
Sample records for barley rna-directed rna

  1. Identification and characterization of barley RNA-directed RNA polymerases

    DEFF Research Database (Denmark)

    Madsen, Christian Toft; Stephens, Jennifer; Hornyik, Csaba;


    in dicot species. In this report, we identi!ed and characterized HvRDR1, HvRDR2 and HvRDR6 genes in the monocot plant barley (Hordeum vulgare). We analysed their expression under various biotic and abiotic stresses including fungal and viral infections, salicylic acid treatment as well as during plant...... development. The different classes and subclasses of barley RDRs displayed contrasting expression patterns during pathogen challenge and development suggesting their involvement in speci!c regulatory pathways. Their response to heat and salicylic acid treatment suggests a conserved pattern of expression...

  2. RNA-directed repair of DNA double-strand breaks. (United States)

    Yang, Yun-Gui; Qi, Yijun


    DNA double-strand breaks (DSBs) are among the most deleterious DNA lesions, which if unrepaired or repaired incorrectly can cause cell death or genome instability that may lead to cancer. To counteract these adverse consequences, eukaryotes have evolved a highly orchestrated mechanism to repair DSBs, namely DNA-damage-response (DDR). DDR, as defined specifically in relation to DSBs, consists of multi-layered regulatory modes including DNA damage sensors, transducers and effectors, through which DSBs are sensed and then repaired via DNAprotein interactions. Unexpectedly, recent studies have revealed a direct role of RNA in the repair of DSBs, including DSB-induced small RNA (diRNA)-directed and RNA-templated DNA repair. Here, we summarize the recent discoveries of RNA-mediated regulation of DSB repair and discuss the potential impact of these novel RNA components of the DSB repair pathway on genomic stability and plasticity. PMID:25960340

  3. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.


    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

  4. The splicing factor SR45 affects the RNA-directed DNA methylation pathway in Arabidopsis


    Ausin, Israel; Greenberg, Maxim V. C.; Li, Carey Fei; Jacobsen, Steven E.


    Cytosine DNA methylation is an epigenetic mark frequently associated with silencing of genes and transposons. In Arabidopsis, the establishment of cytosine DNA methylation is performed by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2). DRM2 is guided to target sequences by small interfering RNAs (siRNAs) in a pathway termed RNA-directed DNA methylation (RdDM). We performed a screen for mutants that affect the establishment of DNA methylation by investigating genes that contain predicted RNA-in...

  5. A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

    KAUST Repository

    Law, Julie A.


    DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

  6. INVOLVED IN DE NOVO 2-containing complex involved in RNA-directed DNA methylation in Arabidopsis

    Energy Technology Data Exchange (ETDEWEB)

    Ausin, Israel; Greenberg, Maxim V.C.; Simanshu, Dhirendra K.; Hale, Christopher J.; Vashisht, Ajay A.; Simon, Stacey A.; Lee, Tzuu-fen; Feng, Suhua; Española, Sophia D.; Meyers, Blake C.; Wohlschlegel, James A.; Patel, Dinshaw J.; Jacobsen, Steven E. (UCLA); (MSKCC); (Delaware)


    At least three pathways control maintenance of DNA cytosine methylation in Arabidopsis thaliana. However, the RNA-directed DNA methylation (RdDM) pathway is solely responsible for establishment of this silencing mark. We previously described INVOLVED IN DE NOVO 2 (IDN2) as being an RNA-binding RdDM component that is required for DNA methylation establishment. In this study, we describe the discovery of two partially redundant proteins that are paralogous to IDN2 and that form a stable complex with IDN2 in vivo. Null mutations in both genes, termed IDN2-LIKE 1 and IDN2-LIKE 2 (IDNL1 and IDNL2), result in a phenotype that mirrors, but does not further enhance, the idn2 mutant phenotype. Genetic analysis suggests that this complex acts in a step in the downstream portion of the RdDM pathway. We also have performed structural analysis showing that the IDN2 XS domain adopts an RNA recognition motif (RRM) fold. Finally, genome-wide DNA methylation and expression analysis confirms the placement of the IDN proteins in an RdDM pathway that affects DNA methylation and transcriptional control at many sites in the genome. Results from this study identify and describe two unique components of the RdDM machinery, adding to our understanding of DNA methylation control in the Arabidopsis genome.

  7. Digital quantification of miRNA directly in plasma using integrated comprehensive droplet digital detection. (United States)

    Zhang, Kaixiang; Kang, Dong-Ku; Ali, M Monsur; Liu, Linan; Labanieh, Louai; Lu, Mengrou; Riazifar, Hamidreza; Nguyen, Thi N; Zell, Jason A; Digman, Michelle A; Gratton, Enrico; Li, Jinghong; Zhao, Weian


    Quantification of miRNAs in blood can be potentially used for early disease detection, surveillance monitoring and drug response evaluation. However, quantitative and robust measurement of miRNAs in blood is still a major challenge in large part due to their low concentration and complicated sample preparation processes typically required in conventional assays. Here, we present the 'Integrated Comprehensive Droplet Digital Detection' (IC 3D) system where the plasma sample containing target miRNAs is encapsulated into microdroplets, enzymatically amplified and digitally counted using a novel, high-throughput 3D particle counter. Using Let-7a as a target, we demonstrate that IC 3D can specifically quantify target miRNA directly from blood plasma at extremely low concentrations ranging from 10s to 10 000 copies per mL in ≤3 hours without the need for sample processing such as RNA extraction. Using this new tool, we demonstrate that target miRNA content in colon cancer patient blood is significantly higher than that in healthy donor samples. Our IC 3D system has the potential to introduce a new paradigm for rapid, sensitive and specific detection of low-abundance biomarkers in biological samples with minimal sample processing. PMID:26387763

  8. IDN2 and its paralogs form a complex required for RNA-directed DNA methylation.

    Directory of Open Access Journals (Sweden)

    Cui-Jun Zhang

    Full Text Available IDN2/RDM12 has been previously identified as a component of the RNA-directed DNA methylation (RdDM machinery in Arabidopsis thaliana, but how it functions in RdDM remains unknown. By affinity purification of IDN2, we co-purified two IDN2 paralogs IDP1 and IDP2 (IDN2 PARALOG 1 and 2. The coiled-coil domain between the XS and XH domains of IDN2 is essential for IDN2 homodimerization, whereas the IDN2 C-terminal XH domain but not the coiled-coil domain is required for IDN2 interaction with IDP1 and IDP2. By introducing the wild-type IDN2 sequence and its mutated derivatives into the idn2 mutant for complementation testing, we demonstrated that the previously uncharacterized IDN2 XH domain is required for the IDN2-IDP1/IDP2 complex formation as well as for IDN2 function. IDP1 is required for de novo DNA methylation, siRNA accumulation, and transcriptional gene silencing, whereas IDP2 has partially overlapping roles with IDP1. Unlike IDN2, IDP1 and IDP2 are incapable of binding double-stranded RNA, suggesting that the roles of IDP1 and IDP2 are different from those of IDN2 in the IDN2-IDP1/IDP2 complex and that IDP1 and IDP2 are essential for the functioning of the complex in RdDM.

  9. Identification of factors involved in target RNA-directed microRNA degradation. (United States)

    Haas, Gabrielle; Cetin, Semih; Messmer, Mélanie; Chane-Woon-Ming, Béatrice; Terenzi, Olivier; Chicher, Johana; Kuhn, Lauriane; Hammann, Philippe; Pfeffer, Sébastien


    The mechanism by which micro (mi)RNAs control their target gene expression is now well understood. It is however less clear how the level of miRNAs themselves is regulated. Under specific conditions, abundant and highly complementary target RNA can trigger miRNA degradation by a mechanism involving nucleotide addition and exonucleolytic degradation. One such mechanism has been previously observed to occur naturally during viral infection. To date, the molecular details of this phenomenon are not known. We report here that both the degree of complementarity and the ratio of miRNA/target abundance are crucial for the efficient decay of the small RNA. Using a proteomic approach based on the transfection of biotinylated antimiRNA oligonucleotides, we set to identify the factors involved in target-mediated miRNA degradation. Among the retrieved proteins, we identified members of the RNA-induced silencing complex, but also RNA modifying and degradation enzymes. We further validate and characterize the importance of one of these, the Perlman Syndrome 3'-5' exonuclease DIS3L2. We show that this protein interacts with Argonaute 2 and functionally validate its role in target-directed miRNA degradation both by artificial targets and in the context of mouse cytomegalovirus infection. PMID:26809675

  10. An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

    KAUST Repository

    Gao, Zhihuan


    DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.

  11. Efficient dual sgRNA-directed large gene deletion in rabbit with CRISPR/Cas9 system. (United States)

    Song, Yuning; Yuan, Lin; Wang, Yong; Chen, Mao; Deng, Jichao; Lv, Qingyan; Sui, Tingting; Li, Zhanjun; Lai, Liangxue


    The CRISPR RNA-guided Cas9 nuclease gene-targeting system has been extensively used to edit the genome of several organisms. However, most mutations reported to date have been are indels, resulting in multiple mutations and numerous alleles in targeted genes. In the present study, a large deletion of 105 kb in the TYR (tyrosinase) gene was generated in rabbit via a dual sgRNA-directed CRISPR/Cas9 system. The typical symptoms of albinism accompanied significantly decreased expression of TYR in the TYR knockout rabbits. Furthermore, the same genotype and albinism phenotype were found in the F1 generation, suggesting that large-fragment deletions can be efficiently transmitted to the germline and stably inherited in offspring. Taken together, our data demonstrate that mono and biallelic large deletions can be achieved using the dual sgRNA-directed CRISPR/Cas9 system. This system produces no mosaic mutations or off-target effects, making it an efficient tool for large-fragment deletions in rabbit and other organisms. PMID:26817461

  12. Struggling to let go: A non‐coding RNA directs its own extension and destruction


    Bernecky, C.; Cramer, P.


    In addition to its role in DNA-dependent transcription, RNA polymerase II (Pol II) possesses RNA-dependent RNA polymerase (RdRP) activity (Lehmann et al, 2007). In a study published in this issue of The EMBO Journal, Wagner et al (2013) report the first native cellular function of the RdRP activity of Pol II. The authors find that a mammalian non-coding RNA (ncRNA) can serve as a template for its own extension by Pol II, resulting in its destabilization and a decrease in its potency to repres...

  13. Synthetic Polymer Hybridization with DNA and RNA Directs Nanoparticle Loading, Silencing Delivery, and Aptamer Function. (United States)

    Zhou, Zhun; Xia, Xin; Bong, Dennis


    We report herein discrete triplex hybridization of DNA and RNA with polyacrylates. Length-monodisperse triazine-derivatized polymers were prepared on gram-scale by reversible addition-fragmentation chain-transfer polymerization. Despite stereoregio backbone heterogeneity, the triazine polymers bind T/U-rich DNA or RNA with nanomolar affinity upon mixing in a 1:1 ratio, as judged by thermal melts, circular dichroism, gel-shift assays, and fluorescence quenching. We call these polyacrylates "bifacial polymer nucleic acids" (bPoNAs). Nucleic acid hybridization with bPoNA enables DNA loading onto polymer nanoparticles, siRNA silencing delivery, and can further serve as an allosteric trigger of RNA aptamer function. Thus, bPoNAs can serve as tools for both non-covalent bioconjugation and structure-function nucleation. It is anticipated that bPoNAs will have utility in both bio- and nanotechnology. PMID:26138550

  14. Chromosomes. A comprehensive Xist interactome reveals cohesin repulsion and an RNA-directed chromosome conformation. (United States)

    Minajigi, Anand; Froberg, John E; Wei, Chunyao; Sunwoo, Hongjae; Kesner, Barry; Colognori, David; Lessing, Derek; Payer, Bernhard; Boukhali, Myriam; Haas, Wilhelm; Lee, Jeannie T


    The inactive X chromosome (Xi) serves as a model to understand gene silencing on a global scale. Here, we perform "identification of direct RNA interacting proteins" (iDRiP) to isolate a comprehensive protein interactome for Xist, an RNA required for Xi silencing. We discover multiple classes of interactors-including cohesins, condensins, topoisomerases, RNA helicases, chromatin remodelers, and modifiers-that synergistically repress Xi transcription. Inhibiting two or three interactors destabilizes silencing. Although Xist attracts some interactors, it repels architectural factors. Xist evicts cohesins from the Xi and directs an Xi-specific chromosome conformation. Upon deleting Xist, the Xi acquires the cohesin-binding and chromosomal architecture of the active X. Our study unveils many layers of Xi repression and demonstrates a central role for RNA in the topological organization of mammalian chromosomes. PMID:26089354

  15. Synthetic Polymer Hybridization with DNA and RNA Directs Nanoparticle Loading, Silencing Delivery, and Aptamer Function


    Zhou, Zhun; Xia, Xin; Bong, Dennis


    We report herein discrete triplex hybridization of DNA and RNA with polyacrylates. Length-monodisperse triazine-derivatized polymers were prepared on gram-scale by reversible addition–fragmentation chain-transfer polymerization. Despite stereoregio backbone heterogeneity, the triazine polymers bind T/U-rich DNA or RNA with nanomolar affinity upon mixing in a 1:1 ratio, as judged by thermal melts, circular dichroism, gel-shift assays, and fluorescence quenching. We call these polyacrylates “bi...

  16. CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea


    Marraffini, Luciano A.; Sontheimer, Erik J.


    Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CR...

  17. CNP2 mRNA directs synthesis of both CNP1 and CNP2 polypeptides. (United States)

    O'Neill, R C; Minuk, J; Cox, M E; Braun, P E; Gravel, M


    The ribosome scanning model for translational initiation predicts that eukaryotic mRNAs should, as a rule, be monocistronic. However, cases have recently been described of eukaryotic mRNAs producing more than one protein through alternative translational initiation at several different AUG codons. The present work reports the occurrence of two translational start sites on the mRNA encoding isoform 2 of the myelin marker enzyme 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNP) in rat and mouse. We show that the CNP2 mRNA is able to direct synthesis of not only CNP2, but also CNP1 polypeptide. Immunoprecipitation experiments using a polyclonal antibody directed against CNP detect both CNP isoforms in tissues or cell lines expressing only the CNP2 transcript. Thus, the synthesis of CNP1 and CNP2 polypeptides must be encoded by the CNP2 transcript. In vitro translation of synthetic CNP2 mRNA demonstrates that both CNP isoforms are synthesized by initiation at different AUG codons. Furthermore, by introducing mutations to "switch off" translation from the second in-frame AUG codon in the CNP2 cDNA, and transfecting 293T cells with those constructs, we are able to correlate the production of CNP1 and CNP2 with different translational start sites. These results lead us to conclude that the CNP2 mRNA is able to produce both CNP1 and CNP2 polypeptides. This investigation has altered our understanding of the temporal expression of the CNP protein isoforms during development of the central nervous system (CNS). PMID:9373034

  18. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin


    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  19. Subcellular distribution of small interfering RNA: directed delivery through RNA polymerase III expression cassettes and localization by in situ hybridization. (United States)

    Paul, Cynthia P


    Reduction in the expression of specific genes through small interfering RNAs (siRNAs) is dependent on the colocalization of siRNAs with other components of the RNA interference (RNAi) pathways within the cell. The expression of siRNAs within cells from cassettes that are derived from genes transcribed by RNA polymerase III (pol III) and provide for selective subcellular distribution of their products can be used to direct siRNAs to the cellular pathways. Expression from the human U6 promoter, resulting in siRNA accumulation in the nucleus, is effective in reducing gene expression, whereas cytoplasmic and nucleolar localization of the siRNA when expressed from the 5S or 7 SL promoters is not effective. The distribution of siRNA within the cell is determined by fluorescence in situ hybridization. Although the long uninterrupted duplex of siRNA makes it difficult to detect with DNA oligonucleotide probes, labeled oligonucleotide probes with 2'-O-methyl RNA backbones provide the stability needed for a strong signal. These methods contribute to studies of the interconnected cellular RNAi pathways and are useful in adapting RNAi as a tool to determine gene function and develop RNA-based therapeutics. PMID:15644179

  20. Repression of callus initiation by the miRNA-directed interaction of auxin-cytokinin in Arabidopsis thaliana. (United States)

    Liu, Zhenhua; Li, Juan; Wang, Long; Li, Qiang; Lu, Qing; Yu, Yanchong; Li, Shuo; Bai, Ming-Yi; Hu, Yuxin; Xiang, Fengning


    In tissue culture systems plant cells can be induced to regenerate to whole plants. A particularly striking example of cellular reprogramming is seen in this regeneration process, which typically begins with the induction of an intermediate cell mass referred to as callus. The identity of the key genetic cues associated with callus formation is still largely unknown. Here a microRNA-directed phytohormonal interaction is described which represses callus initiation and formation in Arabidopsis thaliana. miR160 and ARF10 (At2g28350), a gene encoding an auxin response factor, were shown to exhibit a contrasting pattern of transcription during callus initiation from pericycle-like cells. The callus initiation is faster and more prolific in a miR160-resistant form of ARF10 (mARF10), but slower and less prolific in the transgenic line over-expressing miR160c (At5g46845), arf10 and arf10 arf16 mutants than that in the wild type. ARF10 repressed the expression of Arabidopsis Response Regulator15 (ARR15, At1g74890) via its direct binding to the gene's promoter. The loss of function of ARR15 enhanced callus initiation and partly rescued the phenotype induced by the transgene Pro35S:miR160c. Overexpression of ARR15 partly rescues the callus initiation defect of mARF10 plants. Our findings define miR160 as a key repressor of callus formation and reveal that the initiation of callus is repressed by miR160-directed interaction between auxin and cytokinin. PMID:27189514

  1. Inhibition of Plasmodium falciparum proliferation in vitro by double-stranded RNA directed against malaria histone deacetylase

    International Nuclear Information System (INIS)

    Acetylation and deacetylation of histones play important roles in transcription regulation, cell cycle progression and development events. The steady state status of histone acetylation is controlled by a dynamic equilibrium between competing histone acetylase and deacetylase (HDAC). We have used long PfHDAC-1 double-stranded (ds)RNA to interfere with its cognate mRNA expression and determined the effect on malaria parasite growth and development. Chloroquine- and pyrimethamine-resistant Plasmodium falciparum K1 strain was exposed to 1-25 μg of dsRNA/ml of culture for 48 h and growth was determined by [3H]-hypoxanthine incorporation and microscopic examination. Parasite culture treated with 10 μg/ml pfHDAC-1 dsRNA exhibited 47% growth inhibition when compared with either untreated control or culture treated with an unrelated dsRNA. PfHDAC-1 dsRNA specifically blocked maturation of trophozoite to schizont stages and decreased PfHDAC-1 transcript 44% in treated trophozoites. These results indicate the potential of HDAC-1 as a target for development of novel antimalarials.

  2. Characterization of an RNA-directed DNA polymerase from a cell line derived from a radiation-induced lymphoma in mice

    International Nuclear Information System (INIS)

    An RNA-directed DNA polymerase was purified from a cell line derived from a radiation-induced lymphoma in NIH Swiss mice which produced non-infectious type C virus particles. The enzyme was isolated from a high speed particulate fraction which bands at a density of 1.16-1.19 g/ml in a sucrose gradient, and purified by successive chromatography on DEAE-cellulose, phosphocellulose and hydroxyapatite. The purified DNA polymerase has a molecular weight of 68 000, a pH optimum of 7.5, a KCl optimum of 50 mM, and a Mn2+ optimum of 0.25 mM. It prefers (dT)15.(A)sub(n) to (dT)15.(dA)sub(n) as the primer template and transcribes the poly(C) strand of (dG)15.(C)sub(n) and (dG)15.(OMeC)sub(n). It transcribes heteropolymeric regions of avian myeloblastosis virus 70 S RNA, and is inhibited by antiserum to Rauscher murine leukemia virus DNA polymerase. Comparison of the properties of DNA polymerase purified from radiation-induced lymphoma cells with the DNA polymerase purified from non-defective murine type C RNA tumor viruses shows that the mouse lymphoma enzyme is both biochemically and immunologically related to murine leukemia virus DNA polymerases. (Auth.)

  3. Angiosperms Are Unique among Land Plant Lineages in the Occurrence of Key Genes in the RNA-Directed DNA Methylation (RdDM) Pathway. (United States)

    Ma, Lu; Hatlen, Andrea; Kelly, Laura J; Becher, Hannes; Wang, Wencai; Kovarik, Ales; Leitch, Ilia J; Leitch, Andrew R


    The RNA-directed DNA methylation (RdDM) pathway can be divided into three phases: 1) small interfering RNA biogenesis, 2) de novo methylation, and 3) chromatin modification. To determine the degree of conservation of this pathway we searched for key genes among land plants. We used OrthoMCL and the OrthoMCL Viridiplantae database to analyze proteomes of species in bryophytes, lycophytes, monilophytes, gymnosperms, and angiosperms. We also analyzed small RNA size categories and, in two gymnosperms, cytosine methylation in ribosomal DNA. Six proteins were restricted to angiosperms, these being NRPD4/NRPE4, RDM1, DMS3 (defective in meristem silencing 3), SHH1 (SAWADEE homeodomain homolog 1), KTF1, and SUVR2, although we failed to find the latter three proteins in Fritillaria persica, a species with a giant genome. Small RNAs of 24 nt in length were abundant only in angiosperms. Phylogenetic analyses of Dicer-like (DCL) proteins showed that DCL2 was restricted to seed plants, although it was absent in Gnetum gnemon and Welwitschia mirabilis. The data suggest that phases (1) and (2) of the RdDM pathway, described for model angiosperms, evolved with angiosperms. The absence of some features of RdDM in F. persica may be associated with its large genome. Phase (3) is probably the most conserved part of the pathway across land plants. DCL2, involved in virus defense and interaction with the canonical RdDM pathway to facilitate methylation of CHH, is absent outside seed plants. Its absence in G. gnemon, and W. mirabilis coupled with distinctive patterns of CHH methylation, suggest a secondary loss of DCL2 following the divergence of Gnetales. PMID:26338185

  4. IMP3 RNP safe houses prevent miRNA-directed HMGA2 mRNA decay in cancer and development

    DEFF Research Database (Denmark)

    Jønson, Lars; Christiansen, Jan; Hansen, Thomas van Overeem;


    The IMP3 RNA-binding protein is associated with metastasis and poor outcome in human cancer. Using solid cancer transcriptome data, we found that IMP3 correlates with HMGA2 mRNA expression. Cytoplasmic IMP3 granules contain HMGA2, and IMP3 dose-dependently increases HMGA2 mRNA. HMGA2 is regulated...... by let-7, and let-7 antagomiRs make HMGA2 refractory to IMP3. Removal of let-7 target sites eliminates IMP3-dependent stabilization, and IMP3-containing bodies are depleted of Ago1-4 and miRNAs. The relationship between Hmga2 mRNA and IMPs also exists in the developing limb bud, where IMP1-deficient...... embryos show dose-dependent Hmga2 mRNA downregulation. Finally, IMP3 ribonucleoproteins (RNPs) contain other let-7 target mRNAs, including LIN28B, and a global gene set enrichment analysis demonstrates that miRNA-regulated transcripts in general are upregulated following IMP3 induction. We conclude that...

  5. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment. (United States)

    Kwasniewska, Jolanta; Jaskowiak, Joanna


    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  6. Isolation and Translation of Hordein Messenger RNA from Wild Type and Mutant Endosperms in Barley

    DEFF Research Database (Denmark)

    Brandt, Anders Bøving; Ingwersen, J.


    0.30 megadaltons. The 11S messenger RNA was translated in vitro into hordein precursor polypeptides which are 2–4 kilodaltons larger than the native hordein polypeptides. The endosperm cell of mutant No. 1508 contained twice as much RNA as the wild type endosperm cell but the same amount of...... polyadenylated 11S RNA. The template activity of the latter was 10% of that found for the 11S hordein messenger RNA from the wild type and was limited to translation into one hordein precursor polypeptide....... different B1 hordein polypeptide, which is revealed by 21 nucleotide substitutions resulting in 9 amino acid changes. Messenger RNA has been isolated from developing barley endosperms by sucrose gradient sedimentation, Sepharose 4B gel filtration and preparative gel electrophoresis. Hordein messenger RNA...

  7. Effects of seed irradiation on the early development and mitochondrial RNA synthesis of 'Impala' barley

    International Nuclear Information System (INIS)

    The influence of fractionated γ-irradiation on barley seeds was investigated under outdoor and hothouse conditions. The doses were 250, 500, 1,000, and 2,000 rad. The resulting radiation effects were investigated from the point of view of molecular biology, i.e. studying the RNA synthesis of the mitochondria after 14C-labelling of uridine. The radiation influence on the length of the coleoptiles was another criterion. The irradiation findings are discussed in connection with the cultivation of better and more resistant plants for agriculture. (GSE/AK)

  8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    International Nuclear Information System (INIS)

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response

  9. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  10. miRNA regulation in the early development of barley seed

    Directory of Open Access Journals (Sweden)

    Curaba Julien


    Full Text Available Abstract Background During the early stages of seed development many genes are under dynamic regulation to ensure the proper differentiation and establishment of the tissue that will constitute the mature grain. To investigate how miRNA regulation contributes to this process in barley, a combination of small RNA and mRNA degradome analyses were used to identify miRNAs and their targets. Results Our analysis identified 84 known miRNAs and 7 new miRNAs together with 96 putative miRNA target genes regulated through a slicing mechanism in grain tissues during the first 15 days post anthesis. We also identified many potential miRNAs including several belonging to known miRNA families. Our data gave us evidence for an increase in miRNA-mediated regulation during the transition between pre-storage and storage phases. Potential miRNA targets were found in various signalling pathways including components of four phytohormone pathways (ABA, GA, auxin, ethylene and the defence response to powdery mildew infection. Among the putative miRNA targets we identified were two essential genes controlling the GA response, a GA3oxidase1 and a homolog of the receptor GID1, and a homolog of the ACC oxidase which catalyses the last step of ethylene biosynthesis. We found that two MLA genes are potentially miRNA regulated, establishing a direct link between miRNAs and the R gene response. Conclusion Our dataset provides a useful source of information on miRNA regulation during the early development of cereal grains and our analysis suggests that miRNAs contribute to the control of development of the cereal grain, notably through the regulation of phytohormone response pathways.

  11. [Transgenic wheat expressing virus-derived hairpin RNA is resistant to Barley yellow dwarf virus]. (United States)

    Yan, Fei; Zhang, Wen-Wei; Xiao, Hong; Li, Shi-Fang; Cheng, Zhuo-Min


    An expression vector expected to induce RNA interference against Barley yellow dwarf virus (BYDV), which expressed a composite hpRNA with the dsRNA stem homologous of BYDV GPV replicase gene and the antisense RNA loop homologous of coat protein gene, was designed without marker gene. The vector was transferred into callus cells from wheat (Triticum aestivum L.) immature embryos by particle bombardment. To select the positive transformants as early as possible, a rapid PCR, which does not need extract wheat DNA instead of few leaves, was used at regeneration stage of plantlets. Totally 21 plants proved to contain alien sequence. Antivirus test with high dose infected virus revealed that, 9 plants showed low level of resistance to BVDV, 6 plants showed moderate resistance and 6 plants showed high level of resistance. Interestingly, both low and moderate levels of resistance plants were no symptoms when infected by viruses at low dose. It suggests the dose- dependent effect of the resistance mediated by hpRNA to BYDV-GPV. PMID:17284432

  12. A complete ancient RNA genome: identification, reconstruction and evolutionary history of archaeological Barley Stripe Mosaic Virus. (United States)

    Smith, Oliver; Clapham, Alan; Rose, Pam; Liu, Yuan; Wang, Jun; Allaby, Robin G


    The origins of many plant diseases appear to be recent and associated with the rise of domestication, the spread of agriculture or recent global movements of crops. Distinguishing between these possibilities is problematic because of the difficulty of determining rates of molecular evolution over short time frames. Heterochronous approaches using recent and historical samples show that plant viruses exhibit highly variable and often rapid rates of molecular evolution. The accuracy of estimated evolution rates and age of origin can be greatly improved with the inclusion of older molecular data from archaeological material. Here we present the first reconstruction of an archaeological RNA genome, which is of Barley Stripe Mosaic Virus (BSMV) isolated from barley grain ~750 years of age. Phylogenetic analysis of BSMV that includes this genome indicates the divergence of BSMV and its closest relative prior to this time, most likely around 2000 years ago. However, exclusion of the archaeological data results in an apparently much more recent origin of the virus that postdates even the archaeological sample. We conclude that this viral lineage originated in the Near East or North Africa, and spread to North America and East Asia with their hosts along historical trade routes. PMID:24499968

  13. Polycistronic artificial miRNA-mediated resistance to Wheat dwarf virus in barley is highly efficient at low temperature. (United States)

    Kis, András; Tholt, Gergely; Ivanics, Milán; Várallyay, Éva; Jenes, Barnabás; Havelda, Zoltán


    Infection of Wheat dwarf virus (WDV) strains on barley results in dwarf disease, imposing severe economic losses on crop production. As the natural resistance resources against this virus are limited, it is imperative to elaborate a biotechnological approach that will provide effective and safe immunity to a wide range of WDV strains. Because vector insect-mediated WDV infection occurs during cool periods in nature, it is important to identify a technology which is effective at lower temperature. In this study, we designed artificial microRNAs (amiRNAs) using a barley miRNA precursor backbone, which target different conservative sequence elements of the WDV strains. Potential amiRNA sequences were selected to minimize the off-target effects and were tested in a transient sensor system in order to select the most effective constructs at low temperature. On the basis of the data obtained, a polycistronic amiRNA precursor construct (VirusBuster171) was built expressing three amiRNAs simultaneously. The construct was transformed into barley under the control of a constitutive promoter. The transgenic lines were kept at 12-15 °C to mimic autumn and spring conditions in which major WDV infection and accumulation take place. We were able to establish a stable barley transgenic line displaying resistance to insect-mediated WDV infection. Our study demonstrates that amiRNA technology can be an efficient tool for the introduction of highly efficient resistance in barley against a DNA virus belonging to the Geminiviridae family, and this resistance is effective at low temperature where the natural insect vector mediates the infection process. PMID:26136043

  14. MicroRNA-21-3p, a berberine-induced miRNA, directly down-regulates human methionine adenosyltransferases 2A and 2B and inhibits hepatoma cell growth.

    Directory of Open Access Journals (Sweden)

    Ting-Fang Lo

    Full Text Available Methionine adenosyltransferase (MAT is the cellular enzyme that catalyzes the synthesis of S-adenosylmethionine (SAM, the principal biological methyl donor and a key regulator of hepatocyte proliferation, death and differentiation. Two genes, MAT1A and MAT2A, encode 2 distinct catalytic MAT isoforms. A third gene, MAT2B, encodes a MAT2A regulatory subunit. In hepatocellular carcinoma (HCC, MAT1A downregulation and MAT2A upregulation occur, known as the MAT1A:MAT2A switch. The switch is accompanied with an increasing expression of MAT2B, which results in decreased SAM levels and facilitates cancer cell growth. Berberine, an isoquinoline alkaloid isolated from many medicinal herbs such as Coptis chinensis, has a wide range of pharmacological effects including anti-cancer effects. Because drug-induced microRNAs have recently emerged as key regulators in guiding their pharmacological effects, we examined whether microRNA expression is differentially altered by berberine treatment in HCC. In this study, we used microRNA microarrays to find that the expression level of miR-21-3p (previously named miR-21* increased after berberine treatment in the HepG2 human hepatoma cell line. To predict the putative targets of miR-21-3p, we integrated the gene expression profiles of HepG2 cells after berberine treatment by comparing with a gene list generated from sequence-based microRNA target prediction software. We then confirmed these predictions through transfection of microRNA mimics and a 3' UTR reporter assay. Our findings provide the first evidence that miR-21-3p directly reduces the expression of MAT2A and MAT2B by targeting their 3' UTRs. In addition, an overexpression of miR-21-3p increased intracellular SAM contents, which have been proven to be a growth disadvantage for hepatoma cells. The overexpression of miR-21-3p suppresses growth and induces apoptosis in HepG2 cells. Overall, our results demonstrate that miR-21-3p functions as a tumor suppressor

  15. Host and tissue selection, virion purification, RNA characterization and serological studies of barley yellow dwarf virus-RPV-IL

    International Nuclear Information System (INIS)

    A purification scheme was improved for an isolate of barley yellow dwarf virus transmitted specifically by Rhopalosiphum padi L. (RPV-IL). Enzyme-linked immunosorbent assay (ELISA) detects RPV-IL in all tissues and therefore is an inaccurate measure of extractable virus concentration in plants. The 5' terminus of RPV-IL RNA does not become labeled with 32P after dephosphorylation with phosphatase and subsequent treatment with [γ-32P] ATP and kinase and therefore is some derivative other than phosphate(s). An 125I-labeled 17,000 d protein is detected after treatment of RPV-IL RNA with 125I-Bolten-Hunter reagent and analyses by acid precipitation and polyacrylamide gel electrophoresis. This 17,000 d protein, as determined by immunoprecipitation assays, is a 17,000 d BYDV VPg (virion protein-genome linked). The serological relationships among five luteoviruses were compared using three variations of ELISA

  16. Control of α-amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    International Nuclear Information System (INIS)

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA3) with or without 5 millimolar CaCl2 shows that α-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca2+. No difference was observed in α-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA3 with 5 millimolar CaCl2 and layers incubated in GA3 alone. RNA isolated from layers incubated for 12 hours in GA3 with and without CA2+. A cDNA clone for α-amylase was isolated and used to measure α-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca2+ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca2+ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for α-amylase synthesized in Ca2+-deprived aleurone layers was translatable. Ca2+ is required for the synthesis of α-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing

  17. RNA Directed Modulation of Phenotypic Plasticity in Human Cells. (United States)

    Trakman, Laura; Hewson, Chris; Burdach, Jon; Morris, Kevin V


    Natural selective processes have been known to drive phenotypic plasticity, which is the emergence of different phenotypes from one genome following environmental stimulation. Long non-coding RNAs (lncRNAs) have been observed to modulate transcriptional and epigenetic states of genes in human cells. We surmised that lncRNAs are governors of phenotypic plasticity and drive natural selective processes through epigenetic modulation of gene expression. Using heat shocked human cells as a model we find several differentially expressed transcripts with the top candidates being lncRNAs derived from retro-elements. One particular retro-element derived transcripts, Retro-EIF2S2, was found to be abundantly over-expressed in heat shocked cells. Over-expression of Retro-EIF2S2 significantly enhanced cell viability and modulated a predisposition for an adherent cellular phenotype upon heat shock. Mechanistically, we find that this retro-element derived transcript interacts directly with a network of proteins including 40S ribosomal protein S30 (FAU), Eukaryotic translation initiation factor 5A (EIF5A), and Ubiquitin-60S ribosomal protein L40 (UBA52) to affect protein modulated cell adhesion pathways. We find one motif in Retro-EIF2S2 that exhibits binding to FAU and modulates phenotypic cell transitions from adherent to suspension states. The observations presented here suggest that retroviral derived transcripts actively modulate phenotypic plasticity in human cells in response to environmental selective pressures and suggest that natural selection may play out through the action of retro-elements in human cells. PMID:27082860

  18. RNA-directed epigenetic regulations of DNA rearrangements


    Mochizuki, Kazufumi


    Ciliated protozoa undergo extensive DNA rearrangements, including DNA elimination, chromosome breakage and DNA descrambling, when the germline micronucleus produces the new macronucleus during sexual reproduction. It has long been known that many of these events are epigenetically controlled by DNA sequences of the parental macronuclear genome. Recent studies in some model ciliates have revealed that these epigenetic regulations are mediated by non-coding RNAs. DNA elimination in Paramecium a...

  19. Barley germination

    DEFF Research Database (Denmark)

    Daneri-Castro, Sergio N.; Svensson, Birte; Roberts, Thomas H.


    Germination of barley grain is central to the malting industry and is a valuable model for cereal grain germination. Our current understanding of the complexity of germination at the molecular level is facilitated by access to genomic, transcriptomic, proteomic and metabolomic data. Here we review...... recent progress in barley germination research and discuss the factors to be considered when designing 'omics' experiments and interpreting the results. These factors include the structural and functional relationships between the various tissues of the barley caryopsis and the timing of the events...

  20. Radiostimulation of protein synthesis in barley seeds

    International Nuclear Information System (INIS)

    Barley seeds were irradiated with 10 gy of gamma-radiation and protein synthesis was measured in terms of incorporation of (3H) leucine at varying periods after the onset of germination. It is found that the process of translation of long-life mRNA is accentuated by about 20 percent in the irradiated barley seeds during the first hour of germination as compared to the corresponding appropriate control. (author)

  1. Barley metallothioneins

    DEFF Research Database (Denmark)

    Hegelund, Josefine Nymark; Schiller, Michaela; Kichey, Thomas; Hansen, Thomas Hesselhøj; Pedas, Pai; Husted, Søren; Schjørring, Jan Kofod


    Metallothioneins (MTs) are low-molecular-weight, cysteine-rich proteins believed to play a role in cytosolic zinc (Zn) and copper (Cu) homeostasis. However, evidence for the functional properties of MTs has been hampered by methodological problems in the isolation and characterization of the prot...... storage in developing and mature grains. The localization of MT4 and its discrimination against Cd make it an ideal candidate for future biofortification strategies directed toward increasing food and feed Zn concentrations....... proteins. Here, we document that barley (Hordeum vulgare) MT3 and MT4 proteins exist in planta and that they differ in tissue localization as well as in metal coordination chemistry. Combined transcriptional and histological analyses showed temporal and spatial correlations between transcript levels and...

  2. Characterization of microRNAs and their targets in wild barley (Hordeum vulgare subsp. spontaneum) using deep sequencing. (United States)

    Deng, Pingchuan; Bian, Jianxin; Yue, Hong; Feng, Kewei; Wang, Mengxing; Du, Xianghong; Weining, Song; Nie, Xiaojun


    MicroRNAs (miRNA) are a class of small, endogenous RNAs that play a negative regulatory role in various developmental and metabolic processes of plants. Wild barley (Hordeum vulgare subsp. spontaneum), as the progenitor of cultivated barley (Hordeum vulgare subsp. vulgare), has served as a valuable germplasm resource for barley genetic improvement. To survey miRNAs in wild barley, we sequenced the small RNA library prepared from wild barley using the Illumina deep sequencing technology. A total of 70 known miRNAs and 18 putative novel miRNAs were identified. Sequence analysis revealed that all of the miRNAs identified in wild barley contained the highly conserved hairpin sequences found in barley cultivars. MiRNA target predictions showed that 12 out of 52 miRNA families were predicted to target transcription factors, including 8 highly conserved miRNA families in plants and 4 wheat-barley conserved miRNA families. In addition to transcription factors, other predicted target genes were involved in diverse physiological and metabolic processes and stress defense. Our study for the first time reported the large-scale investigation of small RNAs in wild barley, which will provide essential information for understanding the regulatory role of miRNAs in wild barley and also shed light on future practical utilization of miRNAs for barley improvement. PMID:27100818

  3. Stability of Barley stripe mosaic virus-induced gene silencing in barley

    DEFF Research Database (Denmark)

    Bruun-Rasmussen, Marianne; Madsen, Christian Toft; Jessing, Stine;


    for barley and wheat; however, silencing using this vector is generally transient, with efficient silencing often being confined to the first two or three systemically infected leaves. To investigate this further, part of the barley Phytoene desaturase (PDS) gene was inserted into BSMV and the...... length influenced stability but not efficiency of VIGS. Silencing was transient in most cases; however, the decrease in PDS mRNA levels measured by qRT-PCR began earlier and lasted longer than the photobleaching. Occasionally, silencing persisted and could be transmitted through seed as well as via......Virus-induced gene silencing (VIGS) can be used as a powerful tool for functional genomics studies in plants. With this approach, it is possible to target most genes and downregulate the messenger (m)RNA in a sequence-specific manner. Barley stripe mosaic virus (BSMV) is an established VIGS vector...

