spots along the anticlinal cell walls. The spots were larger in the ml-o mutant than...... in the mother variety. Callose was deposited in connection with the pleiotropic necrotic spotting in barleys with the ml-o gene. Modification of the necrotic spotting by crossing the ml-o gene into other gene backgrounds did not result in any change in the size of appositions upon inoculation with powdery...

  12. Differentially Expressed Genes between Two Barley Cultivars Contrasting in Drought Tolerance

    Institute of Scientific and Technical Information of China (English)

    P.G. Guo; M. Baum; R.H. Li; S. Grando; R.K. Varshney; J. Valkoun; S. Ceccarelli; A. Grane


    @@ Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas. A number of genes have been described that respond to drought at the transcriptional level (Seki et al., 2002; Cheong et al.,2003).

  13. Long-term reconstitution of dry barley increased phosphorus digestibility in pigs

    DEFF Research Database (Denmark)

    Ton Nu, Mai Anh; Blaabjerg, Karoline; Poulsen, Hanne Damgaard

    digestibility of barley from 40 to 60% (Pfeed phosphate supplementation and P excretion to environment. Studies are needed to evaluate the overall...... effect when reconstituted cereals are mixed with other feedstuffs in formulated diets....

  14. Observations of xenon gas-treated barley cells in solution by atomic force microscopy. (United States)

    Yoshino, T; Sotome, I; Ohtani, T; Isobe, S; Oshita, S; Maekawa, T


    Barley cells cut from a sprout were exposed to either air or high-pressure xenon gas for 3 days and the surface of those cells was observed by atomic force microscopy (AFM) to examine the effect of the gas treatment. This method enabled the direct observation of the fresh surface of the barley cells in solution at high resolution. The cuticle layer was preserved on the primary cell wall of 0.48 MPa xenon gas-treated barley cells, while air-treated barley cells lost the cuticle layer from the primary cell wall. These findings indicate that the high-pressure xenon gas treatment is effective to preserve the cuticle layer attached to the primary cell wall. AFM is a powerful tool for the observation of the surface structure of living plant cells in solution. PMID:11108038

  15. Development and Meiosis of Three Interspecific Hybrids with Cultivated Barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Von Bothmer, R.; Flink, J.; Linde-Laursen, Ib


    The development and meiosis of three interspecific hybrids between cultivated barley (Hordeum vulgare L.) and H. secalinum Schreb., H. tetraploidum Covas, and H. parodii Covas, respectively, were studied. All three hybrid combinations developed very slowly vegetatively. Meiosis of the hybrids...

  16. Genotypes-Independent Optimization of Nitrogen Supply for Isolated Microspore Cultures in Barley (United States)

    Lu, Ruiju; Chen, Zhiwei; Gao, Runhong; He, Ting; Wang, Yifei; Xu, Hongwei; Guo, Guimei; Li, Yingbo


    To establish a high-efficiency system of isolated microspore culture for different barley genotypes, we investigated the effects of nitrogen sources and concentrations on callus induction and plant regeneration in different barley genotypes. The results showed that the organic nitrogen sources greatly increased the callus induction, and the great reduction of total nitrogen sources would significantly decrease the callus induction. And the further optimization experiments revealed that the increasing of organic nitrogen sources was much important in callus induction while it seemed different in plant regeneration. Based on the great effects of organic nitrogen on callus induction, the medium of N6-ANO1/4-2000 might be the best choice for the microspore culture system. In addition, the phylogenetic analysis indicated that there were clear differences of genetic backgrounds among these barley genotypes, and it also suggested that this medium for microspore culture had widespread utilization in different barley genotypes. PMID:27525264


    Directory of Open Access Journals (Sweden)

    Danilova A. V.


    Full Text Available The spread of barley dwarf rust pathogen has been studied in five agro-climatic zones of North Caucasus in 2012-2013. The race composition of the North Caucasian pathogen population was identified

  18. A study of ribonucleoproteins: The sequence of rabbit 18S ribosomal RNA and the identification of proteins associated with messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Connaughton, J.F. Jr.


    This study considers the functional role of ribosomal RNA and messenger ribonucleoproteins in the translational regulation of gene expression. The primary structure of rabbit 18S ribosomal RNA was determined by nucleotide sequence analysis of the RNA directly. Rabbit 18S RNA was cleaved with either T{sub 1} ribonuclease or RNase H, using a Pst 1 DNA linker to generate a unique set of overlapping fragments spanning the entire molecule. Both intact and fragmented 18S RNA were end-labeled with {sup 32}P and base-specifically cleaved enzymatically and chemically. Nucleotide sequences were determined from long polyacrylamide sequencing gels run in formamide. To assess functional roles of RNA in gene expression, specific mRNA-protein interactions were also examined. Eukaryotic mRNA is associated with specific proteins that may be important in translational regulation and mRNA stability; mRNP complexes were reconstituted in a message-dependent, cell-free rabbit reticulocyte translation system, using unique mRNA species transcribed in vitro with SP6 polymerase. Transcripts of both rabbit and human {beta}-globin cDNA were labeled with {sup 32}P either throughout the molecule ore selectively at the 5{prime} and 3{prime} terminus.

  19. Uzu mutation in barley (Hordeum vulgare L.) reduces the leaf unrolling response to brassinolide. (United States)

    Honda, Ichiro; Zeniya, Haruko; Yoneyama, Koichi; Chono, Makiko; Kaneko, Shigenobu; Watanabe, Yoshiaki


    A sensitive method to examine the brassinolide (BL) response of barley (Hordeum vulgare L.) using dark-grown leaf segments was established based on the known method for wheat. BL responses of 53 dwarf isogenic lines of barley were examined, and two lines were found having a uzu gene that doesn't respond significantly. These results indicate that uzu dwarfism may be caused by the non-responding character to BL.

  20. Some cytogenetic effects induced in barley by the treatments with hydroalcoholic rosemary extract


    Ionela Mierlici; Gogu Giorghita; Gabriela Capraru


    The paper presents some results regarding the cytogenetic effects induced in barley by the treatments with rosemary extract (Rosmarinus officinalis). It was proved that the treatment with this extract upon the barley caryopses had as effect the stimulation of the mitotic division in the radicle apex of the species and did not lead to important cytogenetic changes (chromosome aberrations) in the ana-thelophase of the radicle mitoses.

  1. Quantitative Analysis of the Early Powdery Mildew Infection Stages on Resistant Barley Genotypes

    DEFF Research Database (Denmark)

    Andersen, J. B.; Torp, J.


    A classification system was developed, that allowed quantification of the leaf surface development of the barley powdery mildew fungus on barley. An experiment with Manchuria and Pallas as susceptible controls and 4 resistance gene each represented by three lines with different gene backgrounds s...... penetration attempts. This number increased as the degree of resistance increased, i.e. the ESH frequency decreased. The penetration stage also invariably proved to be the limiting stage, where the largest proportion of fungal propagules was stopped....

  2. A fitful fungus from a hot, arid climate increases grain yield in cool-cultivated barley


    Murphy, Brian R.; Fiona M Doohan; HODKINSON, TREVOR R.


    Purpose The fungus Piriformospora indica was first isolated from plants growing in arid, hot desert conditions and has been shown to have significant potential as a biocontrol and biofertilising organism in barley under optimal growth conditions. However, it was not thought to be effective in plants grown in low temperatures and has consequently not been well tested in cold-stressed crops. This study sought to determine the effects of inoculating barley plants with this f...

  3. Digestion of Barley, Maize, and Wheat by Selected Species of Ruminal Bacteria †


    McAllister, Tim A.; Cheng, K.-J.; Rode, Lyle M.; Forsberg, Cecil W.


    Differences in the digestion of barley, maize, and wheat by three major ruminal starch-digesting bacterial species, Streptococcus bovis 26, Ruminobacter amylophilus 50, and Butyrivibrio fibrisolvens A38, were characterized. The rate of starch digestion in all cereal species was greater for S. bovis 26 than for R. amylophilus 50 or B. fibrisolvens A38. Starch digestion by S. bovis 26 was greater in wheat than in barley or maize, whereas starch digestion by R. amylophilus 50 was greater in barl...

  4. Comparative Proteomic Analysis of Aluminum Tolerance in Tibetan Wild and Cultivated Barleys


    Dai, Huaxin; Cao, Fangbin; Chen, Xianhong; Zhang, Mian; Ahmed, Imrul Mosaddek; Chen, Zhong-Hua; Li, Chengdao; Zhang, Guoping; Wu, Feibo


    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation t...

  5. A new allele of acid soil tolerance gene from a malting barley variety


    Bian, Miao; Jin, Xiaoli; Broughton, Sue; Zhang, Xiao-Qi; Zhou, Gaofeng; Zhou, Meixue; Zhang, Guoping; Sun, Dongfa; Li, Chengdao


    Background Acid soil is a serious limitation to crop production all over the world. Toxic aluminium (Al) cations in acid soil inhibit root growth and reduce yield. Although a gene tolerant to acid soil has been identified, it has not been used in malting barley breeding, which is partly due to the acid soil tolerance gene being linked to unfavorable malting quality traits. Results A Brazilian malting barley variety Br2 was identified as tolerant to acid soil. A doubled haploid (DH) population...

  6. Linkage mapping of putative regulator genes of barley grain development characterized by expression profiling

    Directory of Open Access Journals (Sweden)

    Wobus Ulrich


    Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference

  7. Influence of barley straw and submerged macrophytes on fishpond wastewater quality


    Ghobrial, M.G.; Okbah, M.A.; Gharib, S.M.; A. M. Soliman


    Barley straw has received, recently, considerable attention as an algicide, which could be used to control algal growth in fishponds. It is regarded as cost-effective, user friendly and environmentally sounds. On the other hand, the submerged wetland macrophytes are crucial for the stabilization of clear water state in shallow lakes, by their active production of anti-algal compounds (allelochemicals) through allelopathy. Microcosm experiments using barley straw and the submerged macrophytes:...

  8. Sanitary state and yielding of spring barley as dependent on soil tillage method


    Tomasz P. Kurowski; Marek Marks; Agnieszka Kurowska; Krzysztof Orzech


    The effects of traditional tillage cultivation (control treatment), no tillage (instead of tillage the soil was loosened with scruff), and direct sowing (with a special drill into unploughed soil) on the health of spring barley cultivar. Klimek were compared in three-field crop rotation (field bean, winter wheat, spring barley) in an experiment performed in the years 1997-1999 on the soil of a good wheat complex. The results of phytopathological observations carried out over the vegetation se...

  9. Hepatoprotective effect of feeding celery leaves mixed with chicory leaves and barley grains to hypercholesterolemic rats


    Abd El-Mageed, Nehal M.


    Celery, chicory leaves, and barley grains are valuable in weight loss diets and regulate lipid metabolism. They may reduce risk of fatty liver. The present study aimed to investigate the effect of diet supplementation with celery, chicory, and barley powder on liver enzymes and blood lipids in rats fed with cholesterol-enriched diet. This study used four groups of rats fed with 3% cholesterol were supplemented diet to induce hypercholesterolemia and one group was fed on cholesterol-free basal...

  10. Genetically engineered stem rust resistance in barley using the Rpg1 gene


    Horvath, Henriette; Rostoks, Nils; Brueggeman, Robert; Steffenson, Brian; von Wettstein, Diter; Kleinhofs, Andris


    The stem-rust-susceptible barley cv. Golden Promise was transformed by Agrobacterium-mediated transformation of immature zygotic embryos with the Rpg1 genomic clone of cv. Morex containing a 520-bp 5′ promoter region, 4,919-bp gene region, and 547-bp 3′ nontranscribed sequence. Representatives of 42 transgenic barley lines obtained were characterized for their seedling infection response to pathotype Pgt-MCC of the stem rust fungus Puccinia graminis f. sp. tritici. Golden Promise was converte...

  11. Transgenic Production of an Anti HIV Antibody in the Barley Endosperm


    Goetz Hensel; Doreen M Floss; Elsa Arcalis; Markus Sack; Stanislav Melnik; Friedrich Altmann; Twan Rutten; Jochen Kumlehn; Eva Stoger; Udo Conrad


    Barley is an attractive vehicle for producing recombinant protein, since it is a readily transformable diploid crop species in which doubled haploids can be routinely generated. High amounts of protein are naturally accumulated in the grain, but optimal endosperm-specific promoters have yet to be perfected. Here, the oat GLOBULIN1 promoter was combined with the legumin B4 (LeB4) signal peptide and the endoplasmic reticulum (ER) retention signal (SE)KDEL. Transgenic barley grain accumulated up...

  12. Genetic differentiation and geographical Relationship of Asian barley landraces using SSRs


    Rehan Naeem; Lynn Dahleen; Bushra Mirza


    Genetic diversity in 403 morphologically distinct landraces of barley (Hordeum vulgare L. subsp. vulgare) originating from seven geographical zones of Asia was studied using simple sequence repeat (SSR) markers from regions of medium to high recombination in the barley genome. The seven polymorphic SSR markers representing each of the chromosomes chosen for the study revealed a high level of allelic diversity among the landraces. Genetic richness was highest in those from India, followed by P...

  13. Effects of Harvesting Time on Nutritional Value of Hydroponic Barley Production


    AKBAĞ, Hande Işıl; TÜRKMEN, Onur Sinan; BAYTEKİN, Harun; Yurtman, İsmail Yaman


    In this study aimed that the effects of different harvesting times on the nutritional value of barley fodder producing in hydroponic system. Barley fodders were harvested on the 4th, 7th, 10th and 13th days following sowing date. Analysis performed for determining the chemical composition and organic matter digestibility (OMD) and ME content with in vitro gas production technique. It was determined that the DM content was decreased, the CP content was not changed significantly, cell wall cont...

  14. A Single Locus Is Responsible for Salinity Tolerance in a Chinese Landrace Barley (Hordeum vulgare L.)


    Rugen Xu; Junmei Wang; Chengdao Li; Peter Johnson; Chao Lu; Meixue Zhou


    INTRODUCTION: Salinity and waterlogging are two major abiotic stresses severely limiting barley production. The lack of a reliable screening method makes it very hard to improve the tolerance through breeding programs. METHODS: This work used 188 DH lines from a cross between a Chinese landrace variety, TX9425 (waterlogging and salinity tolerant), and a Japanese malting barley, Naso Nijo (waterlogging and salinity sensitive), to identify QTLs associated with the tolerance. RESULTS: Four QTLs ...

  15. Identification of thioredoxin target disulfides in proteins released from barley aleurone layers

    DEFF Research Database (Denmark)

    Hägglund, Per; Bunkenborg, J.; Yang, Fen;


    Thioredoxins are ubiquitous disulfide reductases involved in a wide range of cellular processes including DNA synthesis, oxidative stress response and apoptosis. In cereal seeds thioredoxins are proposed to facilitate the germination process by reducing disulfide bonds in storage proteins and oth...... targets in the starchy endosperm. Here we have applied a thiol-specific labeling approach to identify specific disulfide targets of barley thioredoxin in proteins released from barley aleurone layers incubated in buffer containing gibberellic acid....

  16. Cyclitols in maturing grains of wheat, triticale and barley

    Directory of Open Access Journals (Sweden)

    Lesław B. Lahuta


    Full Text Available In the present study, the feeding of stem-flag leaf-ear explants of wheat, triticale and barley with d-chiro-inositol and d-pinitol was used for modification of the composition of soluble carbohydrates in grains without genetic transformation of plants. Maturing grains indicated ability to uptake exogenously applied cyclitols, not occurring naturally in cereal plants, and synthesized their a-d-galactosides. The pattern of changes in soluble carbohydrates during grain maturation and germination was not disturbed by the uptake and accumulation of cyclitols. Both, d-chiro-inositol and d-pinitol as well as their a-d-galactosides can be an additional pool of soluble carbohydrates accumulated by maturing grains, without decreasing seeds viability. This is the first report indicating the possibility of introduction of cyclitols with potentially human health benefits properties into cereal grains.

  17. Biomechanics of Wheat/Barley Straw and Corn Stover

    Energy Technology Data Exchange (ETDEWEB)

    Christopher T. Wright; Peter A. Pryfogle; Nathan A. Stevens; Eric D. Steffler; J. Richard Hess; Thomas H. Ulrich


    The lack of understanding of the mechanical characteristics of cellulosic feedstocks is a limiting factor in economically collecting and processing crop residues, primarily wheat and barley stems and corn stover. Several testing methods, including compression, tension, and bend have been investigated to increase our understanding of the biomechanical behavior of cellulosic feedstocks. Biomechanical data from these tests can provide required input to numerical models and help advance harvesting, handling, and processing techniques. In addition, integrating the models with the complete data set from this study can identify potential tools for manipulating the biomechanical properties of plant varieties in such a manner as to optimize their physical characteristics to produce higher value biomass and more energy efficient harvesting practices.

  18. Molecular Variability in Barley Structural Mutants Produced by Gamma Irradiation

    International Nuclear Information System (INIS)

    Single Sequence Repeat (SSR) and Amplified Fragment Length Polymorphism (AFLP) markers were used to survey gamma ray induced genetic variation in a set of 13 originally produced structural barley (H. vulgare L.) mutants from cv. Freya; including 8 single translocation lines, 3 double translocation lines and 2 multiple reconstructed karyotypes. Both marker systems contributed to the evaluation of the radiation induced DNA alterations and revealed in general 0.49% polymorphisms in the studied genotypes. AFLPs were observed with 3 out of 10 PstI/MseI primer combinations. Transmissible microsatellite instability at loci with perfect (AT)n repeats located in the introns of the rubisco activase and waxy was documented in three mutant lines. The results emphasize that in addition to point mutations, small indels (2bp) form the major group of the gamma induced DNA alterations. (author)

  19. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian;


    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS...... classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...

  20. Modelling phytate degradation kinetics in soaked wheat and barley

    DEFF Research Database (Denmark)

    Blaabjerg, Karoline; Strathe, A B; Poulsen, Hanne Damgaard


    the contact between phytate and plant phytases. The lack of effect of additions of Phytase 1 or Phytase 2 on the phytate degradation in the cereals was possible due to a poor access of the microbial phytases to phytate. Therefore, more knowledge is needed about processing technologies that increase the access...... or Phytase 2 had no effect on the degradation of phytate. The F0 was greater in the heat-treated barley compared with the heat-treated wheat (0.19 vs. 0.14; P=0.02; Phytase 1). Heat-treatment of the cereals increased the F0 from 0.05 to 0.15 (P=0.0007; Phytase 2). The K was lower in the non...

  1. Androgenic response to preculture stress in microspore cultures of barley. (United States)

    Oleszczuk, S; Sowa, S; Zimny, J


    Various stresses such as starvation and cold or heat shocks have been identified as triggers in the induction of the microspore embryogenesis. This study attempts to quantify the effects of different pretreatment conditions for successful microspore culture of malting barley (cv. Scarlett). While the sporophytic microspore development could be induced from treated and nontreated microspores, abiotic stress was essential for embryo formation and plant regeneration. The type of stress treatment applied affected the numbers and the ratios of albino and green plants regenerated, as well as their fertility. The highest number of green plants was obtained after the treatment of anthers in 0.3 M mannitol at 32 degrees C for 24 h before microspore culture. PMID:16937060

  2. The barley genome sequence assembly reveals three additional members of the CslF (1,3;1,4-β-glucan synthase gene family.

    Directory of Open Access Journals (Sweden)

    Miriam Schreiber

    Full Text Available An important component of barley cell walls, particularly in the endosperm, is (1,3;1,4-β-glucan, a polymer that has proven health benefits in humans and that influences processability in the brewing industry. Genes of the cellulose synthase-like (Csl F gene family have been shown to be involved in (1,3;1,4-β-glucan synthesis but many aspects of the biosynthesis are still unclear. Examination of the sequence assembly of the barley genome has revealed the presence of an additional three HvCslF genes (HvCslF11, HvCslF12 and HvCslF13 which may be involved in (1,3;1,4-β-glucan synthesis. Transcripts of HvCslF11 and HvCslF12 mRNA were found in roots and young leaves, respectively. Transient expression of these genes in Nicotiana benthamiana resulted in phenotypic changes in the infiltrated leaves, although no authentic (1,3;1,4-β-glucan was detected. Comparisons of the CslF gene families in cereals revealed evidence of intergenic recombination, gene duplications and translocation events. This significant divergence within the gene family might be related to multiple functions of (1,3;1,4-β-glucans in the Poaceae. Emerging genomic and global expression data for barley and other cereals is a powerful resource for characterising the evolution and dynamics of complete gene families. In the case of the CslF gene family, the results will contribute to a more thorough understanding of carbohydrate metabolism in grass cell walls.

