
Sample records for barley rna-directed rna

  1. Identification and characterization of barley RNA-directed RNA polymerases

    DEFF Research Database (Denmark)

    Madsen, Christian Toft; Stephens, Jennifer; Hornyik, Csaba


    in dicot species. In this report, we identi!ed and characterized HvRDR1, HvRDR2 and HvRDR6 genes in the monocot plant barley (Hordeum vulgare). We analysed their expression under various biotic and abiotic stresses including fungal and viral infections, salicylic acid treatment as well as during plant...... development. The different classes and subclasses of barley RDRs displayed contrasting expression patterns during pathogen challenge and development suggesting their involvement in speci!c regulatory pathways. Their response to heat and salicylic acid treatment suggests a conserved pattern of expression...

  2. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.


    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response

  3. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.


    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

  4. Small RNA-directed epigenetic natural variation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jixian Zhai


    Full Text Available Progress in epigenetics has revealed mechanisms that can heritably regulate gene function independent of genetic alterations. Nevertheless, little is known about the role of epigenetics in evolution. This is due in part to scant data on epigenetic variation among natural populations. In plants, small interfering RNA (siRNA is involved in both the initiation and maintenance of gene silencing by directing DNA methylation and/or histone methylation. Here, we report that, in the model plant Arabidopsis thaliana, a cluster of approximately 24 nt siRNAs found at high levels in the ecotype Landsberg erecta (Ler could direct DNA methylation and heterochromatinization at a hAT element adjacent to the promoter of FLOWERING LOCUS C (FLC, a major repressor of flowering, whereas the same hAT element in ecotype Columbia (Col with almost identical DNA sequence, generates a set of low abundance siRNAs that do not direct these activities. We have called this hAT element MPF for Methylated region near Promoter of FLC, although de novo methylation triggered by an inverted repeat transgene at this region in Col does not alter its FLC expression. DNA methylation of the Ler allele MPF is dependent on genes in known silencing pathways, and such methylation is transmissible to Col by genetic crosses, although with varying degrees of penetrance. A genome-wide comparison of Ler and Col small RNAs identified at least 68 loci matched by a significant level of approximately 24 nt siRNAs present specifically in Ler but not Col, where nearly half of the loci are related to repeat or TE sequences. Methylation analysis revealed that 88% of the examined loci (37 out of 42 were specifically methylated in Ler but not Col, suggesting that small RNA can direct epigenetic differences between two closely related Arabidopsis ecotypes.

  5. A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

    KAUST Repository

    Law, Julie A.


    DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

  6. A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

    KAUST Repository

    Law, Julie A.; Ausí n, Israel; Johnson, Lianna M.; Vashisht, Ajay  A Amar; Zhu, Jian-Kang; Wohlschlegel, James  A A.; Jacobsen, Steven E.


    DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

  7. IMP3 RNP safe houses prevent miRNA-directed HMGA2 mRNA decay in cancer and development

    DEFF Research Database (Denmark)

    Jønson, Lars; Christiansen, Jan; Hansen, Thomas van Overeem


    by let-7, and let-7 antagomiRs make HMGA2 refractory to IMP3. Removal of let-7 target sites eliminates IMP3-dependent stabilization, and IMP3-containing bodies are depleted of Ago1-4 and miRNAs. The relationship between Hmga2 mRNA and IMPs also exists in the developing limb bud, where IMP1-deficient...... that IMP3 RNPs may function as cytoplasmic safe houses and prevent miRNA-directed mRNA decay of oncogenes during tumor progression....

  8. MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans. (United States)

    Corrêa, Régis L; Steiner, Florian A; Berezikov, Eugene; Ketting, René F


    RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.

  9. MiRNA-directed regulation of VEGF and other angiogenic factors under hypoxia.

    Directory of Open Access Journals (Sweden)

    Zhong Hua

    Full Text Available MicroRNAs (miRNAs are a class of 20-24 nt non-coding RNAs that regulate gene expression primarily through post-transcriptional repression or mRNA degradation in a sequence-specific manner. The roles of miRNAs are just beginning to be understood, but the study of miRNA function has been limited by poor understanding of the general principles of gene regulation by miRNAs. Here we used CNE cells from a human nasopharyngeal carcinoma cell line as a cellular system to investigate miRNA-directed regulation of VEGF and other angiogenic factors under hypoxia, and to explore the principles of gene regulation by miRNAs. Through computational analysis, 96 miRNAs were predicted as putative regulators of VEGF. But when we analyzed the miRNA expression profile of CNE and four other VEGF-expressing cell lines, we found that only some of these miRNAs could be involved in VEGF regulation, and that VEGF may be regulated by different miRNAs that were differentially chosen from 96 putative regulatory miRNAs of VEGF in different cells. Some of these miRNAs also co-regulate other angiogenic factors (differential regulation and co-regulation principle. We also found that VEGF was regulated by multiple miRNAs using different combinations, including both coordinate and competitive interactions. The coordinate principle states that miRNAs with independent binding sites in a gene can produce coordinate action to increase the repressive effect of miRNAs on this gene. By contrast, the competitive principle states when multiple miRNAs compete with each other for a common binding site, or when a functional miRNA competes with a false positive miRNA for the same binding site, the repressive effects of miRNAs may be decreased. Through the competitive principle, false positive miRNAs, which cannot directly repress gene expression, can sometimes play a role in miRNA-mediated gene regulation. The competitive principle, differential regulation, multi-miRNA binding sites, and false

  10. IMP3 RNP Safe Houses Prevent miRNA-Directed HMGA2 mRNA Decay in Cancer and Development

    Directory of Open Access Journals (Sweden)

    Lars Jønson


    Full Text Available The IMP3 RNA-binding protein is associated with metastasis and poor outcome in human cancer. Using solid cancer transcriptome data, we found that IMP3 correlates with HMGA2 mRNA expression. Cytoplasmic IMP3 granules contain HMGA2, and IMP3 dose-dependently increases HMGA2 mRNA. HMGA2 is regulated by let-7, and let-7 antagomiRs make HMGA2 refractory to IMP3. Removal of let-7 target sites eliminates IMP3-dependent stabilization, and IMP3-containing bodies are depleted of Ago1-4 and miRNAs. The relationship between Hmga2 mRNA and IMPs also exists in the developing limb bud, where IMP1-deficient embryos show dose-dependent Hmga2 mRNA downregulation. Finally, IMP3 ribonucleoproteins (RNPs contain other let-7 target mRNAs, including LIN28B, and a global gene set enrichment analysis demonstrates that miRNA-regulated transcripts in general are upregulated following IMP3 induction. We conclude that IMP3 RNPs may function as cytoplasmic safe houses and prevent miRNA-directed mRNA decay of oncogenes during tumor progression.

  11. An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

    KAUST Repository

    Gao, Zhihuan


    DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.

  12. Nucleolin Mediates MicroRNA-directed CSF-1 mRNA Deadenylation but Increases Translation of CSF-1 mRNA* (United States)

    Woo, Ho-Hyung; Baker, Terri; Laszlo, Csaba; Chambers, Setsuko K.


    CSF-1 mRNA 3′UTR contains multiple unique motifs, including a common microRNA (miRNA) target in close proximity to a noncanonical G-quadruplex and AU-rich elements (AREs). Using a luciferase reporter system fused to CSF-1 mRNA 3′UTR, disruption of the miRNA target region, G-quadruplex, and AREs together dramatically increased reporter RNA levels, suggesting important roles for these cis-acting regulatory elements in the down-regulation of CSF-1 mRNA. We find that nucleolin, which binds both G-quadruplex and AREs, enhances deadenylation of CSF-1 mRNA, promoting CSF-1 mRNA decay, while having the capacity to increase translation of CSF-1 mRNA. Through interaction with the CSF-1 3′UTR miRNA common target, we find that miR-130a and miR-301a inhibit CSF-1 expression by enhancing mRNA decay. Silencing of nucleolin prevents the miRNA-directed mRNA decay, indicating a requirement for nucleolin in miRNA activity on CSF-1 mRNA. Downstream effects followed by miR-130a and miR-301a inhibition of directed cellular motility of ovarian cancer cells were found to be dependent on nucleolin. The paradoxical effects of nucleolin on miRNA-directed CSF-1 mRNA deadenylation and on translational activation were explored further. The nucleolin protein contains four acidic stretches, four RNA recognition motifs (RRMs), and nine RGG repeats. All three domains in nucleolin regulate CSF-1 mRNA and protein levels. RRMs increase CSF-1 mRNA, whereas the acidic and RGG domains decrease CSF-1 protein levels. This suggests that nucleolin has the capacity to differentially regulate both CSF-1 RNA and protein levels. Our finding that nucleolin interacts with Ago2 indirectly via RNA and with poly(A)-binding protein C (PABPC) directly suggests a nucleolin-Ago2-PABPC complex formation on mRNA. This complex is in keeping with our suggestion that nucleolin may work with PABPC as a double-edged sword on both mRNA deadenylation and translational activation. Our findings underscore the complexity of

  13. Gene Editing With CRISPR/Cas9 RNA-Directed Nuclease. (United States)

    Doetschman, Thomas; Georgieva, Teodora


    Genetic engineering of model organisms and cultured cells has for decades provided important insights into the mechanisms underlying cardiovascular development and disease. In the past few years the development of several nuclease systems has broadened the range of model/cell systems that can be engineered. Of these, the CRISPR (clustered regularly interspersed short palindromic repeats)/Cas9 (CRISPR-associated protein 9) system has become the favorite for its ease of application. Here we will review this RNA-guided nuclease system for gene editing with respect to its usefulness for cardiovascular studies and with an eye toward potential therapy. Studies on its off-target activity, along with approaches to minimize this activity will be given. The advantages of gene editing versus gene targeting in embryonic stem cells, including the breadth of species and cell types to which it is applicable, will be discussed. We will also cover its use in iPSC for research and possible therapeutic purposes; and we will review its use in muscular dystrophy studies where considerable progress has been made toward dystrophin correction in mice. The CRISPR/Ca9s system is also being used for high-throughput screening of genes, gene regulatory regions, and long noncoding RNAs. In addition, the CRISPR system is being used for nongene-editing purposes such as activation and inhibition of gene expression, as well as for fluorescence tagging of chromosomal regions and individual mRNAs to track their cellular location. Finally, an approach to circumvent the inability of post-mitotic cells to support homologous recombination-based gene editing will be presented. In conclusion, applications of the CRISPR/Cas system are expanding at a breath-taking pace and are revolutionizing approaches to gain a better understanding of human diseases. © 2017 American Heart Association, Inc.

  14. Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses. (United States)

    Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M


    Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

  15. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin


    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  16. Cystoviral polymerase complex protein P7 uses its acidic C-terminal tail to regulate the RNA-directed RNA polymerase P2. (United States)

    Alphonse, Sébastien; Arnold, Jamie J; Bhattacharya, Shibani; Wang, Hsin; Kloss, Brian; Cameron, Craig E; Ghose, Ranajeet


    In bacteriophages of the cystovirus family, the polymerase complex (PX) encodes a 75-kDa RNA-directed RNA polymerase (P2) that transcribes the double-stranded RNA genome. Also a constituent of the PX is the essential protein P7 that, in addition to accelerating PX assembly and facilitating genome packaging, plays a regulatory role in transcription. Deletion of P7 from the PX leads to aberrant plus-strand synthesis suggesting its influence on the transcriptase activity of P2. Here, using solution NMR techniques and the P2 and P7 proteins from cystovirus ϕ12, we demonstrate their largely electrostatic interaction in vitro. Chemical shift perturbations on P7 in the presence of P2 suggest that this interaction involves the dynamic C-terminal tail of P7, more specifically an acidic cluster therein. Patterns of chemical shift changes induced on P2 by the P7 C-terminus resemble those seen in the presence of single-stranded RNA suggesting similarities in binding. This association between P2 and P7 reduces the affinity of the former toward template RNA and results in its decreased activity both in de novo RNA synthesis and in extending a short primer. Given the presence of C-terminal acidic tracts on all cystoviral P7 proteins, the electrostatic nature of the P2/P7 interaction is likely conserved within the family and could constitute a mechanism through which P7 regulates transcription in cystoviruses. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. De novo transcriptome sequence assembly from coconut leaves and seeds with a focus on factors involved in RNA-directed DNA methylation. (United States)

    Huang, Ya-Yi; Lee, Chueh-Pai; Fu, Jason L; Chang, Bill Chia-Han; Matzke, Antonius J M; Matzke, Marjori


    Coconut palm (Cocos nucifera) is a symbol of the tropics and a source of numerous edible and nonedible products of economic value. Despite its nutritional and industrial significance, coconut remains under-represented in public repositories for genomic and transcriptomic data. We report de novo transcript assembly from RNA-seq data and analysis of gene expression in seed tissues (embryo and endosperm) and leaves of a dwarf coconut variety. Assembly of 10 GB sequencing data for each tissue resulted in 58,211 total unigenes in embryo, 61,152 in endosperm, and 33,446 in leaf. Within each unigene pool, 24,857 could be annotated in embryo, 29,731 could be annotated in endosperm, and 26,064 could be annotated in leaf. A KEGG analysis identified 138, 138, and 139 pathways, respectively, in transcriptomes of embryo, endosperm, and leaf tissues. Given the extraordinarily large size of coconut seeds and the importance of small RNA-mediated epigenetic regulation during seed development in model plants, we used homology searches to identify putative homologs of factors required for RNA-directed DNA methylation in coconut. The findings suggest that RNA-directed DNA methylation is important during coconut seed development, particularly in maturing endosperm. This dataset will expand the genomics resources available for coconut and provide a foundation for more detailed analyses that may assist molecular breeding strategies aimed at improving this major tropical crop. Copyright © 2014 Huang et al.

  18. Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer. (United States)

    Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong


    The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

  19. Inhibition of Plasmodium falciparum proliferation in vitro by double-stranded RNA directed against malaria histone deacetylase

    International Nuclear Information System (INIS)

    Sriwilaijaroen, N.; Boonma, S.; Attasart, P.; Pothikasikorn, J.; Panyim, S.; Noonpakdee, W.


    Acetylation and deacetylation of histones play important roles in transcription regulation, cell cycle progression and development events. The steady state status of histone acetylation is controlled by a dynamic equilibrium between competing histone acetylase and deacetylase (HDAC). We have used long PfHDAC-1 double-stranded (ds)RNA to interfere with its cognate mRNA expression and determined the effect on malaria parasite growth and development. Chloroquine- and pyrimethamine-resistant Plasmodium falciparum K1 strain was exposed to 1-25 μg of dsRNA/ml of culture for 48 h and growth was determined by [ 3 H]-hypoxanthine incorporation and microscopic examination. Parasite culture treated with 10 μg/ml pfHDAC-1 dsRNA exhibited 47% growth inhibition when compared with either untreated control or culture treated with an unrelated dsRNA. PfHDAC-1 dsRNA specifically blocked maturation of trophozoite to schizont stages and decreased PfHDAC-1 transcript 44% in treated trophozoites. These results indicate the potential of HDAC-1 as a target for development of novel antimalarials.

  20. IBM1, a JmjC domain-containing histone demethylase, is involved in the regulation of RNA-directed DNA methylation through the epigenetic control of RDR2 and DCL3 expression in Arabidopsis (United States)

    Fan, Di; Dai, Yan; Wang, Xuncheng; Wang, Zhenjie; He, Hang; Yang, Hongchun; Cao, Ying; Deng, Xing Wang; Ma, Ligeng


    Small RNA-directed DNA methylation (RdDM) is an important epigenetic pathway in Arabidopsis that controls the expression of multiple genes and several developmental processes. RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and DICER-LIKE 3 (DCL3) are necessary factors in 24-nt small interfering RNA (siRNA) biogenesis, which is part of the RdDM pathway. Here, we found that Increase in BONSAI Methylation 1 (IBM1), a conserved JmjC family histone demethylase, is directly associated with RDR2 and DCL3 chromatin. The mutation of IBM1 induced the hypermethylation of H3K9 and DNA non-CG sites within RDR2 and DCL3, which repressed their expression. A genome-wide analysis suggested that the reduction in RDR2 and DCL3 expression affected siRNA biogenesis in a locus-specific manner and disrupted RdDM-directed gene repression. Together, our results suggest that IBM1 regulates gene expression through two distinct pathways: direct association to protect genes from silencing by preventing the coupling of histone and DNA methylation, and indirect silencing of gene expression through RdDM-directed repression. PMID:22772985

  1. Arabidopsis RNASE THREE LIKE2 Modulates the Expression of Protein-Coding Genes via 24-Nucleotide Small Interfering RNA-Directed DNA Methylation. (United States)

    Elvira-Matelot, Emilie; Hachet, Mélanie; Shamandi, Nahid; Comella, Pascale; Sáez-Vásquez, Julio; Zytnicki, Matthias; Vaucheret, Hervé


    RNaseIII enzymes catalyze the cleavage of double-stranded RNA (dsRNA) and have diverse functions in RNA maturation. Arabidopsis thaliana RNASE THREE LIKE2 (RTL2), which carries one RNaseIII and two dsRNA binding (DRB) domains, is a unique Arabidopsis RNaseIII enzyme resembling the budding yeast small interfering RNA (siRNA)-producing Dcr1 enzyme. Here, we show that RTL2 modulates the production of a subset of small RNAs and that this activity depends on both its RNaseIII and DRB domains. However, the mode of action of RTL2 differs from that of Dcr1. Whereas Dcr1 directly cleaves dsRNAs into 23-nucleotide siRNAs, RTL2 likely cleaves dsRNAs into longer molecules, which are subsequently processed into small RNAs by the DICER-LIKE enzymes. Depending on the dsRNA considered, RTL2-mediated maturation either improves (RTL2-dependent loci) or reduces (RTL2-sensitive loci) the production of small RNAs. Because the vast majority of RTL2-regulated loci correspond to transposons and intergenic regions producing 24-nucleotide siRNAs that guide DNA methylation, RTL2 depletion modifies DNA methylation in these regions. Nevertheless, 13% of RTL2-regulated loci correspond to protein-coding genes. We show that changes in 24-nucleotide siRNA levels also affect DNA methylation levels at such loci and inversely correlate with mRNA steady state levels, thus implicating RTL2 in the regulation of protein-coding gene expression. © 2016 American Society of Plant Biologists. All rights reserved.

  2. Effects of seed irradiation on the early development and mitochondrial RNA synthesis of 'Impala' barley

    Energy Technology Data Exchange (ETDEWEB)

    Baboth, E [Kerteszeti Kutato Intezet, Budapest (Hungary)


    The influence of fractionated ..gamma..-irradiation on barley seeds was investigated under outdoor and hothouse conditions. The doses were 250, 500, 1,000, and 2,000 rad. The resulting radiation effects were investigated from the point of view of molecular biology, i.e. studying the RNA synthesis of the mitochondria after /sup 14/C-labelling of uridine. The radiation influence on the length of the coleoptiles was another criterion. The irradiation findings are discussed in connection with the cultivation of better and more resistant plants for agriculture.

  3. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  4. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma. (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O


    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  5. Polycistronic artificial miRNA-mediated resistance to Wheat dwarf virus in barley is highly efficient at low temperature. (United States)

    Kis, András; Tholt, Gergely; Ivanics, Milán; Várallyay, Éva; Jenes, Barnabás; Havelda, Zoltán


    Infection of Wheat dwarf virus (WDV) strains on barley results in dwarf disease, imposing severe economic losses on crop production. As the natural resistance resources against this virus are limited, it is imperative to elaborate a biotechnological approach that will provide effective and safe immunity to a wide range of WDV strains. Because vector insect-mediated WDV infection occurs during cool periods in nature, it is important to identify a technology which is effective at lower temperature. In this study, we designed artificial microRNAs (amiRNAs) using a barley miRNA precursor backbone, which target different conservative sequence elements of the WDV strains. Potential amiRNA sequences were selected to minimize the off-target effects and were tested in a transient sensor system in order to select the most effective constructs at low temperature. On the basis of the data obtained, a polycistronic amiRNA precursor construct (VirusBuster171) was built expressing three amiRNAs simultaneously. The construct was transformed into barley under the control of a constitutive promoter. The transgenic lines were kept at 12-15 °C to mimic autumn and spring conditions in which major WDV infection and accumulation take place. We were able to establish a stable barley transgenic line displaying resistance to insect-mediated WDV infection. Our study demonstrates that amiRNA technology can be an efficient tool for the introduction of highly efficient resistance in barley against a DNA virus belonging to the Geminiviridae family, and this resistance is effective at low temperature where the natural insect vector mediates the infection process. © 2015 BSPP and John Wiley & Sons Ltd.

  6. RNA-seq analysis of Brachypodium distachyon responses to Barley stripe mosaic virus infection

    Directory of Open Access Journals (Sweden)

    Guoxin Wang


    Full Text Available Barley stripe mosaic virus (BSMV is the type member of the genus Hordeivirus. Brachypodium distachyon line Bd3-1 shows resistance to the BSMV ND18 strain, but is susceptible to an ND18 double mutant (β NDTGB1R390K, T392K in which lysine is substituted for an arginine at position 390 and for threonine at position 392 of the triple gene block 1 (TGB1 protein. In order to understand differences in gene expression following infection with ND18 and double mutant ND18, Bd3-1 seedlings were subjected to RNA-seq analyses at 1, 6, and 14 days post inoculation (dpi. The results revealed that basal immunity genes involved in cellulose synthesis and pathogenesis-related protein biosynthesis were enhanced in incompatible interactions between Bd3-1 and ND18. Most of the differentially expressed transcripts are related to trehalose biosynthesis, ethylene, jasmonic acid metabolism, protein phosphorylation, protein ubiquitination, transcriptional regulation, and transport process, as well as pathogenesis-related protein biosynthesis. In compatible interactions between Bd3-1 and ND18 mutant, Bd3-1 developed weak basal resistance responses to the virus. Many genes involved in cellulose biosynthesis, protein amino acid phosphorylation, protein biosynthesis, protein glycosylation, glycolysis and cellular macromolecular complex assembly that may be related to virus replication, assembly and movement were up-regulated. Some genes involved in oxidative stress responses were also up-regulated at 14 dpi. BSMV ND18 mutant infection suppressed expression of genes functioning in regulation of transcription, protein kinase, cellular nitrogen compound biosynthetic process and photosynthesis. Differential expression patterns between compatible and incompatible interactions in Bd3-1 to the two BSMV strains provide important clues for understanding mechanism of resistance to BMSV in the model plant Brachypodium.

  7. Isolation of tissues and preservation of RNA from intact, germinated barley grain. (United States)

    Betts, Natalie S; Berkowitz, Oliver; Liu, Ruijie; Collins, Helen M; Skadhauge, Birgitte; Dockter, Christoph; Burton, Rachel A; Whelan, James; Fincher, Geoffrey B


    Isolated barley (Hordeum vulgare L.) aleurone layers have been widely used as a model system for studying gene expression and hormonal regulation in germinating cereal grains. A serious technological limitation of this approach has been the inability to confidently extrapolate conclusions obtained from isolated tissues back to the whole grain, where the co-location of several living and non-living tissues results in complex tissue-tissue interactions and regulatory pathways coordinated across the multiple tissues. Here we have developed methods for isolating fragments of aleurone, starchy endosperm, embryo, scutellum, pericarp-testa, husk and crushed cell layers from germinated grain. An important step in the procedure involves the rapid fixation of the intact grain to freeze the transcriptional activity of individual tissues while dissection is effected for subsequent transcriptomic analyses. The developmental profiles of 19 611 gene transcripts were precisely defined in the purified tissues and in whole grain during the first 24 h of germination by RNA sequencing. Spatial and temporal patterns of transcription were validated against well-defined data on enzyme activities in both whole grain and isolated tissues. Transcript profiles of genes involved in mitochondrial assembly and function were used to validate the very early stages of germination, while the profiles of genes involved in starch and cell wall mobilisation matched existing data on activities of corresponding enzymes. The data will be broadly applicable for the interrogation of co-expression and differential expression patterns and for the identification of transcription factors that are important in the early stages of grain and seed germination. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  8. Acceleration of leaf senescence is slowed down in transgenic barley plants deficient in the DNA/RNA-binding protein WHIRLY1. (United States)

    Kucharewicz, Weronika; Distelfeld, Assaf; Bilger, Wolfgang; Müller, Maren; Munné-Bosch, Sergi; Hensel, Götz; Krupinska, Karin


    WHIRLY1 in barley was isolated as a potential regulator of the senescence-associated gene HvS40. In order to investigate whether the plastid-nucleus-located DNA/RNA-binding protein WHIRLY1 plays a role in regulation of leaf senescence, primary foliage leaves from transgenic barley plants with an RNAi-mediated knockdown of the WHIRLY1 gene were characterized by typical senescence parameters, namely pigment contents, function and composition of the photosynthetic apparatus, as well as expression of selected genes known to be either down- or up-regulated during leaf senescence. When the plants were grown at low light intensity, senescence progression was similar between wild-type and RNAi-W1 plants. Likewise, dark-induced senescence of detached leaves was not affected by reduction of WHIRLY1. When plants were grown at high light intensity, however, senescence was induced prematurely in wild-type plants but was delayed in RNAi-W1 plants. This result suggests that WHIRLY1 plays a role in light sensing and/or stress communication between chloroplasts and the nucleus. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  9. Barley germination

    DEFF Research Database (Denmark)

    Daneri-Castro, Sergio N.; Svensson, Birte; Roberts, Thomas H.


    germination. Lastly, the application of metabolomics to barley grain germination provides essential data on biochemical processes, including insights into the formation of compounds that contribute to malt quality. To maximize the benefits of the 'omics' revolution to the malting industry, there is a need......Germination of barley grain is central to the malting industry and is a valuable model for cereal grain germination. Our current understanding of the complexity of germination at the molecular level is facilitated by access to genomic, transcriptomic, proteomic and metabolomic data. Here we review...... of germination in the context of industrial malting. For transcriptomics, recent advances in sequencing the barley genome allow next-generation sequencing approaches to reveal novel effects of variety and environment on germination. For proteomics, selection of the source tissue(s) and the protein extraction...

  10. A putative role for amino acid permeases in sink-source communication of barley tissues uncovered by RNA-seq

    Directory of Open Access Journals (Sweden)

    Kohl Stefan


    Full Text Available Abstract Background The majority of nitrogen accumulating in cereal grains originates from proteins remobilised from vegetative organs. However, interactions between grain filling and remobilisation are poorly understood. We used transcriptome large-scale pyrosequencing of flag leaves, glumes and developing grains to identify cysteine peptidase and N transporter genes playing a role in remobilisation and accumulation of nitrogen in barley. Results Combination of already known and newly derived sequence information reduced redundancy, increased contig length and identified new members of cysteine peptidase and N transporter gene families. The dataset for N transporter genes was aligned with N transporter amino acid sequences of rice and Arabidopsis derived from Aramemnon database. 57 AAT, 45 NRT1/PTR and 22 OPT unigenes identified by this approach cluster to defined subgroups in the respective phylogenetic trees, among them 25 AAT, 8 NRT1/PTR and 5 OPT full-length sequences. Besides, 59 unigenes encoding cysteine peptidases were identified and subdivided into different families of the papain cysteine peptidase clade. Expression profiling of full-length AAT genes highlighted amino acid permeases as the group showing highest transcriptional activity. HvAAP2 and HvAAP6 are highly expressed in vegetative organs whereas HvAAP3 is grain-specific. Sequence similarities cluster HvAAP2 and the putative transporter HvAAP6 together with Arabidopsis transporters, which are involved in long-distance transfer of amino acids. HvAAP3 is closely related to AtAAP1 and AtAAP8 playing a role in supplying N to developing seeds. An important role in amino acid re-translocation can be considered for HvLHT1 and HvLHT2 which are specifically expressed in glumes and flag leaves, respectively. PCA and K-means clustering of AAT transcript data revealed coordinate developmental stages in flag leaves, glumes and grains. Phloem-specific metabolic compounds are proposed that

  11. Genome comparison of barley and maize smut fungi reveals targeted loss of RNA silencing components and species-specific presence of transposable elements. (United States)

    Laurie, John D; Ali, Shawkat; Linning, Rob; Mannhaupt, Gertrud; Wong, Philip; Güldener, Ulrich; Münsterkötter, Martin; Moore, Richard; Kahmann, Regine; Bakkeren, Guus; Schirawski, Jan


    Ustilago hordei is a biotrophic parasite of barley (Hordeum vulgare). After seedling infection, the fungus persists in the plant until head emergence when fungal spores develop and are released from sori formed at kernel positions. The 26.1-Mb U. hordei genome contains 7113 protein encoding genes with high synteny to the smaller genomes of the related, maize-infecting smut fungi Ustilago maydis and Sporisorium reilianum but has a larger repeat content that affected genome evolution at important loci, including mating-type and effector loci. The U. hordei genome encodes components involved in RNA interference and heterochromatin formation, normally involved in genome defense, that are lacking in the U. maydis genome due to clean excision events. These excision events were possibly a result of former presence of repetitive DNA and of an efficient homologous recombination system in U. maydis. We found evidence of repeat-induced point mutations in the genome of U. hordei, indicating that smut fungi use different strategies to counteract the deleterious effects of repetitive DNA. The complement of U. hordei effector genes is comparable to the other two smuts but reveals differences in family expansion and clustering. The availability of the genome sequence will facilitate the identification of genes responsible for virulence and evolution of smut fungi on their respective hosts.

  12. Genome Comparison of Barley and Maize Smut Fungi Reveals Targeted Loss of RNA Silencing Components and Species-Specific Presence of Transposable Elements[W (United States)

    Laurie, John D.; Ali, Shawkat; Linning, Rob; Mannhaupt, Gertrud; Wong, Philip; Güldener, Ulrich; Münsterkötter, Martin; Moore, Richard; Kahmann, Regine; Bakkeren, Guus; Schirawski, Jan


    Ustilago hordei is a biotrophic parasite of barley (Hordeum vulgare). After seedling infection, the fungus persists in the plant until head emergence when fungal spores develop and are released from sori formed at kernel positions. The 26.1-Mb U. hordei genome contains 7113 protein encoding genes with high synteny to the smaller genomes of the related, maize-infecting smut fungi Ustilago maydis and Sporisorium reilianum but has a larger repeat content that affected genome evolution at important loci, including mating-type and effector loci. The U. hordei genome encodes components involved in RNA interference and heterochromatin formation, normally involved in genome defense, that are lacking in the U. maydis genome due to clean excision events. These excision events were possibly a result of former presence of repetitive DNA and of an efficient homologous recombination system in U. maydis. We found evidence of repeat-induced point mutations in the genome of U. hordei, indicating that smut fungi use different strategies to counteract the deleterious effects of repetitive DNA. The complement of U. hordei effector genes is comparable to the other two smuts but reveals differences in family expansion and clustering. The availability of the genome sequence will facilitate the identification of genes responsible for virulence and evolution of smut fungi on their respective hosts. PMID:22623492

  13. The 3' untranslated region of tobacco necrosis virus RNA contains a barley yellow dwarf virus-like cap-independent translation element. (United States)

    Shen, Ruizhong; Miller, W Allen


    RNAs of many viruses are translated efficiently in the absence of a 5' cap structure. The tobacco necrosis virus (TNV) genome is an uncapped, nonpolyadenylated RNA whose translation mechanism has not been well investigated. Computational analysis predicted a cap-independent translation element (TE) within the 3' untranslated region (3' UTR) of TNV RNA that resembles the TE of barley yellow dwarf virus (BYDV), a luteovirus. Here we report that such a TE does indeed exist in the 3' UTR of TNV strain D. Like the BYDV TE, the TNV TE (i) functions both in vitro and in vivo, (ii) requires additional sequence for cap-independent translation in vivo, (iii) has a similar secondary structure and the conserved sequence CGGAUCCUGGGAAACAGG, (iv) is inactivated by a four-base duplication in this conserved sequence, (v) can function in the 5' UTR, and (vi) when located in its natural 3' location, may form long-distance base pairing with the viral 5' UTR that is conserved and probably required. The TNV TE differs from the BYDV TE by having only three helical domains instead of four. Similar structures were found in all members of the Necrovirus genus of the Tombusviridae family, except satellite tobacco necrosis virus, which harbors a different 3' cap-independent translation domain. The presence of the BYDV-like TE in select genera of different families indicates that phylogenetic distribution of TEs does not follow standard viral taxonomic relationships. We propose a new class of cap-independent TE called BYDV-like TE.

  14. The 3′ Untranslated Region of Tobacco Necrosis Virus RNA Contains a Barley Yellow Dwarf Virus-Like Cap-Independent Translation Element (United States)

    Shen, Ruizhong; Miller, W. Allen


    RNAs of many viruses are translated efficiently in the absence of a 5′ cap structure. The tobacco necrosis virus (TNV) genome is an uncapped, nonpolyadenylated RNA whose translation mechanism has not been well investigated. Computational analysis predicted a cap-independent translation element (TE) within the 3′ untranslated region (3′ UTR) of TNV RNA that resembles the TE of barley yellow dwarf virus (BYDV), a luteovirus. Here we report that such a TE does indeed exist in the 3′ UTR of TNV strain D. Like the BYDV TE, the TNV TE (i) functions both in vitro and in vivo, (ii) requires additional sequence for cap-independent translation in vivo, (iii) has a similar secondary structure and the conserved sequence CGGAUCCUGGGAAACAGG, (iv) is inactivated by a four-base duplication in this conserved sequence, (v) can function in the 5′ UTR, and (vi) when located in its natural 3′ location, may form long-distance base pairing with the viral 5′ UTR that is conserved and probably required. The TNV TE differs from the BYDV TE by having only three helical domains instead of four. Similar structures were found in all members of the Necrovirus genus of the Tombusviridae family, except satellite tobacco necrosis virus, which harbors a different 3′ cap-independent translation domain. The presence of the BYDV-like TE in select genera of different families indicates that phylogenetic distribution of TEs does not follow standard viral taxonomic relationships. We propose a new class of cap-independent TE called BYDV-like TE. PMID:15078948

  15. Brewing with fractionated barley

    NARCIS (Netherlands)

    Donkelaar, van L.H.G.


    Brewing with fractionated barley

    Beer is a globally consumed beverage, which is produced from malted barley, water, hops and yeast. In recent years, the use of unmalted barley and exogenous enzymes have become more popular because they enable simpler processing and reduced environmental

  16. Barley yellow dwarf virus: Luteoviridae or Tombusviridae? (United States)

    Miller, W Allen; Liu, Sijun; Beckett, Randy


    Summary Barley yellow dwarf virus (BYDV), the most economically important virus of small grains, features highly specialised relationships with its aphid vectors, a plethora of novel translation mechanisms mediated by long-distance RNA interactions, and an ambiguous taxonomic status. The structural and movement proteins of BYDV that confer aphid transmission and phloem-limitation properties resemble those of the Luteoviridae, the family in which BYDV is classified. In contrast, many genes and cis-acting signals involved in replication and gene expression most closely resemble those of the Tombusviridae. BYDV is in genus Luteovirus, family Luteoviridae. BYDV includes at least two serotypes or viruses: BYDV-PAV and BYDV-MAV. The former BYDV-RPV is now Cereal yellow dwarf virus-RPV (CYDV-RPV). CYDV is in genus Polerovirus, family Luteoviridae. Genus Luteovirus shares many features with family Tombusviridae. Physical properties: approximately 25 nm icosahedral (T = 3) virions. One major (22 kDa) and one minor (50-55 kDa) coat protein. 5.6-5.8 kb positive sense RNA genome with no 5'-cap and no poly(A) tail. Most grasses. Most important in oats, barley and wheat. Also infects maize and rice. Yellowing and dwarfing in barley, stunting in wheat; reddening, yellowing and blasting in oats. Some isolates cause leaf notching and curling. Key attractions: Model for the study of circulative transmission of aphid-transmitted viruses. Plethora of unusual translation mechanisms. Evidence of recombination in recent evolutionary history creates taxonomic ambiguity. Economically important virus of wheat, barley and oats, worldwide. Useful websites/meetings: International symposium: 'Barley Yellow Dwarf Disease: Recent Advances and Future Strategies', CIMMYT, El Batan, Mexico, 1-5 September 2002, Aphid transmission animation:

  17. RNA. (United States)

    Darnell, James E., Jr.


    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  18. Construction of barley consensus map showing chromosomal ...

    African Journals Online (AJOL)

    In the past, it has been difficult to accurately determine the location of many types of barley molecular markers due to the lack of commonality between international barley linkage maps. In this study, a consensus map of barley was constructed from five different maps (OWB, VxHs, KxM, barley consensus 2 and barley ...

  19. Malting barley BRS Borema

    Directory of Open Access Journals (Sweden)

    Euclydes Minella


    Full Text Available BRS Borema is an early maturing, two-rowed spring barley registered in 2003 for commercial production inSouthern Brazil, bred by Embrapa Trigo. It combines good yield potential with superior malting quality and a reasonable levelof disease (net blotch, powdery mildew, leaf rust resistance. It is well-adapted to all major production regions of maltingbarley in Brazil.

  20. An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

    KAUST Repository

    Gao, Zhihuan; Liu, Hai-Liang; Daxinger, Lucia; Pontes, Olga; He, Xinjian; Qian, Weiqiang; Lin, Huixin; Xie, Mingtang; Lorkovic, Zdravko J.; Zhang, ShouDong; Miki, Daisuke; Zhan, Xianqiang; Pontier, Dominique; Lagrange, Thierry; Jin, Hailing; Matzke, Antonius J.; Matzke, Marjori; Pikaard, Craig S.; Zhu, Jian-Kang


    DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2

  1. Transcriptome of barley under three different heavy metal stress reaction

    Czech Academy of Sciences Publication Activity Database

    Kintlová, Martina; Blavet, Nicolas; Cegan, R.; Hobza, Roman


    Roč. 13, SEP (2017), s. 15-17 ISSN 2213-5960 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:61389030 Keywords : plants * Barley * RNA-Seq * Transcriptome * Heavy metal * Copper * Zinc * Cadmium Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany

  2. Water uptake in barley grain: Physiology; genetics and industrial applications. (United States)

    Cu, Suong; Collins, Helen M; Betts, Natalie S; March, Timothy J; Janusz, Agnieszka; Stewart, Doug C; Skadhauge, Birgitte; Eglinton, Jason; Kyriacou, Bianca; Little, Alan; Burton, Rachel A; Fincher, Geoffrey B


    Water uptake by mature barley grains initiates germination and is the first stage in the malting process. Here we have investigated the effects of starchy endosperm cell wall thickness on water uptake, together with the effects of varying amounts of the wall polysaccharide, (1,3;1,4)-β-glucan. In the latter case, we examined mutant barley lines from a mutant library and transgenic barley lines in which the (1,3;1,4)-β-glucan synthase gene, HvCslF6, was down-regulated by RNA interference. Neither cell wall thickness nor the levels of grain (1,3;1,4)-β-glucan were significantly correlated with water uptake but are likely to influence modification during malting. However, when a barley mapping population was phenotyped for rate of water uptake into grain, quantitative trait locus (QTL) analysis identified specific regions of chromosomes 4H, 5H and 7H that accounted for approximately 17%, 18% and 11%, respectively, of the phenotypic variation. These data indicate that variation in water uptake rates by elite malting cultivars of barley is genetically controlled and a number of candidate genes that might control the trait were identified under the QTL. The genomics data raise the possibility that the genetic variation in water uptake rates might be exploited by breeders for the benefit of the malting and brewing industries. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Genomic Prediction in Barley

    DEFF Research Database (Denmark)

    Edriss, Vahid; Cericola, Fabio; Jensen, Jens D


    to next generation. The main goal of this study was to see the potential of using genomic prediction in a commercial Barley breeding program. The data used in this study was from Nordic Seed company which is located in Denmark. Around 350 advanced lines were genotyped with 9K Barely chip from Illumina....... Traits used in this study were grain yield, plant height and heading date. Heading date is number days it takes after 1st June for plant to head. Heritabilities were 0.33, 0.44 and 0.48 for yield, height and heading, respectively for the average of nine plots. The GBLUP model was used for genomic...

  4. Enumeration of fungi in barley

    CSIR Research Space (South Africa)

    Rabie, CJ


    Full Text Available Estimation of fungal contamination of barley grain is important as certain fungi can proliferate during the malting process. The following factors which may affect the enumeration of fungi were evaluated: dilution versus direct plating, pre...

  5. The Swedish mutant barley collection

    International Nuclear Information System (INIS)


    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  6. The Swedish mutant barley collection

    Energy Technology Data Exchange (ETDEWEB)



    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  7. Root hair mutants of barley

    International Nuclear Information System (INIS)

    Engvild, K.C.; Rasmussen, K.


    Barley mutants without root hairs or with short or reduced root hairs were isolated among M 2 seeds of 'Lux' barley (Hordeum vulgare L.) after acidified sodium azide mutagenesis. Root hair mutants are investigated intensively in Arabidopsis where about 40 genes are known. A few root hair mutants are known in maize, rice, barley and tomato. Many plants without root hairs grow quite well with good plant nutrition, and mutants have been used for investigations of uptake of strongly bound nutrients like phosphorus, iron, zinc and silicon. Seed of 'Lux' barley (Sejet Plant Breeding, Denmark) were soaked overnight, and then treated with 1.5-millimolarsodium azide in 0.1 molar sodium phosphate buffer, pH 3, for 2.5 hours according to the IAEA Manual on Mutation Breeding (2nd Ed.). After rinsing in tap water and air-drying, the M 2 seeds were sown in the field the same day. Spikes, 4-6 per M 1 plant, were harvested. The mutation frequency was similar to that obtained with other barley cultivars from which low-phytate mutants were isolated [5]. Seeds were germinated on black filter paper in tap water for 3 or 4 days before scoring for root hair mutants

  8. The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea. (United States)

    Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun


    The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

  9. Characterization of barley Prp1 gene and its expression during seed development and under abiotic stress. (United States)

    Jiang, Qian-Tao; Liu, Tao; Ma, Jian; Wei, Yu-Ming; Lu, Zhen-Xiang; Lan, Xiu-Jin; Dai, Shou-Fen; Zheng, You-Liang


    The pre-mRNA processing (Prp1) gene encodes a spliceosomal protein. It was firstly identified in fission yeast and plays a regular role during spliceosome activation and cell cycle. Plant Prp1 genes have only been identified from rice, Sorghum and Arabidopsis thaliana. In this study, we reported the identification and isolation of a novel Prp1 gene from barley, and further explored its expressional pattern by using real-time quantitative RTPCR, promoter prediction and analysis of microarray data. The putative barley Prp1 protein has a similar primary structure features to those of other known Prp1 protein in this family. The results of amino acid comparison indicated that Prp1 protein of barley and other plant species has a highly conserved 30 termnal region while their 50 sequences greatly varied. The results of expressional analysis revealed that the expression level of barley Prp1 gene is always stable in different vegetative tissues, except it is up-regulated at the mid- and late stages of seed development or under the condition of cold stress. This kind of expressional pattern for barley Prp1 is also supported by our results of comparison of microarray data from barley, rice and Arabidopsis. For the molecular mechanism of its expressional pattern, we conclude that the expression of Prp1 gene may be up-regulated by the increase of pre-mRNAs and not be constitutive or ubiquitous.

  10. Development of endosperm transfer cells in barley. (United States)

    Thiel, Johannes


    Endosperm transfer cells (ETCs) are positioned at the intersection of maternal and filial tissues in seeds of cereals and represent a bottleneck for apoplasmic transport of assimilates into the endosperm. Endosperm cellularization starts at the maternal-filial boundary and generates the highly specialized ETCs. During differentiation barley ETCs develop characteristic flange-like wall ingrowths to facilitate effective nutrient transfer. A comprehensive morphological analysis depicted distinct developmental time points in establishment of transfer cell (TC) morphology and revealed intracellular changes possibly associated with cell wall metabolism. Embedded inside the grain, ETCs are barely accessible by manual preparation. To get tissue-specific information about ETC specification and differentiation, laser microdissection (LM)-based methods were used for transcript and metabolite profiling. Transcriptome analysis of ETCs at different developmental stages by microarrays indicated activated gene expression programs related to control of cell proliferation and cell shape, cell wall and carbohydrate metabolism reflecting the morphological changes during early ETC development. Transporter genes reveal distinct expression patterns suggesting a switch from active to passive modes of nutrient uptake with the onset of grain filling. Tissue-specific RNA-seq of the differentiating ETC region from the syncytial stage until functionality in nutrient transfer identified a high number of novel transcripts putatively involved in ETC differentiation. An essential role for two-component signaling (TCS) pathways in ETC development of barley emerged from this analysis. Correlative data provide evidence for abscisic acid and ethylene influences on ETC differentiation and hint at a crosstalk between hormone signal transduction and TCS phosphorelays. Collectively, the data expose a comprehensive view on ETC development, associated pathways and identified candidate genes for ETC

  11. Developmentally regulated expression and complex processing of barley pri-microRNAs

    Directory of Open Access Journals (Sweden)

    Kruszka Katarzyna


    Full Text Available Abstract Background MicroRNAs (miRNAs regulate gene expression via mRNA cleavage or translation inhibition. In spite of barley being a cereal of great economic importance, very little data is available concerning its miRNA biogenesis. There are 69 barley miRNA and 67 pre-miRNA sequences available in the miRBase (release 19. However, no barley pri-miRNA and MIR gene structures have been shown experimentally. In the present paper, we examine the biogenesis of selected barley miRNAs and the developmental regulation of their pri-miRNA processing to learn more about miRNA maturation in barely. Results To investigate the organization of barley microRNA genes, nine microRNAs - 156g, 159b, 166n, 168a-5p/168a-3p, 171e, 397b-3p, 1120, and 1126 - were selected. Two of the studied miRNAs originate from one MIR168a-5p/168a-3p gene. The presence of all miRNAs was confirmed using a Northern blot approach. The miRNAs are encoded by genes with diverse organizations, representing mostly independent transcription units with or without introns. The intron-containing miRNA transcripts undergo complex splicing events to generate various spliced isoforms. We identified miRNAs that were encoded within introns of the noncoding genes MIR156g and MIR1126. Interestingly, the intron that encodes miR156g is spliced less efficiently than the intron encoding miR1126 from their specific precursors. miR397b-3p was detected in barley as a most probable functional miRNA, in contrast to rice where it has been identified as a complementary partner miRNA*. In the case of miR168a-5p/168a-3p, we found the generation of stable, mature molecules from both pre-miRNA arms, confirming evolutionary conservation of the stability of both species, as shown in rice and maize. We suggest that miR1120, located within the 3′ UTR of a protein-coding gene and described as a functional miRNA in wheat, may represent a siRNA generated from a mariner-like transposable element. Conclusions Seven of the

  12. Isozyme differences in barley mutants

    Energy Technology Data Exchange (ETDEWEB)

    AI-Jibouri, A A.M.; Dham, K M [Department of Botany, Nuclear Research Centre, Baghdad (Iraq)


    Full text: Thirty mutants (M{sub 11}) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  13. Isozyme differences in barley mutants

    International Nuclear Information System (INIS)

    AI-Jibouri, A.A.M.; Dham, K.M.


    Full text: Thirty mutants (M 11 ) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  14. Mutation breeding in malting barley

    Energy Technology Data Exchange (ETDEWEB)

    Hiraki, Makoto; Sanada, Matsuyoshi


    The released varieties of malting barley through mutation breeding is more than ten in number, including foreign varieties. In Japan four varieties has been released so far. We started mutation breeding in 1956 together with cross breeding that we employed before. Until now, Gamma 4, Amagi Nijo 1 and Fuji Nijo 2 have been produced from the direct use of induced mutations and Nirasaki Nijo 8 from the indirect use of them. Mutation breeding has been used mainly in the partial improvement of agronomic characteristics since the selection for malting quality was very complicated. As the variety bred by induced mutation is usually equivalent to the original variety in malting quality, both this new variety and the original one could be cultivated in the same area without any problem on later malt production. Particularly when one farmer cultivates barley in an extensive acreage, he can harvest at the best time according to the different maturing time of each variety. From these points of view, mutation breeding is an efficient tool in malting barley breeding. Mutagens we have used so far are X-rays, ..gamma..-rays, neutron and chemicals such as dES. From our experience in selection, the low dose of radiation and chemical mutagens are more effective in selection of point mutation than the high dose of radiation which tends to produce many abnormal but few practical mutants. (author).

  15. MicroRNA Delivery for Regenerative Medicine


    Peng, Bo; Chen, Yongming; Leong, Kam W.


    MicroRNA (miRNA) directs post-transcriptional regulation of a network of genes by targeting mRNA. Although relatively recent in development, many miRNAs direct differentiation of various stem cells including induced pluripotent stem cells (iPSCs), a major player in regenerative medicine. An effective and safe delivery of miRNA holds the key to translating miRNA technologies. Both viral and nonviral delivery systems have seen success in miRNA delivery, and each approach possesses advantages an...


    African Journals Online (AJOL)

    Preferred Customer

    immediate recovery of the photosynthetic quantum yield after freezing. Landraces which showed the highest cold tolerance were found to acclimatize best. Key words/phrases: Barley, chlorophyll fluorescence, cold acclimation, Ethiopia, frost tolerance. INTRODUCTION. Barley (Hordeum vulgare L.) is a traditional crop.

  17. Fungal growth during malting of barley

    Directory of Open Access Journals (Sweden)

    Kocić-Tanackov Sunčica D.


    Full Text Available Fungi were isolated and identified in two samples of winter two-row barley (SSK3 and SSK6 harvested in 2003, Kragujevac location, during micromalting. Fungi were isolated and identified in barley before the micromalting, after the 1st, 2nd and 3rd day of steeping, the first day and after the germination after kilning and after malt degermination. The total fungi count was followed in both barley samples, during the mentioned phases. The total count of fungi was also determined in the steeping water, and the isolation and identification was performed after the steeping process. Change of the total count of fungi during barley micromalting was exponentional. During barley micromalting nine fungi genera were isolated: Phoma, Alternaria, Fusarium aspergillus, Cladosporium, Geotrichum, Scopulariopsis, Aureobasidium and Mucor. The most frequent genera were: Phoma, Alternaria and Fusarium. In water for steeping, five genera were identified: Geotrichum, Fusarium, Phoma Cladosporium and Mucor. The most frequent genera was Phoma.

  18. Antidepressant-like effects of young green barley leaf (Hordeum vulgare L.) in the mouse forced swimming test. (United States)

    Yamaura, Katsunori; Nakayama, Noriyuki; Shimada, Maki; Bi, Yuanyuan; Fukata, Hideki; Ueno, Koichi


    Young green barley leaf is one of the richest sources of antioxidants and has been widely consumed for health management in Japan. In this study, we examined whether oral administration of young green barley leaf has an antidepressant effect on the forced swimming test in mice. Mice were individually forced to swim in an open cylindrical container, one hour after oral administration of young green barley leaf (400 or 1000 mg / kg) or imipramine (100 mg / kg). Expression of mRNA for nerve growth factor (NGF), brain-derived neurotrophic factor, and glucocorticoid receptor in the brain was analyzed using real-time quantitative polymerase chain reaction (PCR). There was a significant antidepressant-like effect in the forced swimming test; both 400 and 1000 mg / kg young green barley leaves, as well as the positive control imipramine (100 mg / kg), reduced the immobility duration compared to the vehicle group. The expression of mRNA for NGF detected in the hippocampus immediately after the last swimming test was higher than that in the non-swimming group (Nil). Oral administration of imipramine suppressed this increase to the level of the Nil group. Young green barley leaf (400 and 1000 mg / kg) also showed a moderate decrease in the expression of mRNA for NGF, in a dose-dependent manner. Oral administration of young green barley leaf is able to produce an antidepressant-like effect in the forced swimming test. Consequently it is possible that the antidepressant-like effects of the young green barley leaf are, at least in part, mediated by an inhibition of the increase in the hippocampus levels of NGF.

  19. Esterase Isoenzyme Variants in Barley

    DEFF Research Database (Denmark)

    Hvid, S.; Nielsen, G.


    Gene symbols are proposed for 27 esterase isoenzyme alleles representing 10 loci in barley. Two new esterase loci, Est 9 and Est 10, each with an active and a silent allele, and three new alleles in previously described loci were found. A few chemical and physical characteristics of the different...... esterase isoenzyme systems were studied. The heat inactivation temperature differed for the isoenzymes coded by most of the loci, whereas the substrate and inhibitor specificity of the isoenzymes was less distinct. A possible relationship between some of the systems is discussed....

  20. Resistance to Barley Leaf Stripe

    DEFF Research Database (Denmark)

    Nørgaard Knudsen, J. C.


    in well adapted Northwest European spring cultivars. Virulence matching two hitherto not overcome resistances was demonstrated. Differences in apparent race nonspecific or partial resistance were also present, changing the percentage of infected plants of susceptible genotypes from about 20 to 44 per cent.......Ten barley [Hordeum vulgare] genotypes were inoculated with twelve isolates of Pyrenophora graminea of diverse European and North African origin. Race specific resistance occurred. Four, possibly five, genetically different sources of race-specific resistance were found, three of them occurring...

  1. The low-recombining pericentromeric region of barley restricts gene diversity and evolution but not gene expression (United States)

    Baker, Katie; Bayer, Micha; Cook, Nicola; Dreißig, Steven; Dhillon, Taniya; Russell, Joanne; Hedley, Pete E; Morris, Jenny; Ramsay, Luke; Colas, Isabelle; Waugh, Robbie; Steffenson, Brian; Milne, Iain; Stephen, Gordon; Marshall, David; Flavell, Andrew J


    The low-recombining pericentromeric region of the barley genome contains roughly a quarter of the genes of the species, embedded in low-recombining DNA that is rich in repeats and repressive chromatin signatures. We have investigated the effects of pericentromeric region residency upon the expression, diversity and evolution of these genes. We observe no significant difference in average transcript level or developmental RNA specificity between the barley pericentromeric region and the rest of the genome. In contrast, all of the evolutionary parameters studied here show evidence of compromised gene evolution in this region. First, genes within the pericentromeric region of wild barley show reduced diversity and significantly weakened purifying selection compared with the rest of the genome. Second, gene duplicates (ohnolog pairs) derived from the cereal whole-genome duplication event ca. 60MYa have been completely eliminated from the barley pericentromeric region. Third, local gene duplication in the pericentromeric region is reduced by 29% relative to the rest of the genome. Thus, the pericentromeric region of barley is a permissive environment for gene expression but has restricted gene evolution in a sizeable fraction of barley's genes. PMID:24947331

  2. Roles of Hydroxynitrile Glucosides in Barley

    DEFF Research Database (Denmark)

    Roelsgaard, Pernille Sølvhøj

    on barley (Hordeum vulgare). Barley accumulates five hydroxynitrile glucosides, including one cyanogenic glucoside, in the epidermal cell layer. Cyanogenic glucosides are classically known as hydrogen cyanide-releasing defense compounds which act against generalist insects and herbivores. However...... is proposed. The results obtained in this Ph.D. study provide a unique insight demonstrating that hydroxynitrile glucosides play a far more complex role in barley defense against and susceptibility to Bgh than previously described. Future studies can build on the platforms established in this study to provide...

  3. Transcriptome assembly and analysis of Tibetan Hulless Barley (Hordeum vulgare L. var. nudum developing grains, with emphasis on quality properties.

    Directory of Open Access Journals (Sweden)

    Xin Chen

    Full Text Available BACKGROUND: Hulless barley is attracting increasing attention due to its unique nutritional value and potential health benefits. However, the molecular biology of the barley grain development and nutrient storage are not well understood. Furthermore, the genetic potential of hulless barley has not been fully tapped for breeding. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, we investigated the transcriptome features during hulless barley grain development. Using Illumina paired-end RNA-Sequencing, we generated two data sets of the developing grain transcriptomes from two hulless barley landraces. A total of 13.1 and 12.9 million paired-end reads with lengths of 90 bp were generated from the two varieties and were assembled to 48,863 and 45,788 unigenes, respectively. A combined dataset of 46,485 All-Unigenes were generated from two transcriptomes with an average length of 542 bp, and 36,278 among were annotated with gene descriptions, conserved protein domains or gene ontology terms. Furthermore, sequences and expression levels of genes related to the biosynthesis of storage reserve compounds (starch, protein, and β-glucan were analyzed, and their temporal and spatial patterns were deduced from the transcriptome data of cultivated barley Morex. CONCLUSIONS/SIGNIFICANCE: We established a sequences and functional annotation integrated database and examined the expression profiles of the developing grains of Tibetan hulless barley. The characterization of genes encoding storage proteins and enzymes of starch synthesis and (1-3;1-4-β-D-glucan synthesis provided an overview of changes in gene expression associated with grain nutrition and health properties. Furthermore, the characterization of these genes provides a gene reservoir, which helps in quality improvement of hulless barley.