  4. Self vs. non-self discrimination during CRISPR RNA-directed immunity


    Marraffini, Luciano A.; SONTHEIMER, ERIK J.


    All immune systems must distinguish self from non-self to repel invaders without inducing autoimmunity. Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci protect bacteria and archaea from invasion by phage and plasmid DNA through a genetic interference pathway1–9. CRISPR loci are present in ~ 40% and ~90% of sequenced bacterial and archaeal genomes respectively10 and evolve rapidly, acquiring new spacer sequences to adapt to highly dynamic viral populations1, 11–13. Imm...

  5. Albinism in barley androgenesis


    Makowska, Katarzyna; Oleszczuk, Sylwia


    Androgenesis is highly useful for plant breeding, significantly reducing breeding cycle times, as well as in a wide range of biological research. However, for widespread use this process must be efficient. Despite several decades of research on the phenomenon of androgenesis, many processes involved are obscure and there is much to be understood about androgenesis. One of the problems inherent in androgenesis, and reducing its efficiency, is albinism. This article reviews albinism in barley a...


    Directory of Open Access Journals (Sweden)

    Akula Annapurna


    Full Text Available Prevalence of lifestyle diseases is increasing day by day. Mostly the younger generation do not have much awareness about healthy nutritional supplements. One such important cereal grain not used mostly by youngsters is barley It is a good old grain with so many health benefits like weight reduction, decreasing blood pressure, blood cholesterol, blood glucose in Type 2 diabetes and preventing colon cancer. It is easily available and cheap grain. It contains both soluble and insoluble fiber, protein, vitamins B and E, minerals selenium, magnesium and iron, copper, flavonoids and anthocynins. Barley contains soluble fiber, beta glucan binds to bile acids in the intestines and thereby decreasing plasma cholesterol levels. Absorbed soluble fiber decreases cholesterol synthesis by liver and cleansing blood vessels. Insoluble fiber provides bulkiness in the intestines, thereby satiety. decreased appetite. It promotes intestinal movements relieving constipation, cleansing colonic harmful bacteria and reduced incidence of colonic cancer. It is a good source of niacin ,reducing LDL levels and increasing HDL levels. Selenium and vitamin E providing beneficial antioxidant effects. Magnesium, a cofactor for many carbohydrate metabolism enzymes and high fiber content contributes for its blood glucose reducing effect in Type 2 diabetes. It is having good diuretic activity and is useful in urinary tract infections. Barley contains gluten, contraindicated in celiac disease.

  7. Involvement of Alternative Splicing in Barley Seed Germination.

    Directory of Open Access Journals (Sweden)

    Qisen Zhang

    Full Text Available Seed germination activates many new biological processes including DNA, membrane and mitochondrial repairs and requires active protein synthesis and sufficient energy supply. Alternative splicing (AS regulates many cellular processes including cell differentiation and environmental adaptations. However, limited information is available on the regulation of seed germination at post-transcriptional levels. We have conducted RNA-sequencing experiments to dissect AS events in barley seed germination. We identified between 552 and 669 common AS transcripts in germinating barley embryos from four barley varieties (Hordeum vulgare L. Bass, Baudin, Harrington and Stirling. Alternative 3' splicing (34%-45%, intron retention (32%-34% and alternative 5' splicing (16%-21% were three major AS events in germinating embryos. The AS transcripts were predominantly mapped onto ribosome, RNA transport machineries, spliceosome, plant hormone signal transduction, glycolysis, sugar and carbon metabolism pathways. Transcripts of these genes were also very abundant in the early stage of seed germination. Correlation analysis of gene expression showed that AS hormone responsive transcripts could also be co-expressed with genes responsible for protein biosynthesis and sugar metabolisms. Our RNA-sequencing data revealed that AS could play important roles in barley seed germination.

  8. Genomic Prediction in Barley

    DEFF Research Database (Denmark)

    Edriss, Vahid; Cericola, Fabio; Jensen, Jens D;

    Genomic prediction uses markers (SNPs) across the whole genome to predict individual breeding values at an early growth stage potentially before large scale phenotyping. One of the applications of genomic prediction in plant breeding is to identify the best individual candidate lines to contribute...... to next generation. The main goal of this study was to see the potential of using genomic prediction in a commercial Barley breeding program. The data used in this study was from Nordic Seed company which is located in Denmark. Around 350 advanced lines were genotyped with 9K Barely chip from...... Illumina. Traits used in this study were grain yield, plant height and heading date. Heading date is number days it takes after 1st June for plant to head. Heritabilities were 0.33, 0.44 and 0.48 for yield, height and heading, respectively for the average of nine plots. The GBLUP model was used for genomic...

  9. Genomic Prediction in Barley

    DEFF Research Database (Denmark)

    Edriss, Vahid; Cericola, Fabio; Jensen, Jens D;


    Genomic prediction uses markers (SNPs) across the whole genome to predict individual breeding values at an early growth stage potentially before large scale phenotyping. One of the applications of genomic prediction in plant breeding is to identify the best individual candidate lines to contribute...... to next generation. The main goal of this study was to see the potential of using genomic prediction in a commercial Barley breeding program. The data used in this study was from Nordic Seed company which is located in Denmark. Around 350 advanced lines were genotyped with 9K Barely chip from...... Illumina. Traits used in this study were grain yield, plant height and heading date. Heading date is number days it takes after 1st June for plant to head. Heritabilities were 0.33, 0.44 and 0.48 for yield, height and heading, respectively for the average of nine plots. The GBLUP model was used for genomic...

  10. Combination of small interfering RNA-directed B cell lymphoma/leukemia-2 oncogene silencing and arsenic using a nanomedicine strategy for the enhanced cytotoxicity of acute myelogenous leukemia in vitro%载小干扰RNA纳米微粒沉默U937细胞B细胞淋巴瘤/白血病-2基因增加砷剂细胞毒效应的研究

    Institute of Scientific and Technical Information of China (English)

    曾林涓; 钟淑萍; 李学刚; 林忠; 黄开红; 陈茵婷


    目的 观察载小干扰RNA(siRNAs)纳米微粒沉默B细胞淋巴瘤/白血病-2(bcl-2)基因联合纳米砷剂协同抗急性髓性白血病效应.方法 凝胶阻滞电泳、荧光显微镜、流式细胞仪及噻唑蓝(MTT)法分别用于评估正聚乙二醇(PEG)-多聚赖氨酸(PLL)负载siRNAs能力、细胞转染效率及对细胞活力影响,Western blot法观察siRNAs沉默靶基因,MTT法评估siRNAs联合纳米砷剂对U937协同抑制效应.结果 N/P-10时,PEG-PLL和siRNAs基本复合,U937细胞活力为(85.06±5.80)%,转染效率为(83.70±0.37)%,转染后bcl-2蛋白表达下降为(44.1 l±4.39)%.空载体、纯砷单药、纳米As单药及联合用药组细胞活力分别为(99.44±1.45)%、(87.76±2.21)%、(92.98±4.34)%、(67.93±8.16)%(P<0.05)(砷1.25 μmol/L);(99.56±2.53)%、(54.08±4.46)%、(57.85±2.11)%、(38.60±6.24)%(P<0.05)(砷2.50 μmol/L); (98.88±1.59)%、(37.62±1.38)%、(51.31±3.14)%、(28.92±4.97)%(p<0.05)(砷5.00 μmol/L);(97.72±2.55)%、(29.44±4.14)%、(40.18±3.72)%、(20.56±4.97)%(P<0.05)(砷10.00 μmol/L); (96.65±2.03)%、(21.49±1.60)%、(26.34±0.97)%、(15.90±1.70)%(P<0.05)(砷20.00 μmol/L).结论 PEG-PLL对U937细胞毒性较低、转染效率较高,PEG-PLL/siRNAs沉默bel-2联合纳米As获得协同抗白血病效应.%Objective To observed the synergetic inhibitory effects on human acute myelogenous leukemia (AML) by nanoparticle-mediated small interfering RNA (siRNAs) and arsenic therapy in vitro.Methods Gel retardation assay,fluorescence microscopy,flow cytometry assay and methyl thiazol tetrazolium (MTT) assay was performed to evaluate siRNAs complexation capacity,transfection efficiency and in-fluence on cell viability of polyethylene glycol (PEG)-poly (L-lysine) (PLL).The down regulation of B cell lymphoma/leukemia-2 (bcl-2) gene expression was comfirmed by Western blotting assay.The MTT assay was further performed to evaluate the synergetic inhibitory

  11. The Swedish mutant barley collection

    International Nuclear Information System (INIS)

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  12. Root hair mutants of barley

    International Nuclear Information System (INIS)

    Barley mutants without root hairs or with short or reduced root hairs were isolated among M2 seeds of 'Lux' barley (Hordeum vulgare L.) after acidified sodium azide mutagenesis. Root hair mutants are investigated intensively in Arabidopsis where about 40 genes are known. A few root hair mutants are known in maize, rice, barley and tomato. Many plants without root hairs grow quite well with good plant nutrition, and mutants have been used for investigations of uptake of strongly bound nutrients like phosphorus, iron, zinc and silicon. Seed of 'Lux' barley (Sejet Plant Breeding, Denmark) were soaked overnight, and then treated with 1.5-millimolarsodium azide in 0.1 molar sodium phosphate buffer, pH 3, for 2.5 hours according to the IAEA Manual on Mutation Breeding (2nd Ed.). After rinsing in tap water and air-drying, the M2 seeds were sown in the field the same day. Spikes, 4-6 per M1 plant, were harvested. The mutation frequency was similar to that obtained with other barley cultivars from which low-phytate mutants were isolated [5]. Seeds were germinated on black filter paper in tap water for 3 or 4 days before scoring for root hair mutants

  13. Alanine aminotransferase controls seed dormancy in barley. (United States)

    Sato, Kazuhiro; Yamane, Miki; Yamaji, Nami; Kanamori, Hiroyuki; Tagiri, Akemi; Schwerdt, Julian G; Fincher, Geoffrey B; Matsumoto, Takashi; Takeda, Kazuyoshi; Komatsuda, Takao


    Dormancy allows wild barley grains to survive dry summers in the Near East. After domestication, barley was selected for shorter dormancy periods. Here we isolate the major seed dormancy gene qsd1 from wild barley, which encodes an alanine aminotransferase (AlaAT). The seed dormancy gene is expressed specifically in the embryo. The AlaAT isoenzymes encoded by the long and short dormancy alleles differ in a single amino acid residue. The reduced dormancy allele Qsd1 evolved from barleys that were first domesticated in the southern Levant and had the long dormancy qsd1 allele that can be traced back to wild barleys. The reduced dormancy mutation likely contributed to the enhanced performance of barley in industrial applications such as beer and whisky production, which involve controlled germination. In contrast, the long dormancy allele might be used to control pre-harvest sprouting in higher rainfall areas to enhance global adaptation of barley. PMID:27188711

  14. Isolation and characterization of recombinant DNAs containing repeated elements of barley genome: identification of individual actively transcribed families of repeats

    International Nuclear Information System (INIS)

    A bank of Escherichia coli clones containing fragments of barley nuclear DNA was obtained using plasmid pBR 322. Clones carrying repeated sequences of the plant genome were selected by means of colony and blot hybridization. Clones with actively transcribed sequences were selected by hybridization to complementary DNA synthesized by means of reverse transcription on a template of total barley poly(A)-containing RNA. Individual families of repeats, two of which contained transcriptionally active sequences of the barley genome, were identified by blot hybridization of recombinant plasmids containing labeled DNA fragments of the inserts of three different clones

  15. Identification and Characterization of MicroRNAs from Barley (Hordeum vulgare L. by High-Throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Song Weining


    Full Text Available MicroRNAs (miRNAs are a class of endogenous RNAs that regulates the gene expression involved in various biological and metabolic processes. Barley is one of the most important cereal crops worldwide and is a model organism for genetic and genomic studies in Triticeae species. However, the miRNA research in barley has lagged behind other model species in grass family. To obtain more information of miRNA genes in barley, we sequenced a small RNA library created from a pool of equal amounts of RNA from four different tissues using Solexa sequencing. In addition to 126 conserved miRNAs (58 families, 133 novel miRNAs belonging to 50 families were identified from this sequence data set. The miRNA* sequences of 15 novel miRNAs were also discovered, suggesting the additional evidence for existence of these miRNAs. qRT-PCR was used to examine the expression pattern of six randomly selected miRNAs. Some miRNAs involved in drought and salt stress response were also identified. Furthermore, the potential targets of these putative miRNAs were predicted using the psRNATarget tools. Our results significantly increased the number of novel miRNAs in barley, which should be useful for further investigation into the biological functions and evolution of miRNAs in barley and other species.

  16. Defective RNA processing enhances RNA silencing and influences flowering of Arabidopsis


    Herr, Alan J.; Molnàr, Attila; Jones, Alex; Baulcombe, David C.


    Many eukaryotic cells use RNA-directed silencing mechanisms to protect against viruses and transposons and to suppress endogenous gene expression at the posttranscriptional level. RNA silencing also is implicated in epigenetic mechanisms affecting chromosome structure and transcriptional gene silencing. Here, we describe enhanced silencing phenotype (esp) mutants in Arabidopsis thaliana that reveal how proteins associated with RNA processing and 3′ end formation can influence RNA silencing. T...

  17. Endoproteolytic activity assay in malting barley


    Blanca Gómez Guerrero; Michael J. Edney


    Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four cl...

  18. Roles of Hydroxynitrile Glucosides in Barley

    DEFF Research Database (Denmark)

    Roelsgaard, Pernille Sølvhøj

    hydroxynitrile glucosides can act as carbohydrate and nitrogen storage compounds and as reactive oxygen species (ROS) quenching compounds. A positive correlation between the hydroxynitrile glucoside content in barley and susceptibility toward the barley powdery mildew fungus (Blumeria graminis f.sp. hordei, Bgh...... to regulate defense related genes in maize. Barley plants that are gene-silenced in the first step of hydroxynitrile glucoside biosynthesis have been generated to further investigate these results. It appears that hydroxynitrile glucosides in barley have a dual role; up to a certain level Bgh profits...

  19. The barley protein project at Svaloev

    International Nuclear Information System (INIS)

    Important findings of the barley protein improvement project at Svaloev are reported. Linkage analyses have shown that in Hiproly the lysine factor is located on the long arm of chromosome 7. The results, so far, indicate that during favourable conditions the best high lysine barleys yield 95-100% of the standard variety Mona. However, when the growing conditions are unfavourable, high lysine barleys suffer more. Encouraging results were obtained from feeding experiments on pigs and it is anticipated that using available high-lysine barley, the protein supplementation can be reduced by 35%. (author)

  20. Lipid transfer proteins of barley

    Czech Academy of Sciences Publication Activity Database

    Žídková, Jitka; Matejková, M.; Petry-Podgorska, Inga; Žídek, L.; Sikorová, K.; Nálezková, M.; Chmelík, Josef; Sklenář, V.


    Roč. 14, č. 1 (2007), s. 51. ISSN 1211-5894. [Discussions in Structural Molecular Biology and Bioinformatics /6./. 29.03.2007-31.03.2007, Nové Hrady] R&D Projects: GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : protein separation * barley * MALDI-TOF/TOF MS-MS Subject RIV: CB - Analytical Chemistry, Separation

  1. Fermented Barley Supplementation Modulates the Expression of Hypothalamic Genes and Reduces Energy Intake and Weight Gain in Rats. (United States)

    Pichiah, P B Tirupathi; Cho, Suk-Ho; Han, Seong-Kyu; Cha, Youn-Soo


    Dietary fiber and proteins are individually known to decrease feeding, but could result greater weight management benefit when both are combined. We hypothesized that supplementing the diet with fermented barley, being rich in both dietary fiber and proteins, could lower energy intake by modulating the mRNA expression level of hypothalamic genes associated with the regulation of feeding behavior and satiety; thereby decreasing body weight gain. To test our hypothesis, four groups of Sprague Dawley rats were arranged in a 2 × 2 factorial design (n = 6), low-fat diet with either guar gum (LFD-G) or fermented barley (LFD-FB) and high-fat diet with either guar gum (HFD-G) or fermented barley (HFD-FB). Using oral gavage, fermented barley was given at a dosage of 1500 mg/kg body weight and guar gum was supplemented in an equivalent quantity to that of the fiber in the fermented barley. After 19 weeks, the fermented barley-supplemented groups showed a significant reduction in energy intake, triglyceride, body weight gain, and serum leptin, compared to the guar gum-supplemented groups in both the low- and high-fat diet groups. Likewise, the anorexigenic gene proopiomelanocortin (POMC) and cocaine and amphetamine-regulated transcript (CART) mRNA level were significantly higher in the fermented barley-supplemented groups compared to the guar gum-supplemented groups in rats fed on both high- and low-fat diets. In conclusion, fermented barley supplementation upregulated hypothalamic POMC/CART, decreased energy intake in both low- and high-fat diet groups, and prevented excessive weight gain in rats. PMID:27074621

  2. Associated field mycobiota on malting barley

    DEFF Research Database (Denmark)

    Andersen, Birgitte; Thrane, Ulf; Svendsen, Anne; Rasmussen, Ilse A.


    composition of field mycobiota compared with the pesticide-free barley. The determining factor on the mycobiota was the location. The dominant species on barley was Alternaria infectoria Simmons. The most frequent Fusarium species detected were F. tricinctum (Corda) Sacc. and F. avenaceum (Fr.) Sacc. Results...... implied an interaction between Alternaria and Fusarium on the surface of the kernels....

  3. New leaf diseases of barley in Egypt. (United States)

    Mehiar, F F; El-Deen, E; Wasfy, H; El-Samra, I A


    Leaf diseases of barley were observed also in Egypt. From leaves of barley were isolated: Helminthosporium teres, H. gramineum, Stemphylium vesicarium, Alternaria triticina, Vlocladium chartarum, Acnemonium kiliense, Stemphylium spec. accompanied with the Pleospora stage. Inoculations on both attached and detached leaves showed that all the tested fungi were pathogenic, except Acremonium kiliense and Ulocladium chartarum. PMID:1037183

  4. Healthier cereal products: breadmaking with barley flour.


    Chaya Romero, Carolina; Novillo, Carmen; Rodríguez Badiola, Guillermo; Callejo González, Maria Jesús


    Promote consumption of barley breads, in order to improve intake of fibre and healthenhancing components: Instrumental evaluation of breads. Sensory consumer evaluation of breads. Bread-making performances of flours. Instrumental evaluation of barley substituted wheat Dough.

  5. Two classes of short interfering RNA in RNA silencing


    Hamilton, Andrew; Voinnet, Olivier; Chappell, Louise; Baulcombe, David


    RNA silencing is a eukaryotic genome defence system that involves processing of double-stranded RNA (dsRNA) into 21–26 nt, short interfering RNA (siRNA). The siRNA mediates suppression of genes corresponding to the dsRNA through targeted RNA degradation. In some plant systems there are additional silencing processes, involving systemic spread of silencing and RNA-directed methylation/transcriptional suppression of homologous genomic DNA. We show here that siRNAs produced in plants from a gree...

  6. Fungal growth during malting of barley

    Directory of Open Access Journals (Sweden)

    Kocić-Tanackov Sunčica D.


    Full Text Available Fungi were isolated and identified in two samples of winter two-row barley (SSK3 and SSK6 harvested in 2003, Kragujevac location, during micromalting. Fungi were isolated and identified in barley before the micromalting, after the 1st, 2nd and 3rd day of steeping, the first day and after the germination after kilning and after malt degermination. The total fungi count was followed in both barley samples, during the mentioned phases. The total count of fungi was also determined in the steeping water, and the isolation and identification was performed after the steeping process. Change of the total count of fungi during barley micromalting was exponentional. During barley micromalting nine fungi genera were isolated: Phoma, Alternaria, Fusarium aspergillus, Cladosporium, Geotrichum, Scopulariopsis, Aureobasidium and Mucor. The most frequent genera were: Phoma, Alternaria and Fusarium. In water for steeping, five genera were identified: Geotrichum, Fusarium, Phoma Cladosporium and Mucor. The most frequent genera was Phoma.

  7. Barley seed proteomics from spots to structures

    DEFF Research Database (Denmark)

    Finnie, Christine; Svensson, Birte


    information from rice and other cereals facilitate identification of barley proteins. Several hundred barley seed proteins are identified and lower abundance proteins including membrane proteins are now being analysed. In the present review we focus on variation in protein profiles of seed tissues during......Barley is a major cereal crop grown mainly for feed and malting. Two-dimensional gel electrophoresis has been used to analyse barley proteins for over 20 years and more recently, mass spectrometry was applied. In the absence of a genome sequence, barley gene and EST sequences combined with...... grain filling, maturation, germination and radicle elongation. Cultivar comparisons and genetic mapping of polymorphic protein spots in doubled haploid populations provide a means to link the genome to the proteome and identify proteins that can influence grain quality. Many proteins appear in multiple...

  8. Resistance to Barley Leaf Stripe

    DEFF Research Database (Denmark)

    Nørgaard Knudsen, J. C.


    well adapted Northwest European spring cultivars. Virulence matching two hitherto not overcome resistances was demonstrated. Differences in apparent race nonspecific or partial resistance were also present, changing the percentage of infected plants of susceptible genotypes from about 20 to 44 per cent.......Ten barley [Hordeum vulgare] genotypes were inoculated with twelve isolates of Pyrenophora graminea of diverse European and North African origin. Race specific resistance occurred. Four, possibly five, genetically different sources of race-specific resistance were found, three of them occurring in...


    Directory of Open Access Journals (Sweden)

    Alžbeta Žofajová


    Full Text Available The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of  qualitative  raw material for maltinq and beer  industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the  new requirements of  malting and beer industry. As an example of the results obtained most recently description is made of the Ezer, Levan, Donaris, Sladar spring barley varieties with very good malting quality and effective resistance to  powdery mildew.  Cultivation of these varieties  and malting barley production with  reduced use  of pesticidies is environmentally friedly alternative. doi:10.5219/50

  10. Transcriptional Responses to Gibberellin and Abscisic Acid in Barley Aleurone

    Institute of Scientific and Technical Information of China (English)

    Kegui Chen; Yong-Qiang Charles An


    Cereal aleurone has been established as a model system to investigate giberrellin (GA) and abscisic acid (ABA) responses. Using Barley 1 GeneChip, we examined the mRNA accumulation of over 22 000 genes in de-embryonated barley aleurone treated with GA and ABA. We observed that 1328 genes had more than a threefold change in response to GA treatment, whereas 206 genes had a more than threefold change in response to ABA treatment. Interestingly, approximately 2.5-fold more genes were up-regulated than downregulated by ABA. Eighty-three genes were differentially regulated by both GA and ABA. Most of the genes were subject to antagonistic regulation by ABA and GA, particularly for genes related to seed maturation and germination, such as genes encoding late embryogenesis abundant proteins and storage mobilization enzymes. This supports the antagonistic roles of GA and ABA in seed maturation and seed germination.Interestingly, we observed that a significant percentage of the genes were coordinately regulated by both GA and ABA. Some GA-responsive genes encoded proteins involved in ethylene, jasmonate, brassinosteroid and auxin metabolic and signaling transduction pathways, suggesting their potential interaction with the GA response. We also identified a group of transcription factor genes, such as MYB and Homeobox genes, that were differentially regulated by GA. In addition, a number of GA- and/or ABA-responsive genes encoded components potentially involved in GA and ABA signal transduction pathway. Overall, the present study provides a comprehensive and global view of transcript expression accompanying the GA and ABA response in barley aleurone and identifies a group of genes with potential regulatory functions in GA- and ABA-signaling pathways for future functional validation.

  11. Leaf stripe resistance of spring barley cultivars


    Pinnschmidt, Hans O; Nielsen, Bent J.


    Results of six years of screening trials clearly indicate that effective resistance against barley leaf stripe is available, also in modern cultivars. Among the spring barley cultivars that are currently most widely grown in Denmark, Cabaret, Troon, Sebastian, Justina and Brazil appear most resistant, but only Brazil combines a favourable resistance performance (= low mean and standard deviation of environment-adjusted leaf stripe incidence) with a high number of observations (= years of test...

  12. Adaptation of aphid stylectomy for analyses of proteins and mRNAs in barley phloem sap


    Gaupels, Frank; Buhtz, Anja; Knauer, Torsten; Deshmukh, Sachin; Waller, Frank; van Bel, Aart J. E.; Kogel, Karl-Heinz; Kehr, Julia


    Sieve tubes are transport conduits not only for photoassimilates but also for macromolecules and other compounds that are involved in sieve tube maintenance and systemic signalling. In order to gain sufficient amounts of pure phloem exudates from barley plants for analyses of the protein and mRNA composition, a previously described stylectomy set-up was optimized. Aphids were placed in sealed cages, which, immediately after microcauterization of the stylets, were flooded with water-saturated ...

  13. Structure and Function of the Bacterial Root Microbiota in Wild and Domesticated Barley


    Bulgarelli, D.; Garrido Oter, R.; Muench, P.; Weiman, A.; Droege, J.; Pan, Y.; McHardy, A; Schulze-Lefert, P.


    Summary The microbial communities inhabiting the root interior of healthy plants, as well as the rhizosphere, which consists of soil particles firmly attached to roots, engage in symbiotic associations with their host. To investigate the structural and functional diversification among these communities, we employed a combination of 16S rRNA gene profiling and shotgun metagenome analysis of the microbiota associated with wild and domesticated accessions of barley (Hordeum vulgare). Bacterial f...

  14. Functional proteomics of barley and barley chloroplasts – strategies, methods and perspectives

    DEFF Research Database (Denmark)

    Petersen, Jørgen; Rogowska-Wrzesinska, Adelina; Jensen, Ole Nørregaard


    whole-genome sequencing of barley revealed approximately 26,100 open reading frames, which provides a foundation for detailed molecular studies of barley by functional genomics and proteomics approaches. Such studies will provide further insights into the mechanisms of, for example, drought and stress......Barley (Hordeum vulgare) is an important cereal grain that is used in a range of products for animal and human consumption. Crop yield and seed quality has been optimized during decades by plant breeding programs supported by biotechnology and molecular biology techniques. The recently completed...... tolerance, micronutrient utilization, and photosynthesis in barley. In the present review we present the current state of proteomics research for investigations of barley chloroplasts, i.e., the organelle that contain the photosynthetic apparatus in the plant. We describe several different proteomics...

  15. A mutant homeobox gene created six-rowed spike in barley domestication

    International Nuclear Information System (INIS)

    Increased seed production has been a common goal during the domestication of cereal crops. Early cultivators of barley (Hordeum vulgare ssp. vulgare) selected a phenotype with a six-rowed spike that stably produced three times the usual grain number during domestication. We isolated the SIX-ROWED SPIKE 1 (Vrs1) from barley by chromosome walking. We discovered that Vrs1 encodes a homeodomain leucine zipper I-class protein (HD-ZIP I), a potential transcription factor. RNA in situ hybridization revealed that the Vrs1 is expressed only in lateral spikelet primordia. Sequencing alleles of 54 six-rowed mutant lines revealed a single amino acid substitution in 22 lines, creation of a new stop codon in 12 lines, a nucleotide substitution in the conserved splicing site in 3 lines, a frameshift mutation by a deletion in 5 lines, complete deletion of the gene region in 7 lines, and no DNA changes throughout the coding region with no gene expression detected in the remaining 5 lines. We found three haplotypes among six-rowed barley revealing loss-of-function mutation of the homeobox gene Vrs1. We found that two of them independently originated from two different type two-rowed barleys, but origin of the remaining one six-rowed allele remained unclear. (author)

  16. Structure and function of the bacterial root microbiota in wild and domesticated barley. (United States)

    Bulgarelli, Davide; Garrido-Oter, Ruben; Münch, Philipp C; Weiman, Aaron; Dröge, Johannes; Pan, Yao; McHardy, Alice C; Schulze-Lefert, Paul


    The microbial communities inhabiting the root interior of healthy plants, as well as the rhizosphere, which consists of soil particles firmly attached to roots, engage in symbiotic associations with their host. To investigate the structural and functional diversification among these communities, we employed a combination of 16S rRNA gene profiling and shotgun metagenome analysis of the microbiota associated with wild and domesticated accessions of barley (Hordeum vulgare). Bacterial families Comamonadaceae, Flavobacteriaceae, and Rhizobiaceae dominate the barley root-enriched microbiota. Host genotype has a small, but significant, effect on the diversity of root-associated bacterial communities, possibly representing a footprint of barley domestication. Traits related to pathogenesis, secretion, phage interactions, and nutrient mobilization are enriched in the barley root-associated microbiota. Strikingly, protein families assigned to these same traits showed evidence of positive selection. Our results indicate that the combined action of microbe-microbe and host-microbe interactions drives microbiota differentiation at the root-soil interface. PMID:25732064

  17. Effects of n-butanol on barley microspore embryogenesis

    DEFF Research Database (Denmark)

    Castillo, Ana Maria; Nielsen, Nanna; Jensen, Anni; Valles, M. P.


    Doubled haploid (DH) production is an efficient tool in barley breeding, but efficiency of DH methods is not consistent. Hence, the aim of this study was to study the effect of n-butanol application on DH barley plant production efficiency. Five elite cultivars of barley and thirteen breeding...

  18. MS Based Imaging of Barley Seed Development

    Institute of Scientific and Technical Information of China (English)

    Manuela Peukert; Andrea Matros; Hans-Peter Mock


    Spatially resolved analysis of metabolites and proteins is essential to model compartmentalized cellular processes in plants.Within recent years,tremendous progress has been made in MS based imaging (MSI) techniques,mostly MALDI MSI.The technology has been pioneered and is now widely applied in medicinal and pharmacological studies,and in recent years found its way into plant science (Kaspar et al.,2011; Peukert etal.,2012).We are interested in the elucidation of spatially resolved metabolic networks related to barley grain development.An understanding of developmentally and ecologically regulated processes affecting agronomical traits such as final grain weight,seed quality and stress tolerance is of outmost importance,as barley provides one of the staple foods.Barley also serves as a model plant for other cereals such as wheat.The presentation will introduce an untargeted MALDI MSI approach to the analysis of me-tabolite patterns during barley grain development.We analyzed longitudinal and cross sections from developing barley grains (3,7,10 and 14 days after pollination).In the presentation we will address spatial resolution,sensitivity and identification of unknown compounds will also be discussed.A major task is to connect the metabolite patterns to distinct cellular and physiological events.As an example,particular metabolite distributions indicative for nutrient transport into the developing endosperm will be shown.

  19. Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens


    Wenjun Zha; Xinxin Peng; Rongzhi Chen; Bo Du; Lili Zhu; Guangcun He


    BACKGROUND: RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. METHODOLOGY/PRINCIPAL FINDINGS: The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder s...

  20. Spontaneous mutation frequencies in barley

    International Nuclear Information System (INIS)

    Full text: Estimation of the spontaneous mutation frequency requires screening of very large populations and has therefore rarely been carried out in higher plants. A study on inter-allelic recombination in the ml-o locus allowed to collect some data on spontaneous chlorophyll mutants. 1866 barley plants were progeny tested in the greenhouse. 25 plants segregated for newly arisen, spontaneous chlorophyll mutant genes. Among a total of 470129 seedlings screened there were 79 mutants (1.7±0.6x10-4). If these data are pooled with others from similar materials the resulting estimate is 1.6x10-4 in about 1,43 million seedlings. The estimate of the chlorophyll mutation rate per generation is close to 6.3x10-4 per diploid genome. Assuming that the number of loci that can give rise to chlorophyll mutants is in the order of 500, the spontaneous mutation rate would be in the order of 6x10-7 per locus and haploid genome per generation. (author)

  1. Barley germplasm conservation and resources. Chapter 7 in barley: improvement, production, and uses. Blackwell Publishing, ED.S.E. Ullrich (United States)

    The history and current status of barley germplasm preservation activities is presented on a global scale and specifically for the United States. Total of barley germplasm holdings at 47 major barley collections (those with more than 500 accessions) worldwide is approximately 402,000 accessions. I...

  2. Immigration of the barley mildew pathogen into field plots of barley

    DEFF Research Database (Denmark)

    O'Hara, R.B.; Brown, J.K.M.


    Immigration of the barley powdery mildew pathogen (Erysiphe graminis f.sp. hordei) into field plots of the spring barley variety Tyra (carrying the resistance allele Mla1) was investigated. Spores were trapped from the top of the plot canopies, as well as from control plots of wheat with no barley...... nearby. Comparison of the frequencies of virulent and avirulent single-colony isolates showed that the amount of immigration, relative to the amount of inoculum being produced within the plot, reduced very rapidly, until it could not be detected in the middle of the growing season (mid-June)....

  3. The Genetic Basis of Composite Spike Form in Barley and 'Miracle-Wheat'. (United States)

    Poursarebani, Naser; Seidensticker, Tina; Koppolu, Ravi; Trautewig, Corinna; Gawroński, Piotr; Bini, Federica; Govind, Geetha; Rutten, Twan; Sakuma, Shun; Tagiri, Akemi; Wolde, Gizaw M; Youssef, Helmy M; Battal, Abdulhamit; Ciannamea, Stefano; Fusca, Tiziana; Nussbaumer, Thomas; Pozzi, Carlo; Börner, Andreas; Lundqvist, Udda; Komatsuda, Takao; Salvi, Silvio; Tuberosa, Roberto; Uauy, Cristobal; Sreenivasulu, Nese; Rossini, Laura; Schnurbusch, Thorsten


    Inflorescences of the tribe Triticeae, which includes wheat (Triticum sp. L.) and barley (Hordeum vulgare L.) are characterized by sessile spikelets directly borne on the main axis, thus forming a branchless spike. 'Compositum-Barley' and tetraploid 'Miracle-Wheat' (T. turgidum convar. compositum (L.f.) Filat.) display noncanonical spike-branching in which spikelets are replaced by lateral branch-like structures resembling small-sized secondary spikes. As a result of this branch formation 'Miracle-Wheat' produces significantly more grains per spike, leading to higher spike yield. In this study, we first isolated the gene underlying spike-branching in 'Compositum-Barley,' i.e., compositum 2 (com2). Moreover, we found that COM2 is orthologous to the branched head(t) (bh(t)) locus regulating spike branching in tetraploid 'Miracle-Wheat.' Both genes possess orthologs with similar functions in maize BRANCHED SILKLESS 1 (BD1) and rice FRIZZY PANICLE/BRANCHED FLORETLESS 1 (FZP/BFL1) encoding AP2/ERF transcription factors. Sequence analysis of the bh(t) locus in a collection of mutant and wild-type tetraploid wheat accessions revealed that a single amino acid substitution in the DNA-binding domain gave rise to the domestication of 'Miracle-Wheat.' mRNA in situ hybridization, microarray experiments, and independent qRT-PCR validation analyses revealed that the branch repression pathway in barley is governed through the spike architecture gene Six-rowed spike 4 regulating COM2 expression, while HvIDS1 (barley ortholog of maize INDETERMINATE SPIKELET 1) is a putative downstream target of COM2. These findings presented here provide new insights into the genetic basis of spike architecture in Triticeae, and have disclosed new targets for genetic manipulations aiming at boosting wheat's yield potential. PMID:26156223

  4. Winter barley mutants created in the Ukraine

    International Nuclear Information System (INIS)

    Full text: Increasing fodder and protein production is one of the objectives of the development of agriculture in Ukraine. Higher productivity of fodder crops, due to new highly productive varieties, is the means to meet this aim. Winter barley is an important crop for fodder purposes. The climate of the Ukraine is favourable for growing this crop. The areas used for the growth of winter barley are however, small (500,000-550,000 ha) and there is a shortage of good quality varieties. The main aim of the work was therefore to create new varieties of highly productive winter barley, of good quality. The new varieties and mutation lines of winter barley were created under the influence of water solutions of N-nitroso-N-methylurea (NMH - 0,012, 0,005%), N-nitroso-N-ethylurea (NEH - 0,05; 0.025; 0,012%) ethyleneimine (EI - 0,02; 0,01; 0,005%) on winter barley seeds of the varieties of local and foreign selections. On the basis of many years of investigations (1984-94) the following mutations were described: hard-grained, winter-hardiness, earliness, middle-maturity, late-maturity, wide and large leaves, narrow leaves, multinodal, great number of leaves, great number of flowers, strong stem (lodging resistant), tallness, semi-dwarfness, dwarfness, and high productivity. Particularly valuable are mutants with high productivity of green bulk. Their potential yield is 70 t/ha. As a result of the work two varieties of winter barley 'Shyrokolysty' and 'Kormovy' were released into the State register of plant varieties of the Ukraine. The other valuable mutant genotypes are used in cross breeding programmes. (author)

  5. Assesment of amylose and amylopectin variability in barley germplasm

    International Nuclear Information System (INIS)

    Barley grain is composed of carbohydrates, proteins, dietary fiber, vitamins and minerals. The present study was conducted to investigate the variability for amylose and amylopectin content in different accessions of wild and cultivated barley from different regions. Our results showed that apparent amylose content ranged from 14.1 to 35.8 percentage, 5.7 to 26.8 percentage and 13.9 to 36.2 percentage for wild barley, barley landraces and varieties, respectively. The highest range for amylopectin content was observed in barley landraces from 33.7 to 81.7 percentage with the highest mean average value and the lowest range from 39.9 to 63.7 percentage with 52.5 percentage mean average value was observed in wild barley for amylopectin content. Furthermore, we found that out of 157 accessions, 52 had an average content of amylose (20-30 percentage), whereas six accessions had more than 30 percentage of amylose content. Our results indicated that the wild barley and barley varieties had considerable variation for amylose and amylopectin ratio compared to barley landraces, which not only provided some useful information about the difference in the amount of amylose and amylopectin content among these barley accessions, but also offered some prospects of using selected germplasm for barley quality improvement in respect of preferred amylose and amylopectin content. (author)

  6. Implementation of biochemical screening to improve baking quality of barley

    DEFF Research Database (Denmark)

    Vincze, Éva; Dionisio, Giuseppe; Aaslo, Per;


    Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact on the...... physical chemical properties of the bread products due to the poor baking properties of barley flour. As a consequence, the nutritional advantages of barley are not fully exploited. The inferior leavening and baking properties of barley can, in part, be attributed to the physical properties of the storage...... proteins. Changing the storage protein composition can lessen this problem. Our working hypothesis was that exploiting the substantial genetic variation within the gene pool for storage proteins could enable improving the baking qualities of barley flour. We characterised forty-nine barley cultivars for...

  7. Implementation of biochemical screening to improve baking quality of barley

    DEFF Research Database (Denmark)

    Vincze, Éva; Dionisio, Giuseppe; Aaslo, Per; Langkilde, Ane; Bowra, Steve

    Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact on the...... physical chemical properties of the bread products due to the poor baking properties of barley flour. As a consequence, the nutritional advantages of barley are not fully exploited. The inferior leavening and baking properties of barley can, in part, be attributed to the physical properties of the storage...... proteins. Changing the storage protein composition can lessen this problem. Our working hypothesis was that exploiting the substantial genetic variation within the gene pool for storage proteins could enable improving the baking qualities of barley flour. We characterised forty-nine barley cultivars for...