  3. The barley Frost resistance-H2 locus. (United States)

    Pasquariello, Marianna; Barabaschi, Delfina; Himmelbach, Axel; Steuernagel, Burkhard; Ariyadasa, Ruvini; Stein, Nils; Gandolfi, Francesco; Tenedini, Elena; Bernardis, Isabella; Tagliafico, Enrico; Pecchioni, Nicola; Francia, Enrico


    Frost resistance-H2 (Fr-H2) is a major QTL affecting freezing tolerance in barley, yet its molecular basis is still not clearly understood. To gain a better insight into the structural characterization of the locus, a high-resolution linkage map developed from the Nure × Tremois cross was initially implemented to map 13 loci which divided the 0.602 cM total genetic distance into ten recombination segments. A PCR-based screening was then applied to identify positive bacterial artificial chromosome (BAC) clones from two genomic libraries of the reference genotype Morex. Twenty-six overlapping BACs from the integrated physical-genetic map were 454 sequenced. Reads assembled in contigs were subsequently ordered, aligned and manually curated in 42 scaffolds. In a total of 1.47 Mbp, 58 protein-coding sequences were identified, 33 of which classified according to similarity with sequences in public databases. As three complete barley C-repeat Binding Factors (HvCBF) genes were newly identified, the locus contained13 full-length HvCBFs, four Related to AP2 Triticeae (RAPT) genes, and at least five CBF pseudogenes. The final overall assembly of Fr-H2 includes more than 90 % of target region: all genes were identified along the locus, and a general survey of Repetitive Elements obtained. We believe that this gold-standard sequence for the Morex Fr-H2 will be a useful genomic tool for structural and evolutionary comparisons with Fr-H2 in winter-hardy cultivars along with Fr-2 of other Triticeae crops.

  4. Primer extension studies on alpha-amylase mRNAs in barley aleurone. II. Hormonal regulation of expression. (United States)

    Chandler, P M; Jacobsen, J V


    Relative levels of different alpha-amylase mRNAs were assessed by primer extension experiments using RNA prepared from aleurone of barley (Hordeum vulgare L. cv. Himalaya). Three different aleurone systems were studied: protoplasts prepared from aleurone layers, isolated aleurone layers, and aleurone from germinated grain. Oligonucleotide primers specific for the low-pI and high-pI alpha-amylase groups allowed the levels of different alpha-amylase mRNAs to be assessed both within and between the two groups. In all aleurone systems the same set of alpha-amylase mRNAs was produced in response to either applied gibberellic acid (aleurone protoplasts, isolated aleurone layers) or, presumably, native gibberellin(s) (germinated grain). This result indicates that the same set of genes is being expressed in each case. Differences were observed between the different aleurone systems in regulation of levels of alpha-amylase mRNAs. In particular, the regulation of alpha-amylase mRNA levels in aleurone of germinated grain has unique features which are not adequately explained by the response of isolated aleurone layers to gibberellic acid.

  5. The effect of irradiation treatment on Beta-Glucan and protein quality of barley

    International Nuclear Information System (INIS)

    Samples of barley (hordeum vulgare L) grains were tested for nutritional value after being irradiated at dose levels of 10, 20, and 30 KGy. The gross composition of raw and irradiated beans was similar. Soluble protein was reduced by 16.76%, 28.84% and 44.76% when barley grains were irradiated at 10, 20, and 30 KGy, respectively, The amount of water-soluble beta-glucan in raw barley was increased linearly from 1.76 to 2.40 g/100 g of sample as a function of dose. Meanwhile, the effect of irradiation treatment on total beta-glucan (3.90 g/100 g) was insignificant while the level of insoluble beta-glucan was decreased with increasing the dose levels of irradiation. The protein efficiency ratio (PER) of processed barley grains at the doses applied was increased by 6.38%, 12.77%, and 1135%, respectively as compared with the value for raw grains. The data showed that the radiation processing of raw barley grains increased the solubility of beta-glucan, the most anti nutritional factor in the grains and improved the PER in rats. Therefore it could be concluded thal the irradiation treatment (up tp 30 KGy) up-grade the biological value of barley through increase the solubility of Beta-glucan that affect the performance of animals

  6. Consolidated conversion of hulled barley into fermentable sugars using chemical, thermal, and enzymatic (CTE) treatment. (United States)

    Kim, Tae Hyun; Nghiem, Nhuan P; Taylor, Frank; Hicks, Kevin B


    A novel process using chemical, thermal, and enzymatic treatment for conversion of hulled barley into fermentable sugars was developed. The purpose of this process is to convert both lignocellulosic polysaccharides and starch in hulled barley grains into fermentable sugars simultaneously without a need for grinding and hull separation. In this study, hulled barley grains were treated with 0.1 and 1.0 wt.-% sulfuric acid at various temperatures ranging from 110 to 170 °C in a 63-ml flow-through packed-bed stainless steel reactor. After sulfuric acid pretreatment, simultaneous conversion of lignocellulose and starch in the barley grains into fermentable sugars was performed using an enzyme cocktail, which included α-amylase, glucoamylase, cellulase, and β-glucosidase. Both starch and non-starch polysaccharides in the pre-treated barley grains were readily converted to fermentable sugars. The treated hulled barley grains, including their hull, were completely hydrolyzed to fermentable sugars with recovery of almost 100% of the available glucose and xylose. The pretreatment conditions of this chemical, thermal, and enzymatic (CTE) process for achieving maximum yield of fermentable sugars were 1.0 wt.% sulfuric acid and 110 °C. In addition to starch, the acid pretreatment also retained most of the available proteins in solid form, which is essential for subsequent production of fuel ethanol and high protein distiller's dried grains with solubles co-product. PMID:21229334

  7. Diversity for seedling vigor in wild barley (hordeum vulgare L. subs. simpatina) germplasm

    International Nuclear Information System (INIS)

    Seedling vigor is important for improving stand establishment of barley crops, particularly in arid regions and areas where the soil temperature is low at sowing time. Three hundred and fifteen wild barley accessions from the Wild Barley Diversity Collection (WBDC) were evaluated for nine seedling vigor traits in a poly house and growth chamber under hydroponic conditions. The accessions exhibited significant differences for all traits investigated. Traits showing greatest phenotypic variation were seedling visual score, plant height, shoot fresh weight, shoot dry weight and shoot length. Seed weight exhibited the least variation. Seed weight was significantly correlated with visual seedling score and shoot and seedling fresh and dry weight. Correlation analysis showed that the visual seedling score was a reliable method for estimating seedling vigor in wild barley. The first three principal components (PC) explained 82.3% of the variation present in the WBDC with PC1(54.0%) associated with shoot fresh weight, shoot dry weight, seedling dry weight, seedling fresh weight, shoot length and seedling length. Accessions from the southwest portion of the Fertile Crescent, like WBDC020 (Turkey), WBDC238 (Jordan) and WBDC244 (Jordan) exhibited the highest positive values for most of the plant vigor traits investigated. These wild barley accessions likely carry alleles that will be useful for the improvement of plant vigor traits in cultivated barley. (author)

  8. Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. (United States)

    Saghai Maroof, M A; Biyashev, R M; Yang, G P; Zhang, Q; Allard, R W


    This study was undertaken to assess the extent of genetic variation in barley simple sequence repeats (SSRs) and to study the evolutionary dynamics of SSR alleles. SSR polymorphisms were resolved by the polymerase chain reaction with four pairs of primers. In total, 71 variants were observed in a sample of 207 accessions of wild and cultivated barley. Analyses of wheat-barley addition lines and barley doubled haploids identified these variants (alleles) with four loci, each located on a different chromosome. The numbers of alleles detected at a locus corresponded to the number of nucleotide repeats in the microsatellite sequences. The numbers of alleles at two loci were 28 and 37; to our knowledge these are the largest numbers of alleles for single Mendelian loci reported in plants. Three alleles were resolved by each of the other two loci. Allelic diversity was greater in wild than in cultivated barley and surveys of two generations (F8 and F53) of Composite Cross II, an experimental population of cultivated barley, showed that few of the alleles present in the 28 parents survived into generation F53, whereas some infrequent alleles reached high frequencies. Such changes in frequency indicate that the chromosomal segments marked by the SSR alleles are under the influence of natural selection. The SSR variants allow specific DNA sequences to be followed through generations. Thus, the great resolving power of SSR assays may provide clues regarding the precise targets of natural and man-directed selection. PMID:8202509

  9. Advances in the use of mutation induction for genetic improvement of barley and native grains in Peru

    International Nuclear Information System (INIS)

    Barley seeds of two varieties were treated with several doses of gamma rays and sodium azide. Seeds of a quinoa (Chenopodium) variety were treated with three doses of gamma rays. Yield trials were conducted also for doubled haploid lines of barley derived from earlier mutagenic treatments. Some promising new barley mutant lines were identified in the yield trials. The results from the Chenopodium trials facilitate the determination of the optimum dose of gamma rays for the PRQ-22 variety. (author)

  10. Some quality attributes of low fat ice cream substituted with hulless barley flour and barley ß-glucan. (United States)

    Abdel-Haleem, Amal M H; Awad, R A


    The purpose of this paper is to investigate some quality attributes of low fat ice cream (LFIC) substituted with hulless barley flour (HBF) and barley ß-glucan (BBG). The methodology included in this paper is based on adding HBF (1, 2, 3 and 4 %) as a partial substitution of skim milk powder (SMP) and BBG (0.40 %) as a complete substitution of carboxy methyl cellulose (CMC). All mixes and resultant ice cream samples were evaluated for their physicochemical properties as well as the sensory quality attributes.The results indicated that substitution of SMP with HBF significantly increased total solids (TS), fat and crude fiber, while crude protein and ash significantly decreased in ice cream mixes. BBG exhibited the same manner of control. Specific gravity was gradually increased with adding HBFand BBG in the mixes and therefore the overrun percent was significantly changed in the resultant ice cream. Adding HBF in ice cream formula led to significant decrease in acidity with higher freezing point and the product showed higher ability to meltdown. BBG treatment showed the same trend of control. Values of flow time and viscosity significantly increased with increasing HBF in the ice cream mixes, but these values significantly decreased in BBG mix. The time required to freeze ice cream mixes was decreased with increasing the ratio of HBF but, increased in BBG treatment. The substitution of SMP with 1 and 2 % HBF significantly (P ≤ 0.05) enhanced sensory attributes of ice cream samples. While, BBG treatment achieved mild score and acceptability. PMID:26396387

  11. The sexed shape of Helminthosporium gramineum Rabh. fungus involved in increasing disease damage of torn leaves in barley

    Directory of Open Access Journals (Sweden)

    Viorel FLORIAN


    Full Text Available The onset of some sclerotic formations are reported on barley straws on which the following microscopic investigations and biometrical measurements peritecia, ascia and ascospores of Pyrenophora graminea (Rabh. Ito et Kurib. were detected, representing the sexed multiplication of fungus Helminthosporium gramineum, the pathogenic factor causing leaf tearing in barley, a condition rarely encountered in nature. Owing to the great number of peritecia on barley straw residues, we are of the opinion that the sexed multiplication of fungus represents a real danger in barley cultivation assigning the efficient control steps against this pest.

  12. Development and Characterization of Polymorphic EST-SSR and Genomic SSR Markers for Tibetan Annual Wild Barley


    Mian Zhang; Weihua Mao; Guoping Zhang; Feibo Wu


    Tibetan annual wild barley is rich in genetic variation. This study was aimed at the exploitation of new SSRs for the genetic diversity and phylogenetic analysis of wild barley by data mining. We developed 49 novel EST-SSRs and confirmed 20 genomic SSRs for 80 Tibetan annual wild barley and 16 cultivated barley accessions. A total of 213 alleles were generated from 69 loci with an average of 3.14 alleles per locus. The trimeric repeats were the most abundant motifs (40.82%) among the EST-SSRs...

  13. Combining mechanical rhizome removal and cover crops for Elytrigia repens control in organic barley systems

    DEFF Research Database (Denmark)

    Melander, B; Nørremark, M; Kristensen, E F


    -vetch-mustard mixture) on Elytrigia repens rhizome removal, shoot growth and suppression of a subsequent barley crop was examined in two growing seasons. Four passes with a modified rotary cultivator, where each pass was followed by rhizome removal, reduced E. repens shoot growth in barley by 84% and 97%. In general......, the cover crop developed poorly and did not affect barley or E. repens. Barley yield was only affected by treatments in the first season, where yield was negatively correlated with E. repens shoot biomass. The concept has potential for the control of severe E. repens infestations, but future research...

  14. Human 2'-phosphodiesterase localizes to the mitochondrial matrix with a putative function in mitochondrial RNA turnover

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave; Andersen, Kasper Røjkjær; Kjær, Karina Hansen;


    . Interestingly, 2′-PDE shares both functionally and structurally characteristics with the CCR4-type exonuclease–endonuclease–phosphatase family of deadenylases. Here we show that 2′-PDE locates to the mitochondrial matrix of human cells, and comprise an active 3′–5′ exoribonuclease exhibiting a preference...... for oligo-adenosine RNA like canonical cytoplasmic deadenylases. Furthermore, we document a marked negative association between 2′-PDE and mitochondrial mRNA levels following siRNA-directed knockdown and plasmid-mediated overexpression, respectively. The results indicate that 2′-PDE, apart from playing...... a role in the cellular immune system, may also function in mitochondrial RNA turnover....

  15. Knockdown of midgut genes by dsRNA-transgenic plant-mediated RNA interference in the hemipteran insect Nilaparvata lugens.

    Directory of Open Access Journals (Sweden)

    Wenjun Zha

    Full Text Available BACKGROUND: RNA interference (RNAi is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. METHODOLOGY/PRINCIPAL FINDINGS: The Hemipteran insect brown planthopper (Nilaparvata lugens Stål is a typical phloem sap feeder specific to rice (Oryza sativa L.. To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. CONCLUSIONS: Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants.

  16. MRI-assessed therapeutic effects of locally administered PLGA nanoparticles loaded with anti-inflammatory siRNA in a murine arthritis model

    DEFF Research Database (Denmark)

    Te Boekhorst, Bernard C M; Jensen, Linda B; Colombo, Stefano;


    for disease remission. We evaluated the anti-inflammatory effects of poly(dl-lactide-co-glycolide acid) (PLGA) nanoparticles loaded with small interfering RNA (siRNA) directed against TNF-a in vitro and in vivo. The siRNA-loaded PLGA nanoparticles mediated a dose-dependent TNF-a silencing....... In addition, proper siRNA dosing seems to be important for a positive therapeutic outcome in vivo. However, further studies are needed to fully clarify the mechanism(s) underlying the observed anti-inflammatory effects of the siRNA-loaded nanoparticles....... with nanoparticles loaded with TNF-a siRNA (1µg) resulted in a reduction in disease activity, evident by a significant decrease of the paw scores and joint effusions, as compared to treatment with PLGA nanoparticles loaded with non-specific control siRNA, whereas the degree of bone marrow edema in the tibial...

  17. Comparison of different pretreatment strategies for enzymatic hydrolysis of wheat and barley straw. (United States)

    Rosgaard, Lisa; Pedersen, Sven; Meyer, Anne S


    In biomass-to-ethanol processes a physico-chemical pretreatment of the lignocellulosic biomass is a critical requirement for enhancing the accessibility of the cellulose substrate to enzymatic attack. This report evaluates the efficacy on barley and wheat straw of three different pretreatment procedures: acid or water impregnation followed by steam explosion versus hot water extraction. The pretreatments were compared after enzyme treatment using a cellulase enzyme system, Celluclast 1.5 L from Trichoderma reesei, and a beta-glucosidase, Novozyme 188 from Aspergillus niger. Barley straw generally produced higher glucose concentrations after enzymatic hydrolysis than wheat straw. Acid or water impregnation followed by steam explosion of barley straw was the best pretreatment in terms of resulting glucose concentration in the liquid hydrolysate after enzymatic hydrolysis. When the glucose concentrations obtained after enzymatic hydrolyses were related to the potential glucose present in the pretreated residues, the highest yield, approximately 48% (g g-1), was obtained with hot water extraction pretreatment of barley straw; this pretreatment also produced highest yields for wheat straw, producing a glucose yield of approximately 39% (g g-1). Addition of extra enzyme (Celluclast 1.5 L+Novozyme 188) during enzymatic hydrolysis resulted in the highest total glucose concentrations from barley straw, 32-39 g L-1, but the relative increases in glucose yields were higher on wheat straw than on barley straw. Maldi-TOF MS analyses of supernatants of pretreated barley and wheat straw samples subjected to acid and water impregnation, respectively, and steam explosion, revealed that the water impregnated + steam-exploded samples gave a wider range of pentose oligomers than the corresponding acid-impregnated samples.

  18. Effect of Enzyme Supplementation and Irradiation of Barley on Broiler Chicks Performance

    International Nuclear Information System (INIS)

    The experiments were conducted to study the influence of irradiation treatment at dose levels of 0.20 and 60 kGy on barley beta-glucan and the effect of enzyme supplementation and irradiation of barley on broiler chicks performance. The amount of total and water-soluble beta-glucan in raw barley was 36 kg-1, respectively. The effect of irradiation treatment on total beta-glucan was insignificant while the level of soluble beta-glucan was increased with increasing the dose levels of irradiation. The effect of irradiation treatment and enzyme supplementation of barley diets on growth and conversion performance of broiler chicks indicated that birds fed raw barley diet had lower body weight, body weight gain and feed conversion than those fed control diet throughout the experimental period. Irradiation of barley at dose of 20 kGy did not affect the chick performance (feed consumption, weight gain feed-gain ratio) that received the B 20 diet from 7 to 21 days of age, but when bird maintained on B 20 diet from 7 28 days of age, only feed-gain ratio was improved by 14.4%. The results indicate that there was a significant effect of irradiation of barley at 60 kGy (B 60) on feed -gain ratio of chicks when were fed B 60 diet from 7 to 21 days of age. The corresponding improvement in feed-gain ratio was 16.4%. When birds were fed B 60 diet from 7-28 days of age, the improvement in body weight and feed-gain ratio was 25.5 and 19.6%, respectively

  19. Do 14-3-3 proteins and plasma membrane H+-AtPases interact in the barley epidermis in response to the barley powdery mildew fungus?

    DEFF Research Database (Denmark)

    Finni, Christine; Andersen, Claus H; Borch, Jonas;


    , or treatment with fusicoccin, results in an increase in fusicoccin binding ability of barley leaf membranes. Overlay assays show a fungus-induced increase in binding of digoxygenin-labelled 14-3-3 protein to several proteins including a 100 kDa membrane protein, probably the plasma membrane H...

  20. Do 14-3-3 proteins and plasma membrane H+-ATPases interact in the barley epidermis in response to the barley powdery mildew fungus?

    DEFF Research Database (Denmark)

    Finnie, C.; Andersen, C.H.; Borch, J.;


    , or treatment with fusicoccin, results in an increase in fusicoccin binding ability of barley leaf membranes. Overlay assays show a fungus-induced increase in binding of digoxygenin-labelled 14-3-3 protein to several proteins including a 100 kDa membrane protein, probably the plasma membrane H...

  1. Mapping genes in barley for resistance to Puccinia coronata from couch grass and to P. striiformis from brome, wheat and barley

    NARCIS (Netherlands)

    Niks, R.E.; Alemu, Sisay K.; Marcel, T.C.; Heyzen, van Skye


    Barley (Hordeum vulgare L.) mapping populations have been developed that are useful to study the inheritance of quantitative resistance to adapted and unadapted rust fungi. In a recent host range study, we found that the parents of those mapping populations also differed in their resistance to th

  2. Barley Yellow Mosaic Virus VPg Is the Determinant Protein for Breaking eIF4E-Mediated Recessive Resistance in Barley Plants (United States)

    Li, Huangai; Kondo, Hideki; Kühne, Thomas; Shirako, Yukio


    In this study, we investigated the barley yellow mosaic virus (BaYMV, genus Bymovirus) factor(s) responsible for breaking eIF4E-mediated recessive resistance genes (rym4/5/6) in barley. Genome mapping analysis using chimeric infectious cDNA clones between rym5-breaking (JT10) and rym5-non-breaking (JK05) isolates indicated that genome-linked viral protein (VPg) is the determinant protein for breaking the rym5 resistance. Likewise, VPg is also responsible for overcoming the resistances of rym4 and rym6 alleles. Mutational analysis identified that amino acids Ser-118, Thr-120, and His-142 in JT10 VPg are the most critical residues for overcoming rym5 resistance in protoplasts. Moreover, the rym5-non-breaking JK05 could accumulate in the rym5 protoplasts when eIF4E derived from a susceptible barley cultivar was expressed from the viral genome. Thus, the compatibility between VPg and host eIF4E determines the ability of BaYMV to infect barley plants. PMID:27746794

  3. Observed and predicted changes over eight years in frequency of barley powdery mildew avirulent to spring barley in France and Denmark

    DEFF Research Database (Denmark)

    Bousset, L.; Hovmøller, M.S.; Caffier, V.;


    Aerial populations of Blumeria graminis f.sp. hordei were studied in two French and two Danish regions from 1991 to 1999, at a time of year when only winter barley was present. A high frequency of genotypes not able to grow on the spring-sown crop of the previous growing season (denoted 'spring-a...