    Directory of Open Access Journals (Sweden)

    Alžbeta Žofajová


    Full Text Available The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of  qualitative  raw material for maltinq and beer  industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the  new requirements of  malting and beer industry. As an example of the results obtained most recently description is made of the Ezer, Levan, Donaris, Sladar spring barley varieties with very good malting quality and effective resistance to  powdery mildew.  Cultivation of these varieties  and malting barley production with  reduced use  of pesticidies is environmentally friedly alternative. doi:10.5219/50

  5. Cytosolic glutamine synthetase in barley

    DEFF Research Database (Denmark)

    Thomsen, Hanne Cecilie

    remobilisation from ageing plant parts. Thus, GS is highly involved in determining crop yield and NUE. The major objective of this PhD project was to investigate the NUE properties of transgenic barley designed to constitutively overexpress a GS1 isogene (HvGS1.1). These transgenic lines exhibited an increased...... for N demand. Of the GS isogenes, only the transcript levels of root HvGS1.1 increased when plants were transferred from high to low N. This change coincided with an increase in total GS activity. Pronounced diurnal variation was observed for root nitrate transporter genes and GS isogenes in both root...... fertilizer requirement. The enzyme glutamine synthetase (GS) has been a major topic in plant nitrogen research for decades due to its central role in plant N metabolism. The cytosolic version of this enzyme (GS1) plays an important role in relation to primary N assimilation as well as in relation to N...

  6. Functional proteomics of barley and barley chloroplasts – strategies, methods and perspectives

    DEFF Research Database (Denmark)

    Petersen, Jørgen; Rogowska-Wrzesinska, Adelina; Jensen, Ole Nørregaard


    Barley (Hordeum vulgare) is an important cereal grain that is used in a range of products for animal and human consumption. Crop yield and seed quality has been optimized during decades by plant breeding programs supported by biotechnology and molecular biology techniques. The recently completed...... whole-genome sequencing of barley revealed approximately 26,100 open reading frames, which provides a foundation for detailed molecular studies of barley by functional genomics and proteomics approaches. Such studies will provide further insights into the mechanisms of, for example, drought and stress...... tolerance, micronutrient utilization, and photosynthesis in barley. In the present review we present the current state of proteomics research for investigations of barley chloroplasts, i.e., the organelle that contain the photosynthetic apparatus in the plant. We describe several different proteomics...

  7. BAX INHIBITOR-1 is required for full susceptibility of barley to powdery mildew. (United States)

    Eichmann, Ruth; Bischof, Melanie; Weis, Corina; Shaw, Jane; Lacomme, Christophe; Schweizer, Patrick; Duchkov, Dimitar; Hensel, Götz; Kumlehn, Jochen; Hückelhoven, Ralph


    BAX INHIBITOR-1 (BI-1) is one of the few proteins known to have cross-kingdom conserved functions in negative control of programmed cell death. Additionally, barley BI-1 (HvBI-1) suppresses defense responses and basal resistance to the powdery mildew fungus Blumeria graminis f. sp. hordei and enhances resistance to cell death-provoking fungi when overexpressed in barley. Downregulation of HvBI-1 by transient-induced gene silencing or virus-induced gene silencing limited susceptibility to B. graminis f. sp. hordei, suggesting that HvBI-1 is a susceptibility factor toward powdery mildew. Transient silencing of BI-1 did not limit supersusceptibility induced by overexpression of MLO. Transgenic barley plants harboring an HvBI-1 RNA interference (RNAi) construct displayed lower levels of HvBI-1 transcripts and were less susceptible to powdery mildew than wild-type plants. At the cellular level, HvBI-1 RNAi plants had enhanced resistance to penetration by B. graminis f. sp. hordei. These data support a function of BI-1 in modulating cell-wall-associated defense and in establishing full compatibility of B. graminis f. sp. hordei with barley.

  8. Radiosensitivities of cultured barley of different type (Hordeum vulgare)

    International Nuclear Information System (INIS)

    Wang Cailian; Shen Mei; Xu Gang; Zhao Kongnan


    The dormant seeds (with 13% moisture) of 47 barley varieties were irradiated with various doses (0-40 krad) of 137 Cs γ-rays. The radiosensitivities of naked barley was significantly higher than that of hulled barley. The sensitive coefficients of seedling height were 0.04945 and 0.03667 for naked barley and hulled barley, respectively. The radiosensitivity of four-row naked barley was significantly higher than that of two-row hulled barley and six-row hulled barley. 47 varieties studied could be divided into five types with different radiosensitivities, i.e. extreme resistant, resistant, intermediate, sensitive and extreme sensitive. It was also found that the dose-effect curves of cell nucleus volume had a peal at 30 krad

  9. The breeding of new malting barley variety 'Yangpi No.2'

    International Nuclear Information System (INIS)

    Chen Xiulan; He Zhentian; Han Yuepeng; Wang Jinrong; Yang Hefeng


    'Yangpi No.2' barley pasted the examination of Jiangsu province in 2002, is the new spring two-rowed malting barley variety selected by which irradiation mutated the early-maturing of barley. The yield capacity of 'Yangpi No.2' barley is about 6750 kg/hm 2 , it had the characters of early-maturing, good agronomic characters, strong anti-adversity, high quality, and adapted well to everywhere in Jiangsu province. (authors)

  10. Sprouted barley for dairy cows: Nutritional composition and digestibility (United States)

    A 4-unit dual-flow continuous culture fermentor system was used to assess the effect of supplementing 7-d sprouted barley or barley grain with an haylage or pasture diet on nutrient digestibility and methane output. Barley grain was sprouted in climate controlled growth chambers, to be used as part ...

  11. Amylolytic strains of Lactobacillus plantarum isolated from barley ...

    African Journals Online (AJOL)

    ... naturally present in barley, and produced cell-bound and cell-free α-amylase at alkaline conditions. The two strains may be developed into starter cultures to facilitate the germination of barley and produce malt with a higher fermentable sugar content. Key words: Lactobacillus plantarum, starch hydrolysis, barley, malting ...

  12. Winter barley mutants created in the Ukraine

    International Nuclear Information System (INIS)

    Zayats, O.M.


    Full text: Increasing fodder and protein production is one of the objectives of the development of agriculture in Ukraine. Higher productivity of fodder crops, due to new highly productive varieties, is the means to meet this aim. Winter barley is an important crop for fodder purposes. The climate of the Ukraine is favourable for growing this crop. The areas used for the growth of winter barley are however, small (500,000-550,000 ha) and there is a shortage of good quality varieties. The main aim of the work was therefore to create new varieties of highly productive winter barley, of good quality. The new varieties and mutation lines of winter barley were created under the influence of water solutions of N-nitroso-N-methylurea (NMH - 0,012, 0,005%), N-nitroso-N-ethylurea (NEH - 0,05; 0.025; 0,012%) ethyleneimine (EI - 0,02; 0,01; 0,005%) on winter barley seeds of the varieties of local and foreign selections. On the basis of many years of investigations (1984-94) the following mutations were described: hard-grained, winter-hardiness, earliness, middle-maturity, late-maturity, wide and large leaves, narrow leaves, multinodal, great number of leaves, great number of flowers, strong stem (lodging resistant), tallness, semi-dwarfness, dwarfness, and high productivity. Particularly valuable are mutants with high productivity of green bulk. Their potential yield is 70 t/ha. As a result of the work two varieties of winter barley 'Shyrokolysty' and 'Kormovy' were released into the State register of plant varieties of the Ukraine. The other valuable mutant genotypes are used in cross breeding programmes. (author)



    Alžbeta Žofajová; Jozef Gubiš; Ľudovít Sleziak; Klára Križanová; Vratislav Psota


    The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of  qualitative  raw material for maltinq and beer  industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the  new requirements of  malting and beer industry. As an example of the results obtained most recently descripti...

  14. Barley Transformation Using Agrobacterium-Mediated Techniques (United States)

    Harwood, Wendy A.; Bartlett, Joanne G.; Alves, Silvia C.; Perry, Matthew; Smedley, Mark A.; Leyland, Nicola; Snape, John W.

    Methods for the transformation of barley using Agrobacterium-mediated techniques have been available for the past 10 years. Agrobacterium offers a number of advantages over biolistic-mediated techniques in terms of efficiency and the quality of the transformed plants produced. This chapter describes a simple system for the transformation of barley based on the infection of immature embryos with Agrobacterium tumefaciens followed by the selection of transgenic tissue on media containing the antibiotic hygromycin. The method can lead to the production of large numbers of fertile, independent transgenic lines. It is therefore ideal for studies of gene function in a cereal crop system.

  15. Barley seed proteomics from spots to structures

    DEFF Research Database (Denmark)

    Finnie, Christine; Svensson, Birte


    forms on 2D-gels. Specific protein families, including peroxidases and alpha-amylases have been subjected to in-depth analysis resulting in characterisation of different isozymes, post-translational. modifications and processing. A functional proteomics study focusing on the seed thioredoxin system has...... with information from rice and other cereals facilitate identification of barley proteins. Several hundred barley seed proteins are identified and lower abundance proteins including membrane proteins are now being analysed. In the present review we focus on variation in protein profiles of seed tissues during...

  16. Biochemical and Molecular Characterization of a Barley Seed ß-Glucosidase

    DEFF Research Database (Denmark)

    Leah, R.; Kigel, J.; Svendsen, I.


    blot analysis with the cDNA as probe indicated that BGQ60 is encoded by a single gene, and that BGQ60 mRNA only accumulates in the starchy endosperm tissue of late developing seeds. The bgq60 structural gene of approximately 5 kilobases contains an open reading frame encoding 485 amino acids...... during barley seed development and germination are discussed.......A 60-kDa ß-glucosidase (BGQ60) was purified and characterized from seeds of barley (Hordeum vulgare L.). BGQ60 catalytic activity was restricted to the cleavage of short-chain oligosaccharides composed of(1, 2) -,(1, 2, 3) -, and/or(1, 2, 3, 4) -ß-linked glucose or mannose units...

  17. Inhibition of barley grain germination by light

    NARCIS (Netherlands)

    Roth-Bejerano, N.; Meulen, R.M. van der; Wang, M.


    Intact grains of barley (Hordeum distichum cv. Triumph) germinated rapidly in the dark or when exposed to brief daily light breaks in the temperature range 15-25°C, although germination proceeded less rapidly at low temperatures. Prolonged illumination (16 h/day) or continuous light inhibited

  18. The barley Jip23b gene

    DEFF Research Database (Denmark)

    Müller-Uri, Frieder; Cameron-Mills, Verena; Mundy, John


    The barley gene (Jip23) encoding a 23,000-Da protein of unknown function was isolated and shown to be induced by jasmonate methyl ester (MeJA) in leaves. 5'upstream Jip23 sequence was isolated and fused to the beta-glucuronidase gene (GUS), and this reporter was introduced by particle bombardment...

  19. Barley Breeding for Quality Improvement in Tunisia

    African Journals Online (AJOL)



    Nov 6, 2012 ... sub-humid environment at Beja and a semi-arid one at Kef. Heading date ... State of art showed that barley was a main food crop in. North Africa for ... rably to many other food grains (wheat, rye, and oats) and played a .... rates both analysis of variance (ANOVA) and principal component analysis (PCA) into ...

  20. Endoproteolytic activity assay in malting barley

    Directory of Open Access Journals (Sweden)

    Blanca Gómez Guerrero


    Full Text Available Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four classes of endo-proteases have been described: serine-proteases, cysteine-proteases, aspartic-proteases and metallo-proteases. The objective of this work was to develop a rapid and colorimetric enzymatic assay to determine the endo-proteolytic activity of the four endo-protease classes using two different substrates: azo-gelatin and azo-casein. Optimum conditions for the assays such as: pH,reaction time and temperature and absorbance scale were determined. Azo-gelatin presented several difficulties in standardizing an “in solution” assay. On the other hand, azo-casein allowed standardization of the assay for the four enzyme classes to produce consistent results. The endo-proteoteolytic method developed was applied to determine the endo-protease activity in barley, malt and wort.

  1. Chromosome aberration assays in barley (Hordeum vulgare)

    Energy Technology Data Exchange (ETDEWEB)

    Constantin, M J [Univ. of Tennessee, Knoxville; Nilan, R A


    Barley is an exceellent organism for studies of induced chromosome aberrations because of its few (2n = 2x = 14) relatively large chromosomes. Root-tip and shoot-tip cells have been used extensively for the study of ionizing radiation-induced chromosome aberrations. The general procedures are well known, the technology is simple and easy to learn, and the assays are relatively quick and inexpensive. Both root tips and shoot tips can be used for the study of chemical mutagens as well as ionizing radiations. Pollen mother cells are well suited for studying the effects of mutagens on meiotic chromosomes. The literature review for the Gene-Tox Program reported on 61 chemicals tested for their effects on barley chromosomes. Of these, 90% were reported to be either positive or positive dose-related, while 7% were negative and 3% were questionable. Barley assays based on chromosomal aberrations are useful to detect the clastogenic potency of chemicals under laboratory conditions. Indications are that the data from barley can be used to corroborate data obtained from other organisms. Among the classes of chemicals assayed were: alcohols and phenols; alkaloids; epoxides; alkyl sulfates; amides and sulfonamides; aromatic amines; aryl halides; aziridines; alkenes; carbamates; hydroazides; nitroaromatics; nitrosamides; nitrosources; phenothiazines; and polycyclic aromatic hydrocarbons.

  2. The Barley Chromosome 5 Linkage Map

    DEFF Research Database (Denmark)

    Jensen, J.; Jørgensen, Jørgen Helms


    The literature is surveyed for data on recombination between loci on chromosome 5 of barley; 13 loci fall into the category “mapped” loci, more than 20 into the category “associated” loci and nine into the category “loci once suggested to be on chromosome 5”. A procedure was developed...

  3. Technical note: In situ ruminal starch disappearance kinetics of hull-less barley, hulled barley, and corn grains. (United States)

    Ferreira, G; Yang, Y; Teets, C L; Brooks, W S; Griffey, C A


    The objective of this study was to compare ruminal starch disappearance rates of hull-less barley, hulled barley, and corn grains. Five different genotypes were used for each of the 2 barley types. In addition, each of these genotypes was grown in 2 different locations and years, resulting 10 independent barley samples for each of the 2 barley grain types. Five different genotypes of corn grain were obtained from a commercial seed company. After being ground to pass through a 4-mm screen of a cutter mill, 3.6 g of each grain was placed into a porous bag, which was then incubated in the rumen of 2 ruminally cannulated cows for 0, 4, 8, 12, 24, and 48 h. Corn grains had greater instant ruminal starch disappearances than barley grains (22.4 and 8.2%, respectively). Instant ruminal starch disappearances did not differ between hulled and hull-less barley grains. Ruminal starch fractional disappearance rates were greatest for hulled barley grains, moderate for hull-less barley grains, and lowest for corn grains (15.3, 13.9, and 7.1%/h, respectively). Ruminal starch half-life was shortest for hulled and hull-less barley grains (4.4 h) and longest for corn grains (6.6 h). Ruminal starch half-life did not differ between hulled barley and hull-less barley grains. In conclusion, using a holistic experimental design and statistical analysis, this study showed that starch from hull-less barley grains has a ruminal half-life similar to that of hulled barley grains and shorter than that of corn grains. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops


    Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo


    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

  5. Lipid and sugar profiles of various barley cultivars (Hordeum vulgare

    Directory of Open Access Journals (Sweden)

    Pastor Kristian A.


    Full Text Available The lipid components and soluble sugars in flour samples of different cultivars of barley (Hordeum vulgare, involving winter malting barley, winter forage barley, spring barley, and hulless barley, were identified. Fatty acids were extracted from flour samples with n-hexane, and derivatized into volatile methyl esters, using TMSH (trimethylsulfonium hydroxide in methanol. Soluble sugars were extracted from defatted and dried samples of barley flour with 96% ethanol, and further derivatized into the corresponding trimethylsilyl (TMS oximes, using hydroxylamine hydrochloride solution and BSTFA (N,O-bis-(trimethylsilyl-trifluoroacetamide. The hexane and alcoholic extracts of barley cultivars were analyzed by GC-MS system. Lipid and sugar compositions were very similar in all barley cultivars. Therefore, multivariate analysis was applied to numerical values of automatically integrated areas of the identified fatty acid methyl esters and TMS oximes of soluble sugars. The application of hierarchical cluster analysis showed a great similarity between the investigated flour samples of barley cultivars, according to their fatty acid content (0.96. Also, significant, but somewhat less similarity was observed regarding the content of soluble sugars (0.70. These preliminary results indicate the possibility of distinguishing flour made of barley, regardless of the variety, from flours made of other cereal species, just by the analysis of the contents of fatty acids and soluble sugars.[Projekat Ministarstva nauke Republike Srbije, br. TR 31066

  6. Whole Tibetan Hull-Less Barley Exhibit Stronger Effect on Promoting Growth of Genus Bifidobacterium than Refined Barley In Vitro. (United States)

    Gong, Lingxiao; Cao, Wenyan; Gao, Jie; Wang, Jing; Zhang, Huijuan; Sun, Baoguo; Yin, Meng


    The gut microbiota has recently become a new route for research at the intersection of diet and human health. The aim of this study was to investigate whether whole Tibetan hull-less barley (WHB) and refined Tibetan hull-less barley (RHB) caused differentiation of the fecal microbiota in vitro. The microbiota-accessible ingredients in the 2 barley samples were studied using an in vitro enzymatic digestion procedure. After in vitro digestion, insoluble dietary fiber, phenolic compounds, proteins, and β-glucans were 93.2%, 103.4%. 18.8%, and 10.2% higher provided by WHB flour as compared with RHB flour based on the same mass amount. However, due to the significantly higher content of insoluble dietary fiber, WHB digesta had lower percentage contents of fast fermentable substrates including dietary fiber and starch as compared with RHB digesta. The results of Next-generation sequencing of the bacterial 16SrRNA gene showed that both WHB and RHB fermentation had significantly promoted the growth of Bifidobacterium and inhibited the growth of pathogenic bacteria such as Dorea, Escherichia, Oscillopira, and Ruminococcus. Moreover, in response to WHB fermentation, the relative abundance of Bifidobacterium increased by 78.5% and 92.8% as compared with RHB and fructo-oligosaccharides (FOs). Both WHB and RHB are good sources of fermentable dietary fiber with the ability to yield high concentration of short chain fatty acids (SCFAs) as compared to FOs. However, the higher fraction of soluble fiber in RHB digesta increase higher amounts of SCFA compared with WHB digesta. Our findings shed light on the complex interactions of whole cereals with gut microbiota and the possible impact on host health. Until now, only few reports have regarded the impact of in vitro digestion in components of whole grain with complex food matrix. Moreover, our findings shed light on the complex interactions of whole cereals with gut microbiota and the possible impact on host health. © 2018

  7. Angiosperms Are Unique among Land Plant Lineages in the Occurrence of Key Genes in the RNA-Directed DNA Methylation (RdDM) Pathway

    Czech Academy of Sciences Publication Activity Database

    Ma, L.; Hatlen, A.; Kelly, L.J.; Becher, H.; Wang, W.C.; Kovařík, Aleš; Leitch, I. J.; Leitch, Andrew R.


    Roč. 7, č. 9 (2015), s. 2648-2662 ISSN 1759-6653 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : chromatin modification * DNA methylation * evolution Subject RIV: BO - Biophysics Impact factor: 4.098, year: 2015

  8. Association mapping of partitioning loci in barley

    Directory of Open Access Journals (Sweden)

    Mackay Ian J


    Full Text Available Abstract Background Association mapping, initially developed in human disease genetics, is now being applied to plant species. The model species Arabidopsis provided some of the first examples of association mapping in plants, identifying previously cloned flowering time genes, despite high population sub-structure. More recently, association genetics has been applied to barley, where breeding activity has resulted in a high degree of population sub-structure. A major genotypic division within barley is that between winter- and spring-sown varieties, which differ in their requirement for vernalization to promote subsequent flowering. To date, all attempts to validate association genetics in barley by identifying major flowering time loci that control vernalization requirement (VRN-H1 and VRN-H2 have failed. Here, we validate the use of association genetics in barley by identifying VRN-H1 and VRN-H2, despite their prominent role in determining population sub-structure. Results By taking barley as a typical inbreeding crop, and seasonal growth habit as a major partitioning phenotype, we develop an association mapping approach which successfully identifies VRN-H1 and VRN-H2, the underlying loci largely responsible for this agronomic division. We find a combination of Structured Association followed by Genomic Control to correct for population structure and inflation of the test statistic, resolved significant associations only with VRN-H1 and the VRN-H2 candidate genes, as well as two genes closely linked to VRN-H1 (HvCSFs1 and HvPHYC. Conclusion We show that, after employing appropriate statistical methods to correct for population sub-structure, the genome-wide partitioning effect of allelic status at VRN-H1 and VRN-H2 does not result in the high levels of spurious association expected to occur in highly structured samples. Furthermore, we demonstrate that both VRN-H1 and the candidate VRN-H2 genes can be identified using association mapping

  9. Barley grain for ruminants: A global treasure or tragedy

    Directory of Open Access Journals (Sweden)

    Nikkhah Akbar


    Full Text Available Abstract Barley grain (Hordeum vulgare L. is characterized by a thick fibrous coat, a high level of ß-glucans and simply-arranged starch granules. World production of barley is about 30 % of that of corn. In comparison with corn, barley has more protein, methionine, lysine, cysteine and tryptophan. For ruminants, barley is the third most readily degradable cereal behind oats and wheat. Due to its more rapid starch fermentation rate compared with corn, barley also provides a more synchronous release of energy and nitrogen, thereby improving microbial nutrient assimilation. As a result, feeding barley can reduce the need for feeding protected protein sources. However, this benefit is only realized if rumen acidity is maintained within an optimal range (e.g., > 5.8 to 6.0; below this range, microbial maintenance requirements and wastage increase. With a low pH, microbial endotoxines cause pro-inflammatory responses that can weaken immunity and shorten animal longevity. Thus, mismanagement in barley processing and feeding may make a tragedy from this treasure or pearl of cereal grains. Steam-rolling of barley may improve feed efficiency and post-rumen starch digestion. However, it is doubtful if such processing can improve milk production and feed intake. Due to the need to process barley less extensively than other cereals (as long as the pericarp is broken, consistent and global standards for feeding and processing barley could be feasibly established. In high-starch diets, barley feeding reduces the need for capacious small intestinal starch assimilation, subsequently reducing hindgut starch use and fecal nutrient loss. With its nutritional exclusivities underlined, barley use will be a factual art that can either matchlessly profit or harm rumen microbes, cattle production, farm economics and the environment.

  10. Detection of Ustilago nuda (Jensen) Rostrup in winter barley seed


    Ignjatov Maja; Petrović Dragana; Vujaković Milka; Taški-Ajduković Ksenija; Nikolić Zorica; Jovičić Dušica


    Barley is one of the most important cereals grown in our agroecological conditions. The causal agent of loose smut on barley Ustilago nuda (Jensen) Rostrup occurs frequently as varieties susceptible to this pathogen are present in the production. Disease symptoms are manifested on barley head (spike). Parasite is transmitted by seed (seedborne) and stays in the embryo tissue of the infected kernel as dormant mycelium. Recommended method for detection of U. nuda is given by ISTA Rules (method ...

  11. Dominant Groups of Potentially Active Bacteria Shared by Barley Seeds become Less Abundant in Root Associated Microbiome


    Yang, Luhua; Danzberger, Jasmin; Schöler, Anne; Schröder, Peter; Schloter, Michael; Radl, Viviane


    Endophytes are microorganisms colonizing plant internal tissues. They are ubiquitously associated with plants and play an important role in plant growth and health. In this work, we grew five modern cultivars of barley in axenic systems using sterile sand mixture as well as in greenhouse with natural soil. We characterized the potentially active microbial communities associated with seeds and roots using rRNA based amplicon sequencing. The seeds of the different cultivars share a great part o...

  12. Implementation of biochemical screening to improve baking quality of barley

    DEFF Research Database (Denmark)

    Vincze, Éva; Dionisio, Giuseppe; Aaslo, Per


    Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact on the phys......Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact...... on the physical chemical properties of the bread products due to the poor baking properties of barley flour. As a consequence, the nutritional advantages of barley are not fully exploited. The inferior leavening and baking properties of barley can, in part, be attributed to the physical properties of the storage...... proteins. Changing the storage protein composition can lessen this problem. Our working hypothesis was that exploiting the substantial genetic variation within the gene pool for storage proteins could enable improving the baking qualities of barley flour. We characterised forty-nine barley cultivars...

  13. Association of VPg and eIF4E in the host tropism at the cellular level of Barley yellow mosaic virus and Wheat yellow mosaic virus in the genus Bymovirus. (United States)

    Li, Huangai; Shirako, Yukio


    Barley yellow mosaic virus (BaYMV) and Wheat yellow mosaic virus (WYMV) are separate species in the genus Bymovirus with bipartite plus-sense RNA genomes. In fields, BaYMV infects only barley and WYMV infects only wheat. Here, we studied the replicative capability of the two viruses in barley and wheat mesophyll protoplasts. BaYMV replicated in both barley and wheat protoplasts, but WYMV replicated only in wheat protoplasts. The expression of wheat translation initiation factor 4E (eIF4E), a common host factor for potyviruses, from the WYMV genome enabled WYMV replication in barley protoplasts. Replacing the BaYMV VPg gene with that of WYMV abolished BaYMV replication in barley protoplasts, whereas the additional expression of wheat eIF4E from BaYMV genome restored the replication of the BaYMV mutant in barley protoplasts. These results indicate that both VPg and the host eIF4E are involved in the host tropism of BaYMV and WYMV at the replication level. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Cisgenic barley with improved phytase activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik


    copies of the genomic phytase gene and the selection gene to identify segregation between the two genes. Presently, we have identified two cisgenic T1 plants without vector backbone and selection gene but with an extra copy of the genomic phytase gene....... are accordingly very similar to those generated by conventional breeding. The cisgenesis concept allows for the introduction of extra gene copies of a particular gene to accentuate the trait. We are using a barley purple acid phosphatase expressed during grain filling as candidate gene for cisgenesis. A genomic...... barley lambda library has been used to isolate the genomic clone of this phytase including 2.3 kb of the promoter region and 600 bp of the terminator region. The clone has been inserted into a cisgenic Agrobacterium vector where both the gene of interest and the selection gene are flanked by their own T...

  15. Biosorption of nickel with barley straw. (United States)

    Thevannan, Ayyasamy; Mungroo, Rubeena; Niu, Catherine Hui


    Wastewater containing nickel sulphate generated from a nickel plating industry is of great concern. In the present work, biosorption of nickel by barley straw from nickel sulphate solution was investigated. Nickel uptake at room temperature (23+/-0.5 degrees C) was very sensitive to solution pH, showing a better uptake value at a pH of 4.85+/-0.10 among the tested values. The nickel biosorption isotherm fitted well the Langmuir equation. When the ionic strength (IS) of the solution was increased from less than 0.02-0.6M, nickel uptake was reduced to 12% of that obtained at IS of less than 0.02 M. Barley straw showed a higher nickel uptake (0.61 mmol/g) than acid washed crab shells (0.04 mmol/g), demonstrating its potential as an adsorbent for removal of nickel. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  16. Transgenic Wheat, Barley and Oats: Future Prospects (United States)

    Dunwell, Jim M.

    Following the success of transgenic maize and rice, methods have now been developed for the efficient introduction of genes into wheat, barley and oats. This review summarizes the present position in relation to these three species, and also uses information from field trial databases and the patent literature to assess the future trends in the exploitation of transgenic material. This analysis includes agronomic traits and also discusses opportunities in expanding areas such as biofuels and biopharming.

  17. Radiation induced early maturing mutants in barley

    International Nuclear Information System (INIS)

    Kumar, R.; Chauhan, S.V.S.; Sharma, R.P.


    In M 2 generation, two early maturing plants were screened from a single spike progeny of a plant obtained from 20 kR of gamma-ray irradiation of a six-rowed barley (Hordeum vulgare L. var. Jyoti). Their true breeding nature was confirmed in M 3 generation. These mutants flower and mature 38 and 22 days earlier than those of control. (auth.)

  18. Search for endophytic diazotrophs in barley seeds

    Directory of Open Access Journals (Sweden)

    Myriam S. Zawoznik


    Full Text Available Eight endophytic isolates assigned to Pseudomonas, Azospirillum, and Bacillus genera according to pheno-genotypic features were retrieved from barley seeds under selective pressure for nitrogen-fixers. Genetic relationships among related isolates were investigated through RAPD. Six isolates displayed nitrogen-fixing ability, while all could biosynthesize indolacetic acid in vitro and showed no antibiosis effects against Azospirillum brasilense Az39, a recognized PGPR.

  19. Radiosensitivity study of cultured barley (hordeum vulgare)

    International Nuclear Information System (INIS)

    Wang Cailian; Shen Mei; Xu Gang; Zhao Kongnan; Chen Qiufang


    For studying the radioactivity, forty seven varieties of dormant barley seeds were irradiated with various doses (0 ∼ 400 Gy) of 137 Cs γ-rays. The results showed that the dose-effects relations of seedling growth inhibition could be fitted by an equation of F(D) = 1 - (1 - e -a 1 D ) N , and the dose-effects of cell-nucleus, the frequency of root tip cell with chromosome aberations and peroxidase isoenzyme band could be expressed by a linear regression equation Y = A + B · X. The radioactivity of naked barley was much higher than of covered barley. According to different radiosensitivities the varieties studied could be divided into five types i.e. extreme resistant, resistant, intermediate, sensitive, and extreme sensitive. The results also showed that there was close relationship between the DNA content of cell-nucleus, peroxidase isoenzyme zymogram and radioactivity. The radiosensitivty was proportional to the DNA content. The volume of cell-nucleus varied inversly as D 50 of nucleus volume and no obvious correlation with the D 50 of seedling growth inhibition

  20. The germinlike protein GLP4 exhibits superoxide dismutase activity and is an important component of quantitative resistance in wheat and barley

    DEFF Research Database (Denmark)

    Christensen, Anders Bentsen; Thordal-Christensen, Hans; Zimmermann, Grit


    Germinlike proteins (GLP) are encoded in plants by a gene family with proposed functions in plant development and defense. Genes of GLP subfamily 4 of barley (HvGLP4, formerly referred to as HvOxOLP) and the wheat orthologue TaGLP4 (formerly referred to as TaGLP2a) were previously found...... overexpression of TaGLP4 and HvGLP4 enhanced resistance against B. graminis in wheat and barley, whereas transient silencing by RNA interference reduced basal resistance in both cereals. The effect of GLP4 overexpression or silencing was strongly influenced by the genotype of the plant. The data suggest...

  1. Investigation of the somaclonal and mutagen induced variability in barley by the application of protein and DNA markers

    International Nuclear Information System (INIS)

    Atanassov, A.; Todorovska, E.; Trifonova, A.; Petrova, M.; Marinova, E.; Gramatikova, M.; Valcheva, D.; Zaprianov, S.; Mersinkov, N.


    Barley, Hordeum vulgare L., is one of the most important crop species for Bulgaria. The characterisation of the genetic pool is of great necessity for the Bulgarian barley breeding programme which is directed toward improving quantitative and qualitative traits. Molecular markers [protein, restriction fragment length polymorphisms (RFLP) and randomly amplified polymorphic DNA (RAPD)] have been applied to characterise the Bulgarian barley cultivars and their regenerants. The changes in DNA loci coding for 26S, 5.8S and 18S rRNA repeats, C hordein locus and mitochondrial DNA organisation have been investigated. The potential for ribosomal DNA length polymorphism in Bulgarian barley cultivars appear to be limited to three different repeat lengths (10.2, 9.5 and 9.0kb) and three plant rDNA phenotypes. Polymorphism was not observed in ribosomal DNA repeat units in somaclonal variants. Variation concerning C hordein electrophoretic pattern was observed in one line from cultivar Jubiley. Analysis of the HorI locus reveals RFLPs in sequences coding for C hordeins in this line. Mitochondrial molecular markers are convenient for detection of DNA polymorphisms in the variant germplasm as well as for the somaclonal variants derived from it. Two lines from Ruen revealed polymorphic bands after hybridisation with mitochondrial DNA probe. RAPD assays have been carried out by using 20 different 10-mer primers. Heritable polymorphism in several tissue culture derived (TCD) lines was observed. RAPD assay is a sensitive and representative approach to distinguish the variability created by tissue culture and mutagenesis

  2. Barley yellow dwarf virus in barley crops in Tunisia: prevalence and molecular characterization


    Asma NAJAR; Imen HAMDI; Arvind VARSANI


    A field survey was conducted in Tunisia in the North-Eastern regions (Bizerte, CapBon and Zaghouan), the North-Western region (Kef) and the Central-Eastern region (Kairouan) during the 2011/2012 growing season, in order to determine the incidence and the geographic distribution of Barley yellow dwarf virus (BYDVs) in barley fields. Tissue blot immunoassays (TBIA) showed that BYDV was most common in Zaghouan (incidence 14%), Cap Bon (14%) and Bizerte (35%), in randomly collected samples from t...

  3. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.


    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  4. Lysine metabolism in antisense C-hordein barley grains

    DEFF Research Database (Denmark)

    Schmidt, Daiana; Rizzi, Vanessa; Gaziola, Salete A


    The grain proteins of barley are deficient in lysine and threonine due to their low concentrations in the major storage protein class, the hordeins, especially in the C-hordein subgroup. Previously produced antisense C-hordein transgenic barley lines have an improved amino acid composition, with ...

  5. Revisit to Ethiopian traditional barley-based food

    Directory of Open Access Journals (Sweden)

    Jemal Mohammed


    Full Text Available Barley is the number one food crop in the highland parts of North Eastern Ethiopia produced by subsistence farmers grown as landraces. Barley producers in Ethiopia have given it the name gebs ye ehil nigus, which means barley is the king of crops, due to its suitability for preparing many of the known Ethiopians traditional dishes. Various barley foods and drinks play an important role in the socioeconomic and cultural life of Ethiopians, but detailed descriptions related to their preparation and their socioeconomic and cultural roles are not well-recorded and documented like most of the Ethiopian cultural foods. Foods such as ingera, kita, dabo, kolo, genfo, beso, chuko, shamet, tihlo, kinch, and shorba are the most commonly known traditional Ethiopian barley-based foods. These products are prepared from either roasted whole grain, raw and roasted-milled grain, or cracked grain as main, side, ceremonial, and recuperating dishes. The various barley-based traditional foods have perceived qualities and health benefits by the consumers. For example, genfo is served to breast-feeding mothers with the belief that it enhances breast milk production and serves as a good substitute for breast milk. Beso is claimed to be a remedy for gastritis, while genfo and kinche are used to heal broken bones and fractures. Considering the Western consumers' trend on functional foods and health benefits of barley, Ethiopian traditional barley-based foods are worth studying as functional foods, which can be appealing to Western consumers.

  6. Molecular characterization of barley ( Hordeum vulgare L.) genome ...

    African Journals Online (AJOL)

    The present work aimed to select drought tolerant barley (Hordeum vulgare L.) cultivars through identification of stress genes responsible for drought tolerance. Several barley genotypes were tested for drought resistance using specific molecular markers, nine out of all the genotypes were chosen for this study; five out of ...

  7. Combining unmalted barley and pearling gives good quality brewing

    NARCIS (Netherlands)

    Donkelaar, van Laura H.G.; Hageman, Jos A.; Oguz, Serhat; Noordman, Tom R.; Boom, Remko M.; Goot, van der Atze Jan


    Brewing with unmalted barley can reduce the use of raw materials, thereby increasing the efficiency of the brewing process. However, unmalted barley contains several undesired components for brewing and has a low enzymatic activity. Pearling, an abrasive milling method, has been proposed as a

  8. (GPx) activity in young barley seedlings enriched with selenium

    African Journals Online (AJOL)



    Sep 21, 2011 ... E-mail: Tel/Fax: +86. 25 84396293. have been used for animal feeds and beer malts. Recently, young barley seedlings have been used as food material for people in Asian countries such as China,. Japan, and Korea. Young barley seedlings are rich in dietary fiber, chlorophyll, carotene ...

  9. stability analysis of food barley genotypes in northern ethiopia

    African Journals Online (AJOL)


    interaction and stability for barley grain yield and yield related traits in the growing ... that the environments were diverse; causing most of the variation in grain yield. ... component axes IPCA1, IPCA2 and IPCA3, which explained 58.06, 27.11 and ..... AMMI analysis of variance for grain yield (t ha-1) of food barley genotypes ...

  10. 7 CFR 801.3 - Tolerances for barley pearlers. (United States)


    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Tolerances for barley pearlers. 801.3 Section 801.3 Agriculture Regulations of the Department of Agriculture (Continued) GRAIN INSPECTION, PACKERS AND STOCKYARD... FOR GRAIN INSPECTION EQUIPMENT § 801.3 Tolerances for barley pearlers. The maintenance tolerances for...

  11. A cathepsin F-like peptidase involved in barley grain protein mobilization, HvPap-1, is modulated by its own propeptide and by cystatins (United States)

    Diaz, Isabel


    Among the C1A cysteine proteases, the plant cathepsin F-like group has been poorly studied. This paper describes the molecular and functional characterization of the HvPap-1 cathepsin F-like protein from barley. This peptidase is N-glycosylated and has to be processed to become active by its own propeptide being an important modulator of the peptidase activity. The expression pattern of its mRNA and protein suggest that it is involved in different proteolytic processes in the barley plant. HvPap-1 peptidase has been purified in Escherichia coli and the recombinant protein is able to degrade different substrates, including barley grain proteins (hordeins, albumins, and globulins) stored in the barley endosperm. It has been localized in protein bodies and vesicles of the embryo and it is induced in aleurones by gibberellin treatment. These three features support the implication of HvPap-1 in storage protein mobilization during grain germination. In addition, a complex regulation exerted by the barley cystatins, which are cysteine protease inhibitors, and by its own propeptide, is also described PMID:22791822

  12. Fermented Dough Characteristics of Wheat-barley-hemp Composites. Comparison of Two Dosages of Barley and Hemp Wholemeal/Flour

    Directory of Open Access Journals (Sweden)

    Marie Hrušková


    Full Text Available Wheat flour substitution by barley one led to shortening of fermentation and leavening times (about 14–57% and 35–83%, respectively as well as to lessening of dough volumes (about 25–75%, based on lowered protein quality (Zeleny value. Addition of barley flour affected specific bread volume; diminishing for wheat-barley blends 70:30 and 50:50 reached 30% and 43%, respectively. Volume of bread prepared from wheat-barley blend 70:30 enhanced by dehulled hemp wholemeal was the highest within the tested tri-composites set, achieving 130% of wheat-barley control; other hemp products caused the parameter decrease (from 8 to 33%. Within a group of bakery products containing 50% of barley flour, hulled hemp wholemeal partially supressed negative effect of barley flour – specific bread volumes increased about ca 15%. Commercial fine hemp flour samples demonstrated a reversal influence – its addition resulted into lower buns size than wheat-barley control (about 3–34%. Between wheat flour and both groups of flour tri-composites, PCA confirmed differences in dough and bread technological quality. Specific bread volume could be predicted according to maturograph dough elasticity, dough or bread OTG volumes.

  13. Systemic responses of barley to the 3-hydroxy-decanoyl-homoserine lactone producing plant beneficial endophyte Acidovorax radicis N35

    Directory of Open Access Journals (Sweden)

    Shengcai Han


    Full Text Available Quorum sensing auto-inducers of the N-acyl homoserine lactone (AHL type produced by Gram-negative bacteria have different effects on plants including stimulation on root growth and/or priming or acquirement of systemic resistance in plants. In this communication the influence of AHL production of the plant growth promoting endophytic rhizosphere bacterium Acidovorax radicis N35 on barley seedlings was investigated. A. radicis N35 produces 3-hydroxy-C10-homoserine lactone (3-OH-C10-HSL as the major AHL compound. To study the influence of this QS autoinducer on the interaction with barley, the araI-biosynthesis gene was deleted. The comparison of inoculation effects of the A. radicis N35 wild type and the araI mutant resulted in remarkable differences. While the N35 wild type colonized plant roots effectively in microcolonies, the araI mutant occurred at the root surface as single cells. Furthermore, in a mixed inoculum the wild type was much more prevalent in colonization than the araI mutant documenting that the araI mutation affected root colonization. Nevertheless, a significant plant growth promoting effect could be shown after inoculation of barley with the wild type and the araI mutant in soil after two months cultivation. While A. radicis N35 wild type showed only a very weak induction of early defense responses in plant RNA expression analysis, the araI mutant caused increased expression of flavonoid biosynthesis genes. This was corroborated by the accumulation of several flavonoid compounds such as saponarin and lutonarin in leaves of root inoculated barley seedlings. Thus, although the exact role of the flavonoids in this plant response is not clear yet, it can be concluded, that the synthesis of AHLs by A. radicis has implications on the perception by the host plant barley and thereby contributes to the establishment and function of the bacteria-plant interaction.

  14. Genomic Prediction of Barley Hybrid Performance

    Directory of Open Access Journals (Sweden)

    Norman Philipp


    Full Text Available Hybrid breeding in barley ( L. offers great opportunities to accelerate the rate of genetic improvement and to boost yield stability. A crucial requirement consists of the efficient selection of superior hybrid combinations. We used comprehensive phenotypic and genomic data from a commercial breeding program with the goal of examining the potential to predict the hybrid performances. The phenotypic data were comprised of replicated grain yield trials for 385 two-way and 408 three-way hybrids evaluated in up to 47 environments. The parental lines were genotyped using a 3k single nucleotide polymorphism (SNP array based on an Illumina Infinium assay. We implemented ridge regression best linear unbiased prediction modeling for additive and dominance effects and evaluated the prediction ability using five-fold cross validations. The prediction ability of hybrid performances based on general combining ability (GCA effects was moderate, amounting to 0.56 and 0.48 for two- and three-way hybrids, respectively. The potential of GCA-based hybrid prediction requires that both parental components have been evaluated in a hybrid background. This is not necessary for genomic prediction for which we also observed moderate cross-validated prediction abilities of 0.51 and 0.58 for two- and three-way hybrids, respectively. This exemplifies the potential of genomic prediction in hybrid barley. Interestingly, prediction ability using the two-way hybrids as training population and the three-way hybrids as test population or vice versa was low, presumably, because of the different genetic makeup of the parental source populations. Consequently, further research is needed to optimize genomic prediction approaches combining different source populations in barley.

  15. The adsorption of α-amylase on barley proteins affects the in vitro digestion of starch in barley flour. (United States)

    Yu, Wenwen; Zou, Wei; Dhital, Sushil; Wu, Peng; Gidley, Michael J; Fox, Glen P; Gilbert, Robert G


    The conversion of barley starch to sugars is a complex enzymic process. Most previous work concerned the biotechnical aspect of in situ barley enzymes. However, the interactions among the macromolecular substrates and their effects on enzymic catalysis has been little examined. Here, we explore the mechanisms whereby interactions of protein and starch in barley flour affect the kinetics of enzymatic hydrolysis of starch in an in vitro system, using digestion rate data and structural analysis by confocal microscopy. The degradation kinetics of both uncooked barley flour and of purified starches are found to be two-step sequential processes. Barley proteins, especially the water-soluble component, are found to retard the digestion of starch degraded by α-amylase: the enzyme binds with water-insoluble protein and with starch granules, leading to reduced starch hydrolysis. These findings are of potential industrial value in both the brewing and food industries. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Breeding of proanthocyanidin free malting barley

    International Nuclear Information System (INIS)

    Andersen, Anna Maria


    Full text: Haze formation in stored beer is due to colloidal precipitation of proteins with polyphenols of which proanthocyanidins are the most important group. 70-80% of proanthocyanidin in beer are from barley malt. Today breweries attain haze stability by using enzymes, additives or adsorbents. A better solution would be to remove proanthocyanidins. Carlsberg Plant Breeding uses induced mutations to breed proanthocyanidin-free malting barley. After mutagen treatment with sodium azide M1 seeds are planted in the field and M2 seeds are harvested in bulk. A single seed, non-destructive method has been developed to identify mutant kernels lacking proanthocyanidins in the testa. The method involves the inclusion of M2 seeds - 50 at a time - in semisolid clay blocks, whereafter a small part of the endosperm, testa and pericarp are exposed by sanding the seeds. The clay block is then placed in a vanillin-HCI solution so that the uncovered tissues can react with the solution. A red colour will develop in the testa of normal seeds, whereas the testa layers of proanthocyanid-free seeds remain colourless. So far, more than 600 mutants have been induced in over 100 barley varieties, spring as well as winter-types, from barley producing areas around the world. The mutants can be assigned to at least 7 loci, all of which can block the biosynthetic pathway for the proanthocyanidins. Mutants in the ant-18 and ant-19 loci show poor kernel development. Only a few mutants are known in the ant-12, ant-22 and ant-25 loci. Breeding work is focussed on mutants belonging to the ant-13 and ant-17 loci. Whereas the malting quality of ant-17 lines suffer from apparent abnormal enzyme development in the aleurone layer, this defect does not exist in ant-13 lines. Brewing trials with proanthocyanidin-free malt have shown excellent haze stability without changes in beer flavour. Breeding work based on the ant-13 lines led to disease resistant lines with good malting quality, while grain yield

  17. Dynamic Allocation of Sugars in Barley (United States)

    Cumberbatch, L. C.; Crowell, A. S.; Fallin, B. A.; Howell, C. R.; Reid, C. D.; Weisenberger, A. G.; Lee, S. J.; McKisson, J. E.


    Allocation of carbon and nitrogen is a key factor for plant productivity. Measurements are carried out by tracing 11C-tagged sugars using positron emission tomography and coincidence counting. We study the mechanisms of carbon allocation and transport from carbohydrate sources (leaves) to sinks (stem, shoot, roots) under various environmental conditions such as soil nutrient levels and atmospheric CO2 concentration. The data are analyzed using a transfer function analysis technique to model transport and allocation in barley plants. The experimental technique will be described and preliminary results presented. This work was supported in part by USDOE Grant No. DE-FG02-97-ER41033 and DE-SC0005057.

  18. Replication of DNA during barley endosperm development

    DEFF Research Database (Denmark)

    Giese, H.


    The incorporation of [6-H-3]-thymidine into DNA of developing barley end sperm was examined by autoradiography of cross sections of seeds and DNA analysis. The majority of nuclear divisions took place in the very young endosperm, but as late as 25 days after anthesis there was evidence for DNA...... replication. The DNA content of the endosperm increases during development and in response to nitrogen application in parallel to the storage protein synthesis profile. The hordein genes were hypersensitive to DNase I treatment throughout development....

  19. The Barley Chromosome 5 Linkage Map

    DEFF Research Database (Denmark)

    Jensen, J.; Jørgensen, Jørgen Helms


    The distances between nine loci on barley chromosome 5 have been studied in five two-point tests, three three-point tests, and one four-point test. Our previous chromosome 5 linkage map, which contained eleven loci mapped from literature data (Jensen and Jørgensen 1975), is extended with four loci......-position is fixed on the map by a locus (necl), which has a good marker gene located centrally in the linkage group. The positions of the other loci are their distances in centimorgans from the 0-position; loci in the direction of the short chromosome arm are assigned positive values and those...

  20. Radiation induced desynaptic mutants in barley

    International Nuclear Information System (INIS)

    Srivastava, H.M.


    Spontaneous occurrence of asynapsis and desynapsis has been frequently reported in a number of crop plants (Beadle 1930, 1933; Beasley and Brown 1942; Li et al. 1945; Magoon et al. 1961; Miller 1963) and other angiospermic texa (Calarier 1955; Chennaveraiah and Krisnappa 1968; Ehrenberg 1949; Johnson 1941, 1944; Roy and Jha 1958). However, there are only a few reports of induced asynapsis or desynapsis (Gottschalk and Baquar 1971; Martini and Bozzini 1966). The present paper deals with the morphology and meiotic behavior of gamma-ray induced barley mutants showing high degree of desynapsis resulting in partial to complete sterility. (author)

  1. Direct selection of expressed sequences on a YAC clone revealed proline-rich-like genes and BARE-1 sequences physically linked to the complex ¤Mla¤ powdery mildew resistance locus of barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Schwarz, G.; Michalek, W.; Jahoor, A.


    homology to the copia-like retroelement BA REI of barley, putatively involved in evolution of disease resistance loci. The high degree of clones representing barley rRNA sequences or false positives is a major disadvantage of direct selection of cDNAs in barley. (C) 2002 Elsevier Science Ireland Ltd. All...... gene. Of 22 selected cDNA clones, six were re-located on the YAC by southern analysis. Two of these clones are predicted to encode members of the hydroxyproline-rich glycoprotein and proline-rich protein gene families which have been implicated in plant defense response. Four sequences showed high...

  2. Increased efficiency of exogenous messenger RNA translation in a Krebs ascites cell lysate. (United States)

    Metafora, S; Terada, M; Dow, L W; Marks, P A; Bank, A


    Addition of a 0.5 M KCl wash fraction from rabbit reticulocyte ribosomes causes a 3- to 10-fold increase in the extent of translation of natural mRNAs by Krebs-cell lysates. In the presence of the wash fraction, 1 pmol of rabbit or mouse 10S RNA directs the incorporation of 80 pmol of leucine into rabbit globin. The addition of human 10S RNA results in the synthesis of equal amounts of human alpha and beta chains, identified by column chromatography. The stimulation by the wash fraction is almost completely dependent on added mammalian tRNA. In contrast to the wash fraction from rabbit reticulocytes, the wash fraction isolated from Krebs-cell ribosomes is inhibitory to both endogenous and exogenous mRNA translation. The stimulation by the wash fraction from rabbit ribosomes is not specific for globin mRNAs, but also increases endogenous, phage Qbeta, and viral RNA-directed protein synthesis.

  3. The Importance of Barley Varieties in terms of Production, Marketing and Processing

    Directory of Open Access Journals (Sweden)

    Rahmi Taşcı


    Full Text Available In this study, it is aimed to investigate the criteria affecting the marketing of barley in the stages of barley production, marketing and processing in Konya province. In the study; survey results were used which get from mixed feed (37 items and malt factory (1 item, traders (50 items purchasing and selling barley, and agricultural enterprises (107 items including barley production in agricultural activities operating in Konya province. It was determined that barley varieties were not an important criterion in the selling price, while the hectoliter and other plant species do not mix into barley are the main criteria considered by agricultural enterprises to affect the sale of barley. The most important criteria that traders keep in mind when buying barley is hectoliter of barley, which is followed by moisture, colour and foreign matter confusion rate of barley. The most important criteria that factories take into consideration when purchasing barley is determined as the moisture content of the barley, followed by the hectoliter of barley and the rate of foreign matter contamination. For the malt industry; Barley variety is a very important factor in the purchase criteria, followed by barley humidity and colour.

  4. Characterization of volatile aroma compounds in different brewing barley cultivars. (United States)

    Dong, Liang; Hou, Yingmin; Li, Feng; Piao, Yongzhe; Zhang, Xiao; Zhang, Xiaoyu; Li, Cheng; Zhao, Changxin


    Beer is a popular alcoholic malt beverage resulting from fermentation of the aqueous extract of malted barley with hops. The aroma of brewing barley impacts the flavor of beer indirectly, because some flavor compounds or their precursors in beer come from the barley. The objectives of this research were to study volatile profiles and to characterize odor-active compounds of brewing barley in order to determine the variability of the aroma composition among different brewing barley cultivars. Forty-one volatiles comprising aldehydes, ketones, alcohols, organic acids, aromatic compounds and furans were identified using solid phase microextraction combined with gas chromatography/mass spectrometry, among which aldehydes, alcohols and ketones were quantitatively in greatest abundance. Quantitative measurements performed by means of solvent extraction and calculation of odor activity values revealed that acetaldehyde, 2-methylpropanal, 3-methylbutanal, 2-methylbutanal, hexanal, heptanal, octanal, nonanal, 3-methyl-1-butanol, cyclopentanol, 2,3-butanedione, 2,3-pentanedione, 2-heptanone, acetic acid, ethyl acetate, 2-pentylfuran and benzeneacetaldehyde, whose concentrations exceeded their odor thresholds, could be considered as odor-active compounds of brewing barley. Principal component analysis was employed to evaluate the differences among cultivars. The results demonstrated that the volatile profile based on the concentrations of aroma compounds enabled good differentiation of most barley cultivars. © 2014 Society of Chemical Industry.

  5. Useful mutations in Iraqi black barley

    International Nuclear Information System (INIS)

    Ibrahim, I.F.


    Full text: Barley (Hordeum vulgare L.) is an important fodder crop in Iraq, with a cultivated area of about 1 392 375 ha and a total production of about 838500 t. The 2-row black barley ''LBB'' is the most desirable one in semi-arid zone in northern part of Iraq, because of its drought tolerance and high protein content. However, this cultivar is susceptible to powdery mildew, and lodges. Gamma rays and EMS were used to induce mutations in ''LBB'' and its hybrid with A rivat''. Nine mutants with improved lodging were selected during the first six generations. Five mutants INRC-BB-1, INRC-BB-3, INRC-BBR-4A, INRC-HB-552 and INRC-HB-553 were resistant to powdery mildew while 2 mutants INRC-BBH-1 and INRC-HBR-3 were moderately resistant. Two mutants INRC-BB-123 and INRC-HBR-3 were also resistant to drought under 350-400 mm rainfall. Three mutants INRC-BB-1, INRC-HBR-3 and INRC-HBR-88 exceeded their original variety in seed weight per spike and TKW. (author)

  6. γ-ray radiation decontamination of barley plant powder

    International Nuclear Information System (INIS)

    Zhao Xiaojun; Fu Junjie; Wang Zhiping; Zhang Guobin


    Radiation decontamination of barley plant powder by 60 Co γ-rays and the effect on its components were studied. Results showed that irradiation was very effective in killing the microorganisms in barley plant powder. The irradiation did not cause obvious changes of the major components of protein, total sugar, free amino acid, crude fiber, but 35% loss of vitamin E was observed after 10kGy irradiation. It is suggested that 7.5-10kGy irradiation is good enough for decontamination of the barley plant powder. (authors)

  7. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.


    Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active site...


    DEFF Research Database (Denmark)

    Buchmann, N. B.


    An in vitro method for measuring barley protein digestibility is presented. Samples were first incubated with pepsin in HCl; pancreatin was then added concomitantly with a bacteriostatic borate buffer. After TCA-precipitation, soluble nitrogen was measured. The digestion was unaffected...... by accumulated free amino acids. There were no free amino acids following pepsin treatment, but the essential ones were well liberated by pancreatin. Results for barley grown in the field or in pots, and for decortified barley fractions agreed with true digestibility values determined with rats. Of these samples...... digestibility depended on the type of enzyme and on the enzyme-to-substrate ratio....

  9. Functional Analysis of Barley Powdery Mildew Effector Candidates and Identification of their Barley Targets

    DEFF Research Database (Denmark)

    Ahmed, Ali Abdurehim

    The genome of barley powdery mildew fungus (Blumeria graminis f. sp. hordei, Bgh) encodes around 500 Candidate Secreted Effector Proteins (CSEPs), which are believed to be delivered to the barley cells either to interfere with plant defence and/or promote nutrient uptake. So far, little is known...... about the function of many CSEPs in virulence and the identities of their host targets. In this PhD study, we investigated the function of nine CSEPs and found that CSEP0081, CSEP0105, CSEP0162 and CSEP0254 act as effectors by promoting the Bgh infection success. Independent silencing of these CSEPs...... proteins (sHsps), Hsp16.9 and Hsp17.5, were identified as interactors for both CSEP0105 and CSEP0162. These interactions were confirmed in planta by BiFC and co-localization studies. Small heat shock proteins are highly conserved ATP-independent chaperones that protect the cell from stress-induced protein...

  10. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity. (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C


    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Effect of phytase supplementation to barley-canola meal and barley-soybean meal diets on phosphorus and calcium balance in growing pigs

    NARCIS (Netherlands)

    Sauer, W.C.; Cervantes, M.; He, J.M.M.; Schulze, H.


    Two metabolism experiments were carried out, to determine the effect of microbial phytase addition to barley-canola meal and barley-soybean meal diets on P and Ca balance in growing. pigs; In experiment 1, six barrows (29.6kg: initial LW) were fed a barley-canola meal diet, without or. with phytase

  12. Induced mutations for disease resistance in wheat and barley

    International Nuclear Information System (INIS)

    Hanis, M.; Hanisova, A.; Knytl, V.; Cerny, J.; Benc, S.


    The induction of mutations in cultivars of wheat (Triticum aestivum), barley (Hordeum vulgare), and field beans (Phaseolus vulgaris) has been part of the breeding programme at the Plant Breeding Station at Stupice since 1960. A total of 26 cultivars or selections of winter wheat, 4 cultivars or selections of spring wheat, 2 cultivars of field beans, and 43 selections of spring barley have been treated since 1960. A total of 140 mutant lines of wheat and 37 mutant lines of barley with improved disease resistance of a race-specific type have been obtained. Several mutation programme derived cultivars have been registered in Czechoslovakia (''Diamant'', ''Ametyst'', ''Favorit'', ''Hana'', ''Rapid'', and ''Atlas'' in barley, and ''Alfa'' in field beans), but none of them is a mutation for disease resistance. A series of mutants have been used in crossing programmes. Approaches to improve the efficiency of mutation breeding for disease resistance are suggested. (author)

  13. Barley starch bioengineering for high phosphate and amylose

    DEFF Research Database (Denmark)

    Blennow, Per Gunnar Andreas; Carciofi, Massimiliano; Shaik, Shahnoor Sultana


    Starch is a biological polymer that can be industrially produced in massive amounts in a very pure form. Cereals is the main source for starch production and any improvement of the starch fraction can have a tremendous impact in food and feed applications. Barley ranks number four among cereal...... crops and barley is a genetically very well characterized. Aiming at producing new starch qualities in the cereal system, we used RNAi and overexpression strategies to produce pure amylose and high-phosphate starch, respectively, using the barley kernel as a polymer factory. By simultaneous silencing...... of the three genes encoding the starch-branching enzymes SBEI, SBEIIa, and SBEIIb using a triple RNAi chimeric hairpin construct we generated a virtually amylopectin-free barley. The grains of the transgenic lines were shrunken and had a yield of around 80% of the control line. The starch granules were...