  8. Fast neutron mutagenesis in barley

    International Nuclear Information System (INIS)

    Full text: In order to conduct a deletion mutant analysis of the barley genome, seeds of cultivar 'Steptoe' were irradiated in 1992 with two doses of fast neutrons, 3.5 Gy and 4.0 Gy at the FAO/IAEA Seibersdorf SNIF facility by Dr. H. Brunner. M1 seeds were grown at Pullman, Washington, USA in the field. Approximately 500 M2 spikes were picked from each treatment and the remainder harvested in bulk. Mutation rates were determined on 1000 bulk M2 seedlings (chlorophyll deficient) and 500 M2 head rows (chlorophyll deficient and morphological) per treatment. Chlorophyll-deficient mutations were observed at a frequency of 8.1% and 9.4% on M1 spike basis and 2.2% and 2.6% on M2 seedling basis for the 3.5 and 4.0 Gy treatments, respectively. Total mutations observed in the field were 19.0% and 20.8% on M1 spike basis for the two treatments. Approximately 2,500 M2 seedlings were assayed for nitrate reductasedeficient mutants and 12,000 M2 seeds screened for waxy mutants. Although several putative mutants were identified, none have been confirmed to date. The mutation frequencies observed are similar for both treatments and appear to be approximately the same as what we have previously observed with γ-radiation treatments. The absence of nitrate reductase-deficient and waxy mutants is most likely due to the small population size screened. The morphological mutants recovered include dwarfs, sterile, necrotic, glossy, elongated outer glume, winter type and some very interesting floral mutants such as multi-ovary and branched inflorescence. Mutants affecting functions of genes for which cloned DNA segments are available will be sought in order to identify specific molecular changes that have been induced by fast neutron radiation. (author)

  9. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.


    amino acid residues of mature BP 1. The clone pcR7 encodes an additional C-terminal sequence of 22 residues, which apparently are removed during processing. BP 1 is less than 50% identical to other sequenced plant peroxidases. Analyses of RNA and protein from aleurone, endosperm and embryo tissue showed......A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C-terminal...

  10. Endoproteolytic activity assay in malting barley

    Directory of Open Access Journals (Sweden)

    Blanca Gómez Guerrero


    Full Text Available Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four classes of endo-proteases have been described: serine-proteases, cysteine-proteases, aspartic-proteases and metallo-proteases. The objective of this work was to develop a rapid and colorimetric enzymatic assay to determine the endo-proteolytic activity of the four endo-protease classes using two different substrates: azo-gelatin and azo-casein. Optimum conditions for the assays such as: pH,reaction time and temperature and absorbance scale were determined. Azo-gelatin presented several difficulties in standardizing an “in solution” assay. On the other hand, azo-casein allowed standardization of the assay for the four enzyme classes to produce consistent results. The endo-proteoteolytic method developed was applied to determine the endo-protease activity in barley, malt and wort.

  11. Damage resistance and microstructure of barley kernels

    Directory of Open Access Journals (Sweden)

    Velikanov L.


    Full Text Available Relations between mechanical properties, damage susceptibility and microstructure of five Polish cultivars of barley were examined. Brabender Hardness test, Instron measurements, PSI, PRI, and glassiness were used to characterise mechanical properties. The structure analysis was carried out with scanning electron microscopy and X-ray microscopy. Mechanical properties of grain were related to barley cultivar. Grain of cultivars with glassy endosperm were characterised by higher mechanical resistance than those with floury endosperm. Particle size distribution of the extracted starch granules, as determined by digital image analysis, did not correlate with the mechanical properties of barley grains. Generally speaking, the number of damaged kernels correlated with the fracture resistance and was related both to the direction of compression force and water content of grain. Compression along the axis of kernel thickness always resulted in a high number of damaged creases. When water content was high no damaged to the crease zone and a low number of internal damage was characteristic of kernels compressed along the width axis. It was observed that barley endosperm cracked inside cells, while the spaces between cell walls remained unfractured.

  12. Cisgenic barley with improved phytase activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik; Vincze, Éva; Holm, Preben Bach


    barley lambda library has been used to isolate the genomic clone of this phytase including 2.3 kb of the promoter region and 600 bp of the terminator region. The clone has been inserted into a cisgenic Agrobacterium vector where both the gene of interest and the selection gene are flanked by their own T...

  13. Composition and nutritional quality of barley protein

    International Nuclear Information System (INIS)

    The lysine concentration in barley seed protein is known to depend on both genetical and environmental factors. We investigated whether the differences in lysine concentration as well as the differences in nutritional quality between various barley cultivars could be accounted for by the protein composition of the hordein fraction. Hordein, the low lysine storage protein in barley seed, is classified in A, B and C hordeins with decreasing lysine content. The Riso high lysine mutants are characterized by decreased amounts of at least one of the three fractions. With increasing N-fertilization the content of the C hordeins in particular is elevated disproportionally more than the total N-content, resulting in overall decreasing lysine concentrations. Rat-feeding experiments did not displace any significant difference between the protein digestibility in the mutants and in the parent varieties. The biological value (BV) averaged 77 for field-grown normal-lysine barley against 90 for the high lysine mutant 1508. A marked negative correlation between BV and percentage N in the seed was found for both Bomi and mutant 1508. A marked negative correlation between BV and percentage N in the seed was found for both Bomi and mutant 1508. In Bomi this could be explained by the variation in lysine concentration whereas the sulphur-containing amino acids probably are limiting in mutant 1508. Provided that lysine is the first limiting amino acid, the nutritional quality of barley seed protein is closely related to the content of B- and C-hordeins. When this is not the case, as in mutant 1508, other unidentified proteins or groups of proteins become of importance. (author)

  14. Lipid and sugar profiles of various barley cultivars (Hordeum vulgare

    Directory of Open Access Journals (Sweden)

    Pastor Kristian A.


    Full Text Available The lipid components and soluble sugars in flour samples of different cultivars of barley (Hordeum vulgare, involving winter malting barley, winter forage barley, spring barley, and hulless barley, were identified. Fatty acids were extracted from flour samples with n-hexane, and derivatized into volatile methyl esters, using TMSH (trimethylsulfonium hydroxide in methanol. Soluble sugars were extracted from defatted and dried samples of barley flour with 96% ethanol, and further derivatized into the corresponding trimethylsilyl (TMS oximes, using hydroxylamine hydrochloride solution and BSTFA (N,O-bis-(trimethylsilyl-trifluoroacetamide. The hexane and alcoholic extracts of barley cultivars were analyzed by GC-MS system. Lipid and sugar compositions were very similar in all barley cultivars. Therefore, multivariate analysis was applied to numerical values of automatically integrated areas of the identified fatty acid methyl esters and TMS oximes of soluble sugars. The application of hierarchical cluster analysis showed a great similarity between the investigated flour samples of barley cultivars, according to their fatty acid content (0.96. Also, significant, but somewhat less similarity was observed regarding the content of soluble sugars (0.70. These preliminary results indicate the possibility of distinguishing flour made of barley, regardless of the variety, from flours made of other cereal species, just by the analysis of the contents of fatty acids and soluble sugars.[Projekat Ministarstva nauke Republike Srbije, br. TR 31066

  15. Angiosperms Are Unique among Land Plant Lineages in the Occurrence of Key Genes in the RNA-Directed DNA Methylation (RdDM) Pathway

    Czech Academy of Sciences Publication Activity Database

    Ma, L.; Hatlen, A.; Kelly, L.J.; Becher, H.; Wang, W.C.; Kovařík, Aleš; Leitch, I. J.; Leitch, Andrew R.


    Roč. 7, č. 9 (2015), s. 2648-2662. ISSN 1759-6653 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : chromatin modification * DNA methylation * evolution Subject RIV: BO - Biophysics Impact factor: 4.229, year: 2014

  16. Association mapping of partitioning loci in barley

    Directory of Open Access Journals (Sweden)

    Mackay Ian J


    Full Text Available Abstract Background Association mapping, initially developed in human disease genetics, is now being applied to plant species. The model species Arabidopsis provided some of the first examples of association mapping in plants, identifying previously cloned flowering time genes, despite high population sub-structure. More recently, association genetics has been applied to barley, where breeding activity has resulted in a high degree of population sub-structure. A major genotypic division within barley is that between winter- and spring-sown varieties, which differ in their requirement for vernalization to promote subsequent flowering. To date, all attempts to validate association genetics in barley by identifying major flowering time loci that control vernalization requirement (VRN-H1 and VRN-H2 have failed. Here, we validate the use of association genetics in barley by identifying VRN-H1 and VRN-H2, despite their prominent role in determining population sub-structure. Results By taking barley as a typical inbreeding crop, and seasonal growth habit as a major partitioning phenotype, we develop an association mapping approach which successfully identifies VRN-H1 and VRN-H2, the underlying loci largely responsible for this agronomic division. We find a combination of Structured Association followed by Genomic Control to correct for population structure and inflation of the test statistic, resolved significant associations only with VRN-H1 and the VRN-H2 candidate genes, as well as two genes closely linked to VRN-H1 (HvCSFs1 and HvPHYC. Conclusion We show that, after employing appropriate statistical methods to correct for population sub-structure, the genome-wide partitioning effect of allelic status at VRN-H1 and VRN-H2 does not result in the high levels of spurious association expected to occur in highly structured samples. Furthermore, we demonstrate that both VRN-H1 and the candidate VRN-H2 genes can be identified using association mapping

  17. Barley grain for ruminants: A global treasure or tragedy

    Directory of Open Access Journals (Sweden)

    Nikkhah Akbar


    Full Text Available Abstract Barley grain (Hordeum vulgare L. is characterized by a thick fibrous coat, a high level of ß-glucans and simply-arranged starch granules. World production of barley is about 30 % of that of corn. In comparison with corn, barley has more protein, methionine, lysine, cysteine and tryptophan. For ruminants, barley is the third most readily degradable cereal behind oats and wheat. Due to its more rapid starch fermentation rate compared with corn, barley also provides a more synchronous release of energy and nitrogen, thereby improving microbial nutrient assimilation. As a result, feeding barley can reduce the need for feeding protected protein sources. However, this benefit is only realized if rumen acidity is maintained within an optimal range (e.g., > 5.8 to 6.0; below this range, microbial maintenance requirements and wastage increase. With a low pH, microbial endotoxines cause pro-inflammatory responses that can weaken immunity and shorten animal longevity. Thus, mismanagement in barley processing and feeding may make a tragedy from this treasure or pearl of cereal grains. Steam-rolling of barley may improve feed efficiency and post-rumen starch digestion. However, it is doubtful if such processing can improve milk production and feed intake. Due to the need to process barley less extensively than other cereals (as long as the pericarp is broken, consistent and global standards for feeding and processing barley could be feasibly established. In high-starch diets, barley feeding reduces the need for capacious small intestinal starch assimilation, subsequently reducing hindgut starch use and fecal nutrient loss. With its nutritional exclusivities underlined, barley use will be a factual art that can either matchlessly profit or harm rumen microbes, cattle production, farm economics and the environment.

  18. FERTILIZING BREWING BARLEY (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Imre Kádár


    Full Text Available Four levels of N, P and K nutrition (poor, moderate, satisfactory and high and all their possible combinations with 64 treatments in two replications (128 plots were studied in a long term field trial on barley yield and malting quality. A standard East-European spring barley "Opal" (bred in Czechoslovakia was grown in 1986, 13th year of the agricultural experiment, involving various crops in previous years, on a calcareous loamy chernozem soil. The optimum fertility levels for yield enhancement resulted in the poorest malting quality: low modification and extract but long saccharification time and high protein. To solve this problem the brewing industry will have to apply the well-known technological methods available since growers are not likely to give up their fertilizers. Applying soil and plant analysis data, having knowledge about both soil and plant optimum values, the danger of the excessive use of fertilizers can be realized and decreased.

  19. Replication of DNA during barley endosperm development

    DEFF Research Database (Denmark)

    Giese, H.


    The incorporation of [6-H-3]-thymidine into DNA of developing barley end sperm was examined by autoradiography of cross sections of seeds and DNA analysis. The majority of nuclear divisions took place in the very young endosperm, but as late as 25 days after anthesis there was evidence for DNA re...... replication. The DNA content of the endosperm increases during development and in response to nitrogen application in parallel to the storage protein synthesis profile. The hordein genes were hypersensitive to DNase I treatment throughout development.......The incorporation of [6-H-3]-thymidine into DNA of developing barley end sperm was examined by autoradiography of cross sections of seeds and DNA analysis. The majority of nuclear divisions took place in the very young endosperm, but as late as 25 days after anthesis there was evidence for DNA...

  20. Microbial dynamics during barley tempeh fermentation


    Feng, Xinmei


    Tempeh is a traditional staple food in Indonesia mainly made from soybeans. Barley tempeh has been developed by adapting the soybean tempeh process. During soybean tempeh fermentation, Rhizopus oligosporus is dominant. However, other fungi and bacteria also occur, which may influence tempeh quality or even constitute a health risk. Introduction of food-grade lactic acid bacteria (LAB) and yeasts to tempeh fermentation may enhance tempeh nutritional and hygienic quality. The abilities of LAB a...

  1. Search for endophytic diazotrophs in barley seeds

    Directory of Open Access Journals (Sweden)

    Myriam S. Zawoznik


    Full Text Available Eight endophytic isolates assigned to Pseudomonas, Azospirillum, and Bacillus genera according to pheno-genotypic features were retrieved from barley seeds under selective pressure for nitrogen-fixers. Genetic relationships among related isolates were investigated through RAPD. Six isolates displayed nitrogen-fixing ability, while all could biosynthesize indolacetic acid in vitro and showed no antibiosis effects against Azospirillum brasilense Az39, a recognized PGPR.

  2. Enhancement of methane production from barley waste


    L. Neves; Ribeiro, R.; Oliveira, Rosário; Alves, M. M.


    Two different approaches were attempted to try and enhance methane production from an industrial waste composed of 100% barley, which results from production of instant coffee substitutes. In previous work, this waste was co-digested with an excess of activated sludge produced in the wastewater treatment plant located in same industrial unit, resulting in a very poor methane yield (25LCH4(STP)/ kgVSinitial), and low reductions in total solids (31%) and in volatile solids (40%). Wh...

  3. Functional Analysis of Barley Powdery Mildew Effector Candidates and Identification of their Barley Targets

    DEFF Research Database (Denmark)

    Ahmed, Ali Abdurehim

    The genome of barley powdery mildew fungus (Blumeria graminis f. sp. hordei, Bgh) encodes around 500 Candidate Secreted Effector Proteins (CSEPs), which are believed to be delivered to the barley cells either to interfere with plant defence and/or promote nutrient uptake. So far, little is known...... significantly decreased the Bgh haustorial formation rate, indicating their contribution to fungal pathogenesis. All these CSEPs were highly expressed during and after haustorial formation, suggesting that they play a role in virulence during the late infection processes. In addition, they all localized to the...... misfolding and aggregation. Through their chaperone activity, some sHsps contribute to pathogen defence by stabilizing intracellular proteins, including resistance and defence signalling proteins. In this study, we validated the chaperone activity of the barley Hsp16.9, which prevented the aggregation of...

  4. Identification of the differentially accumulated proteins associated with low phosphorus tolerance in a Tibetan wild barley accession. (United States)

    Nadira, Umme Aktari; Ahmed, Imrul Mosaddek; Zeng, Jianbin; Wu, Feibo; Zhang, Guoping


    Low phosphorus (LP) in soil is a widely-occurred limiting factor for crop production in the world. In a previous study we identified a highly LP-tolerant Tibetan wild barley accession (XZ99). Here, a comparatively proteomic analysis was conducted using three barley genotypes differing in LP tolerance to reveal the mechanisms underlying the LP tolerance of XZ99. Totally, 31 differentially accumulated proteins were identified in the roots and leaves of the three genotypes using 2-dimensional gel electrophoresis coupled with mass spectrometry. They were involved in the various biological processes, including carbon and energy metabolism, signal transduction, cell growth and division, secondary metabolism, and stress defense. In comparison with XZ100 (LP sensitive) and ZD9 (LP moderately-tolerant), XZ99 had a more developed root system, which is mainly attributed to enhanced carbohydrate metabolizing proteins under LP conditions. The current results showed that Tibetan wild barley XZ99 and cultivated barley cultivar ZD9 differ in the mechanism of LP tolerance. The changes of the proteins associated with carbohydrate metabolism could account for the difference between the LP-tolerant and LP-sensitive genotypes. In addition, the mRNA expression levels of 9 LP responsive proteins were verified by qRT-PCR. The current results may open a new avenue of understanding the LP tolerance in plants on the proteomic basis. PMID:27111503

  5. Investigation of the somaclonal and mutagen induced variability in barley by the application of protein and DNA markers

    International Nuclear Information System (INIS)

    Barley, Hordeum vulgare L., is one of the most important crop species for Bulgaria. The characterisation of the genetic pool is of great necessity for the Bulgarian barley breeding programme which is directed toward improving quantitative and qualitative traits. Molecular markers [protein, restriction fragment length polymorphisms (RFLP) and randomly amplified polymorphic DNA (RAPD)] have been applied to characterise the Bulgarian barley cultivars and their regenerants. The changes in DNA loci coding for 26S, 5.8S and 18S rRNA repeats, C hordein locus and mitochondrial DNA organisation have been investigated. The potential for ribosomal DNA length polymorphism in Bulgarian barley cultivars appear to be limited to three different repeat lengths (10.2, 9.5 and 9.0kb) and three plant rDNA phenotypes. Polymorphism was not observed in ribosomal DNA repeat units in somaclonal variants. Variation concerning C hordein electrophoretic pattern was observed in one line from cultivar Jubiley. Analysis of the HorI locus reveals RFLPs in sequences coding for C hordeins in this line. Mitochondrial molecular markers are convenient for detection of DNA polymorphisms in the variant germplasm as well as for the somaclonal variants derived from it. Two lines from Ruen revealed polymorphic bands after hybridisation with mitochondrial DNA probe. RAPD assays have been carried out by using 20 different 10-mer primers. Heritable polymorphism in several tissue culture derived (TCD) lines was observed. RAPD assay is a sensitive and representative approach to distinguish the variability created by tissue culture and mutagenesis

  6. Cloning and characterization of four B-hordein genes from Tibetan hull-less barley (Hordeum vulgare subsp. vulgare). (United States)

    Han, Zhao-Xue; Qian, Gang; Pan, Zhi-Fen; Deng, Guang-Bing; Wu, Fang; Tang, Ya-Wei; Qiang, Xiao-Lin; Yu, Mao-Qun


    Four B-hordein genes, designated BH1-BH4, were cloned using PCR amplification from two hull-less barley cultivars, ZQ7239 and ZQ148, collected from Tibet. The results of sequencing indicated that BH1-BH4 contained complete open reading frames (ORFs). Comparison of their predicted polypeptide sequences with the published sequences suggested that they all share the same basic protein structure. Phylogenetic analysis indicated that the deduced amino-acid sequences of BH1-BH4 genes were more closely related to B-hordeins from cultivated barley (Hordeum vulgare L.) than to any other prolamins from wild barley and Aegilops tauschii. Comparison of the coding regions of BH1-BH4 genes showed that BH1 had a lower sequence identity to other previously published B-hordeins than the other three B-hordeins obtained in this study. BH1 was then cloned in a bacterial expression vector based on bacteriophage T7 RNA polymerase. The resulting plasmid produced a 28.15 kDa protein in Escherichia coli. The potential value of B-hordein genes in grain quality improvement of hull-less barley has been discussed. PMID:17046594

  7. Effect Of Barley Fibres And Barley Intake On The Ileal Endogenous Nitrogen Losses In Piglets


    Leterme, Pascal; Souffrant, Wb.; Thewis, André


    Ileal endogenous N losses (ENL) were measured, using the 15N isotope dilution technique, in piglets (17 kg) fed different barley genotypes (naked, spring, winter with low/high beta-glucan content) or diets containing 330, 530, 730 or 930 g of a blend of barleys/kg diet. The apparent protein and amino acid digestibilities of the naked variety and the winter variety with a high beta-glucan content were, on average, significantly higher than those for the other two varieties. The ENL were invers...

  8. Expression of Ethylene Biosynthesis Genes in Barley Tissue Culture (United States)

    The plant hormone ethylene influences green plant regeneration rates from barley callus cultures. Our studies have focused on the effects of short treatments of an ethylene inhibitor or an ethylene precursor on green plant regeneration from two barley cultivars and the expression patterns of two eth...

  9. Lysine metabolism in antisense C-hordein barley grains

    DEFF Research Database (Denmark)

    Schmidt, Daiana; Rizzi, Vanessa; Gaziola, Salete A;


    The grain proteins of barley are deficient in lysine and threonine due to their low concentrations in the major storage protein class, the hordeins, especially in the C-hordein subgroup. Previously produced antisense C-hordein transgenic barley lines have an improved amino acid composition, with ...

  10. The International Barley Sequencing Consortium — At the Threshold of Efficient Access to the Barley Genome (United States)

    Sequencing the genome of barley, an agriculturally and industrially important cereal crop and a useful diploid model for bread wheat, has become a realistic undertaking. Important steps have been initiated to improve genomics tools, build and anchor a physical map, develop a high-density genetic ma...

  11. Cross-protection among strains of barley yellow dwarf virus. (United States)

    Wen, F; Lister, R M; Fattouh, F A


    ELISA, cDNA dot blot hybridization and transmission by vector aphids were used to investigate the occurrence and degree of cross-protection produced in oat plants by virus isolates representing five strains or serotypes of barley yellow dwarf virus, namely PAV, MAV, SGV, RPV and RMV. Generally, the degree of cross-protection was positively correlated with the serological relatedness between the isolates. A high degree of cross-protection occurred between NY-MAV and MAV-PS1, two isolates of the MAV serotype; cross-protection was moderate between MAV-PS1 and either P-PAV (a Purdue isolate of the PAV serotype) or NY-SGV; cross-protection between P-PAV and NY-SGV was low. Cross-protection did not occur in other paired inoculations and did not persist in some plants, the challenge virus eventually becoming detectable. The persistence of cross-protection depended on the interval between inoculations with protecting and challenge viruses; longer inoculation intervals enhanced the persistence of cross-protection. Results obtained by ELISA and dot blot hybridization were usually consistent, indicating that cross-protection affected both viral capsid and RNA synthesis. PMID:2016594

  12. 核糖核酸干扰%The RNA interference

    Institute of Scientific and Technical Information of China (English)

    孔祥平; LiXing W.Reneker


    The phenomenon of RNA interference (RNAi) is highly conserved mechanism in the organism evolution. As a immune system ,RNAi is a ubiquitous mechanism against invading microorganism in plant and animal cells. Recently, it has been found that RNAi is the process by which double-strand RNA(dsRNA) directs sequence-specific degradation of messenger RNA and the mediations of sequence specific messenger RNA degradation are 21-and 23-nucleotide small interfering RNAs that generate by ribonuclease from endogenous longer dsRNA or by transfectious technics from heterologous dsRNA. Over the past few years, the way in which cells respond to dsRNA by silencing homologous genes has revealed a new regulating paradigm in biology.

  13. Transglycosylation by barley α-amylase 1

    DEFF Research Database (Denmark)

    Mótyán, János A.; Fazekas, Erika; Mori, Haruhide;


    The transglycosylation activity of barley α-amylase 1 (AMY1) and active site AMY1 subsite mutant enzymes was investigated. We report here the transferase ability of the V47A, V47F, V47D and S48Y single mutants and V47K/S48G and V47G/S48D double mutant AMY1 enzymes in which the replaced amino acids...... polymerization DP 2, DP 3 and DP 5 were successfully applied to detect activity of Bacillus stearothermophilus maltogenic α-amylase, human salivary α-amylase and Bacillus licheniformis α-amylase, respectively in a fast and simple fluorometric assay....

  14. Mutation breeding of barley in Peru

    International Nuclear Information System (INIS)

    Barley has special value as a food for people living in the Andes mountain area of Peru. It is also the basic raw material for the malting industry. The factors limiting barley production in Peru are mainly diseases, low soil fertility, low rainfall, drought, frost and hail. Improved varieties should have the capability to overcome most of the factors limiting production. To achieve this aim, it is necessary to apply appropriate methods in mutation induction, and crossing and selection. The mutation induction methods are used to improve well adapted varieties and lines. The barley variety Buenavista is suited to the Altiplano conditions. Because of its spikes, it can withstand hail damage better than other varieties. Naked barley is appreciated very much as a different type of food by people living in the highlands. Based on these facts, a mutation breeding programme was initiated to search for naked kernels and other interesting mutants in the Buenavista variety. The mutagenic agents applied were: gamma rays at 20 and 30 krad (200 and 300 Gy); EMS at 0.05 M and 0.1 M; and sodium azide at 0.001 and 0.004 M. The M1 populations were planted in Callejon de Huaylas at 2700 m of elevation. The M2 generation was grown at La Molina on the campus of the University at 200 m of elevation. The total number of plants in the M2 was 187,574. The frequency of chlorophyll mutations ranged from 1.13% to 5.94%. The highest doses of mutagens resulted in a higher number of chlorophyll mutations, while in the case of naked kernels selected from the bulked seeds of each treatment, the lower dose gave the higher number. The frequency of mutants with naked kernels ranged from 0.07% to 0.12%. The main goal of obtaining naked kernel mutants was achieved. At the applied treatments gamma rays were more effective as a mutagenic agent for this purpose than EMS or sodium azide. (author). 4 refs, 5 tabs

  15. Analysis of Spring Barley Actual Evapotranspiration

    Czech Academy of Sciences Publication Activity Database

    Pozníková, Gabriela; Fischer, Milan; Pohanková, Eva; Žalud, Zdeněk; Trnka, Miroslav

    Brno: Mendel university, 2013 - (Škarpa, P.; Ryant, P.; Cerkal, R.; Polák, O.; Kovárník, J.), s. 357-361 ISBN 978-80-7375-908-7. [MendelNet 2013. Mendelova univerzita v Brně (CZ), 20.11.2013-21.11.2013] R&D Projects: GA MŠk(CZ) EE2.3.20.0248; GA MZe QJ1310123 Institutional support: RVO:67179843 Keywords : reference evapotranspiration * Bowen ratio/energy balance method * crop coefficient * spring barley * Czech Republic Subject RIV: EH - Ecology, Behaviour

  16. Protein quality of induced high lysine mutants in barley. (United States)

    Eggum, B O


    Evidence of high-lysine gene sources in barley derived from spontaneous and induced mutations has been presented. In addition barley sources considered to be "normal" also differ in lysine content. Changes in lysine concentrations invariable results in changes in other amino acids in barley protein. Protein fractions are altered in several mutant barleys and differ also in so called "normal barleys". The fractions in the normal barleys are probably more dependent upon environmental conditions than in mutant barleys. It is clearly demonstrated with chemical analyses and biological experiments with rats, poultry and pigs that high-lysine cultivars are superior in nutritive quality than their low-lysine isotypes. However, it appears that most of the lysine genotypes possess reduced grain weight and lower grain yield. This is of course unfortunate as an adequate supply of food appears to be the number one nutritional priority in the world today. This does not mean, however, that protein improvement would be of no practical value under conditions of marginal energy deprivation. The literature reviewed suggests that protein improvement would likely be of value under these conditions. PMID:727018

  17. Physiological and molecular changes in barley and wheat under salinity. (United States)

    Temel, Aslihan; Gozukirmizi, Nermin


    In this study, it was aimed to compare salinity-induced changes in barley (Hordeum vulgare L. cv. Bornova-92) and bread wheat (Triticum aestivum L. cv. Gerek-79). Seeds were germinated under saline conditions (0, 50, 100, 250, and 500 mM NaCl) for 2 days and recovered under non-saline conditions for 2 days. At the end of the salt treatment, germination, water content (WC), total soluble protein content, and catalase (CAT, EC activity were affected in both species, while superoxide dismutase (SOD, EC activity was affected in barley. Salinity affected WC, protein content, and CAT activity in both species, while it affected germination in barley and affected fresh weight and SOD activity in wheat after recovery. Physiological responses of both species were correlated. Expression of α-tubulin, Atls1, and Lls1 genes was down-regulated in barley after 250 mM NaCl treatment. HVA1 gene was highly (more than 50-fold) stimulated by salinity in barley. However, α-tubulin and Atls1 genes were down-regulated, and Lls1 gene was up-regulated in wheat after recovery from 250-mM NaCl treatment. Increase in HVA1 expression was not significant in wheat. The expression profiles of barley and wheat under salinity are different, and barley tended to regulate gene expression faster than wheat. PMID:25578157

  18. Barley mutant line with high protein yield

    International Nuclear Information System (INIS)

    Mutation breeding was initiated in 1969 at the Agricultural Research Institute, Nicosia, aiming at developing high yielding barley lines having also high protein or lysine content. The final results were reported at the FAO/IAEA Research Co-ordination Meeting at Nicosia in 1980. At that time some lines were superior to their mother line in grain yield, protein content or protein yield. However, high yield is essential for feed-barley as there is no premium price for protein content or quality. In the experiments reported earlier, the mean grain yield of mutant M-Att-73-337-1 was 3202 kg/ha, 9.9% higher than the mother variety 'Attiki'. The Kjeldahl protein content was 12.7% for the mutant line and 13.4% for the mother variety. The mutant line was further evaluated in field trials (11 m2 plots and 6 replications) during 1983-88, along with other promising material from the breeding programme. The mutant line outyielded its mother variety by 9.7% in grain yield and 16% in straw yield. These increases are apparently the result of increased 1000-grain weight and a higher number of culms per m2. Protein content of the mutant line was slightly lower, but its protein yield was 5.5% higher. The yield of the mutant line over 16 trials during 1983-88 was also 4% higher than the yield of the main commercially grown variety Athenais

  19. Analysis of promoters in transgenic barley and wheat. (United States)

    Furtado, Agnelo; Henry, Robert J; Pellegrineschi, Alessandro


    Advances in the genetic transformation of cereals have improved the prospects of using biotechnology for plant improvement, and a toolbox of promoters with defined specificities would be a valuable resource in controlling the expression of transgenes in desired tissues for both plant improvement and molecular farming. A number of promoters have been isolated from the important cereals (wheat, barley, rice and maize), and these promoters have been tested mostly in homologous cereal systems and, to a lesser extent, in heterologous cereal systems. The use of these promoters across the important cereals would add value to the utility of each promoter. In addition, promoters with less sequence homology, but with similar specificities, will be crucial in avoiding homology-based gene silencing when expressing more than one transgene in the same tissue. We have tested wheat and barley promoters in transgenic barley and wheat to determine whether their specificity is shared across these two species. The barley bifunctional alpha-amylase/subtilisin inhibitor (Isa) promoter, specific to the pericarp in barley, failed to show any activity in wheat, whereas the wheat early-maturing (Em) promoter showed similar activity in wheat and barley. The wheat high-molecular-weight glutenin (HMW-Glu) and barley D-hordein (D-Hor) and B-hordein (B-Hor) storage protein promoters maintained endosperm-specific expression of green fluorescent protein (GFP) in wheat and barley, respectively. Using gfp, we have demonstrated that the Isa and Em promoters can be used as strong promoters to direct transgenes in specific tissues of barley and wheat grain. Differential promoter activity across cereals expands and adds value to a promoter toolbox for utility in plant biotechnology. PMID:19175520

  20. Methane emissions from feedlot cattle fed barley or corn diets. (United States)

    Beauchemin, K A; McGinn, S M


    Methane emitted from the livestock sector contributes to greenhouse gas emissions worldwide. Understanding the variability in enteric methane production related to diet is essential to decreasing uncertainty in greenhouse gas emission inventories and to identifying viable greenhouse gas reduction strategies. Our study focused on measuring methane in growing beef cattle fed corn- or barley-based diets typical of those fed to cattle in North American feedlots. The experiment was designed as a randomized complete block (group) design with two treatments, barley and corn. Angus heifer calves (initial BW = 328 kg) were allocated to two groups (eight per group), with four cattle in each group fed a corn or barley diet. The experiment was conducted over a 42-d backgrounding phase, a 35-d transition phase and a 32-d finishing phase. Backgrounding diets consisted of 70% barley silage or corn silage and 30% concentrate containing steam-rolled barley or dry-rolled corn (DM basis). Finishing diets consisted of 9% barley silage and 91% concentrate containing barley or corn (DM basis). All diets contained monensin (33 mg/kg of DM). Cattle were placed into four large environmental chambers (two heifers per chamber) during each phase to measure enteric methane production for 3 d. During the backgrounding phase, DMI was greater by cattle fed corn than for those fed barley (10.2 vs. 7.6 kg/d, P methane emissions (g/d) reported may underestimate those of the feedlot industry. Methane emissions per kilogram of DMI and as a percentage of GE intake were not affected by grain source during the backgrounding phase (24.6 g/kg of DMI; 7.42% of GE), but were less (P methane emissions of cattle fed high-forage backgrounding diets and barley-based finishing diets. Mitigating methane losses from cattle will have long-term environmental benefits by decreasing agriculture's contribution to greenhouse gas emissions. PMID:15705762

  1. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.;


    Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active...

  2. Application of proteomics to investigate barley-Fusarium graminearum interaction

    DEFF Research Database (Denmark)

    Yang, Fen

    Due to the great loss of barley grain yield and quality in addition to mycotoxins contamination caused by Fusarium head blight (FHB), it is essential to understand the molecular interaction between barley and Fusarium graminearum, one of the primary Fusarium species causing FHB, in order to control...... expressed in E. coli and purified in Chapter 5. The functional characterization of two proteins is undergoing. In Chapter 6, microarray data of F. graminearum during interaction with barley and wheat was analysed. The expression patterns of 11fungal genes in microarray analysis were different from q...


    Directory of Open Access Journals (Sweden)

    T. Sheela


    Full Text Available This study evaluated that effect of prebiotic food containing oligosaccharide to enhance the growth and activity of probiotic strains. Barley grains probioticated using different strains of probiotics are Lactobacillus kefiranofaciens, Candida kefir,and saccharomyces boluradii. To select a suitable prebiotics like inulin for the development of Synbiotic barley and tested for antibacterial activity against diarrhoea causing pathogen such as Esherichia coli, Staphylococcus aureus, Salmonella paratyphi A, Shigella dysenteriae, Vibrio cholerae. Analysis of identified compound from synbiotic barley grain using GC-MS.

  4. RNA Polymerase V transcription guides ARGONAUTE4 to chromatin


    Wierzbicki, Andrzej T.; Ream, Thomas; Haag, Jeremy R.; Pikaard, Craig S.


    Summary Retrotransposons and repetitive DNA elements in eukaryotes are silenced by small RNA-directed heterochromatin formation. In Arabidopsis, this process involves 24 nt siRNAs that bind to ARGONAUTE4 (AGO4) and facilitate the targeting of complementary loci1,2 via unknown mechanisms. Nuclear RNA Polymerase V is an RNA silencing enzyme recently shown to generate noncoding transcripts at loci silenced by 24nt siRNAs3. We show that AGO4 physically interacts with these Pol V transcripts and i...

  5. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    DEFF Research Database (Denmark)

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren;


    Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...... obtained by these techniques are compared between experiments in which differences in growth rates, strains, or stress treatments occur, the normalization procedure may have a significant impact on the results. In this report we present a solution to the normalization problem in RNA slot blotting...

  6. Complete genomic sequence of barley (Hordeum vulgare) endornavirus (HvEV) determined by next-generation sequencing. (United States)

    Candresse, Thierry; Marais, Armelle; Sorrentino, Roberto; Faure, Chantal; Theil, Sébastien; Cadot, Valérie; Rolland, Mathieu; Villemot, Julie; Rabenstein, Frank


    Endornaviruses are unusual plant-, fungus- and oomycete-infecting viruses with a large, ca 14- to 17-kb linear double-stranded RNA (dsRNA) genome and a persistent lifestyle. The complete genome sequence of an endornavirus from the barley (Hordeum vulgare) Nerz variety was determined from paired Illumina MySeq reads derived from purified dsRNAs. The genome is 14,243 nt long, with 5' and 3' non-coding regions of 207 and 47 nt, respectively. It encodes a single large protein of 4663 amino acids that carries conserved motifs for a methyltransferase, a helicase and an RNA-dependent RNA polymerase. The sequence of Hordeum vulgare endornavirus (HvEV) carries all the hallmarks of a typical member of the genus Endornavirus, with the exception of an UDP-glycosyltransferase motif observed in many, but not all, endornaviral genomes. PMID:26666441

  7. Efficient production of tetraploid barley (Hordeum vulgare L.) by colchicine treatment of diploid barley


    Ayed Sourour; Bouharb Ameni; Cherif Mejda


    An experiment was conducted to induce tetraploidy in three diploid barley varieties (Martin, Rihane and Manel) through different colchicines treatments. Colchicine was added for three different concentrations at three different stages of plant development i.e. on seed (0.05% for 48 hours), on pre-germinated seeds (0.1% for 2 hours) and on three leaf stage (0.1% for 16 hours). Colchicine application reduced significantly germination percentage and viability of plants. Seed germinat...

  8. Resistance against barley leaf rust (Puccinia hordei) in West-European spring barley germplasm


    Niks, Rients; Walther, Ursula; Jaiser, Heidi; Martinez, Fernando; Rubiales, Diego


    International audience The level and type of resistance against leaf rust (Puccinia hordei) was determined in modern spring barley germplasm. In field trials all over Europe most accessions were in some locations and years significantly less infected than the moderately resistant reference ,Grit'. Differentiating P. hordei isolates indicated that most accessions carried hypersensitivity (Rph) genes. A virulence survey indicated that among the known resistance genes, only Rph7 is still full...

  9. Greening etiolated barley plants under clinorotation (United States)

    Syvash, O. O.; Dovbysh, E. P.; Zolotareva, E. K.

    Plants are capable to react to change of a gravitational field and have sensitive and selective mechanisms, allowing to be guided in a field of gravitation of the Earth. It is known, that changes of gravitational conditions (hyper- or hypogravity) influence metabolic processes in alive organisms. One of the important problems of space biology is studying influence of microgravity on development of the photosynthetic apparatus. Damaging action of weightlessness on photosynthetic processes in plants was shown in a lot of space experiments. However, results of these experiments are inconsistent and do not allow to conclude how varied conditions of weight influence photosynthesis and in particular biosynthesis of chlorophyll. The aim of the communication is an analysis of clinorotation effects on the pigment accumulation and photochemical characteristics of the photosynthetic apparatus during its formation at greening of barley seedlings. Barley plants were grown on a slow horizontal clinostat (2 rpm) and in vertical control at room temperature for 7-8 days (6 days in the dark and 1 or 2 day on white light, ˜ 90 μ Mm-2s-1). Protochlorophyllide (Pchld) and carotenoid (β -carotene, lutein, neoxantin, violaxantin) content in dark grown plants, as well as photosynthetic pigment content after 24 and 48h of greening was determined by TLC. It was found that the content of β -carotene, lutein and neoxantin in clinorotated etiolated plants was on 9-25% higher compared to control. Pchld and violaxantin level was less on 9-11% in clinorotated etiolated plants. The content of Chl a, b and carotenoids in control after 24h greening of barley seedlings exceeded on 10-20% their level in clinorotated variant. After 48h greening the total level of pigments doubled and the difference in the pigment content between control and clinorotated leaves averaged 0-12%, i.e. distinction in pigment content between control and clinorotated variants smoothed out in the greening process. No

  10. Search for antisense copies of beta-globin mRNA in anemic mouse spleen

    Directory of Open Access Journals (Sweden)

    Taylor John M


    Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

  11. Barley stripe mosaic virus: Structure and relationship to the tobamoviruses

    International Nuclear Information System (INIS)

    Barley stripe mosaic virus (BSMV) is the type member of the genus Hordeivirus, rigid, rod-shaped viruses in the family Virgaviridae. We have used fiber diffraction and cryo-electron microscopy to determine the helical symmetry of BSMV to be 23.2 subunits per turn of the viral helix, and to obtain a low-resolution model of the virus by helical reconstruction methods. Features in the model support a structural relationship between the coat proteins of the hordeiviruses and the tobamoviruses. - Highlights: • We report a low-resolution structure of barley stripe mosaic virus. • Barley stripe mosaic virus has 23.2 subunits per turn of the viral helix. • We compare barley stripe mosaic virus with tobacco mosaic virus

  12. Effects of drought stress on growth and yield of barley


    H. Samarah, Nezar


    International audience Barley (Hordeum vulgare) grown in Mediterranean regions undergoes drought stress during the grain-filling period. A greenhouse experiment was conducted to study the effect of drought stress on grain growth and yield of barley. Plants were exposed to three drought treatments at the beginning of grain filling: (1) well-watered at 100% field capacity, (2) mild drought stress at 60% field capacity, and (3) severe drought stress at 20% field capacity until grain maturity....