  4. Effects of sulfur nutritional level on cadmium toxicity in barley

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yichang; Huerta, A.J. (Miami Univ., Oxford, OH (United States))


    The effects of S levels on Cd toxicity were studied in barley (Hordeum vulgare 476). Barley was grown hydroponically in half-strength Hoagland's solution containing either 100% or 10% S in a growth chamber at constant 20 C, 290 umole M[sup [minus]2] s[sup [minus]1] light intensity, and a 16/18 hour light/dark period. Five days after the first true leaf appeared, 15 uM Cd was added to the nutrient solutions where appropriate. At 14 days after beginning of Cd treatment, plants were analyzed for photosynthetic characteristics. The photosynthetic characteristics measured were CO[sub 2] response curves (measured with a LICOR 6200 portable photosynthesis system), and fluorescence measurement system. At 21 days they were analyzed for morphological and biomass measurements. The CO[sub 2] response curves for leaves of plants treated with 10% S did not significantly differ from those of plants treated with 100% S. Treatment with Cd significantly reduced the CO[sup 2] saturated rates of photosynthesis and the reduction was more significant in the 10% S than in the 100% S plants. Photochemical efficiency of PSII (FV/FM) and fluorescence quenching capacity (FQ) were not affected by 10% S as compared to 100% S treatment. Interestingly, treatment with Cd significantly increased both FV/FM and FQ as compared to control., However, S level had no effect on the fluorescence parameters of Cd-treated plants. Leaf and root length, leaf area, root and shoot dry weight were only slightly affected (increased or decreased) by 10% S as compared to 100% S but very significantly reduced by treatment with Cd. Our results agree with the previous reports which show that S (an important component of glutathione and phytochelatins which are low molecular weight Cd binding proteins), is important in regulating Cd detoxification in plants. However, we are continuing to conduct experiments as even lower S concentrations and different Cd concentrations.

  5. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage


    Guo, P; Baum, M.; Grando, S.; Ceccarelli, S.; Bai, G.; Li, R; Von Korff, M; Varshney, R.,; Graner, A.; Valkoun, V.


    Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas worldwide. Identification of the genes responsible for drought tolerance in barley (Hordeum vulgare L.) will facilitate understanding of the molecular mechanisms of drought tolerance, and also facilitate the genetic improvement of barley through marker-assisted selection or gene transformation. To monitor the changes in gene expression at the transcriptional level in barley leaves during the repro...

  6. Comparing Multiple Reaction Monitoring and Sequential Window Acquisition of All Theoretical Mass Spectra for the Relative Quantification of Barley Gluten in Selectively Bred Barley Lines. (United States)

    Colgrave, Michelle L; Byrne, Keren; Blundell, Malcolm; Heidelberger, Sibylle; Lane, Catherine S; Tanner, Gregory J; Howitt, Crispin A


    Celiac disease (CD) is a disease of the small intestine that occurs in genetically susceptible subjects triggered by the ingestion of cereal gluten proteins for which the only treatment is strict adherence to a life-long gluten-free diet. Barley contains four gluten protein families, and the existence of barley genotypes that do not accumulate the B-, C-, and D-hordeins paved the way for the development of an ultralow gluten phenotype. Using conventional breeding strategies, three null mutations behaving as recessive alleles were combined to create a hordein triple-null barley variety. Proteomics has become an invaluable tool for characterization and quantification of the protein complement of cereal grains. In this study multiple reaction monitoring (MRM) mass spectrometry, viewed as the gold standard for peptide quantification, was compared to the data-independent acquisition strategy known as SWATH-MS (sequential window acquisition of all theoretical mass spectra). SWATH-MS was comparable (p gluten) in eight barley lines. The results of SWATH-MS analysis further confirmed the absence of the B-, C-, and D-hordeins in the triple-null barley line and showed significantly reduced levels ranging from <1% to 16% relative to wild-type (WT) cv Sloop for the minor γ-hordein class. SWATH-MS represents a valuable tool for quantitative proteomics based on its ability to generate reproducible data comparable with MRM-MS, but has the added benefits of allowing reinterrogation of data to improve analytical performance, ask new questions, and in this case perform quantification of trypsin-resistant proteins (C-hordeins) through analysis of their semi- or nontryptic fragments. PMID:27533879


    Directory of Open Access Journals (Sweden)

    S. VOIA


    Full Text Available The objective of our researches was to observe the nutritive and productive effect of the ratio, offered at discretion, composed of alfalfa hay and barley under the following presentation forms: whole grains, roughly ground (4mm with and without addition of yeast, strain Yea-Sacc1026, to lambs submitted for fattening. The experiment lasted 54 days, the biological material was represented by Turcana lambs, grouped in three lots (n=12. Growth performances were significant bigger (p< 0.04 for the final body weight, total weight gain and average daily gain, but the specific intake was decreased with 0.49 UNC in lambs that consumed ground barley prior to those that consumed whole barley grains. The addition of Saccharomyces cerevisiae, strain Yea-Sacc1026 in the ground barley at 4 mm has a more productive and evident effect (p<0.02 regarding final body weight, total weight and average daily weigh compared to the lambs fed with whole barley grains, with a specific intake lower with 0.89 UNC.

  8. Utilization of barley or wheat bran to bioconvert glutamate to γ-aminobutyric acid (GABA). (United States)

    Jin, Wen-Jie; Kim, Min-Ju; Kim, Keun-Sung


    This study deals with the utilization of agro-industrial wastes created by barley and wheat bran in the production of a value-added product, γ-aminobutyric acid (GABA). The simple and eco-friendly reaction requires no pretreatment or microbial fermentation steps but uses barley or wheat bran as an enzyme source, glutamate as a substrate, and pyridoxal 5'-phosphate (PLP) as a cofactor. The optimal reaction conditions were determined on the basis of the temperatures and times used for the decarboxylation reactions and the initial concentrations of barley or wheat bran, glutamate, and PLP. The optimal reactions produced 9.2 mM of GABA from 10 mM glutamate, yielding a 92% GABA conversion rate, when barley bran was used and 6.0 mM of GABA from 10 mM glutamate, yielding a 60% GABA conversion rate, when wheat bran was used. The results imply that barley bran is more efficient than wheat bran in the production of GABA.

  9. Histochemical characterization of early response to Cochliobolus sativus infection in selected barley genotypes. (United States)

    Rodríguez-Decuadro, Susana; Silva, Paula; Bentancur, Oscar; Gamba, Fernanda; Pritsch, Clara


    Much effort is being made to breed barley with durable resistance to leaf spot blotch incited by Bipolaris sorokiniana (teleomorph: Cochliobolus sativus). We hypothesized that susceptibility and resistance traits in 11 diverse barley genotypes inoculated with a single C. sativus isolate might specify a range of distinct host cell responses. Quantitative descriptions of interaction microphenotypes exhibited by different barley genotype seedlings after infection with C. sativus are provided. Early oxidative responses occurring in epidermis and mesophyll leaf tissue were monitored by histochemical analysis of H2O2 accumulation at 8, 24, and 48 h after inoculation. Cell wall apposition (CWA) in epidermal cells and hypersensitive reaction (HR) of epidermal or mesophyll tissue were early defenses in both resistant and susceptible genotypes. There were differences in level, duration, and frequency of occurrence for CWA and HR for the different barley genotypes. Occurrence of HR in epidermal cells at post-penetration stages was indicative of compatibility. Patterns of cell responses were microphenotypically diverse between different resistant and susceptible genotypes. This suggests that timing and level of response are key features of microphenotypic diversity that distinguish different functional mechanisms of resistance and susceptibility present in barley.

  10. [Hordein locus polymorphism of cultivated barley (Hordeum vulgare L.) in Turkey]. (United States)

    Pomortsev, A A; Martynov, S P; Lialina, E V


    Starch gel electrophoresis has been used to study the polymorphism of hordeins encoded by the Hrd A, Hrd B, and Hrd F loci in 93 landrace specimens of barley assigned to 17 ancient provinces located in modem Turkey. Forty-five alleles of Hrd A with frequencies of 0.11-29.34%, 51 alleles of Hrd B with frequencies of 0.11-8.07%, and 5 alleles of Hrd F with frequencies of 0.75-41.29% have been detected. Cluster analysis of the matrix of allele frequencies has demonstrated that barley populations from different old provinces of Turkey are similar to one another. Cluster structure of local barley populations has been found, most populations (82%) falling into three clusters. The first cluster comprises barley populations from six provinces (Thracia, Bithynia, Pontus, Lydia, Cappadocia, and Armenia); the second cluster, populations from five provinces (Paphlagonia, Galatia, Lycaonia, Cilicia, and Mesopotamia); and the third one, populations from three provinces (Phrygia, Karia, and Lycia). Barley populations from Mysia, Pamphlya, and Syria do not fall in any cluster. PMID:18186193

  11. Grain Composition and Functional Ingredients of Barley Varieties Created in Latvia

    Directory of Open Access Journals (Sweden)

    Šterna Vita


    Full Text Available Cereals, including barley, have been recognised as functional foods that provide beneficial effect on the health of the consumer and decrease the risk of various diseases. The aim of investigation was to determine the grain composition of barley varieties and perspective breeding lines bred in Latvia and to evaluate its functional ingredients. The results of analysis showed that protein content among varieties ranged from 106.6-146.8 g·kg-1, total dietary fibre 187.4-208.2 g·kg-1, β-glucans 42.8 g-49.4 g·kg-1, and amount of α-tocopherol 6.03-8.93 mg·kg-1. The sum of essential amino acids in barley grain samples was from 32.90 g·kg-1 to 38.71 g·kg-1. All varieties of hulled and hulless barley grain were found to be sources of protein with high biological value. Comparison of barley varieties bred in Latvia suggests that variety ‘Kornelija’ outperforms others in protein, dietary fibre and micronutrient content.

  12. Barley-derived beta-D-glucan induces immunostimulation via a dectin-1-mediated pathway. (United States)

    Tada, Rui; Ikeda, Futoshi; Aoki, Kosuke; Yoshikawa, Masashi; Kato, Yuya; Adachi, Yoshiyuki; Tanioka, Asuka; Ishibashi, Ken-ichi; Tsubaki, Kazufumi; Ohno, Naohito


    Barley-derived beta-glucan, a linear mixed-linkage beta-glucan composed of 1,3- and 1,4-beta-D-glucopyranose polymers, binds to dectin-1. However, whether it can trigger signal transduction via dectin-1 remains unclear. In this study, we used a reporter gene assay to determine whether barley-derived beta-d-glucan can activate NF-kappaB via dectin-1-mediated signaling when dectin-1 is cotransfected with Syk, CARD9, and Bcl10 in 293T cells. We found that barley-derived beta-D-glucan can activate NF-kappaB leading to cytokine production when dectin-1, Syk, CARD9, and Bcl10 are coexpressed in the cells. We also found that barley-derived beta-D-glucan can induce the phosphorylation of Syk and production of IL-6 in thioglycolate-elicited peritoneal macrophages. These results indicated that the immunostimulatory effects of barley-derived beta-d-glucan might be exerted, at least in part, via dectin-1. PMID:19428562

  13. Colonic gene silencing using siRNA-loaded calcium phosphate/PLGA nanoparticles ameliorates intestinal inflammation in vivo. (United States)

    Frede, Annika; Neuhaus, Bernhard; Klopfleisch, Robert; Walker, Catherine; Buer, Jan; Müller, Werner; Epple, Matthias; Westendorf, Astrid M


    Cytokines and chemokines are predominant players in the progression of inflammatory bowel diseases. While systemic neutralization of these players with antibodies works well in some patients, serious contraindications and side effects have been reported. Therefore, the local interference of cytokine signaling mediated by siRNA-loaded nanoparticles might be a promising new therapeutic approach. In this study, we produced multi-shell nanoparticles consisting of a calcium phosphate (CaP) core coated with siRNA directed against pro-inflammatory mediators, encapsulated into poly(d,l-lactide-co-glycolide acid) (PLGA), and coated with a final outer layer of polyethyleneimine (PEI), for the local therapeutic treatment of colonic inflammation. In cell culture, siRNA-loaded CaP/PLGA nanoparticles exhibited a rapid cellular uptake, almost no toxicity, and an excellent in vitro gene silencing efficiency. Importantly, intrarectal application of these nanoparticles loaded with siRNA directed against TNF-α, KC or IP-10 to mice suffering from dextran sulfate sodium (DSS)-induced colonic inflammation led to a significant decrease of the target genes in colonic biopsies and mesenteric lymph nodes which was accompanied with a distinct amelioration of intestinal inflammation. Thus, this study provides evidence that the specific and local modulation of the inflammatory response by CaP/PLGA nanoparticle-mediated siRNA delivery could be a promising approach for the treatment of intestinal inflammation.

  14. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid


    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  15. Numerical simulation static-bed drying of barley

    Energy Technology Data Exchange (ETDEWEB)

    Mandas, N. [Universita di Cagliari (Italy). Dipartimento d' Ingegneria Meccanica; Habte, M. [Addis Ababa University (Ethiopia). Mechanical Engineering Department


    The last decade has seen enormous progress in mathematical modelling and numerical simulation in areas related with fluid dynamics and heat and mass transfer. This is because of the increasingly widespread use of powerful, low-cost digital computers. Future efforts should be directed towards developing computer codes that can be implemented by users who may not be well versed in computational skills. Here a computer program has been developed, for simulating a non-equilibrium mathematical model for static-deep-bed drying of barley. The model consists of a set of four non-linear partial differential equations as a result of mass and energy balances and heat transfer equations, together with appropriate diffusion equation. The set of equations is solved by means of a finite-difference method, using a second-order iterative predictor-corrector process to solve the first two equations in the time domain, and a first-order iterative process for the second two, in the space domain. Published experimental results are used to validate the model. The numerical results are in good agreement with the experimental data relative to heated-air drying system, and the prediction accuracy is enhanced with respect to equilibrium models. (author)

  16. Structural lability of Barley stripe mosaic virus virions.

    Directory of Open Access Journals (Sweden)

    Valentin V Makarov

    Full Text Available Virions of Barley stripe mosaic virus (BSMV were neglected for more than thirty years after their basic properties were determined. In this paper, the physicochemical characteristics of BSMV virions and virion-derived viral capsid protein (CP were analyzed, namely, the absorption and intrinsic fluorescence spectra, circular dichroism spectra, differential scanning calorimetry curves, and size distributions by dynamic laser light scattering. The structural properties of BSMV virions proved to be intermediate between those of Tobacco mosaic virus (TMV, a well-characterized virus with rigid rod-shaped virions, and flexuous filamentous plant viruses. The BSMV virions were found to be considerably more labile than expected from their rod-like morphology and a distant sequence relation of the BSMV and TMV CPs. The circular dichroism spectra of BSMV CP subunits incorporated into the virions, but not subunits of free CP, demonstrated a significant proportion of beta-structure elements, which were proposed to be localized mostly in the protein regions exposed on the virion outer surface. These beta-structure elements likely formed during virion assembly can comprise the N- and C-terminal protein regions unstructured in the non-virion CP and can mediate inter-subunit interactions. Based on computer-assisted structure modeling, a model for BSMV CP subunit structural fold compliant with the available experimental data was proposed.

  17. Mechanisms of Induced Resistance in Barley Against Drechslera teres. (United States)

    Lyngs Jørgensen, H J; Lübeck, P S; Thordal-Christensen, H; de Neergaard, E; Smedegaard-Petersen, V


    ABSTRACT Quantitative and qualitative histopathological methods and molecular analyses were used to study the mechanisms by which preinoculation with either of the nonbarley pathogens, Bipolaris maydis and Septoria nodorum, inhibited growth of Drechslera teres. Collectively, our data suggest that induced resistance is the principal mechanism responsible for impeding the pathogen. The enhancement of resistance in the host was primarily manifested during penetration by D. teres, and after penetration, where growth of D. teres ceased soon after development of infection vesicles. Thus, 24 h after pretreatment with B. maydis or S. nodorum, the penetration frequency from D. teres appressoria was reduced from 42.7% in the controls to 9.5 and 14.8%, respectively. The reductions were associated with increased formation of fluorescent papillae in induced cells (early defense reaction). The postpenetrational inhibition of D. teres completely stopped fungal growth and was apparently linked to an enhancement of multicellular hypersensitive responses in inducer-treated leaves (late defense reaction). Papillae formation and multicellular hypersensitive reactions were also observed in fully susceptible, noninduced control leaves, but they were inadequate to stop fungal progress. Northern blots from leaves treated with either inducer alone support the conclusion that induced resistance is involved in suppression of D. teres by increased formation of papillae and hypersensitive reactions. Thus, the blots showed strong expression of several defense response genes that are involved in these reactions in barley attacked by Erysiphe graminis f. sp. hordei.

  18. Inhibition of coagulation factors by recombinant barley serpin BSZx

    DEFF Research Database (Denmark)

    Dahl, Søren Weis; Rasmussen, S.K.; Petersen, L..C.;


    Barley serpin BSZx is a potent inhibitor of trypsin and chymotrypsin at overlapping reactive sites (Dahl, S.W., Rasmussen, S.K. and Hejgaard, J. (1996) J. Biol, Chem., in press), We have now investigated the interactions of BSZx with a range of serine proteinases from human plasma, pancreas...... as substrate, Complexes of these proteinase with BSZx resisted boiling in SDS, and amino acid sequencing showed that cleavage in the reactive center loop only occurred after P-1 Arg. Activated protein C and leukocyte elastase were slowly inhibited by BSZx (k(ass) = 1-2 x 10(2) M(-1) s(-1)) whereas factor XIIa...... and leukocytes, a fungal trypsin and three subtilisins, Thrombin, plasma kallikrein, factor VIIa/tissue factor and factor Xa were inhibited by BSZx at heparin independent association rates (k(ass)) of 4.5 x 10(3)-1.3 x 10(5) M(-1) s(-1) at 22 degrees C. Only factor Xa turned a significant fraction of BSZx over...

  19. Management of diabetic dyslipidemia with subatmospheric dehydrated barley grass powder

    Directory of Open Access Journals (Sweden)

    Venugopal Shonima


    Full Text Available Diabetes is a chronic, potentially debilitating and often fatal disease. The prevalence of type 2 diabetes is increasing in all populations worldwide. The investigation was carried out to study the impact of barley grass powder (BGP supplementation on the carbohydrate and lipid metabolism of stable type 2 diabetes mellitus (T2DM subjects. A total of 59 stable type 2 diabetic subjects were enrolled in the study from pathology laboratories and divided into experimental (n=36 and control groups (n=23. BGP (1.2 g/day in the form of capsules (n=4 was given to the experimental group subjects for a period of 60 days. Fasting blood sugar (FBS, glycated haemoglobin (HbA1c and lipid profile levels were monitored at baseline and at 60 days. Paired t test was applied using Microsoft® Office Excel 2003. Supplementation with BGP resulted in a significant decrease in FBS, HbA1c, total cholesterol (TC, low-density lipoprotein cholesterol (LDL-C and non-high-density lipoprotein cholesterol (Non-HDL-C and a significant increase in high-density lipoprotein cholesterol (HDL-C levels. In conclusion, the results obtained suggest that BGP holds promise to be used as a functional food to optimise the health of diabetic subjects.

  20. Accelerated rates of protein evolution in barley grain and pistil biased genes might be legacy of domestication. (United States)

    Shi, Tao; Dimitrov, Ivan; Zhang, Yinling; Tax, Frans E; Yi, Jing; Gou, Xiaoping; Li, Jia


    Traits related to grain and reproductive organs in grass crops have been under continuous directional selection during domestication. Barley is one of the oldest domesticated crops in human history. Thus genes associated with the grain and reproductive organs in barley may show evidence of dramatic evolutionary change. To understand how artificial selection contributes to protein evolution of biased genes in different barley organs, we used Digital Gene Expression analysis of six barley organs (grain, pistil, anther, leaf, stem and root) to identify genes with biased expression in specific organs. Pairwise comparisons of orthologs between barley and Brachypodium distachyon, as well as between highland and lowland barley cultivars mutually indicated that grain and pistil biased genes show relatively higher protein evolutionary rates compared with the median of all orthologs and other organ biased genes. Lineage-specific protein evolutionary rates estimation showed similar patterns with elevated protein evolution in barley grain and pistil biased genes, yet protein sequences generally evolve much faster in the lowland barley cultivar. Further functional annotations revealed that some of these grain and pistil biased genes with rapid protein evolution are related to nutrient biosynthesis and cell cycle/division. Our analyses provide insights into how domestication differentially shaped the evolution of genes specific to different organs of a crop species, and implications for future functional studies of domestication genes.

  1. Sequencing of 15,622 gene-bearing BACs clarifies the gene-dense regions of the barley genome (United States)

    Barley (Hordeum vulgare L.) possesses a large and highly repetitive genome of 5.1 Gb that has hindered the development of a complete sequence. In 2012, the International Barley Sequencing Consortium released a resource integrating whole-genome shotgun sequences with a physical and genetic framework....