  14. Application of proteomics to investigate barley-Fusarium graminearum interaction

    DEFF Research Database (Denmark)

    Yang, Fen

    in plants under low N and iv) proteomes of uninfected plants were similar under two N levels. Correlation of level of proteolysis induced by the fungus with measurement of Fusarium-damaged kernels, fungal biomass and mycotoxin levels indicated that FHB was more severe in barley with low N. In Chapter 3......, the molecular mechanisms of barley defense to Fusarium graminearum at the early infection stage were studied. Antibodies against barley β-amylases were shown to be the markers for infection at proteome level and for selection of the time for proteome analysis before extensive degradation caused by the fungus...... the disease. Due to the advantages of gel-based proteomics that differentially expressed proteins involved in the interaction can be directly detected by comparing protein profiles displayed on 2-D gels, it is used as a tool for studying the barley- Fusarium graminearum interaction form three different...

  15. Effects of irradiated barley on fattening quail (Coturnix coturnix japonica)

    International Nuclear Information System (INIS)

    Dahlhelm, H.


    For the feeding experiments reported, barley grains irradiated at doses of 2, 10, and 100 kGy were used as a diet. The results obtained revealed no significant effects in the parameters analysed. (orig./CB) [de

  16. Search for antisense copies of beta-globin mRNA in anemic mouse spleen

    Directory of Open Access Journals (Sweden)

    Taylor John M


    Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

  17. Comparative transcriptome profiling of two Tibetan wild barley genotypes in responses to low potassium.

    Directory of Open Access Journals (Sweden)

    Jianbin Zeng

    Full Text Available Potassium (K deficiency is one of the major factors affecting crop growth and productivity. Development of low-K tolerant crops is an effective approach to solve the nutritional deficiency in agricultural production. Tibetan annual wild barley is rich in genetic diversity and can grow normally under poor soils, including low-K supply. However, the molecular mechanism about low K tolerance is still poorly understood. In this study, Illumina RNA-Sequencing was performed using two Tibetan wild barley genotypes differing in low K tolerance (XZ153, tolerant and XZ141, sensitive, to determine the genotypic difference in transcriptome profiling. We identified a total of 692 differentially expressed genes (DEGs in two genotypes at 6 h and 48 h after low-K treatment, including transcription factors, transporters and kinases, oxidative stress and hormone signaling related genes. Meanwhile, 294 low-K tolerant associated DEGs were assigned to transporter and antioxidant activities, stimulus response, and other gene ontology (GO, which were mainly involved in starch and sucrose metabolism, lipid metabolism and ethylene biosynthesis. Finally, a hypothetical model of low-K tolerance mechanism in XZ153 was presented. It may be concluded that wild barley accession XZ153 has a higher capability of K absorption and use efficiency than XZ141 under low K stress. A rapid response to low K stress in XZ153 is attributed to its more K uptake and accumulation in plants, resulting in higher low K tolerance. The ethylene response pathway may account for the genotypic difference in low-K tolerance.

  18. Serine:glyoxylate aminotransferase mutant of barley

    International Nuclear Information System (INIS)

    Blackwell, R.; Murray, A.; Joy, K.; Lea, P.


    A photorespiratory mutant of barley (LaPr 85/84), deficient in both of the major peaks of serine:glyoxylate aminotransferase activity detected in the wild type, also lacks serine:pyruvate and asparagine:glyoxylate aminotransferase activities. Genetic analysis of the mutation demonstrated that these three activities are all carried on the same enzyme. The mutant, when placed in air, accumulated a large pool of serine, showed the expected rate (50%) of ammonia release during photorespiration but produced CO 2 at twice the wild type rate when it was fed [ 14 C] glyoxylate. Compared with the wild type, LaPr 85/84 exhibited abnormal transient changes in chlorophyll a fluorescence when the CO 2 concentration of the air was altered, indicating that the rates of the fluorescence quenching mechanisms were affected in vivo by the lack of this enzyme

  19. The spontaneous chlorophyll mutation frequency in barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms; Jensen, Hans Peter


    A total of 1866 barley plants were progeny tested in the greenhouse. Twenty-five plants segregated for newly arisen, spontaneous chlorophyll mutant genes. Among the total of 470,129 seedlings screened there were 79 mutants (1.7 .+-. 0.6 .times. 10-4). The data are added to data from three similar...... materials and the resulting estimate of the chlorophyll mutant frequency is 1.6 .times. 10-4 in about 1.43 million seedlings. The estimate of the chlorophyll mutation rate per generation is close to 67.3 .times. 10-4 per diploid genome or in the order of 6 .times. 10-7 per locus and haploid genome....

  20. The Localization of Eceriferum Loci in Barley

    DEFF Research Database (Denmark)

    Søgaard, Bodil


    Three different 3-point tests have been made for gene distances on chromosome 1 in barley (Hordeum vulgare L.). In all cases eceriferum, cer-f9, and albina, ac2, were examined with erectoides as the third gene. The erectoides, ert, genes are ert-a23, ert-d33 and ert-m40, respectively. The analyses...... have been carried through to F3. The experiments demonstrated the following sequence of the five genes: cer-f9 — ac2 — ert-d33 — ert-a23 — ert-m40 and the following distances: cer-f9 — ac2 = 2.3 %, ac2 — ert-a23 = 8.5 %, ac2 — ert-d33 = 2.5 % and ac2 — ert-m40 = 12.8 %. The cer-f9 — ac2 distance, which...

  1. Cisgenic barley with improved phytase activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik


    phytase gene (HvPAPhy_a) expressed during grain filling to evaluate the cisgenesis concept in barley. The marker gene elimination method was used to obtain marker-free plant lines. Here, the gene of interest and the selection gene are flanked by their own T-DNA borders to allow unlinked integration...... of the two genes. We analysed the transformants for co-transformation efficiency, increased phytase activities in the grain, integration of the kanamycin resistance gene of the vector-backbone and segregation between the HvPAPhy_a insert and the hygromycin resistance gene. The frequencies of the four......PAPhy_a insert for further analysis. Seeds from plants homozygous for the insert showed 2.6- and 2.8-fold increases in phytase activities and the activity levels were stable over the three generations analysed. In one of the selected lines, the flanking sequences from both the left and right T-DNA borders were...

  2. Cisgenic Barley with Improved Phytase Activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik


    barley lambda library has been used to isolate the genomic clone of this phytase including 2.3 kb of the promoter region and 600 bp of the terminator region. The clone has been inserted into a cisgenic Agrobacterium vector where both the gene of interest and the selection gene are flanked by their own T......-DNA borders in order to promote integration of the two genes at unlinked places in the plant genome. Transformed T0 plants show increases in the phytase activity of mature seeds from 1,400 in wild type to 8,950 FTU/kg in T0 plants. T1 plants of each transformant are currently screened with PCR for extra...... copies of the genomic phytase gene and the selection gene to identify segregation between the two genes. Presently, we have identified two cisgenic T1 plants without vector backbone and selection gene but with an extra copy of the genomic phytase gene....

  3. Cisgenic barley with improved phytase activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik


    barley lambda library has been used to isolate the genomic clone of this phytase including 2.3 kb of the promoter region and 600 bp of the terminator region. The clone has been inserted into a cisgenic Agrobacterium vector where both the gene of interest and the selection gene are flanked by their own T......-DNA borders in order to promote integration of the two genes at unlinked places in the plant genome. Transformed T0 plants show increases in the phytase activity of mature seeds from 1,400 in wild type to 8,950 FTU/kg in T0 plants. T1 plants of each transformant are currently screened with PCR for extra...... copies of the genomic phytase gene and the selection gene to identify segregation between the two genes. Presently, we have identified two cisgenic T1 plants without vector backbone and selection gene but with an extra copy of the genomic phytase gene....

  4. Conserved Transcriptional Regulatory Programs Underlying Rice and Barley Germination (United States)

    Lin, Li; Tian, Shulan; Kaeppler, Shawn; Liu, Zongrang; An, Yong-Qiang (Charles)


    Germination is a biological process important to plant development and agricultural production. Barley and rice diverged 50 million years ago, but share a similar germination process. To gain insight into the conservation of their underlying gene regulatory programs, we compared transcriptomes of barley and rice at start, middle and end points of germination, and revealed that germination regulated barley and rice genes (BRs) diverged significantly in expression patterns and/or protein sequences. However, BRs with higher protein sequence similarity tended to have more conserved expression patterns. We identified and characterized 316 sets of conserved barley and rice genes (cBRs) with high similarity in both protein sequences and expression patterns, and provided a comprehensive depiction of the transcriptional regulatory program conserved in barley and rice germination at gene, pathway and systems levels. The cBRs encoded proteins involved in a variety of biological pathways and had a wide range of expression patterns. The cBRs encoding key regulatory components in signaling pathways often had diverse expression patterns. Early germination up-regulation of cell wall metabolic pathway and peroxidases, and late germination up-regulation of chromatin structure and remodeling pathways were conserved in both barley and rice. Protein sequence and expression pattern of a gene change quickly if it is not subjected to a functional constraint. Preserving germination-regulated expression patterns and protein sequences of those cBRs for 50 million years strongly suggests that the cBRs are functionally significant and equivalent in germination, and contribute to the ancient characteristics of germination preserved in barley and rice. The functional significance and equivalence of the cBR genes predicted here can serve as a foundation to further characterize their biological functions and facilitate bridging rice and barley germination research with greater confidence. PMID

  5. Application of proteomics to investigate barley-Fusarium graminearum interaction


    Yang, Fen; Finnie, Christine; Jacobsen, Susanne


    Due to the great loss of barley grain yield and quality in addition to mycotoxins contamination caused by Fusarium head blight (FHB), it is essential to understand the molecular interaction between barley and Fusarium graminearum, one of the primary Fusarium species causing FHB, in order to control the disease. Due to the advantages of gel-based proteomics that differentially expressed proteins involved in the interaction can be directly detected by comparing protein profiles displayed on 2-D...

  6. MicroRNA delivery for regenerative medicine. (United States)

    Peng, Bo; Chen, Yongming; Leong, Kam W


    MicroRNA (miRNA) directs post-transcriptional regulation of a network of genes by targeting mRNA. Although relatively recent in development, many miRNAs direct differentiation of various stem cells including induced pluripotent stem cells (iPSCs), a major player in regenerative medicine. An effective and safe delivery of miRNA holds the key to translating miRNA technologies. Both viral and nonviral delivery systems have seen success in miRNA delivery, and each approach possesses advantages and disadvantages. A number of studies have demonstrated success in augmenting osteogenesis, improving cardiogenesis, and reducing fibrosis among many other tissue engineering applications. A scaffold-based approach with the possibility of local and sustained delivery of miRNA is particularly attractive since the physical cues provided by the scaffold may synergize with the biochemical cues induced by miRNA therapy. Herein, we first briefly cover the application of miRNA to direct stem cell fate via replacement and inhibition therapies, followed by the discussion of the promising viral and nonviral delivery systems. Next we present the unique advantages of a scaffold-based delivery in achieving lineage-specific differentiation and tissue development. Copyright © 2015 Elsevier B.V. All rights reserved.


    Directory of Open Access Journals (Sweden)

    Manoj Kumar a,b


    Full Text Available The barley proteome was investigated upon fungal infection and subsequent treatment by tricyclazole (TCZ, which is known to have applications in spot blotch disease management in barley.Significantly enhanced chlorophyll content was recorded in TCZ treated plants. The disease severity was significantly reduced after TCZ application in pathogen inoculated plants by reducing the appressoria formation at infection site in barley leaves. Two-dimensional gel electrophoresis (2-DE revealed the expression profile of proteins from (I control plants (healthy barley leaves; application with sterile water,(II plants after foliar application of TCZ (100 µg/ml, (III plants inoculated with B. sorokiniana and (IV plants treated with TCZ (72 h after B. sorokiniana inoculation. A set of 33 proteins expressed differentially after TCZ treatment. Out of this 19 had known functions, while others were unknown or hypothetical proteins. These differentially expressed proteins were related to redox-activity and gene expression, electron transfer,cell division and chromosome partitioning, cell envelop biogenesis, energy metabolism and conversion, respiration and pathogenesis related functions in the barley plants. The study provides a platform and documents the proteins that might be involved in disease management in barley following TCZ application. It is expected that the study will provide boost in understanding proteome regulation upon fungal infection and subsequent anti-fungal treatment and will attract researchers for further validation leading to better pest management.

  8. High-throughput Agrobacterium-mediated barley transformation

    Directory of Open Access Journals (Sweden)

    Snape John W


    Full Text Available Abstract Background Plant transformation is an invaluable tool for basic plant research, as well as a useful technique for the direct improvement of commercial crops. Barley (Hordeum vulgare is the fourth most abundant cereal crop in the world. It also provides a useful model for the study of wheat, which has a larger and more complex genome. Most existing barley transformation methodologies are either complex or have low ( Results A robust, simple and reproducible barley transformation protocol has been developed that yields average transformation efficiencies of 25%. This protocol is based on the infection of immature barley embryos with Agrobacterium strain AGL1, carrying vectors from the pBract series that contain the hpt gene (conferring hygromycin resistance as a selectable marker. Results of large scale experiments utilising the luc (firefly luciferase gene as a reporter are described. The method presented here has been used to produce hundreds of independent, transgenic plant lines and we show that a large proportion of these lines contain single copies of the luc gene. Conclusion This protocol demonstrates significant improvements in both efficiency and ease of use over existing barley transformation methods. This opens up opportunities for the development of functional genomics resources in barley.

  9. Barley HvPAPhy_a as transgene provides high and stable phytase activities in mature barley straw and in grains

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Madsen, Claus Krogh


    The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains......, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T2-generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase...... activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature...

  10. Nematode assemblages in the rhizosphere of spring barley (Hordeum vulgare L.) depended on fertilisation and plant growth phase

    DEFF Research Database (Denmark)

    Madsen, Mette Vestergård


    rhizosphere; nitrogen and phosphorus fertilisation; nematode assemblages; plant parasites; barley......rhizosphere; nitrogen and phosphorus fertilisation; nematode assemblages; plant parasites; barley...

  11. Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions.

    Directory of Open Access Journals (Sweden)

    Jannatul Ferdous

    Full Text Available For accurate and reliable gene expression analysis using quantitative real-time reverse transcription PCR (qPCR, the selection of appropriate reference genes as an internal control for normalization is crucial. We hypothesized that non-coding, small nucleolar RNAs (snoRNAswould be stably expressed in different barley varieties and under different experimental treatments,in different tissues and at different developmental stages of plant growth and therefore might prove to be suitable reference genes for expression analysis of both microRNAs (miRNAsand mRNAs. In this study, we examined the expression stability of ten candidate reference genes in six barley genotypes under five experimental stresses, drought, fungal infection,boron toxicity, nutrient deficiency and salinity. We compared four commonly used housekeeping genes; Actin (ACT, alpha-Tubulin (α-TUB, Glycolytic glyceraldehyde-3-phosphate dehydrogenase(GAPDH, ADP-ribosylation factor 1-like protein (ADP, four snoRNAs; (U18,U61, snoR14 and snoR23 and two microRNAs (miR168, miR159 as candidate reference genes. We found that ADP, snoR14 and snoR23 were ranked as the best of these candidates across diverse samples. Additionally, we found that miR168 was a suitable reference gene for expression analysis in barley. Finally, we validated the performance of our stable and unstable candidate reference genes for both mRNA and miRNA qPCR data normalization under different stress conditions and demonstrated the superiority of the stable candidates. Our data demonstrate the suitability of barley snoRNAs and miRNAs as potential reference genes form iRNA and mRNA qPCR data normalization under different stress treatments [corrected].

  12. HvPap-1 C1A Protease Participates Differentially in the Barley Response to a Pathogen and an Herbivore

    Directory of Open Access Journals (Sweden)

    Mercedes Diaz-Mendoza


    Full Text Available Co-evolutionary processes in plant–pathogen/herbivore systems indicate that protease inhibitors have a particular value in biotic interactions. However, little is known about the defensive role of their targets, the plant proteases. C1A cysteine proteases are the most abundant enzymes responsible for the proteolytic activity during different processes like germination, development and senescence in plants. To identify and characterize C1A cysteine proteases of barley with a potential role in defense, mRNA and protein expression patterns were analyzed in response to biotics stresses. A barley cysteine protease, HvPap-1, previously related to abiotic stresses and grain germination, was particularly induced by flagellin or chitosan elicitation, and biotic stresses such as the phytopathogenic fungus Magnaporthe oryzae or the phytophagous mite Tetranychus urticae. To elucidate the in vivo participation of this enzyme in defense, transformed barley plants overexpressing or silencing HvPap-1 encoding gene were subjected to M. oryzae infection or T. urticae infestation. Whereas overexpressing plants were less susceptible to the fungus than silencing plants, the opposite behavior occurred to the mite. This unexpected result highlights the complexity of the regulatory events leading to the response to a particular biotic stress.

  13. Inheritance of resistance to barley yellow dwarf virus detected by northern blot analysis

    International Nuclear Information System (INIS)

    Lorens, G.F.; Falk, B.W.; Qualset, C.O.


    Development of wheat (Triticum aestivum L.) cultivars tolerant to the barley yellow dwarf virus disease (BYD) has been limited by lack of precision in rating plants for response to infection, usually done by visual scoring of plant symptoms under field conditions. Other methodologies have been developed to study the host/pathogen relationship and to assess resistance or susceptibility. In this study northern dot blot analysis was used to determine barley yellow dwarf virus (BYDV) RNA concentrations of six wheat cultivars that differed in visual BYD symptom expression. Plants were infected with the NYPAV (PAV) isolate of BYDV in the greenhouse. At several dates after inoculation crude plant extracts were blotted on nitrocellulose and hybridized with a 32 P-labeled probe of the pPA8 cDNA clone of BYDV. The distribution of PRC for the F 2 population was compared to the distribution of BYD visual symptom scores for 403 F 2 plants of a similar F 2 population of NS 879/4 x Seri 82 under field conditions. The results were qualitatively similar, suggesting that northern dot blot analysis to measure PRC may be useful in understanding the genetics of resistance to BYD. This technique, when incorporated into breeding programs, could be important in the development of highly tolerant wheat cultivars with reduced losses to BYD

  14. Effect of partially replacing a barley-based concentrate with flaxseed-based products on the rumen bacterial population of lactating Holstein dairy cows. (United States)

    Castillo-Lopez, E; Moats, J; Aluthge, N D; Ramirez Ramirez, H A; Christensen, D A; Mutsvangwa, T; Penner, G B; Fernando, S C


    The effects of partial replacement of a barley-based concentrate with flaxseed-based products on the rumen bacterial population of lactating Holstein dairy cows were evaluated. Treatments fed were CONT, a normal diet that included barley silage, alfalfa hay and a barley-based concentrate that contained no flaxseed or faba beans; FLAX, inclusion of a nonextruded flaxseed-based product containing 55·0% flaxseed, 37·8% field peas and 6·9% alfalfa; EXT, similar to FLAX, but the product was extruded and EXTT, similar to FLAX, but product was extruded and field peas were replaced by high-tannin faba beans. The rumen bacterial population was evaluated by utilizing 16S rRNA gene sequencing. Most abundant phyla, families and genera were unaffected. However, some taxa were affected; for example, unsaturated fatty acid content was negatively correlated with Clostridiaceae, and tannin content was negatively correlated with BS11 and Paraprevotellaceae. Predominant rumen bacterial taxa were not affected, but the abundance of some taxa found in lower proportions shifted, possibly due to sensitivity to unsaturated fatty acids or tannins. Flaxseed-based products were effective for partially replacing barley-based concentrate in rations of lactating dairy cows. No negative effects of these products were observed on the abundance of predominant rumen bacterial taxa, with only minor shifts in less abundant bacteria. © 2017 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.

  15. The miR9863 family regulates distinct Mla alleles in barley to attenuate NLR receptor-triggered disease resistance and cell-death signaling.

    Directory of Open Access Journals (Sweden)

    Jie Liu


    Full Text Available Barley (Hordeum vulgare L. Mla alleles encode coiled-coil (CC, nucleotide binding, leucine-rich repeat (NB-LRR receptors that trigger isolate-specific immune responses against the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh. How Mla or NB-LRR genes in grass species are regulated at post-transcriptional level is not clear. The microRNA family, miR9863, comprises four members that differentially regulate distinct Mla alleles in barley. We show that miR9863 members guide the cleavage of Mla1 transcripts in barley, and block or reduce the accumulation of MLA1 protein in the heterologous Nicotiana benthamiana expression system. Regulation specificity is determined by variation in a unique single-nucleotide-polymorphism (SNP in mature miR9863 family members and two SNPs in the Mla miR9863-binding site that separates these alleles into three groups. Further, we demonstrate that 22-nt miR9863s trigger the biogenesis of 21-nt phased siRNAs (phasiRNAs and together these sRNAs form a feed-forward regulation network for repressing the expression of group I Mla alleles. Overexpression of miR9863 members specifically attenuates MLA1, but not MLA10-triggered disease resistance and cell-death signaling. We propose a key role of the miR9863 family in dampening immune response signaling triggered by a group of MLA immune receptors in barley.

  16. Towards systems genetic analyses in barley: Integration of phenotypic, expression and genotype data into GeneNetwork

    Directory of Open Access Journals (Sweden)

    Druka Arnis


    Full Text Available Abstract Background A typical genetical genomics experiment results in four separate data sets; genotype, gene expression, higher-order phenotypic data and metadata that describe the protocols, processing and the array platform. Used in concert, these data sets provide the opportunity to perform genetic analysis at a systems level. Their predictive power is largely determined by the gene expression dataset where tens of millions of data points can be generated using currently available mRNA profiling technologies. Such large, multidimensional data sets often have value beyond that extracted during their initial analysis and interpretation, particularly if conducted on widely distributed reference genetic materials. Besides quality and scale, access to the data is of primary importance as accessibility potentially allows the extraction of considerable added value from the same primary dataset by the wider research community. Although the number of genetical genomics experiments in different plant species is rapidly increasing, none to date has been presented in a form that allows quick and efficient on-line testing for possible associations between genes, loci and traits of interest by an entire research community. Description Using a reference population of 150 recombinant doubled haploid barley lines we generated novel phenotypic, mRNA abundance and SNP-based genotyping data sets, added them to a considerable volume of legacy trait data and entered them into the GeneNetwork GeneNetwork is a unified on-line analytical environment that enables the user to test genetic hypotheses about how component traits, such as mRNA abundance, may interact to condition more complex biological phenotypes (higher-order traits. Here we describe these barley data sets and demonstrate some of the functionalities GeneNetwork provides as an easily accessible and integrated analytical environment for exploring them. Conclusion By

  17. Molecular characterization of barley 3H semi-dwarf genes.

    Directory of Open Access Journals (Sweden)

    Haobing Li

    Full Text Available The barley chromosome 3H accommodates many semi-dwarfing genes. To characterize these genes, the two-rowed semi-dwarf Chinese barley landrace 'TX9425' was crossed with the Australian barley variety 'Franklin' to generate a doubled haploid (DH population, and major QTLs controlling plant height have been identified in our previous study. The major QTL derived from 'TX9425' was targeted to investigate the allelism of the semi-dwarf gene uzu in barley. Twelve sets of near-isogenic lines and a large NILF2 fine mapping population segregating only for the dwarfing gene from 'TX9425' were developed. The semi-dwarfing gene in 'TX9425' was located within a 2.8 cM region close to the centromere on chromosome 3H by fine mapping. Molecular cloning and sequence analyses showed that the 'TX9425'-derived allele contained a single nucleotide substitution from A to G at position 2612 of the HvBRI1 gene. This was apparently the same mutation as that reported in six-rowed uzu barley. Markers co-segregating with the QTL were developed from the sequence of the HvBRI1 gene and were validated in the 'TX9425'/'Franklin' DH population. The other major dwarfing QTL derived from the Franklin variety was distally located on chromosome 3HL and co-segregated with the sdw1 diagnostic marker hv20ox2. A third dwarfing gene, expressed only in winter-sown trials, was identified and located on chromosome 3HS. The effects and interactions of these dwarfing genes under different growing conditions are discussed. These results improve our understanding of the genetic mechanisms controlling semi-dwarf stature in barley and provide diagnostic markers for the selection of semi-dwarfness in barley breeding programs.

  18. Fungal Distribution and Varieties Resistance to Kernel Discoloration in Korean Two-rowed Barley


    Sang-Hyun Shin; Eun-Jo Seo; Jae-Seong Choi; JungKwan Lee; Jong-Chul Park; Chun-Sik Kang


    Barley kernel discoloration (KD) leads to substantial loss in value through downgrading and discounting of malting barley. The objective of this research is to investigate fungal distribution and varieties resistance to KD in Korean two-rowed barley. Several fungal organisms including Alternaria spp., Fusarium spp., Aspergillus spp., Epicoccum spp. and Rhizopus spp. were isolated from Korean two-rowed barley representing KD. The symptoms of KD were brown and black discolorations o...

  19. Heat Stress Affects Pi-related Genes Expression and Inorganic Phosphate Deposition/Accumulation in Barley

    DEFF Research Database (Denmark)

    Pacak, Andrzej; Barciszewska-Pacak, Maria; Swida-Barteczka, Aleksandra


    Phosphorus (P) in plants is taken from soil as an inorganic phosphate (Pi) and is one of the most important macroelements in growth and development. Plants actively react to Pi starvation by the induced expression of Pi transporters, MIR399, MIR827, and miR399 molecular sponge - IPS1 genes...... and by the decreased expression of the ubiquitin-conjugating enzyme E2 (PHOSPHATE2 - PHO2) and Pi sensing and transport SPX-MFS genes. The PHO2 protein is involved in the degradation of Pi transporters PHT1;1 (from soil to roots) and PHO1 (from roots to shoots). The decreased expression of PHO2 leads to Pi....... In shoots, the PHO2 mRNA level is decreased, leading to an increased Pi level. We concluded that Pi homeostasis in barley during heat stress is maintained by dynamic changes in Pi-related genes expression....

  20. Fusarium infection and trichothecenes in barley and its comparison with wheat

    NARCIS (Netherlands)

    Janssen, Esmee; Liu, C.; Fels, van der H.J.


    Barley is a small-grain cereal that can be infected by Fusarium spp. resulting in reduced quality and safety of harvested barley (products). Barley and other small-grain cereals are commonly studied together for Fusarium infection and related mycotoxin contamination, since the infection and its

  1. Interaction between powdery mildew and barley with ¤mlo5¤ mildew resistance

    DEFF Research Database (Denmark)

    Lyngkjær, M.F.; Østergård, Hanne


    Powdery mildew infection of barley with the mlo5 barley powdery mildew resistance gene was examined, using near-isogenic barley lines, with and without mlo5 resistance, and two near-isogenic powdery mildew isolates, HL3/5 and GE3 with high (virulent) or low (avirulent) penetration efficiency...

  2. Transgressive segregation for very low and high levels of basal resistance to powdery mildew in barley

    NARCIS (Netherlands)

    Aghnoum, R.; Niks, R.E.


    Basal resistance of barley to powdery mildew is a quantitatively inherited trait that limits the growth and sporulation of barley powdery mildew pathogen by a non-hypersensitive mechanism of defense. Two experimental barley lines were developed with a very high (ErBgh) and low (EsBgh) level of basal

  3. Long-term reconstitution of dry barley increased phosphorus digestibility in pigs

    DEFF Research Database (Denmark)

    Ton Nu, Mai Anh; Blaabjerg, Karoline; Poulsen, Hanne Damgaard

    of reconstitution compared to dry stored barley on phosphorus (P) digestibility in pigs. Materials and Methods: Dry barley (13% moisture; phytate P, 1.7 g/kg DM) was rolled and stored directly or reconstituted with water to produce rolled barley with 35% moisture that was stored in air-tight conditions. After 49...

  4. Effects of Net Blotch ( Pyrenophora teres ) on Malt Barley Yield and ...

    African Journals Online (AJOL)

    Barley (Hordeum vulgare L.) production is constrained by diseases such as net blotch caused by Pyrenophora teres Drechsl. The objectives of this study were to assess the effects of net blotch disease on malt barley yield and grain quality under natural infection. Four malt barley varieties (Beka, HB 120, HB 52 and Holker), ...

  5. Detection of Ustilago nuda (Jensen Rostrup in winter barley seed

    Directory of Open Access Journals (Sweden)

    Ignjatov Maja


    Full Text Available Barley is one of the most important cereals grown in our agroecological conditions. The causal agent of loose smut on barley Ustilago nuda (Jensen Rostrup occurs frequently as varieties susceptible to this pathogen are present in the production. Disease symptoms are manifested on barley head (spike. Parasite is transmitted by seed (seedborne and stays in the embryo tissue of the infected kernel as dormant mycelium. Recommended method for detection of U. nuda is given by ISTA Rules (method 7-013. In tests, nine samples (weighing 120 g each of naturally infected barley seed (about 1000 seeds, depending on the absolute mass of seed were examined, observed and described using a Zeiss microscope with sub stage illumination with magnification range x 40 or higher. Mycelium of the fungus approximately 3 μ thick, golden brown in colour was detected and visible without a stain. The percentage of infected embryos in the examined samples of barley seeds ranged from 0.8% to 5.2%.

  6. Aggressiveness of powdery mildew on 'ml-o'- resistant barley

    International Nuclear Information System (INIS)

    Andersen, Lars


    The ml-o genes in barley are important sources in breeding for resistance against the barley powdery mildew fungus (Erysiphe graminis). The resistance mechanism is a rapid formation of a large callose containing cell wall apposition at the site of the pathogen's infection attempt. This reduces the chances of infection to almost nil in all epidermal cells, except in the small subsidiary cells, in which appositions are rarely formed. Small mildew colonies from infections in subsidiary cells may be seen on the otherwise resistant leaf. This is described by the infection type 0/(4). Mildew isolate HL 3 selected by SCHWARZBACH has increased aggressiveness. No ml-o-virulent isolates are known. However, ml-o-resistant varieties when grown extensively in Europe, will introduce field selection for mildew pathotypes with aggressiveness or virulence to ml-o resistance. Studies on increased aggressiveness require new methods. The material comprises two powdery mildew isolates: GE 3 without ml-o aggressiveness and the aggressive HL 3/5; and two near-isogenic barley lines in Carlsberg II: Riso 5678(R) with the recessive mutant resistance gene ml-o5 and Riso 5678(S) with the wild-type gene for susceptibility. Latent period and disease efficiency show no significant differences between the two isolates on the susceptible barley line (S) but the isolates differ from each other on the resistant barley line

  7. Simultaneous Detection of Barley Virus Diseases in Korea

    Directory of Open Access Journals (Sweden)

    Bong-Choon Lee


    Full Text Available Barley mild mosaic virus (BaMMV, Barley yellow mosaic virus (BaYMV and Barley yellow dwarf virus (BYDV have been identified as an important causative agents for an economically important disease of winter barley in Korea. In this study, a multiplex reverse transcription polymerase chain reaction (mRT-PCR method was used for the simultaneous detection. Three sets of virus-specific primers targeted to the capsid protein coding genes of BaMMV, BaYMV and BYDV were used to amplify fragments that were 594 bp, 461 bp, and 290 bp, respectively. Several sets of primers for each target virus were evaluated for their sensitivity and specificity by multiplex RT-PCR. The optimum primer concentrations and RT-PCR conditions were determined for the multiplex RT-PCR. The mRT-PCR assay was found to be a better and rapid virus diagnostic tool of specific barley diseases and potential for investigating the epidemiology of these viral diseases.

  8. The project of mutation breeding in barley (first report)

    International Nuclear Information System (INIS)


    Barley is a second main crop with the production of 7 million tons per year and 3,5 million hectare cultivation area in Turkey. Because of wateer deficiency, cereals cultivated in Central Anatolian region. Barley is well adapted to dry farming system besides it is basic food for animal husbandry and main raw material for brewery industry. the main problems in barley production are drought disease epidemic and increasing salinity gradually. Main purposes of our project is to increase resistance and tolerence to this stress factors. In order to reach to our aim we have been using mutation breeding techniques and conventional breeding methods. This Project has been started with irradiation of barley seeds with different gamma ray doses. After that resistant and tolerant mutant has been selected most of these mutanys have resistance and tolerance to different disease and stress conditions. During the selection procedure, hydroponics and tissue culture techniques have been applied to improve the selection efficiency. Up to now, promising barley mutant lines 71 that have earliness (30 days) than parents and because of that reason that escape from drought period. Disease tests of our mutant lines have been conducted under controlled conditions and tolerant lines have been determined under the high the high epidemic conditions. Salt tolerance studies have been applied under hydroponics conditions and salt tolerant mutant have been determined under 180-200mMolNaCl concentration. All mutant lines are carried out to preliminary yield trials for their evaluation

  9. Identification of a Phytase Gene in Barley (Hordeum vulgare L.) (United States)

    Dai, Fei; Qiu, Long; Ye, Lingzhen; Wu, Dezhi; Zhou, Meixue; Zhang, Guoping


    Background Endogenous phytase plays a crucial role in phytate degradation and is thus closely related to nutrient efficiency in barley products. The understanding of genetic information of phytase in barley can provide a useful tool for breeding new barley varieties with high phytase activity. Methodology/Principal Findings Quantitative trait loci (QTL) analysis for phytase activity was conducted using a doubled haploid population. Phytase protein was purified and identified by the LC-ESI MS/MS Shotgun method. Purple acid phosphatase (PAP) gene was sequenced and the position was compared with the QTL controlling phytase activity. A major QTL for phytase activity was mapped to chromosome 5 H in barley. The gene controlling phytase activity in the region was named as mqPhy. The gene HvPAP a was mapped to the same position as mqPhy, supporting the colinearity between HvPAP a and mqPhy. Conclusions/Significance It is the first report on QTLs for phytase activity and the results showed that HvPAP a, which shares a same position with the QTL, is a major phytase gene in barley grains. PMID:21533044

  10. Identification of a phytase gene in barley (Hordeum vulgare L..

    Directory of Open Access Journals (Sweden)

    Fei Dai

    Full Text Available BACKGROUND: Endogenous phytase plays a crucial role in phytate degradation and is thus closely related to nutrient efficiency in barley products. The understanding of genetic information of phytase in barley can provide a useful tool for breeding new barley varieties with high phytase activity. METHODOLOGY/PRINCIPAL FINDINGS: Quantitative trait loci (QTL analysis for phytase activity was conducted using a doubled haploid population. Phytase protein was purified and identified by the LC-ESI MS/MS Shotgun method. Purple acid phosphatase (PAP gene was sequenced and the position was compared with the QTL controlling phytase activity. A major QTL for phytase activity was mapped to chromosome 5 H in barley. The gene controlling phytase activity in the region was named as mqPhy. The gene HvPAP a was mapped to the same position as mqPhy, supporting the colinearity between HvPAP a and mqPhy. CONCLUSIONS/SIGNIFICANCE: It is the first report on QTLs for phytase activity and the results showed that HvPAP a, which shares a same position with the QTL, is a major phytase gene in barley grains.

  11. The Genetic Architecture of Barley Plant Stature (United States)

    Alqudah, Ahmad M.; Koppolu, Ravi; Wolde, Gizaw M.; Graner, Andreas; Schnurbusch, Thorsten


    Plant stature in temperate cereals is predominantly controlled by tillering and plant height as complex agronomic traits, representing important determinants of grain yield. This study was designed to reveal the genetic basis of tillering at five developmental stages and plant height at harvest in 218 worldwide spring barley (Hordeum vulgare L.) accessions under greenhouse conditions. The accessions were structured based on row-type classes [two- vs. six-rowed] and photoperiod response [photoperiod-sensitive (Ppd-H1) vs. reduced photoperiod sensitivity (ppd-H1)]. Phenotypic analyses of both factors revealed profound between group effects on tiller development. To further verify the row-type effect on the studied traits, Six-rowed spike 1 (vrs1) mutants and their two-rowed progenitors were examined for tiller number per plant and plant height. Here, wild-type (Vrs1) plants were significantly taller and had more tillers than mutants suggesting a negative pleiotropic effect of this row-type locus on both traits. Our genome-wide association scans further revealed highly significant associations, thereby establishing a link between the genetic control of row-type, heading time, tillering, and plant height. We further show that associations for tillering and plant height are co-localized with chromosomal segments harboring known plant stature-related phytohormone and sugar-related genes. This work demonstrates the feasibility of the GWAS approach for identifying putative candidate genes for improving plant architecture. PMID:27446200

  12. Transglycosylation by barley α-amylase 1

    DEFF Research Database (Denmark)

    Mótyán, János A.; Fazekas, Erika; Mori, Haruhide


    The transglycosylation activity of barley α-amylase 1 (AMY1) and active site AMY1 subsite mutant enzymes was investigated. We report here the transferase ability of the V47A, V47F, V47D and S48Y single mutants and V47K/S48G and V47G/S48D double mutant AMY1 enzymes in which the replaced amino acids...... play important role in substrate binding at subsites at −3 through −5. Although mutation increases the transglycosylation activity of enzymes, in the presence of acceptors the difference between wild type and mutants is not so significant. Oligomer transfer reactions of AMY1 wild type and its mutants...... as donor. 4-Methylumbelliferyl-α-d-maltoside, -maltotrioside, -maltotetraoside and -maltopentaoside have been synthesized. Products were identified by MALDI-TOF MS. 1H and 13C NMR analyses showed that AMY1 V47F preserved the stereo- and regioselectivity. The produced MU-α-d-MOSs of degree of polymerization...

  13. 11C-methionine translocation in barley

    International Nuclear Information System (INIS)

    Nakanishi, Hiromi; Bughio, Naimatullah; Shigeta Ishioka, Noriko


    11 C-methionine was supplied to barley plants through a single leaf or via the roots and real time 11 C movement was monitored using a PETIS (positron emitting tracer imaging system). In Fe-deficient plants, 11 C-methionine was translocated from the tip of the absorbing leaf to the discrimination center' at the basal part of the shoot and then retranslocated to all the chlorotic leaves, while a negligible amount was retranslocated to the roots. In Fe-sufficient plants, methionine was translocated from the absorbing leaf to the discrimination center and then only to the newest leaf on the main shoot. A negligible amount was also retranslocated to the roots. Although, in Fe-sufficient plants, methionine translocation was observed from absorbing roots to shoots, in Fe-deficient plants, only a little amount was translocated from roots to shoots. In conclusion, methionine from the upper portion of a plant is not used as a precursor of mugineic acid under Fe-deficiency conditions. (author)

  14. Chemical weed control in barley (hordeum vulgare)

    International Nuclear Information System (INIS)

    Sarwar, M.; Hassan, S.W.; Abid, A.A.


    Effect of two different pre-emergence herbicides i.e. Terbutryn (lgron-500FW) A, 1.01.25 kg a.t. ha/sup -1/ and Flurochloridone (Racer-25 CS) a 0.31, 0.37, 0.44, 0.50 and 0.56 Kg a.i. ha/sup -1/ on weeds and yield of barley wad studied under field conditions hb/sup -1/. All the herbicides significantly reduce the dry weight of weed Maximum reduction (70%) was observed in terbutryn a 1.0 Kg a.i. ha/sup -1/ Growth and yield parameters like number of spike lets per spike. Number of grams per spike. 1000-grain weight. Biological yield. Grain yield straw yield and harvest index showed significant response to various herbicides doses under study. Application of Flurochloridone (Racer-25 (CS) a 0.44 kg a.i. ha/sup -1/ and Terbutryn (lgran-500 FW) a 1.0 kg a.i). The data further revealed that in general all herbicide application treatments exhibited superior performance in respect of growth and yield over control. (author)

  15. Yield and competition in barley variety mixtures

    Directory of Open Access Journals (Sweden)

    Kari Jokinen


    Full Text Available Competition between spring barley varieties and yield performance of two-, three and four-variety mixtures were studied in two replacement series field experiments. In the first experiment, repeated in three successive years (1983 —85 the components were the six-row varieties Agneta, Arra, Hja-673 and Porno. In the second experiment (1984, including two nitrogen doses (50 and 100 kgN/ha, both six-row (Agneta, Pomo and two-row (Ida, Kustaa varieties were used. Arra in the first and Agneta in the second experiment were the most competitive varieties. The results suggested that the fast growth of Arra at the beginning promoted its competitive ability. Increase in available nitrogen usually strengthened the competitiveness of Agneta. The observed competitive differences between varieties were not related to the earliness of a variety, neither to the morphological characters (two- and six-row varieties nor to the grain yield of a variety grown alone. The competitive ability was not always a stable character, the dominant suppression relationship varying from one environment to another (e.g. growing season, nitrogen dose. The observed overyielding was not statistically significant. The ratio of actual to expected yield and the relative yield total of several mixtures exceeded slightly one. As a conclusion, the yield advantage of mixtures was marginal. As a rule, the mixtures were not more stable than monocultures as determined by the coefficient of variation. However, the yield of some mixtures varied less than the yield of the most stable monoculture.

  16. Barley yellow dwarf virus in barley crops in Tunisia: prevalence and molecular characterization

    Directory of Open Access Journals (Sweden)

    Asma NAJAR


    Full Text Available A field survey was conducted in Tunisia in the North-Eastern regions (Bizerte, CapBon and Zaghouan, the North-Western region (Kef and the Central-Eastern region (Kairouan during the 2011/2012 growing season, in order to determine the incidence and the geographic distribution of Barley yellow dwarf virus (BYDVs in barley fields. Tissue blot immunoassays (TBIA showed that BYDV was most common in Zaghouan (incidence 14%, Cap Bon (14% and Bizerte (35%, in randomly collected samples from these three locations.Among the different BYDVs identified, BYDV-PAV (64% was the most common followed by BYDV-MAV (16% and CYDV-RPV (3%. The coat protein gene sequences of six isolates collected from different regions shared >98% pairwise similarity. In comparisons with other BYDV sequences from around the world, the Tunisian sequences shared greatest homology with isolates 109 and ASL1 from the United States of America and Germany (≈97%, and <90% with all other isolate sequences available in public databases.

  17. Improvement of quinoa and barley through induced mutations and biotechnology

    International Nuclear Information System (INIS)

    Siles, A.Z.; Miranda, L.S.


    The main cropping problems in the Bolivian highlands are the long growing period of barley, high degree of environmental influence on the performance of quinoa, and low soil moisture at sowing time, leading to low germination rate and poor stands, and frost or chilling damages. The program aimed to establish protocols for induction of mutations with X rays and chemical mutagens (NaN 3 , MNH, EMS) in quinoa, barley, native forage species and forest plants and to obtain mutant lines, especially in barley and quinoa; and to establish callus regeneration in quinoa and micropropagation of kenua (Polilepis). The project is still in its study stages, hence further evaluations are needed before firm conclusions are drawn. (author)

  18. Occurrence of barley leaf disease and control strategies in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Lise Nistrup; Ørum, Jens Erik; Heick, Thies Marten

    Barley (Hordeum vulgare) is one of the major crops in Denmark and of special importance for malting and for pig feed. In 2016, the crop was grown covering a total area of 700,000 ha; approximately 25% of arable area in Denmark. To ensure high yield of around 60 dt ha-1, disease-tolerant cultivars...... have proven to be quite effective against all leaf diseases, aside from brown rust and mildew. Denmark has a national record system for pesticide usages. All farmers upload their fungicide use by crop, creating a good basis for assessing the differences in use pattern across different regions...... and fungicide treatments are required. Each year, barley cultivars are assessed for susceptibility towards leaf diseases in national observation plots. The most predominant fungal leaf diseases in Denmark are barley scald (Rhynchosporium secalis), net blotch (Pyrenophora teres), brown rust (Puccinia hordei...

  19. Regeneration of the Barley Zygote in In Vitro Cultured Ovules

    DEFF Research Database (Denmark)

    Holme, Inger B; Brinch-Pedersen, Henrik; Lange, Mette


    In vitro cultures of zygotes and small embryos carry a lot of potential for studying plant embryogenesis and are also highly relevant for plant biotechnology. Several years ago we established an in vitro ovule culture technique for barley that allows the regeneration of plants from zygotes (Holm et...... culture ability in immature embryo culture i.e. Femina, Salome and Corniche. Barley spikes were emasculated and hand pollinated 3 days after emasculation. In barley, fertilization takes place one hour after pollination and ovules with fertilized egg cells could therefore be isolated one hour after...... pollination. Ovules were grown for 3 weeks on a culture medium where after embryos could be isolated and transferred to regeneration medium. An average of 1.2 green plantlets per ovule could be regenerated from 50 % of the isolated ovules. No genotypic differences were found on embryo induction...

  20. Nitrogen acquisition by pea and barley and the effect of their crop residues on available nitrogen for subsequent crops

    DEFF Research Database (Denmark)

    Jensen, E.S.


    Nitrogen acquisition by field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) grown on a sandy loam soil and availability of N in three subsequent sequences of a cropping system were studied in an outdoor pot experiment. The effect of crop residues on the N availability was evaluated....... The dry matter production and total N uptake of a spring barley crop following pea or barley, with a period of unplanted soil in the autumn/winter, were significantly higher after pea than after barley. The barley crop following pea and barley recovered 11% of the pea and 8% of the barley residue N...


    Directory of Open Access Journals (Sweden)



    Full Text Available This work is a review of author’s previous publications, unpublished results as well as available literature on barley responses to Cd contamination. The physiological backgrounds of the acute Cd toxicity in barley plants are briefly described. Some data characterizing the chronic Cd toxicity in barley have been also provided in relation to its possible use for seed production and Cd phytoextraction on Cd-contaminated agricultural soils. Information about the main physiological factors limiting growth of Cd-exposed barley plants and grain yield, seedling quality as well as Cd phytoextraction capacity of barley grown in Cd-contaminated soils is presented.

  2. Biotin Carboxyl Carrier Protein in Barley Chloroplast Membranes

    DEFF Research Database (Denmark)

    Kannangara, C. G.; Jense, C J


    Biotin localized in barley chloroplast lamellae is covalently bound to a single protein with an approximate molecular weight of 21000. It contains one mole of biotin per mole of protein and functions as a carboxyl carrier in the acetyl-CoA carboxylase reaction. The protein was obtained by solubil...... by solubilization of the lamellae in phenol/acetic acid/8 M urea. Feeding barley seedlings with [14C]-biotin revealed that the vitamin is not degraded into respiratory substrates by the plant, but is specifically incorporated into biotin carboxyl carrier protein....

  3. Analysis of Pregerminated Barley Using Hyperspectral Image Analysis

    DEFF Research Database (Denmark)

    Arngren, Morten; Hansen, Per Waaben; Eriksen, Birger


    imaging system in a mathematical modeling framework to identify pregerminated barley at an early stage of approximately 12 h of pregermination. Our model only assigns pregermination as the cause for a single kernel’s lack of germination and is unable to identify dormancy, kernel damage etc. The analysis...... is based on more than 750 Rosalina barley kernels being pregerminated at 8 different durations between 0 and 60 h based on the BRF method. Regerminating the kernels reveals a grouping of the pregerminated kernels into three categories: normal, delayed and limited germination. Our model employs a supervised...

  4. Effect of irradiation on the malting quality of barley

    International Nuclear Information System (INIS)

    Avtar, S.; Tejinder, S.; Bains, G.S.


    Two six-row barley cultivars, DL 70 and C164 were subjected to Co 60 gamma irradiation in the range of 0 to 250 Krad and malted with and without gibberellic acid treatment. Barley irradiated with doses up to 75 Krad produced normal malts when compared to the controls. Irradiation doses of 125 and 250 Krad significantly increased the malt yields but considerably decreased the α-amylase activity. Gibberellic acid significantly increased the enzyme activity and degree of modification of the irradiated and the control malts. (author)

  5. The experience of induction of mutation on barley in Peru

    International Nuclear Information System (INIS)

    Romero Loli, M.; Pozo Cardenas, M.; Gomez Pando, L.


    Work on induced mutation of barley was started in 1978 under the Programme of Cereal Improvement. Barley was irradiated with gamma radiation at doses of 12, 15, 18, 21, and 24 Krad. Radiation doses of 18 and 21 Krad gave the highest frequency of albino and cloroticos mutants. Induced mutation is being carried out in different parts of the country to develop mutants having early germination property. These mutants will play an important role in the late cultivation in the mountain areas of Peru

  6. RNA Crystallization (United States)

    Golden, Barbara L.; Kundrot, Craig E.


    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  7. Giemsa C-banding of Barley Chromosomes. IV. Chromosomal Constitution of Autotetraploid Barley

    DEFF Research Database (Denmark)

    Linde-Laursen, Ib


    The progeny of an autotetraploid barley plant (C1) consisted of 45 tetraploids and 33 aneuploids. Giemsa C-banding was used to identify each of the chromosomes in 20 euploid and 31 aneuploid C2--seedlings, and in 11 C3--offspring of aneuploid C2--plants. The euploid C2--seedlings all had four...... homologues of each of the chromosomes. The aneuploid C2--seedlings were fairly equally distributed on hypo-and hyperploids, and on the seven chromosome groups. This suggests that a particular chromosome is lost or gained at random in gametes and embryos. The 11 C3--seedlings comprised seven true euploids......, one seedling with 2n=28 having an extra chromosome 6 and missing one chromosome 3, and three seedlings with 2n=29. The chromosomal composition of aneuploid C3--seedlings did not reflect that of their aneuploid C2--parents with respect to missing or extra chromosomes. Two hypohexaploid C2--seedlings...

  8. Evaluation of Some Chemical Characteristics of barley Mutants induced by Gamma Irradiation

    International Nuclear Information System (INIS)

    Abdeldaiem, M.H.; Ali, H.G.M.


    This study aims to evaluate the antioxidant activity of acetonic extract from some barley mutations (P1, P2 and P3 varieties) induced by gamma irradiation as compared with local barley variety (Hordeum vulgare L.) as control. Barley samples were obtained from Plant Breeding Unit, Plant Research Department, Nuclear Research Centre, Atomic Energy Authority, Egypt. The measurements of the antioxidant activity using a radical scavenging capacity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ?-carotene bleaching assay were assessed in the barley acetonic extract. Furthermore, amino acids composition of barley mutant samples was determined. The results indicated that the acetonic extract of barley varieties under investigation possess marked antioxidant and anti radical capacities. The data showed that the acetonic extract of barley mutant P1 possessed the higher antioxidant activity as compared with the antioxidant activities of acetonic extract from control and other barley mutant samples. Meanwhile, the flour of barley mutations under investigation contained trace elements of iron, copper and manganese. GC and mass analyses were used to identify the active compound of extract of control and mutant barley samples. The results illustrated that the main components of the control sample of barely extract was pentane, 3 methyl (47.73%) while gamma irradiation caused noticeable change in the relative percentage of some components of acetonic extract from barley mutant samples. Moreover, the results presented that changes were disappeared, and some compounds of the acetonic extract from mutant barley samples were appeared. Furthermore, the results exhibited that barley flour supplemented with wheat flour at 30% level produced acceptable cookies. Accordingly, the phenolic constituents of barley acetonic extract induced by gamma irradiation, especially samples of P1 mutant, may have a future role as ingredients in the development of functional foods.

  9. RNA Origami

    DEFF Research Database (Denmark)

    Sparvath, Steffen Lynge

    introducerede vores gruppe den enkeltstrengede RNA-origami metode, der giver mulighed for cotranscriptional foldning af veldefinerede nanostrukturer, og er en central del af arbejdet præsenteret heri. Denne ph.d.-afhandling udforsker potentielle anvendelser af RNA-origami nanostrukturer, som nanomedicin eller...... biosensorer. Afhandlingen består af en introduktion til RNA-nanoteknologi feltet, en introduktion af enkeltstrenget RNA-origami design, og fire studier, der beskriver design, produktion og karakterisering af både strukturelle og funktionelle RNA-origamier. Flere RNA-origami designs er blevet undersøgt, og...... projekterne, der indgår i denne afhandling, inkluderer de nyeste fremskridt indenfor strukturel RNA-nanoteknologi og udvikling af funktionelle RNA-baserede enheder. Det første studie beskriver konstruktion og karakterisering af en enkeltstrenget 6-helix RNA-origami stuktur, som er den første demonstration af...

  10. (QTLs) for γ- aminobutyric acid content in grain of barley

    African Journals Online (AJOL)



    Jan 24, 2012 ... protein content, while Schooner is a hull two-rowed cultivar malting barley with low ... being kept at 20°C for 4~8 min, the mixture was heated in a boiling water bath for ..... John Wiley & Sons, Inc. Hobokwen, New Jersey. Nie C ...

  11. Hydrothermal liquefaction of barley straw to bio-crude oil

    DEFF Research Database (Denmark)

    Zhu, Zhe; Rosendahl, Lasse; Toor, Saqib


    Hydrothermal liquefaction (HTL) of barley straw with K2CO3 at different temperatures (280–400 C) was conducted and compared to optimize its process conditions; the aqueous phase as a co-product from this process was recycled to explore the feasibility of implementing wastewater reuse for bio...

  12. Variation in In Vitro Digestibility of Barley Protein

    DEFF Research Database (Denmark)

    Buchmann, N. B.


    impaired digestibilities; these findings were partially verified in a repeated field trial, but were not confirmed in vivo. In vitro digestibilities of barleys grown in pots at various N-levels were positively correlated with protein or hordein content. In vitro digestibility was negatively correlated...

  13. The Mutation Frequency in Different Spike Categories in Barley

    DEFF Research Database (Denmark)

    Frydenberg, O.; Doll, Hans; Sandfær, J.


    After gamma irradiation of barley seeds, a comparison has been made between the chlorophyll-mutant frequencies in X1 spikes that had multicellular bud meristems in the seeds at the time of treatment (denoted as pre-formed spikes) and X1 spikes having no recognizable meristems at the time...

  14. Wheat and barley exposure to nanoceria: Implications for agricultural productivity (United States)

    The impacts of man-made nanomaterials on agricultural productivity are not yet well understood. A soil microcosm study was performed to assess the physiological, phenological, and yield responses of wheat (Triticum aestivum) and barley (Hordeum vulgare L.) exposed to nanoceria (n...

  15. 108-110 Registration of Guta Barley (Hordeium vulgare L.)

    African Journals Online (AJOL)

    adoption potential by the local farmers. Keywords: Guta; Barley (Hordeium vulgare L); Yield ... evaluated along with Aruso and Shage as the local and standard variety, respectively at altitudinal range of 2400- ... 6. Farmers Evaluation of the Variety. To evaluate the perception and preferences of the local farmers, farmers' ...

  16. Aspects of the barley seed proteome during development and germination

    DEFF Research Database (Denmark)

    Finnie, Christine; Maeda, K.; Østergaard, O.


    Analysis of the water-soluble barley seed proteome has led to the identification of proteins by MS in the major spots on two-dimensional gels covering the pi ranges 4-7 and 6-11. This provides the basis for in-depth studies of proteome changes during seed development and germination, tissue...

  17. The proteomic analysis of barley albumins and globulins

    Czech Academy of Sciences Publication Activity Database

    Laštovičková, Markéta; Bobálová, Janette


    Roč. 102, č. 15 (2008), s709-s711 ISSN 1803-2389. [Meeting on Chemistry and Life /4./. Brno, 09.09.2008-11.09.2008] R&D Projects: GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : barley * albumins * globulins Subject RIV: CB - Analytical Chemistry, Separation

  18. Wheat and barley seed systems in Ethiopia and Syria

    NARCIS (Netherlands)

    Bishaw, Z.


    Keywords: Wheat,Triticumspp., Barley,Hordeumvulgare L., Seed Systems, Formal Seed Sector, Informal Seed Sector, National Seed Program, Seed Source, Seed Selection, Seed Management, Seed Quality,

  19. The Role of alpha-Glucosidase in Germinating Barley Grains

    DEFF Research Database (Denmark)

    Stanley, Duncan; Rejzek, Martin; Næsted, Henrik


    The importance of alpha-glucosidase in the endosperm starch metabolism of barley (Hordeum vulgare) seedlings is poorly understood. The enzyme converts maltose to glucose (Glc), but in vitro studies indicate that it can also attack starch granules. To discover its role in vivo, we took complementa...

  20. Spatial aggregation of pathotypes of barley powdery mildew

    DEFF Research Database (Denmark)

    O'Hara, R.B.; Brown, J.K.M.


    Aggregation in the distribution of pathotypes of Erysiphe graminis f.sp. hordei, the barley powdery mildew pathogen, was investigated in field plots of 'Golden Promise', 'Proctor' and 'Tyra'. 'Golden Promise' and 'Proctor' have no effective mildew resistance alleles, whereas 'Tyra' has Mla1, which...