  13. Does boron affect hormone levels of barley cultivars?


    Muavviz Ayvaz; Mesut Koyuncu; Avni Guven; FAGERSTEDT, KURT V.


    Background: When mineral nutrients are present in excess or in inadequate amounts, their effects can be severe in plants and can be considered as abiotic stress. In this study, we report how hormonal levels in barley cultivars respond to the toxic effect of boron, an essential plant micronutrient. Material and methods: Two different barley (Hordeum vulgare) cultivars (Vamik Hoca and Efes 98) were used as a study material. Boron was applied in three different concentrations (0, 10, 20 ppm) ...

  14. Wheat and barley seed systems in Ethiopia and Syria


    Bishaw, Z.


    Keywords: Wheat,Triticumspp., Barley,Hordeumvulgare L., Seed Systems, Formal Seed Sector, Informal Seed Sector, National Seed Program, Seed Source, Seed Selection, Seed Management, Seed Quality, Genetic Diversity, Ethiopia, SyriaInEthiopiaandSyria, wheat and barley are the two most important principal cereal crops grown since ancient times.Manygenerations of natural and human selection led into highly adapted and diverse populations of local landraces. For most of the history of agriculture, ...

  15. Volatile organic compounds released by barley roots attract wireworms


    Barsics, Fanny; Fiers, Marie; Haubruge, Eric; Verheggen, François


    Wireworms are the soil dwelling larvae of click beetles and are pests of many crops worldwide. Alternatives to insecticide treatments are needed in order to develop integrated management strategies. Our work consists in elucidating the role of barley root-emitted volatile organic compounds on the orientation behaviour of Agriotes sordidus wireworms. Using a dual choice olfactometer we have evaluated the attractiveness of a variety of baits ranging from barley roots themselves to isolated root...

  16. Zeatin-binding proteins in barley leaves

    International Nuclear Information System (INIS)

    Highly labelled tritium-zeatin was used in the work to clarify for the first time a protein factor that is present in cytokinin-sensitive vegetative organs of plants (barley leaves) and which possesses the properties of a cytokinin receptor. Aliquots of tritium-zeatin were mixed with a solution of protein and incubated for several hours in buffer. Following incubation, protein was precipitated by ammonium sulfate at 90% of saturation, and radioactivity of the precipitate was checked in a dioxane scintillator with an efficiency of about 35%. It is shown that the characteristics of interaction of the clarified specific protein sites with cytokinins in regard to a number of criteria correspond to the characteristics expected of receptors of these phytohormones

  17. Zeatin-binding proteins in barley leaves

    Energy Technology Data Exchange (ETDEWEB)

    Romanov, G.A.; Kulaeva, O.N.; Taryan, V.Y.


    Highly labelled tritium-zeatin was used in the work to clarify for the first time a protein factor that is present in cytokinin-sensitive vegetative organs of plants (barley leaves) and which possesses the properties of a cytokinin receptor. Aliquots of tritium-zeatin were mixed with a solution of protein and incubated for several hours in buffer. Following incubation, protein was precipitated by ammonium sulfate at 90% of saturation, and radioactivity of the precipitate was checked in a dioxane scintillator with an efficiency of about 35%. It is shown that the characteristics of interaction of the clarified specific protein sites with cytokinins in regard to a number of criteria correspond to the characteristics expected of receptors of these phytohormones.

  18. The spontaneous chlorophyll mutation frequency in barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms; Jensen, Hans Peter


    A total of 1866 barley plants were progeny tested in the greenhouse. Twenty-five plants segregated for newly arisen, spontaneous chlorophyll mutant genes. Among the total of 470,129 seedlings screened there were 79 mutants (1.7 .+-. 0.6 .times. 10-4). The data are added to data from three similar...... materials and the resulting estimate of the chlorophyll mutant frequency is 1.6 .times. 10-4 in about 1.43 million seedlings. The estimate of the chlorophyll mutation rate per generation is close to 67.3 .times. 10-4 per diploid genome or in the order of 6 .times. 10-7 per locus and haploid genome....

  19. Serine:glyoxylate aminotransferase mutant of barley

    International Nuclear Information System (INIS)

    A photorespiratory mutant of barley (LaPr 85/84), deficient in both of the major peaks of serine:glyoxylate aminotransferase activity detected in the wild type, also lacks serine:pyruvate and asparagine:glyoxylate aminotransferase activities. Genetic analysis of the mutation demonstrated that these three activities are all carried on the same enzyme. The mutant, when placed in air, accumulated a large pool of serine, showed the expected rate (50%) of ammonia release during photorespiration but produced CO2 at twice the wild type rate when it was fed [14C] glyoxylate. Compared with the wild type, LaPr 85/84 exhibited abnormal transient changes in chlorophyll a fluorescence when the CO2 concentration of the air was altered, indicating that the rates of the fluorescence quenching mechanisms were affected in vivo by the lack of this enzyme

  20. Induced High Lysine Mutants in Barley

    DEFF Research Database (Denmark)

    Doll, Hans; Køie, B.; Eggum, B. O.


    Screening of mutagenically treated materials by combined Kjeldahl nitrogen and dye-binding capacity determinations disclosed fourteen barley mutants, which have from a few to about 40 per cent more lysine in the protein and one mutant with 10 per cent less lysine in the protein than the parent...... variety. Comparisons of six high lysine mutants with the parent variety showed that grain yield and seed size of the mutants are reduced between 10 and 30 per cent. However, the most promising mutant had the lowest reduction in grain yield, and the absolute lysine yield of this mutant was some 30 per cent...... above that of the parent variety. Feeding tests with rats revealed substantial increases in the biological value of the high lysine mutant protein. Also the net protein utilization was improved but less so because of a somewhat reduced digestibility of the mutant protein....

  1. Influence of crop rotation and meteorological conditons on density and biomass of weeds in spring barley (Hordeum vulgare L.)


    Maria Wanic; Magdalena Jastrzębska; Marta K. Kostrzewska


    The paper presents the analysis of changes in weed infestation in spring barley cultivated in the years 1990-2004 in crop rotation with a 25% proportion of this cereal (potato - spring barley - sowing peas - winter triticale), when it was grown after potato, and in crop rotation with its 75% proportion (potato - spring barley - spring barley - spring barley), when it was grown once or twice after spring barley. In the experiment, no weed control was applied. Every year in the spring (at full ...

  2. Comparison of barley stripe mosaic virus strains. (United States)

    Hafez, Elsayed E; Abdel Aleem, Engy E; Fattouh, Faiza A


    BSMV (barley stripe mosaic virus) particles were obtained in a pure state from infected host plant tissues of Hordeum vulgare. The three genomic parities (alpha, beta and gamma) were amplified by PCR using specific primers for each particle; each was cloned. Partial sequence of the alpha, beta and gamma segments was determined for the Egyptian isolate of barley stripe mosaic virus (BSMV AE1). Alignment of nucleotide sequences with that of other known strains of the virus, BSMV type strains (CV17, ND18 and China), and the generation of phylogenetic trees was performed. A low level of homology was detected comparing 467 bp of the a and 643 bp of the segments to that of the other strains, and thus BSMV alpha and beta segments were in separate clusters. However, 1154 bp of the gamma segments of BSMV AE1 showed a high level of homology especially to strain BSMV ND18, as they both formed a distinct cluster. Northern blotting of pure BSMV AE1 virus and H. vulgare-infected tissue were compared using an alpha ND18 specific probe. Western blotting using antibodies specific for the coat protein (CP) and the triple gene block 1 (TGB1) protein, which are both encoded by the beta ND18 segment, still indicated a high level of similarity between proteins produced by BSMV ND18 and AE1. We suggest that the BSMV AE1 isolate is a distinct strain of BSMV which reflects the genetic evolutionary divergence among BSMV strains and members of the Hordeivirus group. PMID:18533473

  3. Dynamics of phosphorus compounds in ripening and germinating cereal grains. Part II. Changes in phosphorus compounds content during germination of wheat, barley and rye grains

    Directory of Open Access Journals (Sweden)

    J. Tłuczkiewicz


    Full Text Available The dynamics of phosphorus compounds was investigated in the embryos and endosperm of wheat (Grana, barley (Kosmos and rye (Pancerne grain after 2, 4 and 6 days of germination. In germinating grain the phosphorus compounds transformations ran along the way of synthesis in the embryo and of breakdown in the endosperm. The level of phosphorus: inorganic, nucleotides, saccharides esters and their metabolites, lipid, RNA, DNA, phytin free and phytin bound with proteins and proteins rapidly increased in germinating seed embryos. The content of phosphorus free phytin and that bound with proteins, lipids, RNA and DNA in the endosperm rapidly decreased during germination. On the other hand, the saccharides phosphorus and that of their metabolites did not change, and inorganic, nuclotides and proteins-P slightly increased. Germinating rye grains showed a higher rate of synthesis in the embryos and of breakdown in the endosperm of the investigated phosphorus compounds than wheat and barley grains.

  4. Constructing the barley model for genetic transformation in Triticeae

    Institute of Scientific and Technical Information of China (English)

    LÜ Bo; WU Jia-jie; FU Dao-lin


    Barley (Hordeum vulgare L.) is one of the oldest domesticated crops, showing dramatic adaptation to various climate and environmental conditions. As a major cereal crop, barley ranks the 4th after wheat, maize and rice in terms of planting area and production al over the world. Due to its diploid nature, the cultivated barley is considered as an ideal model to study the polyploid wheat and other Triticeae species. Here, we reviewed the development, optimization, and application of transgenic approaches in barley. The most efifcient and robust genetic transformation has been built on the Agrobacterium-mediated transfer in conjunction with the immature embryo-based regeneration. We then discussed future considerations of using more practical technologies in barley transformation, such as the T-DNA/transposon tagging and the genome editing. As a cereal crop amenable to genetic transformation, barley wil serve as the most valuable carrier for global functional genomics in Triticeae and is becoming the most practical model for generating value-added products.

  5. A high throughput barley stripe mosaic virus vector for virus induced gene silencing in monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Cheng Yuan

    Full Text Available Barley stripe mosaic virus (BSMV is a single-stranded RNA virus with three genome components designated alpha, beta, and gamma. BSMV vectors have previously been shown to be efficient virus induced gene silencing (VIGS vehicles in barley and wheat and have provided important information about host genes functioning during pathogenesis as well as various aspects of genes functioning in development. To permit more effective use of BSMV VIGS for functional genomics experiments, we have developed an Agrobacterium delivery system for BSMV and have coupled this with a ligation independent cloning (LIC strategy to mediate efficient cloning of host genes. Infiltrated Nicotiana benthamiana leaves provided excellent sources of virus for secondary BSMV infections and VIGS in cereals. The Agro/LIC BSMV VIGS vectors were able to function in high efficiency down regulation of phytoene desaturase (PDS, magnesium chelatase subunit H (ChlH, and plastid transketolase (TK gene silencing in N. benthamiana and in the monocots, wheat, barley, and the model grass, Brachypodium distachyon. Suppression of an Arabidopsis orthologue cloned from wheat (TaPMR5 also interfered with wheat powdery mildew (Blumeria graminis f. sp. tritici infections in a manner similar to that of the A. thaliana PMR5 loss-of-function allele. These results imply that the PMR5 gene has maintained similar functions across monocot and dicot families. Our BSMV VIGS system provides substantial advantages in expense, cloning efficiency, ease of manipulation and ability to apply VIGS for high throughput genomics studies.

  6. Inheritance of resistance to barley yellow dwarf virus detected by northern blot analysis

    International Nuclear Information System (INIS)

    Development of wheat (Triticum aestivum L.) cultivars tolerant to the barley yellow dwarf virus disease (BYD) has been limited by lack of precision in rating plants for response to infection, usually done by visual scoring of plant symptoms under field conditions. Other methodologies have been developed to study the host/pathogen relationship and to assess resistance or susceptibility. In this study northern dot blot analysis was used to determine barley yellow dwarf virus (BYDV) RNA concentrations of six wheat cultivars that differed in visual BYD symptom expression. Plants were infected with the NYPAV (PAV) isolate of BYDV in the greenhouse. At several dates after inoculation crude plant extracts were blotted on nitrocellulose and hybridized with a 32P-labeled probe of the pPA8 cDNA clone of BYDV. The distribution of PRC for the F2 population was compared to the distribution of BYD visual symptom scores for 403 F2 plants of a similar F2 population of NS 879/4 x Seri 82 under field conditions. The results were qualitatively similar, suggesting that northern dot blot analysis to measure PRC may be useful in understanding the genetics of resistance to BYD. This technique, when incorporated into breeding programs, could be important in the development of highly tolerant wheat cultivars with reduced losses to BYD

  7. Competition and Facilitation in Hairy Vetch-Barley Intercrops

    Directory of Open Access Journals (Sweden)

    Giacomo Tosti


    Full Text Available Intercrops between legumes and non-legumes are widely used for fodder production and as cover crops, but little quantitative data are available on competition between species in the mixture. The objective of the present study was to assess the interaction between hairy vetch (Vicia villosa Roth. and barley (Hordeum vulgare L. grown as pure crops or intercrops with different proportions of seed rates at sowing. A 4-year field study was conducted using hairy vetch and barley as pure stands at full sowing density and as intercrops at different proportions of their own full seed rate according to the replacement principle. Interaction between species was evaluated on the basis of Land Equivalent Ratio (LER, Relative Neighbour Effect (RNE and Aggressivity (A calculated on biomass and nitrogen (N accumulation. The N accumulation of the mixed crops increased linearly with the legume proportion in the mixture. The mixtures were more efficient than the pure crops in terms of N use (LER > 1. Partial LER values indicated that the barley component benefited from the presence of the legume, while the hairy vetch partial LER decreased with increasing barley proportion in the mixture. The competitive response in terms of biomass accumulation was high for both species when their density in the mixture was high. Concerning N accumulation, barley benefited from an asymmetric interspecific facilitation while the vetch behaviour was similar to that observed for biomass accumulation. Barley dominance progressively increased reaching a maximum just before the last sampling date. At the last sampling date the competitive ability of hairy vetch showed a considerable increase in all mixtures (A ≈ 0. These findings indicate that the use of mixtures between hairy vetch and barley allows an increase in the use efficiency of N resource with respect to pure crops. Barley is the dominant component of the mixture and the hairy vetch is able to cope with the cereal

  8. The miR9863 family regulates distinct Mla alleles in barley to attenuate NLR receptor-triggered disease resistance and cell-death signaling.

    Directory of Open Access Journals (Sweden)

    Jie Liu


    Full Text Available Barley (Hordeum vulgare L. Mla alleles encode coiled-coil (CC, nucleotide binding, leucine-rich repeat (NB-LRR receptors that trigger isolate-specific immune responses against the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh. How Mla or NB-LRR genes in grass species are regulated at post-transcriptional level is not clear. The microRNA family, miR9863, comprises four members that differentially regulate distinct Mla alleles in barley. We show that miR9863 members guide the cleavage of Mla1 transcripts in barley, and block or reduce the accumulation of MLA1 protein in the heterologous Nicotiana benthamiana expression system. Regulation specificity is determined by variation in a unique single-nucleotide-polymorphism (SNP in mature miR9863 family members and two SNPs in the Mla miR9863-binding site that separates these alleles into three groups. Further, we demonstrate that 22-nt miR9863s trigger the biogenesis of 21-nt phased siRNAs (phasiRNAs and together these sRNAs form a feed-forward regulation network for repressing the expression of group I Mla alleles. Overexpression of miR9863 members specifically attenuates MLA1, but not MLA10-triggered disease resistance and cell-death signaling. We propose a key role of the miR9863 family in dampening immune response signaling triggered by a group of MLA immune receptors in barley.

  9. Molecular Mechanisms Underlying Hull-Caryopsis Adhesion/Separation Revealed by Comparative Transcriptomic Analysis of Covered/Naked Barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Ruijun Duan


    Full Text Available The covered/naked caryopsis trait of barley is an important agronomic trait because it is directly linked to dietary use. The formation of covered/naked caryopsis is controlled by an NUD transcription factor, which is involved in pericarp cuticle development. However, the molecular mechanism underlying this trait remains so far largely unknown. In this study, comparative transcriptomes of grains three weeks after anthesis of Tibetan Hulless barley landrace Dulihuang and covered barley Morex were analyzed using RNA-seq technique. A total of 4031 differentially expressed genes (DEGs were identified. The Nud gene was overexpressed in Morex, with trace expression in Dulihuang. Among seventeen cuticle related DEGs, sixteen were down regulated and one up regulated in Morex. These results suggest that the Nud gene in covered caryopsis might down regulate cuticle related genes, which may cause a permeable cuticle over pericarp, leading to a hull-caryopsis organ fusion. A functional cuticle covering the pericarp of naked caryopsis might be the result of deletion or low expression level of the Nud gene. The functional cuticle defines a perfect boundary to separate the caryopsis from the hull in naked barley.

  10. Heat shock causes destabilization of specific mRNAs and destruction of endoplasmic reticulum in barley aleurone cells.


    Belanger, F. C.; Brodl, M R; Ho, T H


    In response to a phytohormone, gibberellic acid, the aleurone layers of barley seeds synthesize and secrete alpha-amylases, which are coded by a set of stable mRNAs. When aleurone layers are subjected to heat shock treatment, the synthesis of alpha-amylase is suppressed while heat shock proteins are induced. The suppression of alpha-amylase synthesis is not the result of translational control as reported in several other systems. Rather, the sequences of alpha-amylase mRNA are rapidly degrade...

  11. Towards systems genetic analyses in barley: Integration of phenotypic, expression and genotype data into GeneNetwork

    Directory of Open Access Journals (Sweden)

    Druka Arnis


    Full Text Available Abstract Background A typical genetical genomics experiment results in four separate data sets; genotype, gene expression, higher-order phenotypic data and metadata that describe the protocols, processing and the array platform. Used in concert, these data sets provide the opportunity to perform genetic analysis at a systems level. Their predictive power is largely determined by the gene expression dataset where tens of millions of data points can be generated using currently available mRNA profiling technologies. Such large, multidimensional data sets often have value beyond that extracted during their initial analysis and interpretation, particularly if conducted on widely distributed reference genetic materials. Besides quality and scale, access to the data is of primary importance as accessibility potentially allows the extraction of considerable added value from the same primary dataset by the wider research community. Although the number of genetical genomics experiments in different plant species is rapidly increasing, none to date has been presented in a form that allows quick and efficient on-line testing for possible associations between genes, loci and traits of interest by an entire research community. Description Using a reference population of 150 recombinant doubled haploid barley lines we generated novel phenotypic, mRNA abundance and SNP-based genotyping data sets, added them to a considerable volume of legacy trait data and entered them into the GeneNetwork GeneNetwork is a unified on-line analytical environment that enables the user to test genetic hypotheses about how component traits, such as mRNA abundance, may interact to condition more complex biological phenotypes (higher-order traits. Here we describe these barley data sets and demonstrate some of the functionalities GeneNetwork provides as an easily accessible and integrated analytical environment for exploring them. Conclusion By

  12. Analysis of pregerminated barley using hyperspectral image analysis. (United States)

    Arngren, Morten; Hansen, Per Waaben; Eriksen, Birger; Larsen, Jan; Larsen, Rasmus


    Pregermination is one of many serious degradations to barley when used for malting. A pregerminated barley kernel can under certain conditions not regerminate and is reduced to animal feed of lower quality. Identifying pregermination at an early stage is therefore essential in order to segregate the barley kernels into low or high quality. Current standard methods to quantify pregerminated barley include visual approaches, e.g. to identify the root sprout, or using an embryo staining method, which use a time-consuming procedure. We present an approach using a near-infrared (NIR) hyperspectral imaging system in a mathematical modeling framework to identify pregerminated barley at an early stage of approximately 12 h of pregermination. Our model only assigns pregermination as the cause for a single kernel's lack of germination and is unable to identify dormancy, kernel damage etc. The analysis is based on more than 750 Rosalina barley kernels being pregerminated at 8 different durations between 0 and 60 h based on the BRF method. Regerminating the kernels reveals a grouping of the pregerminated kernels into three categories: normal, delayed and limited germination. Our model employs a supervised classification framework based on a set of extracted features insensitive to the kernel orientation. An out-of-sample classification error of 32% (CI(95%): 29-35%) is obtained for single kernels when grouped into the three categories, and an error of 3% (CI(95%): 0-15%) is achieved on a bulk kernel level. The model provides class probabilities for each kernel, which can assist in achieving homogeneous germination profiles. This research can further be developed to establish an automated and faster procedure as an alternative to the standard procedures for pregerminated barley. PMID:21932866

  13. Molecular characterization of barley 3H semi-dwarf genes.

    Directory of Open Access Journals (Sweden)

    Haobing Li

    Full Text Available The barley chromosome 3H accommodates many semi-dwarfing genes. To characterize these genes, the two-rowed semi-dwarf Chinese barley landrace 'TX9425' was crossed with the Australian barley variety 'Franklin' to generate a doubled haploid (DH population, and major QTLs controlling plant height have been identified in our previous study. The major QTL derived from 'TX9425' was targeted to investigate the allelism of the semi-dwarf gene uzu in barley. Twelve sets of near-isogenic lines and a large NILF2 fine mapping population segregating only for the dwarfing gene from 'TX9425' were developed. The semi-dwarfing gene in 'TX9425' was located within a 2.8 cM region close to the centromere on chromosome 3H by fine mapping. Molecular cloning and sequence analyses showed that the 'TX9425'-derived allele contained a single nucleotide substitution from A to G at position 2612 of the HvBRI1 gene. This was apparently the same mutation as that reported in six-rowed uzu barley. Markers co-segregating with the QTL were developed from the sequence of the HvBRI1 gene and were validated in the 'TX9425'/'Franklin' DH population. The other major dwarfing QTL derived from the Franklin variety was distally located on chromosome 3HL and co-segregated with the sdw1 diagnostic marker hv20ox2. A third dwarfing gene, expressed only in winter-sown trials, was identified and located on chromosome 3HS. The effects and interactions of these dwarfing genes under different growing conditions are discussed. These results improve our understanding of the genetic mechanisms controlling semi-dwarf stature in barley and provide diagnostic markers for the selection of semi-dwarfness in barley breeding programs.

  14. Genetic Diversity in A Core Subset of Wild Barley Germplasm

    Directory of Open Access Journals (Sweden)

    Yong-Bi Fu


    Full Text Available Wild barley [Hordeum vulgare ssp. spontaneum (C. Koch Thell.] is a part of the primary gene pool with valuable sources of beneficial genes for barley improvement. This study attempted to develop a core subset of 269 accessions representing 16 countries from the Plant Gene Resources of Canada (PGRC collection of 3,782 accessions, and to characterize them using barley simple sequence repeat (SSR markers. Twenty-five informative primer pairs were applied to screen all samples and 359 alleles were detected over seven barley chromosomes. Analyses of the SSR data showed the effectiveness of the stratified sampling applied in capturing country-wise SSR variation. The frequencies of polymorphic alleles ranged from 0.004 to 0.708 and averaged 0.072. More than 24% or 7% SSR variation resided among accessions of 16 countries or two regions, respectively. Accessions from Israel and Jordan were genetically most diverse, while accessions from Lebanon and Greece were most differentiated. Four and five optimal clusters of accessions were obtained using STRUCTURE and BAPS programs and partitioned 16.3% and 20.3% SSR variations, respectively. The five optimal clusters varied in size from 15 to 104 and two clusters had only country-specific accessions. A genetic separation was detected between the accessions east and west of the Zagros Mountains only at the country, not the individual, level. These SSR patterns enhance our understanding of the wild barley gene pool, and are significant for conserving wild barley germplasm and exploring new sources of useful genes for barley improvement.

  15. Efficient production of tetraploid barley (Hordeum vulgare L. by colchicine treatment of diploid barley

    Directory of Open Access Journals (Sweden)

    Ayed Sourour


    Full Text Available An experiment was conducted to induce tetraploidy in three diploid barley varieties (Martin, Rihane and Manel through different colchicines treatments. Colchicine was added for three different concentrations at three different stages of plant development i.e. on seed (0.05% for 48 hours, on pre-germinated seeds (0.1% for 2 hours and on three leaf stage (0.1% for 16 hours. Colchicine application reduced significantly germination percentage and viability of plants. Seed germination was completely inhibited in Martin, while a reduction of 20% and 30% for germination percentage compared to control was recorded in varieties Manel and Rihane, respectively at 0.1% colchicine concentration. Ploidy evaluation showed no tetraploidy in all the three tested varieties by colchicine application of 0.05% for 48 hours on seeds and 0.1% for 2 hours on pre-germinated seeds. However, tetraploid plants were produced only by treatment with 0.1% for 16 hours of seedlings. The percentages of plants were 40%, 44% and 100% for Rihane, Manel and Martin, respectively. Cytological analyses showed the increase of chromosome numbers from 2n=2x=14 to 2n=4x=28. The increase of ploidy levels caused major changes in some morphological traits. In fact, the induced tetraploids in barley was accompanied by significant (P<0.01 decrease in plant height, tiller height, leaf number and leaf length compared to diploid control plants. colchicine treatment induce successfully the production of tetraploid barley plants and could be used in breeding programs.

  16. Addition of Manas barley chromosome arms to the hexaploid wheat genome


    Türkösi, Edina; Cseh, András; Darkó, Éva; Molnár-Láng, Márta


    Background Cultivated barley belongs to the tertiary genepool of hexaploid wheat. Genes of interest can be transferred from barley into wheat through wide hybridization. The application of wheat-barley introgression lines could provide an excellent tool for the transfer of earliness, favourable amino acid composition, biotic stress resistance, abiotic stress tolerance, or good tillering ability into wheat. Results A set of 10 wheat-barley ditelosomic addition lines (2HS, 2HL, 3HS, 3HL, 4HS, 4...

  17. Expression Analysis of Ethylene Biosynthesis and Receptor Genes From Barley Embryo and Tissue Culture (United States)

    Ethylene affects regeneration of green plants from barley tissue culture. With the availability of the HarvEST barley database and barley GeneChip, genome-wide expression studies have focused on differential development between Morex and Golden Promise at various stages of plant growth. The data f...

  18. Pearling barley to alter the composition of the raw material before brewing

    NARCIS (Netherlands)

    Donkelaar, van L.H.G.; Noordman, T.R.; Boom, R.M.; Goot, van der A.J.


    Partly replacing malt with unmalted barley is a trend in brewing. The use of unmalted barley, however, leads to issues such as haze and high mash viscosity, due to its higher content of undesired components. Pearling, an abrasive method to remove the outer layers of the barley kernels has been shown

  19. The enhanced callose deposition in barley with ml-o powdery mildew resistance genes

    DEFF Research Database (Denmark)

    Skou, Jens-Peder


    Carborundum treatment of barley leaves induced a callose deposition which was detected as diffuse blotches in the epidermal cells of susceptible barleys and as deeply stained tracks along the scratches in barleys with the ml-o powdery mildew resistance gene. Subsequent inoculation with powdery...

  20. Effect of Different Levels of Germinated Barley on Live Performance and Carcass Traits in Broiler Chickens

    Directory of Open Access Journals (Sweden)

    Dastar B


    Full Text Available An experiment was conducted to evaluate the effect of different levels of germinated barley (GB on live performance and carcass traits in broiler chickens. The experiment lasted for 5 weeks starting from 7 days of age and ending at 42 days of age. Chicks (Ross 308 were fed six dietary treatments including a corn–soy diet (corn diet, a barley–soy diet (barley diet, a barley diet plus enzymes (enzyme barley diet, and 3 other diets in which GB was replaced with barley at levels of 33%, 66%, and 100% in the barley diet (33% GB diet, 66% GB diet, and GB diet, respectively. Data were analyzed in a completely randomized design. Results indicated that birds fed a barley diet had significantly lower performance than those fed other diets (P. Supplementing of the barley diet with β-glucanase enzyme as well as replacing GB with barley improved the performance of broilers. Birds fed a GB diet had a significantly higher carcass yield those fed other diets (P. The lowest abdominal fat percentage was observed in birds fed a barley diet or a corn diet. Thus, it is concluded that replacing GB with barley, especially at 33% level, is more effective than supplementing barley diets with β-glucanase enzyme in improving live performance of broiler chickens.

  1. The project of mutation breeding in barley (first report)

    International Nuclear Information System (INIS)

    Barley is a second main crop with the production of 7 million tons per year and 3,5 million hectare cultivation area in Turkey. Because of wateer deficiency, cereals cultivated in Central Anatolian region. Barley is well adapted to dry farming system besides it is basic food for animal husbandry and main raw material for brewery industry. the main problems in barley production are drought disease epidemic and increasing salinity gradually. Main purposes of our project is to increase resistance and tolerence to this stress factors. In order to reach to our aim we have been using mutation breeding techniques and conventional breeding methods. This Project has been started with irradiation of barley seeds with different gamma ray doses. After that resistant and tolerant mutant has been selected most of these mutanys have resistance and tolerance to different disease and stress conditions. During the selection procedure, hydroponics and tissue culture techniques have been applied to improve the selection efficiency. Up to now, promising barley mutant lines 71 that have earliness (30 days) than parents and because of that reason that escape from drought period. Disease tests of our mutant lines have been conducted under controlled conditions and tolerant lines have been determined under the high the high epidemic conditions. Salt tolerance studies have been applied under hydroponics conditions and salt tolerant mutant have been determined under 180-200mMolNaCl concentration. All mutant lines are carried out to preliminary yield trials for their evaluation

  2. Simulation of in situ Root Decomposition of Two Barley Cultivars

    Institute of Scientific and Technical Information of China (English)

    Xu Jing-gang; Duan Xue-jiao; Nooralla Juma


    Root C and root-released C are closely related to soil organic matter content and mechanistic simulation modeling has proven to be useful for studying root and soil organic C dynamics in plant-soil ecosystems. A computer model was designed in this study to simulate the dynamics of root C and root released C decomposition in situ and the dynamics of different forms of C in soil under two barley cultivars (Abee and Samson). The results showed that on the 15th day, about 48%of the total 14C fixed in roots was respired for Abee and 42%for Samson. This indicated that the turnover rate of root 14C of Abee was higher than that of Samson. The percentage of water-soluble organic 14C, active microbial 14C and stable 14C over the total fixed 14C were not different between two barley cultivars. From the analysis of the model for two barley cultivars, the total 14C transformed into different soil pools (excluding CO2-C and root C pools) for the two barley cultivars was similar (26%for Abee and 25%for Samson), but the difference of 14C remaining in soil between the two barley cultivars was mainly because of the difference of 14C remaining in roots which have not been yet decomposed. Some of the information which could not be measured in the laboratory conditions was obtained in this study.

  3. The role of root hairs in cadmium acquisition by barley

    Energy Technology Data Exchange (ETDEWEB)

    Zheng Ruilun; Li Huafen [Key Laboratory of Plant-Soil Interactions of the Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100094 (China); Jiang Rongfeng, E-mail: [Key Laboratory of Plant-Soil Interactions of the Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100094 (China); Roemheld, Volker [Institute of Plant Nutrition, University of Hohenheim, D-70593 Stuttgart (Germany); Zhang Fusuo [Key Laboratory of Plant-Soil Interactions of the Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100094 (China); Zhao Fangjie [Soil Science Department, Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ (United Kingdom)


    The role of root hairs in Cd acquisition from soil was investigated in three pot experiments using a root hairless mutant (bald root barley, brb) and its wild-type (WT) cultivar of barley (Hordeum vulgare). brb had significantly lower concentrations and lower total amounts of Cd in shoots than WT. The Cd uptake efficiency based on total root length was 8-45% lower in brb than in WT. The difference between brb and WT increased with increasing extractable Cd in soil under the experimental conditions used. Additions of phosphate to soil decreased Cd extractability. Both soil and foliar additions of phosphate decreased root length, and root hair formation in WT. These effects resulted in decreased Cd uptake with increasing P supply. Cd uptake in WT correlated significantly with root length, root hair length and density, and soil extractable Cd. Root hairs contribute significantly to Cd uptake by barley. - Research highlights: The Cd uptake efficiency was significantly lower in brb than in WT. Additions of phosphate to soil decreased Cd extractability and Cd uptake. Both soil and foliar additions of phosphate decreased root length, and root hair formation in WT. Root hairs contribute significantly to Cd uptake by barley. - The Cd uptake efficiency based on total root length was 8-45% lower in a barley root hairless mutant than in its wild-type, indicating an important role of root hairs in Cd acquisition.

  4. On the origin of Spanish two-rowed barleys. (United States)

    Moralejo, M; Romagosa, I; Salcedo, G; Sánchez-Monge, R; Molina-Cano, J L


    To investigate the phylogenetic origin of Spanish two-rowed barleys, we studied 44 accessions of old land-races both morphologically and biochemically to ascertain their similarity with 51 entries of old cultivars and land-races of widespread origin across Europe. They were also compared with 20 accessions of Hordeum spontaneum from the Mediterranean basin and other regions of its distribution range, 14 accessions of Moroccan cultivated six-rowed barley land-races, and different six-rowed Spanish and two-and six-rowed European cultivars. CM-(trypsin inhibitors and subunits of the barley tetrameric α-amylase inhibitor) proteins and hordeins, all of which are endosperm proteins, were used as biochemical markers. The appearance of separate clusters of the Spanish barleys in the numerical classifications for both protein systems as a result of the existence of characteristic gene combinations that do not exist in entries from other origins permitted us to postulate the existence of local ancestors for most of the Spanish two-rowed barleys studied, and, therefore, a possible in situ domestication. PMID:24190469

  5. Breeding of value added barley by mutation and protein engineering

    International Nuclear Information System (INIS)

    Barley has been bred for food, feed and beverages over the past 5000 years by selecting for spontaneous mutations and random hybrids. Crosses with defined parents (since the turn of the century) and induced mutations (since 1927) have provided variability in selecting for novel varieties. Genetic transformation of barley has been a routine procedure since 1994 and permits the introduction of tailored genes for adding quality values to the grain. It complements, but does not replace, existing efficient breeding methods. Radiation and chemically induced mutations, as well as genes introduced by transformation, have to be fitted into the genome, which may take 50 years of breeding effort and testing for agronomic and industrial performance. The mutation breeding strategy for proanthocyanidin free malt barley, which has led to the commercial varieties Caminant and NFC 8808, is presented. As an example of the breeding strategy to improve barley endosperm cell wall degradation, a description is given of the protein engineering of a (1-3, 1-4)-β-glucanase towards heat stability and the insertion of the gene encoding this enzyme by genetic transformation. It is expected that such barley varieties will extend the use of the grain for beverage and feed uses as well as for the production of renewable raw materials by malting and mashing processes. (author). 34 refs, 1 tab

  6. The role of root hairs in cadmium acquisition by barley

    International Nuclear Information System (INIS)

    The role of root hairs in Cd acquisition from soil was investigated in three pot experiments using a root hairless mutant (bald root barley, brb) and its wild-type (WT) cultivar of barley (Hordeum vulgare). brb had significantly lower concentrations and lower total amounts of Cd in shoots than WT. The Cd uptake efficiency based on total root length was 8-45% lower in brb than in WT. The difference between brb and WT increased with increasing extractable Cd in soil under the experimental conditions used. Additions of phosphate to soil decreased Cd extractability. Both soil and foliar additions of phosphate decreased root length, and root hair formation in WT. These effects resulted in decreased Cd uptake with increasing P supply. Cd uptake in WT correlated significantly with root length, root hair length and density, and soil extractable Cd. Root hairs contribute significantly to Cd uptake by barley. - Research highlights: → The Cd uptake efficiency was significantly lower in brb than in WT. → Additions of phosphate to soil decreased Cd extractability and Cd uptake. → Both soil and foliar additions of phosphate decreased root length, and root hair formation in WT. → Root hairs contribute significantly to Cd uptake by barley. - The Cd uptake efficiency based on total root length was 8-45% lower in a barley root hairless mutant than in its wild-type, indicating an important role of root hairs in Cd acquisition.

  7. Identification of a phytase gene in barley (Hordeum vulgare L..

    Directory of Open Access Journals (Sweden)

    Fei Dai

    Full Text Available BACKGROUND: Endogenous phytase plays a crucial role in phytate degradation and is thus closely related to nutrient efficiency in barley products. The understanding of genetic information of phytase in barley can provide a useful tool for breeding new barley varieties with high phytase activity. METHODOLOGY/PRINCIPAL FINDINGS: Quantitative trait loci (QTL analysis for phytase activity was conducted using a doubled haploid population. Phytase protein was purified and identified by the LC-ESI MS/MS Shotgun method. Purple acid phosphatase (PAP gene was sequenced and the position was compared with the QTL controlling phytase activity. A major QTL for phytase activity was mapped to chromosome 5 H in barley. The gene controlling phytase activity in the region was named as mqPhy. The gene HvPAP a was mapped to the same position as mqPhy, supporting the colinearity between HvPAP a and mqPhy. CONCLUSIONS/SIGNIFICANCE: It is the first report on QTLs for phytase activity and the results showed that HvPAP a, which shares a same position with the QTL, is a major phytase gene in barley grains.

  8. Assessment of genetic diversity in Brazilian barley using SSR markers

    Directory of Open Access Journals (Sweden)

    Jéssica Rosset Ferreira


    Full Text Available Abstract Barley is a major cereal grown widely and used in several food products, beverage production and animal fodder. Genetic diversity is a key component in breeding programs. We have analyzed the genetic diversity of barley accessions using microsatellite markers. The accessions were composed of wild and domesticated barley representing genotypes from six countries and three breeding programs in Brazil. A total of 280 alleles were detected, 36 unique to Brazilian barley. The marker Bmag120 showed the greatest polymorphism information content (PIC, with the highest mean value found on chromosome three, and the lowest on chromosomes four and six. The wild accessions presented the highest diversity followed by the foreign genotypes. Genetic analysis was performed using Principal Coordinates Analysis, UPGMA clustering, and Bayesian clustering analysis implemented in Structure. All results obtained by the different methods were similar. Loss of genetic diversity has occurred in Brazilian genotypes. The number of alleles detected in genotypes released in 1980s was higher, whereas most of the cultivars released thereafter showed lower PIC and clustered in separate subgroups from the older cultivars. The use of a more diverse panel of genotypes should be considered in order to exploit novel alleles in Brazilian barley breeding programs.