  2. Analysis of early events in the interaction between Fusarium graminearum and the susceptible barley (Hordeum vulgare) cultivar Scarlett

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, J.D.; Svensson, Birte;


    A proteomic analysis was conducted to map the events during the initial stages of the interaction between the fungal pathogen Fusarium graminearum and the susceptible barley cultivar Scarlett. Quantification of fungal DNA demonstrated a sharp increase in fungal biomass in barley spikelets at 3 da...

  3. Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

    DEFF Research Database (Denmark)

    Radova, A.; Sebela, M.; Galuszka, P.;


    was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of barley...

  4. Genome-wide association mapping of barley yellow dwarf virus tolerance in spring oat (Avena sativa L.) (United States)

    Barley yellow dwarf (BYD) is one of the most destructive diseases of cereal crops worldwide. Barley yellow dwarf viruses (BYDVs) are responsible for BYD and affect many cereals including oat (Avena sativa L.). Until recently, the molecular marker technology in oat has not allowed for many marker-t...

  5. Induction by chromium ions of chitinases and polyamines in barley (Hordeum vulgare L.) and rape (Brassica napus L. ssp. oleifera)

    DEFF Research Database (Denmark)

    Jacobsen, S.; Hauschild, M.Z.; Rasmussen, U.


    Barley and rape seedlings were grown in hydroponic culture with increasing concentrations of CrO3 (Cr(VI)) or CrCl3 (Cr(III)). The chitinase activity and the concentrations of putrescine, spennidine and spermine were determined in the third leaf of barley seed-lings and in the second leaf of rape...

  6. Influence of crop rotation and meteorological conditons on density and biomass of weeds in spring barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Maria Wanic


    Full Text Available The paper presents the analysis of changes in weed infestation in spring barley cultivated in the years 1990-2004 in crop rotation with a 25% proportion of this cereal (potato - spring barley - sowing peas - winter triticale, when it was grown after potato, and in crop rotation with its 75% proportion (potato - spring barley - spring barley - spring barley, when it was grown once or twice after spring barley. In the experiment, no weed control was applied. Every year in the spring (at full emergence of the cereal and before the harvest, the composition of weed species and weed density of particular weed species were determined, and before the harvest also their biomass. Weed density increased linearly on all plots during the 15-year period. The average values confirm the increase in weed biomass in the case when spring barley was grown once or twice after this crop; however, those differences were influenced by the previous situation only during some seasons. Weed density and biomass showed high year-to-year variability and a positive correlation with the amount of precipitation and a negative correlation with temperature during the period of the study. A negative correlation between the yield of barley and weed biomass was shown.

  7. The untranslated leader sequence of the barley lipoxygenase 1 (Lox1) gene confers embryo-specific expression

    NARCIS (Netherlands)

    Rouster, J.; Mechelen J. van; Cameron-Mills, V.


    The barley lipoxygenase 1 (Lox1) gene encodes a protein expressed in embryos during grain development and germination and in leaves after methyl-jasmonate (MeJA) treatment. Transient gene expression assays in germinating barley embryos were used to identify cis-regulatory elements involved in the em

  8. Conserved generation of short products at piRNA loci

    Directory of Open Access Journals (Sweden)

    Khorshid Mohsen


    Full Text Available Abstract Background The piRNA pathway operates in animal germ lines to ensure genome integrity through retrotransposon silencing. The Piwi protein-associated small RNAs (piRNAs guide Piwi proteins to retrotransposon transcripts, which are degraded and thereby post-transcriptionally silenced through a ping-pong amplification process. Cleavage of the retrotransposon transcript defines at the same time the 5' end of a secondary piRNA that will in turn guide a Piwi protein to a primary piRNA precursor, thereby amplifying primary piRNAs. Although several studies provided evidence that this mechanism is conserved among metazoa, how the process is initiated and what enzymatic activities are responsible for generating the primary and secondary piRNAs are not entirely clear. Results Here we analyzed small RNAs from three mammalian species, seeking to gain further insight into the mechanisms responsible for the piRNA amplification loop. We found that in all these species piRNA-directed targeting is accompanied by the generation of short sequences that have a very precisely defined length, 19 nucleotides, and a specific spatial relationship with the guide piRNAs. Conclusions This suggests that the processing of the 5' product of piRNA-guided cleavage occurs while the piRNA target is engaged by the Piwi protein. Although they are not stabilized through methylation of their 3' ends, the 19-mers are abundant not only in testes lysates but also in immunoprecipitates of Miwi and Mili proteins. They will enable more accurate identification of piRNA loci in deep sequencing data sets.

  9. Antioxidant-guided isolation and mass spectrometric identification of the major polyphenols in barley (Hordeum vulgare) grain. (United States)

    Gangopadhyay, Nirupama; Rai, Dilip K; Brunton, Nigel P; Gallagher, Eimear; Hossain, Mohammad B


    In the present study, the relative contribution of individual/classes of polyphenols in barley, to its antioxidant properties, was evaluated. Flash chromatography was used to fractionate the total polyphenol extract of Irish barley cultivar 'Irina', and fractions with highest antioxidant properties were identified using total phenolic content and three in vitro antioxidant assays: DPPH, FRAP, and ORAC. Flavanols (catechin, procyanidin B, prodelphinidin B, procyanidin C) and a novel substituted flavanol (catechin dihexoside, C27H33O16(-), m/z 613.17), were identified as constituents of the fraction with highest antioxidant capacity. Upon identification of phenolics in the other active fractions, the order of most potent contributors to observed antioxidant capacity of barley extract were, flavanols>flavonols (quercetin)>hydroxycinnamic acids (ferulic, caffeic, coumaric acids). The most abundant polyphenol in the overall extract was ferulic acid (277.7μg/gdw barley), followed by procyanidin B (73.7μg/gdw barley). PMID:27211640

  10. Evaluation of Different Levels of Barley and Replace it Instead of Corn on Performance of Broiler Chicken

    Directory of Open Access Journals (Sweden)

    Amir Hosein Eshrati Bahar


    Full Text Available In isoenergetic - isonitrogenous diets, barley at levels of 0, 25, 50, 75 and 100 % was substituted for corn and its effects on broiler chicken performance was studied. This study was carried out with 5 levels of barley (0, 25, 50, 75 and 100 %, 3 replicates and 14 birds in each replicate in a completely randomized design. In this experiment 300 day old broiler chicks (Lohman were used for 42 days. The results showed that barley up to 25% substitution had no adverse effect on broiler performance. It is concluded that in diet supplementation with barley until 25% could done without any adverse effects on performance, although enzyme supplementation should be considered in the ration to decrease NSP in the barley

  11. The effect of nitrogen fertilization and irradiation on barley susceptibility to net blotch disease

    International Nuclear Information System (INIS)

    Isolates of Drechslera teres f. sp. teres that cause net blotch symptoms on barley were collected from fields in different regions of Syria. there virulence spectra were determined using 11 barley cultivars. Cultivars exhibited a continuos range of response from very susceptible to moderately resistant. Isolate Raqa 13 had the highest mean virulence, then Halap 2, whereas ICARDA 3 was the lowest virulent. The effect of three concentrations (1000, 1500, 2000 ppm) of nitrogen (Urea 45%) fertilizer, and two doses of gamma ray (10 and 20 Gy), on susceptibility to infection by Drechslera teres were studied. Two barley cultivars (Thibaut and Furia) were used in this study. Results showed that 1000 ppm (N) and 15 Gy dose treatment had a positive effect on decreasing the susceptibility. (author)

  12. Cereal bioengineering: Amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Shaik, Shahnoor Sultana; Jensen, Susanne Langgård;


    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were made by transgenic methods. Cereals producing these kind of starches have not been reported before. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch...... branching enzymes SBEIIa, SBEIIb and SBEI by a chimeric hairpin. The construct was inherited as a single locus with a distinct 1:3 segregation in consecutive generations. The transgenic grains were shrunken and the yield was around 80% of that found in wildtype. The starch granules were irregularly......, elongated and globose shaped. Transgenic grains also had a higher beta-glucan content. In order to increase barley starch phosphorylation, endosperm specific overexpression of glucan water dikinase from potato (StGWD) was conducted. The content of phosphate esters in starch from consecutive generations (T0...

  13. Transformation of TrxS Gene into Barley by Particle Bombardment

    Institute of Scientific and Technical Information of China (English)

    WEI Li; YIN Jun; KONG Wei-wei; REN Jiang-ping; LI Lei; LIU Lei


    The production of malting barley in China can't meet the demand of beer industries because of poor quality and it becomes a bottleneck problem in beer manufacture industry. In this paper, TrxS gene cloned from Phalaris coerulescens was transferred into barley cultivar Yupi 1 (YP1)via biolistic bombardment. 1206 immature embryos were bombarded and seven transgenic plants carrying TrxS gene were confirmed by PCR and PCR-Southern blotting analysis. TrxS gene was expressed in transgenic plants by RT-PCR analysis. The activity of Trxh and αt-amylase of transgenic line were higher than that of non-transgenic line, which is helpful to improve malting quality of barley.

  14. Comparison of different pretreatment strategies for enzymatic hydrolysis of wheat and barley straw

    DEFF Research Database (Denmark)

    Rosgaard, Lisa; Pedersen, Sven; Meyer, Anne Boye Strunge


    procedures: acid or water impregnation followed by steam explosion versus hot water extraction. The pretreatments were compared after enzyme treatment using a cellulase enzyme system, Celluclast 1.5 L (R) from Trichoderma reesei, and a beta-glucosidase, Novozyme 188 from Aspergillus niger. Barley straw...... generally produced higher glucose concentrations after enzymatic hydrolysis than wheat straw. Acid or water impregnation followed by steam explosion of barley straw was the best pretreatment in terms of resulting glucose concentration in the liquid hydrolysate after enzymatic hydrolysis. When the glucose...... straw. Maldi-TOF MS analyses of supernatants of pretreated barley and wheat straw samples subjected to acid and water impregnation, respectively, and steam explosion, revealed that the water impregnated + steam-exploded samples gave a wider range of pentose oligomers than the corresponding acid...

  15. Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison

    DEFF Research Database (Denmark)

    Li, Chengdao; Ni, Peixiang; Francki, Michael;


    . A major QTL controlling both pre-harvest sprouting and seed dormancy has been identified on the long arm of barley chromosome 5H, and it explains over 70% of the phenotypic variation. Comparative genomics approaches among barley, wheat and rice were used to identify candidate gene(s) controlling...... seed dormancy and hence one aspect of pre-harvest sprouting. The barley seed dormancy/pre-harvest sprouting QTL was located in a region that showed good synteny with the terminal end of the long arm of rice chromosome 3. The rice DNA sequences were annotated and a gene encoding GA20-oxidase was......Pre-harvest sprouting results in significant economic loss for the grain industry around the world. Lack of adequate seed dormancy is the major reason for pre-harvest sprouting in the field under wet weather conditions. Although this trait is governed by multiple genes it is also highly heritable...

  16. Engineering high-level aluminum tolerance in barley with the ALMT1 gene. (United States)

    Delhaize, Emmanuel; Ryan, Peter R; Hebb, Diane M; Yamamoto, Yoko; Sasaki, Takayuki; Matsumoto, Hideaki


    Acidity is a serious limitation to plant production on many of the world's agricultural soils. Toxic aluminium (Al) cations solubilized by the acidity rapidly inhibit root growth and limit subsequent uptake of water and nutrients. Recent work has shown that the ALMT1 gene of wheat (Triticum aestivum) encodes a malate transporter that is associated with malate efflux and Al tolerance. We generated transgenic barley (Hordeum vulgare) plants expressing ALMT1 and assessed their ability to exude malate and withstand Al stress. ALMT1 expression in barley conferred an Al-activated efflux of malate with properties similar to those of Al-tolerant wheat. The transgenic barley showed a high level of Al tolerance when grown in both hydroponic culture and on acid soils. These findings provide additional evidence that ALMT1 is a major Al-tolerance gene and demonstrate its ability to confer effective tolerance to acid soils through a transgenic approach in an important crop species. PMID:15471989

  17. Maize, Sunflower and Barley Sensitivity to the Residual Activity of Clomazone in Soil

    Directory of Open Access Journals (Sweden)

    Jelena Gajić Umiljendić


    Full Text Available Sensitivity of maize, sunflower and barley to clomazone residues in loamy soil wasassessed in the study using bioassay. Clomazone was applied at a series of concentrationsfrom 0.12 to 12 mg a.i./kg of soil. After 14 days, morphological (shoot height, fresh and dryweight and physiological (content of carotenoids, chlorophyll a and chlorophyll b parameterswere measured. The results showed that morphological parameters are not valid indicatorsof clomazone sensitivity. Based on the results showing inhibition of the physiologicalparameters, I50 values were calculated and used to estimate the difference in sensitivitybetween the species tested. Sunflower was the most sensitive species, while the differencein sensitivity between maize and barley was not significant.Nomenclature: clomazone (2-(2-chlorbenzyl-4,4-dimethyl-1,2-oxazolidin-3-one, maize(Zea mays L., sunflower (Helianthus annuus L., barley (Hordeum vulgare L.

  18. Cereal bioengineering: amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Hebelstrup, Kim; Carciofi, Massimiliano; Jensen, Susanne Langgård;


    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were engineered by transgenic methods. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch branching enzymes (SBEIIa, SBEIIb and SBEI) by a chimeric hairpin...... for the presence of a general mechanism in starch degradation in the plant kingdom where phosphorylation carried out by ectopic expression of StGWD tags barley starch granules for degradation by endogenous enzymes. Together this work shows two new strategies for in planta starch bioengineering of cereals....... It demonstrates that bioengineering may be used to obtain novel and technologically interesting cereal starches, and to elucidate the complex pathways of starch biosynthesis and the roles of individual starch biosynthetic enzymes....

  19. Screening for disease resistance in barley cultivars against Bipolaris sorokiniana using callus culture method. (United States)

    Chand, Ramesh; Sen, Devyani; Prasad, K D; Singh, A K; Bashyal, B M; Prasad, L C; Joshi, A K


    Screening for resistant barley genotypes in response to fungal toxin of Bipolaris sorokiniana was assessed on standing barley plants as well as in selected callus lines of the same. For the standing lines tested, those manifesting chlorosis in response to toxin infiltration showed a significantly slower disease progress as compared to the necrotic lines. Also, necrosis in the callus tissues of the susceptible cultivar in MS medium supplemented with different concentrations of the crude toxin was significantly higher than in the callus tissues of the chlorotic lines studied. Similar host response to the toxin in in vitro and field situations open up the possibility of screening barley cultivars for resistance to spot blotch using callus culture as against classical methods of screening in order to increase accuracy and save time and space.

  20. Comparison of foliar anatomy of ten bread wheat (triticum, poaceae) and ten barley (hordeum, poaceae) cultivars

    International Nuclear Information System (INIS)

    The aim of this study is to determine anatomical differences and classification of leaf and leaf cell characteristics (cuticle thickness, upper epidermis thickness, lower epidermis thickness, mesophyll thickness, parenchyma thickness and leaf thickness) between 10 bread wheat cultivars (Triticum aestivum L.) and 10 barley cultivars (Hordeum vulgare L.). Classification of leaf characteristics in bread wheat and barley cultivars and relationship between leaf characteristics are made by principal component and correlation analyses. Highest thickness belongs to W8 Mufitbey cultivar in mesophyll and lower epidermis and W1 Sonmez 01 cultivar have the lowest thickness of upper epidermis in bread wheat. In Barley, B1 Ince cultivar has highest leaf thickness mesophyll and parenchyma; lowest thickness of cuticle is included B7 Cumhuriyet 50 cultivar. All other cultivars have homogenous contents of leaf characteristics. (author)

  1. Quality of rolled barley flakes as affected by batch of grain and processing technique. (United States)

    Sundberg, B; Abrahamsson, L; Aman, P


    Rolled barely flakes were prepared from three different batches of grain by pearling, steaming and rolling. Autoclaved and malted barleys from the three batches were also processed in the same way. Analysis of the nine products showed that both batch of barley and process had significant effects on chemical composition and viscosity. Puddings were prepared from the products and mechanical consistency, juiciness and grain consistency were graded on both newly prepared and heated puddings by a sensory taste panel. Batch of barley had no effect on mechanical consistency but significant effects on juiciness and grain consistency. Type of processing had significant effect on all three parameters for both newly prepared and heated puddings. PMID:8153065

  2. Effect of Soil Erosion on Spring Barley Growth in East Anglia,England:Preliminary Results

    Institute of Scientific and Technical Information of China (English)



    The effect of soil erosion on spring barley growth was studied on a deep loamy soil in East Anglia,England,in 1992,Soil erosion was simulated by three levels of soil desurfacing,7.5,18and 30cm with three replicates.Significant differences in crop height,ground cover and crop yield were observed between the three levels of desurfacing.Soil desurfacing also has a singnificant effect on soil moisture at the 20cm depth.The interaction between soil removal and crop performance affected soil moisture at the depths of 50 and 100cm,No significant differences were found in runoff and sediment etween the three topsoil removals due to very dry growing season.Regression equations were developed between spring barley yield and soil desurfacing Spring barley grain yield declined by 97.6kg/ha per cm soil desurfacing.

  3. Programmed cell death: The life ambition of the barley aleurone layer

    DEFF Research Database (Denmark)

    Mark, Christina; Zor, Kinga; Heiskanen, Arto;

    We have developed a 24-well multiplate tissue culture system with electrochemical and optical detection techniques for cultivation of immobilised barley aleurone layers. We have applied the system for the purpose of studying the underlying mechanisms of programmed cell death (PCD) in plants. We...... have optimised an electrochemical, intracellular, whole-cell redox activity assay [1] that probes the NAD(P):NAD(P)H ratio via a double-mediator system. Experiments show that redox activity changes depend on phytohormone activation or inactivation of aleurone layer metabolism and subsequent PCD. We...... have successfully applied a fluorescent double-probe system [2] to detect PCD to ensure that our redox activity data match with known responses of barley aleurone layers to phytohormones. We have also used the system for transformation of barley aleurone cells with α-amylase-GFP constructs...

  4. Effect of crop density on competition by wheat and barley with Agrostemma githago and other weeds

    DEFF Research Database (Denmark)

    Doll, H.; Holm, U.; Søgaard, B.


    The effect of Agrostemma githago L. and other naturally occurring weeds on biomass production and grain yield was studied in winter wheat and winter barley. Naturally occurring weeds had only a negligible effect on barley, but reduced wheat grain yield by 10% at a quarter of normal crop density....... The interaction between the cereals and A. githago was studied in additive series employing different crop densities. Growth of this weed species was strongly dependent on crop density, which was more important for controlling weed growth than it was for obtaining a normal grain yield. Wheat and especially barley...... had a better competitive ability than A. githago. Wheat and A. githago utilized resources for growth better when grown in mixture than when grown in pure stands as the relative yield totals were significantly larger than unity....

  5. Interactions between Barley a-Amylases, Substrates, Inhibitors and Regulatory Proteins

    DEFF Research Database (Denmark)

    Hachem, Maher Abou; Bozonnet, Sophie; Willemoës, Martin;


    Barley a-amylase binds sugars at two sites on the enzyme surface in addition to the active site. Crystallography and site-directed mutagenesis highlight the importance of aromatic residues at these surface sites as demonstrated by Kd values determined for ß-cyclodextrin by surface plasmon resonance...... by mutagenesis, crystallography and microcalorimetry. Further improvement of recombinant AMY2 production allows future direct mutational analysis in this isozyme. Specific proteinaceous inhibitors act on a-amylases of different origin. In the complex of barley a-amylase/subtilisin inhibitor (BASI) with AMY2...... of the disulphide reductase thioredoxin h that attacks a specific disulphide bond in BASI and, remarkably, reduces two different disulphide bonds in the barley monomeric and dimeric amylase inhibitors that both belong to the CM-proteins and inhibit animal a-amylase....

  6. Density and relative frequency effects on competitive interactions and resource use in pea–barley intercrops

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, H.; Andersen, H.K.; Jørnsgaard, B.;


    Intercropping advantages may be influenced by both plant density and relative frequency of the intercrop components. In a field study barley (Hordeum vulgare L.) and pea (Pisum sativum L.) were sole cropped and intercropped at three densities and with two relative frequencies when intercropped....... Earlier seedling emergence gave barley an initial growth advantage, assessed using the relative efficiency index (REIc), whereas pea was in general more growth efficient once the initial growth phase had been passed. This reversal in relative growth efficiency along with the observation that early barley...... not increase its reliance on atmospheric nitrogen fixation compared to the pea sole crop. With respect to soil nitrogen uptake there were no effect of plant density but a strong effect of the relative frequency of pea in the intercrop, the greater the proportion the lower the uptake. Changes in the competitive...