  1. Two barley yellow dwarf luteovirus serotypes associated with ...

    African Journals Online (AJOL)

    Barley yellow dwarf luteovirus (BYDV) serotypes PAV and RPV were identified from irrigated wheat (Triticum aestivum L.) samples from three provinces of Zambia by double antibody sandwich enzyme-linked immunosorbent assay using polyclonal and monoclonal antisera. Nine wheat cultivars were surveyed in 11 wheat ...

  2. Evaluation of genetic diversity in barley ( Hordeum vulgare L.) from ...

    African Journals Online (AJOL)

    This study aimed to determine the genetic diversity and relationships among barley varieties (Hordeum vulgare L.) growing at Wollo Highland areas by using hordein and agro-morphological traits. Twenty (20) varieties were laid down in randomized complete block design (RCBD) design with three replications; they were ...

  3. Genetic diversity in barley landraces (Hordeum vulgare L. subsp.

    Indian Academy of Sciences (India)

    Genetic diversity in barley landraces (Hordeum vulgare L. subsp. vulgare) originated from Crescent Fertile region as detected by seed storage proteins. RIM MZID FARHAT CHIBANI RAYDA BEN AYED MOHSEN HANANA JOELLE BREIDI RABIH KABALAN SAMIH EL-HAJJ HASSAN MACHLAB AHMED REBAI LAMIS ...

  4. Genetic analysis on the competitive ability of barley ( Hordeum ...

    African Journals Online (AJOL)

    Genetic analysis on the competitive ability of barley ( Hordeum vulgare L.) recombinant inbred lines intercropped with oat ( Avena sativa L.) weeds. ... Furthermore, the commonly used herbicide price is soaring from time to time and out of the reach of the poor farmers in the developing countries. Therefore, this method is an ...

  5. A weed suppressive index for spring barley (Hordeum vulgare) varieties

    DEFF Research Database (Denmark)

    Hansen, P K; Kristensen, K; Willas, J


    A screening programme for crop variety competitiveness would ideally be based on only a few, non-destructive measurements of key growth traits. In this study we measured the weed suppressive ability of 79 varieties of spring barley in two ways: (i) directly, by weed coverage assessments under wee...

  6. Zinc biofortification of cereals: rice differs from wheat and barley

    NARCIS (Netherlands)

    Stomph, T.J.; Jiang, W.; Struik, P.C.


    In their review, mainly focused on bread wheat (Triticum aestivum), durum wheat (Triticum durum) and barley (Hordeum vulgare), Palmgren et al. 1 M.G. Palmgren et al., Zinc biofortification of cereals: problems and solutions, Trends Plant Sci. 13 (2008), pp. 464–473. Article | PDF (905 K) | View

  7. Synthesis of the major storage protein, hordein, in barley

    DEFF Research Database (Denmark)

    Giese, Nanna Henriette; Andersen, B.; Doll, Hans


    A liquid culture system for culturing detached spikes of barley (Hordeum vulgare L.) at different nutritional levels was established. The synthesis of hordein polypeptides was studied by pulse-labeling with [14C]sucrose at different stages of development and nitrogen (N) nutrition. All polypeptides...

  8. Diversity in Indian barley (Hordeum vulgare) cultivars and ...

    Indian Academy of Sciences (India)

    tinguish varieties of crop plants and establish their purity as a prerequisite for any ... of genetic material in germplasm collection and as a general guide for the choice ... Sixty-nine barley cultivars were grown under field condi- tions in three ...

  9. Wheat and barley differently affect porcine intestinal microbiota

    DEFF Research Database (Denmark)

    Weiss, Eva; Aumiller, Tobias; Spindler, Hanns K


    Diet influences the porcine intestinal microbial ecosystem. Barrows were fitted with ileal T-cannulas to compare short-term effects of eight different wheat or barley genotypes and period-to-period effects on seven bacterial groups in ileal digesta and faeces by qPCR. Within genotypes of wheat an...

  10. Leaf rust of cultivated barley: pathology and control. (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder


    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  11. Registration of Food Barley (Hordeum vulgare L.) Variety HB 1307 ...

    African Journals Online (AJOL)

    Six-rowed food type barley, HB 1307, was developed by Holetta Agricultural Research Center (HARC) from a cross between a landrace line and exotic germplasm (Awra gebs-1 x IBON93/91) and released in 2006 for mid and high altitude areas. The three consecutive years\\' (2002-2004) tests proved its superiority in grain ...

  12. Classification and salt tolerance analysis of barley varieties

    NARCIS (Netherlands)

    Katerji, N.; Hoorn, van J.W.; Hamdy, A.; Mastrorilli, M.; Fares, C.; Ceccarelli, S.; Grando, S.; Oweis, T.


    Six varieties of barley (Hordeum vulgare), five of which were provided by ICARDA, were tested in a green house experiment for their salt tolerance. Afterwards the ICARDA variety Melusine, selected from this experiment for its combination of high yield and salt tolerance, was compared in a lysimeter

  13. Transcriptome analysis of trichothecene-induced gene expression in barley. (United States)

    Boddu, Jayanand; Cho, Seungho; Muehlbauer, Gary J


    Fusarium head blight, caused primarily by Fusarium graminearum, is a major disease problem on barley (Hordeum vulgare L.). Trichothecene mycotoxins produced by the fungus during infection increase the aggressiveness of the fungus and promote infection in wheat (Triticum aestivum L.). Loss-of-function mutations in the TRI5 gene in F. graminearum result in the inability to synthesize trichothecenes and in reduced virulence on wheat. We examined the impact of pathogen-derived trichothecenes on virulence and the transcriptional differences in barley spikes infected with a trichothecene-producing wild-type strain and a loss-of-function tri5 trichothecene nonproducing mutant. Disease severity, fungal biomass, and floret necrosis and bleaching were reduced in spikes inoculated with the tri5 mutant strain compared with the wild-type strain, indicating that the inability to synthesize trichothecenes results in reduced virulence in barley. We detected 63 transcripts that were induced during trichothecene accumulation, including genes encoding putative trichothecene detoxification and transport proteins, ubiquitination-related proteins, programmed cell death-related proteins, transcription factors, and cytochrome P450s. We also detected 414 gene transcripts that were designated as basal defense response genes largely independent of trichothecene accumulation. Our results show that barley exhibits a specific response to trichothecene accumulation that can be separated from the basal defense response. We propose that barley responds to trichothecene accumulation by inducing at least two general responses. One response is the induction of genes encoding trichothecene detoxification and transport activities that may reduce the impact of trichothecenes. The other response is to induce genes encoding proteins associated with ubiquitination and cell death which may promote successful establishment of the disease.

  14. Barley HvPAPhy_a as transgene provides high and stable phytase activities in mature barley straw and in grains. (United States)

    Holme, Inger Baeksted; Dionisio, Giuseppe; Madsen, Claus Krogh; Brinch-Pedersen, Henrik


    The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T 2 -generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature grains as feed to increase the release of bio-available phosphate and minerals bound to the phytate of the grains; secondly, the utilization of the powdered straw either directly or phytase extracted hereof as a supplement to high phytate feed or food; and finally, the use of the stubble to be ploughed into the soil for mobilizing phytate-bound phosphate for plant growth. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Allelopathic effects of barley straw on germination and seedling growth of corn, sugar beet and sunflower

    Directory of Open Access Journals (Sweden)

    mohamad taghi naseri poor yazdi


    Full Text Available Allelopathic effects of barley straw and root on germination and growth of maize, sugar beet, and sunflower were investigated under glasshouse and laboratory experiments in Faculty of Agriculture, Ferdowsi University of Mashhad in 2006. The glasshouse experiment was designed based on randomized complete block design with three replications, treatments included: 0, 200, 400, 600 g/m² of grounded barley straw and also 0 and 50 g/m2 barley root. A laboratory experiment was carried out in order to study the effect of different concentrations of barley water extracts on germination and seedling characteristics of corn, sugar beet and sunflower. Treatments in laboratory trial included 0, 33, 50 and 100 percent of barley extracts. Results showed that leaf area of corn was significantly affected by barley straw treatments. Shoot dry matter and seed weight per plant in corn , leaf and tuber weight in sugar beet and leaf , stem weights , plant per plant in corn , leaf and tuber weight in sugar beet and leaf, stem weights, plant height, head diameter, head weight and seed weight in sunflower were significantly higher in treatment of 50g/m² barley roots. Crop seed germination decreased with increasing the amount of barley straw. The best germination response to barley extract was observed in corn. Maize radicle weight was significantly decreased with increasing concentration of barley water extract.

  16. The Role of α-Glucosidase in Germinating Barley Grains1[W][OA (United States)

    Stanley, Duncan; Rejzek, Martin; Naested, Henrik; Smedley, Mark; Otero, Sofía; Fahy, Brendan; Thorpe, Frazer; Nash, Robert J.; Harwood, Wendy; Svensson, Birte; Denyer, Kay; Field, Robert A.; Smith, Alison M.


    The importance of α-glucosidase in the endosperm starch metabolism of barley (Hordeum vulgare) seedlings is poorly understood. The enzyme converts maltose to glucose (Glc), but in vitro studies indicate that it can also attack starch granules. To discover its role in vivo, we took complementary chemical-genetic and reverse-genetic approaches. We identified iminosugar inhibitors of a recombinant form of an α-glucosidase previously discovered in barley endosperm (ALPHA-GLUCOSIDASE97 [HvAGL97]), and applied four of them to germinating grains. All four decreased the Glc-to-maltose ratio in the endosperm 10 d after imbibition, implying inhibition of maltase activity. Three of the four inhibitors also reduced starch degradation and seedling growth, but the fourth did not affect these parameters. Inhibition of starch degradation was apparently not due to inhibition of amylases. Inhibition of seedling growth was primarily a direct effect of the inhibitors on roots and coleoptiles rather than an indirect effect of the inhibition of endosperm metabolism. It may reflect inhibition of glycoprotein-processing glucosidases in these organs. In transgenic seedlings carrying an RNA interference silencing cassette for HvAgl97, α-glucosidase activity was reduced by up to 50%. There was a large decrease in the Glc-to-maltose ratio in these lines but no effect on starch degradation or seedling growth. Our results suggest that the α-glucosidase HvAGL97 is the major endosperm enzyme catalyzing the conversion of maltose to Glc but is not required for starch degradation. However, the effects of three glucosidase inhibitors on starch degradation in the endosperm indicate the existence of unidentified glucosidase(s) required for this process. PMID:21098673

  17. Luteibacter rhizovicinus MIMR1 promotes root development in barley (Hordeum vulgare L.) under laboratory conditions. (United States)

    Guglielmetti, Simone; Basilico, Roberto; Taverniti, Valentina; Arioli, Stefania; Piagnani, Claudia; Bernacchi, Andrea


    In order to preserve environmental quality, alternative strategies to chemical-intensive agriculture are strongly needed. In this study, we characterized in vitro the potential plant growth promoting (PGP) properties of a gamma-proteobacterium, named MIMR1, originally isolated from apple shoots in micropropagation. The analysis of the 16S rRNA gene sequence allowed the taxonomic identification of MIMR1 as Luteibacter rhizovicinus. The PGP properties of MIMR1 were compared to Pseudomonas chlororaphis subsp. aurantiaca DSM 19603(T), which was selected as a reference PGP bacterium. By means of in vitro experiments, we showed that L. rhizovicinus MIMR1 and P. chlororaphis DSM 19603(T) have the ability to produce molecules able to chelate ferric ions and solubilize monocalcium phosphate. On the contrary, both strains were apparently unable to solubilize tricalcium phosphate. Furthermore, the ability to produce 3-indol acetic acid by MIMR1 was approximately three times higher than that of DSM 19603(T). By using fluorescent recombinants of strains MIMR1 and DSM 19603(T), we also demonstrated that both bacteria are able to abundantly proliferate and colonize the barley rhizosphere, preferentially localizing on root tips and in the rhizoplane. Finally, we observed a negative effect of DSM 19603(T) on barley seed germination and plant growth, whereas MIMR1, compared to the control, determined a significant increase of the weight of aerial part (+22 %), and the weight and length of roots (+53 and +32 %, respectively). The results obtained in this work make L. rhizovicinus MIMR1 a good candidate for possible use in the formulation of bio-fertilizers.

  18. High-throughput transcriptome analysis of barley (Hordeum vulgare) exposed to excessive boron. (United States)

    Tombuloglu, Guzin; Tombuloglu, Huseyin; Sakcali, M Serdal; Unver, Turgay


    Boron (B) is an essential micronutrient for optimum plant growth. However, above certain threshold B is toxic and causes yield loss in agricultural lands. While a number of studies were conducted to understand B tolerance mechanism, a transcriptome-wide approach for B tolerant barley is performed here for the first time. A high-throughput RNA-Seq (cDNA) sequencing technology (Illumina) was used with barley (Hordeum vulgare), yielding 208 million clean reads. In total, 256,874 unigenes were generated and assigned to known peptide databases: Gene Ontology (GO) (99,043), Swiss-Prot (38,266), Clusters of Orthologous Groups (COG) (26,250), and the Kyoto Encyclopedia of Genes and Genomes (KEGG) (36,860), as determined by BLASTx search. According to the digital gene expression (DGE) analyses, 16% and 17% of the transcripts were found to be differentially regulated in root and leaf tissues, respectively. Most of them were involved in cell wall, stress response, membrane, protein kinase and transporter mechanisms. Some of the genes detected as highly expressed in root tissue are phospholipases, predicted divalent heavy-metal cation transporters, formin-like proteins and calmodulin/Ca(2+)-binding proteins. In addition, chitin-binding lectin precursor, ubiquitin carboxyl-terminal hydrolase, and serine/threonine-protein kinase AFC2 genes were indicated to be highly regulated in leaf tissue upon excess B treatment. Some pathways, such as the Ca(2+)-calmodulin system, are activated in response to B toxicity. The differential regulation of 10 transcripts was confirmed by qRT-PCR, revealing the tissue-specific responses against B toxicity and their putative function in B-tolerance mechanisms. Copyright © 2014. Published by Elsevier B.V.

  19. Bacteria-triggered systemic immunity in barley is associated with WRKY and ETHYLENE RESPONSIVE FACTORs but not with salicylic acid. (United States)

    Dey, Sanjukta; Wenig, Marion; Langen, Gregor; Sharma, Sapna; Kugler, Karl G; Knappe, Claudia; Hause, Bettina; Bichlmeier, Marlies; Babaeizad, Valiollah; Imani, Jafargholi; Janzik, Ingar; Stempfl, Thomas; Hückelhoven, Ralph; Kogel, Karl-Heinz; Mayer, Klaus F X; Vlot, A Corina


    Leaf-to-leaf systemic immune signaling known as systemic acquired resistance is poorly understood in monocotyledonous plants. Here, we characterize systemic immunity in barley (Hordeum vulgare) triggered after primary leaf infection with either Pseudomonas syringae pathovar japonica (Psj) or Xanthomonas translucens pathovar cerealis (Xtc). Both pathogens induced resistance in systemic, uninfected leaves against a subsequent challenge infection with Xtc. In contrast to systemic acquired resistance in Arabidopsis (Arabidopsis thaliana), systemic immunity in barley was not associated with NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 or the local or systemic accumulation of salicylic acid. Instead, we documented a moderate local but not systemic induction of abscisic acid after infection of leaves with Psj. In contrast to salicylic acid or its functional analog benzothiadiazole, local applications of the jasmonic acid methyl ester or abscisic acid triggered systemic immunity to Xtc. RNA sequencing analysis of local and systemic transcript accumulation revealed unique gene expression changes in response to both Psj and Xtc and a clear separation of local from systemic responses. The systemic response appeared relatively modest, and quantitative reverse transcription-polymerase chain reaction associated systemic immunity with the local and systemic induction of two WRKY and two ETHYLENE RESPONSIVE FACTOR (ERF)-like transcription factors. Systemic immunity against Xtc was further associated with transcriptional changes after a secondary/systemic Xtc challenge infection; these changes were dependent on the primary treatment. Taken together, bacteria-induced systemic immunity in barley may be mediated in part by WRKY and ERF-like transcription factors, possibly facilitating transcriptional reprogramming to potentiate immunity. © 2014 American Society of Plant Biologists. All Rights Reserved.

  20. Modulation of the nitrate reductase transcript by cytokinin and abscisic acid in etiolated barley seedlings

    International Nuclear Information System (INIS)

    Lu, Jia-ling; Enl, J.R.; Chen, Chong-maw


    To investigate the molecular mechanism of the hormonal modulation of nitrate reductase (NR) activity, the influence of benzyladenine (BA) and/or abscisic acid (ABA) on the level of NR poly(A)RNA was studied in etiolated barley seedlings using a 32 P-labelled NR cDNA as a probe. Enhancement of NR activity by 2 x 10 -5 M BA was measurable only after 60 minutes of exposure of the seedlings to light, while a significant stimulatory effect on the transcript level could by clearly detected within 15 minutes. Northern blot analyses of the levels of NR poly(A)RNA indicate that the amount present is proportional to the concentration of BA applied to the seedlings. The stimulatory effects seen for BA were nullified by ABA. The counteractive effects of ABA on BA were dose-responsive, with greater inhibition at higher concentrations of ABA. Evidence suggests that the interaction of BA and ABA on NR activity is at the transcriptional level, however, is also possible that interactions occur at the postranscriptional level as well

  1. Prowashonupana barley dietary fibre reduces body fat and increases insulin sensitivity in Caenorhabditis elegans model (United States)

    Gao, Chenfei; King, Michael L.; Fitzpatrick, Zachary L.; Wei, Wenqian; King, Jason F.; Wang, Mingming; Greenway, Frank L.; Finley, John W.; Burton, Jeffrey H.; Johnson, William D.; Keenan, Michael J.; Enright, Frederick M.; Martin, Roy J.; Zheng, Jolene


    Prowashonupana barley (PWB) is high in β-glucan with moderate content of resistant starch. PWB reduced intestinal fat deposition (IFD) in wild type Caenorhabditis elegans (C. elegans, N2), and in sir-2.1 or daf-16 null mutants, and sustained a surrogate marker of lifespan, pharyngeal pumping rate (PPR), in N2, sir-2.1, daf-16, or daf-16/daf-2 mutants. Hyperglycaemia (2% glucose) reversed or reduced the PWB effect on IFD in N2 or daf-16/daf-2 mutants with a sustained PPR. mRNA expression of cpt-1, cpt-2, ckr-1, and gcy-8 were dose-dependently reduced in N2 or daf-16 mutants, elevated in daf-16/daf-2 mutants with reduction in cpt-1, and unchanged in sir-2.1 mutants. mRNA expressions were increased by hyperglycaemia in N2 or daf-16/daf-2 mutants, while reduced in sir-2.1 or daf-16 mutants. The effects of PWB in the C. elegans model appeared to be primarily mediated via sir-2.1, daf-16, and daf-16/daf-2. These data suggest that PWB and β-glucans may benefit hyperglycaemia-impaired lipid metabolism. PMID:27721901

  2. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

    Directory of Open Access Journals (Sweden)

    Jonathan A Kopechek

    Full Text Available RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14. Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9 or control RNA (n = 8 during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3 confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively. Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.

  3. Analysis of enzyme production by submerged culture of Aspergillus oryzae using whole barley. (United States)

    Masuda, Susumu; Kikuchi, Kaori; Matsumoto, Yuko; Sugimoto, Toshikazu; Shoji, Hiroshi; Tanabe, Masayuki


    We have reported on high enzyme production by submerged culture of Aspergillus kawachii using barley with the husk (whole barley). To elucidate the mechanism underlying this high enzyme production, we performed a detailed analysis. Aspergillus oryzae RIB40 was submerged-cultured using whole barley and milled whole barley. Enzyme production was analyzed in terms of changes in medium components and gene expression levels. When whole barley was used, high production of glucoamylase and alpha-amylase and high gene expression levels of these enzymes were observed. Low ammonium concentrations were maintained with nitrate ion uptake continuing into the late stage using whole barley. These findings suggest that the sustainability of nitrogen metabolism is related to high enzyme production, and that a mechanism other than that associated with the conventional amylase expression system is involved in this relationship.

  4. Distribution Map and Community Characteristics of Weeds in Barley Fields of Ardabil Province


    B. Soheili; M. Minbashi; D. Hasanpanah; N. Razmi


    Surveying weeds of irrigated barley fields is one of the most important practices in weed management. Based on cultivated areas irrigated barley in all counties of Ardabil province during six years (2000-2005), 46 sample barley fields were selected and weed species were counted in each sampling point and population indices were calculated with Thomas method. By using specific furmula the density, frequency and uniformity of each weed species in fields were calculated. In each field longitude,...

  5. Characterization of Resistance to Cephus cinctus (Hymenoptera: Cephidae) in Barley Germplasm. (United States)

    Varella, Andrea C; Talbert, Luther E; Achhami, Buddhi B; Blake, Nancy K; Hofland, Megan L; Sherman, Jamie D; Lamb, Peggy F; Reddy, Gadi V P; Weaver, David K


    Most barley cultivars have some degree of resistance to the wheat stem sawfly (WSS), Cephus cinctus Norton (Hymenoptera: Cephidae). Damage caused by WSS is currently observed in fields of barley grown in the Northern Great Plains, but the impact of WSS damage among cultivars due to genetic differences within the barley germplasm is not known. Specifically, little is known about the mechanisms underlying WSS resistance in barley. We characterized WSS resistance in a subset of the spring barley CAP (Coordinated Agricultural Project) germplasm panel containing 193 current and historically important breeding lines from six North American breeding programs. Panel lines were grown in WSS infested fields for two consecutive years. Lines were characterized for stem solidness, stem cutting, WSS infestation (antixenosis), larval mortality (antibiosis), and parasitism (indirect plant defense). Variation in resistance to WSS in barley was compared to observations made for solid-stemmed resistant and hollow-stemmed susceptible wheat lines. Results indicate that both antibiosis and antixenosis are involved in the resistance of barley to the WSS, but antibiosis seems to be more prevalent. Almost all of the barley lines had greater larval mortality than the hollow-stemmed wheat lines, and only a few barley lines had mortality as low as that observed in the solid-stemmed wheat line. Since barley lines lack solid stems, it is apparent that barley has a different form of antibiosis. Our results provide information for use of barley in rotation to control the WSS and may provide a basis for identification of new approaches for improving WSS resistance in wheat.

  6. A microRNA feedback loop regulates global microRNA abundance during aging. (United States)

    Inukai, Sachi; Pincus, Zachary; de Lencastre, Alexandre; Slack, Frank J


    Expression levels of many microRNAs (miRNAs) change during aging, notably declining globally in a number of organisms and tissues across taxa. However, little is known about the mechanisms or the biological relevance for this change. We investigated the network of genes that controls miRNA transcription and processing during C. elegans aging. We found that miRNA biogenesis genes are highly networked with transcription factors and aging-associated miRNAs. In particular, miR-71, known to influence life span and itself up-regulated during aging, represses alg-1 /Argonaute expression post-transcriptionally during aging. Increased ALG-1 abundance in mir-71 loss-of-function mutants led to globally increased miRNA expression. Interestingly, these mutants demonstrated widespread mRNA expression dysregulation and diminished levels of variability both in gene expression and in overall life span. Thus, the progressive molecular decline often thought to be the result of accumulated damage over an organism's life may be partially explained by a miRNA-directed mechanism of age-associated decline. © 2018 Inukai et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. Molecular Chemical Structure of Barley Proteins Revealed by Ultra-Spatially Resolved Synchrotron Light Sourced FTIR Microspectroscopy: Comparison of Barley Varieties

    International Nuclear Information System (INIS)

    Yu, P.


    Barley protein structure affects the barley quality, fermentation, and degradation behavior in both humans and animals among other factors such as protein matrix. Publications show various biological differences among barley varieties such as Valier and Harrington, which have significantly different degradation behaviors. The objectives of this study were to reveal the molecular structure of barley protein, comparing various varieties (Dolly, Valier, Harrington, LP955, AC Metcalfe, and Sisler), and quantify protein structure profiles using Gaussian and Lorentzian methods of multi-component peak modeling by using the ultra-spatially resolved synchrotron light sourced Fourier transform infrared microspectroscopy (SFTIRM). The items of the protein molecular structure revealed included protein structure α-helices, β-sheets, and others such as β-turns and random coils. The experiment was performed at the National Synchrotron Light Source in Brookhaven National Laboratory (BNL, US Department of Energy, NY). The results showed that with the SFTIRM, the molecular structure of barley protein could be revealed. Barley protein structures exhibited significant differences among the varieties in terms of proportion and ratio of model-fitted α-helices, β-sheets, and others. By using multi-component peaks modeling at protein amide I region of 1710-1576 cm -1 , the results show that barley protein consisted of approximately 18-34% of α-helices, 14-25% of β-sheets, and 44-69% others. AC Metcalfe, Sisler, and LP955 consisted of higher (P 0.05). The ratio of α-helices to others (0.3 to 1.0, P < 0.05) and that of β-sheets to others (0.2 to 0.8, P < 0.05) were different among the barley varieties. It needs to be pointed out that using a multi-peak modeling for protein structure analysis is only for making relative estimates and not exact determinations and only for the comparison purpose between varieties. The principal component analysis showed that protein amide I Fourier

  8. Archaeogenetic evidence of ancient nubian barley evolution from six to two-row indicates local adaptation.

    Directory of Open Access Journals (Sweden)

    Sarah A Palmer

    Full Text Available BACKGROUND: Archaeobotanical samples of barley (Hordeum vulgare L. found at Qasr Ibrim display a two-row phenotype that is unique to the region of archaeological sites upriver of the first cataract of the Nile, characterised by the development of distinctive lateral bracts. The phenotype occurs throughout all strata at Qasr Ibrim, which range in age from 3000 to a few hundred years. METHODOLOGY AND FINDINGS: We extracted ancient DNA from barley samples from the entire range of occupancy of the site, and studied the Vrs1 gene responsible for row number in extant barley. Surprisingly, we found a discord between the genotype and phenotype in all samples; all the barley had a genotype consistent with the six-row condition. These results indicate a six-row ancestry for the Qasr Ibrim barley, followed by a reassertion of the two-row condition. Modelling demonstrates that this sequence of evolutionary events requires a strong selection pressure. CONCLUSIONS: The two-row phenotype at Qasr Ibrim is caused by a different mechanism to that in extant barley. The strength of selection required for this mechanism to prevail indicates that the barley became locally adapted in the region in response to a local selection pressure. The consistency of the genotype/phenotype discord over time supports a scenario of adoption of this barley type by successive cultures, rather than the importation of new barley varieties associated with individual cultures.

  9. Resistance in winter barley against Ramularia leaf spot

    DEFF Research Database (Denmark)

    Hjortshøj, Rasmus Lund

    Ramularia leaf spot is an emerging disease in barley caused by R. collo-cygni. At present little is known about the resistance mechanisms carried out by the host plant to avoid disease development. Nor is the lifecycle of the fungus or its populations structure fully understood. To gain insight....... fulvum-tomato and S. tritici-wheat in order to find modelsystems to enhance interpretation of results from R. collo-cygni-barley interaction. Results from the mapping showed that resistance to Ramularia leaf spot is controlled by a number of QTL’s, some of which co-locate with other physiological traits....... The populations further segregated for physiological leaf spots, a phenomenon related to the leaf damage imposed by Rubellin, although, resistance to physiological leafspots appeared to come from the Ramularia leaf spot susceptible parent. The toxin assay further supported this result as the genotypes susceptible...

  10. Leaf senescence and nutrient remobilisation in barley and wheat

    DEFF Research Database (Denmark)

    Gregersen, P L; Holm, P B; Krupinska, K


    Extensive studies have been undertaken on senescence processes in barley and wheat and their importance for the nitrogen use efficiency of these crop plants. During the senescence processes, proteins are degraded and nutrients are re-mobilised from senescing leaves to other organs, especially...... of chloroplasts is summarised. Rubisco is thought to be released from chloroplasts into vesicles containing stroma material (RCB = Rubisco-containing bodies). These vesicles may then take different routes for their degradation. Transcriptome analyses on barley and wheat senescence have identified genes involved...... in degradative, metabolic and regulatory processes that could be used in future strategies aimed at modifying the senescence process. The breeding of crops for characters related to senescence processes, e.g. higher yields and better nutrient use efficiency, is complex. Such breeding has to cope with the dilemma...

  11. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian


    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...

  12. Methods of scoring induced chromosome structural changes in barley

    International Nuclear Information System (INIS)

    Nicoleff, H.; Gecheff, K.


    In barley, a material widely used in mutation and chromosomal aberration studies, the method most frequently used for scoring induced chromosomal changes is still anaphase analysis. In this paper, data obtained after treatment of barley with gamma-rays and ethyleneimine (EI) and comparative scoring of aberrations in metaphase and anaphase are reported and discussed. It is evident that the metaphase aberrations induced by gamma-rays and ethyleneimine, due probably to their specific location, showed a differential manifestation during anaphase. Thus, after treatment with ethyleneimine a great portion of the induced aberrations, being located preferentially at the centromere regions, gave no scorable bridges, and an apparent excess of fragments was observed at anaphase. After gamma-irradiation the differences between metaphase and anaphase scoring were mainly due to a large portion of fragments escaping detection

  13. Suppression of Zn stress on barley by irradiated chitosan

    Energy Technology Data Exchange (ETDEWEB)

    Nagasawa, N.; Mitomo, H. [Gunma Univ., Faculty of Engineering, Department of Biological and Chemical Engineering, Kiryu, Gunma (Japan); Ha, P.T.L. [Nuclear Research Institute, Dalat (Viet Nam); Watanabe, S.; Ito, T.; Takeshita, H.; Yoshii, F.; Kume, T. [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment


    Chitosan was irradiated up to 1000 kGy in solid state. Irradiation of chitosan caused the reduction of molecular weight. The molecular weight of the chitosan reduced from ca. 4 x 10{sup 5} to ca. 6 x 10{sup 3} by irradiation at 1000 kGy. For the barley growth promotion, irradiated chitosan showed the significant effect and 1000 kGy irradiated chitosan improved 20% of growth. Using the positron emitting tracer imaging system (PETIS), the effect of chitosan on uptake and transportation of {sup 62}Zn in barley were investigated. It was found that the transportation of Zn from root to shoot and the damage of plant by Zn were suppressed with irradiated chitosan. (author)

  14. Suppression of Zn stress on barley by irradiated chitosan

    International Nuclear Information System (INIS)

    Nagasawa, N.; Mitomo, H.; Ha, P.T.L.; Watanabe, S.; Ito, T.; Takeshita, H.; Yoshii, F.; Kume, T.


    Chitosan was irradiated up to 1000 kGy in solid state. Irradiation of chitosan caused the reduction of molecular weight. The molecular weight of the chitosan reduced from ca. 4 x 10 5 to ca. 6 x 10 3 by irradiation at 1000 kGy. For the barley growth promotion, irradiated chitosan showed the significant effect and 1000 kGy irradiated chitosan improved 20% of growth. Using the positron emitting tracer imaging system (PETIS), the effect of chitosan on uptake and transportation of 62 Zn in barley were investigated. It was found that the transportation of Zn from root to shoot and the damage of plant by Zn were suppressed with irradiated chitosan. (author)

  15. Uptake and distribution of 232U in peas and barley

    International Nuclear Information System (INIS)

    Schreckhise, R.G.; Cline, J.F.


    The uptake of 232 U from soil and its distribution in peas and barley were examined under conditions which isolated root uptake from deposition on aboveground plant parts. Aboveground plant parts were harvested at maturity and analyzed for 232 U content by alpha-energy-analysis. The ratio of concentration (CR) of 232 U in the dry barley seeds to dry soil was 1.6 x 10 -4 while the CR values of the stem/leaf to dry soil fraction was 3.6 x 10 -3 . The Cr values for the pea seed, stem/pod and leaf components were 5.4 x 10 -4 , 3.3 x 10 -3 and 1.7 x 10 -2 , respectively. This indicates that the CR values used in certain radiological dose-assessment models may be high by about a factor of 100 when evaluating the consumption of seeds of legumes or cereal grains by man. (author)

  16. Dominant Groups of Potentially Active Bacteria Shared by Barley Seeds become Less Abundant in Root Associated Microbiome

    Directory of Open Access Journals (Sweden)

    Luhua Yang


    Full Text Available Endophytes are microorganisms colonizing plant internal tissues. They are ubiquitously associated with plants and play an important role in plant growth and health. In this work, we grew five modern cultivars of barley in axenic systems using sterile sand mixture as well as in greenhouse with natural soil. We characterized the potentially active microbial communities associated with seeds and roots using rRNA based amplicon sequencing. The seeds of the different cultivars share a great part of their microbiome, as we observed a predominance of a few bacterial OTUs assigned to Phyllobacterium, Paenibacillus, and Trabusiella. Seed endophytes, particularly members of the Enterobacteriacea and Paenibacillaceae, were important members of root endophytes in axenic systems, where there were no external microbes. However, when plants were grown in soil, seed endophytes became less abundant in root associated microbiome. We observed a clear enrichment of Actinobacteriacea and Rhizobiaceae, indicating a strong influence of the soil bacterial communities on the composition of the root microbiome. Two OTUs assigned to Phyllobacteriaceae were found in all seeds and root samples growing in soil, indicating a relationship between seed-borne and root associated microbiome in barley. Even though the role of endophytic bacteria remains to be clarified, it is known that many members of the genera detected in our study produce phytohormones, shape seedling exudate profile and may play an important role in germination and establishment of the seedlings.

  17. Dominant Groups of Potentially Active Bacteria Shared by Barley Seeds become Less Abundant in Root Associated Microbiome. (United States)

    Yang, Luhua; Danzberger, Jasmin; Schöler, Anne; Schröder, Peter; Schloter, Michael; Radl, Viviane


    Endophytes are microorganisms colonizing plant internal tissues. They are ubiquitously associated with plants and play an important role in plant growth and health. In this work, we grew five modern cultivars of barley in axenic systems using sterile sand mixture as well as in greenhouse with natural soil. We characterized the potentially active microbial communities associated with seeds and roots using rRNA based amplicon sequencing. The seeds of the different cultivars share a great part of their microbiome, as we observed a predominance of a few bacterial OTUs assigned to Phyllobacterium , Paenibacillus , and Trabusiella . Seed endophytes, particularly members of the Enterobacteriacea and Paenibacillaceae, were important members of root endophytes in axenic systems, where there were no external microbes. However, when plants were grown in soil, seed endophytes became less abundant in root associated microbiome. We observed a clear enrichment of Actinobacteriacea and Rhizobiaceae, indicating a strong influence of the soil bacterial communities on the composition of the root microbiome. Two OTUs assigned to Phyllobacteriaceae were found in all seeds and root samples growing in soil, indicating a relationship between seed-borne and root associated microbiome in barley. Even though the role of endophytic bacteria remains to be clarified, it is known that many members of the genera detected in our study produce phytohormones, shape seedling exudate profile and may play an important role in germination and establishment of the seedlings.

  18. Dominant Groups of Potentially Active Bacteria Shared by Barley Seeds become Less Abundant in Root Associated Microbiome (United States)

    Yang, Luhua; Danzberger, Jasmin; Schöler, Anne; Schröder, Peter; Schloter, Michael; Radl, Viviane


    Endophytes are microorganisms colonizing plant internal tissues. They are ubiquitously associated with plants and play an important role in plant growth and health. In this work, we grew five modern cultivars of barley in axenic systems using sterile sand mixture as well as in greenhouse with natural soil. We characterized the potentially active microbial communities associated with seeds and roots using rRNA based amplicon sequencing. The seeds of the different cultivars share a great part of their microbiome, as we observed a predominance of a few bacterial OTUs assigned to Phyllobacterium, Paenibacillus, and Trabusiella. Seed endophytes, particularly members of the Enterobacteriacea and Paenibacillaceae, were important members of root endophytes in axenic systems, where there were no external microbes. However, when plants were grown in soil, seed endophytes became less abundant in root associated microbiome. We observed a clear enrichment of Actinobacteriacea and Rhizobiaceae, indicating a strong influence of the soil bacterial communities on the composition of the root microbiome. Two OTUs assigned to Phyllobacteriaceae were found in all seeds and root samples growing in soil, indicating a relationship between seed-borne and root associated microbiome in barley. Even though the role of endophytic bacteria remains to be clarified, it is known that many members of the genera detected in our study produce phytohormones, shape seedling exudate profile and may play an important role in germination and establishment of the seedlings. PMID:28663753

  19. Drivers of Phosphorus Uptake by Barley Following Secondary Resource Application


    Brod, Eva; Øgaard, Anne K. Falk; Krogstad, Tore; Haraldsen, Trond; Frossard, Emmanuel; Oberson, Astrid


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake is still poorly understood. Using radioactive-labeling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal, and wood ash were studied as P uptake by barley after 44 days and compared with...

  20. Drivers of phosphorus uptake by barley following secondary resource application


    Eva eBrod; Eva eBrod; Anne Falk Øgaard; Tore eKrogstad; Trond Knapp Haraldsen; Emmanuel eFrossard; Astrid eOberson


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake are still poorly understood. Using radioactive labelling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal and wood ash were studied as P uptake by barley after 44 days and compared wit...

  1. Drivers of Phosphorus Uptake by Barley Following Secondary Resource Application


    Brod, Eva; Øgaard, Anne K. Falk; Krogstad, Tore; Haraldsen, Trond; Frossard, Emmanuel; Oberson, Astrid


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake is still poorly understood. Using radioactive-labeling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal, and wood ash were studied as P uptake by barley after 44 days and compared with...

  2. Drivers of phosphorus uptake by barley following secondary resource application

    Directory of Open Access Journals (Sweden)

    Eva eBrod


    Full Text Available Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake are still poorly understood. Using radioactive labelling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal and wood ash were studied as P uptake by barley after 44 days and compared with those of water-soluble mineral P (MinP and an unfertilized control (NoP in a pot experiment with an agricultural soil containing little available P at two soil pH levels, approximately pH 5.3 (unlimed soil and pH 6.2 (limed soil. In a parallel incubation experiment, the effects of the secondary resources on physicochemical and microbial soil processes were studied. The results showed that the relative agronomic efficiency compared with MinP decreased in the order: manure ≥ fish sludge ≥ wood ash ≥ meat bone meal. The solubility of inorganic P in secondary resources was the main driver for P uptake by barley (Hordeum vulgare. The effects of secondary resources on physicochemical and microbial soil processes were of little overall importance. Application of organic carbon with manure resulted in microbial P immobilisation and decreased uptake by barley of P derived from the soil. On both soils, P uptake by barley was best explained by a positive linear relationship with the H2O + NaHCO3-soluble inorganic P fraction in fertilizers, or by a linear negative relationship with the HCl-soluble inorganic P fraction in fertilizers.

  3. Drivers of Phosphorus Uptake by Barley Following Secondary Resource Application (United States)

    Brod, Eva; Øgaard, Anne Falk; Krogstad, Tore; Haraldsen, Trond Knapp; Frossard, Emmanuel; Oberson, Astrid


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake is still poorly understood. Using radioactive-labeling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal, and wood ash were studied as P uptake by barley after 44 days and compared with those of water-soluble mineral P (MinP) and an unfertilized control (NoP) in a pot experiment with an agricultural soil containing little available P at two soil pH levels, approximately pH 5.3 (unlimed soil) and pH 6.2 (limed soil). In a parallel incubation experiment, the effects of the secondary resources on physicochemical and microbial soil processes were studied. The results showed that the relative agronomic efficiency compared with MinP decreased in the order: manure ≥fish sludge ≥wood ash ≥meat bone meal. The solubility of inorganic P in secondary resources was the main driver for P uptake by barley (Hordeum vulgare). The effects of secondary resources on physicochemical and microbial soil processes were of little overall importance. Application of organic carbon with manure resulted in microbial P immobilization and decreased uptake by barley of P derived from the soil. On both soils, P uptake by barley was best explained by a positive linear relationship with the H2O + NaHCO3-soluble inorganic P fraction in fertilizers or by a linear negative relationship with the HCl-soluble inorganic P fraction in fertilizers. PMID:27243015

  4. Genomic Regions Influencing Seminal Root Traits in Barley. (United States)

    Robinson, Hannah; Hickey, Lee; Richard, Cecile; Mace, Emma; Kelly, Alison; Borrell, Andrew; Franckowiak, Jerome; Fox, Glen


    Water availability is a major limiting factor for crop production, making drought adaptation and its many component traits a desirable attribute of plant cultivars. Previous studies in cereal crops indicate that root traits expressed at early plant developmental stages, such as seminal root angle and root number, are associated with water extraction at different depths. Here, we conducted the first study to map seminal root traits in barley ( L.). Using a recently developed high-throughput phenotyping method, a panel of 30 barley genotypes and a doubled-haploid (DH) population (ND24260 × 'Flagship') comprising 330 lines genotyped with diversity array technology (DArT) markers were evaluated for seminal root angle (deviation from vertical) and root number under controlled environmental conditions. A high degree of phenotypic variation was observed in the panel of 30 genotypes: 13.5 to 82.2 and 3.6 to 6.9° for root angle and root number, respectively. A similar range was observed in the DH population: 16.4 to 70.5 and 3.6 to 6.5° for root angle and number, respectively. Seven quantitative trait loci (QTL) for seminal root traits (root angle, two QTL; root number, five QTL) were detected in the DH population. A major QTL influencing both root angle and root number (/) was positioned on chromosome 5HL. Across-species analysis identified 10 common genes underlying root trait QTL in barley, wheat ( L.), and sorghum [ (L.) Moench]. Here, we provide insight into seminal root phenotypes and provide a first look at the genetics controlling these traits in barley. Copyright © 2016 Crop Science Society of America.

  5. Genomic Regions Influencing Seminal Root Traits in Barley

    Directory of Open Access Journals (Sweden)

    Hannah Robinson


    Full Text Available Water availability is a major limiting factor for crop production, making drought adaptation and its many component traits a desirable attribute of plant cultivars. Previous studies in cereal crops indicate that root traits expressed at early plant developmental stages, such as seminal root angle and root number, are associated with water extraction at different depths. Here, we conducted the first study to map seminal root traits in barley ( L.. Using a recently developed high-throughput phenotyping method, a panel of 30 barley genotypes and a doubled-haploid (DH population (ND24260 × ‘Flagship’ comprising 330 lines genotyped with diversity array technology (DArT markers were evaluated for seminal root angle (deviation from vertical and root number under controlled environmental conditions. A high degree of phenotypic variation was observed in the panel of 30 genotypes: 13.5 to 82.2 and 3.6 to 6.9° for root angle and root number, respectively. A similar range was observed in the DH population: 16.4 to 70.5 and 3.6 to 6.5° for root angle and number, respectively. Seven quantitative trait loci (QTL for seminal root traits (root angle, two QTL; root number, five QTL were detected in the DH population. A major QTL influencing both root angle and root number (/ was positioned on chromosome 5HL. Across-species analysis identified 10 common genes underlying root trait QTL in barley, wheat ( L., and sorghum [ (L. Moench]. Here, we provide insight into seminal root phenotypes and provide a first look at the genetics controlling these traits in barley.

  6. Brassinosteroid enhances resistance to fusarium diseases of barley. (United States)

    Ali, Shahin S; Kumar, G B Sunil; Khan, Mojibur; Doohan, Fiona M


    Fusarium pathogens are among the most damaging pathogens of cereals. These pathogens have the ability to attack the roots, seedlings, and flowering heads of barley and wheat plants with disease, resulting in yield loss and head blight disease and also resulting in the contamination of grain with mycotoxins harmful to human and animal health. There is increasing evidence that brassinosteroid (BR) hormones play an important role in plant defense against both biotic and abiotic stress agents and this study set out to determine if and how BR might affect Fusarium diseases of barley. Application of the epibrassinolide (epiBL) to heads of 'Lux' barley reduced the severity of Fusarium head blight (FHB) caused by Fusarium culmorum by 86% and reduced the FHB-associated loss in grain weight by 33%. Growth of plants in soil amended with epiBL resulted in a 28 and 35% reduction in Fusarium seedling blight (FSB) symptoms on the Lux and 'Akashinriki' barley, respectively. Microarray analysis was used to determine whether growth in epiBL-amended soil changed the transcriptional profile in stem base tissue during the early stages of FSB development. At 24 and 48 h post F. culmorum inoculation, there were 146 epiBL-responsive transcripts, the majority being from the 48-h time point (n = 118). Real-time reverse-transcription polymerase chain reaction analysis validated the results for eight transcripts, including five defense genes. The results of gene expression studies show that chromatin remodeling, hormonal signaling, photosynthesis, and pathogenesis-related genes are activated in plants as a result of growth in epiBL.

  7. The Barley Grain Thioredoxin System – an Update

    Directory of Open Access Journals (Sweden)

    Per eHägglund


    Full Text Available Thioredoxin reduces disulfide bonds and play numerous important functions in plants. In cereal seeds, cytosolic h-type thioredoxin facilitates the release of energy reserves during the germination process and is recycled by NADPH-dependent thioredoxin reductase. This review presents a summary of the research conducted during the last ten years to elucidate the structure and function of the barley seed thioredoxin system at the molecular level combined with proteomic approaches to identify target proteins.

  8. The breeding of new malting barley variety 'yangpi NO.3'

    International Nuclear Information System (INIS)

    Wang Jinrong; Chen Xiulan; He Zhentian; Han Yuepeng; Wang Jianhua; Zhang Rong


    'Yangpi No 3' is a spring and two-rowed new malting barley variety. It was selected by the radiation-induced mutations. Its yield was about 6750 kg/hm 2 and the maturity was slightly later. The variety is with good agronomic traits, strong resistance, top quality and planted mainly in Huainan of Jiangsu Province. It had been qualified by Crop Variety Evaluation Committee of Jiangsu Province in Feb, 2009(200901). (authors)

  9. Nutrient uptake by barley in six colombian soils


    Madero Morales, Edgar Enrique; Amézquita, Edgar


    In Colombia, the increase of barley production is restricted by such factors as irregular rainfall, low temperatures, soil acidity, low fertility and disease, associated with improper soil management and scarse improve germoplasm, A suitable use of fertilizers is an alternative to face part of the problem by means of plant breeding in different terrain, tend to develop of low soil productivity tolerant cultivars. To arrive at appropiate recommendations for farmers, it was consider the quantit...

  10. Structure, morphology and functionality of acetylated and oxidised barley starches. (United States)

    El Halal, Shanise Lisie Mello; Colussi, Rosana; Pinto, Vânia Zanella; Bartz, Josiane; Radunz, Marjana; Carreño, Neftali Lenin Villarreal; Dias, Alvaro Renato Guerra; Zavareze, Elessandra da Rosa


    Acetylation and oxidation are chemical modifications which alter the properties of starch. The degree of modification of acetylated and oxidized starches is dependent on the catalyst and active chlorine concentrations, respectively. The objective of this study was to evaluate the effect of acetylation and oxidation on the structural, morphological, physical-chemical, thermal and pasting properties of barley starch. Barley starches were acetylated at different catalyst levels (11%, 17%, and 23% of NaOH solution) and oxidized at different sodium hypochlorite concentrations (1.0%, 1.5%, and 2.0% of active chlorine). Fourier-transformed infrared spectroscopy (FTIR), X-ray diffractograms, thermal, morphological, and pasting properties, swelling power and solubility of starches were evaluated. The degree of substitution (DS) of the acetylated starches increased with the rise in catalyst concentration. The percentage of carbonyl (CO) and carboxyl (COOH) groups in oxidized starches also increased with the rise of active chlorine level. The presence of hydrophobic acetyl groups, carbonyl and carboxyl groups caused a partial disorganization and depolymerization of starch granules. The structural, morphological and functional changes in acetylated and oxidized starches varied according to reaction conditions. Acetylation makes barley starch more hydrophobic by the insertion of acetyl groups. Also the oxidation promotes low retrogradation and viscosity. All these characteristics are important for biodegradable film production. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Films based on oxidized starch and cellulose from barley. (United States)

    El Halal, Shanise Lisie Mello; Colussi, Rosana; Deon, Vinícius Gonçalves; Pinto, Vânia Zanella; Villanova, Franciene Almeida; Carreño, Neftali Lenin Villarreal; Dias, Alvaro Renato Guerra; Zavareze, Elessandra da Rosa


    Starch and cellulose fibers were isolated from grains and the husk from barley, respectively. Biodegradable films of native starch or oxidized starches and glycerol with different concentrations of cellulose fibers (0%, 10% and 20%) were prepared. The films were characterized by morphological, mechanical, barrier, and thermal properties. Cellulose fibers isolated from the barley husk were obtained with 75% purity and high crystallinity. The morphology of the films of the oxidized starches, regardless of the fiber addition, was more homogeneous as compared to the film of the native starch. The addition of cellulose fibers in the films increased the tensile strength and decreased elongation. The water vapor permeability of the film of oxidized starch with 20% of cellulose fibers was lower than the without fibers. However the films with cellulose fibers had the highest decomposition with the initial temperature and thermal stability. The oxidized starch and cellulose fibers from barley have a good potential for use in packaging. The addition of cellulose fibers in starch films can contribute to the development of films more resistant that can be applied in food systems to maintain its integrity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. New NS varieties of six-rowed winter barley

    Directory of Open Access Journals (Sweden)

    Pržulj Novo


    Full Text Available The paper describes the characteristics of several new NS varieties of winter six-rowed barley released in Serbia between 2004 and 2007. These are Somborac, Ozren, Javor, Novosadski 773, Sremac and Leotar. In the official variety trials in the country, all six of these varieties outyielded the check variety, and the margins were as follows: Somborac - 3.4%, Ozren - 5.0%, Javor - 7.3%, Novosadski 773 - 3.4%, Sremac - 7.4%, and Leotar - 7.2%. Yield levels in absolute terms depended on the variety as well as year. All six-rowed NS varieties headed earlier than the check and had better resistance to lodging than the check has. The test weight of the new varieties was 70.2-73.8 kg/hl and the 1000-grain weight 33.4-50.2 g. The cellulose content was 4.4-4.8%, the fat content 1.4%, and the protein content 13.3-14.6%. The high variability of the new NS varieties of winter six-rowed barley makes it possible to choose the most suitable genotype for each barley-growing area in the country. .

  13. Yield improvement in barley by using gamma-irradiation

    International Nuclear Information System (INIS)

    Benamer, Ibrahim Mohammed


    Breeding work for barley improvement in Libya is very rare. All varieties grown here are foreign varieties. Yield per hectare is low compared with other countries having similar climatic conditions. Productivity, lodging, disease resistance, drought and salt tolerance are the main characteristics that need to be improved. A mutation breeding programme for barley improvement was initiated at the Tajoura Nuclear Research Centre in 1983-1984. The objectives of this programme are the development of new lines that could be used directly or indirectly in the development of new varieties. The locally adapted barley (Hordeum vulgare L.) variety ''California Mariout'' was used as a parent material. Grains with 14% moisture were exposed to 200 Gy gamma-ray from 60 Co source at the Centre. Three experiments were conducted during 1986-1989. From the first experiment (1986-1987), 62 mutant lines were evaluated. From the second and third experiments (1987-1989), only seven mutant lines were evaluated. In the 1988-1989 experiment, the crop was irrigated and fertilised with 0, 100 and 200 kgN/ha. Lodging score was low in 0 kgN/ha and increased significantly by the increase in N level. None of the mutant lines more lodging resistant than the parent or the control. However, yield differences were significant and the application of 100 kgN/ha increased the grain yield

  14. Variation in the agronomic and morphological traits in spring barley

    Directory of Open Access Journals (Sweden)

    N. Dyulgerov


    Full Text Available Abstract. The study was conducted to examine the variation in the agronomic and morphological traits in spring barley. For this purpose, 22 lines from the ICARDA High Input Barley Program for favorable environment and 3 check varieties (Rihane-03, VMorales and Veslets were tested in an alpha-lattice design with two replications at the Institute of Agriculture – Karnobat, Bulgaria in 2014 and 2015 growing season. The traits days to heading, plant height, number of tillers per plant, flag leaf length, flag leaf width, spike length, awn length, peduncle length, spikelet number per spike, grain number per spike, grain weight per spike, 1000 grains weight, grain yield, powdery mildew (Erysiphe graminis f. sp. hordei, net blotch (Pyrenophora teres f. teres and stripe rust (Puccinia striiformis f. sp. hordei infection were studied. Significant differences between lines for all studied traits were found. The number of fertile tillers per plant was significantly positively correlated with grain yield. Lines expressed higher grain yields, shorter stem, better tolerance to net blotch and stripe rust than Bulgarian check variety Veslets were identified. These genotypes can, therefore, be used as parents for the improvement of spring barley.

  15. Genetic analysis of aluminum tolerance in Brazilian barleys

    Directory of Open Access Journals (Sweden)

    Minella Euclydes


    Full Text Available Aluminum (Al toxicity is a major factor limiting barley growth in acid soils, and genotypes with adequate level of tolerance are needed for improving barley adaptation in Brazil. To study the inheritance of Al tolerance in Brazilian barleys, cultivars Antarctica 1, BR 1 and FM 404 were crossed to sensitive Kearney and PFC 8026, and intercrossed. Parental, F1, F2 and F6 generations were grown in nutrient solution containing 0.03, 0.05 and 0.07 mM of Al and classified for tolerance by the root tip hematoxylin staining assay. Tolerant by sensitive F2 progenies segregated three tolerant to one sensitive, fitting the 3:1 ratio expected for a single gene. The F6 populations segregated one tolerant to one sensitive also fitting a monogenic ratio. The F2 seedlings from crosses among tolerant genotypes scored the same as the parents. Since the population size used would allow detection of recombination as low as 7%, the complete absence of Al sensitive recombinants suggests that tolerance in these cultivars is most probably, controlled by the same gene. Thus, the potential for improving Al tolerance through recombination of these genotypes is very low and different gene sources should be evaluated.

  16. Unique and Conserved Features of the Barley Root Meristem

    Directory of Open Access Journals (Sweden)

    Gwendolyn K. Kirschner


    Full Text Available Plant root growth is enabled by root meristems that harbor the stem cell niches as a source of progenitors for the different root tissues. Understanding the root development of diverse plant species is important to be able to control root growth in order to gain better performances of crop plants. In this study, we analyzed the root meristem of the fourth most abundant crop plant, barley (Hordeum vulgare. Cell division studies revealed that the barley stem cell niche comprises a Quiescent Center (QC of around 30 cells with low mitotic activity. The surrounding stem cells contribute to root growth through the production of new cells that are displaced from the meristem, elongate and differentiate into specialized root tissues. The distal stem cells produce the root cap and lateral root cap cells, while cells lateral to the QC generate the epidermis, as it is typical for monocots. Endodermis and inner cortex are derived from one common initial lateral to the QC, while the outer cortex cell layers are derived from a distinct stem cell. In rice and Arabidopsis, meristem homeostasis is achieved through feedback signaling from differentiated cells involving peptides of the CLE family. Application of synthetic CLE40 orthologous peptide from barley promotes meristem cell differentiation, similar to rice and Arabidopsis. However, in contrast to Arabidopsis, the columella stem cells do not respond to the CLE40 peptide, indicating that distinct mechanisms control columella cell fate in monocot and dicot plants.

  17. Proteomic analysis of barley response during early spot blotch infection

    International Nuclear Information System (INIS)

    Al-Daoude, A.; Jawhar, M.; Shoaib, A.; Arabi, M.I.E.


    Spot blotch (SB), caused by the fungus Cochliobolus sativus, is a common foliar disease of barley worldwide, but little is known about the host response to infection at the protein level. In this study, a systematic shotgun proteomics approach was chosen to document the early barley response to C. sativus infection. Overall, 28 protein spots were consistently observed as differential in the proteome profiles of the challenged and unchallenged plants. After tryptic digestion, MALDI-TOF/MS analysis and MASCOT database searching identified proteins associated with the defense response including resistance proteins, putative hydrolase, proteinase, kinase and general metabolism and transport proteins. These afford important functions in host resistance and pathogen's inhibition in plants. One of the identified products is a putative NBS-LRR protein which is considered one of the major plant disease resistance proteins identified to date. This work indicates that, in combination with functional genomics, response of barley to challenge by C. sativus involved the recruitment of proteins from various defense pathways.(author)

  18. The effect of lanthanum applications on drought tolerance in barley

    International Nuclear Information System (INIS)

    Buckingham, S.; Maheswaran, J.; Peverill, K.; Meehan, B.; Stokes, J.


    Full text: Glasshouse investigations carried out by the authors on both perlite and soil, have repeatedly shown that several plant species, when treated with lanthanum, retain greater amounts of moisture under water stressed conditions. Dry matter increases under water stress have been observed in some cases. Barley plants watered to 50% field capacity, and show-ing signs of water stress, yielded 18% more dry matter when treated with 5 kg/ha and 10 kg/ha of lanthanum than control plants (P<0.05). The results of these experiments suggest that increased dry matter production in crops under periods of water stress, is likely when previously treated with lanthanum. Consequently, it is conceivable that lanthanum may have potential as an agent that induces drought tolerance in grain crops, grown in low rainfall areas. Subsequent field trials using barley as a test crop at Walpeup, in the Mallee region of Victoria have shown that in a below average rainfall year, combined soil and foliar applications of lanthanum can significantly increase grain yield. This effect was not evident when barley grown on the same soil type was treated with lanthanum under above average rainfall conditions

  19. BarleyBase—an expression profiling database for plant genomics (United States)

    Shen, Lishuang; Gong, Jian; Caldo, Rico A.; Nettleton, Dan; Cook, Dianne; Wise, Roger P.; Dickerson, Julie A.