  9. Assessment of genetic diversity in Brazilian barley using SSR markers (United States)

    Ferreira, Jéssica Rosset; Pereira, Jorge Fernando; Turchetto, Caroline; Minella, Euclydes; Consoli, Luciano; Delatorre, Carla Andréa


    Abstract Barley is a major cereal grown widely and used in several food products, beverage production and animal fodder. Genetic diversity is a key component in breeding programs. We have analyzed the genetic diversity of barley accessions using microsatellite markers. The accessions were composed of wild and domesticated barley representing genotypes from six countries and three breeding programs in Brazil. A total of 280 alleles were detected, 36 unique to Brazilian barley. The marker Bmag120 showed the greatest polymorphism information content (PIC), with the highest mean value found on chromosome three, and the lowest on chromosomes four and six. The wild accessions presented the highest diversity followed by the foreign genotypes. Genetic analysis was performed using Principal Coordinates Analysis, UPGMA clustering, and Bayesian clustering analysis implemented in Structure. All results obtained by the different methods were similar. Loss of genetic diversity has occurred in Brazilian genotypes. The number of alleles detected in genotypes released in 1980s was higher, whereas most of the cultivars released thereafter showed lower PIC and clustered in separate subgroups from the older cultivars. The use of a more diverse panel of genotypes should be considered in order to exploit novel alleles in Brazilian barley breeding programs. PMID:27007902

  10. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    DEFF Research Database (Denmark)

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren; Hammer, Karin; Kilstrup, Mogens


    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates the...... relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell......Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...

  11. The Genetic Architecture of Barley Plant Stature. (United States)

    Alqudah, Ahmad M; Koppolu, Ravi; Wolde, Gizaw M; Graner, Andreas; Schnurbusch, Thorsten


    Plant stature in temperate cereals is predominantly controlled by tillering and plant height as complex agronomic traits, representing important determinants of grain yield. This study was designed to reveal the genetic basis of tillering at five developmental stages and plant height at harvest in 218 worldwide spring barley (Hordeum vulgare L.) accessions under greenhouse conditions. The accessions were structured based on row-type classes [two- vs. six-rowed] and photoperiod response [photoperiod-sensitive (Ppd-H1) vs. reduced photoperiod sensitivity (ppd-H1)]. Phenotypic analyses of both factors revealed profound between group effects on tiller development. To further verify the row-type effect on the studied traits, Six-rowed spike 1 (vrs1) mutants and their two-rowed progenitors were examined for tiller number per plant and plant height. Here, wild-type (Vrs1) plants were significantly taller and had more tillers than mutants suggesting a negative pleiotropic effect of this row-type locus on both traits. Our genome-wide association scans further revealed highly significant associations, thereby establishing a link between the genetic control of row-type, heading time, tillering, and plant height. We further show that associations for tillering and plant height are co-localized with chromosomal segments harboring known plant stature-related phytohormone and sugar-related genes. This work demonstrates the feasibility of the GWAS approach for identifying putative candidate genes for improving plant architecture. PMID:27446200

  12. In vitro culture in barley breeding

    International Nuclear Information System (INIS)

    One of the most useful biotechnics for plant breeders is in vitro culture of anthers or miscropores to induce haploids and homozygous diploids. High frequency of microspore-derived diploid plants could be produced by culturing anthers on Ficoll medium. The segregation ratios of certain morphological characters were not random and could be shifted by culture conditions. It was reported by a number of authors that true breeding and highly productive genotypes were obtained from microspore-derived diploid plants and doubled haploids derived from bulbosom techniques. There is a great possibility that a selective system for desirable characters can be built in an in vitro culture system. Where haploids can be induced in crop plants, they provide the most rapid technique for producing homozygous lines. Since the genetically controlled factors in homozygous lines are fixed and will be identical in the future generations, it becomes possible for a plant breeder to evaluate quantitative characters such as yield and quality very early in the breeding program. There are two methods which have been used extensively for production of homozygous diploid barley plants. They are bulbosum techniques and anther culture methods. (author). 14 refs, 5 tabs

  13. Chemical weed control in barley (hordeum vulgare)

    International Nuclear Information System (INIS)

    Effect of two different pre-emergence herbicides i.e. Terbutryn (lgron-500FW) A, 1.01.25 kg a.t. ha/sup -1/ and Flurochloridone (Racer-25 CS) a 0.31, 0.37, 0.44, 0.50 and 0.56 Kg a.i. ha/sup -1/ on weeds and yield of barley wad studied under field conditions hb/sup -1/. All the herbicides significantly reduce the dry weight of weed Maximum reduction (70%) was observed in terbutryn a 1.0 Kg a.i. ha/sup -1/ Growth and yield parameters like number of spike lets per spike. Number of grams per spike. 1000-grain weight. Biological yield. Grain yield straw yield and harvest index showed significant response to various herbicides doses under study. Application of Flurochloridone (Racer-25 (CS) a 0.44 kg a.i. ha/sup -1/ and Terbutryn (lgran-500 FW) a 1.0 kg a.i). The data further revealed that in general all herbicide application treatments exhibited superior performance in respect of growth and yield over control. (author)

  14. RNA genetics

    Energy Technology Data Exchange (ETDEWEB)

    Domingo, E. (Instituto de Biologia Molecular, Facultad de Ciencias, Universidad Autonoma de Madrid, Canto Blanco, Madrid (ES)); Holland, J.J. (California Univ., San Diego, La Jolla, CA (USA). Dept. of Biology); Ahlquist, P. (Wisconsin Univ., Madison, WI (USA). Dept. of Plant Pathology)


    This book contains the proceedings on RNA genetics: Retroviruses, Viroids, and RNA recombination, Volume 2. Topics covered include: Replication of retrovirus genomes, Hepatitis B virus replication, and Evolution of RNA viruses.

  15. Implementation of biochemical screening to improve baking quality of Barley

    DEFF Research Database (Denmark)

    Aaslo, Per; Langkilde, Ane; Dionisio, Giuseppe;


    objective is to develop barley varieties with good baking properties. The poor leavening properties of barley can be attributed, at least partially, to the physical properties of the storage proteins. Studies based on small scaled baking trials and protein pattern analysed by SDS-PAGE on a large number of...... high protein barley cultivars suggested differences in baking quality and correlation between baking quality and D-hordeins. The amino acid composition was measures using the newly developed AccQ Tag Ultra Amino acid (AA) derivatisation system designed for the Acquity UPLC. Obtained results from the...... opportunity to give a forecast of the taste of the bread, as the AA composition is known to control certain aspects of the taste. We uses a MSE approach on a time of flight instrument coupled to a UPLC and in gel digestion to identify and characterize the different D-hordeins responsible for baking quality...

  16. Improvement of quinoa and barley through induced mutations and biotechnology

    International Nuclear Information System (INIS)

    The main cropping problems in the Bolivian highlands are the long growing period of barley, high degree of environmental influence on the performance of quinoa, and low soil moisture at sowing time, leading to low germination rate and poor stands, and frost or chilling damages. The program aimed to establish protocols for induction of mutations with X rays and chemical mutagens (NaN3, MNH, EMS) in quinoa, barley, native forage species and forest plants and to obtain mutant lines, especially in barley and quinoa; and to establish callus regeneration in quinoa and micropropagation of kenua (Polilepis). The project is still in its study stages, hence further evaluations are needed before firm conclusions are drawn. (author)

  17. Triple Hybridization with Cultivated Barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Bothmer, R. von; Claesson, L.; Flink, J.;


    represented species closely or distantly related to H. jubatum and H. lechleri. In trispecific crosses with diploid barley, the seed set was 5.7%. Crosses with tetraploid barley were highly unsuccessful (0.2% seed set). Three lines of diploid barley were used in the crosses, i.e. 'Gull', 'Golden Promise' and...... 'Vada'. Generally, cv 'Gull' had high crossability in crosses with related species in the primary hybrid. It is suggested that 'Gull' has a genetic factor for crossability not present in cv 'Vada' and cv 'Golden Promise'. One accession of H. brachyantherum used in the primary hybrid had a very high...... crossability (seed set 54.7%) in combination with cv 'Vada' but no viable offspring was produced. In all, two trispecific hybrids were raised, viz. (H. lechleri .times. H. brevisubulatum) .times. 'Gull' (2n = 27-30) and (H. jubatum .times. H. lechleri) .times. 'Gull' (2n = 20-22). The first combination...

  18. Nonenzymatic microorganism identification based on ribosomal RNA (United States)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.


    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.



    LaFrance, Jeffrey T.; Watts, Myles J.


    The impact of the protein content of feed barley on the costs of feeding beef, dairy cattle, and swine in Montana is evaluated. A model of least-cost feed rations is constructed to analyze the marginal value of additional protein content in feed barley. The results indicate that increasing the protein content of feed barley above 12% will not substantially increase the value of barley to feeders. This implies that the establishment and maintenance of a protein premium in the feed barley marke...


    Directory of Open Access Journals (Sweden)



    Full Text Available This work is a review of author’s previous publications, unpublished results as well as available literature on barley responses to Cd contamination. The physiological backgrounds of the acute Cd toxicity in barley plants are briefly described. Some data characterizing the chronic Cd toxicity in barley have been also provided in relation to its possible use for seed production and Cd phytoextraction on Cd-contaminated agricultural soils. Information about the main physiological factors limiting growth of Cd-exposed barley plants and grain yield, seedling quality as well as Cd phytoextraction capacity of barley grown in Cd-contaminated soils is presented.

  1. The experience of induction of mutation on barley in Peru

    International Nuclear Information System (INIS)

    Work on induced mutation of barley was started in 1978 under the Programme of Cereal Improvement. Barley was irradiated with gamma radiation at doses of 12, 15, 18, 21, and 24 Krad. Radiation doses of 18 and 21 Krad gave the highest frequency of albino and cloroticos mutants. Induced mutation is being carried out in different parts of the country to develop mutants having early germination property. These mutants will play an important role in the late cultivation in the mountain areas of Peru

  2. Barley starch bioengineering for high phosphate and amylose

    DEFF Research Database (Denmark)

    Blennow, Per Gunnar Andreas; Carciofi, Massimiliano; Shaik, Shahnoor Sultana;


    the three genes encoding the starch-branching enzymes SBEI, SBEIIa, and SBEIIb using a triple RNAi chimeric hairpin construct we generated a virtually amylopectin-free barley. The grains of the transgenic lines were shrunken and had a yield of around 80% of the control line. The starch granules were...... irregular and showed no distinct melting enthalpy and very weak X-ray scattering. Hyperphosphorylated barley starch was achieved by endosperm specific overexpression of the potato glucan water dikinase1 (StGWD1). The content of phosphate esters in this starch was tenfold higher than the control lines...

  3. Biotin Carboxyl Carrier Protein in Barley Chloroplast Membranes

    DEFF Research Database (Denmark)

    Kannangara, C. G.; Jense, C J


    Biotin localized in barley chloroplast lamellae is covalently bound to a single protein with an approximate molecular weight of 21000. It contains one mole of biotin per mole of protein and functions as a carboxyl carrier in the acetyl-CoA carboxylase reaction. The protein was obtained by...... solubilization of the lamellae in phenol/acetic acid/8 M urea. Feeding barley seedlings with [14C]-biotin revealed that the vitamin is not degraded into respiratory substrates by the plant, but is specifically incorporated into biotin carboxyl carrier protein....

  4. Barley coleoptile peroxidases. Purification, molecular cloning, and induction by pathogens

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Bloch, H.; Rasmussen, Søren Kjærsgård


    A cDNA clone encoding the Prx7 peroxidase from barley (Hordeum vulgare L.) predicted a 341-amino acid protein with a molecular weight of 36,515. N- and C-terminal putative signal peptides were present, suggesting a vacuolar location of the peroxidase. Immunoblotting and reverse-transcriptase poly......A cDNA clone encoding the Prx7 peroxidase from barley (Hordeum vulgare L.) predicted a 341-amino acid protein with a molecular weight of 36,515. N- and C-terminal putative signal peptides were present, suggesting a vacuolar location of the peroxidase. Immunoblotting and reverse...


    DEFF Research Database (Denmark)

    Buchmann, N. B.


    An in vitro method for measuring barley protein digestibility is presented. Samples were first incubated with pepsin in HCl; pancreatin was then added concomitantly with a bacteriostatic borate buffer. After TCA-precipitation, soluble nitrogen was measured. The digestion was unaffected by......, the field-grown barleys per se differed too little for the accuracy to be confirmed. The other cereals tested, oats, rye, maize, wheat, and rice, gave unsatisfactory results with pepsin/pancreatin, and also with pepsin, pancreatin, or pronase used separately. The ranking of the cereals according to in...

  6. TOTAL IMPORTS AND IMPORT PATTERNS OF BARLEY INTO JAPAN: Implications of the 1988 Japanese Beef Market Access Agreement


    Lin, Biing-Hwan; Makus, Larry D.


    A two-stage budgeting procedure was employed to analyze (1) the Japanese import demand for barley and (2) allocation of Japanese barley imports between North America (Canada and the United States) and Australia. It was found that the import demand for barley was price inelastic and corn was a substitute for barley. Japanese barley imports were also influenced by size of the cattle herd and the number of cattle slaughtered. Price competition played a significant role in import allocation and b...

  7. [Influence of breads with use of barley, buckwheat and oat flours and barley flakes on postprandial glycaemia in patients with type 2 diabetes mellitus]. (United States)

    Sharafetdinov, Kh Kh; Gapparov, M M; Plotnikova, O A; Zykina, V V; Shlelenko, L A; Tiurina, O E; Rabotkin, Iu V


    It was investigated the influence of breads with use of barley, buckwheat and oat flours and barley flakes on postprandial glycaemia in patients with type 2 diabetes mellitus. It was shown that consumption of breads with use of barley and buckwheat flours is accompanied less marked postprandial glycaemic reaction in compared with standard loading of carbohydrates (wheat bread). Also it was noted greater increase of postprandial glycaemia in consumption of bread with use of barley flakes in compared with consumption of wheat bread inclusive equivalent amount of carbohydrates. PMID:19999818

  8. Synthesis of SP II albumin, β-amylase and chymotrypsin inhibitor CI-1 on polysomes from the endoplasmic reticulum of barley endosperm

    International Nuclear Information System (INIS)

    Free and initially membrane bound polysomes were isolated from 20 day old endosperms of Bomi and Hiproly barley and used as templates in an in vitro protein synthesizing system based on wheat germ extract. Three 35S--labelled translation products were identified as SP II albumin, β-amylase and chymotrypsin inhibitor CI-1 among the polypeptides synthesized by the polysomes of the endoplasmic reticulum. Identification employed immunoaffinity isolation. Protein Z was not detectable among the in vitro translation products of either initially membrane bound or free endosperm polysomes. Compared to Bomi barley the Hiproly endosperm is enriched for translatable mRNA coding SP II albumin, β-amylase and chymotrypsin inhibitor CI-1. In vitro and in vivo synthesized β-amylases have identical molecular weights. Only one form of SP II albumin is produced in vitro, confirming that the lower molecular weight SP II B albumin is a proteolytic cleavage product of the SP II A albumin. (author)

  9. Giemsa C-banding of Barley Chromosomes. IV. Chromosomal Constitution of Autotetraploid Barley

    DEFF Research Database (Denmark)

    Linde-Laursen, Ib


    homologues of each of the chromosomes. The aneuploid C2--seedlings were fairly equally distributed on hypo-and hyperploids, and on the seven chromosome groups. This suggests that a particular chromosome is lost or gained at random in gametes and embryos. The 11 C3--seedlings comprised seven true euploids......The progeny of an autotetraploid barley plant (C1) consisted of 45 tetraploids and 33 aneuploids. Giemsa C-banding was used to identify each of the chromosomes in 20 euploid and 31 aneuploid C2--seedlings, and in 11 C3--offspring of aneuploid C2--plants. The euploid C2--seedlings all had four......, one seedling with 2n=28 having an extra chromosome 6 and missing one chromosome 3, and three seedlings with 2n=29. The chromosomal composition of aneuploid C3--seedlings did not reflect that of their aneuploid C2--parents with respect to missing or extra chromosomes. Two hypohexaploid C2--seedlings...

  10. Identifying and characterizing barley genes that protect against trichothecene mycotoxins (United States)

    Fusarium head blight of wheat and barley, caused by the fungal pathogen Fusarium graminearum, is a major disease problem around the world. During infection, trichothecene mycotoxins are produced and act as virulence factors, resulting in reduced grain yield and quality. There are two types of tricho...

  11. Physiological tests for drought tolerance in barley and durum wheat

    International Nuclear Information System (INIS)

    Physiological tests for characterizing drought tolerance in barley (H. vulgare L.) and durum wheat (T. durum L.) were evaluated. These tests involved: 1) germination in osmotic solution (-13 atm by d-mannitol); 2) thermal stress on seedlings (42 deg. C for 5 hours); 3) stability of the cellular membrane under osmotic stress (PEG 6000 at 43%). For both species genotypic variability which was associated with drought tolerance in the field was identified by the laboratory evaluation techniques. Based on these procedures, the two-row barley types were more drought tolerant than six-row types. In durum wheat, only some local populations and some varieties, bred in drought environments, showed high laboratory test values. Weak and not significant correlations were found between the physiological tests indicating that the genetic mechanisms which control these traits may be independent and process-specific. Yield trials, in barley, have been carried out in environments with drought conditions and the correlation between grain and physiological tests were significant. Of the three procedures evaluated in this study, the dry matter increase after a period of thermal stress and electrolyte leakage seemed to be most reliable and potentially useful for screening for drought tolerance in barley and durum wheat. (author). 13 refs, 6 tabs

  12. Modelling phytate degradation kinetics in soaked wheat and barley

    DEFF Research Database (Denmark)

    Blaabjerg, Karoline; Strathe, A B; Poulsen, Hanne Damgaard


    or Phytase 2 had no effect on the degradation of phytate. The F0 was greater in the heat-treated barley compared with the heat-treated wheat (0.19 vs. 0.14; P=0.02; Phytase 1). Heat-treatment of the cereals increased the F0 from 0.05 to 0.15 (P=0.0007; Phytase 2). The K was lower in the non-heat-treated...... wheat compared with the non-heat-treated barley (averaging 23.3 vs. 43.5 h), whereas K was higher in the wheat compared with the barley (averaging 12.3 vs. 11.1 h; P=0.02 and P=0.006; Phytase 1 and Phytase 2) when the cereals were heat-treated. In conclusion, the GMM function is a suitable model for......The objective of this study was to identify an appropriate mathematical function describing the in vitro phytate degradation profile of soaked wheat or barley (20 °C; 1 cereal: 2.75 water (w/w)) as affected by heat-treatment (stem pelleting at 90 °C) and phytase addition (Phytase 1: 0, 250, 500...

  13. Wheat and barley exposure to nanoceria: Implications for agricultural productivity (United States)

    The impacts of man-made nanomaterials on agricultural productivity are not yet well understood. A soil microcosm study was performed to assess the physiological, phenological, and yield responses of wheat (Triticum aestivum) and barley (Hordeum vulgare L.) exposed to nanoceria (n...

  14. 7 CFR 457.118 - Malting barley crop insurance. (United States)


    ... accordance with 7 CFR part 400, subpart G. (b) Approved malting variety. A variety of barley specified as... and Drug Administration when determining concentrations of mycotoxins or other substances or... organization of the United States for substances or conditions, including mycotoxins, that are identified...

  15. Variation in In Vitro Digestibility of Barley Protein

    DEFF Research Database (Denmark)

    Buchmann, N. B.


    In vitro digestibility of protein was measured with pepsin/pancreatin in 321 spring barley lines grown in the field. The variation in digestibility was far less than the variation in the protein content. A small environmental influence on the digestibility was found. Two entries had slightly...

  16. Semidwarf, high yielding and high protein mutants in barley

    International Nuclear Information System (INIS)

    An induced mutations programme was undertaken in barley (Hordeum vulgare L.) with the primary objective of developing some semidwarf, short duration, high yielding types as most of the local cultivars grown in Meerut are tall statured with maturity period of 130-140 days. In recent years, the barley crop in this region, particularly at flowering/grain filling stages during February/March, has often been affected by unexpected rains accompanied by gusty winds, resulting in severe lodging of the crop and thereby reduction in crop yields. To combat this problem it is necessary to develop short statured types of barley, which can withstand lodging. If such types are associated with early maturity, that will be of greater help. Dry seeds of three local cultivars of barley 'K-169', 'K-272' and 'DL-281' were irradiated with gamma rays at 100; 200; 300 and 400 Gy. A number of morphological mutants for different plant characters like plant height (dwarfs and semidwarfs), maturity period (early and late maturing), spike density and size (lax panicled and erectoides), high tillering and chlorophyll deficiency (virescent) types were isolated from M2 mutated populations of the three varieties. Among these mutants, one semidwarf mutant (No. 3-20-5) of parent cultivar K-169 is of particular interest because of increased yield and significantly high protein content, besides the short stature

  17. Molecular analysis of genome instability in barley (Hordeum vulgare)

    International Nuclear Information System (INIS)

    A reliable protocol for regenerating barley from seedling explants, including leaf bases with a complete apical meristem, has been developed at the Institute of Genetic Engineering. The system was established with Bulgarian barley cultivars (Ruen, Karnobat, Obzor and Yubilei) and reconstructed genotypes (K. Gecheff IG). Pretreatment of the mature embryos with a high concentration of 2.4D generated valuable and stable genetic deviations in the regenerants. The brewery cultivar Ruen was selected as the model genotype. It has been demonstrated that genetic variations, such as higher yield, earlier maturation and lower protein content, have been induced and maintained for 5 years. Comparative experiments, including treatment of barley mature seeds with 60Co gamma rays (10 and 20 krad) and sodium azide (1.10-3 M and 5 x 10-4 M), were also carried out. The results obtained showed that both treatments stimulated calusogenesis and regeneration of the plants. Molecular markers such as proteins, restriction fragment length polymorphisms (RFLPs) and random amplified polymorphic DNAs (RAPDs) were applied in studies on the mutagenic effects of 2.4D, gamma rays and sodium azide, and a combination threof, on the quality and quantity of the genetic diversification generated in tissue culture of the Bulgarian barley cultivars Ruen, Karnobat, Obzor and Yubilei and the reconstructed genotypes

  18. Protein composition of malting barley varieties required in brewing industry

    Czech Academy of Sciences Publication Activity Database

    Flodrová, Dana; Benkovská, Dagmar; Bobálová, Janette

    Berlin : Freie Universität Berlin, 2011. s. 354. [Proteomic Forum 2011. 03.04.2011-07.04.2011, Berlin] R&D Projects: GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : barley * varieties * proteins Subject RIV: CB - Analytical Chemistry, Separation

  19. The Role of alpha-Glucosidase in Germinating Barley Grains

    DEFF Research Database (Denmark)

    Stanley, Duncan; Rejzek, Martin; Næsted, Henrik;


    chemical-genetic and reverse-genetic approaches. We identified iminosugar inhibitors of a recombinant form of an alpha-glucosidase previously discovered in barley endosperm (ALPHA-GLUCOSIDASE97 [HvAGL97]), and applied four of them to germinating grains. All four decreased the Glc-to-maltose ratio in the...

  20. Aspects of the barley seed proteome during development and germination

    DEFF Research Database (Denmark)

    Finnie, Christine; Maeda, K.; Østergaard, O.;


    Analysis of the water-soluble barley seed proteome has led to the identification of proteins by MS in the major spots on two-dimensional gels covering the pi ranges 4-7 and 6-11. This provides the basis for in-depth studies of proteome changes during seed development and germination, tissue...

  1. Zinc biofortification of cereals: rice differs from wheat and barley

    NARCIS (Netherlands)

    Stomph, T.J.; Jiang, W.; Struik, P.C.


    In their review, mainly focused on bread wheat (Triticum aestivum), durum wheat (Triticum durum) and barley (Hordeum vulgare), Palmgren et al. 1 M.G. Palmgren et al., Zinc biofortification of cereals: problems and solutions, Trends Plant Sci. 13 (2008), pp. 464–473. Article | PDF (905 K) | View Reco


    DEFF Research Database (Denmark)

    Buchmann, N. B.


    An in vitro method for measuring barley protein digestibility is presented. Samples were first incubated with pepsin in HCl; pancreatin was then added concomitantly with a bacteriostatic borate buffer. After TCA-precipitation, soluble nitrogen was measured. The digestion was unaffected by...

  3. Wheat and barley seed systems in Ethiopia and Syria

    NARCIS (Netherlands)

    Bishaw, Z.


    Keywords: Wheat,Triticumspp., Barley,Hordeumvulgare L., Seed Systems, Formal Seed Sector, Informal Seed Sector, National Seed Program, Seed Source, Seed Selection, Seed Management, Seed Quality,

  4. Analysis of Pregerminated Barley Using Hyperspectral Image Analysis

    DEFF Research Database (Denmark)

    Arngren, Morten; Hansen, Per Waaben; Eriksen, Birger;


    is based on more than 750 Rosalina barley kernels being pregerminated at 8 different durations between 0 and 60 h based on the BRF method. Regerminating the kernels reveals a grouping of the pregerminated kernels into three categories: normal, delayed and limited germination. Our model employs a...

  5. Wheat and barley differently affect porcine intestinal microbiota

    DEFF Research Database (Denmark)

    Weiss, Eva; Aumiller, Tobias; Spindler, Hanns K;


    Diet influences the porcine intestinal microbial ecosystem. Barrows were fitted with ileal T-cannulas to compare short-term effects of eight different wheat or barley genotypes and period-to-period effects on seven bacterial groups in ileal digesta and faeces by qPCR. Within genotypes of wheat an...

  6. Expression of Barley Endopeptidase B in Trichoderma reesei


    Saarelainen, R.; Mantyla, A.; Nevalainen, H.; Suominen, P.


    The gene for barley endopeptidase B (EPB) has been expressed in the filamentous fungus Trichoderma reesei from the cbh1 promoter. The EPB signal sequence allowed secretion of over 90% of the recombinant protein. Yields reached about 500 mg of immunoreactive protein per liter and exceeded values for any other protein derived from a higher eukaryotic organism produced in T. reesei.

  7. 2012 North Dakota Transgenic Barley FHB Nursery Report (United States)

    The 2012 North Dakota transgenic field trials consisted of 23 barley lines, tested in three misted and three non-misted replicates. Plots were sown on May 9, 2012 in hill plots with 10 seed per hill spaced at 30 cm, and all plots were inoculated using the grain spawn method at heading. Lines include...

  8. Identifying root system genes using induced mutants in barley

    International Nuclear Information System (INIS)

    Root systems play an important role in plant growth and development. They absorb water and nutrients, anchor plant in the soil and affect plant tolerance to various abiotic stresses. Despite their importance, the progress in understanding the molecular processes underlying root development has been achieved only in Arabidopsis thaliana. It was accomplished through detailed analysis of root mutants with the use of advanced molecular, genomic and bioinformatic tools. Recently, similar studies performed with rice and maize root mutants have led to the identification of homologous and novel genes controlling root system formation in monocots. The collection of barley mutants with changes in root system development and morphology has been developed in our Department after mutagenic treatments of spring barley varieties with N-methyl N-nitosourea (MNU) and sodium azide. Among these mutants, the majority was characterized by seminal roots significantly shorter than roots of a parent variety throughout a whole vegetation period. Additionally, several mutants with root hairs impaired at different stages of development have been identified. These mutants have become the material of studies aimed at genetic and molecular dissection of seminal root and root hair formation in barley. The studies included the molecular mapping of genes responsible for mutant phenotype using DNA markers and root transcriptome analysis in the mutant/parent variety system. Using cDNA RDA approach, we have identified the HvEXPB1 gene encoding root specific beta expansin related to the root hair initiation in barley. We have also initiated the database search for barley sequences homologous to the known Arabodopsis, maize and rice genes. The identified homologous ESTs are now used for isolation of the complete coding sequences and gene function will be validated through identification of mutations related to the altered phenotype. This work was supported by the IAEA Research Contracts 12611 and 12849

  9. iTAG Barley: A 9-12 classroom module to explore gene expression and segregation using Oregon Wolfe Barley (United States)

    The Oregon Wolfe Barleys (OWBs) are a model resource for genetics research and instruction ( ; The population of 94 doubled haploid lines was developed from an F1 of a cross between dominant and reces...

  10. iTAG Barley: A 9-12 curriculum to explore inheritance of traits and genes using Oregon Wolfe barley (United States)

    Segregating plants from the Informative & Spectacular Subset (ISS) of the Oregon Wolfe doubled haploid barley (OWB) population are easily grown on a lighted window bench in the classroom. These lines originate from a wide cross and have exceptionally diverse and dramatic phenotypes, making this an i...

  11. Luteibacter rhizovicinus MIMR1 promotes root development in barley (Hordeum vulgare L.) under laboratory conditions. (United States)

    Guglielmetti, Simone; Basilico, Roberto; Taverniti, Valentina; Arioli, Stefania; Piagnani, Claudia; Bernacchi, Andrea


    In order to preserve environmental quality, alternative strategies to chemical-intensive agriculture are strongly needed. In this study, we characterized in vitro the potential plant growth promoting (PGP) properties of a gamma-proteobacterium, named MIMR1, originally isolated from apple shoots in micropropagation. The analysis of the 16S rRNA gene sequence allowed the taxonomic identification of MIMR1 as Luteibacter rhizovicinus. The PGP properties of MIMR1 were compared to Pseudomonas chlororaphis subsp. aurantiaca DSM 19603(T), which was selected as a reference PGP bacterium. By means of in vitro experiments, we showed that L. rhizovicinus MIMR1 and P. chlororaphis DSM 19603(T) have the ability to produce molecules able to chelate ferric ions and solubilize monocalcium phosphate. On the contrary, both strains were apparently unable to solubilize tricalcium phosphate. Furthermore, the ability to produce 3-indol acetic acid by MIMR1 was approximately three times higher than that of DSM 19603(T). By using fluorescent recombinants of strains MIMR1 and DSM 19603(T), we also demonstrated that both bacteria are able to abundantly proliferate and colonize the barley rhizosphere, preferentially localizing on root tips and in the rhizoplane. Finally, we observed a negative effect of DSM 19603(T) on barley seed germination and plant growth, whereas MIMR1, compared to the control, determined a significant increase of the weight of aerial part (+22 %), and the weight and length of roots (+53 and +32 %, respectively). The results obtained in this work make L. rhizovicinus MIMR1 a good candidate for possible use in the formulation of bio-fertilizers. PMID:23653264

  12. Cloning and molecular characterization of a flavin-dependent oxidoreductase gene from barley. (United States)

    Al-Momany, Bayan; Abu-Romman, Saeid


    Oxophytodienoate reductases (OPRs) are a small group of flavin-dependent oxidoreductases in plants. In this study, a new member of the OPR gene family (HvOPR2) was cloned from barley (Hordeum vulgare L.) using reverse transcription polymerase chain reaction (RT-PCR). The full-length cDNA of HvOPR2 was 1,206 bp with an open reading frame of 1,101 bp, encoding a 366 amino acids long polypeptide with a predicted molecular weight of 40.52 and a theoretical isoelectric point of 6.21. The corresponding genomic clone of HvOPR2 was isolated using the PCR amplification technique and was found to consist of five exons and four introns. Bioinformatic analysis revealed that the deduced HvOPR2 has a considerable homology with other plant OPRs and possessed the flavin oxidoreductase/NADH oxidase substrate-binding domain. Phylogenetic analysis showed that HvOPR2 codes for the OPR of subgroup I, which contains enzymes that are not required for jasmonic acid biosynthesis. Time-course transcriptional profiling of HvOPR2 was analyzed in response to a variety of abiotic stresses and hormonal treatments by semi-quantitative RT-PCR. The HvOPR2 gene was induced in response to drought, hydrogen peroxide, and wounding. Moreover, the corresponding mRNA transcripts were increased in response to jasmonic acid and salicylic acid, but not in response to abscisic acid. These results strongly suggested a role for HvOPR2 in barley defense/response to abiotic stresses and signaling molecules. PMID:24961571

  13. Epigenome Editing of Potato by Grafting Using Transgenic Tobacco as siRNA Donor. (United States)

    Kasai, Atsushi; Bai, Songling; Hojo, Hatsune; Harada, Takeo


    In plants, it is possible to induce heritable transcriptional gene silencing (TGS) via RNA-directed DNA methylation (RdDM) using artificially synthesized small RNA (siRNA) homologous to the 5'-flanking region of the target gene. As the siRNA signal with a specific RNA determinant moves through plasmodesmata and sieve elements, we attempted to induce TGS of a transgene and an endogenous gene of potato (Solanum tuberosum) rootstock by grafting using siRNA produced in a tobacco (Nicotiana benthamiana) scion. Our results provide evidence that this system can induce TGS of target genes in tubers formed on potato rootstock. The TGS is maintained in the progeny tubers lacking the transported siRNAs. Our findings reveal that epigenome editing using mobile RNA has the potential to allow breeding of artificial sport cultivars in vegetative propagation crops. PMID:27564864

  14. Direct RNA sequencing mediated identification of mRNA localized in protrusions of human MDA-MB-231 metastatic breast cancer cells

    DEFF Research Database (Denmark)

    Jakobsen, Kristine Raaby; Sørensen, Emilie; Brøndum, Karin Kathrine;


    To describe genome wide RNA localized in protrusions of the metastatic human breast cancer cell line MDA-MB-231 we used Boyden chamber based methodology followed by direct mRNA sequencing. Results In the hereby identified group of protrusion localized mRNA some previously were described to be...... localized exemplified by mRNA for Ras-Related protein 13 (RAB13) and p0071 (Plakophilin-4/PKP4). For other transcripts, exemplified by mRNA for SH3PXD2A/TKS5 and PPFIA1/Liprin-α1, only the corresponding proteins previously were described to have protrusion localization. Finally, a cohort of MDA-MB-231...... protrusion localized transcripts represents novel candidates to mediate cancer cell subcellular region specific functions through mRNA direction to protrusions. We included a further characterization of p0071, an armadillo repeat protein of adherence junctions and desmosomes, in MDA-MB-231 and non...

  15. Analysis of enzyme production by submerged culture of Aspergillus oryzae using whole barley. (United States)

    Masuda, Susumu; Kikuchi, Kaori; Matsumoto, Yuko; Sugimoto, Toshikazu; Shoji, Hiroshi; Tanabe, Masayuki


    We have reported on high enzyme production by submerged culture of Aspergillus kawachii using barley with the husk (whole barley). To elucidate the mechanism underlying this high enzyme production, we performed a detailed analysis. Aspergillus oryzae RIB40 was submerged-cultured using whole barley and milled whole barley. Enzyme production was analyzed in terms of changes in medium components and gene expression levels. When whole barley was used, high production of glucoamylase and alpha-amylase and high gene expression levels of these enzymes were observed. Low ammonium concentrations were maintained with nitrate ion uptake continuing into the late stage using whole barley. These findings suggest that the sustainability of nitrogen metabolism is related to high enzyme production, and that a mechanism other than that associated with the conventional amylase expression system is involved in this relationship. PMID:19809198

  16. Long-term reconstitution of dry barley increased phosphorus digestibility in pigs

    DEFF Research Database (Denmark)

    Ton Nu, Mai Anh; Blaabjerg, Karoline; Poulsen, Hanne Damgaard

    Introduction: Cereals are normally stored dry at low moisture content (< 14%) to maintain grain quality. The hypothesis is that reconstitution of grain with water activates the endogenous enzymes and makes grain nutrients more soluble and digestible. The objective is to investigate the effect of...... reconstitution compared to dry stored barley on phosphorus (P) digestibility in pigs. Materials and Methods: Dry barley (13% moisture; phytate P, 1.7 g/kg DM) was rolled and stored directly or reconstituted with water to produce rolled barley with 35% moisture that was stored in air-tight conditions. After 49......: Reconstituted barley had higher soluble P (2.56 g/kg DM) and lower phytate P (0.93 g/ kg DM) compared with dry barley (0.78 and 1.7 g/kg DM, respectively). Pigs fed the reconstituted barley diet showed increased P absorption (52%) and decreased P excretion in feces (21%) (P<0.001). Reconstitution increased P...

  17. A Dicer-independent miRNA biogenesis pathway that requires Ago catalysis


    Cheloufi, Sihem; dos Santos, Camila O.; Chong, Mark M.W.; Hannon, Gregory J.


    The nucleolytic activity of animal Argonaute proteins is deeply conserved, despite its having no obvious role in microRNA-directed gene regulation. In mice, Ago2 (also known as Eif2c2) is uniquely required for viability, and only this family member retains catalytic competence. To investigate the evolutionary pressure to conserve Argonaute enzymatic activity, we engineered a mouse with catalytically inactive Ago2 alleles. Homozygous mutants died shortly after birth with an obvious anaemia. Ex...

  18. Effect of barley-legume intercrop on disease frequency in an organic farming system


    Kinane, Dr. J.; Lyngkjær, Dr. M.


    The effect of barley-legume intercrop in an organic farming system on disease incidence was investigated. The legumes were lupin, faba bean and pea. Diseases were detected on pea and barley. On pea, only ascochyta blight (Ascochyta pisi) was observed. When either pea variety was intercropped with barley, the level of ascochyta blight was reduced. Net blotch (Pyrenophora teres), brown rust (Puccinia recondita) and powdery mildew (Blumeria graminis f. sp. hordei) (in order of incidence) were mo...

  19. Effects of a Dietary Supplement with Barley Sprout Extract on Blood Cholesterol Metabolism


    A Ri Byun; Hyejin Chun; Jin Lee; Sang Wha Lee; Hong Soo Lee; Kyung Won Shim


    Objective. Barley sprout (Hordeum vulgare L.) contains 4.97% fat, 52.6% polysaccharide, and 34.1% protein along with a variety of vitamins, minerals, and polyphenolic compounds. Hexacosanol is one such compound from the barley leaf that might improve cholesterol metabolism by decreasing cholesterol synthesis. Method. Therefore, this study was conducted to investigate the effects of barley sprout extract on serum lipid metabolism in healthy volunteers (n = 51). Subjects were randomly divided i...

  20. Molecular Phylogeography of Domesticated Barley Traces Expansion of Agriculture in the Old World


    Saisho, Daisuke; Purugganan, Michael D.


    Barley (Hordeum vulgare ssp. vulgare) was first cultivated 10,500 years ago in the Fertile Crescent and is one of the founder crops of Eurasian agriculture. Phylogeographic analysis of five nuclear loci and morphological assessment of two traits in >250 domesticated barley accessions reveal that landraces found in South and East Asia are genetically distinct from those in Europe and North Africa. A Bayesian population structure assessment method indicates that barley accessions are subdivided...

  1. Rhizoctonia cerealis anastomosis group GAG-1, the common pathogen of wheat, barley and sugar beet


    Helena Furgał-Węgrzycka; Jan Adamiak; Ewa Adamiak


    Isuluies of Rhizoctonia cerealis anastomosis group GAG-1 were obtained from sharp eyespot lesions on wheat and on barley culms and from diseased sugar beet seedlings. Isolates of R. cerealis were collected from a fields with crop rotation experiments: sugar beet-spring wheat-winter barley. In pathogenicity tests isolates of R. cerealis from sugar beet seedlings and from sharp eyespot lesions on wheat and barley were pathogenic to these crops. Isolates of R. cerealis from sharp eyespot lesions...