  7. Development and characterization of polymorphic EST-SSR and genomic SSR markers for Tibetan annual wild barley. (United States)

    Zhang, Mian; Mao, Weihua; Zhang, Guoping; Wu, Feibo


    Tibetan annual wild barley is rich in genetic variation. This study was aimed at the exploitation of new SSRs for the genetic diversity and phylogenetic analysis of wild barley by data mining. We developed 49 novel EST-SSRs and confirmed 20 genomic SSRs for 80 Tibetan annual wild barley and 16 cultivated barley accessions. A total of 213 alleles were generated from 69 loci with an average of 3.14 alleles per locus. The trimeric repeats were the most abundant motifs (40.82%) among the EST-SSRs, while the majority of the genomic SSRs were di-nuleotide repeats. The polymorphic information content (PIC) ranged from 0.08 to 0.75 with a mean of 0.46. Besides this, the expected heterozygosity (He) ranged from 0.0854 to 0.7842 with an average of 0.5279. Overall, the polymorphism of genomic SSRs was higher than that of EST-SSRs. Furthermore, the number of alleles and the PIC of wild barley were both higher than that of cultivated barley, being 3.12 vs 2.59 and 0.44 vs 0.37. Indicating more polymorphism existed in the Tibetan wild barley than in cultivated barley. The 96 accessions were divided into eight subpopulations based on 69 SSR markers, and the cultivated genotypes can be clearly separated from wild barleys. A total of 47 SSR-containing EST unigenes showed significant similarities to the known genes. These EST-SSR markers have potential for application in germplasm appraisal, genetic diversity and population structure analysis, facilitating marker-assisted breeding and crop improvement in barley. PMID:24736399

  8. Development and characterization of polymorphic EST-SSR and genomic SSR markers for Tibetan annual wild barley.

    Directory of Open Access Journals (Sweden)

    Mian Zhang

    Full Text Available Tibetan annual wild barley is rich in genetic variation. This study was aimed at the exploitation of new SSRs for the genetic diversity and phylogenetic analysis of wild barley by data mining. We developed 49 novel EST-SSRs and confirmed 20 genomic SSRs for 80 Tibetan annual wild barley and 16 cultivated barley accessions. A total of 213 alleles were generated from 69 loci with an average of 3.14 alleles per locus. The trimeric repeats were the most abundant motifs (40.82% among the EST-SSRs, while the majority of the genomic SSRs were di-nuleotide repeats. The polymorphic information content (PIC ranged from 0.08 to 0.75 with a mean of 0.46. Besides this, the expected heterozygosity (He ranged from 0.0854 to 0.7842 with an average of 0.5279. Overall, the polymorphism of genomic SSRs was higher than that of EST-SSRs. Furthermore, the number of alleles and the PIC of wild barley were both higher than that of cultivated barley, being 3.12 vs 2.59 and 0.44 vs 0.37. Indicating more polymorphism existed in the Tibetan wild barley than in cultivated barley. The 96 accessions were divided into eight subpopulations based on 69 SSR markers, and the cultivated genotypes can be clearly separated from wild barleys. A total of 47 SSR-containing EST unigenes showed significant similarities to the known genes. These EST-SSR markers have potential for application in germplasm appraisal, genetic diversity and population structure analysis, facilitating marker-assisted breeding and crop improvement in barley.

  9. phiC31 integrase-mediated site-specific recombination in barley.

    Directory of Open Access Journals (Sweden)

    Eszter Kapusi

    Full Text Available The Streptomyces phage phiC31 integrase was tested for its feasibility in excising transgenes from the barley genome through site-specific recombination. We produced transgenic barley plants expressing an active phiC31 integrase and crossed them with transgenic barley plants carrying a target locus for recombination. The target sequence involves a reporter gene encoding green fluorescent protein (GFP, which is flanked by the attB and attP recognition sites for the phiC31 integrase. This sequence disruptively separates a gusA coding sequence from an upstream rice actin promoter. We succeeded in producing site-specific recombination events in the hybrid progeny of 11 independent barley plants carrying the above target sequence after crossing with plants carrying a phiC31 expression cassette. Some of the hybrids displayed fully executed recombination. Excision of the GFP gene fostered activation of the gusA gene, as visualized in tissue of hybrid plants by histochemical staining. The recombinant loci were detected in progeny of selfed F(1, even in individuals lacking the phiC31 transgene, which provides evidence of stability and generative transmission of the recombination events. In several plants that displayed incomplete recombination, extrachromosomal excision circles were identified. Besides the technical advance achieved in this study, the generated phiC31 integrase-expressing barley plants provide foundational stock material for use in future approaches to barley genetic improvement, such as the production of marker-free transgenic plants or switching transgene activity.

  10. Identification of a novel gene (Hsdr4) involved in water-stress tolerance in wild barley. (United States)

    Suprunova, Tatiana; Krugman, Tamar; Distelfeld, Assaf; Fahima, Tzion; Nevo, Eviatar; Korol, Abraham


    Drought is one of the most severe stresses limiting plant growth and yield. Genes involved in water stress tolerance of wild barley (Hordeum spontaneoum), the progenitor of cultivated barley, were investigated using genotypes contrasting in their response to water stress. Gene expression profiles of water-stress tolerant vs. water-stress sensitive wild barley genotypes, under severe dehydration stress applied at the seedling stage, were compared using cDNA-AFLP analysis. Of the 1100 transcript-derived fragments (TDFs) amplified about 70 displayed differential expression between control and stress conditions. Eleven of them showed clear difference (up- or down-regulation) between tolerant and susceptible genotypes. These TDFs were isolated, sequenced and tested by RT-PCR. The differential expression of seven TDFs was confirmed by RT-PCR, and TDF-4 was selected as a promising candidate gene for water-stress tolerance. The corresponding gene, designated Hsdr4 (Hordeum spontaneum dehydration-responsive), was sequenced and the transcribed and flanking regions were determined. The deduced amino acid sequence has similarity to the rice Rho-GTPase-activating protein-like with a Sec14 p-like lipid-binding domain. Analysis of Hsdr4 promoter region that was isolated by screening a barley BAC library, revealed a new putative miniature inverted-repeat transposable element (MITE), and several potential stress-related binding sites for transcription factors (MYC, MYB, LTRE, and GT-1), suggesting a role of the Hsdr4 gene in plant tolerance to dehydration stress. Furthermore, the Hsdr4 gene was mapped using wild barley mapping population to the long arm of chromosome 3H between markers EBmac541 and EBmag705, within a region that previously was shown to affect osmotic adaptation in barley. PMID:17238046

  11. Uptake and utilization efficiency of nitrogen and phosphorus in barley genotypes

    Directory of Open Access Journals (Sweden)



    Full Text Available Field experiment was carried out in order to study the genotypic variation in nitrogen and phosphorus uptake and utilization by barley. The study included nine Bulgarian genotypes of two-rowed barley: three cultivars Krami, Krasen, Kristi and six perspectives breading lines. The genotypes were sown in a randomized, complete block design with four replications after maize as predecessor with the size of experimental plots of 7 m2. It was found that barley genotypes differed in the uptake efficiency of both elements - nitrogen and phosphorus. Genotypes were divided into two groups in regard to nitrogen. Cultivars Krami, Krasen, Kristi and lines 2390300, 24102400, 22506999 uptake 170-186 kg N*ha-1, and lines 704112296, 24201900, 689069970 demonstrated higher nitrogen uptake efficiency 213-241 kg N*ha-1. Most of the new lines had higher phosphorus uptake efficiency in a range 90-111 kg Р2О5 ha-1compared to the varieties. The ratio total N/total Р2О5 uptake was close to 2.0 for the most of genotypes. The obtained mean values of nitrogen utilization efficiency were 81.6 kg biomass and 34.0 kg grain per kg N, respectively. The mean values of phosphorus utilization efficiency were 171.3 kg biomass and 71.4 kg grain per kg P2O5, respectively. The barley genotypes utilized more efficient phosphorus then total uptake nitrogen for producing grain and straw. Line 24102400 demonstrated higher nitrogen utilization efficiency for biomass and grain from all studied genotypes, followed by variety Krami. These two genotypes could be recommended as perspective in future improves of nitrogen efficiency in barley. Uptake efficiency of nitrogen and phosphorus positively correlated with the barley productivity and nutrients content in the grain and straw. In contrast, the relationship between total uptake of both elements at maturity and utilization efficiency of nitrogen or phosphorus for grain formation was negative.

  12. Transferability and polymorphism of barley EST-SSR markers used for phylogenetic analysis in Hordeum chilense

    Directory of Open Access Journals (Sweden)

    Dorado Gabriel


    Full Text Available Abstract Background Hordeum chilense, a native South American diploid wild barley, is a potential source of useful genes for cereal breeding. The use of this wild species to increase genetic variation in cereals will be greatly facilitated by marker-assisted selection. Different economically feasible approaches have been undertaken for this wild species with limited direct agricultural use in a search for suitable and cost-effective markers. The availability of Expressed Sequence Tags (EST derived microsatellites or simple sequence repeat (SSR markers, commonly called as EST-SSRs, for barley (Hordeum vulgare represents a promising source to increase the number of genetic markers available for the H. chilense genome. Results All of the 82 barley EST-derived SSR primer pairs tested for transferability to H. chilense amplified products of correct size from this species. Of these 82 barley EST-SSRs, 21 (26% showed polymorphism among H. chilense lines. Identified polymorphic markers were used to test the transferability and polymorphism in other Poaceae family species with the aim of establishing H. chilense phylogenetic relationships. Triticum aestivum-H. chilense addition lines allowed us to determine the chromosomal localizations of EST-SSR markers and confirm conservation of the linkage group. Conclusion From the present study a set of 21 polymorphic EST-SSR markers have been identified to be useful for diversity analysis of H. chilense, related wild barleys like H. murinum, and for wheat marker-assisted introgression breeding. Across-genera transferability of the barley EST-SSR markers has allowed phylogenetic inference within the Triticeae complex.

  13. Obtained transgenic wheat expressing pac1 mediated by Agrobacterium is resistant against Barley yellow dwarf virus-GPV

    Institute of Scientific and Technical Information of China (English)

    YAN Fei; ZHENG Yinying; ZHANG Wenwei; XIAO Hong; LI Shifang; CHENG Zhuomin


    In fission yeast (Schizosaccharomyces pombe), pac1 gene was cloned with 99.3% nucleotide sequence similarity with published pac1 in GenBank. In pET-5α expression system, the expression product of cloned pac1 in E. coli showed activity to degrade the double-strand RNA. Harboring the binary vector pBI121, which contains pac1 gene, Agrobacterium tumefaciens strain LBA4404 was used to transform the wheat immature embryos precultured 7―10 d. After preregeneration, regeneration and selection culture stage, totally 41 G418 resistant plants were obtained, in which 25 lines were proved to integrate with transgene and express transgene normally by PCR, Dot blot, RT-PCR and ELISA detection. Antivirus test carried out on 25 positive lines with high dose of Barley yellow dwarf virus-GPV revealed that 12 lines had resistance to BVDV-GPV in low level, another 12 lines had resistance to BVDV- GPV in middle level, and 1 line showed resistance to BVDV-GPV in high level. However, both low and middle level of resistance plants showed no symptoms when infected by viruses at low dose, which suggested the dose-dependent effect of the resistance mediated by pac1 to BYDV-GPV.

  14. Functional Diversification of Maize RNA Polymerase IV and V subtypes via Alternative Catalytic Subunits

    Energy Technology Data Exchange (ETDEWEB)

    Haag, Jeremy R.; Brower-Toland, Brent; Krieger, Elysia K.; Sidorenko, Lyudmila; Nicora, Carrie D.; Norbeck, Angela D.; Irsigler, Andre; LaRue, Huachun; Brzeski, Jan; Mcginnis, Karen A.; Ivashuta, Sergey; Pasa-Tolic, Ljiljana; Chandler, Vicki L.; Pikaard, Craig S.


    Unlike nuclear multisubunit RNA polymerases I, II, and III, whose subunit compositions are conserved throughout eukaryotes, plant RNA polymerases IV and V are nonessential, Pol II-related enzymes whose subunit compositions are still evolving. Whereas Arabidopsis Pols IV and V differ from Pol II in four or five of their 12 subunits, respectively, and differ from one another in three subunits, proteomic ana- lyses show that maize Pols IV and V differ from Pol II in six subunits but differ from each other only in their largest subunits. Use of alternative catalytic second subunits, which are nonredundant for development and paramutation, yields at least two sub- types of Pol IV and three subtypes of Pol V in maize. Pol IV/Pol V associations with MOP1, RMR1, AGO121, Zm_DRD1/CHR127, SHH2a, and SHH2b extend parallels between paramutation in maize and the RNA-directed DNA methylation pathway in Arabidopsis.

  15. [RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer]. (United States)

    Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente


    RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer. PMID:20415061

  16. Influence of tannin on protein utilization in feedstuffs with special reference to barley

    International Nuclear Information System (INIS)

    To evaluate the effect of tannins on protein utilization, increasing amounts of tannin were added to diets fed to rats. Soybean meal was used as protein source. Tannin was found to exert a severe negative effect on protein digestibility. With tannin in the diet, availability of all amino acids decreased significantly, but to different degrees. Tannins are present in a number of plant materials at different levels, including barley. In feeding experiments using 29 barley samples varying in tannin content from 0.55 to 1.23%, tannin showed a significant negative correlation with protein digestibility. (author)

  17. Improving nitrogen use efficiency in barley (Hordeum vulgare L.) through the cisgenic approach

    DEFF Research Database (Denmark)

    Kichey, Thomas; Holme, Inger; Møller, Inge Skrumsager;


    Barley is one of the major crops cultivated worldwide and constitutes an important basis for animal feed. However, the production is facing a number of challenges that will be accentuated in the years to come, in particular restrictions on the use of nitrogen (N) fertilizer. In order to improve...... the N use efficiency in barley, we are developing a new generation of genetically modified plants based on the concept of cisgenesis. In this approach, plants are transformed only with their own genetic material. The genes encoding the cytosolic isoform of the glutamine synthetase (GS1...

  18. Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Skau

    -glucans were compared in a human intervention study. The work first focussed on large-scale extraction and physico-chemical characterisation of barley and oat β-glucans. The second step was to investigate the in vitro health effects of barley and oat β-glucans in relation to their physico-chemical properties...... are of great importance for their functionality. β-Glucan solubility and polymer aggregation in solution is dependent on the block structural pattern and differently structured β-glucans may exert various functional and bioactive properties in our body. It is important to account for these diverse effects...

  19. Irradiation seed treatment reduces scald, common root rot and increases phosphorus absorption of barley

    International Nuclear Information System (INIS)

    The effect of low doses of gamma irradiation on severity of barley to scald and common root rot diseases, and phosphorus absorption was studied seeds were exposed to doses of 0, 10, 15, 20, 30, 40 and 50 Gy. A stimulatory effect was observed at irradiation doses of 30 and 40 Gy, which decreased the severity of barley to scald by 34% and 31% respectively. On the other hand, doses 20 and 30 Gy decreased the severity to CRR by 54% and 49% respectively, whereas, phosphorus absorption was significantly increased at doses of 15 and 20 Gy

  20. The Nutritive Value of Wastewater Grown Barley and its Utilization in Fish Feed


    A. M. Snow; Abdel E. Ghaly


    The feasibility of using wastewater grown barley plants as a component of fish feed was evaluated. The barley plants were grown in a hydroponics system on wastewater from a recirculating aquaculture facility. The effects of wastewater application rate on plant growth and pollution potential reduction were investigated. At the end of the experiment, the average crop heights and yields were 31.0 and 36.0 cm and 59 and 83 t ha -1 at wastewater application rates of 690 and 1380 mL compartment -1 ...

  1. NAC Transcription Factors of Barley (Hordeum vulgare L.) and their Involvement in Leaf Senescence

    DEFF Research Database (Denmark)

    Wagner, Michael

    yielding cereal crops are generated. In cereals, the process of leaf senescence is of utmost relevance when discussing yield. It is during the senescence process that all nutrients are transported from the withering leaf to the developing grains. Furthermore, the timing of senescence determines...... parts of the senescence process. The specific aims of this study were therefore (1) to establish and characterise the NAC transcription factors of the model cereal crop barley (Hordeum vulgare L.) (2) to identify and study putative barley NAC transcription factors involved in the regulation of leaf...

  2. Relationship between soil cellulolytic activity and suppression of seedling blight of barley in arable soils

    DEFF Research Database (Denmark)

    Rasmussen, Peter Have; Knudsen, I.; Elmholt, S.;


    The objective was to investigate the relationship between soil suppression of seedling blight of barley caused by Fusarium culmorum (W.G. Smith) Sacc. and the soil cellulolytic activity of beta-glucosidase, cellobiohydrolase and endocellulase. Disease suppression was investigated in bioassays....... From the preliminary results obtained, it is proposed that the cellulolytic activity can be used as an enzymatic approach to study the microbial turnover of organic matter in soils and as indicator of seedling blight of barley caused by F. culmorum. (C) 2002 Elsevier Science B.V. All rights reserved....

  3. Spectrum of Resistance Conferred by ml-o Powdery Mildew Resistance Genes in Barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms


    /(4) in all tests. They were also resistant to field populations of the pathogen when scored in disease nurseries at more than 78 locations in 29 countries in Europe, the Near East, North and South America. New Zealand, and Japan. This indicates that the 11 genes confer the same, world-wide spectrum......Ten barley mutants and five Ethiopian barley lines representing 11 independently arisen powdery mildew resistance genes in the ml-o locus were tested at the seedling stage to cultures of the powdery mildew fungus from Europe, Israel, USA. Canada, and Japan. They were resistant with infection type 0...

  4. Exploring the Plant–Microbe Interface by Profiling the Surface-Associated Proteins of Barley Grains

    DEFF Research Database (Denmark)

    Sultan, Abida; Andersen, Birgit; Svensson, Birte;


    xylanase inhibitors. To gain insight into the importance of the microbial consortia and their interaction with barley grains, we used a combined gel-based (2-DE coupled to MALDI-TOF-TOF MS) and gel-free (LC–MS/MS) proteomics approach complemented with enzyme activity assays to profile the surface......-associated proteins and xylanolytic activities of two barley cultivars. The surface-associated proteome was dominated by plant proteins with roles in defense and stress-responses, while the relatively less abundant microbial (bacterial and fungal) proteins were involved in cell-wall and polysaccharide degradation...

  5. Oligosaccharide and Substrate Binding in the Starch Debranching Enzyme Barley Limit Dextrinase

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Windahl, Michael Skovbo; Sim, Lyann;


    Complete hydrolytic degradation of starch requires hydrolysis of both the α-1,4- and α-1,6-glucosidic bonds in amylopectin. Limit dextrinase (LD) is the only endogenous barley enzyme capable of hydrolyzing the α-1,6-glucosidic bond during seed germination, and impaired LD activity inevitably...... reduces the maltose and glucose yields from starch degradation. Crystal structures of barley LD and active-site mutants with natural substrates, products and substrate analogues were sought to better understand the facets of LD-substrate interactions that αconfine high activity of LD to branched...... starch synthesis....

  6. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique;


    The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... fragments coupled with matrix assisted laser desorption mass spectrometry. The sequenced peptide fragments cover 70% of the entire protein sequence, which shows 62% and 77% identity to that of starch debranching enzymes from spinach and rice and 37% identity to Klebsiella pullulanase. Sequence alignment...

  7. Climate Change Effects to Plant Ecosystems - Genetic Resources for Future Barley Breeding

    DEFF Research Database (Denmark)

    Ingvordsen, Cathrine Heinz

    collectively in the very near future. Crop yields have stagnated since the start of this century; a trend also revealed in the cultivation of barley and wheat in the Nordic countries Denmark, Sweden, Norway and Finland, why actions are needed to develop climate resilient cultivars and secure future primary...... accessions, which can be introduced into cultivars to achieve climate resilience. The results from the present dissertation have entered into manuscripts on the direct effect of climate change on barley productivity and quality as well as in life cycle assessment studies (LCA). Valuable genetic resources...

  8. The comparison of nitrogen use and leaching in sole cropped versus intercropped pea and barley

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, H.; Ambus, P.; Jensen, E.S.


    in sole cropped barley. Calculation of the LER showed that plant growth resources were used from 17 to 31% more efficiently by the intercrop than by the sole crops. Pea increased the N derived from N-2 fixation from 70% when sole cropped to 99% of the total aboveground N accumulation when intercropped...... from the sole cropped pea and barley lysimeters. Soil N balances indicated depletion of N in the soil-plant system during the experimental period, independent of cropping system and residue management. N complementarity in the cropping system and the synchrony between residual N availability and crop N...

  9. Optimising root growth to improve uptake and utilization of water and nitrogen in wheat and barley


    César de Carvalho, Pedro Miguel


    Durum wheat (Triticum turgidum L. var durum) and spring barley (Hordeum vulgare L.) are the most widely grown crop species in the semi-arid to arid areas of the Mediterranean region. However, their average on-farm yields are relatively low, 1.95 and 2.60 t ha-1, respectively (FAO, 2007). Water is generally recognized as the most limiting factor for barley and durum wheat production in the Mediterranean, though it has been found, at least for some regions, that N fertilizer applications have b...