    BarleyBase (BB) ( is an online database for plant microarrays with integrated tools for data visualization and statistical analysis. BB houses raw and normalized expression data from the two publicly available Affymetrix genome arrays, Barley1 and Arabidopsis ATH1 with plans to include the new Affymetrix 61K wheat, maize, soybean and rice arrays, as they become available. BB contains a broad set of query and display options at all data levels, ranging from experiments to individual hybridizations to probe sets down to individual probes. Users can perform cross-experiment queries on probe sets based on observed expression profiles and/or based on known biological information. Probe set queries are integrated with visualization and analysis tools such as the R statistical toolbox, data filters and a large variety of plot types. Controlled vocabularies for gene and plant ontologies, as well as interconnecting links to physical or genetic map and other genomic data in PlantGDB, Gramene and GrainGenes, allow users to perform EST alignments and gene function prediction using Barley1 exemplar sequences, thus, enhancing cross-species comparison. PMID:15608273

  20. Messenger RNAs from the Scutellum and Aleurone of Germinating Barley Encode (1-->3,1-->4)-beta-d-Glucanase, alpha-Amylase and Carboxypeptidase

    DEFF Research Database (Denmark)

    Mundy, John; Brandt, Anders; Fincher, Geoffrey B


    Polyclonal antibodies raised against barley (1-->3,1-->4)-beta-d-glucanase, alpha-amylase and carboxypeptidase were used to detect precursor polypeptides of these hydrolytic enzymes among the in vitro translation products of mRNA isolated from the scutellum and aleurone of germinating barley....... In the scutellum, mRNA encoding carboxypeptidase appeared to be relatively more abundant than that encoding alpha-amylase or (1-->3,1-->4)-beta-d-glucanase, while in the aleurone alpha-amylase and (1-->3,1-->4)-beta-d-glucanase mRNAs predominated. The apparent molecular weights of the precursors for (1......-->3,1-->4)-beta-d-glucanase, alpha-amylase, and carboxypeptidase were 33,000, 44,000, and 35,000, respectively. In each case these are slightly higher (1,500-5,000) than molecular weights of the mature enzymes. Molecular weights of precursors immunoprecipitated from aleurone and scutellum mRNA translation...

  1. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus. (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang


    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  2. Identification of Circular RNAs From the Parental Genes Involved in Multiple Aspects of Cellular Metabolism in Barley

    Directory of Open Access Journals (Sweden)

    Behrooz eDarbani


    Full Text Available RNA circularization made by head-to-tail back-splicing events is involved in the regulation of gene expression from transcriptional to post-translational levels. By exploiting RNA-Seq data and down-stream analysis, we shed light on the importance of circular RNAs in plants. The results introduce circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes including protein coding transcripts, microRNA, rRNA, and long non-coding/microprotein coding RNAs. The results shed light on the mitochondrial exonic circular RNAs and imply the importance of circular RNAs for regulation of mitochondrial genes. Importantly, we introduce circular RNAs in barley and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs' functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear transcripts.Keywords: circular RNAs, coding and non-coding transcripts, leaves, seeds, transfer cells, micronutrients, mitochondria

  3. Transcriptome reprogramming due to the introduction of a barley telosome into bread wheat affects more barley genes than wheat. (United States)

    Rey, Elodie; Abrouk, Michael; Keeble-Gagnère, Gabriel; Karafiátová, Miroslava; Vrána, Jan; Balzergue, Sandrine; Soubigou-Taconnat, Ludivine; Brunaud, Véronique; Martin-Magniette, Marie-Laure; Endo, Takashi R; Bartoš, Jan; Appels, Rudi; Doležel, Jaroslav


    Despite a long history, the production of useful alien introgression lines in wheat remains difficult mainly due to linkage drag and incomplete genetic compensation. In addition, little is known about the molecular mechanisms underlying the impact of foreign chromatin on plant phenotype. Here, a comparison of the transcriptomes of barley, wheat and a wheat-barley 7HL addition line allowed the transcriptional impact both on 7HL genes of a non-native genetic background and on the wheat gene complement as a result of the presence of 7HL to be assessed. Some 42% (389/923) of the 7HL genes assayed were differentially transcribed, which was the case for only 3% (960/35 301) of the wheat gene complement. The absence of any transcript in the addition line of a suite of chromosome 7A genes implied the presence of a 36 Mbp deletion at the distal end of the 7AL arm; this deletion was found to be in common across the full set of Chinese Spring/Betzes barley addition lines. The remaining differentially transcribed wheat genes were distributed across the whole genome. The up-regulated barley genes were mostly located in the proximal part of the 7HL arm, while the down-regulated ones were concentrated in the distal part; as a result, genes encoding basal cellular functions tended to be transcribed, while those encoding specific functions were suppressed. An insight has been gained into gene transcription in an alien introgression line, thereby providing a basis for understanding the interactions between wheat and exotic genes in introgression materials. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Loose smut of barley grown in three types of farming

    Directory of Open Access Journals (Sweden)

    T. Nedelcheva


    Full Text Available Abstract. Over the period of 2014-2015, on the experimental field of the Institute of Agriculture in Karnobat, Bulgaria, was set a field trial with twenty cultivars of barley – 15 two-row: Obzor, Emon, Perun, Orfey, Lardeya, Asparuh, Kuber, Zagorets, Imeon, Sayra, Devinya, Sitara, Krami, Vicky, Potok; 3 four-row: Veslets, Aheloy 2, Tamaris; and 2 six-row cultivars – IZ Bori and Bozhin. All the cultivars were grown in three types of farming: conventional, organic and biodynamic. In conventional farming were applied pesticides and nitrogen fertilization. In the organic production were not used pesticides, mineral and organic fertilizers; and in biodynamic farming was applied biodynamic compost prepared from manure and biodynamic preparations (also organic. In conventional farming, the seeds were disinfected before sowing with Kinto plus (Triticonazole 20 g/l + Prochloraz 60 g/l, at a rate of 150 ml/100 kg seeds. In organic and biodynamic farming were used nondisinfected seeds. In the phenophase of full maturity of barley was conducted monitoring survey for plants infected with loose smut in all 2 the trial variants, the number of infected plants per m were counted and the infection rates were calculated. Infected plants of Tamaris grown in the three types of farming underwent microscopic analysis and measurement of 100 teliospores from each variant. The aim of this experiment was to investigate varietal susceptibility of barley to Ustilago nuda, grown in three types of farming, and to establish if the growing method affects the size of the teliospores of the pathogen. With two-row barley were found plants of Lardeya, Kuber, Devinya, Krami and Vicky infected with Ustilago nuda. Krami manifested the lowest resistance in the three types of farming. With four-row barley, Tamaris was found to be highly susceptible and Veslets was poorly resistant. Both cultivars expressed weaker susceptibility in conventional and biodynamic farming and stronger in

  5. Molecular phylogeography of domesticated barley traces expansion of agriculture in the Old World. (United States)

    Saisho, Daisuke; Purugganan, Michael D


    Barley (Hordeum vulgare ssp. vulgare) was first cultivated 10,500 years ago in the Fertile Crescent and is one of the founder crops of Eurasian agriculture. Phylogeographic analysis of five nuclear loci and morphological assessment of two traits in >250 domesticated barley accessions reveal that landraces found in South and East Asia are genetically distinct from those in Europe and North Africa. A Bayesian population structure assessment method indicates that barley accessions are subdivided into six clusters and that barley landraces from 10 different geographical regions of Eurasia and North Africa show distinct patterns of distribution across these clusters. Using haplotype frequency data, it appears that the Europe/North Africa landraces are most similar to the Near East population (F ST = 0.15) as well as to wild barley (F ST = 0.11) and are strongly differentiated from all other Asian populations (F ST = 0.34-0.74). A neighbor-joining analysis using these F ST estimates also supports a division between European, North African, and Near East barley types from more easterly Asian accessions. There is also differentiation in the presence of a naked caryopsis and spikelet row number between eastern and western barley accessions. The data support the differential migration of barley from two domestication events that led to the origin of barley--one in the Fertile Crescent and another farther east, possibly at the eastern edge of the Iranian Plateau--with European and North African barley largely originating from the former and much of Asian barley arising from the latter. This suggests that cultural diffusion or independent innovation is responsible for the expansion of agriculture to areas of South and East Asia during the Neolithic revolution.

  6. Characteristics of injury and recovery of net NO3- transport of barley seedlings from treatments of NaCl (United States)

    Klobus, G.; Ward, M. R.; Huffaker, R. C.


    The nature of the injury and recovery of nitrate uptake (net uptake) from NaCl stress in young barley (Hordeum vulgare L, var CM 72) seedlings was investigated. Nitrate uptake was inhibited rapidly by NaCl, within 1 minute after exposure to 200 millimolar NaCl. The duration of exposure to saline conditions determined the time of recovery of NO3- uptake from NaCl stress. Recovery was dependent on the presence of NO3- and was inhibited by cycloheximide, 6-methylpurine, and cerulenin, respective inhibitors of protein, RNA, and sterol/fatty acid synthesis. These inhibitors also prevented the induction of the NO3- uptake system in uninduced seedlings. Uninduced seedlings exhibited endogenous NO3- transport activity that appeared to be constitutive. This constitutive activity was also inhibited by NaCl. Recovery of constitutive NO3- uptake did not require the presence of NO3-.

  7. 76 FR 61287 - Request for Public Comment on the United States Standards for Barley (United States)


    ... barley marketing and define U.S. barley quality in the domestic and global marketplace. The standards define commonly used industry terms; contain basic principles governing the application of standards... standards using approved methodologies and can be applied at any point in the marketing chain. Furthermore...

  8. Demarcation of mutant-carrying regions in barley plants after ethylmethane-sulfonate seed treatment

    DEFF Research Database (Denmark)

    Jacobsen, P.


    The branching pattern of the barley plant is analyzed and the anatomical structure of the resting barley embryo studied in longitudinal and cross-sections as well as by dissection techniques. The frequency and distribution of ethylmethane-sulfonate induced chloroplast and morphological seedling...

  9. Effect of microwave freeze drying on quality and energy supply in drying of barley grass. (United States)

    Cao, Xiaohuang; Zhang, Min; Mujumdar, Arun S; Zhong, Qifeng; Wang, Zhushang


    Young barley grass leaves are well-known for containing the antioxidant substances flavonoid and chlorophyll. However, low product quality and energy efficiency exist with respect to the dehydration of barley grass leaves. To improve energy supply and the quality of barley grass, microwave heating instead of contact heat was applied for the freeze drying of barley grass at a pilot scale at 1, 1.5 and 2 W g -1 , respectively; After drying, energy supply and quality parameters of color, moisture content, chlorophyll, flavonoids, odors of dried barley grass were determined to evaluate the feasibility of the study. Microwave freeze drying (MFD) allowed a low energy supply and high contents of chlorophyll and flavonoids. A lightness value of 60.0, a green value of -11.5 and an energy supply of 0.61 kW h -1  g -1 were observed in 1.5 W g -1 MFD; whereas drying time (7 h) decreased by 42% compared to contact heating. Maximum content of flavonoid and chlorophyll was 11.7 and 12.8 g kg -1 barley grass. Microwave heating leads to an odor change larger than that for contact heating observed for the freeze drying of barley grass. MFD retains chlorophyll and flavonoids, as well as colors and odors of samples, and also decreases energy consumption in the freeze drying of barley grass. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  10. The draft genome of Tibetan hulless barley reveals adaptive patterns to the high stressful Tibetan Plateau. (United States)

    Zeng, Xingquan; Long, Hai; Wang, Zhuo; Zhao, Shancen; Tang, Yawei; Huang, Zhiyong; Wang, Yulin; Xu, Qijun; Mao, Likai; Deng, Guangbing; Yao, Xiaoming; Li, Xiangfeng; Bai, Lijun; Yuan, Hongjun; Pan, Zhifen; Liu, Renjian; Chen, Xin; WangMu, QiMei; Chen, Ming; Yu, Lili; Liang, Junjun; DunZhu, DaWa; Zheng, Yuan; Yu, Shuiyang; LuoBu, ZhaXi; Guang, Xuanmin; Li, Jiang; Deng, Cao; Hu, Wushu; Chen, Chunhai; TaBa, XiongNu; Gao, Liyun; Lv, Xiaodan; Abu, Yuval Ben; Fang, Xiaodong; Nevo, Eviatar; Yu, Maoqun; Wang, Jun; Tashi, Nyima


    The Tibetan hulless barley (Hordeum vulgare L. var. nudum), also called "Qingke" in Chinese and "Ne" in Tibetan, is the staple food for Tibetans and an important livestock feed in the Tibetan Plateau. The diploid nature and adaptation to diverse environments of the highland give it unique resources for genetic research and crop improvement. Here we produced a 3.89-Gb draft assembly of Tibetan hulless barley with 36,151 predicted protein-coding genes. Comparative analyses revealed the divergence times and synteny between barley and other representative Poaceae genomes. The expansion of the gene family related to stress responses was found in Tibetan hulless barley. Resequencing of 10 barley accessions uncovered high levels of genetic variation in Tibetan wild barley and genetic divergence between Tibetan and non-Tibetan barley genomes. Selective sweep analyses demonstrate adaptive correlations of genes under selection with extensive environmental variables. Our results not only construct a genomic framework for crop improvement but also provide evolutionary insights of highland adaptation of Tibetan hulless barley.

  11. Microarray Analysis of Late Response to Boron Toxicity in Barley (Hordeum vulgare L.) Leaves

    NARCIS (Netherlands)

    Oz, M.T.; Yilmaz, R.; Eyidogan, F.; Graaff, de L.H.; Yucel, M.; Oktem, H.A.


    DNA microarrays, being high-density and high-throughput, allow quantitative analyses of thousands of genes and their expression patterns in parallel. In this study, Barley1 GereChip was used to investigate transcriptome changes associated with boron (B) toxicity in a sensitive barley cultivar

  12. Ingestible roasted barley for contrast-enhanced photoacoustic imaging in animal and human subjects. (United States)

    Wang, Depeng; Lee, Dong Hyeun; Huang, Haoyuan; Vu, Tri; Lim, Rachel Su Ann; Nyayapathi, Nikhila; Chitgupi, Upendra; Liu, Maggie; Geng, Jumin; Xia, Jun; Lovell, Jonathan F


    Photoacoustic computed tomography (PACT) is an emerging imaging modality. While many contrast agents have been developed for PACT, these typically cannot immediately be used in humans due to the lengthy regulatory process. We screened two hundred types of ingestible foodstuff samples for photoacoustic contrast with 1064 nm pulse laser excitation, and identified roasted barley as a promising candidate. Twenty brands of roasted barley were further screened to identify the one with the strongest contrast, presumably based on complex chemical modifications incurred during the roasting process. Individual roasted barley particles could be detected through 3.5 cm of chicken-breast tissue and through the whole hand of healthy human volunteers. With PACT, but not ultrasound imaging, a single grain of roasted barley was detected in a field of hundreds of non-roasted particles. Upon oral administration, roasted barley enabled imaging of the gut and peristalsis in mice. Prepared roasted barley tea could be detected through 2.5 cm chicken breast tissue. When barley tea was administered to humans, photoacoustic imaging visualized swallowing dynamics in healthy volunteers. Thus, roasted barley represents an edible foodstuff that should be considered for photoacoustic contrast imaging of swallowing and gut processes, with immediate potential for clinical translation. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Standardized ileal digestibility of amino acids in eight genotypes of barley fed to growing pigs

    DEFF Research Database (Denmark)

    Spindler, H K; Mosenthin, R; Rosenfelder, Pia


    . In conclusion, a comprehensive database on chemical composition and SID of CP and AA in eight current barley genotypes has been made available. However, as present SID values are lower compared to feed tables, adjustments are required to minimize the risk of overestimating the actual protein value of barley...

  14. Effect of pulsed electric field on the germination of barley seeds

    DEFF Research Database (Denmark)

    Dymek, Katarzyna; Dejmek, Petr; Panarese, Valentina


    This study explores metabolic responses of germinating barley seeds upon the application of pulsed electric fields (PEF). Malting barley seeds were steeped in aerated water for 24 h and PEF-treated at varying voltages (0 (control), 110, 160, 240, 320, 400 and 480 V). The seeds were then allowed...

  15. Regrowth in Barley (Hordeum vulgare L.) and Rye (Secale cereale L.)

    DEFF Research Database (Denmark)

    Christiansen, J L; Jørgensen, Johannes Ravn; Jørnsgård, B


    Regrowth after cutting at four development stages, from heading to grain maturity, was investigated in a pot experiment containing three rye and four barley varieties (including 2 Hordeum spontaneum lines). Regrowth in the barley varieties decreased strongly from heading to grain maturity. Rye ge...

  16. Complex Interspecific Hybridization in Barley (Hordeum vulgare L.) and the Possible Occurrence of Apomixis

    DEFF Research Database (Denmark)

    Bothmer, R. von; Bengtsson, M.; Flink, J.


    Several complex hybrids were produced from the combination [(Hordeum lechleri, 6 .times. .times. H. procerum, 6 .times.) .times. H. vulgare, 2 .times.]. Crosses with six diploid barley lines resulted in triple hybrids, most of which had a full complement of barley chromosomes (no. 1-7), but were...

  17. Transformation of barley (Hordeum vulgare L.) by Agrobacterium tumefaciens infection of in vitro cultured ovules

    DEFF Research Database (Denmark)

    Holme, Inger; Brinch-Pedersen, Henrik; Lange, Mette


    Agrobacterium-mediated transformation of in vitro cultured barley ovules is an attractive alternative to well-established barley transformation methods of immature embryos. The ovule culture system can be used for transformation with and without selection and has successfully been used to transfo...

  18. NAC Transcription Factors of Barley (Hordeum vulgare L.) and their Involvement in Leaf Senescence

    DEFF Research Database (Denmark)

    Wagner, Michael

    parts of the senescence process. The specific aims of this study were therefore (1) to establish and characterise the NAC transcription factors of the model cereal crop barley (Hordeum vulgare L.) (2) to identify and study putative barley NAC transcription factors involved in the regulation of leaf...

  19. Investigation of the effect of nitrogen on severity of Fusarium Head Blight in barley

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, J.D.; Spliid, N.H.


    The effect of nitrogen on Fusarium Head Blight (FHB) in a susceptible barley cultivar was investigated using gel-based proteomics. Barley grown with either 15 or 100 kg ha(-1)N fertilizer was inoculated with Fusarium graminearum (Fg). The storage protein fraction did not change significantly...

  20. Dilute-acid pretreatment of barley straw for biological hydrogen production using Caldicellulosiruptor saccharolyticus

    NARCIS (Netherlands)

    Panagiotopoulos, I.A.; Bakker, R.R.C.; Vrije, de G.J.; Claassen, P.A.M.; Koukios, E.G.


    The main objective of this study was to use the fermentability test to investigate the feasibility of applying various dilute acids in the pretreatment of barley straw for biological hydrogen production. At a fixed acid loading of 1% (w/w dry matter) 28-32% of barley straw was converted to soluble

  1. Matrix attachment regions (MARs) enhance transformation frequencies and reduce variance of transgene expression in barley

    DEFF Research Database (Denmark)

    Petersen, K.; Leah, R.; Knudsen, S.


    -MAR from petunia revealed that only the P1-MAR had specific binding affinity for barley nuclear matrices. The barley transformation frequency with the uidA reporter gene was increased 2-fold when the gene was flanked with either the P1-MAR or TBS-MAR, while the gene copy number was strongly reduced...

  2. High-resolution mapping of the barley Ryd3 locus controlling tolerance to BYDV

    NARCIS (Netherlands)

    Lüpken, T.; Stein, N.; Perovic, D.; Habekuss, A.; Serfling, A.; Krämer, I.; Hähnel, U.; Steuernagel, B.; Scholz, U.; Ariyadasa, R.; Martis, M.; Mayer, K.; Niks, R.E.; Collins, N.C.; Friedt, W.; Ordon, F.


    Barley yellow dwarf disease (BYD) is transmitted by aphids and is caused by different strains of Barley yellow dwarf virus (BYDV) and Cereal yellow dwarf virus (CYDV). Economically it is one of the most important diseases of cereals worldwide. Besides chemical control of the vector, growing of

  3. Linkage disequilibrium mapping of morphological, resistance, and other agronomically relevant traits in modern spring barley cultivars

    NARCIS (Netherlands)

    Kraakman, A.T.W.; Martinez, F.; Mussiraliev, B.; Eeuwijk, van F.A.; Niks, R.E.


    A set of 148 modern spring barley cultivars was explored for the extent of linkage disequilibrium (LD) between genes governing traits and nearby marker alleles. Associations of agronomically relevant traits (days to heading, plant height), resistance traits (leaf rust, barley yellow dwarf virus

  4. Lysine Rich Proteins in the Salt-Soluble Protein Fraction of Barley

    DEFF Research Database (Denmark)

    Ingversen, J.; Køie, B.


    Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2.......Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2....

  5. Growth and yield of barley (Hordeum vulgare L.) as affected by ...

    African Journals Online (AJOL)


    (2003) reported that about 65% of grain yield variability in barley was attributed to ... of those of the respective non-stressed environments (Cantero-Martínez et ... production stability of barley (Fekadu and Skjelvåg, 2002) and nitrogen and phosphorus are .... of SAS version 9.1 for analysis of variance of non-orthogonal data.

  6. Development and characterization of polymorphic EST based SSR markers in barley (Hordeum vulgare). (United States)

    Jo, Won-Sam; Kim, Hye-Yeong; Kim, Kyung-Min


    In barley, breeding using good genetic characteristics can improve the quality or quantity of crop characters from one generation to the next generation. The development of effective molecular markers in barley is crucial for understanding and analyzing the diversity of useful alleles. In this study, we conducted genetic relationship analysis using expressed sequence tag-simple sequence repeat (EST-SSR) markers for barley identification and assessment of barley cultivar similarity. Seeds from 82 cultivars, including 31 each of naked and hulled barley from the Korea Seed and Variety Service and 20 of malting barley from the RDA-Genebank Information Center, were analyzed in this study. A cDNA library of the cultivar Gwanbori was constructed for use in analysis of genetic relationships, and 58 EST-SSR markers were developed and characterized. In total, 47 SSR markers were employed to analyze polymorphisms. A relationship dendrogram based on the polymorphism data was constructed to compare genetic diversity. We found that the polymorphism information content among the examined cultivars was 0.519, which indicates that there is low genetic diversity among Korean barley cultivars. The results obtained in this study may be useful in preventing redundant investment in new cultivars and in resolving disputes over seed patents. Our approach can be used by companies and government groups to develop different cultivars with distinguishable markers. In addition, the developed markers can be used for quantitative trait locus analysis to improve both the quantity and the quality of cultivated barley.

  7. Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans. (United States)

    Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui


    Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.

  8. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops. (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo


    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  9. Distribution Map and Community Characteristics of Weeds in Barley Fields of Ardabil Province

    Directory of Open Access Journals (Sweden)

    B. Soheili


    Full Text Available Surveying weeds of irrigated barley fields is one of the most important practices in weed management. Based on cultivated areas irrigated barley in all counties of Ardabil province during six years (2000-2005, 46 sample barley fields were selected and weed species were counted in each sampling point and population indices were calculated with Thomas method. By using specific furmula the density, frequency and uniformity of each weed species in fields were calculated. In each field longitude, latitude and altitude were recorded by using GPS. These data were used for producing weed maps using GIS. Results showed that Galium tricurnatum, Fumaria vaillantiand Raphanus raphanistrum were dominante broadleaf species in irrigated barley fields of Ardabil province. The dominant grassy weed species in these fields were Avena fatua and Secale cereal. Convolvulus arvensis and Cirsium arvense were the most important troublesome plants prior to harvesting in irrigated barley fields of this province.

  10. Targeted modification of storage protein content resulting in improved amino acid composition of barley grain

    DEFF Research Database (Denmark)

    Sikdar, Md. Shafiqul Islam; Bowra, S; Schmidt, Daiana


    family members. Analysis of the AA composition of the transgenic lines showed that the level of essential amino acids increased with a concomitant reduction in proline and glutamine. Both the barley C-hordein and wheat ω-gliadin genes proved successful for RNAi-gene mediated suppression of barley C......C-hordein in barley and ω-gliadins in wheat are members of the prolamins protein families. Prolamins are the major component of cereal storage proteins and composed of non-essential amino acids (AA) such as proline and glutamine therefore have low nutritional value. Using double stranded RNAi...... silencing technology directed towards C-hordein we obtained transgenic barley lines with up to 94.7 % reduction in the levels of C-hordein protein relative to the parental line. The composition of the prolamin fraction of the barley parental line cv. Golden Promise was resolved using SDS...

  11. Nitrogen immobilization and mineralization during initial decomposition of 15N-labelled pea and barley residues

    DEFF Research Database (Denmark)

    Jensen, E.S.


    The immobilization and mineralization of N following plant residue incorporation were studied in a sandy loam soil using N-15-labelled field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) straw. Both crop residues caused a net immobilization of soil-derived inorganic N during...... the complete incubation period of 84 days. The maximum rate of N immobilization was found to 12 and 18 mg soil-derived N g(-1) added C after incorporation of pea and barley residues, respectively. After 7 days of incubation, 21% of the pea and 17% of the barley residue N were assimilated by the soil microbial...... the decomposition of the barley residue. The net mineralization of residue-derived N was 2% in the barley and 22% in the pea residue treatment after 84 days of incubation. The results demonstrated that even if crop residues have a relative low C/N ratio (15), transient immobilization of soil N in the microbial...

  12. Substitution of wheat dried distillers grains with solubles for barley grain or barley silage in feedlot cattle diets: intake, digestibility, and ruminal fermentation. (United States)

    Li, Y L; McAllister, T A; Beauchemin, K A; He, M L; McKinnon, J J; Yang, W Z


    The objective of this study was to evaluate the effects of substituting wheat dried distillers grains with solubles (DDGS) for barley grain and barley silage on intake, digestibility, and ruminal fermentation in feedlot beef cattle. Eight ruminally cannulated Angus heifers (initial BW 455 ± 10.8 kg) were assigned to a replicated 4 × 4 Latin square design with 4 treatments: control, low (25%), medium (30%), and high (35%) wheat DDGS (DM basis). The diets consisted of barley silage, barley concentrate, and wheat DDGS in ratios of 15:85:0 (CON), 10:65:25 (25DDGS), 5:65:30 (30DDGS), and 0:65:35 (35DDGS; DM basis), respectively. The diets were formulated such that wheat DDGS was substituted for both barley grain and barley silage to evaluate whether wheat DDGS can be fed as a source of both energy (grain) and fiber in feedlot finishing diets. Intakes (kg/d) of DM and OM were not different, whereas those of CP, NDF, ADF, and ether extract (EE) were greater (P Ruminal pH and total VFA concentrations were not different (P > 0.15) between 25DDGS and CON diets. Replacing barley silage with increasing amounts of wheat DDGS (i.e., from 25DDGS to 35DDGS) linearly reduced (P ruminal pH tended (P=0.10) to linearly decrease, and ruminal pH status decreased with longer (P=0.04) duration of pH 0.19) ruminal VFA and NH(3)-N concentrations. Results indicated that wheat DDGS can be effectively used to replace both barley grain and silage at a moderate amount to meet energy and fiber requirements of finishing cattle. However, when silage content of the diet is low (ruminal pH status even though the rapidly fermentable starch content of the diet is considerably reduced. © 2011 American Society of Animal Science. All rights reserved.

  13. The fungal community structure of barley malts from diverse geographical regions correlates with malt quality parameters. (United States)

    Kaur, Mandeep; Bowman, John P; Stewart, Doug C; Evans, David E


    Malt is a preferred base for fermentations that produce beer or whisky. Barley for malt is grown under diverse environments in different geographical locations. Malt provides an ecological niche for a varied range of microorganisms with both positive and negative effects on its quality for brewing. Little information exists in the literature on the microbial community structure of Australian malt as well as broader global geographical differences in the associated fungal and bacterial communities. The aims of the present study were to compare the bacterial and fungal community structures of Australian commercial malt with its international counterparts originating from different geographical regions using terminal restriction fragment length polymorphism (TRFLP) fingerprinting and clone library analyses of ribosomal RNA genes. Further, the relationship between malt associated microbial communities and conventional malt quality parameters was also compared. Results showed that differences in fungal communities of malts from different geographical location were more pronounced than bacterial communities. TRFLP analysis discriminated high quality commercial malts with low fungal loads from malts deliberately infected with fungal inocula (Fusarium/Penicillium). Malt moisture, beta-amylase, α-amylase and limit dextrinase contents showed significant correlations with fungal community structure. This investigation concluded that fungal community structure was more important to subsequent malt quality outcomes than bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Effects of process parameters on the properties of barley containing snacks enriched with brewer's spent grain. (United States)

    Kirjoranta, Satu; Tenkanen, Maija; Jouppila, Kirsi


    Brewer's spent grain (BSG), a by-product of malting of barley in the production of malt extract, was used as an ingredient in extruded barley-based snacks in order to improve the nutritional value of the snacks and widen the applications of this by-product in food sector. The effects of the extrusion parameters on the selected properties of the snacks were studied. Snacks with different ingredients including whole grain barley flour, BSG, whey protein isolate (WPI), barley starch and waxy corn starch were produced in 5 separate trials using a co-rotating twin-screw extruder. Extrusion parameters were water content of the mass (17-23 %), screw speed (200-500 rpm) and temperature of the last section and die (110-150 °C). Expansion, hardness and water content of the snacks were determined. Snacks containing barley flour and BSG (10 % of solids) had small expansion and high hardness. Addition of WPI (20 % of solids) increased expansion only slightly. Snacks with high expansion and small hardness were obtained when part of the barley flour was replaced with starch (barley or waxy corn). Yet, the highest expansion and the smallest hardness were achieved when barley flour was used with barley starch and WPI without BSG. Furthermore, expansion increased by increasing screw speed and decreasing water content of the mass in most of the trials. This study showed that BSG is a suitable material for extruded snacks rich in dietary fiber. Physical properties of the snacks could be improved by using barley or waxy corn starch and WPI.

  15. Characterization of the Entire Cystatin Gene Family in Barley and Their Target Cathepsin L-Like Cysteine-Proteases, Partners in the Hordein Mobilization during Seed Germination1[W (United States)

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel


    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340

  16. Effects of Pleurotus sapidus (Schulzer Sacc. treatment on nutrient composition and ruminal fermentability of barley straw, barley rootless, and a mixture of the two

    Directory of Open Access Journals (Sweden)

    Alfonso Soto-Sánchez


    Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.

  17. Breeding cultivars of barley and mustard containing biochemical mutants

    Energy Technology Data Exchange (ETDEWEB)

    Oram, R N [Division of Plant industry, CSIRO, Canberra (Australia)


    Full text: The inactivation of dominant and co-dominant alleles is becoming increasingly important in changing the composition of seed carbohydrates, protein, oil, fibre and secondary products to suit modern food and feed technologies. In barley, breeding lines adapted to south-eastern Australian conditions have been developed containing a waxy endosperm from the Japanese variety 'Sumire Mochi', the high lysine gene lys from cv. 'Hiproly' of Ethiopia, and the induced high lysine mutant gene lys 3a from 'Risoe 1508'. The improved mutant lines yield 12-34% less than the highest yielding feed barley. The lys and lys 3a alleles suppress the formation of prolamins, the waxy allele inhibits the formation of amylose. It seems difficult to modify the background genotype to fully compensate for the reduction of major storage carbohydrate or protein compounds. However, waxy barleys have uses in some human foods and a premium can be paid to producers. The grain of the provisionally-patented waxy cultivar Wasiro is suitable for pearling. It contains 5% {beta}-glucan (soluble fibre) and therefore should be as effective as oat bran for reducing blood cholesterol. In Indian mustard (Brassica juncea), three cultivars differing in date of maturity, each containing the spontaneous mutant alleles for low erucic acid levels in the seed oil, have been developed to produce a high quality, mildly flavoured cooking/salad oil. The concentration of glucosinolates in the seed meal must be reduced to make it palatable and non-toxic to pigs and poultry. Three B. juncea lines were treated in up to four successive generations with gamma rays or EMS. 60,000 seed samples were analysed in subsequent generations. Two induced mutants with reduced glucosinolate concentrations are now available besides 4 naturally-occurring sources with only little reduced yields. Recombination may give a high-yielding low erucic acid and low glucosinolate variety of B. juncea. (author)

  18. Breeding cultivars of barley and mustard containing biochemical mutants

    International Nuclear Information System (INIS)

    Oram, R.N.


    Full text: The inactivation of dominant and co-dominant alleles is becoming increasingly important in changing the composition of seed carbohydrates, protein, oil, fibre and secondary products to suit modern food and feed technologies. In barley, breeding lines adapted to south-eastern Australian conditions have been developed containing a waxy endosperm from the Japanese variety 'Sumire Mochi', the high lysine gene lys from cv. 'Hiproly' of Ethiopia, and the induced high lysine mutant gene lys 3a from 'Risoe 1508'. The improved mutant lines yield 12-34% less than the highest yielding feed barley. The lys and lys 3a alleles suppress the formation of prolamins, the waxy allele inhibits the formation of amylose. It seems difficult to modify the background genotype to fully compensate for the reduction of major storage carbohydrate or protein compounds. However, waxy barleys have uses in some human foods and a premium can be paid to producers. The grain of the provisionally-patented waxy cultivar Wasiro is suitable for pearling. It contains 5% β-glucan (soluble fibre) and therefore should be as effective as oat bran for reducing blood cholesterol. In Indian mustard (Brassica juncea), three cultivars differing in date of maturity, each containing the spontaneous mutant alleles for low erucic acid levels in the seed oil, have been developed to produce a high quality, mildly flavoured cooking/salad oil. The concentration of glucosinolates in the seed meal must be reduced to make it palatable and non-toxic to pigs and poultry. Three B. juncea lines were treated in up to four successive generations with gamma rays or EMS. 60,000 seed samples were analysed in subsequent generations. Two induced mutants with reduced glucosinolate concentrations are now available besides 4 naturally-occurring sources with only little reduced yields. Recombination may give a high-yielding low erucic acid and low glucosinolate variety of B. juncea. (author)

  19. Objectives and results of barley breeding in Australia

    International Nuclear Information System (INIS)

    Sparrow, D.H.B.


    An important current development in Australian barley improvement is the release of semi-dwarf cultivars. These are derived from Abed Deba, Triumph or Aapo which are believed to have an allelic series of mutant genes. A common problem with these genes is their association with relatively late maturity and small grain, limiting current cultivars to rainfall areas above 450mm per annum. The first release 'Skiff' (S.A., N.S.W. 1988) is to be followed by selections from 'Forrest' x 'Aapo' in Western Australia and 'Grimmett' x 'Triumph' in Queensland, whilst 'Triumph' is already being grown in Tasmania. (author)

  20. Is barley malt safe as a food ingredient?

    DEFF Research Database (Denmark)

    Duedahl-Olesen, Lene; Olesen, P. A.

    hydrocarbons (PAH) are such process contaminants previously identified in e.g. smoked fish [3]. Germinated barley is smoke treated and for many whisky malt dried over peat-fuelled furnace for flavour addition probably with increased health risks for spent grain consumers as a result. To evaluate our concern we...... for animal feed and recently the high nutritive value has made it feasible as bread flour supplement [1] and therefore human food. Process contamination such as the genotoxic acrylamide formed due to Maillard reactions between reducing sugars and amino acids at raised temperature could appear during drying...

  1. Cadmium translocation and accumulation in developing barley grains

    DEFF Research Database (Denmark)

    Chen, Fei; Wu, Feibo; Dong, Jing


     Soil cadmium (Cd) contamination has posed a serious problem for safe food production and become a potential agricultural and environmental hazard worldwide. In order to study the transport of Cd into the developing grains, detached ears of two-rowed barley cv. ZAU 3 were cultured in Cd stressed...... of detached spike showed increase Cd accumulation for 5 days, followed by sharp decrease till day 10 and increase again after 12.5 days. Awn-removal and stem-girdling markedly decreased Cd concentration in grains, and sucrose or zinc (Zn) addition to the medium and higher relative humidity (RH) also induced...

  2. Genetic diversity and structure analysis in wild and landraces of barley from Jordan by using ISJ markers

    International Nuclear Information System (INIS)

    Baloch, A. W.; Balogh, M. J.; Baloch, M.; Baloch, I. A.


    The present experiment was carried out to estimate genetic diversity and genetic structure in cultivated and wild barley populations collected from Jordan which is considered as primary gene pool of barley. In a total, 94 cultivated barley accessions composed of 4 populations and 52 wild barley accessions consisted of 3 populations were used for genetic analysis using 7 Intron Splice Junction (ISJ) markers. The genetic diversity index (He) of cultivated barley ranged between 0.049 and 0.060; whereas that of wild barley populations ranged between 0.084 and 0.146, suggesting that wild resources of barley harbored greater genetic diversity than its domesticated counterpart, reflecting that barley domestication occurred with genetic bottleneck. Analysis of molecular variance showed high genetic variations among rather than within populations, referring that high genetic differentiation of barley populations caused by genetic and geographical separation of the populations in the harsh growing conditions of Fertile Crescent. Principal coordinate, clustering and structure analysis not only separated cultivated and wild barley, but also each single population, showing their genetic basis and original sample site. The obtained Results also revealed that there is lesser genetic communication between cultivated and wild barley under natural environments. The current findings can better be exploited for collection and utilization of plant germplasms. (author)

  3. Long Noncoding RNA HOTAIR Controls Cell Cycle by Functioning as a Competing Endogenous RNA in Esophageal Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Kewei Ren


    Full Text Available Recent studies have shown that long noncoding RNAs (lncRNAs play pivotal roles in the initiation and progression of cancer, including esophageal squamous cell carcinoma (ESCC. The lncRNA HOX transcript antisense RNA (HOTAIR was reported to be dysregulated and correlated with the progression of ESCC. However, the biological role and the underlying mechanism of HOTAIR in the development of ESCC remain unclear. Herein, we found that HOTAIR was aberrantly upregulated in ESCC cells and that HOTAIR depletion inhibited proliferation and led to G1 cell cycle arrest in ESCC cells. Besides, we found that HOTAIR acted as an endogenous sponge to downregulate miR-1 expression by directly binding to miR-1. Furthermore, HOTAIR overturned the effect of miR-1 on the proliferation and cell cycle profile in ESCC cells, which involved the derepression of cyclin D1 (CCND1 expression, a target of miR-1. Taken together, our study elucidated a novel HOTAIR /miR-1/CCND1 regulatory axis in which HOTAIR acted as a competing endogenous RNA by sponging miR-1 and upregulated CCND1 expression, thereby facilitating the tumorigenesis of ESCC. Investigation of this lncRNA/miRNA/mRNA pathway may contribute to a better understanding of ESCC pathogenesis and facilitate the development of lncRNA-directed therapy against this disease.

  4. Classification of Fusarium-Infected Korean Hulled Barley Using Near-Infrared Reflectance Spectroscopy and Partial Least Squares Discriminant Analysis

    Directory of Open Access Journals (Sweden)

    Jongguk Lim


    Full Text Available The purpose of this study is to use near-infrared reflectance (NIR spectroscopy equipment to nondestructively and rapidly discriminate Fusarium-infected hulled barley. Both normal hulled barley and Fusarium-infected hulled barley were scanned by using a NIR spectrometer with a wavelength range of 1175 to 2170 nm. Multiple mathematical pretreatments were applied to the reflectance spectra obtained for Fusarium discrimination and the multivariate analysis method of partial least squares discriminant analysis (PLS-DA was used for discriminant prediction. The PLS-DA prediction model developed by applying the second-order derivative pretreatment to the reflectance spectra obtained from the side of hulled barley without crease achieved 100% accuracy in discriminating the normal hulled barley and the Fusarium-infected hulled barley. These results demonstrated the feasibility of rapid discrimination of the Fusarium-infected hulled barley by combining multivariate analysis with the NIR spectroscopic technique, which is utilized as a nondestructive detection method.

  5. Effect of supplementation with barley and calcium hydroxide on intake of Mediterranean shrubs

    Directory of Open Access Journals (Sweden)

    Dragan Skobic


    Full Text Available Maquis plant communities are one of the most varied vegetation types in the Mediterranean region and an important habitat for wild and domestic herbivores. Although the majority of these shrubs are nutritious, the secondary compounds are main impediments that reduce their forage value. In five experiments we determined the effect of supplementing goats with calcium hydroxide plus barley, and barley alone on intake of five dominant shrubs (Quercus ilex, Erica multiflora, Arbutus unedo, Viburnum tinus and Pistacia lentiscus of the Mediterranean maquis community. The combination of calcium hydroxide plus barley and barley alone increased utilization of all five investigated Mediterranean shrubs; therewith that intake of Arbutus unedo and Viburnum tinus was not statistically significant. Supplemented goats with calcium hydroxide plus barley or barley alone could be effective in controlling secondary compounds-rich Mediterranean shrubs where their abundance threatens biodiversity. This control can be facilitated by browsing dominant Mediterranean shrubs, which has been shown to be effective in managing Mediterranean maquis density. Calcium hydroxide and barley (energy enhance use of secondary compounds-containing plants, which may increase production of alternate forages and create a more diverse mix of plant species in the Mediterranean maquis plant community.

  6. Barley fibre and wet distillers' solubles in the diet of growing cattle

    Directory of Open Access Journals (Sweden)

    T. ROOT


    Full Text Available Twenty-eight bulls were used in a 3 × 2 factorial design to study the effects of two by-products from the integrated starch-ethanol process, barley fibre and distillers' solubles, as supplements for grass silage. The animals were divided into five blocks and slaughtered when the average live weight (LW of each block reached 500 kg. The three energy supplements were barley (B, a mixture (1:1 on a dry matter (DM basis of barley and barley fibre (BF, and barley fibre (F, fed without (DS- or with (DS+ wet distillers' solubles (200 g kg-1 concentrate on DM basis. Concentrates were given at the rate of 95 g DM kg-1 LW0.6. Including barley fibre in the diet did not affect feed intake, but distillers' solubles tended to increase both silage and total DM intakes as well as amino acids absorbed in the intestine and energy intake. The protein balance in the rumen increased with the inclusion of barley fibre (P

  7. Physiological basis of barley yield under near optimal and stress conditions

    Directory of Open Access Journals (Sweden)

    Pržulj Novo


    Full Text Available Average barley yield fall below its potential due to incidence of stresses. Water stress is the main environmental factor limiting yield. The component a priori more sensitive to most stresses is the amount of radiation absorbed. The effect of stresses influence on the total amount of radiation absorbed by barley crop during its vegetation and the photosynthetic efficiency of radiation conversion. Growth inhibition is accompanied by reductions in leaf and cell wall extensibility. Grain yield under drought conditions is source limited. Supply of assimilates to the developing inflorescence plays a critical role in establishing final grain number and grain size. Grain weight is negatively affected by drought, high temperature, and any other factors that may reduce grain filling duration and grain filling rate. Awns and glaucousness confer better performance of barley under drought stress conditions. Barley responds with an increased accumulation of a number of proteins when subjected to different stress inducing cell dehydration. Screening techniques that are able to identify desirable genotypes based on the evaluation of physiological traits related to stress evasion and stress resistance maybe useful in breeding barley for resistance to stress, particularly drought stress. Crop management and breeding can reduce the incidence of stress on yield. The effect of these practices is sustained by an understanding of their physiology. In this paper the physiological basis of the processes determining barley yield and the incidence of stresses on photosynthetic metabolism that determine grain yield of barley is discussed. .

  8. In Vitro Biochemical Characterization of All Barley Endosperm Starch Synthases

    Directory of Open Access Journals (Sweden)

    Jose Antonio Cuesta-Seijo


    Full Text Available Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs. While the overall starch synthase (SS reaction is known, the functional differences between the five SS classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes. Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has maltoligosaccharides and not polysaccharides as its preferred substrates.

  9. Physiological responses in barley to applications of lanthanum

    International Nuclear Information System (INIS)

    Reddy, N.; Maheswaran, J.; Peverill, K.; Meehan, B.


    Full text: Chinese research and glasshouse investigations carried out in Victoria by the authors have shown that several plant species, when treated with Rare Earth Elements (REEs), retain greater amounts of moisture under water stressed conditions. The physiological adaptation of the plant to retain moisture in response to REE treatment however, has not been investigated. A glasshouse trial is currently in progress to study the physiological and agronomic responses of barley (cv. Schooner) grown in pots to application of lanthanum (0, 5 and 10 kg/ha), at a concentration of 0.05%, under well-watered (field capacity) and water-deficit (25 - 30% field capacity) conditions. Lanthanum was applied both directly to the soil and as a foliar spray. The physiological measurements include, photosynthetic rate, leaf water potential, osmotic potential, relative water content, stomatal conductance and water use efficiency. Measured agronomic parameters include plant height, tiller production, leaf area development, total grain weight, total biomass, root and shoot ratio and harvest index. Analysis of plant tissue for N, P, K, Ca, Mg, Zn and La to study the relationship between application of REE and nutrient uptake is also being carried out. The paper discusses physiological and agronomic changes in barley plants in response to treatment with lanthanum, under conditions of water stress

  10. Estimating Leaching Requirements for Barley Growth under Saline Irrigation

    Directory of Open Access Journals (Sweden)

    Ahmed Al-Busaidi


    Full Text Available The utilization of marginal water resources for agriculture is receiving considerable attention. The lands irrigated with saline water are required to reduce salt accumulations through leaching and/or drainage practices. A field experiment was carried out to investigate the effect of saline irrigation and leaching fraction on barley (Hordeum vulgare L. growth. For this purpose highly saline water was diluted to the salinity levels of 3, 6 and 9 dS m-1 and applied by drip irrigation at 0.0, 0.15, 0.20 and 0.25 leaching fractions (LF. The results of the experiment showed that both quantity and quality of water regulated salts distribution within the soil in the following manner: a the salts were found higher near or immediate below the soil surface; b an enhanced LF carried more salts down the soil horizon but there was no significant difference in plant yield between different treatments of leaching fractions. Salinity of water significantly impaired barley growth. The good drainage of sandy soil enhanced the leaching process and minimized the differences between leaching fractions. The increment in saline treatments (3, 6 and 9 dS m-1 added more salts and stressed plant growth. However, the conjunctive use of marginal water at proportional LF could be effective in enhancing the yield potential of crops in water-scarce areas.

  11. A fermented barley and soybean formula enhances skin hydration. (United States)

    Lee, Sein; Kim, Jong-Eun; Suk, Sujin; Kwon, Oh Wook; Park, Gaeun; Lim, Tae-Gyu; Seo, Sang Gwon; Kim, Jong Rhan; Kim, Dae Eung; Lee, Miyeong; Chung, Dae Kyun; Jeon, Jong Eun; Cho, Dong Woon; Hurh, Byung Serk; Kim, Sun Yeou; Lee, Ki Won


    Skin hydration is one of the primary aims of beauty and anti-aging treatments. Barley (Hordeum vulgare) and soybean (Glycine max) are major food crops, but can also be used as ingredients for the maintenance of skin health. We developed a natural product-based skin treatment using a barley and soybean formula (BS) incorporating yeast fermentation, and evaluated its skin hydration effects as a dietary supplement in a clinical study. Participants ingested a placebo- (n = 33) or BS- (3 g/day) containing drink (n = 32) for 8 weeks. A significant increase in hydration in the BS group as compared to the placebo group was observed on the faces of subjects after 4 and 8 weeks, and on the forearm after 4 weeks. Decreases in stratum corneum (SC) thickness were also observed on the face and forearm. BS enhanced hyaluronan (HA) and skin barrier function in vitro and reduced Hyal2 expression in human dermal fibroblasts (HDF). BS also recovered ultraviolet (UV) B-induced downregulation of HA in HaCaT cells. These results suggest that BS has promising potential for development as a health functional food to enhance skin health.

  12. Genomic Prediction of Manganese Efficiency in Winter Barley

    Directory of Open Access Journals (Sweden)

    Florian Leplat


    Full Text Available Manganese efficiency is a quantitative abiotic stress trait controlled by several genes each with a small effect. Manganese deficiency leads to yield reduction in winter barley ( L.. Breeding new cultivars for this trait remains difficult because of the lack of visual symptoms and the polygenic features of the trait. Hence, Mn efficiency is a potential suitable trait for a genomic selection (GS approach. A collection of 248 winter barley varieties was screened for Mn efficiency using Chlorophyll (Chl fluorescence in six environments prone to induce Mn deficiency. Two models for genomic prediction were implemented to predict future performance and breeding value of untested varieties. Predictions were obtained using multivariate mixed models: best linear unbiased predictor (BLUP and genomic best linear unbiased predictor (G-BLUP. In the first model, predictions were based on the phenotypic evaluation, whereas both phenotypic and genomic marker data were included in the second model. Accuracy of predicting future phenotype, , and accuracy of predicting true breeding values, , were calculated and compared for both models using six cross-validation (CV schemes; these were designed to mimic plant breeding programs. Overall, the CVs showed that prediction accuracies increased when using the G-BLUP model compared with the prediction accuracies using the BLUP model. Furthermore, the accuracies [] of predicting breeding values were more accurate than accuracy of predicting future phenotypes []. The study confirms that genomic data may enhance the prediction accuracy. Moreover it indicates that GS is a suitable breeding approach for quantitative abiotic stress traits.

  13. Transfer of radiocaesium to barley, rye grass and pea

    International Nuclear Information System (INIS)

    Oehlenschlaeger, M.; Gissel-Nielsen, G.


    In areas with intensive farming, as in Denmark, it is of great interest to identify possible countermeasures to be taken in order to reduce the longterm effects of radioactive contamination of arable land. The most important longer-lived radionuclides from the Chernobyl were 137 Cs and 134 Cs. The aim of the present project was to identify crops with relatively low or high root uptake of these two isotopes. Although such differences may be small, a shift in varieties might be a cost-effective way to reduce collective doses. The experiment was carried out at Risoe National Laboratory in the summer of 1988. The species used were: spring barley (Hordeum vulgare L) varieties: Golf, Apex, Anker, Sila; Perennial rye grass (Lolium perenne L.) varieties: Darbo (early) and Patoro (late); Italian rye-grass (Lolium multiflorum) variety: Prego; and pea (Pisum arvense L.) variety: Bodil. Each crop was grown in two types of soil, a clay-loam and an organic soil. 137 Cs was added to the clay-loam. The organic soil, which was contaminated with 137 Cs from the Chernobyl accident, was supplied with 134 Cs. Sila barley and Italian rye-grass were identified among the species tested as plants with a relative high uptake of radio-caesium. (author)

  14. Green Barley as an Ingredient in Pasta: Antioxidant Activity and Sensory Characteristics Evaluation

    Directory of Open Access Journals (Sweden)

    Ivanišová Eva


    Full Text Available The aims of the present study was to determine antioxidant activity, sensory properties as well as total polyphenol, flavonoid and chlorophyll content of raw and cooked pasta enriched by 1%, 3% and 5% addition of green barley powder. Results of antioxidant activity showed that increase of green barley addition increase antioxidant activity of pasta. The values in raw pasta obtained by DPPH ranged from 1.17 (control to 1.81 (5% addition mg TEAC/g DM, after cooking values ranged from 0.82 (control to 1.59 (5% addition mg TEAC/g DM. Similar tendency was signed by molybdenum reducing antioxidant power method. In enriched pasta was also found higher content of total polyphenol (0.19 in control raw sample and 1.81 mg GAE/g DM in pasta with 5 % of green barley addition; values of cooked pasta ranged from 0.10 in control sample to 0.73 mg GAE/g DM in pasta with 5 % of green barley addition as well as total flavonoid content (results of raw pasta were from 0.00 in control sample to 0.41 mg QE/g DM in pasta with 5% of green barley addition; values of cooked pasta were from 0.00 in control sample to 0.29 mg QE/g DM in variant with 5% green barley. Green barley also enriched pasta for chlorophyll with the best results in 5% addition. From prepared variants of enriched pasta the best overall acceptability was sign in 3% of green barley addition. Pastas enriched with plant-derived bioactive compounds such as green barley may confer health benefits to consumers.

  15. Comparison of agrobacterium mediated wheat and barley transformation with nucleoside diphosphate kinase 2 (NDPK2) gene

    International Nuclear Information System (INIS)

    Waheed, U.; Shah, M.M.; Smedley, M.; Harwood, W.


    An efficient and reliable transformation system is imperative for improvement of important crop species like barley and wheat. Wheat transformation is complex due to larger genome size and polyploidy while barley has a limitation of genotypic dependency. The objective of current study was to compare the relative transformation efficiency of wheat and barley using specific expression vector pBRACT 214-NDPK2 constructed through gateway cloning carrying Nucleoside Diphosphate Kinase 2 (NDPK2) gene. The vector was used to compare the transformation response in both crops using immature embryos through Agrobacterium mediated transformation. Both wheat and barley showed different responses towards callus induction and regeneration. Immature embryos of 1.5 to 2 mm in diameter was found optimum for wheat callus induction while 1 to 1.5 mm for barley. Both embryogenic and non-embryogenic calli were found in wheat with significantly greater tendency for embryogenecity in barley. The overall regeneration response was found different for all transformed wheat and barley cultivars. Wheat cultivars showed good response initially that drastically slowed down in later stages with the exception of Fielder that reached to the green shoots with good roots. The barley transformed lines showed good regeneration response as compared to wheat. PCR analysis of putative transformants using genomic DNA showed a maximum of 27% transformation efficiency in barely. No true transformation response was obtained in all cultivars of wheat used in this study. The protocol developed for wheat and barley transformation will greatly be helpful in crop improvement programme through genetic engineering especially in diploid relatives of cereals. (author)

  16. Reduction of deoxynivalenol in barley by treatment with aqueous sodium carbonate and heat. (United States)

    Abramson, David; House, James D; Nyachoti, C Martin


    Naturally contaminated lots of Canadian barley containing either 18.4 or 4.3 microg/g deoxynivalenol (DON) were heated at 80 degrees C, with small amounts of water or 1 M sodium carbonate solution to study the rate of DON reduction. Samples were heated in sealed polypropylene containers for periods of up to 8 days. In the 18.4 microg/g DON barley, rapid reductions were observed: with no solutions added, DON declined to 14.7 microg/g after 1 day, and to 4.9 microg/g after 8 days solely due to heat; with water at 10 mL/100 g barley, DON levels reached 3.7 microg/g after 8 days; with 1 M sodium carbonate solution added at 10 mL/100 g barley, DON declined to 4.7 microg/g after 1 day, and to 0.4 microg/g after 8 days; with 20 mL/100 g barley, DON declined to 1.4 microg/g after 1 day and to near-zero levels after 8 days. In the 4.3 microg/g DON barley, more gradual reductions were evident: with no solutions added, DON declined to 2.9 microg/g after 8 days solely due to heat; with water at 10 mL/100 g barley, DON levels reached 2.3 microg/g after 8 days; with 1 M sodium carbonate solution added at 10 mL/100 g barley, DON declined to 2.7 microg/g after 1 day, and to near-zero levels after 8 days; with 20 mL/100 g barley, DON declined to 1.4 microg/g after 1 day and to near-zero levels after 3, 5 and 8 days.

  17. Spring Barley Yield Parameters after Lignite, Sodium Humate and Nitrogen Utilization

    Directory of Open Access Journals (Sweden)

    Kováčik Peter


    Full Text Available The existence of a small number of publications dealing with the impact of solid sodium humate and lignite on the quantity and quality of grown crops was the reason for establishing the field experiment. The objective of this experiment was to detect the impact of solid lignite and solid sodium humate on the quantity and quality of spring barley yield. These substances were applied into the soil either independently or along with nitrogen fertiliser. The next objective was to determine the impact of foliar application of sodium humate water solution applied either independently or along with nitrogen fertiliser on the quality and quantity of spring barley yield. The achieved results showed that the autumn application of solid lignite and the presowing application of solid sodium humate into the soil tended to decrease the yield of both grain and straw of spring barley, crude protein content in grain, proportion of the first-class grains and volume weight of grain, whereas the impact of humate was more negative. Lignite and sodium humate in the solid form should be used along with nitrogen fertiliser. The application of sodium humate in liquid form during the growth season of barley tended to increase the yield of both grain and straw. The joint application of nitrogen and liquid sodium humate during the growth season of barley increased the grain yield of barley significantly. A lower dose of nitrogen, applied during the growth season of barley (growth season BBCH 23, increased the grain yield of barley considerably more than a higher N dose, applied into the soil before barley sowing.



    Džafić, A; Oručević-Žuljević, Sanja; Spaho, Nermina; Akagić, Asima


    The aim of this study was to investigate opportunities to improve the nutritional value of biscuits. Therefore, the content of β-glucans, physical, chemical and sensory properties of biscuits were determined in relation to a share of added barley flour and a baking temperature. Five different blends of barley and wheat were used for biscuit production: barley/wheat flours in combinations: 0/100; 25/75; 50/50; 75/25 and 100/0 according to the procedure described in AACC method 10-52. The temp...