  2. Cultivar and Environmental Variation of β-glucan Content in Chinese Barleys

    Institute of Scientific and Technical Information of China (English)

    CHEN Jin-xin; Zhang Guo-ping; QIANG Xiao-lin; WANG Jun-mei; DING Shou-ren


    β-glucan is a polysaccharide compound closely related to the quality of barley used as malting,feed and food. Low β-glucan content is expected for brewing and feed barley, while high β-glucan content is desirable for food barley. The β-glucan content of barley genotypes collected from various areas of China as well as from Canada and Australia were assayed. Meanwhile a multi-locations trial was conducted to determineβ-glucan content of 10 barley cultivars in 8 locations for two successive planting years. The results showed that barley genotypes from Tibet and Xinjiang had higher β-glucan content and the genotypes with higher than 8%of β-glucan content were detected in Tibet barleys, being valuable for use in the development of healthy food.Barley cultivars being planted now in winter-sowing areas of China had basically the same β-glucan content as those from Canada and Australia. Barley seeds produced in Hangzhou had lower β-glucan content than seeds from the original areas. There was a highly significant difference in β-glucan content among 10 barleys, 8locations and between years. On an average of two years, Xiumei 3 and Kongpei 1 had the highest and lowestβ-glucan content, respectively, and Taian and Hangzhou produced the highest and lowest β-glucan content barley seeds, respectively. Analysis of AMMI model showed that interaction effect between cultivar and environment was highly significant in both experimental years, and was dependent on cuitivar, suggesting that it is important to plant the suitable cultivars in a particular area in order to obtain barley seeds with reasonableβ-glucan content.

  3. Dynamics of phosphorus compounds in ripening and germinating cereal grains. Part I. Changes in phosphorus compounds content during ripening of wheat, barley and rye grains

    Directory of Open Access Journals (Sweden)

    J. Tłuczkiewicz


    Full Text Available The dynamics of phosphorus compounds was followed in ripening wheat (Grana, barley (Kosmos and rye (Pancerne seeds. In the investigated ontogenesis period the content in the seeds of total and acid-soluble phosphorus doubled. The phosphorus of free phytin and phytin that bound with proteins increased to the end of maturation. In dormant seeds the contribution of phosphorus bound with phytin was 62-70 per cent of total P. As the seeds ripened, the content of inorganic and nucleotides-P decreased, while that of saccharides-P and their metabolites started to decrease from the moment of wax ripeness. Later RNA-P and DNA-P level decreased only and that of lipids-P markedly. Phosphoproteid content diminished at the beginning of ripening and further remained at almost the same level. Wheat, barley and rye seed exhibited similar dynamics of metabolically active (nucleotides, saccharide-P esters and their metabolites, functional (nucleic acids and structural (phospholipids phosphorus compounds. Accumulation of storage forms (phytin of phosphorus was higher in wheat and successively lower in rye and barley.

  4. Barley Sprouts Extract Attenuates Alcoholic Fatty Liver Injury in Mice by Reducing Inflammatory Response (United States)

    Lee, Yun-Hee; Kim, Joung-Hee; Kim, Sou Hyun; Oh, Ji Youn; Seo, Woo Duck; Kim, Kyung-Mi; Jung, Jae-Chul; Jung, Young-Suk


    It has been reported that barley leaves possess beneficial properties such as antioxidant, hypolipidemic, antidepressant, and antidiabetic. Interestingly, barley sprouts contain a high content of saponarin, which showed both anti-inflammatory and antioxidant activities. In this study, we evaluated the effect of barley sprouts on alcohol-induced liver injury mediated by inflammation and oxidative stress. Raw barley sprouts were extracted, and quantitative and qualitative analyses of its components were performed. The mice were fed a liquid alcohol diet with or without barley sprouts for four weeks. Lipopolysaccharide (LPS)-stimulated RAW 264.7 cells were used to study the effect of barley sprouts on inflammation. Alcohol intake for four weeks caused liver injury, evidenced by an increase in serum alanine aminotransferase and aspartate aminotransferase activities and tumor necrosis factor (TNF)-α levels. The accumulation of lipid in the liver was also significantly induced, whereas the glutathione (GSH) level was reduced. Moreover, the inflammation-related gene expression was dramatically increased. All these alcohol-induced changes were effectively prevented by barley sprouts treatment. In particular, pretreatment with barley sprouts significantly blocked inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2 expression in LPS-stimulated RAW 264.7. This study suggests that the protective effect of barley sprouts against alcohol-induced liver injury is potentially attributable to its inhibition of the inflammatory response induced by alcohol. PMID:27455313

  5. Genotypic and Environmental Variations of Arabinoxylan Content and Endoxylanase Activity in Barley Grains

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xiao-qin; XUE Da-wei; WU Fei-bo; ZHANG Guo-ping


    Arabinoxylan (AX) content in barley grains is an important quality determinant when barley is used as raw material of malt or beer production. The cultivar and environmental variations of total arabinoxylan (TAX), water extractable arabinoxylan (WEAX) and endoxylanase activity (EA) were investigated using eight barley cultivars growing at seven locations with diverse environmental conditions. The results showed that both barley cultivar and location significantly affected the TAX, WEAX and EA levels, but the variations of TAX content and EA were mainly attributed to cultivar, while the impact of location on WEAX content was greater than that of cultivar. Correlation analysis indicated that TAX was significantly correlated to WUAX.

  6. Archaeogenetic evidence of ancient nubian barley evolution from six to two-row indicates local adaptation.

    Directory of Open Access Journals (Sweden)

    Sarah A Palmer

    Full Text Available BACKGROUND: Archaeobotanical samples of barley (Hordeum vulgare L. found at Qasr Ibrim display a two-row phenotype that is unique to the region of archaeological sites upriver of the first cataract of the Nile, characterised by the development of distinctive lateral bracts. The phenotype occurs throughout all strata at Qasr Ibrim, which range in age from 3000 to a few hundred years. METHODOLOGY AND FINDINGS: We extracted ancient DNA from barley samples from the entire range of occupancy of the site, and studied the Vrs1 gene responsible for row number in extant barley. Surprisingly, we found a discord between the genotype and phenotype in all samples; all the barley had a genotype consistent with the six-row condition. These results indicate a six-row ancestry for the Qasr Ibrim barley, followed by a reassertion of the two-row condition. Modelling demonstrates that this sequence of evolutionary events requires a strong selection pressure. CONCLUSIONS: The two-row phenotype at Qasr Ibrim is caused by a different mechanism to that in extant barley. The strength of selection required for this mechanism to prevail indicates that the barley became locally adapted in the region in response to a local selection pressure. The consistency of the genotype/phenotype discord over time supports a scenario of adoption of this barley type by successive cultures, rather than the importation of new barley varieties associated with individual cultures.

  7. Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    Directory of Open Access Journals (Sweden)

    Nilsson Lena


    Full Text Available Abstract Background Gene silencing vectors based on Barley stripe mosaic virus (BSMV are used extensively in cereals to study gene function, but nearly all studies have been limited to genes expressed in leaves of barley and wheat. However since many important aspects of plant biology are based on root-expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species have created a need for tools to study gene function in these species. Results Here we demonstrate the successful BSMV-mediated virus induced gene silencing (VIGS of three different genes in barley roots, i.e. the barley homologues of the IPS1, PHR1, and PHO2 genes known to participate in Pi uptake and reallocation in Arabidopsis. Attempts to silence two other genes, the Pi transporter gene HvPht1;1 and the endo-β-1,4-glucanase gene HvCel1, in barley roots were unsuccessful, probably due to instability of the plant gene inserts in the viral vector. In B. distachyon leaves, significant silencing of the PHYTOENE DESATURASE (BdPDS gene was obtained as shown by photobleaching as well as quantitative RT-PCR analysis. On the other hand, only very limited silencing of the oat AsPDS gene was observed in both hexaploid (A. sativa and diploid (A. strigosa oat. Finally, two modifications of the BSMV vector are presented, allowing ligation-free cloning of DNA fragments into the BSMV-γ component. Conclusions Our results show that BSMV can be used as a vector for gene silencing in barley roots and in B. distachyon leaves and possibly roots, opening up possibilities for using VIGS to study cereal root biology and to exploit the wealth of genome information in the new cereal model plant B. distachyon. On the other hand, the silencing induced by BSMV in oat seemed too

  8. Study of fluorescence quenching of Barley α-amylase (United States)

    Bakkialakshmi, S.; Shanthi, B.; Bhuvanapriya, T.


    The fluorescence quenching of Barley α-amylase by acrylamide and succinimide has been studied in water using steady-state and time-resolved fluorescence techniques. The steady-state fluorescence quenching technique has been performed in three different pHs (i.e., 6, 7 and 8) of water. Ground state and excited state binding constants (Kg &Ke) have been calculated. From the calculated binding constants (Kg &Ke) the free energy changes for the ground (ΔGg) and excited (ΔGe) states have been calculated and are presented in tables. UV and FTIR spectra have also been recorded to prove the binding of Barley α-amylase with acrylamide and succinimide.

  9. Suppression of Zn stress on barley by irradiated chitosan

    International Nuclear Information System (INIS)

    Chitosan was irradiated up to 1000 kGy in solid state. Irradiation of chitosan caused the reduction of molecular weight. The molecular weight of the chitosan reduced from ca. 4 x 105 to ca. 6 x 103 by irradiation at 1000 kGy. For the barley growth promotion, irradiated chitosan showed the significant effect and 1000 kGy irradiated chitosan improved 20% of growth. Using the positron emitting tracer imaging system (PETIS), the effect of chitosan on uptake and transportation of 62Zn in barley were investigated. It was found that the transportation of Zn from root to shoot and the damage of plant by Zn were suppressed with irradiated chitosan. (author)

  10. Suppression of Zn stress on barley by irradiated chitosan

    Energy Technology Data Exchange (ETDEWEB)

    Nagasawa, N.; Mitomo, H. [Gunma Univ., Faculty of Engineering, Department of Biological and Chemical Engineering, Kiryu, Gunma (Japan); Ha, P.T.L. [Nuclear Research Institute, Dalat (Viet Nam); Watanabe, S.; Ito, T.; Takeshita, H.; Yoshii, F.; Kume, T. [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment


    Chitosan was irradiated up to 1000 kGy in solid state. Irradiation of chitosan caused the reduction of molecular weight. The molecular weight of the chitosan reduced from ca. 4 x 10{sup 5} to ca. 6 x 10{sup 3} by irradiation at 1000 kGy. For the barley growth promotion, irradiated chitosan showed the significant effect and 1000 kGy irradiated chitosan improved 20% of growth. Using the positron emitting tracer imaging system (PETIS), the effect of chitosan on uptake and transportation of {sup 62}Zn in barley were investigated. It was found that the transportation of Zn from root to shoot and the damage of plant by Zn were suppressed with irradiated chitosan. (author)

  11. Low GI Food with Barley in Space Foods (United States)

    Katayama, Naomi; Sugimoto, Manabu; Hashimoto, Hirofumi; Kihara, Makoto; Yamashita, Masamichi; Space Agriculture Task Force

    The construction of the life-support system to perform space, moon base, Mars emigration is demanded. The space foods will play a very important role of life support on this occasion. Particularly, in environment of the microgravity, our metabolism becomes less than the face of the Earth. The management of the blood sugar level is very important. We need to eat the meal which will be rise in blood sugar level slowly. The barley which includes much water-soluble dietary fibers is helpful to make low GI space food. After eating 30% barley with unpolished rice, blood sugar level was rise slowly. The cooking process is very important to our body in thinking about digestion and absorption. Soft foods, long-heated foods and grind-foods are easy to digest. After eating these-foods, our blood sugar level will rise, easily. We introduce the space foods with 30% wheat that the blood sugar level is hard to rising.

  12. New high yielding, high lysine mutants in barley

    International Nuclear Information System (INIS)

    Barley mutants with an increased content of lysine have successfully been selected. Unfortunately, they had a reduced grain yield, and this has led to the opinion that it may not be possible to obtain normal yielding high lysine mutants. In the present study, twenty low hordein barley mutants were derived from 49,000 M2 seeds. Two probably had a 10% increase in lysine content and a grain yield that was the same as that of the mother variety. The mutants were initially selected by a fast turbidity test on the M2 seeds, using special controls that make the tests sensitive. The screening procedure further consists of determination of the non-hordein/hordein ratio in later generations. 14 refs, 3 figs, 3 tabs


    The fungal plant pathogen, F. graminearum, causes Fusarium head blight disease of wheat and barley. To understand the early infection cycle of this organism, we monitored the RNA expression profiles in newly formed spores (macroconidia), in maturing spores and during the early stages of spore germin...



    I.G. Shirokikh; S.Yu. Ogorodnikova; O.N. Shupletsova; I.N. Shchennikova


    In barley callus culture on acid selective media with aluminum the authors selected the resistant lines, from which the regenerated plants were obtained. During a growing on acid sod-podzol soil the seed progeny of regenerated lines was compared with initial varieties on biochemical parameters, on determinants of productivity and yield. It was revealed, that hereditable in regenerated progeny the determinants of somaclonal variability can be used for creation of high productive and resistant ...

  15. Drivers of Phosphorus Uptake by Barley Following Secondary Resource Application (United States)

    Brod, Eva; Øgaard, Anne Falk; Krogstad, Tore; Haraldsen, Trond Knapp; Frossard, Emmanuel; Oberson, Astrid


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake is still poorly understood. Using radioactive-labeling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal, and wood ash were studied as P uptake by barley after 44 days and compared with those of water-soluble mineral P (MinP) and an unfertilized control (NoP) in a pot experiment with an agricultural soil containing little available P at two soil pH levels, approximately pH 5.3 (unlimed soil) and pH 6.2 (limed soil). In a parallel incubation experiment, the effects of the secondary resources on physicochemical and microbial soil processes were studied. The results showed that the relative agronomic efficiency compared with MinP decreased in the order: manure ≥fish sludge ≥wood ash ≥meat bone meal. The solubility of inorganic P in secondary resources was the main driver for P uptake by barley (Hordeum vulgare). The effects of secondary resources on physicochemical and microbial soil processes were of little overall importance. Application of organic carbon with manure resulted in microbial P immobilization and decreased uptake by barley of P derived from the soil. On both soils, P uptake by barley was best explained by a positive linear relationship with the H2O + NaHCO3-soluble inorganic P fraction in fertilizers or by a linear negative relationship with the HCl-soluble inorganic P fraction in fertilizers. PMID:27243015

  16. New Starch Phenotypes Produced by TILLING in Barley


    Francesca Sparla; Giuseppe Falini; Ermelinda Botticella; Claudia Pirone; Valentina Talamè; Riccardo Bovina; Silvio Salvi; Roberto Tuberosa; Francesco Sestili; Paolo Trost


    Barley grain starch is formed by amylose and amylopectin in a 1:3 ratio, and is packed into granules of different dimensions. The distribution of granule dimension is bimodal, with a majority of small spherical B-granules and a smaller amount of large discoidal A-granules containing the majority of the starch. Starch granules are semi-crystalline structures with characteristic X-ray diffraction patterns. Distinct features of starch granules are controlled by different enzymes and are relevant...

  17. The Barley Grain Thioredoxin System – an Update

    Directory of Open Access Journals (Sweden)

    Per eHägglund


    Full Text Available Thioredoxin reduces disulfide bonds and play numerous important functions in plants. In cereal seeds, cytosolic h-type thioredoxin facilitates the release of energy reserves during the germination process and is recycled by NADPH-dependent thioredoxin reductase. This review presents a summary of the research conducted during the last ten years to elucidate the structure and function of the barley seed thioredoxin system at the molecular level combined with proteomic approaches to identify target proteins.

  18. Nutritional assessment of barley, talbina and their germinated products

    Directory of Open Access Journals (Sweden)

    Mohamed kamal El-Sayed Youssef


    Full Text Available Talbina is a food product with high potential applications as a functional food. Talbina was prepared from two barley varieties namely: Giza126 and Giza130 by adding whole barley flour to water (1:10 w/v and (1:5 w/v for germinated barley then heating at  80° C for 5 minutes with continuous stirring until reaching a porridge like texture. The present investigation was carried out in an attempt to clearly the nutritional assessment of talbina as a functional food. The study included the determination of gross chemical composition, caloric value, mineral composition, vitamins composition and the amino acids composition. Meanwhile, computation of the chemical scores (CS and A/E ratios were carried out for raw, germinated barley, talbina, germinated talbina and commercial talbina. The data revealed that protein content of the all raw studied and processing treatments ranged from 8.75-18.34g/100g on dry weight basis. Besides, the all treatments recorded rather slight decrease in crude fat content. Likewise, ash and carbohydrates ranged between 2.29-2.86 and 73.40-82.66%, respectively. Whereas crude fiber had an increase after treatments and it ranged from 3.83-4.37%. On the other hand by making talbina iron, manganese, copper and zinc increased especially zinc, which recorded higher value than that recommended daily. Furthermore, germinated talbina130 recorded the highest amounts of vitamins B2, Nicotinic acid, B6 and folic acid. Moreover, the present study indicated that phenylalanine was the highest essential amino acid, followed by leucine.

  19. Drivers of Phosphorus Uptake by Barley Following Secondary Resource Application. (United States)

    Brod, Eva; Øgaard, Anne Falk; Krogstad, Tore; Haraldsen, Trond Knapp; Frossard, Emmanuel; Oberson, Astrid


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake is still poorly understood. Using radioactive-labeling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal, and wood ash were studied as P uptake by barley after 44 days and compared with those of water-soluble mineral P (MinP) and an unfertilized control (NoP) in a pot experiment with an agricultural soil containing little available P at two soil pH levels, approximately pH 5.3 (unlimed soil) and pH 6.2 (limed soil). In a parallel incubation experiment, the effects of the secondary resources on physicochemical and microbial soil processes were studied. The results showed that the relative agronomic efficiency compared with MinP decreased in the order: manure ≥fish sludge ≥wood ash ≥meat bone meal. The solubility of inorganic P in secondary resources was the main driver for P uptake by barley (Hordeum vulgare). The effects of secondary resources on physicochemical and microbial soil processes were of little overall importance. Application of organic carbon with manure resulted in microbial P immobilization and decreased uptake by barley of P derived from the soil. On both soils, P uptake by barley was best explained by a positive linear relationship with the H2O + NaHCO3-soluble inorganic P fraction in fertilizers or by a linear negative relationship with the HCl-soluble inorganic P fraction in fertilizers. PMID:27243015

  20. Drivers of Phosphorus Uptake by Barley Following Secondary Resource Application


    Brod, Eva; Øgaard, Anne Falk; Krogstad, Tore; Haraldsen, Trond Knapp; Frossard, Emmanuel; Oberson, Astrid


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake is still poorly understood. Using radioactive-labeling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal, and wood ash were studied as P uptake by barley after 44 days and compared with...

  1. Drivers of phosphorus uptake by barley following secondary resource application


    Eva eBrod; Anne Falk Øgaard; Tore eKrogstad; Trond Knapp Haraldsen; Emmanuel eFrossard; Astrid eOberson


    Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P) fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake are still poorly understood. Using radioactive labelling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal and wood ash were studied as P uptake by barley after 44 days and compared wit...

  2. Drivers of phosphorus uptake by barley following secondary resource application

    Directory of Open Access Journals (Sweden)

    Eva eBrod


    Full Text Available Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake are still poorly understood. Using radioactive labelling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal and wood ash were studied as P uptake by barley after 44 days and compared with those of water-soluble mineral P (MinP and an unfertilized control (NoP in a pot experiment with an agricultural soil containing little available P at two soil pH levels, approximately pH 5.3 (unlimed soil and pH 6.2 (limed soil. In a parallel incubation experiment, the effects of the secondary resources on physicochemical and microbial soil processes were studied. The results showed that the relative agronomic efficiency compared with MinP decreased in the order: manure ≥ fish sludge ≥ wood ash ≥ meat bone meal. The solubility of inorganic P in secondary resources was the main driver for P uptake by barley (Hordeum vulgare. The effects of secondary resources on physicochemical and microbial soil processes were of little overall importance. Application of organic carbon with manure resulted in microbial P immobilisation and decreased uptake by barley of P derived from the soil. On both soils, P uptake by barley was best explained by a positive linear relationship with the H2O + NaHCO3-soluble inorganic P fraction in fertilizers, or by a linear negative relationship with the HCl-soluble inorganic P fraction in fertilizers.

  3. Microbes in the tailoring of barley malt properties


    Laitila, Arja


    Microbes have a decisive role in the barley-malt-beer chain. A major goal of this thesis was to study the relationships between microbial communities and germinating grains during malting. Furthermore, the study provided a basis for tailoring of malt properties with natural, malt-derived microbes. The malting ecosystem is a dynamic process, exhibiting continous change. The first hours of steeping and kilning were the most important steps in the process with regard to microbiological qual...

  4. Gamma Ray and Barley Improvement for drought Land in Syria

    International Nuclear Information System (INIS)

    The Barley breeding program has been concentrated to improve it's yield under dry conditions (zone-C 250 m.m), so the Barley Breeder's in GCSAR reached to Barley mutant (M4) suitable for rain-fed area in zone-C by exposing Arabi Aswad (local Barley variety) to gamma-ray treatment 10 Kr/dose, It's cod is Furat A-4806. Furat A-4806 tested in yield trials 1988/1989-1992/1993 in Hasakeh Research Station RCBD 4.5 M2 plot size , Its out yielded A. Aswad by 31 %. And completed testing in On-Farme yield Trials (At Farmers fields) 1993/1994 - 1996/1997 RCBD 32 M2 plot size , Its out yielded the Farmers Variety 18 - 28 % in Hama and Daraa provinces, 16 % in Hasakeh province (Sig. at 1%). Furat A-4806 has been released and has a new name (furat 3). Furat 3 has planted at Farmers fields to released it under there conditions ( 1 Hac in 47 locations in Hama, Homs, Edleb, Aleppo and Hasakeh provinces 2000/2001 - 2002/2003. Agronomic data were: 1000-kernel weight 37.4 g ; protein content 11.7%, number of days to heading 117; Number of days to maturity 156 ; plant height 52 cm. It was also found to be moderately resistant to moderately susceptible to scald, and moderately resistant to Powdery Mildew. Furat 3 is two-row type, with brunet seeds color, and resistant to lodging. Furat 3 has been released for: Hassake, Hama, Aleppo and Dara'a, and has good adoption. (Author)

  5. Alcohol Yield of Oat, Barley and Wheat Hydrolysates


    PIKL, Miroslav


    Major part of ethanol production for industrial use in Czech Republic is made from cereals. Effect of acid, alkali and enzymatic hydrolysis after thermopressure preparation takes part in the paper. The most promising alternative is enzymatic hydrolysis. Especially efficiency of different hydrolytic enzymes towards different species of cereals takes the main part of the simulations. Local farm products, oats, barley and wheat were prepaired by steam explosion in different pressure. After hydro...

  6. Brassinosteroid enhances resistance to fusarium diseases of barley. (United States)

    Ali, Shahin S; Kumar, G B Sunil; Khan, Mojibur; Doohan, Fiona M


    Fusarium pathogens are among the most damaging pathogens of cereals. These pathogens have the ability to attack the roots, seedlings, and flowering heads of barley and wheat plants with disease, resulting in yield loss and head blight disease and also resulting in the contamination of grain with mycotoxins harmful to human and animal health. There is increasing evidence that brassinosteroid (BR) hormones play an important role in plant defense against both biotic and abiotic stress agents and this study set out to determine if and how BR might affect Fusarium diseases of barley. Application of the epibrassinolide (epiBL) to heads of 'Lux' barley reduced the severity of Fusarium head blight (FHB) caused by Fusarium culmorum by 86% and reduced the FHB-associated loss in grain weight by 33%. Growth of plants in soil amended with epiBL resulted in a 28 and 35% reduction in Fusarium seedling blight (FSB) symptoms on the Lux and 'Akashinriki' barley, respectively. Microarray analysis was used to determine whether growth in epiBL-amended soil changed the transcriptional profile in stem base tissue during the early stages of FSB development. At 24 and 48 h post F. culmorum inoculation, there were 146 epiBL-responsive transcripts, the majority being from the 48-h time point (n = 118). Real-time reverse-transcription polymerase chain reaction analysis validated the results for eight transcripts, including five defense genes. The results of gene expression studies show that chromatin remodeling, hormonal signaling, photosynthesis, and pathogenesis-related genes are activated in plants as a result of growth in epiBL. PMID:23777406

  7. Proteomic analysis of different extracts from barley grains

    Czech Academy of Sciences Publication Activity Database

    Chmelík, Josef; Řehulka, Pavel; Střelcová, M.; Kubáň, V.; Mayrhofer, C.; Allmaier, G.


    Roč. 48, č. 6 (2002), s. 261-264. ISSN 0370-663X R&D Projects: GA ČR GA521/99/1576 Grant ostatní: Austrian-Czech Republic Collaboration Grant(AT) II/4 Institutional research plan: CEZ:AV0Z4031919 Keywords : proteomics * barley * mass spectrometry Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 0.333, year: 2002

  8. The effect of lanthanum applications on drought tolerance in barley

    International Nuclear Information System (INIS)

    Full text: Glasshouse investigations carried out by the authors on both perlite and soil, have repeatedly shown that several plant species, when treated with lanthanum, retain greater amounts of moisture under water stressed conditions. Dry matter increases under water stress have been observed in some cases. Barley plants watered to 50% field capacity, and show-ing signs of water stress, yielded 18% more dry matter when treated with 5 kg/ha and 10 kg/ha of lanthanum than control plants (P<0.05). The results of these experiments suggest that increased dry matter production in crops under periods of water stress, is likely when previously treated with lanthanum. Consequently, it is conceivable that lanthanum may have potential as an agent that induces drought tolerance in grain crops, grown in low rainfall areas. Subsequent field trials using barley as a test crop at Walpeup, in the Mallee region of Victoria have shown that in a below average rainfall year, combined soil and foliar applications of lanthanum can significantly increase grain yield. This effect was not evident when barley grown on the same soil type was treated with lanthanum under above average rainfall conditions

  9. Genetic analysis of aluminum tolerance in Brazilian barleys

    Directory of Open Access Journals (Sweden)

    Minella Euclydes


    Full Text Available Aluminum (Al toxicity is a major factor limiting barley growth in acid soils, and genotypes with adequate level of tolerance are needed for improving barley adaptation in Brazil. To study the inheritance of Al tolerance in Brazilian barleys, cultivars Antarctica 1, BR 1 and FM 404 were crossed to sensitive Kearney and PFC 8026, and intercrossed. Parental, F1, F2 and F6 generations were grown in nutrient solution containing 0.03, 0.05 and 0.07 mM of Al and classified for tolerance by the root tip hematoxylin staining assay. Tolerant by sensitive F2 progenies segregated three tolerant to one sensitive, fitting the 3:1 ratio expected for a single gene. The F6 populations segregated one tolerant to one sensitive also fitting a monogenic ratio. The F2 seedlings from crosses among tolerant genotypes scored the same as the parents. Since the population size used would allow detection of recombination as low as 7%, the complete absence of Al sensitive recombinants suggests that tolerance in these cultivars is most probably, controlled by the same gene. Thus, the potential for improving Al tolerance through recombination of these genotypes is very low and different gene sources should be evaluated.

  10. Alleviation of Al Toxicity in Barley by Addition of Calcium

    Institute of Scientific and Technical Information of China (English)

    GUO Tian-rong; CHEN Ying; ZHANG Yan-hua; JIN Ye-fei


    The potential mechanism by which Ca alleviates Al toxicity was investigated in barley seedlings. It was found that 100 μM Al-alone treatment inhibited barley plant growth and thereby reduced shoot height and root length, and dry weights of root, shoot and leaf; promoted Al accumulation but inhibited Ca absorption in plant tissues; and induced an increase in the activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) and in the level of lipid peroxidation (MDA content) in leaves. Except for the increase in Ca concentration in plant tissues, treatment with 0.5 mM Ca in the absence of Al had less effect on the above-mentioned parameters, compared with the control. Addition of Ca efficiently reduced Al toxicity, which is reflected by the promotion of plant growth, reduction in Al concentration and MDA content,increase in Ca concentration and in SOD, POD, and CAT activities compared with the Al-alone-treatment; with increase in Ca level (3.0 mM), the ameliorative effect became more dominant. This indicated that the alleviation of aluminum toxicity in barley seedlings with Ca supplementation could be associated with less absorption of Al and the enhancement of the protective ability of the cell because of increased activity of the antioxidative enzyme.

  11. Barley coleoptile peroxidases. Purification, molecular cloning, and induction by pathogens

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Bloch, H.; Rasmussen, Søren Kjærsgård


    A cDNA clone encoding the Prx7 peroxidase from barley (Hordeum vulgare L.) predicted a 341-amino acid protein with a molecular weight of 36,515. N- and C-terminal putative signal peptides were present, suggesting a vacuolar location of the peroxidase. Immunoblotting and reverse-transcriptase poly......A cDNA clone encoding the Prx7 peroxidase from barley (Hordeum vulgare L.) predicted a 341-amino acid protein with a molecular weight of 36,515. N- and C-terminal putative signal peptides were present, suggesting a vacuolar location of the peroxidase. Immunoblotting and reverse...... from barley coleoptiles. P9.3 and P7.3 had Reinheitszahl values of 3.31 and 2.85 and specific activities (with 2,2'-azino-di-[3-ethyl-benzothiazoline-6-sulfonic acid], pH 5.5, as the substrate) of 11 and 79 units/mg, respectively. N-terminal amino acid sequencing and matrix-assisted laser desorption...

  12. Internal water balance of barley under soil moisture stress. (United States)

    Millar, A A; Duysen, M E; Wilkinson, G E


    Leaf water potential, leaf relative water content, and relative transpiration of barley were determined daily under greenhouse conditions at 3 growth stages: tillering to boot, boot to heading, and heading to maturity. The leaf moisture characteristic curve (relative water content versus leaf water potential) was the same for leaves of the same age growing in the same environment for the first 2 stages of growth, but shifted at the heading to maturity stage to higher leaf relative water content for a given leaf water potential. Growth chamber experiments showed that the leaf moisture characteristic curve was not the same for plants growing in different environments.Relative transpiration data indicated that barley stomates closed at a water potential of about -22 bars at the 3 stages studied.The water potential was measured for all the leaves on barley to determine the variation of water potential with leaf position. Leaf water potential increased basipetally with plant leaf position. In soil with a moisture content near field capacity a difference of about 16.5 bars was observed between the top and bottom leaves on the same plant, while in soil with a moisture content near the permanent wilting point the difference was only 5.6 bars between the same leaf positions. PMID:16656869

  13. Barley metallothioneins differ in ontogenetic pattern and response to metals

    DEFF Research Database (Denmark)

    Schiller, Michaela; Hegelund, Josefine Nymark; Pedas, Pai;


    pollination. However, among the MT grain transcripts MT2c was the most abundant, whereas MT4 was the least abundant. Excess Cu up-regulated three out of the six MTs expressed in leaves of young barley plants. In contrast, most MTs were down-regulated by excess Zn or Cd. Zn starvation led to up-regulation of......, the root-specific gene MT1b1 was 1000-fold up-regulated. Immunolocalizations provided the first evidence for accumulation of MT1a and MT2a proteins in planta, with correlation to transcript levels. In developing grains, MT2a and MT4 expression increased 4- and 300-fold over a 28-day-period after...... MT1a, whereas Cu starvation up-regulated MT2a, which has two copper-responsive elements in the promoter. Arabidopsis lines constitutively overexpressing barley MT2a showed increased sensitivity to excess Cd and Zn but no Cu-induced response. We suggest that barley MTs are differentially involved in...

  14. Barley HvHMA1 Is a Heavy Metal Pump Involved in Mobilizing Organellar Zn and Cu and Plays a Role in Metal Loading into Grains

    DEFF Research Database (Denmark)

    Mikkelsen, Maria Dalgaard; Pedas, Pai; Schiller, Michaela;


    the properties of HvHMA1, which is a barley orthologue of Arabidopsis thaliana AtHMA1 localized to the chloroplast envelope. HvHMA1 was localized to the periphery of chloroplast of leaves and in intracellular compartments of grain aleurone cells. HvHMA1 expression was significantly higher in grains...... by RNA interference did not have an effect on foliar Zn and Cu contents but resulted in a significant increase in grain Zn and Cu content. Heterologous expression of HvHMA1 in heavy metal-sensitive yeast strains increased their sensitivity to Zn, but also to Cu, Co, Cd, Ca, Mn, and Fe. Based on these...

  15. Identification of Circular RNAs From the Parental Genes Involved in Multiple Aspects of Cellular Metabolism in Barley

    Directory of Open Access Journals (Sweden)

    Behrooz eDarbani


    Full Text Available RNA circularization made by head-to-tail back-splicing events is involved in the regulation of gene expression from transcriptional to post-translational levels. By exploiting RNA-Seq data and down-stream analysis, we shed light on the importance of circular RNAs in plants. The results introduce circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes including protein coding transcripts, microRNA, rRNA, and long non-coding/microprotein coding RNAs. The results shed light on the mitochondrial exonic circular RNAs and imply the importance of circular RNAs for regulation of mitochondrial genes. Importantly, we introduce circular RNAs in barley and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs' functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear transcripts.Keywords: circular RNAs, coding and non-coding transcripts, leaves, seeds, transfer cells, micronutrients, mitochondria

  16. Identification of Circular RNAs from the Parental Genes Involved in Multiple Aspects of Cellular Metabolism in Barley (United States)

    Darbani, Behrooz; Noeparvar, Shahin; Borg, Søren


    RNA circularization made by head-to-tail back-splicing events is involved in the regulation of gene expression from transcriptional to post-translational levels. By exploiting RNA-Seq data and down-stream analysis, we shed light on the importance of circular RNAs in plants. The results introduce circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes including protein coding transcripts, microRNA, rRNA, and long non-coding/microprotein coding RNAs. The results shed light on the mitochondrial exonic circular RNAs and imply the importance of circular RNAs for regulation of mitochondrial genes. Importantly, we introduce circular RNAs in barley and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs' functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear transcripts. PMID:27375638

  17. Molecular phylogeography of domesticated barley traces expansion of agriculture in the Old World. (United States)

    Saisho, Daisuke; Purugganan, Michael D


    Barley (Hordeum vulgare ssp. vulgare) was first cultivated 10,500 years ago in the Fertile Crescent and is one of the founder crops of Eurasian agriculture. Phylogeographic analysis of five nuclear loci and morphological assessment of two traits in >250 domesticated barley accessions reveal that landraces found in South and East Asia are genetically distinct from those in Europe and North Africa. A Bayesian population structure assessment method indicates that barley accessions are subdivided into six clusters and that barley landraces from 10 different geographical regions of Eurasia and North Africa show distinct patterns of distribution across these clusters. Using haplotype frequency data, it appears that the Europe/North Africa landraces are most similar to the Near East population (F ST = 0.15) as well as to wild barley (F ST = 0.11) and are strongly differentiated from all other Asian populations (F ST = 0.34-0.74). A neighbor-joining analysis using these F ST estimates also supports a division between European, North African, and Near East barley types from more easterly Asian accessions. There is also differentiation in the presence of a naked caryopsis and spikelet row number between eastern and western barley accessions. The data support the differential migration of barley from two domestication events that led to the origin of barley--one in the Fertile Crescent and another farther east, possibly at the eastern edge of the Iranian Plateau--with European and North African barley largely originating from the former and much of Asian barley arising from the latter. This suggests that cultural diffusion or independent innovation is responsible for the expansion of agriculture to areas of South and East Asia during the Neolithic revolution. PMID:17947416

  18. Investigation of Leaf Diseases and Estimation of Chlorophyll Concentration in Seven Barley Varieties Using Fluorescence and Hyperspectral Indices


    Kang Yu; Georg Leufen; Mauricio Hunsche; Georg Noga; Xinping Chen; Georg Bareth


    Leaf diseases, such as powdery mildew and leaf rust, frequently infect barley plants and severely affect the economic value of malting barley. Early detection of barley diseases would facilitate the timely application of fungicides. In a field experiment, we investigated the performance of fluorescence and reflectance indices on (1) detecting barley disease risks when no fungicide is applied and (2) estimating leaf chlorophyll concentration (LCC). Leaf fluorescence and canopy reflectance were...

  19. Effect of Barleys Having Different Liter Weights on Performance, Economic Value, Ruminal Fermentation of Lambs, and Nutrient Digestibility


    GÜLER, Talat; ŞAHİN, Kazım; ÇERÇİ, İ.Halil; ERTAS, O. Nihat


    This experiment was conducted to determine the effects of diets containing barleys having different liter weights (It wt) on average daily gain, feed efficiency, profit margins, ruminal fermentation, and carcass characteristics of lambs and diet digestibility. 16 Akkaraman lambs approximately 8 mo old (averaging 30 kg) were used in a randomized design. Treatment groups consisting of barley grains and barley grains were classified to liter weights as follows: 1. Barley has 643 g lt wt (Grou...

  20. Kaposi's sarcoma-associated herpesvirus ORF57 protein binds and protects a nuclear noncoding RNA from cellular RNA decay pathways.

    Directory of Open Access Journals (Sweden)

    Brooke B Sahin


    Full Text Available The control of RNA stability is a key determinant in cellular gene expression. The stability of any transcript is modulated through the activity of cis- or trans-acting regulatory factors as well as cellular quality control systems that ensure the integrity of a transcript. As a result, invading viral pathogens must be able to subvert cellular RNA decay pathways capable of destroying viral transcripts. Here we report that the Kaposi's sarcoma-associated herpesvirus (KSHV ORF57 protein binds to a unique KSHV polyadenylated nuclear RNA, called PAN RNA, and protects it from degradation by cellular factors. ORF57 increases PAN RNA levels and its effects are greatest on unstable alleles of PAN RNA. Kinetic analysis of transcription pulse assays shows that ORF57 protects PAN RNA from a rapid cellular RNA decay process, but ORF57 has little effect on transcription or PAN RNA localization based on chromatin immunoprecipitation and in situ hybridization experiments, respectively. Using a UV cross-linking technique, we further demonstrate that ORF57 binds PAN RNA directly in living cells and we show that binding correlates with function. In addition, we define an ORF57-responsive element (ORE that is necessary for ORF57 binding to PAN RNA and sufficient to confer ORF57-response to a heterologous intronless beta-globin mRNA, but not its spliced counterparts. We conclude that ORF57 binds to viral transcripts in the nucleus and protects them from a cellular RNA decay pathway. We propose that KSHV ORF57 protein functions to enhance the nuclear stability of intronless viral transcripts by protecting them from a cellular RNA quality control pathway.