  10. Barley alpha-amylase/subtilisin inhibitor: structure, biophysics and protein engineering

    DEFF Research Database (Denmark)

    Nielsen, P.K.; Bønsager, Birgit Christine; Fukuda, Kenji;


    Bifunctional alpha-amylase/subtilisin inhibitors have been implicated in plant defence and regulation of endogenous alpha-amylase action. The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits the barley alpha-amylase 2 (AMY2) and subtilisin-type serine proteases. BASI belongs to the Kunitz...... Ca2+-modulated kinetics of the AMY2/BASl interaction and found that the complex formation involves minimal structural changes. The modulation of the interaction by calcium ions makes it unique among the currently known binding mechanisms of proteinaceous alpha-amylase inhibitors....

  11. Gibberellic Acid enhancement of DNA turnover in barley aleurone cells. (United States)

    Taiz, L; Starks, J E


    When imbibed, deembryonated halfseeds from barley (Hordeum vulgare L., var. Himalaya) are incubated in buffer, the DNA content of the aleurone layer increases 25 to 40% over a 24-hour period. In contrast, the DNA of isolated aleurone layers declines by 20% over the same time period. Gibberellic acid (GA) causes a reduction in DNA levels in both halfseed aleurone layers and isolated aleurone layers. GA also increases the specific radioactivity of [(3)H]thymidine-labeled halfseed aleurone layer DNA during the first 12 hours of treatment. Pulse-chase studies demonstrated that the newly synthesized DNA is metabolically labile.The buoyant density on CsCl density gradients of hormone-treated aleurone DNA is identical with that of DNA extracted from whole seedlings. After density-labeling halfseed DNA with 5-bromodeoxyuridine, a bimodal absorption profile is obtained in neutral CsCl. The light band (1.70 g/ml) corresponds to unsubstituted DNA, while the heavy band (1.725-1.74 g/ml) corresponds to a hybrid density-labeled species. GA increases the relative amount of the heavy (hybrid) peak in halfseed aleurone layer DNA, further suggesting that the hormone enhances semiconservative replication in halfseeds.DNA methylation was also demonstrated. Over 60% of the radioactivity from [(3)H-Me]methionine is incorporated into 5-methylcytosine. GA has no effect on the percentage distribution of label among the bases.It was concluded that GA enhances the rate of DNA degradation and DNA synthesis (turnover) in halfseeds, but primarily DNA degradation in isolated aleurone layers. Incorporation by isolated aleurone layers is due to DNA repair. Semiconservative replication apparently plays no physiological role in the hormone response, since both isolated aleurone layers and gamma-irradiated halfseeds respond normally. The hypothesis was advanced that endoreduplication and DNA degradation are means by which the seed stores and mobilizes deoxyribonucleotides for the embryo during

  12. Alpha-synuclein suppression by targeted small interfering RNA in the primate substantia nigra.

    Directory of Open Access Journals (Sweden)

    Alison L McCormack

    Full Text Available The protein alpha-synuclein is involved in the pathogenesis of Parkinson's disease and other neurodegenerative disorders. Its toxic potential appears to be enhanced by increased protein expression, providing a compelling rationale for therapeutic strategies aimed at reducing neuronal alpha-synuclein burden. Here, feasibility and safety of alpha-synuclein suppression were evaluated by treating monkeys with small interfering RNA (siRNA directed against alpha-synuclein. The siRNA molecule was chemically modified to prevent degradation by exo- and endonucleases and directly infused into the left substantia nigra. Results compared levels of alpha-synuclein mRNA and protein in the infused (left vs. untreated (right hemisphere and revealed a significant 40-50% suppression of alpha-synuclein expression. These findings could not be attributable to non-specific effects of siRNA infusion since treatment of a separate set of animals with luciferase-targeting siRNA produced no changes in alpha-synuclein. Infusion with alpha-synuclein siRNA, while lowering alpha-synuclein expression, had no overt adverse consequences. In particular, it did not cause tissue inflammation and did not change (i the number and phenotype of nigral dopaminergic neurons, and (ii the concentrations of striatal dopamine and its metabolites. The data represent the first evidence of successful anti-alpha-synuclein intervention in the primate substantia nigra and support further development of RNA interference-based therapeutics.

  13. RNA quantification using gold nanoprobes - application to cancer diagnostics

    Directory of Open Access Journals (Sweden)

    Baptista Pedro V


    Full Text Available Abstract Molecular nanodiagnostics applied to cancer may provide rapid and sensitive detection of cancer related molecular alterations, which would enable early detection even when those alterations occur only in a small percentage of cells. The use of gold nanoparticles derivatized with thiol modified oligonucleotides (Au-nanoprobes for the detection of specific nucleic acid targets has been gaining momentum as an alternative to more traditional methodologies. Here, we present an Au-nanoparticles based approach for the molecular recognition and quantification of the BCR-ABL fusion transcript (mRNA, which is responsible for chronic myeloid leukemia (CML, and to the best of our knowledge it is the first time quantification of a specific mRNA directly in cancer cells is reported. This inexpensive and very easy to perform Au-nanoprobe based method allows quantification of unamplified total human RNA and specific detection of the oncogene transcript. The sensitivity settled by the Au-nanoprobes allows differential gene expression from 10 ng/μl of total RNA and takes less than 30 min to complete after total RNA extraction, minimizing RNA degradation. Also, at later stages, accumulation of malignant mutations may lead to resistance to chemotherapy and consequently poor outcome. Such a method, allowing for fast and direct detection and quantification of the chimeric BCR-ABL mRNA, could speed up diagnostics and, if appropriate, revision of therapy. This assay may constitute a promising tool in early diagnosis of CML and could easily be extended to further target genes with proven involvement in cancer development.

  14. Deciphering Mineral Homeostasis in Barley Seed Transfer Cells at Transcriptional Level.

    Directory of Open Access Journals (Sweden)

    Behrooz Darbani

    Full Text Available In addition to the micronutrient inadequacy of staple crops for optimal human nutrition, a global downtrend in crop-quality has emerged from intensive breeding for yield. This trend will be aggravated by elevated levels of the greenhouse gas carbon dioxide. Therefore, crop biofortification is inevitable to ensure a sustainable supply of minerals to the large part of human population who is dietary dependent on staple crops. This requires a thorough understanding of plant-mineral interactions due to the complexity of mineral homeostasis. Employing RNA sequencing, we here communicate transfer cell specific effects of excess iron and zinc during grain filling in our model crop plant barley. Responding to alterations in mineral contents, we found a long range of different genes and transcripts. Among them, it is worth to highlight the auxin and ethylene signaling factors Arfs, Abcbs, Cand1, Hps4, Hac1, Ecr1, and Ctr1, diurnal fluctuation components Sdg2, Imb1, Lip1, and PhyC, retroelements, sulfur homeostasis components Amp1, Hmt3, Eil3, and Vip1, mineral trafficking components Med16, Cnnm4, Aha2, Clpc1, and Pcbps, and vacuole organization factors Ymr155W, RabG3F, Vps4, and Cbl3. Our analysis introduces new interactors and signifies a broad spectrum of regulatory levels from chromatin remodeling to intracellular protein sorting mechanisms active in the plant mineral homeostasis. The results highlight the importance of storage proteins in metal ion toxicity-resistance and chelation. Interestingly, the protein sorting and recycling factors Exoc7, Cdc1, Sec23A, and Rab11A contributed to the response as well as the polar distributors of metal-transporters ensuring the directional flow of minerals. Alternative isoform switching was found important for plant adaptation and occurred among transcripts coding for identical proteins as well as transcripts coding for protein isoforms. We also identified differences in the alternative-isoform preference between

  15. High-Level Accumulation of Exogenous Small RNAs Not Affecting Endogenous Small RNA Biogenesis and Function in Plants

    Institute of Scientific and Technical Information of China (English)

    SHEN Wan-xia; Neil A Smith; ZHOU Chang-yong; WANG Ming-bo


    RNA silencing is a fundamental plant defence and gene control mechanism in plants that are directed by 20-24 nucleotide (nt) small interfering RNA (siRNA) and microRNA (miRNA). Infection of plants with viral pathogens or transformation of plants with RNA interference (RNAi) constructs is usually associated with high levels of exogenous siRNAs, but it is unclear if these siRNAs interfere with endogenous small RNA pathways and hence affect plant development. Here we provide evidence that viral satellite RNA (satRNA) infection does not affect siRNA and miRNA biogenesis or plant growth despite the extremely high level of satRNA-derived siRNAs. We generated transgenic Nicotiana benthamiana plants that no longer develop the speciifc yellowing symptoms generally associated with infection by Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat). We then used these plants to show that CMV Y-Sat infection did not cause any visible phenotypic changes in comparison to uninfected plants, despite the presence of high-level Y-Sat siRNAs. Furthermore, we showed that the accumulation of hairpin RNA (hpRNA)-derived siRNAs or miRNAs, and the level of siRNA-directed transgene silencing, are not signiifcantly affected by CMV Y-Sat infection. Taken together, our results suggest that the high levels of exogenous siRNAs associated with viral infection or RNAi-inducing transgenes do not saturate the endogenous RNA silencing machineries and have no signiifcant impact on normal plant development.

  16. Cell layer-specific distribution of transiently expressed barley ESCRT-III component HvVPS60 in developing barley endosperm. (United States)

    Hilscher, Julia; Kapusi, Eszter; Stoger, Eva; Ibl, Verena


    The significance of the endosomal sorting complexes required for transport (ESCRT)-III in cereal endosperm has been shown by the identification of the recessive mutant supernumerary aleurone layer1 (SAL1) in maize. ESCRT-III is indispensable in the final membrane fission step during biogenesis of multivesicular bodies (MVBs), responsible for protein sorting to vacuoles and to the cell surface. Here, we annotated barley ESCRT-III members in the (model) crop Hordeum vulgare and show that all identified members are expressed in developing barley endosperm. We used fluorescently tagged core ESCRT-III members HvSNF7a/CHMP4 and HvVPS24/CHMP3 and the associated ESCRT-III component HvVPS60a/CHMP5 for transient localization studies in barley endosperm. In vivo confocal microscopic analyses show that the localization of recombinantly expressed HvSNF7a, HvVPS24 and HvVPS60a differs within barley endosperm. Whereas HvSNF7a induces large agglomerations, HvVPS24 shows mainly cytosolic localization in aleurone and subaleurone. In contrast, HvVPS60a localizes strongly at the plasma membrane in aleurone. In subaleurone, HvVPS60a was found to a lesser extent at the plasma membrane and at vacuolar membranes. These results indicate that the steady-state association of ESCRT-III may be influenced by cell layer-specific protein deposition or trafficking and remodelling of the endomembrane system in endosperm. We show that sorting of an artificially mono-ubiquitinated Arabidopsis plasma membrane protein is inhibited by HvVPS60a in aleurone. The involvement of HvVPS60a in different cell layer-specific trafficking pathways, reflected by localization of HvVPS60a at the plasma membrane in aleurone and at the PSV membrane in subaleurone, is discussed.

  17. Weed infestation in canopy of spring barley in condition of different tillage systems and fertilization and plant protection levels

    Directory of Open Access Journals (Sweden)

    Piotr Kraska


    Full Text Available The purpose of this work was to determine the influence of conventional tillage (fall ploughing at 25 cm and minimum tillage systems (chisel ploughing at 30 cm and two differentiated fertilization and plant protection levels on number, species composition and air dry weed mass in spring barley cv. Rataj. This spring barley was cultivated in crop rotation potato - spring barley - winter rye. The analysis of field infestation was made prior to spring barley harvest with quantitative- weighting method. There was estimated number of weeds, weed species composition and air dry weight of weeds in two randomly chosen areas of each plot of 0.5 m2. The density of weeds and weed air dry weight was statistically analysed by means of variance analysis, and the mean values were estimated with Tukey's confidence intervals (p=0.05. Intensive level of fertilization and chemical crop protection decreased number of monocotyledonous weeds and total weeds in canopy of spring barley. Conventional system of soil cultivation decreased in a canopy of spring barley the following species of weeds: Geranium pusillum, Galinsoga parviflora, Stellaria media, Apera spica-venti, Poa annua and Echinochloa crusgalli. Conventional tillage increases number of Chamomilla suaveolens and Fallopia convolvulus in a canopy of spring barley. Intensive fertilization and plant protection levels decreased weed infestation first of all through Echinochloa crusgalli, Apera spica-venti, Fallopia convolvulus, Galinsoga parviflora, Geranium pusillum, Chenopodium album and Setaria pumila.

  18. In situ identification and quantification of starch-hydrolyzing bacteria attached to barley and corn grain in the rumen of cows fed barley-based diets. (United States)

    Xia, Yun; Kong, Yunhong; Seviour, Robert; Yang, Hee-Eun; Forster, Robert; Vasanthan, Thavaratnam; McAllister, Tim


    Cereal grains rich in starch are widely used to meet the energy demands of high-producing beef and dairy cattle. Bacteria are important players in starch digestion in the rumen, and thus play an important role in the hydrolysis and fermentation of cereal grains. However, our understanding of the composition of the rumen starch-hydrolyzing bacteria (SHB) is limited. In this study, BODIPY FL DQ starch staining combined with fluorescence in situ hybridization (FISH) and quantitative FISH were applied to label, identify and quantify SHB possessing active cell-surface-associated (CSA) α-amylase activity in the rumen of heifers fed barley-based diets. When individual cells of SHB with active CSA α-amylase activity were enumerated, they constituted 19-23% of the total bacterial cells attached to particles of four different cultivars of barley grain and corn. Quantitative FISH revealed that up to 70-80% of these SHB were members of Ruminococcaceae in the phylum Firmicutes but were not Streptococcus bovis, Ruminobacter amylophilus, Succinomonas amylolytica, Bifidobacterium spp. or Butyrivibrio fibrisolvens, all of whose amylolytic activities have been demonstrated previously in vitro. The proportion of barley grain in the diet had a large impact on the percentage abundance of total SHB and Ruminococcaceae SHB in these animals.

  19. In situ identification and quantification of starch-hydrolyzing bacteria attached to barley and corn grain in the rumen of cows fed barley-based diets. (United States)

    Xia, Yun; Kong, Yunhong; Seviour, Robert; Yang, Hee-Eun; Forster, Robert; Vasanthan, Thavaratnam; McAllister, Tim


    Cereal grains rich in starch are widely used to meet the energy demands of high-producing beef and dairy cattle. Bacteria are important players in starch digestion in the rumen, and thus play an important role in the hydrolysis and fermentation of cereal grains. However, our understanding of the composition of the rumen starch-hydrolyzing bacteria (SHB) is limited. In this study, BODIPY FL DQ starch staining combined with fluorescence in situ hybridization (FISH) and quantitative FISH were applied to label, identify and quantify SHB possessing active cell-surface-associated (CSA) α-amylase activity in the rumen of heifers fed barley-based diets. When individual cells of SHB with active CSA α-amylase activity were enumerated, they constituted 19-23% of the total bacterial cells attached to particles of four different cultivars of barley grain and corn. Quantitative FISH revealed that up to 70-80% of these SHB were members of Ruminococcaceae in the phylum Firmicutes but were not Streptococcus bovis, Ruminobacter amylophilus, Succinomonas amylolytica, Bifidobacterium spp. or Butyrivibrio fibrisolvens, all of whose amylolytic activities have been demonstrated previously in vitro. The proportion of barley grain in the diet had a large impact on the percentage abundance of total SHB and Ruminococcaceae SHB in these animals. PMID:26142428

  20. Yield and yield structure of spring barley (Hodeum vulgare L. grown in monoculture after different stubble crops

    Directory of Open Access Journals (Sweden)

    Dorota Gawęda


    Full Text Available A field experiment was conducted in the period 2006- 2008 in the Uhrusk Experimental Farm belonging to the University of Life Sciences in Lublin. The experimental factor was the type of stubble crop ploughed in each year after harvest of spring barley: white mustard, lacy phacelia, winter rape, and a mixture of narrow-leaf lupin with field pea. In the experiment, successive spring barley crops were grown one after the other (in continuous monoculture. The aim of the experiment was to evaluate the effect of stubble crops used on the size and structure of barley yield. The three-year study showed an increasing trend in grain yield of spring barley grown after the mixture of legumes, lacy phacelia, and white mustard compared to its size in the treatment with no cover crop. Straw yield was significantly higher when barley was grown after the mixture of narrowleaf lupin with field pea than in the other treatments of the experiment. The type of ploughed-in stubble crop did not modify significantly plant height, ear length, and grain weight per ear. Growing the mixture of leguminous plants as a cover crop resulted in a significant increase in the density of ears per unit area in barley by an average of 14.7% relative to the treatment with winter rape. The experiment also showed the beneficial effect of the winter rape cover crop on 1000-grain weight of spring barley compared to that obtained in the treatments with white mustard and the mixture of legumes. All the cover crops caused an increase in the number of grains per ear of barley relative to that found in the control treatment. However, this increase was statistically proven only for the barley crops grown after lacy phacelia and the mixture of legumes.

  1. Hamowanie syntezy chlorofilu i RNA w izolowanych liścieniach ogórka przez N-hydroksymocznik [Inhibition of chlorophyll and RNA synthesis by N-hydroxyurea in detached cucumber cotyledons

    Directory of Open Access Journals (Sweden)

    A. Rennert


    Full Text Available N-hydroxyurea (HU at the concentration of 5 x 10-4 M decreased the content of chlorophyll in detached cucumber cotyledons; at this concentration it has no inhibitory effect on growth. Benzylaminopurine, gibberelic acid and KCl partially reversed the inhibitory effect of HU on chlorophyll synthesis. HU stimulated yellowing of barley first leaf sections. The compound had little effect on leucine-14C incorporation to protein, and markedly inhibited uracil-14C incorporation in to RNA of the greening cucumber cotyledons. It is suggested that the inhibition of RNA and chlorophyll synthesis in HU-treated cucumber cotyledons follows the HU-dependent inhibition of DNA replication.

  2. Proteomic and activity profiles of ascorbate-glutathione cycle enzymes in germinating barley embryo

    DEFF Research Database (Denmark)

    Bønsager, Birgit Christine; Shahpiri, Azar; Finnie, Christine;


    Enzymes involved in redox control are important during seed germination and seedling growth. Ascorbate-glutathione cycle enzymes in barley embryo extracts were monitored both by 2D-gel electrophoresis and activity measurements from 4 to 144 h post imbibition (PI). Strikingly different activity...

  3. Quality Control System for Beer Developed with Monoclonal Antibodies Specific to Barley Lipid Transfer Protein

    Directory of Open Access Journals (Sweden)

    Yukie Murakami-Yamaguchi


    Full Text Available Non-specific lipid transfer protein (LTP in barley grain reacted with the IgE in sera drawn from food allergy patients. A sandwich-type of enzyme-linked immunosorbent assay (ELISA was developed with mouse monoclonal antibodies raised against LTP purified with barley flour. This ELISA showed a practical working range of 0.3–3 ng/mL and no cross-reactivity with wheat, adlay and rye. Using this ELISA, LTP was determined in several types of barley-foods, including fermented foods such as malt vinegar, barley-malt miso and beer. LTP content in beer of the same kind was approximately constant, even if manufacturing factory and production days were different. Not only as a factor of foam formation and stability but also as an allergen, controlling and monitoring of LTP in beer should be considered. Taken together, our LTP-detecting ELISA can be proposed as an appropriate system for the quality control of beer.

  4. Effect of pulsed electric field on the germination of barley seeds

    DEFF Research Database (Denmark)

    Dymek, Katarzyna; Dejmek, Petr; Panarese, Valentina;


    to finish germination in saturated air. It is shown that exposure of germinating barley to PEF affects radicle emergence without significantly affecting the seeds’ gross metabolic activity, as quantified by isothermal calorimetry. An exploration of protein 2-DE profiles of both the embryo and the starchy...

  5. Performance of spring barley (Hordeum vulgare) varieties under organic and conventional conditions

    NARCIS (Netherlands)

    Kokare, A.; Legzdina, L.; Beinarovica, I.; Niks, R.E.; Maliepaard, C.A.; Lammerts Van Bueren, E.