  19. Barley (Hordeum vulgare L.) cysteine proteases: heterologous expression, purification and characterization

    DEFF Research Database (Denmark)

    Rosenkilde, Anne Lind; Dionisio, Giuseppe; Holm, Preben Bach


    During germination of barley seeds, mobilization of protein is essential and cysteine proteases accounts for more than 90 % of the total proteolytic activity in the degradation of barley seed storage proteins. Cysteine proteases exist as pro-enzyme and is activated through reduction of the active...... site cysteines and by removal of the pro-domain. The complement of cysteine proteases is comprehensive and for detailed studies of the individual components of this complement, a fast and efficient eukaryotic expression platform is highly desirable. A cDNA clone of the barley key cysteine endoprotease...

  20. Pea-barley intercropping and short-term subsequent crop effects across European organic cropping conditions

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, Henrik; Gooding, M.; Ambus, Per


    . In the replacement design the total relative plant density is kept constant, while the additive design uses the optimal sole crop density for pea supplementing with ‘extra’ barley plants. The pea and barley crops were followed by winter wheat with and without N application. Additional experiments in Denmark......) to grain N yield with 25–30% using the Land Equivalent ratio. In terms of absolute quantities, sole cropped pea accumulated more N in the grains as compared to the additive design followed by the replacement design and then sole cropped barley. The post harvest soil mineral N content was unaffected...

  1. Effect of crop density on competition by wheat and barley with Agrostemma githago and other weeds

    DEFF Research Database (Denmark)

    Doll, H.; Holm, U.; Søgaard, B.


    The effect of Agrostemma githago L. and other naturally occurring weeds on biomass production and grain yield was studied in winter wheat and winter barley. Naturally occurring weeds had only a negligible effect on barley, but reduced wheat grain yield by 10% at a quarter of normal crop density....... The interaction between the cereals and A. githago was studied in additive series employing different crop densities. Growth of this weed species was strongly dependent on crop density, which was more important for controlling weed growth than it was for obtaining a normal grain yield. Wheat and especially barley...

  2. Distinct developmental defense activations in barley embryos identified by transcriptome profiling

    DEFF Research Database (Denmark)

    Nielsen, ME; Lok, F; Nielsen, Henrik Bjørn


    analyses of > 22,000 genes, which together with measurements of jasmonic acid and salicylic acid during embryo development provide new information on the initiation in the developing barley embryo of at least two distinct types of developmental defense activation (DDA). Early DDA is characterized by the up......-regulation of several PR genes is notable. Throughout barley embryo development, there are no indications of an increased biosynthesis of either jasmonic acid or salicylic acid. Collectively, the results help explain how the proposed DDA enables protection of the developing barley embryo and grain for purposes...

  3. Structural Basis for Specificity of Propeptide-Enzyme Interaction in Barley C1A Cysteine Peptidases (United States)

    Cambra, Inés; Hernández, David; Diaz, Isabel; Martinez, Manuel


    C1A cysteine peptidases are synthesized as inactive proenzymes. Activation takes place by proteolysis cleaving off the inhibitory propeptide. The inhibitory capacity of propeptides from barley cathepsin L and B-like peptidases towards commercial and barley cathepsins has been characterized. Differences in selectivity have been found for propeptides from L-cathepsins against their cognate and non cognate enzymes. Besides, the propeptide from barley cathepsin B was not able to inhibit bovine cathepsin B. Modelling of their three-dimensional structures suggests that most propeptide inhibitory properties can be explained from the interaction between the propeptide and the mature cathepsin structures. Their potential use as biotechnological tools is discussed. PMID:22615948

  4. High capacity of plant regeneration from callus of interspecific hybrids with cultivated barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Jensen, C. J.; Andersen, B.


    Callus was induced from hybrids between cultivated barley (Hordeum vulgare L. ssp. vulgare) and ten species of wild barley (Hordeum L.) as well as from one backcross line ((H. lechleri .times. H. vulgare) .times. H. vulgare). Successful callus induction and regeneration of plants were achieved from...... explants of young spikes on the barley medium J 25-8. The capacity for plant regeneration was dependent on the wild parental species. In particular, combinations with four related wild species, viz. H. jubatum, H. roshevitzii, H. lechleri, and H. procerum, regenerated high numbers of plants from calli....

  5. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.


    .9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...

  6. Expression of Nudix hydrolase genes in barley under UV irradiation (United States)

    Tanaka, Sayuri; Sugimoto, Manabu; Kihara, Makoto

    Seed storage and cultivation should be necessary to self-supply foods when astronauts would stay and investigate during long-term space travel and habitation in the bases on the Moon and Mars. Thought the sunlight is the most importance to plants, both as the ultimate energy source and as an environmental signal regulating growth and development, UV presenting the sunlight can damage many aspects of plant processes at the physiological and DNA level. Especially UV-C, which is eliminated by the stratospheric ozone layer, is suspected to be extremely harmful and give a deadly injury to plants in space. However, the defense mechanism against UV-C irradiation damage in plant cells has not been clear. In this study, we investigated the expression of Nudix hydrolases, which defense plants from biotic / abiotic stress, in barley under UV irradiation. The genes encoding the amino acid sequences, which show homology to those of 28 kinds of Nudix hydrolases in Arabidopsis thaliana, were identified in the barley full-length cDNA library. BLAST analysis showed 14 kinds of barley genes (HvNUDX1-14), which encode the Nudix motif sequence. A phylogenetic tree showed that HvNUDX1, HvNUDX7, HvNUDX9 and HvNUDX11 belonged to the ADP-ribose pyrophosphohydrolase, ADP-sugar pyrophosphohydrolase, NAD(P)H pyrophosphohydrolase and FAD pyrophosphohydrolase subfamilies, respectively, HvNUDX3, HvNUDX6, and HvNUDX8 belonged to the Ap _{n}A pyrophosphohydrolase subfamilies, HvNUDX5 and HvNUDX14 belonged to the coenzyme A pyrophosphohydrolase subfamilies, HvNUDX12 and HvNUDX13 belonged to the Ap _{4}A pyrophosphohydrolase subfamilies. Induction of HvNUDX genes by UV-A (340nm), UV-B (312nm), and UV-C (260nm) were analyzed by quantitative RT-PCR. The results showed that HvNUDX4 was induced by UV-A and UV-B, HvNUDX6 was induced by UV-B and UV-C, and HvNUDX7 and HvNUDX14 were induced by UV-C, significantly. Our results suggest that the response of HvNUDXs to UV irradiation is different by UV

  7. Nanocapsule-mediated cytosolic siRNA delivery for anti-inflammatory treatment. (United States)

    Jiang, Ying; Hardie, Joseph; Liu, Yuanchang; Ray, Moumita; Luo, Xiang; Das, Riddha; Landis, Ryan F; Farkas, Michelle E; Rotello, Vincent M


    The use of nanoparticle-stabilized nanocapsules for cytosolic siRNA delivery for immunomodulation in vitro and in vivo is reported. These NPSCs deliver siRNA directly to the cytosol of macrophages in vitro with concomitant knockdown of gene expression. In vivo studies showed directed delivery of NPSCs to the spleen, enabling gene silencing of macrophages, with preliminary studies showing 70% gene knockdown at a siRNA dose of 0.28 mg/kg. Significantly, the delivery of siRNA targeting tumor necrosis factor-α efficiently silenced TNF-α expression in LPS-challenged mice, demonstrating efficacy in modulating immune response in an organ-selective manner. This research highlights the potential of the NPSC platform for targeted immunotherapy and further manipulation of the immune system. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  9. Supplementary Material for: Growth curve registration for evaluating salinity tolerance in barley

    KAUST Repository

    Meng, Rui; Saade, Stephanie; Kurtek, Sebastian; Berger, Bettina; Brien, Chris; Pillen, Klaus; Tester, Mark A.; Sun, Ying


    of HEB-25 barley families and the commercial variety, Navigator. We account for the spatial variation in smarthouse microclimates and in temporal variation across phenotyping runs using a functional ANOVA model to derive corrected FSS curves. From FSS, we

  10. A study on the qualitative and quantitative traits of barley (Hordeum ...

    African Journals Online (AJOL)


    Key words: Qualitative and quantitative, barley, narbon vetch, weed, dry land. ... and biomass production (Baishya and Sharma, 1990; ..... pakistan. Digitalverlag gmbh, germany. 157: 1-5. Pisulewska E, Hanczowski P, Pisulewski P (2003).

  11. Comparative Studies on Callose Formation in Powdery Mildew Compatible and Incompatible Barley

    DEFF Research Database (Denmark)

    Skou, Jens-Peder; Jørgensen, Jørgen Helms; Lilholt, Ulla


    Callose formation in barley mutants, lines and varieties with different genes for resistance to powdery mildew in seven different loci was compared. Only barley with resistance genes in the ml-o locus showed so early a callose formation passing off at such a high rate that it prevented fungal...... penetration Ml-(La) resistant varieties and near-isogenic lines in 'Manchuria' with resistance genes in 5 other loci showed only a tendency to a larger callose formation than their susceptible counterparts after inoculation with avirulent as well as virulent powdery mildew. The callose formation in ml......-o resistant barley was independent of the powdery mildew culture applied. This supports the hypothesis set forth as to why the ml-o mutants are resistant against all known cultures or races of barley powdery mildew, and why this resistance may be more durable than other powdery mildew resistances...

  12. Secretomics identifies Fusarium graminearum proteins involved in the interaction with barley and wheat

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, Jens D.; Svensson, Birte


    Fusarium graminearum is a phytopathogenic fungus primarily infecting small grain cereals, including barley and wheat. Secreted enzymes play important roles in the pathogenicity of many fungi. In order to access the secretome of F. graminearum, the fungus was grown in liquid culture with barley...... or wheat flour as the sole nutrient source to mimic the host–pathogen interaction. A gel‐based proteomics approach was employed to identify the proteins secreted into the culture medium. Sixty‐nine unique fungal proteins were identified in 154 protein spots, including enzymes involved in the degradation...... between wheat and barley flour medium were mainly involved in fungal cell wall remodelling and the degradation of plant cell walls, starch and proteins. The in planta expression of corresponding F. graminearum genes was confirmed by quantitative reverse transcriptase‐polymerase chain reaction in barley...

  13. Autoradiographic study on moisture distribution in pearl-barley and in rice grain

    International Nuclear Information System (INIS)

    Sakharov, Eh.V.; Koz'mina, E.P.; Troitskaya, E.Ya


    The dependence of some structural details of the pearl-barley and rice endosperm on the internal moisture distribution is found. The general scheme of the study is shown. The curves of the local moisture distribution in the pearly-barley and rice kernel are plotted according to the radiography data. Moisture distribution over the whole section of the rice kernel is relatively constant at 85 deg C after ten minutes of moisture. Whereas moisture of pearl-barley kernel is only approaching the center of kernel by the time the moisture content increases to 1.5-2%. The slow moisture transfer in the pearl-barley kernel makes the cooking period three times longer as that of the rice

  14. Tracer study on sulphur use efficiency in potato-barley sequence on acid soil of Shimla

    International Nuclear Information System (INIS)

    Sud, K.C.; Sharma, R.C.; Sharma, N.K.


    Controlled studies were conducted on acidic soil of Fagu (Shimla) to study the efficiency of labelled ammonium sulphate as effected by farmyard manure (FYM) on potato (Solanum tuberosum L.) and its residual effect on succeeding barley (Hordeum vulgare L.). The direct and residual effects of FYM and sulphur on dry matter yield and S concentration in potato and barley plants were significant. Applied FYM had a positive effect on radioassay values i.e. % Sdff and % S utilization by potato from labelled S carrier, whereas, the residual effect of applied S on barley was more than its direct effect on potato. Results indicate that combined application of S and FYM resulted in 3.4 per cent more S contribution to barley crop and was reflected in % S utilization values. (author)

  15. Interaction of micro and macro elements with manure on barley feed ...

    African Journals Online (AJOL)

    ajl yemi


    Nov 28, 2011 ... on barley feed yield and soil nutrient content in Sistan region ... In order to study the effect of interaction of 'micro' and 'macro' ... different proportions of manure and chemical fertilizer treatment were: 100% manure (F1), 100%.


    Directory of Open Access Journals (Sweden)

    Štefan Dráb


    Full Text Available Malting quality of barley depends on genetic and agro-ekological factors. Chemical composition of malting barley and its technological parameters are very important for malting and brewing, due to this fact the quality of barley must be strictly evaluated. The aim of this work was to evaluate the influence of variety, locality and year of production on the 5 technological parameters of malt: extract, relative extract at 45 °C, Kolbach index, diastatic power and friability. It was found out that the barley variety significantly influenced the following parameters: extract, relative extract and diastatic power. The growing locality weakly influenced qualitative parameters i.e. Kolbach index and relative extract at 45°C. The study confirmed the most significant impact of the year on the Kolbach index and friability.

  17. The enhanced callose deposition in barley with ml-o powdery mildew resistance genes

    DEFF Research Database (Denmark)

    Skou, Jens-Peder


    Carborundum treatment of barley leaves induced a callose deposition which was detected as diffuse blotches in the epidermal cells of susceptible barleys and as deeply stained tracks along the scratches in barleys with the ml-o powdery mildew resistance gene. Subsequent inoculation with powdery...... mildew resulted in appositions that enlarged inversely to their size in the respective varieties when inoculated without carborundum treatment. Aphids sucking the leaves resulted in rows of callose containing spots along the anticlinal cell walls. The spots were larger in the ml-o mutant than...... in the mother variety. Callose was deposited in connection with the pleiotropic necrotic spotting in barleys with the ml-o gene. Modification of the necrotic spotting by crossing the ml-o gene into other gene backgrounds did not result in any change in the size of appositions upon inoculation with powdery...

  18. Competition for and utilisation of sulfur in sole and intercrops of pea and barley

    DEFF Research Database (Denmark)

    Andersen, Mette Klindt; Hauggaard-Nielsen, Henrik; Jensen, Henning Høgh


    gave barley a growth and nutrient use advantage compared to pea (REIc values importance of initial size differences decreased relative to the effect of species identity in determining the competitive strength of the two species and by the end...

  19. Development and Meiosis of Three Interspecific Hybrids with Cultivated Barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Von Bothmer, R.; Flink, J.; Linde-Laursen, Ib


    The development and meiosis of three interspecific hybrids between cultivated barley (Hordeum vulgare L.) and H. secalinum Schreb., H. tetraploidum Covas, and H. parodii Covas, respectively, were studied. All three hybrid combinations developed very slowly vegetatively. Meiosis of the hybrids...

  20. CASE STUDY: North Africa and Middle East — Breeding better barley

    International Development Research Centre (IDRC) Digital Library (Canada)


    Jan 6, 2011 ... CASE STUDY: North Africa and Middle East — Breeding better barley — together ... In Syria, for example, "host farmers" in nine communities were ... and Yemen, the same approach is being applied to research on lentils.

  1. Barley uptake of N deposited in the rhizosphere of associated field pea

    DEFF Research Database (Denmark)

    Jensen, E.S.


    N deposited in the rhizosphere of a legume may contribute to the N-nutrition of an intercropped non-legume. The process of deposition and subsequent uptake by a neighbouring plant is often termed N-transfer. The N-transfer from field pea (Pisum sativum L.) to associated spring barley (Hordeum...... debris. Separating the root systems reduced the barley recovery of pea-derived N to about half the amount recovered in the association where root systems grew in the same compartment. The death of pea, caused by spraying with a herbicide, increased the amount of N recovered in barley, whereas shading...... the pea plant had no effect on the amount of pea-derived N taken up in barley. The N deposited up to 45 days of growth contributed

  2. Bacteria-Triggered Systemic Immunity in Barley Is Associated with WRKY and ETHYLENE RESPONSIVE FACTORs But Not with Salicylic Acid1[C][W (United States)

    Dey, Sanjukta; Wenig, Marion; Langen, Gregor; Sharma, Sapna; Kugler, Karl G.; Knappe, Claudia; Hause, Bettina; Bichlmeier, Marlies; Babaeizad, Valiollah; Imani, Jafargholi; Janzik, Ingar; Stempfl, Thomas; Hückelhoven, Ralph; Kogel, Karl-Heinz; Mayer, Klaus F.X.


    Leaf-to-leaf systemic immune signaling known as systemic acquired resistance is poorly understood in monocotyledonous plants. Here, we characterize systemic immunity in barley (Hordeum vulgare) triggered after primary leaf infection with either Pseudomonas syringae pathovar japonica (Psj) or Xanthomonas translucens pathovar cerealis (Xtc). Both pathogens induced resistance in systemic, uninfected leaves against a subsequent challenge infection with Xtc. In contrast to systemic acquired resistance in Arabidopsis (Arabidopsis thaliana), systemic immunity in barley was not associated with NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 or the local or systemic accumulation of salicylic acid. Instead, we documented a moderate local but not systemic induction of abscisic acid after infection of leaves with Psj. In contrast to salicylic acid or its functional analog benzothiadiazole, local applications of the jasmonic acid methyl ester or abscisic acid triggered systemic immunity to Xtc. RNA sequencing analysis of local and systemic transcript accumulation revealed unique gene expression changes in response to both Psj and Xtc and a clear separation of local from systemic responses. The systemic response appeared relatively modest, and quantitative reverse transcription-polymerase chain reaction associated systemic immunity with the local and systemic induction of two WRKY and two ETHYLENE RESPONSIVE FACTOR (ERF)-like transcription factors. Systemic immunity against Xtc was further associated with transcriptional changes after a secondary/systemic Xtc challenge infection; these changes were dependent on the primary treatment. Taken together, bacteria-induced systemic immunity in barley may be mediated in part by WRKY and ERF-like transcription factors, possibly facilitating transcriptional reprogramming to potentiate immunity. PMID:25332505

  3. Approaches to improving the nutritional quality of barley seed proteins

    International Nuclear Information System (INIS)

    Shewry, P.R.; Bright, S.W.J.; Burgess, S.R.; Miflin, B.J.


    The poor nutritional quality of barley grain is determined by the low level of lysine in the prolamin storage proteins (hordein). These account for between 35 to 50% of the total grain nitrogen, depending on the nutritional status of the plant. There is a reduced proportion of hordein in mutant high lysine lines but these also have reduced synthesis of storage carbohydrates and hence low yields. Three strategies for improvement are discussed. Increases in the lysine content of hordein may be difficult to achieve because of the presence of complex families of structural genes. It would also be necessary to insert a large number of additional lysine residues. Two more promising approaches are to increase the level of expression of genes coding for lysine-rich globulin storage proteins and to increase the pool of free lysine by selecting mutant lines with relaxed feedback regulation of lysine synthesis. (author)

  4. Brewing with 100 % unmalted grains: barley, wheat, oat and rye

    DEFF Research Database (Denmark)

    Zhuang, Shiwen; Shetty, Radhakrishna; Hansen, Mikkel


    of fermentable wort carbohydrates were observed in the worts (all at ca. 12°P), and in particular oat wort had lower concentration of maltose compared to the others, resulting in the lowest concentration of alcohol in final beer. Moreover, wort made from unmalted grains also showed lower free amino nitrogen......Whilst beers have been produced using various levels of unmalted grains as adjuncts along with malt, brewing with 100 % unmalted grains in combination with added mashing enzymes remains mostly unknown. The aim of this study was to investigate the brewing potential of 100 % unmalted barley, wheat......, oat and rye in comparison with 100 % malt. To address this, identical brewing methods were adopted at 10-L scale for each grain type by applying a commercial mashing enzyme blend (Ondea® Pro), and selected quality attributes were assessed for respective worts and beers. Different compositions...

  5. A change in radioresistance of barley under chronic irradiation

    International Nuclear Information System (INIS)

    Kal'chenko, V.A.; Shevchenko, V.A.; Fedotov, I.S.


    Mutation process and radioresistance of barley growing in an area with increased radiation background (beta radiation doss -0.6 R/day) have been analyzed. Experimental material is given with 250 kindred families where aberration level of chromosomes was analyzed in mitosis and meiosis during 4 years. It is shown that the first generations (M 1 -M 2 ) in experimental material demonstrate an increased level of structural mutations of chromosomes, while the subsequent generations (M 3 -M 4 ) demonstrate the level reduced to control. A higher radioresistance is observed in M 5 plants of chronically irradiated version as compared to nonirradiated version. It is suggested that increase in radioresistance results from the stimulation of repair systems with low doses of chronic irradiation as well as from the selection of a more radioresistant forms out of the population [ru

  6. Inhibition of coagulation factors by recombinant barley serpin BSZx

    DEFF Research Database (Denmark)

    Dahl, Søren Weis; Rasmussen, S.K.; Petersen, L..C.


    Barley serpin BSZx is a potent inhibitor of trypsin and chymotrypsin at overlapping reactive sites (Dahl, S.W., Rasmussen, S.K. and Hejgaard, J. (1996) J. Biol, Chem., in press), We have now investigated the interactions of BSZx with a range of serine proteinases from human plasma, pancreas......, urokinase and tissue type plasminogen activator, plasmin and pancreas kallikrein and elastase were not or only weakly affected, The inhibition pattern with mammalian proteinases reveal a specificity of BSZx similar to that of antithrombin III. Trypsin from Fusarium was not inhibited while interaction...... with subtilisin Carlsberg and Novo was rapid but most BSZx was cleaved as a substrate, Identification of a monoclonal antibody specific for native BSZx indicate that complex formation and loop cleavage result in similar conformational changes....

  7. Micro-PIXE evaluation of Fe distribution in barley roots

    International Nuclear Information System (INIS)

    Schneider, T.; Povh, B.; Strasser, O.; Gierth, M.; Przybylowicz, W.; Mesjasz-Przybylowicz, J.; Churms, C.; Schuessler, A.


    High Fe concentrations were reported from roots of plants grown in soil. This has been discussed as a possible Fe source for plants, since the concentrations shown in the roots were much higher than in the shoots. There are, however, also some indications that soil contamination at the root surface of soil grown plants could have led to an overestimation of the Fe concentration in roots. Fe distribution in root cross sections of barley (Hordeum vulgare L. cv. Alexis) has been studied to investigate this hypothesis. Micro-PIXE analyses in point and mapping mode were complemented by the STIM technique. Based on the correlation between Fe and soil-related elements (Ti, Al and Si), most of Fe located at the root surface could be attributed to soil contamination. It could also be shown that this soil contamination leads to an overestimation of Fe concentration in roots. (author)

  8. NASA crop calendars: Wheat, barley, oats, rye, sorghum, soybeans, corn (United States)

    Stuckey, M. R.; Anderson, E. N.


    Crop calenders used to determine when Earth Resources Technology Satellite ERTS data would provide the most accurate wheat acreage information and to minimize the amount of ground verified information needed are presented. Since barley, oats, and rye are considered 'confusion crops, i.e., hard to differentiate from wheat in ERTS imagery, specific dates are estimated for these crops in the following stages of development: (1) seed-bed operation, (2) planting or seeding, (3) intermediate growth, (4) dormancy, (5) development of crop to full ground cover, (6) heading or tasseling, and flowering, (7) harvesting, and (8) posting-harvest operations. Dormancy dates are included for fall-snow crops. A synopsis is given of each states' growing conditions, special cropping practices, and other characteristics which are helpful in identifying crops from ERTS imagery.

  9. The plasma membrane proteome of germinating barley embryos

    DEFF Research Database (Denmark)

    Hynek, Radovan; Svensson, Birte; Jensen, O.N.


    Cereal seed germination involves a complex coordination between different seed tissues. Plasma membranes must play crucial roles in coordination and execution of germination; however, very little is known about seed plasma membrane proteomes due to limited tissue amounts combined...... with amphiphilicity and low abundance of membrane proteins. A fraction enriched in plasma membranes was prepared from embryos dissected from 18 h germinated barley seeds using aqueous two-phase partitioning. Reversed-phase chromatography on C-4 resin performed in micro-spin columns with stepwise elution by 2-propanol...... was used to reduce soluble protein contamination and enrich for hydrophobic proteins. Sixty-one proteins in 14 SDS-PAGE bands were identified by LC-MS/MS and database searches. The identifications provide new insight into the plasma membrane functions in seed germination....

  10. Biomechanics of Wheat/Barley Straw and Corn Stover

    Energy Technology Data Exchange (ETDEWEB)

    Christopher T. Wright; Peter A. Pryfogle; Nathan A. Stevens; Eric D. Steffler; J. Richard Hess; Thomas H. Ulrich


    The lack of understanding of the mechanical characteristics of cellulosic feedstocks is a limiting factor in economically collecting and processing crop residues, primarily wheat and barley stems and corn stover. Several testing methods, including compression, tension, and bend have been investigated to increase our understanding of the biomechanical behavior of cellulosic feedstocks. Biomechanical data from these tests can provide required input to numerical models and help advance harvesting, handling, and processing techniques. In addition, integrating the models with the complete data set from this study can identify potential tools for manipulating the biomechanical properties of plant varieties in such a manner as to optimize their physical characteristics to produce higher value biomass and more energy efficient harvesting practices.

  11. Efflux of inorganic substances from young barley roots, (2)

    International Nuclear Information System (INIS)

    Fujimoto, Hiroshi; Kojima, Shigeru


    The root system of young barley was almost halved, and the two portions were planted in culture grounds with different composition after severing the capillary connection between both root groups. With one portion in the acid medium solution of various compositions and the other in the 22 Na-absorbing medium solution, the sodium absorbed from one root group moved to and flowed out from the other root group, and this state was observed. Also, the efflux of potassium from the root was observed. (1) The Na efflux was small in the culture ground with dilute hydrochloric acid, and larger in that with AlCl 3 or phosphate. (2) The K efflux was large under short-day condition. (3) Under short-day condition, in the culture ground with soluble Al, the K efflux was promoted by nitrogen-source addition, but the Na efflux was suppressed. (Mori, K.)

  12. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.


    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

  13. Preventive and Therapeutic Role of Functional Ingredients of Barley Grass for Chronic Diseases in Human Beings

    Directory of Open Access Journals (Sweden)

    Yawen Zeng


    Full Text Available Barley grass powder is the best functional food that provides nutrition and eliminates toxins from cells in human beings; however, its functional ingredients have played an important role as health benefit. In order to better cognize the preventive and therapeutic role of barley grass for chronic diseases, we carried out the systematic strategies for functional ingredients of barley grass, based on the comprehensive databases, especially the PubMed, Baidu, ISI Web of Science, and CNKI, between 2008 and 2017. Barley grass is rich in functional ingredients, such as gamma-aminobutyric acid (GABA, flavonoids, saponarin, lutonarin, superoxide dismutase (SOD, K, Ca, Se, tryptophan, chlorophyll, vitamins (A, B1, C, and E, dietary fiber, polysaccharide, alkaloid, metallothioneins, and polyphenols. Barley grass promotes sleep; has antidiabetic effect; regulates blood pressure; enhances immunity; protects liver; has anti-acne/detoxifying and antidepressant effects; improves gastrointestinal function; has anticancer, anti-inflammatory, antioxidant, hypolipidemic, and antigout effects; reduces hyperuricemia; prevents hypoxia, cardiovascular diseases, fatigue, and constipation; alleviates atopic dermatitis; is a calcium supplement; improves cognition; and so on. These results support that barley grass may be one of the best functional foods for preventive chronic diseases and the best raw material of modern diet structure in promoting the development of large health industry and further reveal that GABA, flavonoids, SOD, K-Ca, vitamins, and tryptophan mechanism of barley grass have preventive and therapeutic role for chronic diseases. This paper can be used as a scientific evidence for developing functional foods and novel drugs for barley grass for preventive chronic diseases.

  14. Two quantitative character selection following neutron and EMS treatment in malt barley. An applied micromutation experiment

    Energy Technology Data Exchange (ETDEWEB)

    Haensel, H; Simon, W; Ehrendorfer, K [Hochschule fuer Bodenkultur, Vienna (Austria)


    Mutation experiments in spring barley are described aimed at increasing the grain yield and ''classification'' (i.e. weight percent of caryopsis greater than 2.5 mm). The course of selection up to the M/sub 8/-generation obtained by self-pollination is given. A comparison is presented with materials obtained after neutron and ethyl methanesulfonate treatment. The possibilities are also discussed of using the methods of micromutation breeding for barley crop yield and its malt quality improvement.

  15. Dawn and Dusk Set States of the Circadian Oscillator in Sprouting Barley (Hordeum vulgare Seedlings.

    Directory of Open Access Journals (Sweden)

    Weiwei Deng

    Full Text Available The plant circadian clock is an internal timekeeper that coordinates biological processes with daily changes in the external environment. The transcript levels of clock genes, which oscillate to control circadian outputs, were examined during early seedling development in barley (Hordeum vulgare, a model for temperate cereal crops. Oscillations of clock gene transcript levels do not occur in barley seedlings grown in darkness or constant light but were observed with day-night cycles. A dark-to-light transition influenced transcript levels of some clock genes but triggered only weak oscillations of gene expression, whereas a light-to-dark transition triggered robust oscillations. Single light pulses of 6, 12 or 18 hours induced robust oscillations. The light-to-dark transition was the primary determinant of the timing of subsequent peaks of clock gene expression. After the light-to-dark transition the timing of peak transcript levels of clock gene also varied depending on the length of the preceding light pulse. Thus, a single photoperiod can trigger initiation of photoperiod-dependent circadian rhythms in barley seedlings. Photoperiod-specific rhythms of clock gene expression were observed in two week old barley plants. Changing the timing of dusk altered clock gene expression patterns within a single day, showing that alteration of circadian oscillator behaviour is amongst the most rapid molecular responses to changing photoperiod in barley. A barley EARLY FLOWERING3 mutant, which exhibits rapid photoperiod-insensitive flowering behaviour, does not establish clock rhythms in response to a single photoperiod. The data presented show that dawn and dusk cues are important signals for setting the state of the circadian oscillator during early development of barley and that the circadian oscillator of barley exhibits photoperiod-dependent oscillation states.

  16. Localization to Chromosomes of Structural Genes for the Major Protease Inhibitors of Barley Grains

    DEFF Research Database (Denmark)

    Hejgaard, Jørn; Bjørn, S.E.; Nielsen, Gunnar Gissel


    Wheat-barley chromosome addition lines were compared by isoelectric focusing of protein extracts to identify chromosomes carrying loci for the major immunochemically distinct protease inhibitors of barley grains. Structural genes for the following inhibitors were localized: an inhibitor of both...... endogenous α-amylase 2 and subtilisin (ASI) on chromosome 2, two chymotrypsin/subtilisin inhibitors (CI-1 and CI-2) on chromosome 5 (long arm) and the major trypsin inhibitor (TI-1) on chromosome 3....

  17. Linkage mapping of putative regulator genes of barley grain development characterized by expression profiling

    Directory of Open Access Journals (Sweden)

    Wobus Ulrich


    Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference


    Directory of Open Access Journals (Sweden)

    J. J. Ermolaev


    Full Text Available This work is devoted to development of a production line of kissels on the basis of grechishny and barley крахмалов, allowing to use their structural and mechanical and chemical properties, investigating rheological characteristics of solutions buckwheat and barley крахмалов, to receive the dry granulated drinks on the basis of vegetative raw materials which will partially solve problems of equation of a food.

  19. Evolution and Intensity of Hail in Wheat and Barley (United States)

    Bernaldo de Quirós, I.; Saa Requejo, A.; Tarquis, A. M.; Burgaz, F.


    The cereals have represented a very important place in the agriculture along the history. The current expansion and growth of the energetic markets are changing the role of the agriculture. The cereals, with other crops, are becoming more significant as suppliers of raw material for the production of biofuels. The purpose of the present project is to carry out a study about the hail in cereals. The survey is focus in wheat and barley as they both represent the highest cereal production of Spain. Four provinces have been chosen (those with the values of production are higher): Burgos and Zaragoza for the wheat and Cuenca and Valladolid for the barley. The materials and methods that we had available for the study of the evolution and intensity of the damages for hail include an analysis of the correlation between the ratios of agricultural insurances provided by ENESA and the number of days of annual hail (from 1981 to 2007). At the same time, one weather station per province was selected by the longest more complete data recorded (from 1963 to 2007) to perform an analysis of monthly time series of the number of hail days (HD). The results of the study show us that there is no relation between the ratio of the agricultural insurances and the number of hail days. This can be due to the large area of which the ratio refers to and the low density of meteorological stations to cover the hail that is registered in every of the four provinces. On the other hand, it is observed that monthly HD time series don't show a change in pattern except in one of the stations studied. Therefore with the information available we cannot state that there are clear changes in the evolution of the hail registered for each province.

  20. Early maturing mutations as germplasm stocks for barley breeding

    International Nuclear Information System (INIS)

    Ukai, Yasuo


    A total of 102 early maturing mutations have been isolated after various treatments of seeds or plants with ionizing radiations or chemicals from a barley cultivar 'Chikurin Ibaraki 1' or its mutants. Fifty of them were evaluated as regards responses to internal physiological factors. The mutants were found to have a mutational alteration in vernalization and/or photoperiodic response. Earliness in a narrow sense was not noticeably changed. The original genotype is a winter and long-day type. By mutation four different degrees of change in vernalization requirement i.e. complete (V 1 ) and incomplete (V 2 ) spring habit and winter habit with reduced requirement to varying degrees (V 3 , V 4 ) have been produced. Photoperiodic response was also changed into at least three types i.e. complete (P 1 ) and incomplete (P 2 ) loss of sensitivity to short photoperiod and a slight reduction in critical daylength for heading. P 1 and P 2 type mutants were all characterized by marked earliness in heading time in field. Thirty seven mutants were located in seven separate loci. Allelism test of the mutated genes to spontaneous ones revealed that the genes carried by P 1 type mutants were all allelic to an earliness gene ea sub(k) on chromosome 5 and the gene involved in P 2 type mutants to ea 7 on chromosome 6. On the contrary, the gene commonly involved in all V 1 type mutants and one V 2 type mutant was not allelic to spring habit gene Sh 2 or Sh 3 . It seemed likely that the gene was not allelic to, either, but closely linked with sh on chromosome 4. The diversity in terms of genetic and physiological properties of the early maturing mutants arising from common ancestry emphasizes the importance of induced mutation in broadening of germplasm of barley breeding. (author)

  1. Meat bone meal as fertiliser for barley and oat

    Directory of Open Access Journals (Sweden)

    L. CHEN


    Full Text Available The traditional production of mineral N and P fertilisers is unsustainable due its reliance on fossil fuels in the case of N, and on limited mineral resource stocks in the case of P. The use of alternative or complementary fertilisers that originate from organic waste materials is gaining interest. Organic farms, especially arable organic farms without livestock, need usable sources of plant nutrients. Meat bone meal (MBM, a potential organic fertiliser for agricultural crops, contains considerable amounts of nutrients (on average 8% N, 5% P, 1% K and 10% Ca. In EU countries, Commission regulation (EC No 181/2006 authorised the use of MBM as an organic fertiliser. In this study, MBM was compared to conventional mineral NPK fertiliser. Two randomised complete block split-plot field experiments were conducted: one with spring barley (Hordeum vulgare in two years; and another with oat (Avena sativa for three years, including a fourth year of testing for residual effect. Compared to mineral fertiliser (20% N, 3% P and 9% K, MBM was applied at three N levels: 60, 90 and 120 kg N ha-1. The grain yield of both cereal species supported by MBM, did not differ from the yield obtained with the mineral fertiliser at any N level. At 120 kg N ha-1, the grain yield level with either type was ca. 4500 kg ha-1 of barley and 5000 kg ha-1 of oat, representing fair averages for Finnish conditions. Moreover, MBM and mineral fertilisation showed no differences in quality in terms of 1000-grain weight, test-weight, protein content and protein yield. Since MBM has a low N/P ratio, P was applied in surplus to attain comparable N levels. Therefore MBM fertilisation should be fitted for crop rotation and for meeting environmental requirements.;

  2. Combinatorial Pooling Enables Selective Sequencing of the Barley Gene Space (United States)

    Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R.; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J.


    For the vast majority of species – including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding. PMID:23592960

  3. Combinatorial pooling enables selective sequencing of the barley gene space.

    Directory of Open Access Journals (Sweden)

    Stefano Lonardi


    Full Text Available For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.

  4. Combinatorial pooling enables selective sequencing of the barley gene space. (United States)

    Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J


    For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.

  5. Diversity for seedling vigor in wild barley (hordeum vulgare L. subs. simpatina) germplasm

    International Nuclear Information System (INIS)

    Tyagi, K.; Park, M.R.; Lee, H.J.; Lee, C.A.; Rehman, S.; Steffenson, B.; Lee, K.J.; Yun, S.J.


    Seedling vigor is important for improving stand establishment of barley crops, particularly in arid regions and areas where the soil temperature is low at sowing time. Three hundred and fifteen wild barley accessions from the Wild Barley Diversity Collection (WBDC) were evaluated for nine seedling vigor traits in a poly house and growth chamber under hydroponic conditions. The accessions exhibited significant differences for all traits investigated. Traits showing greatest phenotypic variation were seedling visual score, plant height, shoot fresh weight, shoot dry weight and shoot length. Seed weight exhibited the least variation. Seed weight was significantly correlated with visual seedling score and shoot and seedling fresh and dry weight. Correlation analysis showed that the visual seedling score was a reliable method for estimating seedling vigor in wild barley. The first three principal components (PC) explained 82.3% of the variation present in the WBDC with PC1(54.0%) associated with shoot fresh weight, shoot dry weight, seedling dry weight, seedling fresh weight, shoot length and seedling length. Accessions from the southwest portion of the Fertile Crescent, like WBDC020 (Turkey), WBDC238 (Jordan) and WBDC244 (Jordan) exhibited the highest positive values for most of the plant vigor traits investigated. These wild barley accessions likely carry alleles that will be useful for the improvement of plant vigor traits in cultivated barley. (author)

  6. Occurrence of deoxynivalenol and zearalenone in brewing barley grains from Brazil. (United States)

    Piacentini, Karim C; Rocha, L O; Savi, G D; Carnielli-Queiroz, L; Almeida, F G; Minella, E; Corrêa, B


    Barley (Hordeum vulgare L.) is an important cereal crop for food and represents one of the main ingredients in beer production. Considering the importance of barley and its derived products, the knowledge about the mycotoxin contamination in the barley production is essential in order to assess its safety. In this study, the levels of deoxynivalenol (DON) and zearalenone (ZEN) in brewing barley were determined using a LC-MS/MS method. A survey was conducted in 2015 to estimate the mycotoxin levels in these products (n = 76) from four crop regions in Brazil. The results showed high levels of DON and ZEN in the analyzed samples, with contamination levels of 94 and 73.6%, respectively. The mean levels of DON and ZEN ranged from 1700 to 7500 μg/kg and from 300 to 630 μg/kg, respectively. Barley samples from regions 1 and 2 presented higher levels of ZEN and DON, respectively, and those from region 4 presented lower levels of both. Co-occurrence of DON and ZEN was seen in the majority of the barley grain samples, and the mycotoxin content was above the maximum levels established by the Brazilian and European regulations.

  7. Allelopathic effect of ryegrass (lolium persicum) and wild mustard (sinapis arvensis) on barley

    International Nuclear Information System (INIS)

    Baziar, M.R.; Farahvash, F.; Mirshekari, B.; Rashidi, V.


    Most crop plants and weeds have allelopathic effects and analysis of these effects on plants in crop alteration and successive planting is very important. In this research the allelopathic ability of different parts and concentrations of two weeds, Lolium Persicum (Ryegrass) and Sinapis arvensis (wild mustered), on growth characteristics of two barley varieties was studied in the greenhouse using a completely randomized design with four replications. Test factors consisted of two barley varieties (Valfajr and Rehane), three weed organs (root, stalk, leaf) and four concentrations of extracts of weed organs (25, 50, 75 and control or distilled water). After the preparation of extracts of different weed organs with different concentrations, their effect on growth characteristics of barley plant was evaluated. Finally, seedling length, rootlet length caulicle length, wet weight of seedling, dry weight of seedling were measured. Also, the above two seeds had significant effects on the two strains of barley and could influence growth characteristics of barley. Based on the results of present study, one can argue that Ryegrass (Lolium Persicum) and wild mustard (Sinapis arvensis) can strongly affect germination, growth and performance of barley through production of chemical materials with allelopathic properties, leading unfavorable growth and product yield. (author)


    Lahouar, Lamia; Ghrairi, Fatma; El Arem, Amira; Medimagh, Sana; El Felah, Mouledi; Salem, Hichem Ben; Achour, Lotfi


    Many experimental studies have suggested an important role for barley Rihane(BR)in the prevention of colon cancer and cardiovascular diseases. The objective of this study was to evaluate the physico-chemical properties and nutritional characterizations of BR compared to other varieties grown in Tunisia (Manel, Roho and Tej). Total, insoluble and soluble dietary fiber(β-glucan), total protein, ash and some minerals of BR and Tunisian barley varieties were determined. The results revealed that BR is good source of dietary fiber mainly β-glucan compared to the other varieties. This variety is a relatively rich source of phosphorous and potassium and it contains many important unsaturated fatty acids. BR has higher nutritional value than other varieties. Barley Rihane has significant nutritional characterizations compared to others Tunisian barleys varieties. Abbreviations: BR, Barley Rihane; LDL, low density lipoprotein; HDL, high density lipoprotein; AOM, azoxymethane; TBV, Tunisian barley varieties; TGW, thousand grain weight; SW, weight specific; TDF, total dietary fiber; IDF, insoluble dietary fiber; SDF, soluble dietary fiber; DM, Dry Matter.

  9. The effect of feeding barley or hay alone or in combination with molassed sugar beet pulp on the metabolic responses in plasma and caecum of horses

    DEFF Research Database (Denmark)

    Jensen, R B; Austbø, Dag; Blache, D


    only (HAY), hay and molassed SBP (HAY + SBP), hay and pelleted barley (BAR), and hay, pelleted barley and molassed SBP (BAR + SBP). The amount of barley (2 g starch/kg body weight (BW)) fed in the test meals was similar for the BAR and BAR + SBP diets. Each diet was fed for 16 days followed by data...... to the large intestine in response to the dietary carbohydrate composition. In conclusion, there was no effect of adding molassed SBP to a meal of barley compared to feeding barley alone, and fluctuations in plasma and caecal variables were more stable when feeding hay and molassed SBP than feeding barley...

  10. Epigenetic chromatin modifiers in barley: IV. The study of barley Polycomb group (PcG genes during seed development and in response to external ABA

    Directory of Open Access Journals (Sweden)

    Stanca Michele A


    Full Text Available Abstract Background Epigenetic phenomena have been associated with the regulation of active and silent chromatin states achieved by modifications of chromatin structure through DNA methylation, and histone post-translational modifications. The latter is accomplished, in part, through the action of PcG (Polycomb group protein complexes which methylate nucleosomal histone tails at specific sites, ultimately leading to chromatin compaction and gene silencing. Different PcG complex variants operating during different developmental stages have been described in plants. In particular, the so-called FIE/MEA/FIS2 complex governs the expression of genes important in embryo and endosperm development in Arabidopsis. In our effort to understand the epigenetic mechanisms regulating seed development in barley (Hordeum vulgare, an agronomically important monocot plant cultivated for its endosperm, we set out to characterize the genes encoding barley PcG proteins. Results Four barley PcG gene homologues, named HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were identified and structurally and phylogenetically characterized. The corresponding genes HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were mapped onto barley chromosomes 7H, 4H, 2H and 5H, respectively. Expression analysis of the PcG genes revealed significant differences in gene expression among tissues and seed developmental stages and between barley cultivars with varying seed size. Furthermore, HvFIE and HvE(Z gene expression was responsive to the abiotic stress-related hormone abscisic acid (ABA known to be involved in seed maturation, dormancy and germination. Conclusion This study reports the first characterization of the PcG homologues, HvFIE, HvE(Z, HvSu(z12a and HvSu(z12b in barley. All genes co-localized with known chromosomal regions responsible for malting quality related traits, suggesting that they might be used for developing molecular markers to be applied in marker assisted selection. The Pc

  11. Advances in the use of mutation induction for genetic improvement of barley and native grains in Peru

    International Nuclear Information System (INIS)

    Romero Loli, M.; Luz Gomez, P.; Jorge Jimenez, D.; Agripina Roldan, Ch.


    Barley seeds of two varieties were treated with several doses of gamma rays and sodium azide. Seeds of a quinoa (Chenopodium) variety were treated with three doses of gamma rays. Yield trials were conducted also for doubled haploid lines of barley derived from earlier mutagenic treatments. Some promising new barley mutant lines were identified in the yield trials. The results from the Chenopodium trials facilitate the determination of the optimum dose of gamma rays for the PRQ-22 variety. (author)

  12. Some quality attributes of low fat ice cream substituted with hulless barley flour and barley ß-glucan. (United States)

    Abdel-Haleem, Amal M H; Awad, R A


    The purpose of this paper is to investigate some quality attributes of low fat ice cream (LFIC) substituted with hulless barley flour (HBF) and barley ß-glucan (BBG). The methodology included in this paper is based on adding HBF (1, 2, 3 and 4 %) as a partial substitution of skim milk powder (SMP) and BBG (0.40 %) as a complete substitution of carboxy methyl cellulose (CMC). All mixes and resultant ice cream samples were evaluated for their physicochemical properties as well as the sensory quality attributes.The results indicated that substitution of SMP with HBF significantly increased total solids (TS), fat and crude fiber, while crude protein and ash significantly decreased in ice cream mixes. BBG exhibited the same manner of control. Specific gravity was gradually increased with adding HBFand BBG in the mixes and therefore the overrun percent was significantly changed in the resultant ice cream. Adding HBF in ice cream formula led to significant decrease in acidity with higher freezing point and the product showed higher ability to meltdown. BBG treatment showed the same trend of control. Values of flow time and viscosity significantly increased with increasing HBF in the ice cream mixes, but these values significantly decreased in BBG mix. The time required to freeze ice cream mixes was decreased with increasing the ratio of HBF but, increased in BBG treatment. The substitution of SMP with 1 and 2 % HBF significantly (P ≤ 0.05) enhanced sensory attributes of ice cream samples. While, BBG treatment achieved mild score and acceptability.

  13. Effect of Climate and Agricultural Land Use Changes on UK Feed Barley Production and Food Security to the 2050s

    Directory of Open Access Journals (Sweden)

    David O. Yawson


    Full Text Available Currently, the UK has a high self-sufficiency rate in barley production. This paper assessed the effects of projected climate and land use changes on feed barley production and, consequently, on meat supply in the UK from the 2030s to the 2050s. Total barley production under projected land use and climate changes ranged from 4.6 million tons in the 2030s to 9.0 million tons in the 2050s. From these, the projected feed barley supply ranged from approximately 2.3 to 4.6 million tons from the 2030s to the 2050s, respectively. The results indicate that while UK spring barley production will thrive under, and benefit from climate change, total land area allocated to barley production will ultimately determine self-sufficiency. Without expansion in the area of land and/or further significant increases in yields, the UK may face large deficits in domestic feed barley production and, for that matter, meat supply in the future. Hence, agricultural and food security policy needs to consider, principally, the effect of agricultural land use change on key crops, such as barley. Even though the UK can import feed barley or meat to address the deficits observed in this study, the question that needs to be addressed is where all that import will come from.

  14. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid


    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  15. Conserved generation of short products at piRNA loci

    Directory of Open Access Journals (Sweden)

    Khorshid Mohsen


    Full Text Available Abstract Background The piRNA pathway operates in animal germ lines to ensure genome integrity through retrotransposon silencing. The Piwi protein-associated small RNAs (piRNAs guide Piwi proteins to retrotransposon transcripts, which are degraded and thereby post-transcriptionally silenced through a ping-pong amplification process. Cleavage of the retrotransposon transcript defines at the same time the 5' end of a secondary piRNA that will in turn guide a Piwi protein to a primary piRNA precursor, thereby amplifying primary piRNAs. Although several studies provided evidence that this mechanism is conserved among metazoa, how the process is initiated and what enzymatic activities are responsible for generating the primary and secondary piRNAs are not entirely clear. Results Here we analyzed small RNAs from three mammalian species, seeking to gain further insight into the mechanisms responsible for the piRNA amplification loop. We found that in all these species piRNA-directed targeting is accompanied by the generation of short sequences that have a very precisely defined length, 19 nucleotides, and a specific spatial relationship with the guide piRNAs. Conclusions This suggests that the processing of the 5' product of piRNA-guided cleavage occurs while the piRNA target is engaged by the Piwi protein. Although they are not stabilized through methylation of their 3' ends, the 19-mers are abundant not only in testes lysates but also in immunoprecipitates of Miwi and Mili proteins. They will enable more accurate identification of piRNA loci in deep sequencing data sets.

  16. A Genome Wide Association Study of arabinoxylan content in 2-row spring barley grain.

    Directory of Open Access Journals (Sweden)

    Ali Saleh Hassan

    Full Text Available In barley endosperm arabinoxylan (AX is the second most abundant cell wall polysaccharide and in wheat it is the most abundant polysaccharide in the starchy endosperm walls of the grain. AX is one of the main contributors to grain dietary fibre content providing several health benefits including cholesterol and glucose lowering effects, and antioxidant activities. Due to its complex structural features, AX might also affect the downstream applications of barley grain in malting and brewing. Using a high pressure liquid chromatography (HPLC method we quantified AX amounts in mature grain in 128 spring 2-row barley accessions. Amounts ranged from ~ 5.2 μg/g to ~ 9 μg/g. We used this data for a Genome Wide Association Study (GWAS that revealed three significant quantitative trait loci (QTL associated with grain AX levels which passed a false discovery threshold (FDR and are located on two of the seven barley chromosomes. Regions underlying the QTLs were scanned for genes likely to be involved in AX biosynthesis or turnover, and strong candidates, including glycosyltransferases from the GT43 and GT61 families and glycoside hydrolases from the GH10 family, were identified. Phylogenetic trees of selected gene families were built based on protein translations and were used to examine the relationship of the barley candidate genes to those in other species. Our data reaffirms the roles of existing genes thought to contribute to AX content, and identifies novel QTL (and candidate genes associated with them potentially influencing the AX content of barley grain. One potential outcome of this work is the deployment of highly associated single nucleotide polymorphisms markers in breeding programs to guide the modification of AX abundance in barley grain.

  17. Effect of Enzyme Supplementation and Irradiation of Barley on Broiler Chicks Performance

    International Nuclear Information System (INIS)

    Farag, D.H.M.; Abd El-Hakeim, N.F.


    The experiments were conducted to study the influence of irradiation treatment at dose levels of 0.20 and 60 kGy on barley beta-glucan and the effect of enzyme supplementation and irradiation of barley on broiler chicks performance. The amount of total and water-soluble beta-glucan in raw barley was 36 kg -1 , respectively. The effect of irradiation treatment on total beta-glucan was insignificant while the level of soluble beta-glucan was increased with increasing the dose levels of irradiation. The effect of irradiation treatment and enzyme supplementation of barley diets on growth and conversion performance of broiler chicks indicated that birds fed raw barley diet had lower body weight, body weight gain and feed conversion than those fed control diet throughout the experimental period. Irradiation of barley at dose of 20 kGy did not affect the chick performance (feed consumption, weight gain feed-gain ratio) that received the B 20 diet from 7 to 21 days of age, but when bird maintained on B 20 diet from 7 28 days of age, only feed-gain ratio was improved by 14.4%. The results indicate that there was a significant effect of irradiation of barley at 60 kGy (B 60) on feed -gain ratio of chicks when were fed B 60 diet from 7 to 21 days of age. The corresponding improvement in feed-gain ratio was 16.4%. When birds were fed B 60 diet from 7-28 days of age, the improvement in body weight and feed-gain ratio was 25.5 and 19.6%, respectively

  18. Research on mutant barley population under biotic and abiotic stress condition

    International Nuclear Information System (INIS)

    Peskircioglu, H.; Tuyluer, I.; Sagel, Z.; Kunter, B.; Kantoglu, Y.


    Barley is one of the most important cereal with 8,5 million tons production, 3,5 million hectares of sowing area in Turkey which is also one of the gene centres of barley. Barley is grown in every regions of Turkey where climatic conditions are available for the crop. But barley is the predominant crop in the driest land areas throughout the Anatolian plateau. Winters on that plateau are especially severe. Summers are hot and dry with temperatures above 30 degree C. Annual precipitation averages about 300 to 400 millimeters and rains mainly in winter. Because of all of these prerequisite conditions, winter barley dominates in Turkey, which indirectly refers to water economy. According to the above mentioned reasons the objectives of this investigation were: 1) Improvement of drought resistance, loading resistance and high yielding barley varieties by mutation breeding in Central Anatolian Region. 2) Determination and selection of abiotic stress such as salt resistance In our barley mutation breeding programme under Central Anatolian conditions well adapted Tokak 157/37 variety has been used. We applied 250 Gy-300 Gy gamma ray doses . Selection began at M 2 generation. Agronomical characters including earliness, straw length, lodging resistance and disease resistance are monitored in the field and greenhouse. Mutant lines have been tested for salt resistance in the hydrophonic culture which contains 180 mMol and 220 mMol NaCl concentrations. Preliminary yield trial and advanced yield trial are started after M 4 generations. In M 6 generation, we had some desirable lines those are 25-30 days earlier than its parents, so these lines escape from drought period. Some lines that have grown in the hydrophonic cultures, contains 180mMol NaCl still surviving.

  19. Barley yellow mosaic virus VPg is the determinant protein for breaking eIF4E-mediated recessive resistance in barley plants

    Directory of Open Access Journals (Sweden)

    Huangai Li


    Full Text Available In this study, we investigated the barley yellow mosaic virus (BaYMV, genus Bymovirus factor(s responsible for breaking eIF4E-mediated recessive resistance genes (rym4/5/6 in barley. Genome mapping analysis using chimeric infectious cDNA clones between rym5-breaking (JT10 and rym5-non-breaking (JK05 isolates indicated that genome-linked viral protein (VPg is the determinant protein for breaking the rym5 resistance. Likewise, VPg is also responsible for overcoming the resistances of rym4 and rym6 alleles. Mutational analysis identified that amino acids Ser-118, Thr-120 and His-142 in JT10 VPg are the most critical residues for overcoming rym5 resistance in protoplasts. Moreover, the rym5-non-breaking JK05 could accumulate in the rym5 protoplasts when eIF4E derived from a susceptible barley cultivar was expressed from the viral genome. Thus, the compatibility between VPg and host eIF4E determines the ability of BaYMV to infect barley plants.

  20. Mapping genes in barley for resistance to Puccinia coronata from couch grass and to P. striiformis from brome, wheat and barley

    NARCIS (Netherlands)

    Niks, R.E.; Alemu, Sisay K.; Marcel, T.C.; Heyzen, van Skye


    Barley (Hordeum vulgare L.) mapping populations have been developed that are useful to study the inheritance of quantitative resistance to adapted and unadapted rust fungi. In a recent host range study, we found that the parents of those mapping populations also differed in their resistance to

  1. Effect of pH and Recombinant Barley (Hordeum vulgare L.) Endoprotease B2 on Degradation of Proteins in Soaked Barley

    DEFF Research Database (Denmark)

    Christensen, Jesper Bjerg; Dionisio, Giuseppe; Poulsen, Hanne Damgaard


    .3. Solubilized and degraded proteins evaluated by biuret, SDS-PAGE, and differential proteomics revealed that pH 4.3 had the greatest impact on both solubilization and degradation. In order to boost proteolysis, the recombinant barley endoprotease B2 (rec-HvEP-B2) was included after 8 h using the pH 4.3 regime......Nonfermented soaking of barley feedstuff has been established as an in vitro procedure prior to the feeding of pigs as it can increase protein digestibility. In the current study, two feed cultivars of barley (Finlissa and Zephyr) were soaked in vitro either nonbuffered or buffered at pH 3.6 and 4....... Proteolysis evaluated by SDS-PAGE and differential proteomics confirmed a powerful effect of adding rec-HvEP-B2 to the soaked barley, regardless of the genotype. Our study addresses the use of rec-HvEP-B2 as an effective feed enzyme protease. HvEP-B2 has the potential to increase the digestibility of protein...

  2. Wheat and barley seed system in Syria: How diverse are wheat and barley varieties and landraces from farmer’s fields?

    NARCIS (Netherlands)

    Bishaw, Z.; Struik, P.C.; Gastel, van A.J.G.