  1. Uptake, distribution, and turnover rates of selenium in barley. (United States)

    Huang, K X; Clausen, J


    The present communication elucidates initially the topographic distribution of selenium in barley grains. Then by the fluorimetric method the uptake of selenium (selenite) in 8-16 d old germinating barley was estimated. Finally by means of 75Se the anabolic and catabolic rates (turnover) of 75Se (selenite) was compared. The distribution of selenium in barley was evaluated after micro-dissection of barley grains. In dried grains the highest concentration was found in husk and pericarp with about 0.6 ppm Se. Then followed Scutellum with 0.4 and 0.3 ppm in embryon. The aleurone layer, embryonic leaves, and initial root did only have 0.2 ppm Se. In order to know more about the uptake and distribution of selenium in 8-d-old barley, the plants were cultivated for a further 8 d in the culture medium with variation in selenite concentration. In roots and leaves, the uptake did not arrive at saturation during the period studied since the dose-response curve increased up to 0.34 mM selenite in the medium, whereas the selenium levels were about 200 ppm in roots and 30 ppm in leaves. However, the uptake was linear, with concentration during 8 d of cultivation up to 0.84 microM selenite for grain and stem. At higher concentrations the dose-response curve diminished its slope. At 0.34 mM selenite the concentration in grain increased to 6.87 ppm and in the stem to 8.13 ppm. The uptake, distribution, and catabolic rate of selenium components in germinating barley were further evaluated by exposing the plants to 0.0492 microCi 75Se (12.6 microM selenite) for up to 4 d. Then the plants were moved to a selenium deficient medium for further 4 d. Then finally the medium was supplemented with high doses of cold selenite (0.126 mM selenite) for further 4 d. The first third period made it possible to estimate the rate of uptake. It was highest in roots (313 fmol/h/mg dw), i.e., about 10 times those of grains, stems, and leaves. The intermediate period where the barley was transferred to a

  2. A genome-wide association study of malting quality across eight U.S. barley breeding programs (United States)

    This study leverages the breeding data of 1,862 breeding lines evaluated in 97 field trials for genome-wide association study of malting quality traits in barley. The breeding lines were six-row and two-row barley advanced breeding lines from eight barley breeding populations established at six pub...

  3. Comparative Studies on Callose Formation in Powdery Mildew Compatible and Incompatible Barley

    DEFF Research Database (Denmark)

    Skou, Jens-Peder; Jørgensen, Jørgen Helms; Lilholt, Ulla


    Callose formation in barley mutants, lines and varieties with different genes for resistance to powdery mildew in seven different loci was compared. Only barley with resistance genes in the ml-o locus showed so early a callose formation passing off at such a high rate that it prevented fungal pen...

  4. Agronomic effects of a reciprocal translocation in a widely grown Spanish barley variety

    NARCIS (Netherlands)

    Farré, A.; Visioni, A.; Lacasa-Benito, I.; Cistué, L.; Jansen, J.


    A large spontaneous reciprocal translocation is present in a widely grown Spanish barley cv. ‘Albacete’. It has been hypothesized that high popularity of ‘Albacete’ with farmers, particularly in semi-arid areas where barley is grown under rainfed conditions, may be due to the presence of this transl

  5. Genetic characterization of a reciprocal translocation present in a widely grown barley variety

    NARCIS (Netherlands)

    Farré, A.; Cuadrado, A.; Lacasa-Benito, I.; Cistué, L.; Schubert, I.; Comadran, J.; Jansen, J.; Romagosa, I.


    Artificially induced translocation stocks have been used to physically map the barley genome; however, natural translocations are extremely uncommon in cultivated genotypes. Albacete is a barley variety widely grown in recent decades in Spain and carrying a reciprocal translocation which obviously d

  6. Quantifying relationships between rooting traits and water uptake under drought in Mediterranean barley and durum wheat

    Institute of Scientific and Technical Information of China (English)

    Pedro Carvalho; Sayed AzamAli; M. John Foulkes


    In Mediterranean regions drought is the major factor limiting spring barley and durum wheat grain yields. This study aimed to compare spring barley and durum wheat root and shoot responses to drought and quantify relationships between root traits and water uptake under terminal drought. One spring barley (Hordeum vulgare L. cv. Rum) and two durum wheat Mediterranean cultivars (Triticum turgidum L. var durum cvs Hourani and Karim) were examined in soil-column experi-ments under wel watered and drought conditions. Root system architecture traits, water uptake, and plant growth were measured. Barley aerial biomass and grain yields were higher than for durum wheat cultivars in wel watered conditions. Drought decreased grain yield more for barley (47%) than durum wheat (30%, Hourani). Root-to-shoot dry matter ratio increased for durum wheat under drought but not for barley, and root weight increased for wheat in response to drought but decreased for barley. The critical root length density (RLD) and root volume density (RVD) for 90%available water capture for wheat were similar to (cv. Hourani) or lower than (cv. Karim) for barley depending on wheat cultivar. For both species, RVD accounted for a slightly higher proportion of phenotypic variation in water uptake under drought than RLD.


    Directory of Open Access Journals (Sweden)

    Temiraev R. B.


    Full Text Available The article presents experimental data indicating that for the optimization of biological and food processing meat value at risk of aflatoxicosis in feeding chicken-broilers with barley-wheat and sunflower type one should include hullless barley grain at exposure of ozone of 3.0 hour complex with Bifidumbacterinum probiotics

  8. Spectrum of Resistance Conferred by ml-o Powdery Mildew Resistance Genes in Barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms


    Ten barley mutants and five Ethiopian barley lines representing 11 independently arisen powdery mildew resistance genes in the ml-o locus were tested at the seedling stage to cultures of the powdery mildew fungus from Europe, Israel, USA. Canada, and Japan. They were resistant with infection type 0...

  9. Comparison of Pretreatment Strategies for Enzymatic Saccharification and Fermentation of Barley Straw to Ethanol (United States)

    Barley straw used in this study contained 34.1±0.6% cellulose, 22.6±0.4% hemicellulose, and 13.3±0.2% lignin (moisture, 6.5±0.0%). Several pretreatments (dilute acid, lime, and alkaline peroxide) and enzymatic saccharification procedures were evaluated for the conversion of barley straw to monomeri...

  10. Lysine Rich Proteins in the Salt-Soluble Protein Fraction of Barley

    DEFF Research Database (Denmark)

    Ingversen, J.; Køie, B.


    Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2.......Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2....

  11. Barley alpha-amylase/subtilisin inhibitor: structure, biophysics and protein engineering

    DEFF Research Database (Denmark)

    Nielsen, P.K.; Bønsager, Birgit Christine; Fukuda, Kenji; Svensson, Birte


    Bifunctional alpha-amylase/subtilisin inhibitors have been implicated in plant defence and regulation of endogenous alpha-amylase action. The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits the barley alpha-amylase 2 (AMY2) and subtilisin-type serine proteases. BASI belongs to the Kunit...

  12. Molecular mapping of greenbug (Schizaphis graminum) resistance gene Rsg1 in barley (United States)

    The greenbug, Schizaphis graminum (Rondani) is an extremely damaging aphid pest of barley (Hordeum vulgare L., 2n = 2x =14 L.) particularly in the southern Great Plains of the US. The simply inherited, dominant resistance gene Rsg1 is presented in all greenbug-resistant US barley cultivars, includi...

  13. Fractionation of barley into value-added ingredients enriched with protein, beta-glucan or starch (United States)

    Barley contains several valuable nutrients, including protein, beta-glucan (BG) and starch. Each has additional value when concentrated. Among reported studies on barley fractionation (dry or wet), most focused enriching one or two components in term of concentrations in resulting fractions but negl...

  14. Effect of pulsed electric field on the germination of barley seeds

    DEFF Research Database (Denmark)

    Dymek, Katarzyna; Dejmek, Petr; Panarese, Valentina;


    This study explores metabolic responses of germinating barley seeds upon the application of pulsed electric fields (PEF). Malting barley seeds were steeped in aerated water for 24 h and PEF-treated at varying voltages (0 (control), 110, 160, 240, 320, 400 and 480 V). The seeds were then allowed...

  15. Differential levels of mite infestation of wheat and barley in Czech grain stores

    Institute of Scientific and Technical Information of China (English)

    Jan Hubert; Zuzana Kucerova; Radek Aulicky; Marta Nesvoma; Vaclav Stejskal


    While mites are able to utilize numerous food sources, the suitability of the food strongly influences population growth. The different suitabilities of various stored agricultural products will thus affect the level of infestation. In this study, we compared field mite infestation rates in two stored cereals: wheat and barley. We analyzed mite abundance, frequency and species composition in samples of grain obtained from 79 selected Czech grain stores. Stored barley seemed to be more vulnerable to mite attack than wheat, as we consistently found more infested samples, more species and higher mean and median mite abundance per sample in barley as compared to wheat. The mean mite abundance per sample were 55 and 506 individuals for wheat and barley, respectively. In barley, 10% of samples exceeded allergen risk threshold (i.e., 1 000 individuals per kg of grain). Altogether, 25 species were identified from approximately 35 000 individuals. The most frequently identified species were the same in wheat and barley, that is, Tydeus interruptus Sig Thor, Acarus siro L., Tarsonemus granarius Lindquist, Lepidoglyphus destructor (Schrank) and 1),rophagusputrescentiae (Schrank). Based on principal components analysis, we found a closer association of T. interruptus, T. putrescentiae, L. destructor and Cheyletus eruditus (Schrank) with barley samples, corresponding to the high frequency and abundance values of these mites. The probable reasons for the higher infestation, especially mite abundance in barley, are discussed in relation to the higher proportion of crushed parts, which may release favorable nutrient sources and amplify the abundance values.

  16. Rhizoctonia cerealis anastomosis group GAG-1, the common pathogen of wheat, barley and sugar beet

    Directory of Open Access Journals (Sweden)

    Helena Furgał-Węgrzycka


    Full Text Available Isuluies of Rhizoctonia cerealis anastomosis group GAG-1 were obtained from sharp eyespot lesions on wheat and on barley culms and from diseased sugar beet seedlings. Isolates of R. cerealis were collected from a fields with crop rotation experiments: sugar beet-spring wheat-winter barley. In pathogenicity tests isolates of R. cerealis from sugar beet seedlings and from sharp eyespot lesions on wheat and barley were pathogenic to these crops. Isolates of R. cerealis from sharp eyespot lesions on wheat and barley caused severe damping-ofTof sugar beet. Isolates of R. cerealis from sugar beet seedlings also caused symptoms of sharp eyespot on wheat and barley. None of the wheat and barley isolates of R. cerealis tested caused root-rot on wheat or barley seedlings. Isolates of R. cerealis obtained from diseased plants of wheat, barley and sugar beet were similar in morphology of cultures and anastomosed with GAG-1 tester isolate. The relatinoship between anastomosis. colony characters, growth rate, hyphal diameter and pathogenicity of AG-4. AG-2-2 and AG-5 isolates obtained together with R. cerealis from diseased plants were also investigated.

  17. The draft genome of Tibetan hulless barley reveals adaptive patterns to the high stressful Tibetan Plateau. (United States)

    Zeng, Xingquan; Long, Hai; Wang, Zhuo; Zhao, Shancen; Tang, Yawei; Huang, Zhiyong; Wang, Yulin; Xu, Qijun; Mao, Likai; Deng, Guangbing; Yao, Xiaoming; Li, Xiangfeng; Bai, Lijun; Yuan, Hongjun; Pan, Zhifen; Liu, Renjian; Chen, Xin; WangMu, QiMei; Chen, Ming; Yu, Lili; Liang, Junjun; DunZhu, DaWa; Zheng, Yuan; Yu, Shuiyang; LuoBu, ZhaXi; Guang, Xuanmin; Li, Jiang; Deng, Cao; Hu, Wushu; Chen, Chunhai; TaBa, XiongNu; Gao, Liyun; Lv, Xiaodan; Abu, Yuval Ben; Fang, Xiaodong; Nevo, Eviatar; Yu, Maoqun; Wang, Jun; Tashi, Nyima


    The Tibetan hulless barley (Hordeum vulgare L. var. nudum), also called "Qingke" in Chinese and "Ne" in Tibetan, is the staple food for Tibetans and an important livestock feed in the Tibetan Plateau. The diploid nature and adaptation to diverse environments of the highland give it unique resources for genetic research and crop improvement. Here we produced a 3.89-Gb draft assembly of Tibetan hulless barley with 36,151 predicted protein-coding genes. Comparative analyses revealed the divergence times and synteny between barley and other representative Poaceae genomes. The expansion of the gene family related to stress responses was found in Tibetan hulless barley. Resequencing of 10 barley accessions uncovered high levels of genetic variation in Tibetan wild barley and genetic divergence between Tibetan and non-Tibetan barley genomes. Selective sweep analyses demonstrate adaptive correlations of genes under selection with extensive environmental variables. Our results not only construct a genomic framework for crop improvement but also provide evolutionary insights of highland adaptation of Tibetan hulless barley. PMID:25583503

  18. Structure and Composition of Protein Bodies from Wild-Type and High-Lysine Barley Endosperm

    DEFF Research Database (Denmark)

    Ingversen, J.


    Protein bodies were isolated from 13 and 28 day old endosperms of barley mutant 1508 and its wild type, Bomi barley. The fine structure of the isolated protein bodies was determined by electron microscopy, and the proteins present in the preparations characterized by amino-acid analysis and SDS-p...

  19. The wide distribution of endornaviruses, large double-stranded RNA replicons with plasmid-like properties. (United States)

    Fukuhara, T; Koga, R; Aoki, N; Yuki, C; Yamamoto, N; Oyama, N; Udagawa, T; Horiuchi, H; Miyazaki, S; Higashi, Y; Takeshita, M; Ikeda, K; Arakawa, M; Matsumoto, N; Moriyama, H


    The International Committee on Taxonomy of Viruses (ICTV) recently accepted Endornavirus as a new genus of plant dsRNA virus. We have determined the partial nucleotide sequences of the RNA-dependent RNA polymerase regions from the large dsRNAs (about 14 kbp) isolated from barley (Hordeum vulgare), kidney bean (Phaseolus vulgaris), melon (Cucumis melo), bottle gourd (Lagenaria siceraria), Malabar spinach (Basella alba), seagrass (Zostera marina), and the fungus Helicobasidium mompa. Phylogenetic analyses of these seven dsRNAs indicate that these dsRNAs are new members of the genus Endornavirus that are widely distributed over the plant and fungal kingdoms. PMID:16341944

  20. The fungal community structure of barley malts from diverse geographical regions correlates with malt quality parameters. (United States)

    Kaur, Mandeep; Bowman, John P; Stewart, Doug C; Evans, David E


    Malt is a preferred base for fermentations that produce beer or whisky. Barley for malt is grown under diverse environments in different geographical locations. Malt provides an ecological niche for a varied range of microorganisms with both positive and negative effects on its quality for brewing. Little information exists in the literature on the microbial community structure of Australian malt as well as broader global geographical differences in the associated fungal and bacterial communities. The aims of the present study were to compare the bacterial and fungal community structures of Australian commercial malt with its international counterparts originating from different geographical regions using terminal restriction fragment length polymorphism (TRFLP) fingerprinting and clone library analyses of ribosomal RNA genes. Further, the relationship between malt associated microbial communities and conventional malt quality parameters was also compared. Results showed that differences in fungal communities of malts from different geographical location were more pronounced than bacterial communities. TRFLP analysis discriminated high quality commercial malts with low fungal loads from malts deliberately infected with fungal inocula (Fusarium/Penicillium). Malt moisture, beta-amylase, α-amylase and limit dextrinase contents showed significant correlations with fungal community structure. This investigation concluded that fungal community structure was more important to subsequent malt quality outcomes than bacteria. PMID:26340674

  1. Improvement of barley for drought tolerance by induced mutation

    International Nuclear Information System (INIS)

    Barley (cultivar Ardhaoui) is a traditional cereal adapted to the agroclimatic and abiotic stresses of South Tunisia. It is used by local communities as the food plant and source of proteins for animals. It is a heterogeneous mixtures of land races and represent the adapted natural germplasm which needs to be improved in yield, quality and tolerance to stress (especially drought). Irradiation technique is used in this work for the selection of barley lines tolerant to drought. Building on the obtained results, the technique will be used to develop barley lines matching specific environments prevailing in the south of Tunisia. The obtained mutants are characterized by the increased of grain yield and water use efficiency through a greater tolerance to drought. On the level of the physiological behavior, the mutants are more efficient regarding the values of rate of photosynthesis A, the stomatic conductance gs, the rate of transpiration E, chlorophyl rate and the internal CO2 concentration Ci. The content of proline shows that this amino acid is strongly concentrated at the irradiated lines. The analysis of nutritional behavior shows that the content of (Ca+Mg) in irradiated lines decreases by increasing the stress. The phosphorus content was also assigned by the water stress. On the contrary, the potassium content increases with the intensity of stress. Under water deficit, the growth parameter, the grain production and the number of spike and tillers are significantly reduced for the control (the reduction reached 42 to 50%). This reduction does not exceed 25% for the irradiated lines. The availability of these improved mutant seeds can contribute to increase food security for the local population. (author)

  2. Elevated phosphorus impedes manganese acquisition by barley plants. (United States)

    Pedas, Pai; Husted, Søren; Skytte, Kristian; Schjoerring, Jan Kofod


    The occurrence of manganese (Mn) deficiency in cereal crops has increased in recent years. This coincides with increasing phosphorus (P) status of many soils due to application of high levels of animal manure and P-fertilizers. In order to test the hypothesis that elevated P my lead to Mn deficiency we have here conducted a series of hydroponics and soil experiments examining how the P supply affects the Mn nutrition of barley. Evidence for a direct negative interaction between P and Mn during root uptake was obtained by on-line inductively coupled plasma mass spectrometry (ICP-MS). Addition of a pulse of KH(2)PO(4) rapidly and significantly reduced root Mn uptake, while a similar concentration of KCl had no effect. Addition of a P pulse to the same nutrient solution without plants did not affect the concentration of Mn, revealing that no precipitation of Mn-P species was occurring. Barley plants growing at a high P supply in hydroponics with continuous replenishment of Mn(2+) had up to 50% lower Mn concentration in the youngest leaves than P limited plants. This P-induced depression of foliar Mn accelerated the development of Mn deficiency as evidenced by a marked change in the fluorescence induction kinetics of chlorophyll a. Also plants growing in soil exhibited lower leaf Mn concentrations in response to elevated P. In contrast, leaf concentrations of Fe, Cu, and N increased with the P supply, supporting that the negative effect of P on Mn acquisition was specific rather than due to a general dilution effect. It is concluded that elevated P supply directly interferes with Mn uptake in barley roots and that this negative interaction can induce Mn deficiency in the shoot. This finding has major implications in commercial plant production where many soils have high P levels. PMID:22639592

  3. Breeding cultivars of barley and mustard containing biochemical mutants

    International Nuclear Information System (INIS)

    Full text: The inactivation of dominant and co-dominant alleles is becoming increasingly important in changing the composition of seed carbohydrates, protein, oil, fibre and secondary products to suit modern food and feed technologies. In barley, breeding lines adapted to south-eastern Australian conditions have been developed containing a waxy endosperm from the Japanese variety 'Sumire Mochi', the high lysine gene lys from cv. 'Hiproly' of Ethiopia, and the induced high lysine mutant gene lys 3a from 'Risoe 1508'. The improved mutant lines yield 12-34% less than the highest yielding feed barley. The lys and lys 3a alleles suppress the formation of prolamins, the waxy allele inhibits the formation of amylose. It seems difficult to modify the background genotype to fully compensate for the reduction of major storage carbohydrate or protein compounds. However, waxy barleys have uses in some human foods and a premium can be paid to producers. The grain of the provisionally-patented waxy cultivar Wasiro is suitable for pearling. It contains 5% β-glucan (soluble fibre) and therefore should be as effective as oat bran for reducing blood cholesterol. In Indian mustard (Brassica juncea), three cultivars differing in date of maturity, each containing the spontaneous mutant alleles for low erucic acid levels in the seed oil, have been developed to produce a high quality, mildly flavoured cooking/salad oil. The concentration of glucosinolates in the seed meal must be reduced to make it palatable and non-toxic to pigs and poultry. Three B. juncea lines were treated in up to four successive generations with gamma rays or EMS. 60,000 seed samples were analysed in subsequent generations. Two induced mutants with reduced glucosinolate concentrations are now available besides 4 naturally-occurring sources with only little reduced yields. Recombination may give a high-yielding low erucic acid and low glucosinolate variety of B. juncea. (author)

  4. Promoter-bound trinucleotide repeat mRNA drives epigenetic silencing in fragile X syndrome. (United States)

    Colak, Dilek; Zaninovic, Nikica; Cohen, Michael S; Rosenwaks, Zev; Yang, Wang-Yong; Gerhardt, Jeannine; Disney, Matthew D; Jaffrey, Samie R


    Epigenetic gene silencing is seen in several repeat-expansion diseases. In fragile X syndrome, the most common genetic form of mental retardation, a CGG trinucleotide-repeat expansion adjacent to the fragile X mental retardation 1 (FMR1) gene promoter results in its epigenetic silencing. Here, we show that FMR1 silencing is mediated by the FMR1 mRNA. The FMR1 mRNA contains the transcribed CGG-repeat tract as part of the 5' untranslated region, which hybridizes to the complementary CGG-repeat portion of the FMR1 gene to form an RNA·DNA duplex. Disrupting the interaction of the mRNA with the CGG-repeat portion of the FMR1 gene prevents promoter silencing. Thus, our data link trinucleotide-repeat expansion to a form of RNA-directed gene silencing mediated by direct interactions of the trinucleotide-repeat RNA and DNA. PMID:24578575

  5. Peroxidase isoenzymes in germinating barley seeds and in seminal roots

    Directory of Open Access Journals (Sweden)

    A. Stroński


    Full Text Available Roots and germinating seeds of summer barley of the cv. Alsa, Antałek, Cebeco 7161, Lubuski, Skrzeszowicki and Union were found to differ in the number of peroxidase isoenzymes. In the germinating seeds from 5 to 8 isoenzymes were found whereas in the two-week-old roots – from 10 to 14 isoenzymes. Four isoenzymes in germinating seeds and eight isoenzymes in seminal roots appeared in all the cultivars tested. The cultivars differed also in the relative activity of the isoenzymes in the tested organs.

  6. Obtaining barley haploid embryos and seedlings using anther culture technique

    International Nuclear Information System (INIS)

    The effect of three barley genotypes (Igri, Arabi abiad, and Taqa 76), three irradiation doses (0, 5, and 10 Gy), and two media (FW, modified FW), on the number of formed embryos, and the ratio between regenerated embryos to green seedlings and albinos, were studied using anther culture. Also the study involved the compatibility between seedling morphology and chromosome number. results indicated significant differences among the genotypes, and media in callus and embryos formation and also in the ratio and albino seedlings. However, the effect of gamma rays dose was significant only on embryos regeneration. A high percentage of compatibility (90%) was obtained between the seedling morphology and chromosome number. (author)

  7. Effects of irradiation on spring barley and sugar beet

    International Nuclear Information System (INIS)

    Presoaked barley seeds were irradiated with 60-500 R of 300 kV X-rays at a dose rate of 600 R/h. The seeds were sown in plastic containers and grown at 200C in a climatic chamber. A significant increase was observed in all investigated parameters except for the plant length till 250 R. Irradiation of presoaked seeds of sugar beet with 1,000-8,000 R resulted in an increase of root weight and sugar yield after 1,000 R. The irradiation of dry seeds, however, did not cause any stimulation. (MG/AK)

  8. RNA interference-mediated inhibition of Hepatitis B Virus replication

    Institute of Scientific and Technical Information of China (English)

    TANG Ni; ZHANG Bingqiang; YAN Ge; PU Dan; GAO Xiaolin; Tong-Chuan He; HUANG Ailong


    Persistent and recurrent infection of hepatitis B virus (HBV) represents one of the most common and severe viral infections of humans, and has caused a formidable health problem in the affected countries. Currently used antiviral drugs have a very limited success on controlling HBV replication and infection. RNA interference (RNAi), a process by which double-stranded RNA (dsRNA) directs sequence-specific degradation of target mRNA in mammalian and plant cells, has recently been used to knockdown gene expression in various species. In this study, we sought to determine whether RNAi-mediated silencing of HBV viral gene expression could lead to the effective inhibition of HBV replication. We first developed RNAi vectors that expressed small interfering RNA (siRNA) and targeted the HBV core or surface gene sequence. Our results demonstrated that these specific siRNAs efficiently reduced the levels of corresponding viral RNAs and proteins, and thus suppressed viral replication. Treatment with siRNA gave the greatest reduction in the levels of HBsAg (92%) and in HBeAg (85%) respectively in the cultured cell medium. Our findings further demonstrated that the RNAi-mediated antiviral effect was sequence-specific and dose-dependent. Therefore, our findings strongly suggest that RNAi-mediated silencing of HBV viral genes could effectively inhibit the replication of HBV, hence RNAi-based strategy should be further explored as a more efficacious antiviral therapy of HBV infection.

  9. Further molecular evidence for the Hordeum vulgare ssp. spontaneum in Tibet as ultimate progenitor of Chinese cultivated barley

    Institute of Scientific and Technical Information of China (English)


    106 accessions of Tibetan wild barley, including 50 accessions of the two-rowed wild barley Hordeum vulgare ssp. spontaneum(HS), 27 accessions of the six-rowed bottle-shaped wild barley H. lagunculiforme(HL) and 29 accessions of the six-rowed wild barley H. agriocrithon(HA) that separately represent different agrigeographical regions of Tibet, were used to study the genetic diversity and genetic differentiation using SSR markers selected from seven barley linkage groups. 229 allelic variants were identified with an average of 7.6 alleles/locus. The average of total number of alleles per locus in HA(6.4) is much higher than that in HS(3.9) and HL(3.4). The genetic diversity and its standard deviation among the three subspecies were in the order of HS>HL>HA. Very significant genetic differentiation was observed among the three subspecies of wild barley. Comparisons of the results from this and previous studies showed a strong Oriental-Occidental differentiation of barley, and that Shannan region of Tibet might be the center of origin of the Tibetan two-rowed wild barley, thus supporting not only the hypothesis of a mono-phyletic origin of cultivated barley but also the proposition that the Tibetan two-rowed wild barley as ultimate progenitor of Chinese cultivated barley.

  10. 大麦雄性不育的遗传研究%Genetic Study on Barley Male Sterility

    Institute of Scientific and Technical Information of China (English)

    张凤英; 刘志萍; 包海柱


    [Objective] The aim was to research the genetic mechanism of barley male sterility, and provide the theoretical reference for breeding strong heterosis hybrid of barley. [Method] Fertility segregation phenomenon, morphological characteristics and main agronomic characters of male sterility character of 4 kinds of barley male sterility materials 2001-17, 2001-37, 2001-84 and 2001-116 and their derived lines were observed and researched. [Result] Barley male sterility existed genetic phenomenon of single dominant nuclear gene caused by environmental stimulation, its sterility controlled by MS, the sterile genotype was MSms. There was stable nucleo-cytoplasmic inheritance on barley male sterility which was controlled by cytoplasmic male sterile gene S and nuclear gene rr, and its genotype was S(rr), this male sterility belonged to CMS type sterility. Temperature had no effect on fertility. [Conclusion] There was stable nucleo-cytoplasmic inheritance on barley male sterility, this result played a positively promoting role in barley practical production.

  11. Assessment of genetic diversity by simple sequence repeat markers among forty elite varieties in the germplasm for malting barley breeding* (United States)

    Wang, Jun-mei; Yang, Jian-ming; Zhu, Jing-huan; Jia, Qiao-jun; Tao, Yue-zhi


    The genetic diversity and relationship among 40 elite barley varieties were analyzed based on simple sequence repeat (SSR) genotyping data. The amplified fragments from SSR primers were highly polymorphic in the barley accessions investigated. A total of 85 alleles were detected at 35 SSR loci, and allelic variations existed at 29 SSR loci. The allele number per locus ranged from 1 to 5 with an average of 2.4 alleles per locus detected from the 40 barley accessions. A cluster analysis based on the genetic similarity coefficients was conducted and the 40 varieties were classified into two groups. Seven malting barley varieties from China fell into the same subgroup. It was found that the genetic diversity within the Chinese malting barley varieties was narrower than that in other barley germplasm sources, suggesting the importance and feasibility of introducing elite genotypes from different origins for malting barley breeding in China. PMID:20872987

  12. Differential RNA expression of Bmy1 during seed development and the association with beta-amylase accumulation, activity, and total protein (United States)

    Four genotypes carrying different Bmy1 intron III alleles were analyzed for differences in Bmy1 RNA expression in developing seeds at 17, 19, and 21 days after anthesis (DAA). Ashqelon and PI 296897, wild barleys which carry the Bmy1.c and Bmy1.d intron III alleles, respectively, had 2.5 to 3- fold...

  13. A complete ancient RNA genome: identification, reconstruction and evolutionary history of archaeological Barley Stripe Mosaic Virus


    Oliver Smith; Alan Clapham; Pam Rose; Yuan Liu; Jun Wang; Allaby, Robin G.


    The origins of many plant diseases appear to be recent and associated with the rise of domestication, the spread of agriculture or recent global movements of crops. Distinguishing between these possibilities is problematic because of the difficulty of determining rates of molecular evolution over short time frames. Heterochronous approaches using recent and historical samples show that plant viruses exhibit highly variable and often rapid rates of molecular evolution. The accuracy of estimate...

  14. Effects of a Dietary Supplement with Barley Sprout Extract on Blood Cholesterol Metabolism. (United States)

    Byun, A Ri; Chun, Hyejin; Lee, Jin; Lee, Sang Wha; Lee, Hong Soo; Shim, Kyung Won


    Objective. Barley sprout (Hordeum vulgare L.) contains 4.97% fat, 52.6% polysaccharide, and 34.1% protein along with a variety of vitamins, minerals, and polyphenolic compounds. Hexacosanol is one such compound from the barley leaf that might improve cholesterol metabolism by decreasing cholesterol synthesis. Method. Therefore, this study was conducted to investigate the effects of barley sprout extract on serum lipid metabolism in healthy volunteers (n = 51). Subjects were randomly divided into two groups: one group consumed a single capsule of barley leaf extract daily (n = 25, 42.48 ± 13.58 years) and the other consumed placebo capsules (n = 26, 40.54 ± 11.1 years) for 12 weeks. Results. After 12 weeks, total cholesterol and low-density lipoprotein- (LDL-) cholesterol were not lower in the barley sprout extract group compared to the placebo group (p = 0.415 and p = 0.351, resp.) and no differences in clinical or laboratory findings were observed between both groups. Conclusion. Our study failed to show significant lipid-lowering effects of barley sprout extract, possibly due to dosage, duration of therapy, and small sample size. Despite our nonsignificant findings, barley sprout has a possibility as a functional health food; therefore future research is needed. PMID:26101533

  15. Effects of a Dietary Supplement with Barley Sprout Extract on Blood Cholesterol Metabolism

    Directory of Open Access Journals (Sweden)

    A Ri Byun


    Full Text Available Objective. Barley sprout (Hordeum vulgare L. contains 4.97% fat, 52.6% polysaccharide, and 34.1% protein along with a variety of vitamins, minerals, and polyphenolic compounds. Hexacosanol is one such compound from the barley leaf that might improve cholesterol metabolism by decreasing cholesterol synthesis. Method. Therefore, this study was conducted to investigate the effects of barley sprout extract on serum lipid metabolism in healthy volunteers (n=51. Subjects were randomly divided into two groups: one group consumed a single capsule of barley leaf extract daily (n=25, 42.48 ± 13.58 years and the other consumed placebo capsules (n=26, 40.54 ± 11.1 years for 12 weeks. Results. After 12 weeks, total cholesterol and low-density lipoprotein- (LDL- cholesterol were not lower in the barley sprout extract group compared to the placebo group (p=0.415 and p=0.351, resp. and no differences in clinical or laboratory findings were observed between both groups. Conclusion. Our study failed to show significant lipid-lowering effects of barley sprout extract, possibly due to dosage, duration of therapy, and small sample size. Despite our nonsignificant findings, barley sprout has a possibility as a functional health food; therefore future research is needed.

  16. Effect of cultivar and year on phyllochron in winter barley

    Directory of Open Access Journals (Sweden)

    Pržulj Novo M.


    Full Text Available Development and growth of leaves in cereals significantly affects grain yield since dry matter accumulation depends on the leaf area that intercepts light. Phyllochron (PHY is defined as time interval between the emergences of successive leaves on the main stem. The aim of this study was to determine the effect of year and cultivar on phyllochron in winter barley. Twelve cultivars of winter barley differing in origin and time of anthesis were tested during six growing seasons (GS, from 2002/03 to 2007/08. The highest PHY across GSs was determined in the two-rowed cultivar Cordoba (81.6°Cd and the lowest in the two-rowed cultivar Novosadski 581 (71.0°Cd. The early cultivars had fast leaf development, the medium cultivars medium and the late cultivars slow development, 72.5°Cd, 75.6°Cd and 78.9°Cd, respectively. The tested cultivars showed significant variability in the PHY, which can be used for selecting most adaptable genotypes for specific growing conditions.

  17. Influence of caffeine on fractionated irradiation in wheat and barley

    International Nuclear Information System (INIS)

    Fractionated irradiation is one of the important methods studying repair of radiation damage. Some authors reported that caffeine, a repair inhibitor, had no effects on fractionated irradiation in human cell, animal cell and Vicia faba. And they concluded that caffeine inhibited the repair of potentially lethal damage (PLD), but did not inhibit the repair of sub-lethal damage (SLD). In this study, the effect of caffeine on the repair of PLD and SLD were reexamined in wheat and barley systems. The germinating seeds of wheat of barley were pre-irradiation treated 3 h with 5 x 10-3 mol/L caffeine, then they were irradiated by single or fractionated X-ray doses. The results showed that after caffeine treatment the effect of fractionated irradiation was disappeared. In this case, caffeine not only inhibited the repair of PLD but also inhibited the repair SLD. In previous fracttionated radiation experiments, the repairs during interval were discussed in detail, but the repairs after whole irradiation were neglected. According to the resuls of this experiment and some early reported about fractionated irradiation, the repair efficiency during interval and the repair function after whole irradiation were discussed

  18. Variability and inheritance of the tillering in barley hybrids

    Directory of Open Access Journals (Sweden)

    Mandić Milomirka


    Full Text Available Productive tillering is a very important trait which influences the degree of barley lodging resistance. Five dive-gent genotypes of two-rowed winter barley (Vada, Đerdap, NS-293, Jagodinac and Sladoran have been selected for diallel crossing in order to study the mode of inheritance, the gene effect and the components genetic variance for the productive tillering in F1 and F2 generation. The test of the significance of the generations' mean values related to the parental average was used for inheritance mode determinations (KRALJEVIC-BALALIC et al., 1991 and the genetic variance components and regression VrWr analysis from diallel crossings were made using the method of MATHER and JINKS (1971. The variability of the investigated trait differed. The cross combination Đerdap x Jagodinac had the highest coefficient of variance (39.78%. Different modes of inheritance (partial dominance, dominance and over dominance and partial dominance were found in the F1 and F2 generation, respectively. The genetic variance components, average degree of dominance and regression line indicated partial dominance in the inheritance of tillering. The range of the obtained values of heritability for the tillering was found to be very wide (0.02-0.47. The cross combinations Đerdap x Jagodinac and Vada x Đerdap were selected for future breeding.

  19. In Vitro Biochemical Characterization of All Barley Endosperm Starch Synthases

    Directory of Open Access Journals (Sweden)

    Jose Antonio Cuesta-Seijo


    Full Text Available Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs. While the overall starch synthase (SS reaction is known, the functional differences between the five SS classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes. Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has maltoligosaccharides and not polysaccharides as its preferred substrates.

  20. Transfer of radiocaesium to barley, rye grass and pea

    International Nuclear Information System (INIS)

    In areas with intensive farming, as in Denmark, it is of great interest to identify possible countermeasures to be taken in order to reduce the longterm effects of radioactive contamination of arable land. The most important longer-lived radionuclides from the Chernobyl were 137Cs and 134Cs. The aim of the present project was to identify crops with relatively low or high root uptake of these two isotopes. Although such differences may be small, a shift in varieties might be a cost-effective way to reduce collective doses. The experiment was carried out at Risoe National Laboratory in the summer of 1988. The species used were: spring barley (Hordeum vulgare L) varieties: Golf, Apex, Anker, Sila; Perennial rye grass (Lolium perenne L.) varieties: Darbo (early) and Patoro (late); Italian rye-grass (Lolium multiflorum) variety: Prego; and pea (Pisum arvense L.) variety: Bodil. Each crop was grown in two types of soil, a clay-loam and an organic soil. 137Cs was added to the clay-loam. The organic soil, which was contaminated with 137Cs from the Chernobyl accident, was supplied with 134Cs. Sila barley and Italian rye-grass were identified among the species tested as plants with a relative high uptake of radio-caesium. (author)

  1. Does boron affect hormone levels of barley cultivars?

    Directory of Open Access Journals (Sweden)

    Muavviz Ayvaz


    Full Text Available Background: When mineral nutrients are present in excess or in inadequate amounts, their effects can be severe in plants and can be considered as abiotic stress. In this study, we report how hormonal levels in barley cultivars respond to the toxic effect of boron, an essential plant micronutrient. Material and methods: Two different barley (Hordeum vulgare cultivars (Vamik Hoca and Efes 98 were used as a study material. Boron was applied in three different concentrations (0, 10, 20 ppm to plants that had grown from seeds for four weeks. Plants were harvested, stem-root length and stem-root dry-fresh weight content were determined. For further analysis, chlorophyll, total protein, endogenic IAA and ABA content analyses were carried out. Results: According to the data obtained, plant growth and development decreased with increasing boron concentrations. With increasing boron concentrations, soluble total protein increased in both cultivars. Boron application led to increased endogenic IAA content in both cultivars. 10 and 20 ppm boron application led to increased endogenic ABA content in Vamik Hoca cultivar whereas endogenic ABA content decreased in Efes 98. Absence of boron application led to increased endogenic IAA and ABA content in both cultivars. Conclusion: As a result, the response to boron is different in the two cultivars and Efes 98 may be more resistant to the toxicity than Vamik Hoca cultivar.

  2. How barley growing conditions and its output change in Hungary

    Directory of Open Access Journals (Sweden)

    Éva Erdélyi


    Full Text Available There is no doubt that climate change has started. It is very important to make effort in developing impact analyses and adaptation strategies. First we were investigated how theproduction risk of winter barley is changing with time using the E,V efficiency criterion. Based on the regional yearly production data of the crop, we can conclude that beside other non-climatic effects, the changing climate has considerable impact on crops yield; its variability is increasing with the variability of meteorological parameters. We have used production data from 1951 to nowadays. Next, using comparison analyses for climate scenarios, we predict what we can expect in the future. For detecting the reasons of risk increase in the past, and forecasting the potential main points of future risk we have analysed statistically whether the climate needs of winter barley will be satisfied ornot in its important periods of growing. Frequency calculations were made based on the daily meteorological data. The situation doesn’t show big change, but It is no doubt that the anomalies of the indicators have been becoming more and more frequent. The morefrequent the extreme weather events are, the more we can be convinced of uncertainty.


    Directory of Open Access Journals (Sweden)

    Marián Tomka


    Full Text Available Identification and characterization of genotypes is essential for improving the quality of cultivated varieties in breeding programs. Information about the origin of varieties can help farmers in selecting appropriate varieties to specific growing conditions or end use of crops. A set of ten microsatellite markers was used to describe genetic diversity in a sample of 30 barley (Hordeum vulgare L. genotypes. A total of 55 different alleles were amplified using ten SSR markers localized on chromosomes 1H, 2H, 3H, 5H, 6H, 7H with an average number of 5.5 alleles per locus. On the basis of allele frequencies we have calculated diversity index, polymorphic information content and index of probability, which have mean values of 0.664; 0.643 and 0.126 respectively. These values indicate high differentiation ability of SSR markers. In the created dendrogram using hierarchical cluster analysis using UPGMA algorithm we were able to differentiate all 30 barley genotypes. The results show that DNA markers are suitable for the identification and differentiation of genotypes and indicated the effectiveness of microsatellite markers to describe genetic diversity.