    Organic agriculture needs spring barley varieties that are adapted to organic growing conditions and have good and stable grain yield across years, even under less favourable growing conditions. The aim of this study was to compare how varieties differ in yield and yield stability under conventional

  6. Genetic differentiation and geographical Relationship of Asian barley landraces using SSRs

    Directory of Open Access Journals (Sweden)

    Rehan Naeem


    Full Text Available Genetic diversity in 403 morphologically distinct landraces of barley (Hordeum vulgare L. subsp. vulgare originating from seven geographical zones of Asia was studied using simple sequence repeat (SSR markers from regions of medium to high recombination in the barley genome. The seven polymorphic SSR markers representing each of the chromosomes chosen for the study revealed a high level of allelic diversity among the landraces. Genetic richness was highest in those from India, followed by Pakistan while it was lowest for Uzbekistan and Turkmenistan. Out of the 50 alleles detected, 15 were unique to a geographic region. Genetic diversity was highest for landraces from Pakistan (0.70 ± 0.06 and lowest for those from Uzbekistan (0.18 ± 0.17. Likewise, polymorphic information content (PIC was highest for Pakistan (0.67 ± 0.06 and lowest for Uzbekistan (0.15 ± 0.17. Diversity among groups was 40% compared to 60% within groups. Principal component analysis clustered the barley landraces into three groups to predict their domestication patterns. In total 51.58% of the variation was explained by the first two principal components of the barley germplasm. Pakistan landraces were clustered separately from those of India, Iran, Nepal and Iraq, whereas those from Turkmenistan and Uzbekistan were clustered together into a separate group.

  7. Saccharification and fermentation of whole barley ground in the Szego mill

    Energy Technology Data Exchange (ETDEWEB)

    Wayman, M.; Parekh, S.R.; Parekh, R.S.; Trass, O.; Gandolfi, E.


    Barley, after steeping in water, was ground with ease and efficiency in the Szego mill, and its starch was liquefied, saccharified and fermented to very high yields of ethanol. The Szego mill consists of vertical rollers with helical grooves which rotate within a fixed cylinder, resulting in very fine grinding and a somewhat flaky product. The steeped barley was ground to a fine paste. This was readily liquefied and saccharified by amylolytic enzymes (dual enzyme process), and the resulting sugars were fermented in 24 h by ordinary bakers' yeast Saccharomyces cerevisiae, resulting in over 450 l ethanol/t of barley. Still shorter time, 12 h, and the same high yield were achieved when liquefied barley starch was simultaneously saccharified by glucoamylase and fermented. Fermentation to ethanol by a glucoamylase-producing yeast S. diastaticus strain 164A (from Labatt Brewing Company) enabled the amount of this enzyme required for saccharification to be reduced to about one-half the normal quantity, but at some cost in slower fermentation and slightly lower ethanol yield.

  8. Targeted modification of storage protein content resulting in improved amino acid composition of barley grain

    DEFF Research Database (Denmark)

    Sikdar, Md. Shafiqul Islam; Bowra, S; Schmidt, Daiana;


    C-hordein in barley and ω-gliadins in wheat are members of the prolamins protein families. Prolamins are the major component of cereal storage proteins and composed of non-essential amino acids (AA) such as proline and glutamine therefore have low nutritional value. Using double stranded RNAi sil...

  9. Use of recurrent irradiation in plant breeding of quantitative characters of barley and wheat

    International Nuclear Information System (INIS)

    In this work was applied recurrent irradiation by gamma radiation of cobalt 60 in different doses to barley and wheat seeds in order to generate genetic variation and facilitating the selection of quantitative characters. The first part of this work was realized without making any selection and the second one by means of selection toward the greatest number of tassel spikelets. The experimental evaluation of irradiated materials without selection indicated that in high doses it was obtained a best expression of the character and that this was greater increasing the generations of irradiation excepting the MI generation as in barley as wheat. According to the experimental evaluation, the selected lines of irradiated material of barley was greater yield that the original variety, but this did not occur with the wheat, because of the grain size of the selected lines was more little. The posterior selection for following increasing the spikelets number for tassel has been effective and in the barley the advances were greater than in the wheat. (Author). 4 refs, 5 figs

  10. Stimulation of bacteria and protists in rhizosphere of glyphosate-treated barley

    DEFF Research Database (Denmark)

    Imparato, Valentina; Santos, Susana; Johansen, Anders;


    treatments with no effect on total abundance. Also the abundance of culturable protists increased as an effect of glyphosate and the bacterial genetic diversity as revealed by 16S rDNA DGGE analysis was affected. Overall, the results indicate that when barley leaves are treated with glyphosate...

  11. Effects of Microbial Additives on Chemical Composition and Fermentation Characteristics of Barley Silage (United States)

    Amanullah, S. M.; Kim, D. H.; Lee, H. J.; Joo, Y. H.; Kim, S. B.; Kim, S. C.


    This study examined the effects of bacterial inoculants on chemical composition and fermentation indices of barley silage. Barley forage (Youngyang) was harvested at 24% dry matter (DM) and wilted to 47.9% DM. The wilted barley forage was chopped to 3–5 cm length and applied with no inoculant (CON), L. plantarum (1×1010 cfu/g, LP) or Effective Microorganisms (0.5×109 cfu/g, EM). Then the forages were ensiled in four replications for each treatment in 20 L mini silos and stored for 100 days. The contents of crude protein and ether extract were higher in CON silage ensiled for 100-d, while the contents of DM and crude ash were higher in EM silage (p0.05). The pH, ammonia-N concentration and lactate to acetate ratio were higher (p<0.05) in CON silage, while lactate concentrations were higher (p<0.05) in CON and LP silage. Acetate concentration and lactic acid bacteria was increased (p<0.05) by both inoculants (LP and EM), but propionate concentration and yeast was increased (p<0.05) by EM and LP, respectively. These results indicated that the fermentation quality of barley silage was improved by the application of bacterial inoculants. PMID:25049981

  12. Penicillium verrucosum in wheat and barley indicates presence of ochratoxin A

    DEFF Research Database (Denmark)

    Lund, Flemming; Frisvad, Jens Christian


    Aims: The aims of this study were to isolate and identify ochratoxin A (OTA) producing fungi in cereals containing OTA and to determine the best selective and indicative medium for recovery of OTA producing fungi.Methods and Results: Seventy-six wheat, barley and rye samples from Europe containing...

  13. Genetic mapping of the barley lodging resistance locus Erectoides-k

    DEFF Research Database (Denmark)

    Kristensen, Peter Skov; Dockter, Christoph; Lundqvist, Udda;


    ’ is a semi-dwarf barley cultivar known for its culm stability and resistance to lodging. In total, eight allelic ert-k mutants are known that show different phenotypic strength concerning culm length and spike architecture. They represent alternatives to the widely used, but pleiotropic ‘Green Revolution...

  14. Automated Analysis of Barley Organs Using 3D Laser Scanning: An Approach for High Throughput Phenotyping

    Directory of Open Access Journals (Sweden)

    Stefan Paulus


    Full Text Available Due to the rise of laser scanning the 3D geometry of plant architecture is easy to acquire. Nevertheless, an automated interpretation and, finally, the segmentation into functional groups are still difficult to achieve. Two barley plants were scanned in a time course, and the organs were separated by applying a histogram-based classification algorithm. The leaf organs were represented by meshing algorithms, while the stem organs were parameterized by a least-squares cylinder approximation. We introduced surface feature histograms with an accuracy of 96% for the separation of the barley organs, leaf and stem. This enables growth monitoring in a time course for barley plants. Its reliability was demonstrated by a comparison with manually fitted parameters with a correlation R2 = 0:99 for the leaf area and R2 = 0:98 for the cumulated stem height. A proof of concept has been given for its applicability for the detection of water stress in barley, where the extension growth of an irrigated and a non-irrigated plant has been monitored.

  15. Induced Sterility as a Factor in the Competition between Barley Varieties

    DEFF Research Database (Denmark)

    Sandfær, Jens


    In a mixture of two spring barley varieties, ‘Tystofte Prentice’ and ‘Svaløf Freja’, a sterility interaction was found. The percentage of sterile flowers in ‘Freja’ showed an approximately six-fold increase over that in pure stand, whereas in ‘T. Prentice’ the percentage of sterile flowers showed...

  16. Biochemistry, Structure and Function of Non-Wheat Proteins: Case Study of Barley ß-Amylase (United States)

    The importance of a protein is not always evident and may be due to its multifunctional nature. ß-Amylase in seeds of barley (Hordeum vulgare L.) constitutes approximately 2% of the total protein in mature seeds and is assumed to be important when storage proteins are mobilized to support protein s...

  17. Barley uptake of N deposited in the rhizosphere of associated field pea

    DEFF Research Database (Denmark)

    Jensen, E.S.


    N deposited in the rhizosphere of a legume may contribute to the N-nutrition of an intercropped non-legume. The process of deposition and subsequent uptake by a neighbouring plant is often termed N-transfer. The N-transfer from field pea (Pisum sativum L.) to associated spring barley (Hordeum...

  18. Lumbricus terrestris L. activity increases the availability of metals and their accumulation in maize and barley

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, E. [Department of Chemical Engineering, School of Civil Engineering, University of Castilla-La Mancha, Avenida Camilo Jose Cela, s/n, 13071 Ciudad Real (Spain); Alonso-Azcarate, J. [Department of Physical Chemistry, Faculty of Environmental Sciences, University of Castilla-La Mancha, Avenida Carlos III, s/n, 45071 Toledo (Spain); Rodriguez, L., E-mail: [Department of Chemical Engineering, School of Civil Engineering, University of Castilla-La Mancha, Avenida Camilo Jose Cela, s/n, 13071 Ciudad Real (Spain)


    The effect of the earthworm Lumbricus terrestris L. on metal availability in two mining soils was assessed by means of chemical extraction methods and a pot experiment using crop plants. Results from single and sequential extractions showed that L. terrestris had a slight effect on metal fractionation in the studied soils: only metals bound to the soil organic matter were significantly increased in some cases. However, we found that L. terrestris significantly increased root, shoot and total Pb and Zn concentrations in maize and barley for the soil with the highest concentrations of total and available metals. Specifically, shoot Pb concentration was increased by a factor of 7.5 and 3.9 for maize and barley, respectively, while shoot Zn concentration was increased by a factor of 3.7 and 1.7 for maize and barley, respectively. Our results demonstrated that earthworm activity increases the bioavailability of metals in soils. - Research highlights: > Lumbricus terrestris L. activity increases the bioavailability of metals in soils. > Earthworm activity can significantly increase total, shoot and root metal concentrations for crop plants. > Both bioassays and chemical extraction methods are necessary for assessing the bioavailability of metals in contaminated soils. - Lumbricus terrestris L. activity increases the bioavailability of metals in soils and total, shoot and root metal concentrations for maize and barley.

  19. Improving the nutritional quality of the barley and wheat grain storage proteins by antisense technology

    DEFF Research Database (Denmark)

    Sikdar, Md. Shafiqul Islam; Lange, Mette; Aaslo, Per;


    gliadins) are also available from Germany and UK. We have grown them under different N regimes (high, medium and low N) in semi-field conditions. Previously five different antisense C-hordein lines of barley have been characterized in our laboratory. The analyses revealed that the lysine, threonine...

  20. Degradability Characteristics of Treated and Untreated Barley Grain Using In situ Technique

    Directory of Open Access Journals (Sweden)

    Akbar Taghizadeh


    Full Text Available This study was carried out to determine of degradability characteristics of untreated barely grain (UBG and treated barley grain with autoclaving at 120°C, 5´ (TBG1 and 20' (TBG2, treated barley grain at 100°C, 5´ (TBG3 and 20' (TBG4, using in situ technique in Ghizel sheep’s. The sheep fed diet content 40% alfalfa: 60% concentrate containing 2.9 Mcal kg-1 DM and 14% CP. The incubation times were 0, 4, 8, 16, 24, 36 and 48 h and rumen degradation of cp and DM was measured. The equation of p = a+b (1-e-ct was used for fitting of dry matter and crude protein disappearance data. The dry matter disappearance of TBG1 and TBG2 at 24 and 48 h were lower than the other treatments (p<0.05. The crude protein disappearance of 24 and 48 h of UBG was more than the other treatment (p<0.05. Treating of barley grain of 120°C (5' and 20' can be decreased ruminal crude protein degradability of barley grain resulting high escaped crude protein into lower digestive tract.

  1. Barley and wheat foods: influence on plasma cholesterol concentrations in hypercholesterolemic men. (United States)

    McIntosh, G H; Whyte, J; McArthur, R; Nestel, P J


    Twenty-one mildly hypercholesterolemic men aged 30-59 y were provided with comparable barley and wheat foods for each of 4 wk in a crossover-designed experiment. The purpose of the study was to examine the influence of two sources of dietary fiber (nonstarch polysaccharides, NSP) on blood lipids and glucose concentrations. Barley contains beta-glucan as a source of soluble dietary fiber (DF) whereas wheat contains the largely insoluble cellulose and hemicellulose fiber. Total dietary fiber increased from a previous intake of 21-38 g/d during the period of study for the two groups. Consumption of barley relative to wheat foods was associated with a significant fall in both plasma total cholesterol (6%, P less than 0.05) and in low-density-lipoprotein cholesterol (7%, P less than 0.02) whereas triglyceride and glucose concentrations did not change significantly. It is concluded that barley dietary fiber is more effective than wheat dietary fiber at lowering blood cholesterol in hypercholesterolemic men. PMID:1850576

  2. Marine eutrophication impacts from present and future production of spring barley

    DEFF Research Database (Denmark)

    Cosme, Nuno Miguel Dias; Niero, Monia


    Environmental emissions of nitrogen (N) from agriculture surplus may enrich coastal waters and trigger marine eutrophication impacts. We estimated these impacts for spring barley production in Denmark, under present and future climatic conditions with double carbon dioxide concentration and 5 °C...

  3. 7 CFR 457.102 - Wheat or barley winter coverage endorsement. (United States)


    ... winter coverage endorsement. United States Department of Agriculture Federal Crop Insurance Corporation... crop covered under this endorsement must be insured. 10. The amount of any indemnity paid under the... multiple crop benefits in the same crop year. 11. Whenever any winter wheat or barley is damaged during...

  4. Automated analysis of barley organs using 3D laser scanning: an approach for high throughput phenotyping. (United States)

    Paulus, Stefan; Dupuis, Jan; Riedel, Sebastian; Kuhlmann, Heiner


    Due to the rise of laser scanning the 3D geometry of plant architecture is easy to acquire. Nevertheless, an automated interpretation and, finally, the segmentation into functional groups are still difficult to achieve. Two barley plants were scanned in a time course, and the organs were separated by applying a histogram-based classification algorithm. The leaf organs were represented by meshing algorithms, while the stem organs were parameterized by a least-squares cylinder approximation. We introduced surface feature histograms with an accuracy of 96% for the separation of the barley organs, leaf and stem. This enables growth monitoring in a time course for barley plants. Its reliability was demonstrated by a comparison with manually fitted parameters with a correlation R(2) = 0:99 for the leaf area and R(2) = 0:98 for the cumulated stem height. A proof of concept has been given for its applicability for the detection of water stress in barley, where the extension growth of an irrigated and a non-irrigated plant has been monitored. PMID:25029283

  5. Barley yellow dwarf disease as a target of breeding for resistance (short review

    Directory of Open Access Journals (Sweden)

    Katarzyna Golnik


    Full Text Available The aim of this work was to give a brief review of some points of wide knowledge of barley yellow dwarf (BYD disease and its breeding for resistance program.Yd2 gene has been shortly characterised. Current situation in Poland has been underlined.

  6. Selectivity of the surface binding site (SBS) on barley starch synthase I

    DEFF Research Database (Denmark)

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica;


    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  7. The Nutritive Value of Wastewater Grown Barley and its Utilization in Fish Feed

    Directory of Open Access Journals (Sweden)

    A. M. Snow


    Full Text Available The feasibility of using wastewater grown barley plants as a component of fish feed was evaluated. The barley plants were grown in a hydroponics system on wastewater from a recirculating aquaculture facility. The effects of wastewater application rate on plant growth and pollution potential reduction were investigated. At the end of the experiment, the average crop heights and yields were 31.0 and 36.0 cm and 59 and 83 t ha -1 at wastewater application rates of 690 and 1380 mL compartment -1 day -1, respectively. The hydroponics system reduced the TS, COD, NH4+-N, NO2--N, NO3--N and PO4 -3-P of the aquaculture wastewater by 51.5-52.9, 72.3-72.3, 81.8-82.3, 97.9-98.2, 78.9-79.7 and 84.7-86.3%, respectively. The aquaculture wastewater grown barley met the energy, fat, Ca, Mg, P, Na, S and Mn dietary requirements of aquatic animals. It exceeded the carbohydrate, crude fiber, Cl, K, Cu, Fe, Se and Zn dietary requirements of fish and shellfish. It did not contain sufficient amounts of protein. The aquaculture wastewater grown barley could potential be used as a component in fish feed, but will require supplementation with a high protein source that contains low concentrations of carbohydrate, crude fiber, Cl, K, Cu, Fe, Se and Zn. Common protein sources that could be used for supplementation included fishmeal, bone meal and blood meal.

  8. Osmotic stress at the barley root affects expression of circadian clock genes in the shoot. (United States)

    Habte, Ermias; Müller, Lukas M; Shtaya, Munqez; Davis, Seth J; von Korff, Maria


    The circadian clock is an important timing system that controls physiological responses to abiotic stresses in plants. However, there is little information on the effects of the clock on stress adaptation in important crops, like barley. In addition, we do not know how osmotic stress perceived at the roots affect the shoot circadian clock. Barley genotypes, carrying natural variation at the photoperiod response and clock genes Ppd-H1 and HvELF3, were grown under control and osmotic stress conditions to record changes in the diurnal expression of clock and stress-response genes and in physiological traits. Variation at HvELF3 affected the expression phase and shape of clock and stress-response genes, while variation at Ppd-H1 only affected the expression levels of stress genes. Osmotic stress up-regulated expression of clock and stress-response genes and advanced their expression peaks. Clock genes controlled the expression of stress-response genes, but had minor effects on gas exchange and leaf transpiration. This study demonstrated that osmotic stress at the barley root altered clock gene expression in the shoot and acted as a spatial input signal into the clock. Unlike in Arabidopsis, barley primary assimilation was less controlled by the clock and more responsive to environmental perturbations, such as osmotic stress. PMID:24895755

  9. Phytoremediation of Petroleum-Contaminated Soils around Isfahan Oil Refinery (Iran by Sorghum and Barley

    Directory of Open Access Journals (Sweden)

    Farida Irajy Asiabadi


    Full Text Available Petroleum compounds are one of the most frequently encountered pollutants in soils adjacent to oil refineries. Phytoremediation,where feasible, has become a cost-effective alternative to physicochemical methods of soil remediation. In this study, sorghum (Sorghum bicolor and barley (Hordeum vulgare were selected for phytoremediationand the diminution in the concentration of oil-based contaminants was measured during a 90-day period. Contaminated and control treatments were compared in terms of root and shoot dry weight. Comparisons revealed reductions of about 22% and 30% in root dry matter and 51% and 42% in shoot dry matter of sorghum and barley in contaminated soil, respectively. The control and planted soils were significantly different in total and oil-degrading bacterial counts. Moreover, the concentration of total petroleum hydrocarbons decreased by 52%-64% in 90 days. Since planting the contaminated soil with sorghum and barley resulted in an improvement of 30% compared to unplanted contaminated soil, the two plants were highly efficient in removing petroleum from oil-contaminated soils. Therefore, despite the necessity of further studies to enhance the efficacy of phytoremediation by assessing the appropriateness of various plant species, some genotypes like sorghum and barley were found suitable choices for phytoremediation of the investigated petroleum-contaminated soil.

  10. Stability of transgene expression, field performance and recombination breeding of transformed barley lines

    DEFF Research Database (Denmark)

    Horvath, H.; Jensen, L.G.; Wong, O.T.;


    Stable inheritance of the transgene, consistent expression and competitive agronomic properties of transgenic crops are important parameters for successful use of the latter. These properties have been analyzed with 18 homozygous transgenic barley lines of the cultivar Golden Promise. The lines o...



    Kondalenko O.A.; Stepanova S.V.; Shayhiev I.G.


    In article the technology of application of a sorption material from seed covers of barley by processing by plasma of the high-frequency category for elimination of consequences of environmental pollution at technogenic accidents and accidents on objects of petrochemical industries is improved.

  12. Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys. (United States)

    Dai, Huaxin; Cao, Fangbin; Chen, Xianhong; Zhang, Mian; Ahmed, Imrul Mosaddek; Chen, Zhong-Hua; Li, Chengdao; Zhang, Guoping; Wu, Feibo


    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A) specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance. PMID:23691047

  13. Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys.

    Directory of Open Access Journals (Sweden)

    Huaxin Dai

    Full Text Available Aluminum (Al toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance.