    The present study described the diversity of wheat and barley varieties and landraces available in farmer’s fields in Syria using different indicators. Analysis of spatial and temporal diversity and coefficient of parentage along with measurements of agronomic and morphological traits were employed

  3. Comparative energy content and amino acid digestibility of barley obtained from diverse sources fed to growing pigs

    Directory of Open Access Journals (Sweden)

    Hong Liang Wang


    Full Text Available Objective Two experiments were conducted to determine the content of digestible energy (DE and metabolizable energy (ME as well as the apparent ileal digestibility (AID and standardized ileal digestibility (SID of crude protein (CP and amino acids (AA in barley grains obtained from Australia, France or Canada. Methods In Exp. 1, 18 growing barrows (Duroc×Landrace×Yorkshire; 31.5±3.2 kg were individually placed in stainless-steel metabolism crates (1.4×0.7×0.6 m and randomly allotted to 1 of 3 test diets. In Exp. 2, eight crossbred pigs (30.9±1.8 kg were allotted to a replicate 3×4 Youden Square designed experiment with three periods and four diets. Two pigs received each diet during each test period. The diets included one nitrogen-free diet and three test diets. Results The relative amounts of gross energy (GE, CP, and all AA in the Canadian barley were higher than those in Australian and French barley while higher concentrations of neutral detergent fiber, acid detergent fiber, total dietary fiber, insoluble dietary fiber and β-glucan as well as lower concentrations of GE and ether extract were observed in the French barley compared with the other two barley sources. The DE and ME as well as the SID of histidine, isoleucine, leucine and phenylalanine in Canadian barley were higher (p<0.05 than those in French barley but did not differ from Australian barley. Conclusion Differences in the chemical composition, energy content and the SID and AID of AA were observed among barley sources obtained from three countries. The feeding value of barley from Canada and Australia was superior to barley obtained from France which is important information in developing feeding systems for growing pigs where imported grains are used.

  4. A root hairless barley mutant for elucidating genetic of root hairs and phosphorus uptake (Correction in v. 242, 2002, p. 299)

    DEFF Research Database (Denmark)

    Gahoonia, T.S.; Nielsen, N.E.; Priyavadan, A.J.


    This paper reports a new barley mutant missing root hairs. The mutant was spontaneously discovered among the population of wild type (Pallas, a spring barley cultivar), producing normal, 0.8 mm long root hairs. We have called the mutant bald root barley (brb). Root anatomical studies confirmed...

  5. Effects of Added Enzymes on Sorted, Unsorted and Sorted-Out Barley: A Model Study on Realtime Viscosity and Process Potentials Using Rapid Visco Analyser

    DEFF Research Database (Denmark)

    Shetty, Radhakrishna; Zhuang, Shiwen; Olsen, Rasmus Lyngsø


    Barley sorting is an important step for selecting grain of required quality for malting prior to brewing. However, brewing with unmalted barley with added enzymes has been thoroughly proven, raising the question of whether traditional sorting for high quality malting-barley is still necessary. To...

  6. Researches on detection of barley varieties and lines against Ustilago nuda hordei “Jens.â€? Rostr. Marmara Region


    Gümüştekin, H.; Akın, K.


    This research has been started in 1994 to test barley varieties and lines against Ustilago nuda hordei “Jens.â€? Rostr. Schaffn. In 1994, 14 barley varieties and lines and in 1995 23 barley varieties and lines were tested. After testing 37 varieties and lines, 27 of them were found resistant (R), and 10 of them susceptible (S).

  7. Comparative analysis the selenium concentration in grains of wheat and barley species

    International Nuclear Information System (INIS)

    Jalal, F.; Arif, M.; Munsif, F.; Ali, K.


    Macro and micro nutrients are essential for human health and growth development. It is reported that about three million people are suffering from nutrient deficiencies all over the world. Various sources are available like: vegetables, fruits, fish, meat and cereals to overcome these deficiencies. Among cereals, wheat and barley are main source to meet the requirement of this dietary element. Two year studies were conducted to investigate the Se concentration in grains of different wheat (T. aestivum L., T. turgidum L. and T. durum L.) and barley (H. spontaneum L. and H. vulgare L.) species originated from different parts of the world. Results indicated that the durum and emmer wheat grains contain higher Se level in both studied years (70.5 and 72.9 micro g kg-1 in 2012 and 74.1 and 73.2 microg kg-1 in 2013 respectively). Among H. spontaneum L. collected from six populations, Mahola population of barley showed remarkable variations in grain Se concentration ranged from 88.3-437.2 and 90.2-439.5 micro g kg-1 in 2012 and 2013 respectively. The information obtained from the findings helps in identifying the lines of wild barley that have more Se uptake and accumulation capability. According to the conclusion of the study that H. Spontaneum L. had greater genetic variation for Se as compare to other species of wheat and barley. (author)

  8. Gravimorphism in rice and barley: promotion of leaf elongation by vertical inversion in agravitropically growing plants. (United States)

    Abe, K; Takahashi, H; Suge, H


    We have compared shoot responses of agravitropic rice and barley plants to vertical inversion with those of normal ones. When rice plants were vertically inverted, the main stems of a japonica type of rice, cv. Kamenoo, showed negative gravitropism at nodes 2-15 of both elongated and non-elongated internodes. However, shoots of lazy line of rice, lazy-Kamenoo, bent gravitropically at nodes 11-15 only elongated internodes but not at nodes 2-10 of non-elongated ones. Thus, shoots of Kamenoo responded gravitropically at all stages of growth, whereas shoots of lazy-Kamenoo did not show gravitropic response before heading. In Kamenoo plants, lengths of both leaf-sheath and leaf-blade were shortened by vertical inversion, but those of the vertically inverted plants of lazy-Kamenoo were significantly longer than the plants in an upright position. When agravitropic and normal plants of barley were vertically inverted, the same results as in rice were obtained; elongation of both leaf-sheath and leaf-blade was inhibited in normal barley plants, Chikurin-Ibaragi No. 1, but significantly stimulated in agravitropic plants of serpentina barley. These results suggest that vertical inversion of rice and barley plants enhances the elongation growth of leaves in the absence of tropistic response.

  9. Grain Composition and Functional Ingredients of Barley Varieties Created in Latvia

    Directory of Open Access Journals (Sweden)

    Šterna Vita


    Full Text Available Cereals, including barley, have been recognised as functional foods that provide beneficial effect on the health of the consumer and decrease the risk of various diseases. The aim of investigation was to determine the grain composition of barley varieties and perspective breeding lines bred in Latvia and to evaluate its functional ingredients. The results of analysis showed that protein content among varieties ranged from 106.6-146.8 g·kg-1, total dietary fibre 187.4-208.2 g·kg-1, β-glucans 42.8 g-49.4 g·kg-1, and amount of α-tocopherol 6.03-8.93 mg·kg-1. The sum of essential amino acids in barley grain samples was from 32.90 g·kg-1 to 38.71 g·kg-1. All varieties of hulled and hulless barley grain were found to be sources of protein with high biological value. Comparison of barley varieties bred in Latvia suggests that variety ‘Kornelija’ outperforms others in protein, dietary fibre and micronutrient content.

  10. Utilization of barley or wheat bran to bioconvert glutamate to γ-aminobutyric acid (GABA). (United States)

    Jin, Wen-Jie; Kim, Min-Ju; Kim, Keun-Sung


    This study deals with the utilization of agro-industrial wastes created by barley and wheat bran in the production of a value-added product, γ-aminobutyric acid (GABA). The simple and eco-friendly reaction requires no pretreatment or microbial fermentation steps but uses barley or wheat bran as an enzyme source, glutamate as a substrate, and pyridoxal 5'-phosphate (PLP) as a cofactor. The optimal reaction conditions were determined on the basis of the temperatures and times used for the decarboxylation reactions and the initial concentrations of barley or wheat bran, glutamate, and PLP. The optimal reactions produced 9.2 mM of GABA from 10 mM glutamate, yielding a 92% GABA conversion rate, when barley bran was used and 6.0 mM of GABA from 10 mM glutamate, yielding a 60% GABA conversion rate, when wheat bran was used. The results imply that barley bran is more efficient than wheat bran in the production of GABA. © 2013 Institute of Food Technologists®

  11. Development of functional spaghetti enriched in bioactive compounds using barley coarse fraction obtained by air classification. (United States)

    Verardo, Vito; Gómez-Caravaca, Ana Maria; Messia, Maria Cristina; Marconi, Emanuele; Caboni, Maria Fiorenza


    Barley byproducts obtained by air classification have been used to produce a different barley functional spaghetti, which were compared to different commercial whole semolina samples. Total, insoluble, and soluble fiber and β-glucan contents of the barley spaghetti were found to be greater than those of commercial samples. Furthermore, it was proved that barley spaghetti reached the FDA requirements, which could allow these pastas to deserve the health claims "good source of dietary fiber" and "may reduce the risk of heart disease". When the barley coarse fraction was used, a flavan-3-ols enrichment and an increase of antioxidant activity were reported, while commercial samples showed the absence of flavan-3-ols and a higher presence of phenolic acids and tannins. Whole semolina commercial spaghetti had a significantly higher content of phenolic acids than semolina spaghetti samples. Besides, it was observed that when vital gluten was added to the spaghetti formulation, phenolic compounds were blocked in the gluten network and were partially released during the cooking process.

  12. Fungal Distribution and Varieties Resistance to Kernel Discoloration in Korean Two-rowed Barley

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Shin


    Full Text Available Barley kernel discoloration (KD leads to substantial loss in value through downgrading and discounting of malting barley. The objective of this research is to investigate fungal distribution and varieties resistance to KD in Korean two-rowed barley. Several fungal organisms including Alternaria spp., Fusarium spp., Aspergillus spp., Epicoccum spp. and Rhizopus spp. were isolated from Korean two-rowed barley representing KD. The symptoms of KD were brown and black discolorations of the lemma and palea. The most frequently detected fungal species was Alternaria spp. which exhibited 69.1% and 72.2% in 2011 and 2012, respectively. Epicoccum spp., Fusarium spp., and Aspergillus spp. were also detected. Fusarium spp., primary pathogen of barley head blight, were rarely occurred in the 2011 and their occurrence increased to 4.7% in 2012. Twenty cultivars of Korean two-rowed barely were evaluated to KD. The average percentage of KD was 8.0−36.0% in 2011 and 5.2−36.6% in 2012. Two cultivars (‘Sacheon 6’ and ‘Dajinbori’ showed KD of 6.2% to 8.8% and determined resistant, however ‘Samdobori’ and ‘Daeyeongbori’ demonstrating KD of 22.2−36.6% were highly susceptible. ‘Jinyangbori’, ‘Danwonbori’, ‘Sinhobori’ and ‘Kwangmaegbori’ showing KD of less than 15% were moderately resistant cultivar.

  13. Dinitrogen fixation estimates in Vetch-barley swards using {sup 15} N-methodology

    Energy Technology Data Exchange (ETDEWEB)

    Kurdali, F; Sharabi, N E [Atomic Energy Commission, P.O.Box 6091, Damascus, (Syrian Arab Republic)


    N 2- fixation in vetch (Vicia Sativa) grown alone and in mixture with barley (hordeum vulgare) in pots was evaluated using {sup 15} N isotope dilution method. Two harvests were made over the growing season. The proportion of the above-ground N, derived from atmospheric N 2 (% Ndfa) in mixed vetch was significantly higher than that of vetch in pure culture for the different harvests. However, this increase was not accompanied with the amount of N 2-fixation. On the other hand, no significant differences were observed in N-content or in N-derived from soil between barley grown in mixture and in monoculture, in spite of the difference in the number of plants between the tow cropping systems. These results indicate a high competing capacity of barley for soil nitrogen in mixed culture. Barley grown together with vetch had lower atom % 15 N excess than barley grown in mono-culture because it may have received some of their N from N-released by the legume in the second herbage but not in the first. Overall, results obtained from this experiment indicate the importance of mixed crops for forage production. Based on these results, further investigation must carried out in the field. 1 fig.

  14. Transient Overexpression of HvSERK2 Improves Barley Resistance to Powdery Mildew. (United States)

    Li, Yingbo; Li, Qingwei; Guo, Guimei; He, Ting; Gao, Runhong; Faheem, Muhammad; Huang, Jianhua; Lu, Ruiju; Liu, Chenghong


    Somatic embryogenesis receptor-like kinases (SERKs) play an essential role in plant response to pathogen infection. Here we identified three SERK genes ( HvSERK1/2/3 ) from barley, and aimed to determine their implication in defense responses to barley powdery mildew ( Bgh ). Although HvSERK1/2/3 share the characteristic domains of the SERK family, only HvSERK2 was significantly induced in barley leaves during Bgh infection. The expression of HvSERK2 was rapidly induced by hydrogen peroxide (H₂O₂) treatment, but not by treatment with salicylic acid (SA), methyl jasmonate (MeJA), ethephon (ETH), or abscisic acid (ABA). Bioinformatics analysis of the cloned HvSERK2 promoter revealed that it contains several elements responsible for defense responses against pathogens. Promoter functional analysis showed that the HvSERK2 promoter was induced by Bgh and H₂O₂. Subcellular localization analysis of HvSERK2 indicated that it is mainly located on the plasma membrane. Transient overexpression of HvSERK2 in epidermal cells of the susceptible barley cultivar Hua 30 reduced the Bgh haustorium index from 58.6% to 43.2%. This study suggests that the HvSERK2 gene plays a positive role in the improvement of barley resistance to powdery mildew, and provides new insight into the function of SERK genes in the biotic stress response of plants.

  15. Structural comparison of arabinoxylans from two barley side-stream fractions. (United States)

    Pitkänen, Leena; Tuomainen, Päivi; Virkki, Liisa; Aseyev, Vladimir; Tenkanen, Maija


    The structures of barley ( Hordeum vulgare) arabinoxylans isolated from two industrial side fractions, barley husks (BH) and barley fiber (BF), were characterized. Arabinoxylans were extracted with saturated barium hydroxide after enzymatic pretreatment. Barium hydroxide was selective toward arabinoxylans, and only a minor amount of glucose-containing material was coextracted. Acid methanolysis followed by gas chromatography, 1H NMR spectroscopy, and specific enzymatic treatments followed by anion exchange chromatography with pulse amperometric detection (HPAEC-PAD) revealed that the chemical structure of barley husk arabinoxylan (BHAX) clearly differed from that of barley fiber arabinoxylan (BFAX). BFAX was more branched, containing more beta-D-xylopyranosyl (beta-D-Xylp) residues carrying alpha-L-arabinofuranosyl (alpha-L-Araf) units at both O-2 and O-3 positions. BHAX, on the other hand, contained more 2-O-beta-D-Xyl p-alpha-L-Ara f substituents than BFAX. BHAX and BFAX also differed with respect to the hydrodynamic properties investigated with multidetector size exclusion chromatography. BFAX had a higher weight-average molar mass and larger hydrodynamic volume, the latter indicating less dense conformation than BHAX. Mn, Mw /Mn, Rh, and the Mark-Houwink a value were also determined for both arabinoxylans.

  16. Density Stress has Minimal Impacts on the Barley or Maize Seedling Transcriptome

    Directory of Open Access Journals (Sweden)

    Summer St. Pierre


    Full Text Available High planting density affects the morphology and productivity of many crop species. Our objectives were to examine the phenotypic and transcriptomic changes that occur during plant density stress in barley ( L. and maize ( L. seedlings. In maize and barley seedlings, density stress impacted several morphological traits. Gene expression profiles were examined in four barley and five maize genotypes grown at low and high plant densities. Only 221 barley and 35 maize genes exhibited differential expression in response to plant density stress. The majority of the gene expression changes were observed in a subset of the genotypes and reflected minor changes in the level of expression, indicating that the plant density stress imposed in this study did not result in major changes in gene expression. Also, little overlap was observed within barley or maize genotypes in gene expression during density stress, indicating that genotypic differences play a major role in the response to density stress. While it is clear that gene expression differences are involved in morphological changes induced by high plant densities, it is likely that many of these gene expression differences are subtle and restricted to particular tissues and developmental time.

  17. Growth curve registration for evaluating salinity tolerance in barley

    KAUST Repository

    Meng, Rui


    Background: Smarthouses capable of non-destructive, high-throughput plant phenotyping collect large amounts of data that can be used to understand plant growth and productivity in extreme environments. The challenge is to apply the statistical tool that best analyzes the data to study plant traits, such as salinity tolerance, or plant-growth-related traits. Results: We derive family-wise salinity sensitivity (FSS) growth curves and use registration techniques to summarize growth patterns of HEB-25 barley families and the commercial variety, Navigator. We account for the spatial variation in smarthouse microclimates and in temporal variation across phenotyping runs using a functional ANOVA model to derive corrected FSS curves. From FSS, we derive corrected values for family-wise salinity tolerance, which are strongly negatively correlated with Na but not significantly with K, indicating that Na content is an important factor affecting salinity tolerance in these families, at least for plants of this age and grown in these conditions. Conclusions: Our family-wise methodology is suitable for analyzing the growth curves of a large number of plants from multiple families. The corrected curves accurately account for the spatial and temporal variations among plants that are inherent to high-throughput experiments.

  18. Growth curve registration for evaluating salinity tolerance in barley

    KAUST Repository

    Meng, Rui; Saade, Stephanie; Kurtek, Sebastian; Berger, Bettina; Brien, Chris; Pillen, Klaus; Tester, Mark A.; Sun, Ying


    Background: Smarthouses capable of non-destructive, high-throughput plant phenotyping collect large amounts of data that can be used to understand plant growth and productivity in extreme environments. The challenge is to apply the statistical tool that best analyzes the data to study plant traits, such as salinity tolerance, or plant-growth-related traits. Results: We derive family-wise salinity sensitivity (FSS) growth curves and use registration techniques to summarize growth patterns of HEB-25 barley families and the commercial variety, Navigator. We account for the spatial variation in smarthouse microclimates and in temporal variation across phenotyping runs using a functional ANOVA model to derive corrected FSS curves. From FSS, we derive corrected values for family-wise salinity tolerance, which are strongly negatively correlated with Na but not significantly with K, indicating that Na content is an important factor affecting salinity tolerance in these families, at least for plants of this age and grown in these conditions. Conclusions: Our family-wise methodology is suitable for analyzing the growth curves of a large number of plants from multiple families. The corrected curves accurately account for the spatial and temporal variations among plants that are inherent to high-throughput experiments.

  19. Structural lability of Barley stripe mosaic virus virions.

    Directory of Open Access Journals (Sweden)

    Valentin V Makarov

    Full Text Available Virions of Barley stripe mosaic virus (BSMV were neglected for more than thirty years after their basic properties were determined. In this paper, the physicochemical characteristics of BSMV virions and virion-derived viral capsid protein (CP were analyzed, namely, the absorption and intrinsic fluorescence spectra, circular dichroism spectra, differential scanning calorimetry curves, and size distributions by dynamic laser light scattering. The structural properties of BSMV virions proved to be intermediate between those of Tobacco mosaic virus (TMV, a well-characterized virus with rigid rod-shaped virions, and flexuous filamentous plant viruses. The BSMV virions were found to be considerably more labile than expected from their rod-like morphology and a distant sequence relation of the BSMV and TMV CPs. The circular dichroism spectra of BSMV CP subunits incorporated into the virions, but not subunits of free CP, demonstrated a significant proportion of beta-structure elements, which were proposed to be localized mostly in the protein regions exposed on the virion outer surface. These beta-structure elements likely formed during virion assembly can comprise the N- and C-terminal protein regions unstructured in the non-virion CP and can mediate inter-subunit interactions. Based on computer-assisted structure modeling, a model for BSMV CP subunit structural fold compliant with the available experimental data was proposed.

  20. Dynamic viscosity study of barley malt and chicory concentrates

    Directory of Open Access Journals (Sweden)

    G. O. Magomedov


    Full Text Available The purpose of research is to find optimal conditions for dispersing and subsequent dehydration of liquid food environments in the nozzle spray drying chamber through the study of dynamic changes in viscosity according to temperature, velocities gradients and dry residue content. The objects of study were roasted chicory and malt barley concentrates with dry residue content of 20, 40, 60 and 80%. Research of dynamic viscosity were carried out at the measuring complex based on the rotational viscometer Rheotest II, analog-to-digital converter, module Laurent and a personal computer with a unique software that allows to record in real time (not only on a tape recorder, but also in the form of graphic files the behavior of the viscosity characteristics of concentrates. Registration of changes of dynamic viscosity was carried out at a shear rate gradient from 1,0 с -1 to 27,0 с -1 and the products temperature thermostating : 35, 55, 75˚ C. The research results are presented in the form of graphic dependences of effective viscosity on shear rate and flow curves (dependencies of shear stresses on the velocity gradient, which defined flow regimes, the optimal modes of dispersion concentrates into spray dryer chambers in obtaining of powdered semi-finished products and instanting were found: dry residue content - 40 %, concentrate temperature - 75 ˚C, velocity gradient in the air channel of the nozzle at least 20 c-1

  1. Effect of mungbean residue and nitrogen levels on barley

    International Nuclear Information System (INIS)

    Jan, A.; Muhammad, Z.; Daur, I.; Khan, I.A.


    A field experiment was conducted to evaluate response of barley to mungbean residue (0, 10, 20 and 30 Mg ha/sup -1/), nitrogen levels (0, 25, 50 and 75 kg ha/sup -1/) and their interaction. Emergence m/sup -2/ (50), plant height (109 cm), leaf area tiller-1 (106 cm/sup 2/), lodging score (5.55), termites attack (3.4%), grains spike-1 (67), biological yield (12.80 Mg ha/sup -1/) and grain yield (2.32 Mg ha/sup -1/) were significantly (p=0.05) higher for 30 Mg ha/sup -1/ mungbean residue compared to other levels. Similarly plant height (110 cm), lodging score (5.29) and biological yield (13.75 Mg ha/sup -1/) were higher at 75 kg ha/sup -1/ N compared to other levels of N. Productive tillers m/sup -2/, grains spike/sup -1/, 1000 grain weight, grain yield and harvest index were optimum at 50 kg ha-1 N as compared to 75 kg ha/sup -1/ N that encouraged lodging. Interaction between residue and nitrogen indicated that 10 Mg residue and 50 kg N ha/sup -1/ is recommended to achieve maximum net return under comparable conditions. (author)

  2. The strategy of carbon utilization in uniculm barley

    International Nuclear Information System (INIS)

    Gordon, A.J.; Ryle, G.J.A.; Powell, C.E.


    Following exposure of the youngest mature leaf of uniculm barley to 14 CO 2 , groups of plants were harvested over a 72 h period to determine the fate of 14 C in the photosynthesizing leaf and in growing leaves and roots. Initially, 14 C was mainly present in sucrose with a little in starch and charged compounds; transport out of the fed leaf was rapid and, by 7 and 24 h, 56 and 93% respectively of the 14 C had been translocated about equally to growing leaves and roots. Sucrose entering meristems was quickly metabolized to protein and structural carbohydrate (40 and 60% of the 14 C in these organs at 7 and 24 h respectively), while the remainder was converted to short-term storage products or intermediary metabolites. By the end of the first day c.35% of the 14 C originally assimilated had been lost in respiration. The metabolism of the leaf appeared to be organized on a diurnal basis, for it exported nearly all its carbon within 24 h of assimilation. In contrast, some of the assimilate imported into growing leaves and, to a lesser extent, roots was not immediately used for growth but persisted as temporary metabolites and was subsequently used for growth in the following days. (author)

  3. A proteomics study of barley powdery mildew haustoria. (United States)

    Godfrey, Dale; Zhang, Ziguo; Saalbach, Gerhard; Thordal-Christensen, Hans


    A number of fungal and oomycete plant pathogens of major economic importance feed on their hosts by means of haustoria, which they place inside living plant cells. The underlying mechanisms are poorly understood, partly due to difficulty in preparing haustoria. We have therefore developed a procedure for isolating haustoria from the barley powdery mildew fungus (Blumeria graminis f.sp. hordei, Bgh). We subsequently aimed to understand the molecular mechanisms of haustoria through a study of their proteome. Extracted proteins were digested using trypsin, separated by LC, and analysed by MS/MS. Searches of a custom Bgh EST sequence database and the NCBI-NR fungal protein database, using the MS/MS data, identified 204 haustoria proteins. The majority of the proteins appear to have roles in protein metabolic pathways and biological energy production. Surprisingly, pyruvate decarboxylase (PDC), involved in alcoholic fermentation and commonly abundant in fungi and plants, was absent in our Bgh proteome data set. A sequence encoding this enzyme was also absent in our EST sequence database. Significantly, BLAST searches of the recently available Bgh genome sequence data also failed to identify a sequence encoding this enzyme, strongly indicating that Bgh does not have a gene for PDC.

  4. Effectiveness of rabbit manure biofertilizer in barley crop yield. (United States)

    Islas-Valdez, Samira; Lucho-Constantino, Carlos A; Beltrán-Hernández, Rosa I; Gómez-Mercado, René; Vázquez-Rodríguez, Gabriela A; Herrera, Juan M; Jiménez-González, Angélica


    The quality of biofertilizers is usually assessed only in terms of the amount of nutrients that they supply to the crops and their lack of viable pathogens and phytotoxicity. The goal of this study was to determine the effectiveness of a liquid biofertilizer obtained from rabbit manure in terms of presence of pathogens, phytotoxicity, and its effect on the grain yield and other agronomic traits of barley (Hordeum vulgare L.). Environmental effects of the biofertilizer were also evaluated by following its influence on selected soil parameters. We applied the biofertilizer at five combinations of doses and timings each and in two application modes (foliar or direct soil application) within a randomized complete block design with three replicates and using a chemical fertilizer as control. The agronomic traits evaluated were plant height, root length, dry weight, and number of leaves and stems at three growth stages: tillering, jointing, and flowering. The effectiveness of the biofertilizer was significantly modified by the mode of application, the growth stage of the crop, and the dose of biofertilizer applied. The results showed that the foliar application of the biofertilizer at the tillering stage produced the highest increase in grain yield (59.7 %, p biofertilizer caused significant changes in soil, particularly concerning pH, EC, Ca, Zn, Mg, and Mn. It is our view that the production and use of biofertilizers are a reliable alternative to deal with a solid waste problem while food security is increased.

  5. The impact of stubble crop on spring barley weed infestation

    Directory of Open Access Journals (Sweden)

    Eleonora Wrzesińska


    Full Text Available The condition and degree of weed infestation were determined in a spring barely crop grown in a short-term monoculture after mulching the soil with plants grown as a stubble crop (the control treatment without cover crop – lacy phacelia, white mustard, sunflower. The field experiment was carried out in 2010–2013 on good rye soil complex using a split-block design in four replications. The obtained results (the mean from all years of the experiment showed that the stubble crop, especially sunflower, reduced the diversity of weed species without causing at the same time changes in weed species dominance. In all the control treatments of the experiment, Chenopodium album and Fallopia convolvulus were the dominant species. The degree of spring barley weed infestation depended on the species grown in the cover crop. White mustard and lacy phacelia slightly increased the number of weeds but their fresh matter significantly increased. However, the sunflower cover crop significantly increased the number of weeds without any substantial differentiation of their fresh mass.

  6. Plasma membrane and salinity tolerance of barley plants

    International Nuclear Information System (INIS)

    Al-Rahmani, F. H.; Al-Mashhadani, M. S.; Al-Delemee, N. H.


    Barley cultivar, California Mario ut, was grown in a nutrient solution containing increasing Nacl concentrations up to 250 mm. The effect of Nacl on growth, mineral compost ion ant integrity of the plasma membrane was studied. Growth of the shoot'and root was stimulated or little affected by 10 and 20 ml Nacl. Further increase in Nacl concentrations depressed the growth. The depression was conspicuous between 100 and 250 mm Nacl. Increasing Nacl concentration decreased potassium content in the shoots and roots and led to steep increase in sodium accumulation. The integrity of the plasma membrane was measured in term of potassium leakage from the root tips. Rapid leakage of potassium was obtained at Nacl concentrations ranging from 100 to 250 mm. At the same concentrations of Nacl, adenosine triphosphatase activity in the root tips was increased. Results indicate that the plasma membrane of root cells was damaged by the increased levels of salinity. It was concluded that the plasma membrane of root cells is the primary site of salinity toxicity. (authors). 40 refs., 5 tabs. 3 figs

  7. Latent manganese deficiency increases transpiration in barley (Hordeum vulgare). (United States)

    Hebbern, Christopher A; Laursen, Kristian Holst; Ladegaard, Anne H; Schmidt, Sidsel B; Pedas, Pai; Bruhn, Dan; Schjoerring, Jan K; Wulfsohn, Dvoralai; Husted, Søren


    To investigate if latent manganese (Mn) deficiency leads to increased transpiration, barley plants were grown for 10 weeks in hydroponics with daily additions of Mn in the low nM range. The Mn-starved plants did not exhibit visual leaf symptoms of Mn deficiency, but Chl a fluorescence measurements revealed that the quantum yield efficiency of PSII (F(v)/F(m)) was reduced from 0.83 in Mn-sufficient control plants to below 0.5 in Mn-starved plants. Leaf Mn concentrations declined from 30 to 7 microg Mn g(-1) dry weight in control and Mn-starved plants, respectively. Mn-starved plants had up to four-fold higher transpiration than control plants. Stomatal closure and opening upon light/dark transitions took place at the same rate in both Mn treatments, but the nocturnal leaf conductance for water vapour was still twice as high in Mn-starved plants compared with the control. The observed increase in transpiration was substantiated by (13)C-isotope discrimination analysis and gravimetric measurement of the water consumption, showing significantly lower water use efficiency in Mn-starved plants. The extractable wax content of leaves of Mn-starved plants was approximately 40% lower than that in control plants, and it is concluded that the increased leaf conductance and higher transpirational water loss are correlated with a reduction in the epicuticular wax layer under Mn deficiency.

  8. The viscoelastic properties of the protein-rich materials from the fermented hard wheat, soft wheat and barley flours (United States)

    The linear and non-linear rheological properties of the suspensions for the hard red spring wheat (HRS) flour, soft wheat (Pastry) flour, barley flour, as well as the remain residues of HRS flour, Pastry flour, and barley flour after fermentation were investigated. The linear and non-linear rheologi...

  9. Comparison of mobile and stationary spore-sampling techniques for estimating virulence frequencies in aerial barley powdery mildew populations

    DEFF Research Database (Denmark)

    Hovmøller, M.S.; Munk, L.; Østergård, Hanne


    Gene frequencies in samples of aerial populations of barley powdery mildew (Erysiphe graminis f.sp. hordei), which were collected in adjacent barley areas and in successive periods of time, were compared using mobile and stationary sampling techniques. Stationary samples were collected from trap ...

  10. Induction by chromium ions of chitinases and polyamines in barley (Hordeum vulgare L.) and rape (Brassica napus L. ssp. oleifera)

    DEFF Research Database (Denmark)

    Jacobsen, S.; Hauschild, M.Z.; Rasmussen, U.


    Barley and rape seedlings were grown in hydroponic culture with increasing concentrations of CrO3 (Cr(VI)) or CrCl3 (Cr(III)). The chitinase activity and the concentrations of putrescine, spennidine and spermine were determined in the third leaf of barley seed-lings and in the second leaf of rape...

  11. Comparison of Production Effectiveness of Wheat and Barley in Terms of Energy Use and Productivity in Sistan and Blochestan Province

    Directory of Open Access Journals (Sweden)

    S.M. Ziaei


    Full Text Available Comparison of energy productivity of different crops can be used as an effective tool to prioritize crops planting in each area. This study was conducted in order to compare of wheat and barley farms of Sistan and Blochestan province in relation of various aspects of energy consumption at 2009. 100 wheat and 100 barley fields were selected randomly from Zahedan, Zabol, Saravan, Khash, Iranshahr, Gasht, Sib and Soran, Zaboli, Nahok, Jalegh and Nikshahr cities. Inputs data and yield of wheat and barley fields were collected in the form of questionnaires in a face-to-face interviewing. Results showed that total energy inputs of wheat and barley fields were 32492.97 and 25655.81 MJ.ha-1, respectively. Total energy outputs for wheat and barley fields also were 48517.24 and 49800.87 MJ.ha-1, respectively. Based on these results the amount of energy use efficiency for wheat and barley fields were 1.49 and 1.94 respectively, and the amount of energy productivity for mentioned fields were 0.056 and 0.066. The share of renewable energy as one of the sustainability index of agricultural systems was 19.60 for wheat and 14.60 for barley fields. Therefore, it seems that barley production is more efficient from various aspects of energy consumption rather than wheat in Sistan and Blochestan province.

  12. Genome-wide association mapping of barley yellow dwarf virus tolerance in spring oat (Avena sativa L.) (United States)

    Barley yellow dwarf (BYD) is one of the most destructive diseases of cereal crops worldwide. Barley yellow dwarf viruses (BYDVs) are responsible for BYD and affect many cereals including oat (Avena sativa L.). Until recently, the molecular marker technology in oat has not allowed for many marker-t...

  13. Analysis of early events in the interaction between Fusarium graminearum and the susceptible barley (Hordeum vulgare) cultivar Scarlett

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, J.D.; Svensson, Birte


    A proteomic analysis was conducted to map the events during the initial stages of the interaction between the fungal pathogen Fusarium graminearum and the susceptible barley cultivar Scarlett. Quantification of fungal DNA demonstrated a sharp increase in fungal biomass in barley spikelets at 3 da...

  14. Biosynthesis of the leucine derived α-, β- and γ-hydroxynitrile glucosides in barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Knoch, Eva; Motawie, Mohammed Saddik; Olsen, Carl Erik


    Barley (Hordeum vulgare L.) produces five leucine-derived hydroxynitrile glucosides (HNGs), of which only epiheterodendrin is a cyanogenic glucoside. The four non-cyanogenic HNGs are the β-HNG epidermin and the γ-HNGs osmaronin, dihydroosmaronin and sutherlandin. By analyzing 247 spring barley...

  15. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana. (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V


    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  16. Alpha-synuclein suppression by targeted small interfering RNA in the primate substantia nigra.

    Directory of Open Access Journals (Sweden)

    Alison L McCormack

    Full Text Available The protein alpha-synuclein is involved in the pathogenesis of Parkinson's disease and other neurodegenerative disorders. Its toxic potential appears to be enhanced by increased protein expression, providing a compelling rationale for therapeutic strategies aimed at reducing neuronal alpha-synuclein burden. Here, feasibility and safety of alpha-synuclein suppression were evaluated by treating monkeys with small interfering RNA (siRNA directed against alpha-synuclein. The siRNA molecule was chemically modified to prevent degradation by exo- and endonucleases and directly infused into the left substantia nigra. Results compared levels of alpha-synuclein mRNA and protein in the infused (left vs. untreated (right hemisphere and revealed a significant 40-50% suppression of alpha-synuclein expression. These findings could not be attributable to non-specific effects of siRNA infusion since treatment of a separate set of animals with luciferase-targeting siRNA produced no changes in alpha-synuclein. Infusion with alpha-synuclein siRNA, while lowering alpha-synuclein expression, had no overt adverse consequences. In particular, it did not cause tissue inflammation and did not change (i the number and phenotype of nigral dopaminergic neurons, and (ii the concentrations of striatal dopamine and its metabolites. The data represent the first evidence of successful anti-alpha-synuclein intervention in the primate substantia nigra and support further development of RNA interference-based therapeutics.

  17. Effect of barley and its amylopectin content on ruminal fermentation and nitrogen utilization in lactating dairy cows. (United States)

    Foley, A E; Hristov, A N; Melgar, A; Ropp, J K; Etter, R P; Zaman, S; Hunt, C W; Huber, K; Price, W J


    The effect of type of grain (corn vs. barley) and amylopectin content of barley grain (normal vs. waxy) on ruminal fermentation, digestibility, and utilization of ruminal ammonia nitrogen for milk protein synthesis was studied in a replicated 3 x 3 Latin square design trial with 6 lactating dairy cows. The experimental treatments were (proportion of dietary dry matter): CORN, 40% corn grain, NBAR, 30% normal Baronesse barley:10% corn grain, and WBAR, 30% high-amylopectin (waxy) Baronesse barley:10% corn grain. All grains were steam-rolled and fed as part of a total mixed ration. The NBAR and WBAR diets resulted in increased ruminal ammonia concentrations compared with CORN (8.2, 7.4, and 5.6 mM, respectively), but other ruminal fermentation parameters were not affected. Ruminal digestibility of dietary nutrients and microbial protein synthesis in the rumen were also not affected by diet. Corn grain had greater in situ effective ruminal dry matter degradability (62.8%) than the barley grains (58.2 and 50.7%, respectively), and degradability of the normal barley starch was greater than that of the waxy barley (69.3 and 58.9%, respectively). A greater percentage of relative starch crystallinity was observed for the waxy compared with the normal barley grain. Total tract apparent digestibility of dry matter and organic matter were decreased by WBAR compared with CORN and NBAR. Total tract starch digestibility was greater and milk urea nitrogen content was lower for CORN compared with the 2 barley diets. In this study, the extent of processing of the grain component of the diet was most likely the factor that determined the diet responses. Minimal processing of barley grain (processing indexes of 79.2 to 87.9%) reduced its total tract digestibility of starch compared with steam-rolled corn (processing index of 58.8%). As a result of the increased ammonia concentration and reduced degradability of barley dry matter in the rumen, the utilization of ruminal ammonia

  18. High-Level Accumulation of Exogenous Small RNAs Not Affecting Endogenous Small RNA Biogenesis and Function in Plants

    Institute of Scientific and Technical Information of China (English)

    SHEN Wan-xia; Neil A Smith; ZHOU Chang-yong; WANG Ming-bo


    RNA silencing is a fundamental plant defence and gene control mechanism in plants that are directed by 20-24 nucleotide (nt) small interfering RNA (siRNA) and microRNA (miRNA). Infection of plants with viral pathogens or transformation of plants with RNA interference (RNAi) constructs is usually associated with high levels of exogenous siRNAs, but it is unclear if these siRNAs interfere with endogenous small RNA pathways and hence affect plant development. Here we provide evidence that viral satellite RNA (satRNA) infection does not affect siRNA and miRNA biogenesis or plant growth despite the extremely high level of satRNA-derived siRNAs. We generated transgenic Nicotiana benthamiana plants that no longer develop the speciifc yellowing symptoms generally associated with infection by Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat). We then used these plants to show that CMV Y-Sat infection did not cause any visible phenotypic changes in comparison to uninfected plants, despite the presence of high-level Y-Sat siRNAs. Furthermore, we showed that the accumulation of hairpin RNA (hpRNA)-derived siRNAs or miRNAs, and the level of siRNA-directed transgene silencing, are not signiifcantly affected by CMV Y-Sat infection. Taken together, our results suggest that the high levels of exogenous siRNAs associated with viral infection or RNAi-inducing transgenes do not saturate the endogenous RNA silencing machineries and have no signiifcant impact on normal plant development.

  19. Relationship between soil cellulolytic activity and suppression of seedling blight of barley in arable soils

    DEFF Research Database (Denmark)

    Rasmussen, Peter Have; Knudsen, I.; Elmholt, S.


    the Hanes-Wolf transformation of the Michaelis-Menten equation. Soil samples from 6 to 13 cm depth were collected in the early spring as undisturbed blocks from 10 arable soils with different physico-chemical properties and cultivation history. Significant correlations were found between soil suppresiveness......The objective was to investigate the relationship between soil suppression of seedling blight of barley caused by Fusarium culmorum (W.G. Smith) Sacc. and the soil cellulolytic activity of beta-glucosidase, cellobiohydrolase and endocellulase. Disease suppression was investigated in bioassays...... with test soils mixed with sand, and barley seeds inoculated with F. culmorum. After 19 days, disease severity was evaluated on the barley seedlings. Soil cellulolytic activities were measured using 4-methylumbelliferyl-labelled fluorogenic substrates, and were expressed as V-max values obtained by using...

  20. Expression of a defence-related intercellular barley peroxidase in transgenic tobacco

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Brandt, J.; Bojsen, K.


    genetically, phenotypically and biochemically. The T-DNA was steadily inherited through three generations. The barley peroxidase is expressed and sorted to the intercellular space in the transgenic tobacco plants. The peroxidase can be extracted from the intercellular space in two molecular forms from both...... barley and transgenic tobacco. The tobacco expressed forms are indistinguishable from the barley expressed forms as determined by analytical isoelectric focusing (pI 8.5) and Western-blotting. Staining for N-glycosylation showed that one form only was glycosylated. The N-terminus of purified Prx8 from...... transgenic tobacco was blocked by pyroglutamate, after the removal of which, N-terminal sequencing verified the transit signal-peptide cleavage site deduced from the cDNA sequence. Phenotype comparisons show that the constitutive expression of Prx8 lead to growth retardation. However, an infection assay...

  1. The effect of nitrogen fertilization and irradiation on barley susceptibility to net blotch disease

    International Nuclear Information System (INIS)

    Arabi, M.I.E.; Al-safadi, B.; Charbaji, T.


    Isolates of Drechslera teres f. sp. teres that cause net blotch symptoms on barley were collected from fields in different regions of Syria. there virulence spectra were determined using 11 barley cultivars. Cultivars exhibited a continuos range of response from very susceptible to moderately resistant. Isolate Raqa 13 had the highest mean virulence, then Halap 2, whereas ICARDA 3 was the lowest virulent. The effect of three concentrations (1000, 1500, 2000 ppm) of nitrogen (Urea 45%) fertilizer, and two doses of gamma ray (10 and 20 Gy), on susceptibility to infection by Drechslera teres were studied. Two barley cultivars (Thibaut and Furia) were used in this study. Results showed that 1000 ppm (N) and 15 Gy dose treatment had a positive effect on decreasing the susceptibility. (author)

  2. Functional and structural characterization of plastidic starch phosphorylase during barley endosperm development

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Ruzanski, Christian; Krucewicz, Katarzyna


    The production of starch is essential for human nutrition and represents a major metabolic flux in the biosphere. The biosynthesis of starch in storage organs like barley endosperm operates via two main pathways using different substrates: starch synthases use ADP-glucose to produce amylose......,4-glucans using HvPho1 from G1P as the sole substrate. The structural properties of HvPho1 provide insights into the low affinity of HvPho1 for large polysaccharides like starch or amylopectin. Our results suggest that HvPho1 may play a role during the initiation of starch biosynthesis in barley....... and amylopectin, the two major components of starch, whereas starch phosphorylase (Pho1) uses glucose-1-phosphate (G1P), a precursor for ADP-glucose production, to produce α-1,4 glucans. The significance of the Pho1 pathway in starch biosynthesis has remained unclear. To elucidate the importance of barley Pho1...

  3. The effect of some growth regulators on enzyme systems in irradiated barley grain using disinfestation doses

    International Nuclear Information System (INIS)

    Bachman, S.


    Disinfestation doses of 20 to 100 krad may cause changes in the biological systems of barley grain and, therefore, may influence undesirably the technological quality of malted grain. The effect of some growth regulators on irradiated grain has been investigated. The experiments have been carried out on brewery barley var. Visa Breuns. Following growth-regulators were used: gibberellic acid (Polish preparation ''Gibrescol''), kinetin (6-furfurylo-aminopurin), CCC (2-chloroethyl trimethyl ammonium chloride), and betaine hydrochloride. By treating the irradiated barley with solutions of growth regulators it was possible to diminish the loss of enzyme activity. A ''regenerating'' effect of growth substances, mainly gibberellic acid and betain hydrochloride in 10 -4 M solutions, was observed. Amylolytic activity decreased immediately after irradiation but in samples treated with growth regulators it was higher than in those without regulators. The results may have a practical importance since gibberellic acid has just been introduced into the brewery industry. (F.J.)

  4. Identification of AFLP molecular linked to row- type gene in barley

    International Nuclear Information System (INIS)

    Sayed- Tabatabaei, B.E.


    Formation of the two-and six-rowed types in barley is predominantly controlled by alleles at a single locus (vrzl) which is located in long armn of chromosome 2H. This gene is a key character on the study of barley domestication and yield. Near-isogenic lines of barley were produced from crosses between Kanto Nakate Gold (tow-rowed) and Azumamugi (six-rowed). The selected lines were used for screening of AFLP polymorphic bands which are linked to vrs1 locus. After screening of a total of 1792 primer combination, five polymorphic bands were identified. A construction of high resolution map around the vrs1 locus was made using recombinant inbred lines. These markers can be used for a map-based cloning of the genes at the vrsl locus

  5. Maize, Sunflower and Barley Sensitivity to the Residual Activity of Clomazone in Soil

    Directory of Open Access Journals (Sweden)

    Jelena Gajić Umiljendić


    Full Text Available Sensitivity of maize, sunflower and barley to clomazone residues in loamy soil wasassessed in the study using bioassay. Clomazone was applied at a series of concentrationsfrom 0.12 to 12 mg a.i./kg of soil. After 14 days, morphological (shoot height, fresh and dryweight and physiological (content of carotenoids, chlorophyll a and chlorophyll b parameterswere measured. The results showed that morphological parameters are not valid indicatorsof clomazone sensitivity. Based on the results showing inhibition of the physiologicalparameters, I50 values were calculated and used to estimate the difference in sensitivitybetween the species tested. Sunflower was the most sensitive species, while the differencein sensitivity between maize and barley was not significant.Nomenclature: clomazone (2-(2-chlorbenzyl-4,4-dimethyl-1,2-oxazolidin-3-one, maize(Zea mays L., sunflower (Helianthus annuus L., barley (Hordeum vulgare L.

  6. Zinc blotting assay for detection of zinc binding prolamin in barley (Hordeum vulgare) grain

    DEFF Research Database (Denmark)

    Uddin, Mohammad Nasir; Nielsen, Ane Langkilde-Lauesen; Vincze, Eva


    In plants, zinc is commonly found bound to proteins. In barley (Hordeum vulgare), major storage proteins are alcohol-soluble prolamins known as hordeins, and some of them have the potential to bind or store zinc. 65Zn overlay and blotting techniques have been widely used for detecting zinc......-binding protein. However, to our knowledge so far this zinc blotting assay has never been applied to detect a prolamin fraction in barley grains. A radioactive zinc (65ZnCl2) blotting technique was optimized to detect zinc-binding prolamins, followed by development of an easy-to-follow nonradioactive colorimetric...... zinc blotting method with a zinc-sensing dye, dithizone. Hordeins were extracted from mature barley grain, separated by SDS-PAGE, blotted on a membrane, renatured, overlaid, and probed with zinc; subsequently, zinc-binding specificity of certain proteins was detected either by autoradiography or color...

  7. Proteome analysis of dissected barley seed tissue during germination and radicle elongation

    DEFF Research Database (Denmark)

    Bønsager, Birgit Christine


    at the protein or the DNA level. In addition, germination of barley seeds is of interest for the brewing industry since this process corresponds to the steeping process that starts the industrial malting. In the present study a proteomics approach was employed to understand the initial changes in the water...... soluble protein composition of the barley seed upon imbibition and the following events that occur until to 72 h post imbibition (PI). 2D gel electrophoresis of proteins extracted from dissected barley seeds tissues during germination (0-24 h) and the subsequent radicle elongation (24-72 h) describes...... spatio-temporal variations in the protein patterns. Seeds from 8 time points (0, 4, 12, 24, 36, 52, 60, and 72 h PI) were dissected into embryo, aleurone layer and endosperm and small scale protein extractions enabled us to obtain good resolution 2D gels. The 2D gels were compared between the time points...

  8. Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison

    DEFF Research Database (Denmark)

    Li, Chengdao; Ni, Peixiang; Francki, Michael


    Pre-harvest sprouting results in significant economic loss for the grain industry around the world. Lack of adequate seed dormancy is the major reason for pre-harvest sprouting in the field under wet weather conditions. Although this trait is governed by multiple genes it is also highly heritable....... A major QTL controlling both pre-harvest sprouting and seed dormancy has been identified on the long arm of barley chromosome 5H, and it explains over 70% of the phenotypic variation. Comparative genomics approaches among barley, wheat and rice were used to identify candidate gene(s) controlling seed...... dormancy and hence one aspect of pre-harvest sprouting. The barley seed dormancy/pre-harvest sprouting QTL was located in a region that showed good synteny with the terminal end of the long arm of rice chromosome 3. The rice DNA sequences were annotated and a gene encoding GA20-oxidase was identified...

  9. The comparison of nitrogen use and leaching in sole cropped versus intercropped pea and barley

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, H.; Ambus, P.; Jensen, E.S.


    The effect of sole and intercropping of field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) and of crop residue management on crop yield, NO3- leaching and N balance in the cropping system was tested in a 2-year lysimeter experiment on a temperate sandy loam soil. The crop rotation...... cropping. Crops received no fertilizer in the experimental period. Natural N-15 abundance techniques were used to determine pea N-2 fixation. The pea-barley intercrop yielded 4.0 Mg grain ha(-1), which was about 0.5 Mg lower than the yields of sole cropped pea but about 1.5 Mg greater than harvested...... was pea and barley sole and intercrops followed by winter-rye and a fallow period. The Land Equivalent Ratio (LER), which is defined as the relative land area under sole crops that is required to produce the yields achieved in intercropping, was used to compare intercropping performance relative to sole...

  10. Comparison of foliar anatomy of ten bread wheat (triticum, poaceae) and ten barley (hordeum, poaceae) cultivars

    International Nuclear Information System (INIS)

    Ardic, M.; Sezer, O.; Ozgdsd, K.; Yaylaci, O. K.; Koyuncu, O.; Olgun, M.; Bascdftcd, Z. B.; Ayter, N. G.


    The aim of this study is to determine anatomical differences and classification of leaf and leaf cell characteristics (cuticle thickness, upper epidermis thickness, lower epidermis thickness, mesophyll thickness, parenchyma thickness and leaf thickness) between 10 bread wheat cultivars (Triticum aestivum L.) and 10 barley cultivars (Hordeum vulgare L.). Classification of leaf characteristics in bread wheat and barley cultivars and relationship between leaf characteristics are made by principal component and correlation analyses. Highest thickness belongs to W8 Mufitbey cultivar in mesophyll and lower epidermis and W1 Sonmez 01 cultivar have the lowest thickness of upper epidermis in bread wheat. In Barley, B1 Ince cultivar has highest leaf thickness mesophyll and parenchyma; lowest thickness of cuticle is included B7 Cumhuriyet 50 cultivar. All other cultivars have homogenous contents of leaf characteristics. (author)

  11. A comparative assessment of antioxidant properties, total phenolic content of einkorn, wheat, barley and their malts. (United States)

    Fogarasi, Attila-Levente; Kun, Szilárd; Tankó, Gabriella; Stefanovits-Bányai, Eva; Hegyesné-Vecseri, Beáta


    Two einkorn wheat, one barley, three optional winter cultivation wheat and five winter cultivation wheat samples harvested in Hungary in 2011, and their malts were evaluated for their DPPH radical and ABTS radical cation scavenging activity, ferric reduction capacity (FRAP) and total phenolic content (TPC). All einkorn and barley samples exhibited significant antioxidant activities determined by DPPH and ABTS radical scavenging activities. The einkorn samples show higher polyphenol content than the other wheat samples. In all cases the barley sample had the highest antioxidant potential and polyphenol content. The einkorn malts had high DPPH and ABTS radical cation scavenging activities, but the phenolic content was lower against wheat samples. There was significant difference between the antioxidant potential of optional and winter cultivation wheat samples except on ABTS scavenging activities. Einkorn wheat is potentially a new raw material to produce organic beer that might have beneficial effects with its increased antioxidant potential. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Phosphorus acquisition by barley (Hordeum vulgare L. at suboptimal soil temperature

    Directory of Open Access Journals (Sweden)

    Kari Ylivainio


    Full Text Available We studied the effects of soil temperature (8 ºC and 15 ºC on barley growth, barley phosphorus (P uptake and soil P solubility. Barley was grown in a pot experiment in two soils with different P fertilization histories for 22 years. The availability of P was estimated by using 33P-labeled fertilizer and calculating L-values. After cultivation for 22 years at ambient soil temperature without P fertilization (-P, soil L-value had decreased compared to soil that received annual P fertilization (P+. Low soil temperature further reduced the L-values, more in the -P soil than in the +P soil. Our results demonstrated that P fertilization can only partially ameliorate poor growth at low soil temperatures. Thus, applying ample fertilization to compensate for poor growth at low soil temperatures would increase the P content and solubility in the soil, but plant uptake would remain inhibited by cold.

  13. The Hv NAC6 transcription factor: a positive regulator of penetration resistance in barley and Arabidopsis

    DEFF Research Database (Denmark)

    Jensen, Michael Krogh; Rung, Jesper Henrik; Gregersen, Per Langkjaer


    Pathogens induce the expression of many genes encoding plant transcription factors, though specific knowledge of the biological function of individual transcription factors remains scarce. NAC transcription factors are encoded in plants by a gene family with proposed functions in both abiotic...... and biotic stress adaptation, as well as in developmental processes. In this paper, we provide convincing evidence that a barley NAC transcription factor has a direct role in regulating basal defence. The gene transcript was isolated by differential display from barley leaves infected with the biotrophic...... powdery mildew fungus, Blumeria graminis f.sp. hordei (Bgh). The full-length cDNA clone was obtained using 5'-RACE and termed HvNAC6, due to its high similarity to the rice homologue, OsNAC6. Gene silencing of HvNAC6 during Bgh inoculation compromises penetration resistance in barley epidermal cells...

  14. Extracellular RNA Communication (ExRNA) (United States)

    Federal Laboratory Consortium — Until recently, scientists believed RNA worked mostly inside the cell that produced it. Some types of RNA help translate genes into proteins that are necessary for...

  15. Ethnobotany, diverse food uses, claimed health benefits and implications on conservation of barley landraces in North Eastern Ethiopia highlands

    Directory of Open Access Journals (Sweden)

    Sopade Peter A


    Full Text Available Abstract Background Barley is the number one food crop in the highland parts of North Eastern Ethiopia produced by subsistence farmers grown as landraces. Information on the ethnobotany, food utilization and maintenance of barley landraces is valuable to design and plan germplasm conservation strategies as well as to improve food utilization of barley. Methods A study, involving field visits and household interviews, was conducted in three administrative zones. Eleven districts from the three zones, five kebeles in each district and five households from each kebele were visited to gather information on the ethnobotany, the utilization of barley and how barley end-uses influence the maintenance of landrace diversity. Results According to farmers, barley is the "king of crops" and it is put for diverse uses with more than 20 types of barley dishes and beverages reportedly prepared in the study area. The products are prepared from either boiled/roasted whole grain, raw- and roasted-milled grain, or cracked grain as main, side, ceremonial, and recuperating dishes. The various barley traditional foods have perceived qualities and health benefits by the farmers. Fifteen diverse barley landraces were reported by farmers, and the ethnobotany of the landraces reflects key quantitative and qualitative traits. Some landraces that are preferred for their culinary qualities are being marginalized due to moisture shortage and soil degradation. Conclusions Farmers' preference of different landraces for various end-use qualities is one of the important factors that affect the decision process of landraces maintenance, which in turn affect genetic diversity. Further studies on improving maintenance of landraces, developing suitable varieties and improving the food utilization of barley including processing techniques could contribute to food security of the area.

  16. Ethnobotany, diverse food uses, claimed health benefits and implications on conservation of barley landraces in North Eastern Ethiopia highlands. (United States)

    Shewayrga, Hailemichael; Sopade, Peter A


    Barley is the number one food crop in the highland parts of North Eastern Ethiopia produced by subsistence farmers grown as landraces. Information on the ethnobotany, food utilization and maintenance of barley landraces is valuable to design and plan germplasm conservation strategies as well as to improve food utilization of barley. A study, involving field visits and household interviews, was conducted in three administrative zones. Eleven districts from the three zones, five kebeles in each district and five households from each kebele were visited to gather information on the ethnobotany, the utilization of barley and how barley end-uses influence the maintenance of landrace diversity. According to farmers, barley is the "king of crops" and it is put for diverse uses with more than 20 types of barley dishes and beverages reportedly prepared in the study area. The products are prepared from either boiled/roasted whole grain, raw- and roasted-milled grain, or cracked grain as main, side, ceremonial, and recuperating dishes. The various barley traditional foods have perceived qualities and health benefits by the farmers. Fifteen diverse barley landraces were reported by farmers, and the ethnobotany of the landraces reflects key quantitative and qualitative traits. Some landraces that are preferred for their culinary qualities are being marginalized due to moisture shortage and soil degradation. Farmers' preference of different landraces for various end-use qualities is one of the important factors that affect the decision process of landraces maintenance, which in turn affect genetic diversity. Further studies on improving maintenance of landraces, developing suitable varieties and improving the food utilization of barley including processing techniques could contribute to food security of the area.

  17. The effect of intercropping on weed infestation of a spring barley crop cultivated in monoculture

    Directory of Open Access Journals (Sweden)

    Ewa Kwiecińska-Poppe


    Full Text Available This paper presents the results of a study carried out in the years 2005-2007 in the Bezek Experimental Farm near the city of Chełm, Poland, on heavy mixed rendzina soil. The effect of intercropping, using red clover (cv. Dajana and white clover (cv. Astra, on weed infestation of a spring barley crop was studied. The species composition of weeds in the spring barley crop changed to a small extent under the influence of the application of clover intercropping, whereas the population size of particular species showed large fluctuations. In the spring barley crop with the red clover intercrop, Sonchus arvensis occurred in greatest numbers among dicotyledonous weed species. In the barley crop with white clover and without intercrop, Viola arvensis and Sonchus arvensis were the dominant dicotyledonous species. Setaria pumila was the dominant monocotyledonous species in all the treatments. Intercropping using red and white clover clearly limited the growth and development of weeds. The red clover intercrop in the spring barley crop better reduced the infestation with dicotyledonous weeds and also significantly reduced the number of monocotyledonous weeds and the total number of weeds, whereas the white clover intercrop limited only the number of monocotyledonous weeds. The application of the herbicide Chwastox Extra 300 SL significantly reduced the fresh weight of weeds found in the spring barley crop. The presence of the intercrop resulted in different total numbers of weeds in particular treatments. Intercropping distinctly limited the occurrence of the following weed species: Sonchus arvensis, Fallopia convolvulus, Melandrium album, Amaranthus retroflexus, Veronica arvensis and Medicago lupulina. The investigated intercrop species also reduced the biomass of weeds. The application of the herbicide did not differentiate the number of monocotyledonous weeds, which resulted from the application of Chwastox Extra 300 SL that controls only

  18. Exploring options for managing strategies for pea-barley intercropping using a modeling approach

    DEFF Research Database (Denmark)

    Launay, M.; Brisson, N.; Satger, S.


    ) intercropping made better use of environmental resources as regards yield amount and stability than sole cropping, with a noticeable site effect, (2) pea growth in intercrops was strongly linked to soil moisture, and barley yield was determined by nitrogen uptake and light interception due to its height......, underlining the interspecific offset in the use of environmental growth resources which led to similar total grain yields whatever the pea–barley design, and (5) long-term strategies including mineralization management through organic residue supply and rotation management were very valuable, always favoring...

  19. Marine eutrophication impacts from present and future production of spring barley

    DEFF Research Database (Denmark)

    Cosme, Nuno Miguel Dias; Niero, Monia


    Environmental emissions of nitrogen (N) from agriculture surplus may enrich coastal waters and trigger marine eutrophication impacts. We estimated these impacts for spring barley production in Denmark, under present and future climatic conditions with double carbon dioxide concentration and 5 °C...... increase. Characterised emissions of airborne (NH3 and NOx) and waterborne (NO3-) forms result in an endpoint impact of 2.35*10-12 (North Sea) and 8.47*10-12 species.yr (Baltic Sea) under present conditions per kg spring barley produced. The future scenario shows 67% increase on both spatial units. Spatial...... to hypoxia under future pressures may alter the impacts assessment....


    Directory of Open Access Journals (Sweden)

    Dimo PENKOV


    Full Text Available Using adapted methods for balanced experiments with waterfowl, the apparent (AMEn-0 and the true (TMEn-0 metabolizable energy of hull-less barley have been established. Despite the lower content of crude fi ber, the energy values were similar to the common barley (Hordeum sativa L.. The AMEn-0 and the TMEn-0 of the forage for Muscovy ducks were 12.29 MJ/kg DM and 13.28 MJ/kg DM, and the coeffi cients of the gross energy transformation - 68.97 and 74.52, respectively.

  1. Cereal bioengineering: Amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Shaik, Shahnoor Sultana; Jensen, Susanne Langgård

    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were made by transgenic methods. Cereals producing these kind of starches have not been reported before. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch...... and T1) of transgenic grains was tenfold higher than from vector control and wild type grains. Amylose content was not affected in hyper-phosphorylated grains. Hyper-phosphorylated starch granules had several pores on the surfaces, similar to pores seen on enzymatically semi-degraded granules...

  2. Cereal bioengineering: Amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Shaik, Shahnoor Sultana; Jensen, Susanne Langgård


    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were made by transgenic methods. Cereals producing these kind of starches have not been reported before. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch...... and T1) of transgenic grains was tenfold higher than from vector control and wild type grains. Amylose content was not affected in hyper-phosphorylated grains. Hyper-phosphorylated starch granules had several pores on the surfaces, similar to pores seen on enzymatically semi-degraded granules...

  3. Oligosaccharide and Substrate Binding in the Starch Debranching Enzyme Barley Limit Dextrinase

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Windahl, Michael Skovbo; Sim, Lyann


    Complete hydrolytic degradation of starch requires hydrolysis of both the α-1,4- and α-1,6-glucosidic bonds in amylopectin. Limit dextrinase (LD) is the only endogenous barley enzyme capable of hydrolyzing the α-1,6-glucosidic bond during seed germination, and impaired LD activity inevitably...... reduces the maltose and glucose yields from starch degradation. Crystal structures of barley LD and active-site mutants with natural substrates, products and substrate analogues were sought to better understand the facets of LD-substrate interactions that αconfine high activity of LD to branched...... starch synthesis....

  4. Barley alpha-amylase/subtilisin inhibitor: structure, biophysics and protein engineering

    DEFF Research Database (Denmark)

    Nielsen, P.K.; Bønsager, Birgit Christine; Fukuda, Kenji


    Bifunctional alpha-amylase/subtilisin inhibitors have been implicated in plant defence and regulation of endogenous alpha-amylase action. The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits the barley alpha-amylase 2 (AMY2) and subtilisin-type serine proteases. BASI belongs to the Kunitz...... Ca2+-modulated kinetics of the AMY2/BASl interaction and found that the complex formation involves minimal structural changes. The modulation of the interaction by calcium ions makes it unique among the currently known binding mechanisms of proteinaceous alpha-amylase inhibitors....

  5. Catalase activity of a crude enzyme preparation from iron-chlorotic barley (Hordeum vulgaris) seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Kotaka, S; Krueger, A P; Andriese, P C


    An attempt is made to investigate the effect of Fe-EDTA on catalase activity of the enzyme preparation from iron-chlorotic barley. It has been observed that the addition of iron in the form of iron-potassium-ethylene-tetraacetate to cell-free extracts prepared from barley seedlings which had developed chlorosis produced a marked increase in the catalase activity of the extracts. Results are presented which indicate that the pattern of increase in catalase activity is related to the extent of chlorosis. 7 references, 3 figures.

  6. Genetic mapping of the barley lodging resistance locus Erectoides-k

    DEFF Research Database (Denmark)

    Kristensen, Peter Skov; Dockter, Christoph; Lundqvist, Udda


    ’ is a semi-dwarf barley cultivar known for its culm stability and resistance to lodging. In total, eight allelic ert-k mutants are known that show different phenotypic strength concerning culm length and spike architecture. They represent alternatives to the widely used, but pleiotropic ‘Green Revolution...... provides a solid foundation for the identification of the underlying mutations causing the ert-k lodging-resistant phenotype. In addition, the linked markers could be used to follow the ert-k mutant genotype in marker-assisted selection of new lodging-resistant barley cultivars....

  7. Iron transport, deposition and bioavailability in the wheat and barley grain

    DEFF Research Database (Denmark)

    Borg, Søren; Brinch-Pedersen, Henrik; Tauris, Birgitte


    will briefly review existing knowledge on the distribution and transport pathways of iron in the two small grained cereals, barley and wheat, and focus on the efforts made to increase the iron content in cereals in general. However, mineral content is not the only factor of relevance for improving......). The nutritional impact of increasing mineral content accordingly has to be seen in the context of mineral bioavailability. Finally, we will briefly report on recent data from barley, where laser capture microdissection of the different grain tissues combined with gene expression profiling has provided some...

  8. Effects of gamma irradiation of barley and malt on malting quality

    International Nuclear Information System (INIS)

    Köksel, H.; ÇElik, S.; ÖZkara, R.


    Two two-rowed barley cultivars, Tokak and Clerine, were irradiated at two different dose ranges (0.05–0.75 kGy and 0.5–5.0 kGy) using a 60Co source. Irradiation of barley at the medium levels before malting had detrimental effects on most of the malt quality criteria. The detrimental effects of irradiation was lower at doses up to 0.25 kGy. Irradiation of malt samples caused either slight or no deterioration of quality characteristics

  9. Effect of Barley and Enzyme on Performance, Carcass, Enzyme Activity and Digestion Parameters of Broilers

    Directory of Open Access Journals (Sweden)

    majid kalantar


    Full Text Available Introduction Corn has been recently used for producing ethanol fuel in the major corn-producing countries such as the US and Brazil. Recent diversion of corn for biofuel production along with the increased world's demand for this feedstuff has resulted in unprecedented rise in feed cost for poultry worldwide. Alternative grains such as wheat and barley can be successfully replaced for corn in poultry diets. These cereal grains can locally grow in many parts of the world as they have remarkably lower water requirement than corn. Wheat and barley are generally used as major sources of energy in poultry diets. Though the major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls (Olukosi et al. 2007; Mirzaie et al. 2012. NSPs are generally considered as anti-nutritional factors (Jamroz et al. 2002. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value (Olukosi et al. 2007.Wheat and barley are generally used as major sources of energy in poultry diets. The major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls. NSPs are generally considered as anti-nutritional factors. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value. The major part of NSPs in barley comprises polymers of (1→3 (1→4-β- glucans which could impede growth factors and consequently carcass quality through lowering the rate and amount of available nutrients in the mucosal surface of the intestinal. Materials and Methods This experiment was conducted to evaluate the effect of corn and barley based diets supplemented with multi-enzyme on growth, carcass, pancreas enzyme activity and physiological characteristics of broilers. A total number of 375 one day old

  10. Irradiation seed treatment reduces scald, common root rot and increases phosphorus absorption of barley

    International Nuclear Information System (INIS)

    Arabi, M.I.E.; Jawhar, M.


    The effect of low doses of gamma irradiation on severity of barley to scald and common root rot diseases, and phosphorus absorption was studied seeds were exposed to doses of 0, 10, 15, 20, 30, 40 and 50 Gy. A stimulatory effect was observed at irradiation doses of 30 and 40 Gy, which decreased the severity of barley to scald by 34% and 31% respectively. On the other hand, doses 20 and 30 Gy decreased the severity to CRR by 54% and 49% respectively, whereas, phosphorus absorption was significantly increased at doses of 15 and 20 Gy

  11. Hamowanie syntezy chlorofilu i RNA w izolowanych liścieniach ogórka przez N-hydroksymocznik [Inhibition of chlorophyll and RNA synthesis by N-hydroxyurea in detached cucumber cotyledons

    Directory of Open Access Journals (Sweden)

    A. Rennert


    Full Text Available N-hydroxyurea (HU at the concentration of 5 x 10-4 M decreased the content of chlorophyll in detached cucumber cotyledons; at this concentration it has no inhibitory effect on growth. Benzylaminopurine, gibberelic acid and KCl partially reversed the inhibitory effect of HU on chlorophyll synthesis. HU stimulated yellowing of barley first leaf sections. The compound had little effect on leucine-14C incorporation to protein, and markedly inhibited uracil-14C incorporation in to RNA of the greening cucumber cotyledons. It is suggested that the inhibition of RNA and chlorophyll synthesis in HU-treated cucumber cotyledons follows the HU-dependent inhibition of DNA replication.

  12. Uptake of proline by the scutellum of germinating barley grain

    International Nuclear Information System (INIS)

    Vaeisaenen, E.; Sopanen, T.


    Scutella separated from germinating grains of barley (Hordeum vulgare L. cv Himalaya) took up 1 millimolar L-[ 14 C]proline at an initial rate of about 6.5 micromoles gram -1 fresh weight hour -1 (pH 5, 30 0 C). The uptake had a pH optimum at 5. The bulk of the uptake (93%) was via carrier-mediated active transport. All of the 19 L-amino acids tested at 10 millimolar concentration inhibited the mediated uptake of 1 millimolar proline, the inhibitions varying from 18 to 76%. By studying how large a fraction of the mediated uptake was inhibitable by asparagine, alanine, glutamine, and leucine, the mediated uptake was shown to be due to three components. Two of these are most probably attributable to the two nonspecific uptake systems proposed earlier to act in the uptake of glutamine and leucine. The third component was not inhibited by glutamine, asparagine, or alanine, but was inhibited by unlabeled proline and leucine. The uptake by this system was apparently carrier-mediated active transport. D-Proline inhibited this system as strongly as L-proline. Nine of the 16 L-amino tested at 50 millimolar concentrations did not inhibit the uptake of 1 millimolar proline by this system. Valine, leucine, isoleucine, and the basic amino acids were inhibitory, but in spite of this, they did not appear to be taken up by this system. It seems therefore that in addition to two nonspecific amino acid uptake systems the scutella have an uptake system which is specific for proline. It is likely that this proline-specific system accounts for the bulk of proline uptake in a germinating grain

  13. Radioprotective effects of ascorbic acid in barley seeds

    Energy Technology Data Exchange (ETDEWEB)

    Conger, B V


    Experiments were conducted to test the radioprotective effects of a naturally occurring reducing agent, ascorbic acid, on seeds (caryopses) of barley, Hordeum vulgare L. emend Lam. Seeds were soaked either before or after ..gamma.. or fission neutron irradiation in distilled water or ascorbic acid solutions ranging in concentration from 0.01 to 1.00 M. Results are reported as percentage germination, seedling height, seedling growth reduction, and (in one experiment) percent of cells with chromosome aberrations. As evidenced by both reduced germination and seedling growth, ascorbic acid was toxic when seeds were soaked for 1 hr at ambient temperature prior to irradiation and then planted immediately. When seeds were soaked in ascorbic acid before irradiation and soaked after irradiation in air-bubbled water at 0/sup 0/C for 18 hr, the toxicity disappeared, and a protective effect (which increased with increasing ascorbic acid concentration) was observed for ..gamma.. and, to a lesser extent, for neutron irradiation. Additional studies suggested that the protective effect was related to reduced hydration of the embryos of seeds soaked in ascorbic acid. Also, no radioprotective effect was observed when seeds were presoaked for 2 or 16 hr in 0.01 M ascorbic acid solutions buffered at pH 3 or pH 7. A protective effect was observed for seeds of 1.5 percent water content soaked after irradiation in an oxygen-bubbled ascorbic acid solution of 0.5 M but was not observed for seeds soaked in nitrogen-bubbled ascorbic acid. The protective effect against oxygen-dependent damage may be a result of interaction of ascorbic acid with radiation-induced free radicals.

  14. Starch accumulation in hulless barley during grain filling. (United States)

    Zheng, Xu-Guang; Qi, Jun-Cang; Hui, Hong-Shan; Lin, Li-Hao; Wang, Feng


    Starch consists of two types of molecules: amylose and amylopectin. The objective of this study was increase understanding about mechanisms related to starch accumulation in hulless barley (Hordeum vulgare L.) grain by measuring temporal changes in (i) grain amylose and amylopectin content, (ii) starch synthase activity, and (iii) the relative expressions of key starch-related genes. The amylopectin/amylose ratio gradually declined in both Beiqing 6 and Kunlun 12. In both cultivars, the activities of adenosine diphosphate glucose pyrophosphorylase, soluble starch synthase (SSS), granule bound starch synthase (GBSS), and starch branching enzyme (SBE) increased steadily during grain filling, reaching their maximums 20-25 days after anthesis. The activities of SSS and SBE were greater in Ganken 5 than in either Beiqing 6 or Kunlun 12. The expression of GBSS I was greater in Beiqing 6 and Kunlun 12 than in Ganken 5. In contrast, the expression of SSS I, SSS II and SBE I was greater in Ganken 5 than in Beiqing 6 and Kunlun 12. The peak in GBSS I expression was later than that of SSS I, SSS II, SBE IIa and SBE IIb. The GBSS I transcript in Kunlun 12 was expressed on average 90 times more than the GBSS II transcript. The results suggest that SBE and SSS may control starch synthesis at the transcriptional level, whereas GBSS I may control starch synthesis at the post transcriptional level. GBSS I is mainly responsible for amylose synthesis whereas SSS I and SBE II are mainly responsible for amylopectin synthesis in amyloplasts.

  15. WHIRLY1 Functions in the Control of Responses to Nitrogen Deficiency But Not Aphid Infestation in Barley. (United States)

    Comadira, Gloria; Rasool, Brwa; Kaprinska, Barbara; García, Belén Márquez; Morris, Jennifer; Verrall, Susan R; Bayer, Micha; Hedley, Peter E; Hancock, Robert D; Foyer, Christine H


    WHIRLY1 is largely targeted to plastids, where it is a major constituent of the nucleoids. To explore WHIRLY1 functions in barley (Hordeum vulgare), RNA interference-knockdown lines (W1-1, W1-7, and W1-9) that have very low levels of HvWHIRLY1 transcripts were characterized in plants grown under optimal and stress conditions. The WHIRLY1-1 (W1-1), W1-7, and W1-9 plants were phenotypically similar to the wild type but produced fewer tillers and seeds. Photosynthesis rates were similar in all lines, but W1-1, W1-7, and W1-9 leaves had significantly more chlorophyll and less sucrose than the wild type. Transcripts encoding specific subsets of chloroplast-localized proteins, such as ribosomal proteins, subunits of the RNA polymerase, and thylakoid nicotinamide adenine dinucleotide (reduced) and cytochrome b6/f complexes, were much more abundant in the W1-7 leaves than the wild type. Although susceptibility of aphid (Myzus persicae) infestation was similar in all lines, the WHIRLY1-deficient plants showed altered responses to nitrogen deficiency, maintaining higher photosynthetic CO2 assimilation rates than the wild type under limiting nitrogen. Although all lines showed globally similar low nitrogen-dependent changes in transcripts and metabolites, the increased abundance of FAR-RED IMPAIRED RESPONSE1-like transcripts in nitrogen-deficient W1-7 leaves infers that WHIRLY1 has a role in communication between plastid and nuclear genes encoding photosynthetic proteins during abiotic stress. © 2015 American Society of Plant Biologists. All Rights Reserved.

  16. Winter forage quality of oats (avena sativa), barley (hordeum vulgare) and vetch (vicia sativa) in pure stand and cereal legume mixture

    International Nuclear Information System (INIS)

    Ullah, Z.


    A field study was carried out for two consecutive years in subtropical rainfed conditions of Rawalpindi, Pakistan to evaluate the forage quality of oats, barley and vetch grown in pure stands and cereal-legume mixtures. Treatments comprised oats pure stand, oats in oats-vetch mixture, barley pure stand, barley in barley-vetch mixture, vetch pure stand, vetch in oats-vetch mixture and vetch in barley-vetch mixture. Forage yield and quality of oats and barley were improved in oats-vetch and barley-vetch mixtures than their respective pure stands. The higher values of crude protein (CP) and lower values of neutral detergent fiber (NDF) and acid detergent fiber (ADF) reflected quality forage. CP for oats in oats-vetch -1 -1 mixture and barley in barley-vetch mixture was 175 g kg and 170 g kg, -1 respectively. NDF and ADF for oats in oats-vetch mixture were 494 g kg /sup -1/ and 341 g kg, respectively; while these values for barley in barley-vetch -1 -1 mixture were 340 g kg and 176 g kg, respectively. (author)

  17. HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes. (United States)

    Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna


    CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

  18. Effect of soaking in water and rumen digeta solutions on metabolizable energy content and chemical composition of barley seeds for use in poultry diet. (United States)

    Tabatabee, S N; Sadeghi, G H; Tabeidian, S A


    An experiment was carried out to evaluate the effect of soaking in water and different rumen digesta solutions on nutritional value of dry barley seeds. Treatments were included distilled water as control and rumen digesta that diluted with distilled water to obtain 20, 40 and 60% digesta solutions. Solutions have added to 10 kg of barley seed samples to achieve final 30% moisture content. After 21 days the chemical composition and energy content of barley seed were determined. Gross energy of barley seeds did not affected by different experimental treatments. Use of 20% rumen digesta solution resulted to a significant (pcontent of barley seeds. Barley seed that treated with 40% of rumen digesta solution had highest TME and TMEn content and its different from seeds that treated with 60 and 100% rumen digesta solutions was significant (prumen digesta solutions increased crud protein, ether extract, crude fiber and ash content of barley seeds numerically.

  19. Deciphering Mineral Homeostasis in Barley Seed Transfer Cells at Transcriptional Level.

    Directory of Open Access Journals (Sweden)

    Behrooz Darbani

    Full Text Available In addition to the micronutrient inadequacy of staple crops for optimal human nutrition, a global downtrend in crop-quality has emerged from intensive breeding for yield. This trend will be aggravated by elevated levels of the greenhouse gas carbon dioxide. Therefore, crop biofortification is inevitable to ensure a sustainable supply of minerals to the large part of human population who is dietary dependent on staple crops. This requires a thorough understanding of plant-mineral interactions due to the complexity of mineral homeostasis. Employing RNA sequencing, we here communicate transfer cell specific effects of excess iron and zinc during grain filling in our model crop plant barley. Responding to alterations in mineral contents, we found a long range of different genes and transcripts. Among them, it is worth to highlight the auxin and ethylene signaling factors Arfs, Abcbs, Cand1, Hps4, Hac1, Ecr1, and Ctr1, diurnal fluctuation components Sdg2, Imb1, Lip1, and PhyC, retroelements, sulfur homeostasis components Amp1, Hmt3, Eil3, and Vip1, mineral trafficking components Med16, Cnnm4, Aha2, Clpc1, and Pcbps, and vacuole organization factors Ymr155W, RabG3F, Vps4, and Cbl3. Our analysis introduces new interactors and signifies a broad spectrum of regulatory levels from chromatin remodeling to intracellular protein sorting mechanisms active in the plant mineral homeostasis. The results highlight the importance of storage proteins in metal ion toxicity-resistance and chelation. Interestingly, the protein sorting and recycling factors Exoc7, Cdc1, Sec23A, and Rab11A contributed to the response as well as the polar distributors of metal-transporters ensuring the directional flow of minerals. Alternative isoform switching was found important for plant adaptation and occurred among transcripts coding for identical proteins as well as transcripts coding for protein isoforms. We also identified differences in the alternative-isoform preference between

  20. Deciphering Mineral Homeostasis in Barley Seed Transfer Cells at Transcriptional Level. (United States)

    Darbani, Behrooz; Noeparvar, Shahin; Borg, Søren


    In addition to the micronutrient inadequacy of staple crops for optimal human nutrition, a global downtrend in crop-quality has emerged from intensive breeding for yield. This trend will be aggravated by elevated levels of the greenhouse gas carbon dioxide. Therefore, crop biofortification is inevitable to ensure a sustainable supply of minerals to the large part of human population who is dietary dependent on staple crops. This requires a thorough understanding of plant-mineral interactions due to the complexity of mineral homeostasis. Employing RNA sequencing, we here communicate transfer cell specific effects of excess iron and zinc during grain filling in our model crop plant barley. Responding to alterations in mineral contents, we found a long range of different genes and transcripts. Among them, it is worth to highlight the auxin and ethylene signaling factors Arfs, Abcbs, Cand1, Hps4, Hac1, Ecr1, and Ctr1, diurnal fluctuation components Sdg2, Imb1, Lip1, and PhyC, retroelements, sulfur homeostasis components Amp1, Hmt3, Eil3, and Vip1, mineral trafficking components Med16, Cnnm4, Aha2, Clpc1, and Pcbps, and vacuole organization factors Ymr155W, RabG3F, Vps4, and Cbl3. Our analysis introduces new interactors and signifies a broad spectrum of regulatory levels from chromatin remodeling to intracellular protein sorting mechanisms active in the plant mineral homeostasis. The results highlight the importance of storage proteins in metal ion toxicity-resistance and chelation. Interestingly, the protein sorting and recycling factors Exoc7, Cdc1, Sec23A, and Rab11A contributed to the response as well as the polar distributors of metal-transporters ensuring the directional flow of minerals. Alternative isoform switching was found important for plant adaptation and occurred among transcripts coding for identical proteins as well as transcripts coding for protein isoforms. We also identified differences in the alternative-isoform preference between the treatments

  1. Sequence elements controlling expression of Barley stripe mosaic virus subgenomic RNAs in vivo

    International Nuclear Information System (INIS)

    Johnson, Jennifer A.; Bragg, Jennifer N.; Lawrence, Diane M.; Jackson, Andrew O.


    Barley stripe mosaic virus (BSMV) contains three positive-sense, single-stranded genomic RNAs, designated α, β, and γ, that encode seven major proteins and one minor translational readthrough protein. Three proteins (αa, βa, and γa) are translated directly from the genomic RNAs and the remaining proteins encoded on RNAβ and RNAγ are expressed via three subgenomic messenger RNAs (sgRNAs). sgRNAβ1 directs synthesis of the triple gene block 1 (TGB1) protein. The TGB2 protein, the TGB2' minor translational readthrough protein, and the TGB3 protein are expressed from sgRNAβ2, which is present in considerably lower abundance than sgRNAβ1. A third sgRNA, sgRNAγ, is required for expression of the γb protein. We have used deletion analyses and site-specific mutations to define the boundaries of promoter regions that are critical for expression of the BSMV sgRNAs in infected protoplasts. The results reveal that the sgRNAβ1 promoter encompasses positions -29 to -2 relative to its transcription start site and is adjacent to a cis-acting element required for RNAβ replication that maps from -107 to -74 relative to the sgRNAβ1 start site. The core sgRNAβ2 promoter includes residues -32 to -17 relative to the sgRNAβ2 transcriptional start site, although maximal activity requires an upstream hexanucleotide sequence residing from positions -64 to -59. The sgRNAγ promoter maps from -21 to +2 relative to its transcription start site and therefore partially overlaps the γa gene. The sgRNAβ1, β2, and γ promoters also differ substantially in sequence, but have similarities to the putative homologous promoters of other Hordeiviruses. These differences are postulated to affect competition for the viral polymerase, coordination of the temporal expression and abundance of the TGB proteins, and constitutive expression of the γb protein

  2. Observed and predicted changes over eight years in frequency of barley powdery mildew avirulent to spring barley in France and Denmark

    DEFF Research Database (Denmark)

    Bousset, L.; Hovmøller, M.S.; Caffier, V.


    Aerial populations of Blumeria graminis f.sp. hordei were studied in two French and two Danish regions from 1991 to 1999, at a time of year when only winter barley was present. A high frequency of genotypes not able to grow on the spring-sown crop of the previous growing season (denoted 'spring......-avirulent') was observed in most years and regions. This frequency increased with increasing proportion of winter barley; it was highest in France and decreased in general over the 8-year period. Most of the spring-avirulent genotypes possessed the V-a22 virulence gene, matching a resistance that has never been present...... of the pathogen population in this system, demonstrated that selection solely due to host resistance genes, i.e. without assuming any cost of virulence, might lead to such results as those observed. The changes in frequency of spring-avirulent genotypes and the frequency of unnecessary virulence genes may...

  3. Production and processing of siRNA precursor transcripts from the highly repetitive maize genome.

    Directory of Open Access Journals (Sweden)

    Christopher J Hale


    Full Text Available Mutations affecting the maintenance of heritable epigenetic states in maize identify multiple RNA-directed DNA methylation (RdDM factors including RMR1, a novel member of a plant-specific clade of Snf2-related proteins. Here we show that RMR1 is necessary for the accumulation of a majority of 24 nt small RNAs, including those derived from Long-Terminal Repeat (LTR retrotransposons, the most common repetitive feature in the maize genome. A genetic analysis of DNA transposon repression indicates that RMR1 acts upstream of the RNA-dependent RNA polymerase, RDR2 (MOP1. Surprisingly, we show that non-polyadenylated transcripts from a sampling of LTR retrotransposons are lost in both rmr1 and rdr2 mutants. In contrast, plants deficient for RNA Polymerase IV (Pol IV function show an increase in polyadenylated LTR RNA transcripts. These findings support a model in which Pol IV functions independently of the small RNA accumulation facilitated by RMR1 and RDR2 and support that a loss of Pol IV leads to RNA Polymerase II-based transcription. Additionally, the lack of changes in general genome homeostasis in rmr1 mutants, despite the global loss of 24 nt small RNAs, challenges the perceived roles of siRNAs in maintaining functional heterochromatin in the genomes of outcrossing grass species.

  4. Influence of barley grain particle size and treatment with citric acid on digestibility, ruminal fermentation and microbial protein synthesis in Holstein calves. (United States)

    Kazemi-Bonchenari, M; Salem, A Z M; López, S


    Chemical and physical treatments of barley grain increase ruminally resistant starch and can improve the rumen fermentation pattern. The objective of the present study was to evaluate the effects of chemical (addition of citric acid, CA) and physical (grinding to two different particle sizes, PS) treatment of barley grain on performance, rumen fermentation, microbial protein yield in the rumen and selected blood metabolites in growing calves. In all, 28 male Holstein calves (172±5.1 kg initial BW) were used in a complete randomised design with a factorial arrangement of 2 barley grain particle sizes×2 levels of citric acid. The diets were as follows: (i) small PS (average 1200 µm) barley grain soaked in water (no CA addition); (ii) small PS barley grain soaked in a CA solution (adding 20 g CA/kg barley); (iii) large PS (average 2400 µm) barley grain soaked in water (no citric acid addition) and (iv) large PS barley grain soaked in a citric acid solution (adding 20 g CA/kg barley). Barley grain was then incorporated at 35% in a total mixed ration and fed to the calves for 11 weeks. Feeding small PS barley decreased feed intake (P=0.02) and average daily weight gain (P=0.01). The addition of CA to barley grain did not affect intake but increased weight gain (P0.05). However, the molar proportion of propionate was increased (P=0.03) when barley was more finely ground, and that of acetate was increased (P=0.04) when CA was added to barley grain. The ruminal concentration of ammonia nitrogen was increased (Pgrain with citric acid increased fibre digestibility of total mixed rations, attenuated the decrease in ruminal pH, and improved weight gain and feed efficiency in male Holstein growing calves fed a high-cereal diet (550 g cereal grain/kg diet).

  5. Cooking Characteristics and Antioxidant Activity of Rice-Barley Mix at Different Cooking Method and Mixing Ratio. (United States)

    Woo, Koan Sik; Kim, Hyun-Joo; Lee, Ji Hae; Ko, Jee Yeon; Lee, Byong Won; Lee, Byoung Kyu


    This study aimed to compare the phenolic compounds and antioxidant activity of barley at different proportion (0, 5, 10, 15, and 20%), and using different cooking methods. The grains used in this experiment are barley ( Hordeum vulgare L. cv. Huinchalssal) and Samkwang rice. The rice-barley mixture was cooked using general and high pressure cooking methods with and without fermented alcohol. The quality characteristics such as water binding capacity, pasting characteristic, water solubility, and swelling power of different proportions of barley were evaluated. The antioxidant characteristics evaluated are total polyphenol, flavonoid contents, 2,2-diphenyl-1-picrylhydrazyl (DPPH), and 2,2-azinobis(3-ethylbenothiazoline-6-sulphonic acid) (ABTS) diammonium salt radical scavenging activities. Results showed that peak [195.0~184.0 rapid visco units (RVU)], trough (130.0~116.2 RVU), final (252.0~221.8 RVU), and setback viscosity (57.0~37.5 RVU) decreased correspondingly with the increase in the amount of barley. Water binding capacity (187.31~136.01%) and swelling power (162.37~127.58%) decreased as amounts of barley increases, however the water solubility (5.35~6.89%) increased. Moreover, the total polyphenol and flavonoid, and the DPPH and ABTS radical scavenging activities contents increased as the amounts of barley in the mixture increases. This study generally aims to provide useful information for the manufacturing of processed products.

  6. Relationship of carbohydrates and lignin molecular structure spectral profiles to nutrient profile in newly developed oats cultivars and barley grain (United States)

    Prates, Luciana Louzada; Refat, Basim; Lei, Yaogeng; Louzada-Prates, Mariana; Yu, Peiqiang


    The objectives of this study were to quantify the chemical profile and the magnitude of differences in the oat and barley grain varieties developed by Crop Development Centre (CDC) in terms of Cornell Net Carbohydrate Protein System (CNCPS) carbohydrate sub-fractions: CA4 (sugars), CB1 (starch), CB2 (soluble fibre), CB3 (available neutral detergent fibre - NDF), and CC (unavailable carbohydrate); to estimate the energy values; to detect the lignin and carbohydrate (CHO) molecular structure profiles in CDC Nasser and CDC Seabiscuit oat and CDC Meredith barley grains by using Fourier transform infrared attenuated total reflectance (FTIR-ATR); to develop a model to predict nutrient supply based on CHO molecular profile. Results showed that NDF, ADF and CHO were greater (P 0.05) for oat and barley grains as well as non-structural CHO. However, cellulosic compounds peak area and height were greater (P < 0.05) in oat than barley grains. Multiple regressions were determined to predict nutrient supply by using lignin and CHO molecular profiles. It was concluded that although there were some differences between oat and barley grains, CDC Nasser and CDC Meredith presented similarities related to chemical and molecular profiles, indicating that CDC Meredith barley could be replaced for CDC Nasser as ruminant feed. The FTIR was able to identify functional groups related to CHO molecular spectral in oat and barley grains and FTIR-ATR results could be used to predict nutrient supply in ruminant livestock systems.

  7. The barley MATE gene, HvAACT1, increases citrate efflux and Al3+ tolerance when expressed in wheat and barley (United States)

    Zhou, Gaofeng; Delhaize, Emmanuel; Zhou, Meixue; Ryan, Peter R.


    Background and Aims Aluminium is toxic in acid soils because the soluble Al3+ inhibits root growth. A mechanism of Al3+ tolerance discovered in many plant species involves the release of organic anions from root apices. The Al3+-activated release of citrate from the root apices of Al3+-tolerant genotypes of barley is controlled by a MATE gene named HvAACT1 that encodes a citrate transport protein located on the plasma membrane. The aim of this study was to investigate whether expressing HvAACT1 with a constitutive promoter in barley and wheat can increase citrate efflux and Al3+ tolerance of these important cereal species. Methods HvAACT1 was over-expressed in wheat (Triticum aestivum) and barley (Hordeum vulgare) using the maize ubiquitin promoter. Root apices of transgenic and control lines were analysed for HvAACT1 expression and organic acid efflux. The Al3+ tolerance of transgenic and control lines was assessed in both hydroponic solution and acid soil. Key Results and Conclusions Increased HvAACT1 expression in both cereal species was associated with increased citrate efflux from root apices and enhanced Al3+ tolerance, thus demonstrating that biotechnology can complement traditional breeding practices to increase the Al3+ tolerance of important crop plants. PMID:23798600

  8. Yield and yield structure of spring barley (Hodeum vulgare L. grown in monoculture after different stubble crops

    Directory of Open Access Journals (Sweden)

    Dorota Gawęda


    Full Text Available A field experiment was conducted in the period 2006- 2008 in the Uhrusk Experimental Farm belonging to the University of Life Sciences in Lublin. The experimental factor was the type of stubble crop ploughed in each year after harvest of spring barley: white mustard, lacy phacelia, winter rape, and a mixture of narrow-leaf lupin with field pea. In the experiment, successive spring barley crops were grown one after the other (in continuous monoculture. The aim of the experiment was to evaluate the effect of stubble crops used on the size and structure of barley yield. The three-year study showed an increasing trend in grain yield of spring barley grown after the mixture of legumes, lacy phacelia, and white mustard compared to its size in the treatment with no cover crop. Straw yield was significantly higher when barley was grown after the mixture of narrowleaf lupin with field pea than in the other treatments of the experiment. The type of ploughed-in stubble crop did not modify significantly plant height, ear length, and grain weight per ear. Growing the mixture of leguminous plants as a cover crop resulted in a significant increase in the density of ears per unit area in barley by an average of 14.7% relative to the treatment with winter rape. The experiment also showed the beneficial effect of the winter rape cover crop on 1000-grain weight of spring barley compared to that obtained in the treatments with white mustard and the mixture of legumes. All the cover crops caused an increase in the number of grains per ear of barley relative to that found in the control treatment. However, this increase was statistically proven only for the barley crops grown after lacy phacelia and the mixture of legumes.

  9. Comparative energy content and amino acid digestibility of barley obtained from diverse sources fed to growing pigs. (United States)

    Wang, Hong Liang; Shi, Meng; Xu, Xiao; Ma, Xiao Kang; Liu, Ling; Piao, Xiang Shu


    Two experiments were conducted to determine the content of digestible energy (DE) and metabolizable energy (ME) as well as the apparent ileal digestibility (AID) and standardized ileal digestibility (SID) of crude protein (CP) and amino acids (AA) in barley grains obtained from Australia, France or Canada. In Exp. 1, 18 growing barrows (Duroc×Landrace×Yorkshire; 31.5±3.2 kg) were individually placed in stainless-steel metabolism crates (1.4×0.7×0.6 m) and randomly allotted to 1 of 3 test diets. In Exp. 2, eight crossbred pigs (30.9±1.8 kg) were allotted to a replicate 3×4 Youden Square designed experiment with three periods and four diets. Two pigs received each diet during each test period. The diets included one nitrogen-free diet and three test diets. The relative amounts of gross energy (GE), CP, and all AA in the Canadian barley were higher than those in Australian and French barley while higher concentrations of neutral detergent fiber, acid detergent fiber, total dietary fiber, insoluble dietary fiber and β-glucan as well as lower concentrations of GE and ether extract were observed in the French barley compared with the other two barley sources. The DE and ME as well as the SID of histidine, isoleucine, leucine and phenylalanine in Canadian barley were higher (penergy content and the SID and AID of AA were observed among barley sources obtained from three countries. The feeding value of barley from Canada and Australia was superior to barley obtained from France which is important information in developing feeding systems for growing pigs where imported grains are used.

  10. Calibration and validation of the crop growth model daisy for spring barley in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Pohanková, Eva; Hlavinka, Petr; Takáč, J.; Žalud, Zdeněk; Trnka, Miroslav


    Roč. 63, č. 4 (2015), s. 1177-1186 ISSN 1211-8516 R&D Projects: GA MŠk(CZ) LD13030; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 Keywords : Tolar * Crop growth model * daisy * Field experiments * Growth dynamics * Phenology * Spring barley Subject RIV: EH - Ecology, Behaviour

  11. Quantitative trait loci associated with the tocochromanol (vitamin E) pathway in barley (United States)

    In this study, the Genome-Wide Association Studies approach was used to detect Quantitative Trait Loci associated with tocochromanol concentrations using a panel of 1,466 barley accessions. All major tocochromanol types- alpha-, beta-, delta-, gamma-tocopherol and tocotrienol- were assayed. We found...

  12. Effects of partial replacement of barley with sugar beet pulp on pre ...

    African Journals Online (AJOL)

    Sixteen Zel ewes (BW = 37 ± 3.10 kg) were used in a completely randomized design to determine the effects of partial replacement of barley grain with beet pulp (BP), during late pregnancy and early lactation, on litter weight, lamb's daily gain, milk yield and milk composition. Dietary treatments were initiated approximately ...

  13. Quality Control System for Beer Developed with Monoclonal Antibodies Specific to Barley Lipid Transfer Protein

    Directory of Open Access Journals (Sweden)

    Yukie Murakami-Yamaguchi


    Full Text Available Non-specific lipid transfer protein (LTP in barley grain reacted with the IgE in sera drawn from food allergy patients. A sandwich-type of enzyme-linked immunosorbent assay (ELISA was developed with mouse monoclonal antibodies raised against LTP purified with barley flour. This ELISA showed a practical working range of 0.3–3 ng/mL and no cross-reactivity with wheat, adlay and rye. Using this ELISA, LTP was determined in several types of barley-foods, including fermented foods such as malt vinegar, barley-malt miso and beer. LTP content in beer of the same kind was approximately constant, even if manufacturing factory and production days were different. Not only as a factor of foam formation and stability but also as an allergen, controlling and monitoring of LTP in beer should be considered. Taken together, our LTP-detecting ELISA can be proposed as an appropriate system for the quality control of beer.

  14. Phytotoxic effects of argan shell biochar on salad and barley germination

    Directory of Open Access Journals (Sweden)

    Laila Bouqbis


    Full Text Available Biochar produced from argan shells can be contaminated by toxic substances accumulated during the pyrolysis process. To determine the potential impact of toxic substances and salt stress, this study focused on the effect argan shell biochar had on the germination of salad (0%, 0.5%, 1%, 2%, 4% or 8% biochar dry weight in a sand-biochar mixture and barley seeds (0%, 1%, 2.5%, 5% or 10% biochar dry weight in a peat-biochar mixture. No negative salt stress effect of argan biochar on the germination of salad was observed nor on the germination rate and fresh weight of seedlings. Additionally, biochar application increased the germination rate and the fresh biomass weight in all of the treatments. No significant difference was observed from the control with the barley germination rate, fresh and dry weights of barley seedlings, water content and water use efficiency of different mixtures (peat-biochar. Thus, for both the salad and barley germination tests, no negative effects of biochar produced from argan shells were identified, providing a preliminary indication that it could be safely used for agriculture.

  15. Interaction of barley powdery mildew effector candidate CSEP0055 with the defence protein PR17c

    DEFF Research Database (Denmark)

    Zhang, Wenjing; Pedersen, Carsten; Kwaaitaal, Mark Adrianus Cornelis J


    A large number of effector candidates have been identified recently in powdery mildew fungi. However, their roles and how they perform their functions remain unresolved. In this study, we made use of host-induced gene silencing and confirmed that the secreted barley powdery mildew effector candid...

  16. A Japanese powdery mildew isolate with exceptionally large infection efficience on Mlo-resistant barley

    DEFF Research Database (Denmark)

    Lyngkjær, M.F.; Jensen, H.P.; Østergård, Hanne


    A Japanese field isolate (Race I) of Erysiphe graminis f,sp. hordei was tested on 17 barley lines carrying the mlo powdery mildew resistance gene. Race I produced many successful infections with infection type larger than or equal to 2 on six lines (M66, MC20, SR1, SR7, Atem and Totem). On the re...

  17. Mechanistic and genetic overlap of barley host and non-host resistance to Blumeria graminis

    NARCIS (Netherlands)

    Trujillo, M.; Troeger, M.; Niks, R.E.; Kogel, K.H.; Huckelhoven, R.


    Non-host resistance of barley to Blumeria graminis f.sp. tritici (Bgt), an inappropriate forma specialis of the grass powdery mildew fungus, is associated with formation of cell wall appositions (papillae) at sites of attempted fungal penetration and a hypersensitive cell death reaction (HR) of

  18. Latent manganese deficiency increases transpiration in barley (Hordeum vulgare)

    DEFF Research Database (Denmark)

    Hebbern, Christopher Alan; Laursen, Kristian Holst; Ladegaard, Anne Hald


    To investigate if latent manganese (Mn) deficiency leads to increased transpiration, barley plants were grown for 10 weeks in hydroponics with daily additions of Mn in the low nM range. The Mn-starved plants did not exhibit visual leaf symptoms of Mn deficiency, but Chl a fluorescence measurements...

  19. Comparative Transcriptional Profiling of Two Contrasting Barley Genotypes under Salinity Stress during the Seedling Stage

    Directory of Open Access Journals (Sweden)

    Runhong Gao


    Full Text Available Salinity is one of the major abiotic stresses that affect crop productivity. Identification of the potential novel genes responsible for salt tolerance in barley will contribute to understanding the molecular mechanism of barley responses to salt stress. We compared changes in transcriptome between Hua 11 (a salt-tolerant genotype and Hua 30 (a salt sensitive genotype in response to salt stress at the seedling stage using barley cDNA microarrays. In total, 557 and 247 salt-responsive genes were expressed exclusively in the shoot and root tissue of the salt-tolerant genotype, respectively. Among these genes, a number of signal-related genes, transcription factors and compatible solutes were identified and some of these genes were carefully discussed. Notably, a LysM RLK was firstly found involved in salt stress response. Moreover, key enzymes in the pathways of jasmonic acid biosynthesis, lipid metabolism and indole-3-acetic acid homeostasis were specifically affected by salt stress in salt tolerance genotype. These salt-responsive genes and biochemical pathways identified in this study could provide further information for understanding the mechanisms of salt tolerance in barley.

  20. miR172 down-regulates the translation of cleistogamy 1 in barley (United States)

    Floret opening in barley is induced by the swelling of the lodicule, a trait under the control of the cleistogamy1 (cly1) gene. The product of cly1 is a member of the APETALA2 (AP2) transcription factor family, which inhibits lodicule development. A sequence polymorphism at the miR172 target site wi...

  1. Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers. (United States)

    Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej


    Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.

  2. Comparison of different pretreatment strategies for enzymatic hydrolysis of wheat and barley straw

    DEFF Research Database (Denmark)

    Rosgaard, Lisa; Pedersen, Sven; Meyer, Anne Boye Strunge


    In biomass-to-ethanol processes a physico-chemical pretreatment of the lignocellulosic biomass is a critical requirement for enhancing the accessibility of the cellulose substrate to enzymatic attack. This report evaluates the efficacy on barley and wheat straw of three different pretreatment pro...

  3. An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment

    Directory of Open Access Journals (Sweden)

    Péter Szűcs


    Full Text Available Barley ( L. is an economically important model plant for genetics research. Barley is currently served by an increasingly comprehensive set of tools for genetic analysis that have recently been augmented by high-density genetic linkage maps built with gene-based single nucleotide polymorphisms (SNPs. These SNP-based maps need to be aligned with earlier generation maps, which were used for quantitative trait locus (QTL detection, by integrating multiple types of markers into a single map. A 2383 locus linkage map was developed using the Oregon Wolfe Barley (OWB Mapping Population to allow such alignments. The map is based on 1472 SNP, 722 DArT, and 189 prior markers which include morphological, simple sequence repeat (SSR, Restriction Fragment Length Polymorphism (RFLP, and sequence tagged site (STS loci. This new OWB map forms, therefore, a useful bridge between high-density SNP-only maps and prior QTL reports. The application of this bridge concept is shown using malting-quality QTLs from multiple mapping populations, as reported in the literature. This is the first step toward developing a Barley QTL Community Curation workbook for all types of QTLs and maps, on the GrainGenes website. The OWB-related resources are available at OWB Data and GrainGenes Tools (OWB-DGGT (.

  4. Bioaccessible mineral content of malted finger millet (Eleusine coracana), wheat (Triticum aestivum), and barley (Hordeum vulgare). (United States)

    Platel, Kalpana; Eipeson, Sushma W; Srinivasan, Krishnapura


    Malted grains are extensively used in weaning and geriatric foods. Malting generally improves the nutrient content and digestibility of foods. The present investigation examined the influence of malting of finger millet, wheat, and barley on the bioaccessibility of iron, zinc, calcium, copper, and manganese. Malting increased the bioaccessibility of iron by >3-fold from the two varieties of finger millet and by >2-fold from wheat, whereas such a beneficial influence was not seen in barley. The bioaccessibility of zinc from wheat and barley increased to an extent of 234 and 100%, respectively, as a result of malting. However, malting reduced the bioaccessibility of zinc from finger millet. Malting marginally increased the bioaccessibility of calcium from white finger millet and wheat. Whereas malting did not exert any influence on bioaccessibility of copper from finger millet and wheat, it significantly decreased (75%) the same from barley. Malting did increase the bioaccessibility of manganese from brown finger millet (17%) and wheat (42%). Thus, malting could be an appropriate food-based strategy to derive iron and other minerals maximally from food grains.

  5. Production of eicosapentaenoic acid by mortierella spp on barley spent grain

    CSIR Research Space (South Africa)

    Jacobs, A


    Full Text Available fermentation, on barley spent grain, a by-product of the brewing industry and a food- grade waste. The substrate has a high protein content and a high fat content (21-25% and 9- 10% respectively on a dry basis). The enzymes used by the fungi to produce ω-3...

  6. Selectivity of the surface binding site (SBS) on barley starch synthase I

    DEFF Research Database (Denmark)

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica


    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  7. Phenotypic selection and regulation of reproduction in different environments in wild barley

    NARCIS (Netherlands)

    Volis, S.; Verhoeven, K.J.F.; Mendlinger, S.; Ward, D.


    Plasticity of the phenotypic architecture of wild barley, Hordeum spontaneum, was studied in response to water and nutrient stress. Direct and indirect selection on several vegetative and reproductive traits was estimated and path analysis used to reveal how regulating pathways via maternal

  8. Evaluating Yield and Drought Stress Indices under End Season Drought Stress in Promising Genotypes of Barley

    Directory of Open Access Journals (Sweden)

    H. Tajalli


    Full Text Available To study the effects of end season drought stress on yield, yield components and drought stress indices in barley, a split plot experiment arranged in randomized complete block design with three replications was conducted at the Agricultural Research Center of Birjand in 2008-2009 crop years. Drought stress, in 2 levels, consists of control (complete irrigation and stopping irrigation at the 50% of heading stage, and 20 promising genotypes of barley were the treatments of the experiment. Results revealed that stopping irrigation lead to declining of 14.64 and 8.12 percent of seed and forage yields against control condition, respectively. Using stress susceptibility index (SSI indicated that genotypes 2, 3, 7, 9, 10 and 15; using STI and GMP indices, genotypes 5, 8, 18 and 20 using MP, genotypes 8, 18 and 20, and TOL, genotypes 2, 3, 7, 9, and 10, were the most drought tolerant genotypes. Correlation between seed yield and stress evaluation indices showed that MP, GMP and STI are the best indices to be used in selection and introducing drought tolerant genotypes of barley. Considering all indices, and given that the best genotypes are those with high yield under normal condition and minimum yield reduction under drought stress, No. 18 and 20 could be introduced as the most tolerant barley genotypes to drought.

  9. Climate Change Impacts and Adaptation Strategies in Spring Barley Production in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Trnka, M.; Dubrovský, Martin; Žalud, Z.


    Roč. 64, 1-2 (2004), s. 227-255 ISSN 0165-0009 R&D Projects: GA ČR GA521/02/0827 Institutional research plan: CEZ:AV0Z3042911 Keywords : CERES-barley model * climate change impacts * stochastic weather generator Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 2.035, year: 2004

  10. Improving nitrogen use efficiency in barley (Hordeum vulgare L.) through the cisgenic approach

    DEFF Research Database (Denmark)

    Kichey, Thomas Michel René; Holme, Inger; Møller, Inge Skrumsager


    into the pGreenII binary vector. The genes have been inserted into barley by Agrobacterium-mediated transformation using the hygromycin phosphotransferase gene for selection of transformed lines on hygromycin. In this system, the resistance gene is placed on the helper plasmid pSoup allowing for separate...

  11. The Effect of Fungicides for Seed Treatment on Germination of Barley

    Directory of Open Access Journals (Sweden)

    Vesna Stevanović


    Full Text Available The application of chemicals, such as fungicides for seed treatment, is one of the most reliable and perhaps most efficient measures for integrated preservation of crops, and its practicing has become a legal obligation for all seed producers. This investigation was carried out in the laboratory for seed quality and phytopathology of the Small Grains Research Center in Kragujevac. The objective was to establish the effect of fungicides on germination energy and seed germinability (determined after treatments. Two varieties were tested due to a possibility of specific sensitivities of some varieties, so that the results acquired on one variety would not necessarily be valid for another one. Fungicides based on active ingredients from the triasol chemical group had different effects on the energy of germination of barley seeds. Applying Raxil S040-FS, the average germination of barley seeds was 79.3% for the variety Record, and 91.3% for the Grand variety. The variety Record achieved a lower value than the minimum for barley seed germination (88% stipulated by the Rules on Seed Quality of Agricultural Crops.Regardless of barley type, the product Raxil S040-FS showed a statistically significant effect on the number of atypical seedlings and increase in the number of non-germinated seeds, compared to the control.

  12. Dissection of barley chromosomes 1H and 6H by the gametocidal system

    Czech Academy of Sciences Publication Activity Database

    Ishihara, A.; Mizuno, N.; Islam, R.A.K.M.; Doležel, Jaroslav; Endo, Takashi R.; Nasuda, S.


    Roč. 89, č. 5 (2014), s. 203-214 ISSN 1341-7568 Institutional support: RVO:61389030 Keywords : barley * chromosome dissection * chromosome mapping Subject RIV: EI - Biotechnology ; Bionics Impact factor: 0.930, year: 2014

  13. Pirimiphos-methyl residues in stored wheat and barley, bread, burghul and parboiled wheat

    International Nuclear Information System (INIS)

    Hadjidemetriou, D.G.


    Residues of 14 C-pirimiphos-methyl in stored grain declined to 88% in wheat and 82% in barley after 12 months. Corresponding percentages with the unlabelled insecticide were 78% and 59% since only the parent chemical was determined. Surface residues, removed by washing the grain with water, decreased from 3.3 to 0.2 mg/kg for wheat and from 2.0 to 0.2 mg/kg for barley. Bound residues increased gradually with time and reached a maximum of 2.2% for wheat and 3.0% for barley in 12 months. Pirimiphos-methyl residues in flour increased from 1.1 at 0 time to 2.2 mg/kg after one year. The mean values of residues contained in the unwashed wheat grain were 81% for bran and 19% for flour. The loss in milling during preparation of wholemeal flour from prewashed grain was 7% for wheat and 6% for barley. Processed products from wheat showed residue losses ranging from 24 to 45%. (author). 16 refs, 2 figs, 2 tabs

  14. Genetic diversity and structure analysis based on hordein protein polymorphism in barley landrace populations from jordan

    International Nuclear Information System (INIS)

    Baloch, A.W.; Ali, M.; Baloch, A.M.; Mangan, B.U.N.; Song, W


    Jordan is unanimously considered to be one of the centers of genetic diversity for barley, where wild and landraces of barley has been grown under different climatic conditions. The genetic diversity and genetic structure based on hordein polymorphism was assessed in 90 different accessions collected from four different sites of Jordan. A-PAGE was used to reveal hordein polymorphism among the genotypes. A total of 29 distinct bands were identified, out of them 9 bands were distinguished for D, 11 for C, and 9 for the B hordein regions. The observed genetic similarity was an exceptionally high between the populations than expected, which is probably due to high gene flow estimated between them. The genetic diversity parameters were not differ largely among the populations, indicating that local selection of a particular site did not play a key role in shaping genetic diversity. Analysis of molecular variance (AMOVA) revealed significant population structure when accessions were structured according to population site. There was 94% of hordein variation resided within the populations and only 8% present among the populations. Both Bayesian and Principale Coordinate Analysis (PCoA) concordantly demonstrated admixture genotypes of the landraces barley populations. Consequently, none of the population found to be clustered separately according to its population site. It is concluded that this approach can be useful to explore the germplasm for genetic diversity but perhaps is not suitable for determining phylogenic relations in barley. (author)

  15. Purification of a lipoxygenase from ungerminated barley. Characterization and product formation

    NARCIS (Netherlands)

    Vliegenthart, J.F.G.; Aarle, P.G.M. van; Barse, M.M.J. de; Veldink, G.A.


    Lipoxygenase was purified from ungerminated barley (variety ‘Triumph’), yielding an active enzyme with a pl of 5.2 and a molecular mass of approximately 90 kDa. In addition to the 90 kDa band SDS-PAGE showed the presence of two further proteins of 63 kDa. Western blot analysis showed

  16. Linkage disequilibrium mapping of yield and yield stability in modern spring barley cultivars

    NARCIS (Netherlands)

    Kraakman, A.T.W.; Niks, R.E.; Berg, van den P.M.M.M.; Stam, P.; Eeuwijk, van F.A.


    Associations between markers and complex quantitative traits were investigated in a collection of 146 modern two-row spring barley cultivars, representing the current commercial germ plasm in Europe. Using 236 AFLP markers, associations between markets were found for markers as far apart as 10 cM.

  17. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.


    is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  18. Penicillium verrucosum in wheat and barley indicates presence of ochratoxin A

    DEFF Research Database (Denmark)

    Lund, Flemming; Frisvad, Jens Christian


    Aims: The aims of this study were to isolate and identify ochratoxin A (OTA) producing fungi in cereals containing OTA and to determine the best selective and indicative medium for recovery of OTA producing fungi.Methods and Results: Seventy-six wheat, barley and rye samples from Europe containing...

  19. Secretory expression of functional barley limit dextrinase by Pichia pastoris using high cell-density fermentation

    DEFF Research Database (Denmark)

    Vester-Christensen, Malene Bech; Abou Hachem, Maher; Næsted, Henrik


    biosynthesis by trimming of intermediate branched alpha-glucan structures. Highly active barley LD is obtained by secretory expression during high cell-density fermentation of Pichia pastoris. The LD encoding gene fragment without signal peptide was subcloned in-frame with the Saccharomyces cerevisiae alpha...

  20. Energy consumption in barley and turnip rape cultivation for bioethanol and biodiesel (RME) production

    Energy Technology Data Exchange (ETDEWEB)

    Mikkola, Hannu; Ahokas, Jukka [University of Helsinki, Faculty of Agriculture and Forestry, Department of Agricultural Sciences, FIN-00014 Helsingin yliopisto (Finland); Pahkala, Katri [MTT, Agrifood Research Finland, Crop Science and Technology, FIN-31600 Jokioinen (Finland)


    The energy consumption for six spring barley (Hordeum vulgare L.) production chains and five spring turnip rape (Brassica rapa ssp. oleifera (DC) Metsg.) production chains were compared with each other and in relation to the energy content of the seed yield. Two cultivation intensities, standard and intensive production, were used for barley. Fertiliser production and grain drying were the most energy consuming phases of the chains. The production of nitrogen fertiliser alone accounted for 1/3-1/2 of the total energy consumption of the production chains. If barley were direct drilled and the yield stored in airtight silos, instead of drying, the energy consumption would decrease by 30-34%. Use of wood-chips instead of oil for grain drying would decrease the use of fossil fuel to the same extent. The input-output ratios for the intensive barley production chains were 0.18-0.25. They were somewhat lower than the ratios for the standard production intensity. The intensive production was more energy efficient despite higher input rates. The input-output ratios for turnip rape production were 0.32-0.34. The energy consumption for manufacturing, repair and maintenance of machines and buildings requires more research because it is a significant factor but the data available are largely old and few studies have been conducted. (author)