  14. Root border cell development is a temperature-insensitive and Al-sensitive process in barley. (United States)

    Pan, Jian-Wei; Ye, Dan; Wang, Li-Ling; Hua, Jing; Zhao, Gu-Feng; Pan, Wei-Huai; Han, Ning; Zhu, Mu-Yuan


    In vivo and in vitro experiments showed that border cell (BC) survival was dependent on root tip mucigel in barley (Hordeum vulgare L. cv. Hang 981). In aeroponic culture, BC development was an induced process in barley, whereas in hydroponic culture, it was a kinetic equilibrium process during which 300-400 BCs were released into water daily. The response of root elongation to temperatures (10-35 degrees C) was very sensitive but temperature changes had no great effect on barley BC development. At 35 degrees C, the root elongation ceased whereas BC production still continued, indicating that the two processes might be regulated independently under high temperature (35 degrees C) stress. Fifty microM Al could inhibit significantly BC development by inhibiting pectin methylesterase activity in the root cap of cv. 2000-2 (Al-sensitive) and cv. Humai 16 (Al-tolerant), but 20 microM Al could not block BC development in cv. Humai 16. BCs and their mucigel of barley had a limited role in the protection of Al-induced inhibition of root elongation, but played a significant role in the prevention of Al from diffusing into the meristems of the root tip and the root cap. Together, these results suggested that BC development was a temperature-insensitive but Al-sensitive process, and that BCs and their mucigel played an important role in the protection of root tip and root cap meristems from Al toxicity. PMID:15215510

  15. Registration of 'Stoneham' spring feed barley resistant to Russian wheat aphid (United States)

    'Stoneham' (REG. No.; PI 641940) a Russian wheat aphid (RWA, Diuraphis noxia Kurdjumov)-resistant, spring, two-rowed, feed barley (Hordeum vulgare) tested as 97BX 27-132, was developed and released by the USDA-ARS, Stillwater, OK and Aberdeen, ID; Colorado State University; and the University of Neb...

  16. Fine mapping of the barley chromosome 6H net form net blotch susceptibility locus (United States)

    Net form net blotch (NFNB) caused by the necrotrophic fungal pathogen Pyrenophora teres f. teres (Ptt) is a destructive foliar disease of barley with the potential to cause significant yield loss in major production regions throughout the world. Characterization of diverse genetic resistances to thi...

  17. Root border cell development is a temperature-insensitive and Al-sensitive process in barley. (United States)

    Pan, Jian-Wei; Ye, Dan; Wang, Li-Ling; Hua, Jing; Zhao, Gu-Feng; Pan, Wei-Huai; Han, Ning; Zhu, Mu-Yuan


    In vivo and in vitro experiments showed that border cell (BC) survival was dependent on root tip mucigel in barley (Hordeum vulgare L. cv. Hang 981). In aeroponic culture, BC development was an induced process in barley, whereas in hydroponic culture, it was a kinetic equilibrium process during which 300-400 BCs were released into water daily. The response of root elongation to temperatures (10-35 degrees C) was very sensitive but temperature changes had no great effect on barley BC development. At 35 degrees C, the root elongation ceased whereas BC production still continued, indicating that the two processes might be regulated independently under high temperature (35 degrees C) stress. Fifty microM Al could inhibit significantly BC development by inhibiting pectin methylesterase activity in the root cap of cv. 2000-2 (Al-sensitive) and cv. Humai 16 (Al-tolerant), but 20 microM Al could not block BC development in cv. Humai 16. BCs and their mucigel of barley had a limited role in the protection of Al-induced inhibition of root elongation, but played a significant role in the prevention of Al from diffusing into the meristems of the root tip and the root cap. Together, these results suggested that BC development was a temperature-insensitive but Al-sensitive process, and that BCs and their mucigel played an important role in the protection of root tip and root cap meristems from Al toxicity.

  18. Frequency of Aneuploids in Progenies of Autotriploid Barley, Hordeum Vulgare L

    DEFF Research Database (Denmark)

    Sandfær, J.


    Chromosome counts of 863 progeny plants originating from 68 autotriploid barley plants revealed a considerable variation in chromosome numbers ranging from the diploid number (2n= 14) to 2n= 39. The most frequent groups were plants with 15 and 16 chromosomes each constituting about 27% of all pro...

  19. Hordein Variation in Wild (Hordeum Spontaneum) and Cultivated (H. Vulgare) Barley

    DEFF Research Database (Denmark)

    Doll, Hans; Brown, A. H. D.


    The storage protein hordein contains two major groups of polypeptides which are highly polymorphic in barley, and in its evolutionary progenitor Hordeum spontaneum Koch. Crosses between the two species showed that the complex electrophoretic phenotypes within the two groups of polypeptides are go...

  20. Composition and Functional Lipid Profiles of Low-Phyate Barleys and Related Cultivars (United States)

    Barley, one of the earliest cultivated cereal grains in the world, is gaining renewed interest for use in food, feed and as a bioethanol feedstock. Like other grains, its high phytate content is undesirable since phytate affects mineral bioavailability and contributes to P pollution to environment....

  1. Effect of Initial Soluble Salt Composition of Saline Soil on Salinity Tolerance of Barley Plant

    Institute of Scientific and Technical Information of China (English)



    A pot experiment was carried out on a marine saline soil to study the effect of initial soluble Na/Ca ratio of saline soil on the salinity tolerance of barley plant.The results showed that (1) the Na/Ca ratio affected significantly the dry weight of the plant at an earlier stage of growth,the critical values of initial Na/Ca ratio at which the plant could grow normally on soils containing salts of 2.5,3.5 and 4.5g kg-1 were 30,20 and 15,respectively;(2)smaller Na/Ca ratio resulted in a considerable decrease in Na accumulation but a great increase in K accumulation in the barley plant;and (3) the plasmallema of barley leaf were badly injured when the Na/Ca ratio was more than 30 and the increase of Na content of plant caused an exudation of K from the leaf cells.Some critical indexes were suggested for the cultivation of barley plant on marine saline soils and could be used as reference in the biological reclamation of marine saline soils.

  2. The Discovery of Resistant Sources of Spring Barley, Hordeum vulgare ssp. spontaneum, and Unique Greenbug Biotypes. (United States)

    Armstrong, J Scott; Mornhinweg, Dolores W; Payton, Mark E; Puterka, Gary J


    The genetic sources for host-plant resistance to the greenbug (Schizaphis graminum Rondani) in barley (Hordeum vulgare ssp. spontaneum) are limited in that only two single dominant genes Rsg1 and Rsg2 are available for the complex of greenbug biotypes. We evaluated four new barley lines from the Wild Barley Diversity Collection (WBDC) that previously showed potential for greenbug resistance. Three of those entries, WBDC 53, WBDC 117, WBDC 336, exhibited very dominant sources of resistance to older known biotypes B, C, E, F, H, I, and TX1, which also add to the host-plant differentials used to separate these greenbug biotypes. We also re-evaluated the earlier known set of greenbug biotypes that have been in culture for several years against the known host-plant differentials, and included seven newer greenbug isolates collected from Wyoming to the full complement of small grain differentials. This resulted in the discovery of five new greenbug biotypes, WY10 MC, WY81, WY10 B, WY12 MC, and WY86. Wyoming isolates WY4 A and WY4 B were identical in their phenotypic profile, and should be combined as a single unique greenbug biotype. These barley trials resulted in finding new sources of host-plant resistance, although more research needs to be conducted on what type of resistance was found, and how it can be used. We also document that the Wheatland, Wyoming area serves as a very conducive environment for the development of new greenbug biotypes. PMID:26527793

  3. Inactivation of barley limit dextrinase inhibitor by thioredoxin-catalysed disulfide reduction

    DEFF Research Database (Denmark)

    Jensen, Johanne Mørch; Hägglund, Per; Christensen, Hans Erik Mølager;


    Barley limit dextrinase (LD) that catalyses hydrolysis of α-1,6 glucosidic linkages in starch-derived dextrins is inhibited by limit dextrinase inhibitor (LDI) found in mature seeds. LDI belongs to the chloroform/methanol soluble protein family (CM-protein family) and has four disulfide bridges a...

  4. An integrated resource for barley linkage map and malting quality QTL alignment (United States)

    Barley (Hordeum vulgare subsp. vulgare) is an economically important model plant for genetics research that is currently served by a comprehensive set of tools for genetic analysis. High density genetic linkage maps constructed from the inheritance of robust gene-based Single Nucleotide Polymorphism...

  5. [The radiation-increased synthesis of phytochelatins in roots of gamma-irradiated barley seedlings]. (United States)

    Danilin, I A; Dikarev, V G; Geras'kin, S A


    It was shown that gamma-irradiation and cadmium nitrate increased synthesis of phytochelatins in roots of barley seedlings. The stimulation of synthesis of phytochelatins in gamma-irradiated plants was shown for the first time. The results obtained indicate more important role of phytochelatins in intercellular metabolism than heavy-metal-binding.

  6. Phytochelatin-metal(loid) transport into vacuoles shows different substrate preferences in barley and Arabidopsis. (United States)

    Song, Won-Yong; Mendoza-Cózatl, David G; Lee, Youngsook; Schroeder, Julian I; Ahn, Sang-Nag; Lee, Hyun-Sook; Wicker, Thomas; Martinoia, Enrico


    Cadmium (Cd) and arsenic (As) are toxic to all living organisms, including plants and humans. In plants, Cd and As are detoxified by phytochelatins (PCs) and metal(loid)-chelating peptides and by sequestering PC-metal(loid) complexes in vacuoles. Consistent differences have been observed between As and Cd detoxification. Whereas chelation of Cd by PCs is largely sufficient to detoxify Cd, As-PC complexes must be sequestered into vacuoles to be fully detoxified. It is not clear whether this difference in detoxification pathways is ubiquitous among plants or varies across species. Here, we have conducted a PC transport study using vacuoles isolated from Arabidopsis and barley. Arabidopsis vacuoles accumulated low levels of PC2 -Cd, and vesicles from yeast cells expressing either AtABCC1 or AtABCC2 exhibited negligible PC2 -Cd transport activity compared with PC2 -As. In contrast, barley vacuoles readily accumulated comparable levels of PC2 -Cd and PC2 -As. PC transport in barley vacuoles was inhibited by vanadate, but not by ammonium, suggesting the involvement of ABC-type transporters. Interestingly, barley vacuoles exhibited enhanced PC2 transport activity when essential metal ions, such as Zn(II), Cu(II) and Mn(II), were added to the transport assay, suggesting that PCs might contribute to the homeostasis of essential metals and detoxification of non-essential toxic metal(loid)s.

  7. The effect of fungicide dose on the composition of laboratory populations of barley powdery mildew

    DEFF Research Database (Denmark)

    O'Hara, R.B.; Nielsen, B.J.; Østergård, Hanne


    The effect of the use of different doses of the fungicide fenpropimorph on populations of barley powdery mildew Blumeria (Erysiphe) graminis f. sp. hordei was investigated in a laboratory selection experiment. A sample from the Danish aerial population of powdery mildew was split into populations...... to explain why this resistance has evolved at a slower rate than resistance towards other fungicides....

  8. Risk assessment by sowing date for barley (Hordeum vulgare) in northern Ethiopia

    NARCIS (Netherlands)

    Berhe, A.A.; Stroosnijder, L.; Habtu, S.; Keesstra, S.D.; Berhe, M.; Hadgu Meles, K.


    Risks of dry and wet sowing methods of rainfed barley were evaluated in northern Ethiopia. The evaluation was based on yield simulation using a validated AquaCrop model. Risks of failure (false start) were assessed by taking biomass threshold levels (


    Directory of Open Access Journals (Sweden)

    Joel O. Calderón-García


    Full Text Available Historical production of barley for ten years (2003-2012 as well as under climate change scenarios for near future (2015-2039 and for near future (2075-2099 in Calpulalpan, Tlaxcala was evaluated. An assessment of suitable regions for production was performed as well as historical performance and barley considering future climate change scenarios through the model AquaCrop (FAO also was estimated. Finally, the average production costs in the region were estimated through surveys with barley producers. The results show that over 70% of the area of the municipality has some degree of aptitude for producing barley. Climate change scenarios indicate increases proficiency in 2% of the surface and reductions of up to 16%. The production model shows very close results with those obtained by farmers in the municipality yields (2.53 t/ha, thus estimated future changes show a decline in yields of about 5% up to 100% depending on the future horizon. Considering current production costs, the benefit-cost relationship could be reduced from 1.4 and to 0.0 in the future. This will certainly affect the economy of the producers in the region.


    Directory of Open Access Journals (Sweden)



    Full Text Available Non-starch polysaccharides (NSP are composed from chemical compounds with different physical and chemical proprieties (cellulose, arabinoxylans, beta glucans and pectic polysaccharides with manans and gallactans. The antinutritional effects on monogastrics are different and in many cases extreme. Some cereals like barley, oat, wheat, contain significant quantities of NSP. The main negative effects of NSP are related to their viscous nature, to their physiological and morphological influence on the digestive tract and their interaction with the intestinal microflora. The purpose of this experiment is to establish the correlation coefficients between the values of intestinal viscosity and the levels of NSPt, NSPi and NSPs obtained by the inclusion of different percentage of barley in the structure of combined forages. The experiment was carried out on a period of 6 weeks on 120 broiler chickens divided in four experimental groups (CL, EL1, EL2 and EL3. The broiler chickens were fed with combined forages with the same nutritive characteristics but with different percentage of barley (0-40%. It has been showed that at the age of 3 and 6 weeks the intestinal viscosity rise with up to 64.67% along with the proportion of barley from the combined forages. Between the content of forages in NSP and intestinal viscosity exist a positive correlation, the highest correlation coefficient was registered in the case of NSPs, 0.92 at 3 weeks and respectively 0.99 at 6 weeks.

  11. Impact of removing straw from wheat and barley fields: A literature review (United States)

    The sustainability of straw removal from wheat and barley fields from the standpoint of its effects on soil properties and nutrient cycling is a concern. A recent literature review reveals that there is no negative effect of small grain straw removal on soil organic carbon (SOC) content with irriga...

  12. Genetic differentiation and geographical Relationship of Asian barley landraces using SSRs. (United States)

    Naeem, Rehan; Dahleen, Lynn; Mirza, Bushra


    Genetic diversity in 403 morphologically distinct landraces of barley (Hordeum vulgare L. subsp. vulgare) originating from seven geographical zones of Asia was studied using simple sequence repeat (SSR) markers from regions of medium to high recombination in the barley genome. The seven polymorphic SSR markers representing each of the chromosomes chosen for the study revealed a high level of allelic diversity among the landraces. Genetic richness was highest in those from India, followed by Pakistan while it was lowest for Uzbekistan and Turkmenistan. Out of the 50 alleles detected, 15 were unique to a geographic region. Genetic diversity was highest for landraces from Pakistan (0.70 ± 0.06) and lowest for those from Uzbekistan (0.18 ± 0.17). Likewise, polymorphic information content (PIC) was highest for Pakistan (0.67 ± 0.06) and lowest for Uzbekistan (0.15 ± 0.17). Diversity among groups was 40% compared to 60% within groups. Principal component analysis clustered the barley landraces into three groups to predict their domestication patterns. In total 51.58% of the variation was explained by the first two principal components of the barley germplasm. Pakistan landraces were clustered separately from those of India, Iran, Nepal and Iraq, whereas those from Turkmenistan and Uzbekistan were clustered together into a separate group. PMID:21734828

  13. A high density barley microsatellite consensus map with 775 SSR loci

    NARCIS (Netherlands)

    Varshney, R.K.; Marcel, T.C.; Ramsay, L.; Russell, J.; Roder, M.S.; Stein, N.; Waugh, R.; Langridge, P.; Niks, R.E.; Graner, A.


    A microsatellite or simple sequence repeat (SSR) consensus map of barley was constructed by joining six independent genetic maps based on the mapping populations 'Igri x Franka', 'Steptoe x Morex', 'OWBRec x OWBDom', 'Lina x Canada Park', 'L94 x Vada' and 'SusPtrit x Vada'. Segregation data for micr

  14. AFLP genetic polymorphism in wild barley (Hordeum spontaneum) populations in Israel

    NARCIS (Netherlands)

    Turpeinen, T.; Vanhala, T.; Nevo, E.; Nissila, E.


    The genetic diversity produced by the amplified fragment length polymorphism (AFLP) method was studied in 94 genotypes of wild barley, Hordeum spontaneum (C. Koch) Thell., originating from ten ecologically and geographically different locations in Israel. Eight primer pairs produced 204 discernible

  15. Molecular Marker Development and Linkage Analysis in Three Low Phytic Acid Barley (Hordeum vulgare) Mutant Lines (United States)

    Phytate is the primary form of phosphorus found in mature cereal grain. This form of phosphorus is not available to monogastric animals due to a lack of the enzyme phytase in their digestive tract. Several barley low phytic acid (lpa) mutants have been identified that contain substantial decreases...

  16. A comparison of two milling strategies to reduce the mycotoxin deoxynivalenol in barley (United States)

    The trichothecene mycotoxin deoxynivalenol (DON), a common contaminant of wheat (Triticum aestivum L.) and barley (Hordeum vulgare L.) grain, is a threat to feed and food safety in the United States. New strategies to reduce the threat of DON need to be developed and implemented. Previous work has...

  17. Mechanistic and genetic overlap of barley host and non-host resistance to Blumeria graminis

    NARCIS (Netherlands)

    Trujillo, M.; Troeger, M.; Niks, R.E.; Kogel, K.H.; Huckelhoven, R.


    Non-host resistance of barley to Blumeria graminis f.sp. tritici (Bgt), an inappropriate forma specialis of the grass powdery mildew fungus, is associated with formation of cell wall appositions (papillae) at sites of attempted fungal penetration and a hypersensitive cell death reaction (HR) of sing

  18. High diversity of genes for nonhost resistance of barley to heterologous rust fungi

    NARCIS (Netherlands)

    Jafary, H.; Albertazzi, G.; Marcel, T.C.; Niks, R.E.


    Inheritance studies on the nonhost resistance of plants would normally require interspecific crosses that suffer from sterility and abnormal segregation. Therefore, we developed the barley¿Puccinia rust model system to study, using forward genetics, the specificity, number, and diversity of genes in

  19. Nitrogen deficiency in barley (Hordeum vulgare) seedlings induces molecular and metabolic adjustments that trigger aphid resistance. (United States)

    Comadira, Gloria; Rasool, Brwa; Karpinska, Barbara; Morris, Jenny; Verrall, Susan R; Hedley, Peter E; Foyer, Christine H; Hancock, Robert D


    Agricultural nitrous oxide (N2O) pollution resulting from the use of synthetic fertilizers represents a significant contribution to anthropogenic greenhouse gas emissions, providing a rationale for reduced use of nitrogen (N) fertilizers. Nitrogen limitation results in extensive systems rebalancing that remodels metabolism and defence processes. To analyse the regulation underpinning these responses, barley (Horedeum vulgare) seedlings were grown for 7 d under N-deficient conditions until net photosynthesis was 50% lower than in N-replete controls. Although shoot growth was decreased there was no evidence for the induction of oxidative stress despite lower total concentrations of N-containing antioxidants. Nitrogen-deficient barley leaves were rich in amino acids, sugars and tricarboxylic acid cycle intermediates. In contrast to N-replete leaves one-day-old nymphs of the green peach aphid (Myzus persicae) failed to reach adulthood when transferred to N-deficient barley leaves. Transcripts encoding cell, sugar and nutrient signalling, protein degradation and secondary metabolism were over-represented in N-deficient leaves while those associated with hormone metabolism were similar under both nutrient regimes with the exception of mRNAs encoding proteins involved in auxin metabolism and responses. Significant similarities were observed between the N-limited barley leaf transcriptome and that of aphid-infested Arabidopsis leaves. These findings not only highlight significant similarities between biotic and abiotic stress signalling cascades but also identify potential targets for increasing aphid resistance with implications for the development of sustainable agriculture.

  20. Energy consumption in barley and turnip rape cultivation for bioethanol and biodiesel (RME) production

    Energy Technology Data Exchange (ETDEWEB)

    Mikkola, Hannu; Ahokas, Jukka [University of Helsinki, Faculty of Agriculture and Forestry, Department of Agricultural Sciences, FIN-00014 Helsingin yliopisto (Finland); Pahkala, Katri [MTT, Agrifood Research Finland, Crop Science and Technology, FIN-31600 Jokioinen (Finland)


    The energy consumption for six spring barley (Hordeum vulgare L.) production chains and five spring turnip rape (Brassica rapa ssp. oleifera (DC) Metsg.) production chains were compared with each other and in relation to the energy content of the seed yield. Two cultivation intensities, standard and intensive production, were used for barley. Fertiliser production and grain drying were the most energy consuming phases of the chains. The production of nitrogen fertiliser alone accounted for 1/3-1/2 of the total energy consumption of the production chains. If barley were direct drilled and the yield stored in airtight silos, instead of drying, the energy consumption would decrease by 30-34%. Use of wood-chips instead of oil for grain drying would decrease the use of fossil fuel to the same extent. The input-output ratios for the intensive barley production chains were 0.18-0.25. They were somewhat lower than the ratios for the standard production intensity. The intensive production was more energy efficient despite higher input rates. The input-output ratios for turnip rape production were 0.32-0.34. The energy consumption for manufacturing, repair and maintenance of machines and buildings requires more research because it is a significant factor but the data available are largely old and few studies have been conducted. (author)