  4. Competition and dry matter yield in intercrops of barley and legume for forage

    Directory of Open Access Journals (Sweden)



    Full Text Available For increasing land use efficiency intercropping plays a pivotal role. Barley (Hordeum vulgare L., vetch (Vicia villosa, and grass pea (Lathyrus sativus L. monocultures as well as mixtures of barley with each of the above legumes, in three seeding ratios (i.e., barley: legume 75:25, 50:50 and 25:75, based on seed numbers were used to investigated forage yield and competition indices such as land equivalent ratio (LER,competitive ratio (CR, relative crowding coefficient (RCC, aggressivity (A, actual yield loss (AYL, monetary advantage index (MAI and intercropping advantage (IA.The experimental was arranged asa randomized complete block design (RCBD with three replications.The results showed that intercropping reduced the dry matter yield of the three component plants, compared with their respective monocrops. The greatest value of total dry matter yield was obtained from barley25-grass pea75 (5.44 t ha-1 mixture, followed by grass pea sole crop (4.99 t ha-1. The total AYL values were positive and greater than 0 in all mixtures, indicating an advantage from intercropping over sole crops. Intercropped barley had a higher relative crowding coefficient (K=1.64 than intercropped legumes (K=1.20, indicating that barley was more competitive than legumes in mixtures. Furthermore, grass pea was more competitive than vetch in mixtures with barley. The highest LER, SPI and MAI were obtained when barley was mixed at a rate of 25% with 75% seed rate of grass pea. It is concluded that intercropping of barley with grass pea has a good potential to improve the performance of forage with high land-use efficiency.

  5. Predicting the Effect of Some Yield Stabilizing Agents on Increasing Drought Resistance in Barley

    Directory of Open Access Journals (Sweden)

    S.A. Ouda


    Full Text Available This study was carried out to predict the role of two yield stabilizing agents (magnesium carbonate and sodium salicylate on barley yield under water stress condition. Four hulled barley cultivars and two hull-less were sprayed with magnesium carbonate or sodium salicylate twice during vegetative growth and the last irrigation was skipped. Different growth and yield parameters were measured for five bordered plants. Data for mean temperature and relative humidity % were collected and averaged over the two growing seasons. Three groups of prediction equations were developed. The first group is an overall of the six barley cultivars prediction equations under the above mentioned treatments using plant attributes and weather parameters. The second group predicted barley yield over all the normal (hulled cultivars only. The third group predicted barley yield over the two hull-less barley cultivars. Results indicated that the highest reduction in yields as result of skipping the last irrigation were obtained by Giza 126. Whereas, the lowest reduction in biological yields were obtained by the two hull-less cultivars. The application of magnesium carbonate had better effect on the yield of barley cultivars than the application of sodium salicylate. Results also showed that both temperature and relative humidity % were highly and negatively correlated with barley yields. The three yield attributes were positively correlated with barley grain, straw and biological yields, except for plant height, which was negatively correlated with grain yield. All the three developed groups of prediction equations had high degree of precision because R2 was high and SE% was low. Thus, it allowed us to predicted the expected yield under optimum conditions, under water stress and under the application of yield stabilizing agents, in addition to water stress. Furthermore, percent reduction in yield as a result of skipping the last irrigation and the improvement in yield

  6. Analysis on Interaction between Genotype of Four Main Flavonoids of Barley Grain and Environment

    Institute of Scientific and Technical Information of China (English)

    Tao YANG; Chengli DUAN; Yawen ZENG; Juan DU; Shuming YANG; Xiaoying PU; Shengchao YANG


    [Objective] This study aimed to analyze the interaction between genotype of flavonoids of barley grain and environment, to increase the flavonoid content of barley grain in cultivation and breeding. [Method] In this study, the content of cate- chin, myricetin, quercetin and kaempferol of barley grain planted in Kunming, Qujing and Baoshan were determined by HPLC, and the genotype, environment, genotype- environment interaction of the flavonoid content of barley grain were analyzed. [Result] According to the experimental results, the genotype variance, environmental variance and G x E interaction variance of catechin and kaempferol contents show the same trend: genotype variation 〉 environmental variation 〉 G × E interaction variation, which all reach a extremely significant level; the genotype variance, envi- ronmental variance and G × E interaction variance of quercetin and total flavonoid contents show the same trend: genetype variation 〉 G × E interaction variation 〉 environmental variation, which all reach a extremely significant level; the genotype variance and environmental variance of myricetin content both reach a extremely sig- nificant level, while the G × E interaction variance reaches a significant level, showing an order of genotype variation 〉 environmental variation 〉 G × E interaction variation; the genotype variance, environmental variance and G x E interaction vari- ance of total flavonoid content show an order of genotype variation 〉 environmental variation 〉 G × E interaction variation. Among different barley varieties, Ziguang- mangluoerling and Kuanyingdamai in Qujing, Kunming and Baoshan have relatively high content of quercetin, while other barley varieties barely contain any quercetin. The grains of Ziguangmangluoerling and Kuanyingdamai are purple, while the grains of other barley varieties are yellow. [Conclusion] Four main flavonoids and the total flavonoids of barley grain are mainly under genetic control and

  7. Targeted modification of storage protein content resulting in improved amino acid composition of barley grain

    DEFF Research Database (Denmark)

    Sikdar, Md. Shafiqul Islam; Bowra, S; Schmidt, Daiana;


    C-hordein in barley and ω-gliadins in wheat are members of the prolamins protein families. Prolamins are the major component of cereal storage proteins and composed of non-essential amino acids (AA) such as proline and glutamine therefore have low nutritional value. Using double stranded RNAi...... family members. Analysis of the AA composition of the transgenic lines showed that the level of essential amino acids increased with a concomitant reduction in proline and glutamine. Both the barley C-hordein and wheat ω-gliadin genes proved successful for RNAi-gene mediated suppression of barley C...

  8. Effect of Stem Rust on the Quality of Selected Barley Genotypes


    Njau, P. N.; O. D. Otaye; Tabu, I. M.; Mwando, K. E.


    Stem rust, (Puccinia graminis f.sp. tritici) is a catastrophic disease of barley. Previously stem-rust-tolerant genes were incorporated in genotypes of wheat grown in Kenya, but in 1999, a new race Ug99 that is virulent to the genes was detected in Uganda. The new race spread rapidly and, in 2001, stem rust Ug99 isolates were detected in Kenya. Although barley is an important crop affected by stem rust, limited work has been done to it. In this study 20 barley cultivars from Kenya and from In...

  9. High capacity of plant regeneration from callus of interspecific hybrids with cultivated barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Jensen, C. J.; Andersen, B.; Bothmer, R. von


    Callus was induced from hybrids between cultivated barley (Hordeum vulgare L. ssp. vulgare) and ten species of wild barley (Hordeum L.) as well as from one backcross line ((H. lechleri .times. H. vulgare) .times. H. vulgare). Successful callus induction and regeneration of plants were achieved from...... explants of young spikes on the barley medium J 25-8. The capacity for plant regeneration was dependent on the wild parental species. In particular, combinations with four related wild species, viz. H. jubatum, H. roshevitzii, H. lechleri, and H. procerum, regenerated high numbers of plants from calli....

  10. Barley (Hordeum vulgare L.) cysteine proteases: heterologous expression, purification and characterization

    DEFF Research Database (Denmark)

    Rosenkilde, Anne Lind; Dionisio, Giuseppe; Holm, Preben Bach;


    During germination of barley seeds, mobilization of protein is essential and cysteine proteases accounts for more than 90 % of the total proteolytic activity in the degradation of barley seed storage proteins. Cysteine proteases exist as pro-enzyme and is activated through reduction of the active...... site cysteines and by removal of the pro-domain. The complement of cysteine proteases is comprehensive and for detailed studies of the individual components of this complement, a fast and efficient eukaryotic expression platform is highly desirable. A cDNA clone of the barley key cysteine endoprotease...

  11. Distinct developmental defense activations in barley embryos identified by transcriptome profiling

    DEFF Research Database (Denmark)

    Nielsen, ME; Lok, F; Nielsen, Henrik Bjørn


    analyses of > 22,000 genes, which together with measurements of jasmonic acid and salicylic acid during embryo development provide new information on the initiation in the developing barley embryo of at least two distinct types of developmental defense activation (DDA). Early DDA is characterized by the up......-regulation of several PR genes is notable. Throughout barley embryo development, there are no indications of an increased biosynthesis of either jasmonic acid or salicylic acid. Collectively, the results help explain how the proposed DDA enables protection of the developing barley embryo and grain for purposes...

  12. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.;


    .9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...

  13. Expression of Nudix hydrolase genes in barley under UV irradiation (United States)

    Tanaka, Sayuri; Sugimoto, Manabu; Kihara, Makoto

    Seed storage and cultivation should be necessary to self-supply foods when astronauts would stay and investigate during long-term space travel and habitation in the bases on the Moon and Mars. Thought the sunlight is the most importance to plants, both as the ultimate energy source and as an environmental signal regulating growth and development, UV presenting the sunlight can damage many aspects of plant processes at the physiological and DNA level. Especially UV-C, which is eliminated by the stratospheric ozone layer, is suspected to be extremely harmful and give a deadly injury to plants in space. However, the defense mechanism against UV-C irradiation damage in plant cells has not been clear. In this study, we investigated the expression of Nudix hydrolases, which defense plants from biotic / abiotic stress, in barley under UV irradiation. The genes encoding the amino acid sequences, which show homology to those of 28 kinds of Nudix hydrolases in Arabidopsis thaliana, were identified in the barley full-length cDNA library. BLAST analysis showed 14 kinds of barley genes (HvNUDX1-14), which encode the Nudix motif sequence. A phylogenetic tree showed that HvNUDX1, HvNUDX7, HvNUDX9 and HvNUDX11 belonged to the ADP-ribose pyrophosphohydrolase, ADP-sugar pyrophosphohydrolase, NAD(P)H pyrophosphohydrolase and FAD pyrophosphohydrolase subfamilies, respectively, HvNUDX3, HvNUDX6, and HvNUDX8 belonged to the Ap _{n}A pyrophosphohydrolase subfamilies, HvNUDX5 and HvNUDX14 belonged to the coenzyme A pyrophosphohydrolase subfamilies, HvNUDX12 and HvNUDX13 belonged to the Ap _{4}A pyrophosphohydrolase subfamilies. Induction of HvNUDX genes by UV-A (340nm), UV-B (312nm), and UV-C (260nm) were analyzed by quantitative RT-PCR. The results showed that HvNUDX4 was induced by UV-A and UV-B, HvNUDX6 was induced by UV-B and UV-C, and HvNUDX7 and HvNUDX14 were induced by UV-C, significantly. Our results suggest that the response of HvNUDXs to UV irradiation is different by UV

  14. Steam gasification of wheat straw, barley straw, willow and giganteus

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, L.K. [FLS Miljoe A/S, Valby (Denmark); Rathmann, O.; Olsen, A. [Risoe National Lab., Roskilde (Denmark); Poulsen, K. [ReaTech, CAT Science Centre Roskilde (Denmark)


    A thorough experimental study of the H{sub 2}O gasification char-reactivity of wheat straw, barley straw, willow and giganteus at 1-10 bar total pressure, 0.15-1.5 bar H{sub 2}O and O-1.0 bar H{sub 2} and 750-925 C, was performed in a Pressurized Thermogravimetric Analyzer. There were a total of 58 experiments. Kinetic experiments with char of wheat straw at 10 bar total pressure showed that the reactivity increases with rising temperature and increasing partial pressure of H{sub 2}O,, while it decreases with increasing partial pressure of H{sub 2}. At constant partial H{sub 2}O pressure in the absence of H-2, an indication of a negative influence by the total pressure was observed. Except for the effect of total pressure, the experimental data were analyzed by means of the Langmuir-Hinshelwood equation, including both inhibition by H{sub 2} and reactivity limitation at high H{sub 2}O concentration. Also, the reactivity profile was assumed to be independent of temperature and reactant concentration. The value found for the main activation energy E{sub 1}, 149 kJ/mole, describing the temperature dependence at low H{sub 2}O concentration, is close to experimental values for biomass reported by other workers. At conditions relevant to both fluid-bed and entrained-flow gasifier types the present results indicate an inhibiting effect of the product gas H{sub 2}, reducing the reactivity by a factor of up to 10. A screening study of steam gasification of barley straw, willow and giganteus in addition to the wheat straw showed reaction rates with rather equal temperature dependence. However, at equal temperatures, there was a spread in reactivity of about 10 times from the lowest (wheat and giganteus) to the highest (barley), probably due to different contents of catalytic elements. (au) 5 tabs., 15 ills., 10 refs.

  15. Secretomics identifies Fusarium graminearum proteins involved in the interaction with barley and wheat

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, Jens D.; Svensson, Birte; Jørgensen, Hans J. L.; Collinge, David B.; FINNIE, CHRISTINE


    wheat flour as the sole nutrient source to mimic the host–pathogen interaction. A gel‐based proteomics approach was employed to identify the proteins secreted into the culture medium. Sixty‐nine unique fungal proteins were identified in 154 protein spots, including enzymes involved in the degradation of...... between wheat and barley flour medium were mainly involved in fungal cell wall remodelling and the degradation of plant cell walls, starch and proteins. The in planta expression of corresponding F. graminearum genes was confirmed by quantitative reverse transcriptase‐polymerase chain reaction in barley......Fusarium graminearum is a phytopathogenic fungus primarily infecting small grain cereals, including barley and wheat. Secreted enzymes play important roles in the pathogenicity of many fungi. In order to access the secretome of F. graminearum, the fungus was grown in liquid culture with barley or...

  16. Differentially Expressed Genes between Two Barley Cultivars Contrasting in Drought Tolerance

    Institute of Scientific and Technical Information of China (English)

    P.G. Guo; M. Baum; R.H. Li; S. Grando; R.K. Varshney; J. Valkoun; S. Ceccarelli; A. Grane


    @@ Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas. A number of genes have been described that respond to drought at the transcriptional level (Seki et al., 2002; Cheong et al.,2003).

  17. The enhanced callose deposition in barley with ml-o powdery mildew resistance genes

    DEFF Research Database (Denmark)

    Skou, Jens-Peder


    Carborundum treatment of barley leaves induced a callose deposition which was detected as diffuse blotches in the epidermal cells of susceptible barleys and as deeply stained tracks along the scratches in barleys with the ml-o powdery mildew resistance gene. Subsequent inoculation with powdery...... mildew resulted in appositions that enlarged inversely to their size in the respective varieties when inoculated without carborundum treatment. Aphids sucking the leaves resulted in rows of callose containing spots along the anticlinal cell walls. The spots were larger in the ml-o mutant than...... in the mother variety. Callose was deposited in connection with the pleiotropic necrotic spotting in barleys with the ml-o gene. Modification of the necrotic spotting by crossing the ml-o gene into other gene backgrounds did not result in any change in the size of appositions upon inoculation with powdery...

  18. Observations of xenon gas-treated barley cells in solution by atomic force microscopy. (United States)

    Yoshino, T; Sotome, I; Ohtani, T; Isobe, S; Oshita, S; Maekawa, T


    Barley cells cut from a sprout were exposed to either air or high-pressure xenon gas for 3 days and the surface of those cells was observed by atomic force microscopy (AFM) to examine the effect of the gas treatment. This method enabled the direct observation of the fresh surface of the barley cells in solution at high resolution. The cuticle layer was preserved on the primary cell wall of 0.48 MPa xenon gas-treated barley cells, while air-treated barley cells lost the cuticle layer from the primary cell wall. These findings indicate that the high-pressure xenon gas treatment is effective to preserve the cuticle layer attached to the primary cell wall. AFM is a powerful tool for the observation of the surface structure of living plant cells in solution. PMID:11108038

  19. Cereal bioengineering: amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Hebelstrup, Kim; Carciofi, Massimiliano; Jensen, Susanne Langgård;


    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were engineered by transgenic methods. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch branching enzymes (SBEIIa, SBEIIb and SBEI) by a chimeric hairpin...... demonstrates for the first time a way for production of pure amylose in plants with limited yield loss. In a different barley line endosperm specific overexpression of glucan water dikinase from potato (StGWD) was conducted. The content of phosphate esters in starch from consecutive generations (T0 and T1) of...... the presence of a general mechanism in starch degradation in the plant kingdom where phosphorylation carried out by ectopic expression of StGWD tags barley starch granules for degradation by endogenous enzymes. Together this work shows two new strategies for in planta starch bioengineering of cereals...

  20. Relationship between soil cellulolytic activity and suppression of seedling blight of barley in arable soils

    DEFF Research Database (Denmark)

    Rasmussen, Peter Have; Knudsen, I.; Elmholt, S.;


    The objective was to investigate the relationship between soil suppression of seedling blight of barley caused by Fusarium culmorum (W.G. Smith) Sacc. and the soil cellulolytic activity of beta-glucosidase, cellobiohydrolase and endocellulase. Disease suppression was investigated in bioassays with...... test soils mixed with sand, and barley seeds inoculated with F. culmorum. After 19 days, disease severity was evaluated on the barley seedlings. Soil cellulolytic activities were measured using 4-methylumbelliferyl-labelled fluorogenic substrates, and were expressed as V-max values obtained by using...... content of total C and N. From the preliminary results obtained, it is proposed that the cellulolytic activity can be used as an enzymatic approach to study the microbial turnover of organic matter in soils and as indicator of seedling blight of barley caused by F. culmorum. (C) 2002 Elsevier Science B...

  1. Genotypes-Independent Optimization of Nitrogen Supply for Isolated Microspore Cultures in Barley (United States)

    Lu, Ruiju; Chen, Zhiwei; Gao, Runhong; He, Ting; Wang, Yifei; Xu, Hongwei; Guo, Guimei; Li, Yingbo


    To establish a high-efficiency system of isolated microspore culture for different barley genotypes, we investigated the effects of nitrogen sources and concentrations on callus induction and plant regeneration in different barley genotypes. The results showed that the organic nitrogen sources greatly increased the callus induction, and the great reduction of total nitrogen sources would significantly decrease the callus induction. And the further optimization experiments revealed that the increasing of organic nitrogen sources was much important in callus induction while it seemed different in plant regeneration. Based on the great effects of organic nitrogen on callus induction, the medium of N6-ANO1/4-2000 might be the best choice for the microspore culture system. In addition, the phylogenetic analysis indicated that there were clear differences of genetic backgrounds among these barley genotypes, and it also suggested that this medium for microspore culture had widespread utilization in different barley genotypes. PMID:27525264


    Directory of Open Access Journals (Sweden)

    Štefan Dráb


    Full Text Available Malting quality of barley depends on genetic and agro-ekological factors. Chemical composition of malting barley and its technological parameters are very important for malting and brewing, due to this fact the quality of barley must be strictly evaluated. The aim of this work was to evaluate the influence of variety, locality and year of production on the 5 technological parameters of malt: extract, relative extract at 45 °C, Kolbach index, diastatic power and friability. It was found out that the barley variety significantly influenced the following parameters: extract, relative extract and diastatic power. The growing locality weakly influenced qualitative parameters i.e. Kolbach index and relative extract at 45°C. The study confirmed the most significant impact of the year on the Kolbach index and friability.

  3. Extraction of starch from hulled and hull-less barley with papain and aqueous sodium hydroxide


    Sharma, Priyanka; Tejinder, S.


    Starch was isolated from hulled (VJM 201) and hull-less (BL 134) barley with papain and aqueous sodium hydroxide treatments. For enzyme-assisted extraction, barley was steeped in water containing 0.2 % SO2 + 0.55 % lactic acid at 50° ± 2 °C for 4–5 h. The slurry was mixed with 0.4–2.0 g papain/kg barley and incubated at 50° ± 2 °C for 1–5 h. Aqueous sodium hydroxide (0.01–0.05 M) was added to the finely ground barley meal. The alkaline slurry was incubated at ambient temperature (25° ± 2 °C) ...

  4. Tracer study on sulphur use efficiency in potato-barley sequence on acid soil of Shimla

    International Nuclear Information System (INIS)

    Controlled studies were conducted on acidic soil of Fagu (Shimla) to study the efficiency of labelled ammonium sulphate as effected by farmyard manure (FYM) on potato (Solanum tuberosum L.) and its residual effect on succeeding barley (Hordeum vulgare L.). The direct and residual effects of FYM and sulphur on dry matter yield and S concentration in potato and barley plants were significant. Applied FYM had a positive effect on radioassay values i.e. % Sdff and % S utilization by potato from labelled S carrier, whereas, the residual effect of applied S on barley was more than its direct effect on potato. Results indicate that combined application of S and FYM resulted in 3.4 per cent more S contribution to barley crop and was reflected in % S utilization values. (author)

  5. Knockdown of midgut genes by dsRNA-transgenic plant-mediated RNA interference in the hemipteran insect Nilaparvata lugens.

    Directory of Open Access Journals (Sweden)

    Wenjun Zha

    Full Text Available BACKGROUND: RNA interference (RNAi is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. METHODOLOGY/PRINCIPAL FINDINGS: The Hemipteran insect brown planthopper (Nilaparvata lugens Stål is a typical phloem sap feeder specific to rice (Oryza sativa L.. To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. CONCLUSIONS: Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants.

  6. The barley genome sequence assembly reveals three additional members of the CslF (1,3;1,4-β-glucan synthase gene family.

    Directory of Open Access Journals (Sweden)

    Miriam Schreiber

    Full Text Available An important component of barley cell walls, particularly in the endosperm, is (1,3;1,4-β-glucan, a polymer that has proven health benefits in humans and that influences processability in the brewing industry. Genes of the cellulose synthase-like (Csl F gene family have been shown to be involved in (1,3;1,4-β-glucan synthesis but many aspects of the biosynthesis are still unclear. Examination of the sequence assembly of the barley genome has revealed the presence of an additional three HvCslF genes (HvCslF11, HvCslF12 and HvCslF13 which may be involved in (1,3;1,4-β-glucan synthesis. Transcripts of HvCslF11 and HvCslF12 mRNA were found in roots and young leaves, respectively. Transient expression of these genes in Nicotiana benthamiana resulted in phenotypic changes in the infiltrated leaves, although no authentic (1,3;1,4-β-glucan was detected. Comparisons of the CslF gene families in cereals revealed evidence of intergenic recombination, gene duplications and translocation events. This significant divergence within the gene family might be related to multiple functions of (1,3;1,4-β-glucans in the Poaceae. Emerging genomic and global expression data for barley and other cereals is a powerful resource for characterising the evolution and dynamics of complete gene families. In the case of the CslF gene family, the results will contribute to a more thorough understanding of carbohydrate metabolism in grass cell walls.

  7. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  8. Linkage mapping of putative regulator genes of barley grain development characterized by expression profiling

    Directory of Open Access Journals (Sweden)

    Wobus Ulrich


    Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference

  9. Efficiency of new fungal cellulase systems in boosting enzymatic degradation of barley straw lignocellulose

    DEFF Research Database (Denmark)

    Rosgaard, L.; Pedersen, S.; Meyer, Anne Boye Strunge


    the catalytic glucose yields significantly as compared to those obtained with the benchmark Celluclast + Novozyme 188 blend. A comparison of glucose yields obtained on steam-pretreated barley straw and microcrystalline cellulose, Avicel, indicated that the yield improvements were mainly due to the presence......This study examined the cellulytic effects on steam-pretreated barley straw of cellulose-degrading enzyme systems from the five thermophilic fungi Chaetomium thermophilum, Thielavia terrestris, Thermoascus aurantiacus, Corynascus thermophilus, and Myceliophthora thermophila and from the mesophile...

  10. Influence of barley straw and submerged macrophytes on fishpond wastewater quality


    Ghobrial, M.G.; Okbah, M.A.; Gharib, S.M.; A. M. Soliman


    Barley straw has received, recently, considerable attention as an algicide, which could be used to control algal growth in fishponds. It is regarded as cost-effective, user friendly and environmentally sounds. On the other hand, the submerged wetland macrophytes are crucial for the stabilization of clear water state in shallow lakes, by their active production of anti-algal compounds (allelochemicals) through allelopathy. Microcosm experiments using barley straw and the submerged macrophytes:...

  11. Sanitary state and yielding of spring barley as dependent on soil tillage method


    Tomasz P. Kurowski; Marek Marks; Agnieszka Kurowska; Krzysztof Orzech


    The effects of traditional tillage cultivation (control treatment), no tillage (instead of tillage the soil was loosened with scruff), and direct sowing (with a special drill into unploughed soil) on the health of spring barley cultivar. Klimek were compared in three-field crop rotation (field bean, winter wheat, spring barley) in an experiment performed in the years 1997-1999 on the soil of a good wheat complex. The results of phytopathological observations carried out over the vegetation se...

  12. Genetically engineered stem rust resistance in barley using the Rpg1 gene


    Horvath, Henriette; Rostoks, Nils; Brueggeman, Robert; Steffenson, Brian; von Wettstein, Diter; Kleinhofs, Andris


    The stem-rust-susceptible barley cv. Golden Promise was transformed by Agrobacterium-mediated transformation of immature zygotic embryos with the Rpg1 genomic clone of cv. Morex containing a 520-bp 5′ promoter region, 4,919-bp gene region, and 547-bp 3′ nontranscribed sequence. Representatives of 42 transgenic barley lines obtained were characterized for their seedling infection response to pathotype Pgt-MCC of the stem rust fungus Puccinia graminis f. sp. tritici. Golden Promise was converte...

  13. Hepatoprotective effect of feeding celery leaves mixed with chicory leaves and barley grains to hypercholesterolemic rats


    Abd El-Mageed, Nehal M.


    Celery, chicory leaves, and barley grains are valuable in weight loss diets and regulate lipid metabolism. They may reduce risk of fatty liver. The present study aimed to investigate the effect of diet supplementation with celery, chicory, and barley powder on liver enzymes and blood lipids in rats fed with cholesterol-enriched diet. This study used four groups of rats fed with 3% cholesterol were supplemented diet to induce hypercholesterolemia and one group was fed on cholesterol-free basal...

  14. Transgenic Production of an Anti HIV Antibody in the Barley Endosperm


    Goetz Hensel; Doreen M Floss; Elsa Arcalis; Markus Sack; Stanislav Melnik; Friedrich Altmann; Twan Rutten; Jochen Kumlehn; Eva Stoger; Udo Conrad


    Barley is an attractive vehicle for producing recombinant protein, since it is a readily transformable diploid crop species in which doubled haploids can be routinely generated. High amounts of protein are naturally accumulated in the grain, but optimal endosperm-specific promoters have yet to be perfected. Here, the oat GLOBULIN1 promoter was combined with the legumin B4 (LeB4) signal peptide and the endoplasmic reticulum (ER) retention signal (SE)KDEL. Transgenic barley grain accumulated up...

  15. Comparative Proteomic Analysis of Aluminum Tolerance in Tibetan Wild and Cultivated Barleys


    Dai, Huaxin; Cao, Fangbin; Chen, Xianhong; Zhang, Mian; Ahmed, Imrul Mosaddek; Chen, Zhong-Hua; Li, Chengdao; Zhang, Guoping; Wu, Feibo


    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation t...

  16. Effects of Harvesting Time on Nutritional Value of Hydroponic Barley Production


    Akbağ, Hande Işıl; TÜRKMEN, Onur Sinan; BAYTEKİN, Harun; Yurtman, İsmail Yaman


    In this study aimed that the effects of different harvesting times on the nutritional value of barley fodder producing in hydroponic system. Barley fodders were harvested on the 4th, 7th, 10th and 13th days following sowing date. Analysis performed for determining the chemical composition and organic matter digestibility (OMD) and ME content with in vitro gas production technique. It was determined that the DM content was decreased, the CP content was not changed significantly, cell wall cont...

  17. A new allele of acid soil tolerance gene from a malting barley variety


    Bian, Miao; Jin, Xiaoli; Broughton, Sue; Zhang, Xiao-Qi; Zhou, Gaofeng; Zhou, Meixue; Zhang, Guoping; Sun, Dongfa; Li, Chengdao


    Background Acid soil is a serious limitation to crop production all over the world. Toxic aluminium (Al) cations in acid soil inhibit root growth and reduce yield. Although a gene tolerant to acid soil has been identified, it has not been used in malting barley breeding, which is partly due to the acid soil tolerance gene being linked to unfavorable malting quality traits. Results A Brazilian malting barley variety Br2 was identified as tolerant to acid soil. A doubled haploid (DH) population...

  18. Some cytogenetic effects induced in barley by the treatments with hydroalcoholic rosemary extract


    Ionela Mierlici; Gogu Giorghita; Gabriela Capraru


    The paper presents some results regarding the cytogenetic effects induced in barley by the treatments with rosemary extract (Rosmarinus officinalis). It was proved that the treatment with this extract upon the barley caryopses had as effect the stimulation of the mitotic division in the radicle apex of the species and did not lead to important cytogenetic changes (chromosome aberrations) in the ana-thelophase of the radicle mitoses.

  19. Quantitative Analysis of the Early Powdery Mildew Infection Stages on Resistant Barley Genotypes

    DEFF Research Database (Denmark)

    Andersen, J. B.; Torp, J.


    A classification system was developed, that allowed quantification of the leaf surface development of the barley powdery mildew fungus on barley. An experiment with Manchuria and Pallas as susceptible controls and 4 resistance gene each represented by three lines with different gene backgrounds s...... penetration attempts. This number increased as the degree of resistance increased, i.e. the ESH frequency decreased. The penetration stage also invariably proved to be the limiting stage, where the largest proportion of fungal propagules was stopped....

  20. Determinants of barley grain yield in drought-prone Mediterranean environments


    Enrico Francia; Alessandro Tondelli; Fulvia Rizza; Franz W. Badeck; Thomas, William T. B.; Fred van Eeuwijk; Ignacio Romagosa; A. Michele Stanca; Nicola Pecchioni


    The determinants of barley grain yield in drought-prone Mediterranean environments have been studied in the Nure x Tremois (NT) population. A large set of yield and other morpho-physiological data were recorded in 118 doubled-haploid lines of the population, in multi-environment field trials (18 site-year combination). Agrometeorological variables have been recorded and calculated at each site too. Four main periods of barley development were considered, vegetative, reproductive early and lat...

  1. Digestion of Barley, Maize, and Wheat by Selected Species of Ruminal Bacteria †


    McAllister, Tim A.; Cheng, K.-J.; Rode, Lyle M.; Forsberg, Cecil W.


    Differences in the digestion of barley, maize, and wheat by three major ruminal starch-digesting bacterial species, Streptococcus bovis 26, Ruminobacter amylophilus 50, and Butyrivibrio fibrisolvens A38, were characterized. The rate of starch digestion in all cereal species was greater for S. bovis 26 than for R. amylophilus 50 or B. fibrisolvens A38. Starch digestion by S. bovis 26 was greater in wheat than in barley or maize, whereas starch digestion by R. amylophilus 50 was greater in barl...

  2. Quantitative trait loci for agronomic traits in an elite barley population for Mediterranean conditions


    Mansour, Elsayed; Casas Cendoya, Ana María; Gracia Gimeno, María Pilar; Molina-Cano, José Luis; Moralejo, Marian; Cattivelli, Luigi; William T.B. Thomas; Igartua Arregui, Ernesto


    Advances in plant breeding through marker-assisted selection (MAS) are only possible when genes or quantitative trait loci (QTLs) can contribute to the improvement of elite germplasm. A population of recombinant inbred lines (RILs) was developed for one of the best crosses of the Spanish National Barley Breeding Program, between two six-row winter barley cultivars Orria and Plaisant. The objective of this study was to identify favourable QTLs for agronomic traits in this population, which may...

  3. Assisting decision-making in Queensland barley production through chance constrained programming


    Gali, Jyothi; Brown, Colin G.


    A chance constrained programming model is developed to assist Queensland barley growers make varietal and agronomic decisions in the face of changing product demands and volatile production conditions. Unsuitable or overlooked in many risk programming applications, the chance constrained programming approach nonetheless aptly captures the single‐stage decision problem faced by barley growers of whether to plant lower‐yielding but potentially higher‐priced malting varieties, given a particular...

  4. A fitful fungus from a hot, arid climate increases grain yield in cool-cultivated barley


    Murphy, Brian R.; Fiona M Doohan; HODKINSON, TREVOR R.


    Purpose The fungus Piriformospora indica was first isolated from plants growing in arid, hot desert conditions and has been shown to have significant potential as a biocontrol and biofertilising organism in barley under optimal growth conditions. However, it was not thought to be effective in plants grown in low temperatures and has consequently not been well tested in cold-stressed crops. This study sought to determine the effects of inoculating barley plants with this f...

  5. The plasma membrane proteome of germinating barley embryos

    DEFF Research Database (Denmark)

    Hynek, Radovan; Svensson, Birte; Jensen, O.N.;


    amphiphilicity and low abundance of membrane proteins. A fraction enriched in plasma membranes was prepared from embryos dissected from 18 h germinated barley seeds using aqueous two-phase partitioning. Reversed-phase chromatography on C-4 resin performed in micro-spin columns with stepwise elution by 2-propanol......Cereal seed germination involves a complex coordination between different seed tissues. Plasma membranes must play crucial roles in coordination and execution of germination; however, very little is known about seed plasma membrane proteomes due to limited tissue amounts combined with...... was used to reduce soluble protein contamination and enrich for hydrophobic proteins. Sixty-one proteins in 14 SDS-PAGE bands were identified by LC-MS/MS and database searches. The identifications provide new insight into the plasma membrane functions in seed germination....

  6. Approaches to improving the nutritional quality of barley seed proteins

    International Nuclear Information System (INIS)

    The poor nutritional quality of barley grain is determined by the low level of lysine in the prolamin storage proteins (hordein). These account for between 35 to 50% of the total grain nitrogen, depending on the nutritional status of the plant. There is a reduced proportion of hordein in mutant high lysine lines but these also have reduced synthesis of storage carbohydrates and hence low yields. Three strategies for improvement are discussed. Increases in the lysine content of hordein may be difficult to achieve because of the presence of complex families of structural genes. It would also be necessary to insert a large number of additional lysine residues. Two more promising approaches are to increase the level of expression of genes coding for lysine-rich globulin storage proteins and to increase the pool of free lysine by selecting mutant lines with relaxed feedback regulation of lysine synthesis. (author)

  7. Biomechanics of Wheat/Barley Straw and Corn Stover

    Energy Technology Data Exchange (ETDEWEB)

    Christopher T. Wright; Peter A. Pryfogle; Nathan A. Stevens; Eric D. Steffler; J. Richard Hess; Thomas H. Ulrich


    The lack of understanding of the mechanical characteristics of cellulosic feedstocks is a limiting factor in economically collecting and processing crop residues, primarily wheat and barley stems and corn stover. Several testing methods, including compression, tension, and bend have been investigated to increase our understanding of the biomechanical behavior of cellulosic feedstocks. Biomechanical data from these tests can provide required input to numerical models and help advance harvesting, handling, and processing techniques. In addition, integrating the models with the complete data set from this study can identify potential tools for manipulating the biomechanical properties of plant varieties in such a manner as to optimize their physical characteristics to produce higher value biomass and more energy efficient harvesting practices.

  8. Molecular Variability in Barley Structural Mutants Produced by Gamma Irradiation

    International Nuclear Information System (INIS)

    Single Sequence Repeat (SSR) and Amplified Fragment Length Polymorphism (AFLP) markers were used to survey gamma ray induced genetic variation in a set of 13 originally produced structural barley (H. vulgare L.) mutants from cv. Freya; including 8 single translocation lines, 3 double translocation lines and 2 multiple reconstructed karyotypes. Both marker systems contributed to the evaluation of the radiation induced DNA alterations and revealed in general 0.49% polymorphisms in the studied genotypes. AFLPs were observed with 3 out of 10 PstI/MseI primer combinations. Transmissible microsatellite instability at loci with perfect (AT)n repeats located in the introns of the rubisco activase and waxy was documented in three mutant lines. The results emphasize that in addition to point mutations, small indels (2bp) form the major group of the gamma induced DNA alterations. (author)

  9. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.; Svensson, Birte; Aghajari, N.


    insight into the substrate binding by describing residues defining 9 subsites, namely -7 through +2. These structures support that the pseudotetrasaccharide inhibitor acarbose is hydrolyzed by the active enzymes. Moreover, sugar binding was observed to the starch granule-binding site previously determined...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active...... active site for polysaccharide chains. Moreover, the sugar tongs surface site could also perform the unraveling of amylose chains, with the aid of Tyr-380 acting as "molecular tweezers"....

  10. Isolation, mapping, and characterization of two barley multiovary mutants. (United States)

    Soule, J D; Kudrna, D A; Kleinhofs, A


    Mutations in homeotic genes disturb the spatial and temporal patterns of development, often leading to the appearance of tissues in abnormal locations. Many homeotic genes, involved in flower development, code for proteins with a highly conserved domain called the MADS box, which acts as a sequence-specific DNA binding protein. Two floral development mutants were isolated from a fast neutron irradiated M2 barley population. The phenotypes are multiovary, that is, stamens replaced with carpels, designated mo7a, and stamens replaced with carpels and lodicules converted to leaflike structures, designated mo6b. These phenotypes resemble the Arabidopsis mutants APETALA3 (AP3) and PISTILATA (PI). The mo6b and mo7a mutants were mapped to the centromeric region of chromosome 1 (7H) and to the telomeric region of chromosome 3 (3H), respectively. PMID:11218087

  11. Resistance in winter barley against Ramularia leaf spot

    DEFF Research Database (Denmark)

    Hjortshøj, Rasmus Lund

    , with an apparent shift towards abiotic stress responses. Finally the population genetic study based on low distances between populations samples in Denmark and Scotland and high genotypic diversity gave indications of a pathogen with a high evolutionary potential. Altogether, this points to a plant......Ramularia leaf spot is an emerging disease in barley caused by R. collo-cygni. At present little is known about the resistance mechanisms carried out by the host plant to avoid disease development. Nor is the lifecycle of the fungus or its populations structure fully understood. To gain insight...... into these aspects four experiments were set up; (1) a mapping experiment aiming at identifying QTL’s controlling disease levels under field conditions was conducted in two winterbarley populations. (2) a toxin assay testing the parental lines used in the mapping populations for response to Rubellin D...

  12. Androgenic response to preculture stress in microspore cultures of barley. (United States)

    Oleszczuk, S; Sowa, S; Zimny, J


    Various stresses such as starvation and cold or heat shocks have been identified as triggers in the induction of the microspore embryogenesis. This study attempts to quantify the effects of different pretreatment conditions for successful microspore culture of malting barley (cv. Scarlett). While the sporophytic microspore development could be induced from treated and nontreated microspores, abiotic stress was essential for embryo formation and plant regeneration. The type of stress treatment applied affected the numbers and the ratios of albino and green plants regenerated, as well as their fertility. The highest number of green plants was obtained after the treatment of anthers in 0.3 M mannitol at 32 degrees C for 24 h before microspore culture. PMID:16937060

  13. Enzymatic hydrolysis of pretreated barley and wheat straw

    DEFF Research Database (Denmark)

    Rosgaard, Lisa


    work involved evaluation of 1) possible ways to increase the glucose release from the commercial cellulase product Celluclast by boosting with other enzyme activities to increase the enzymatic hydrolysis, 2) comparing differently pretreated feedstock substrates and 3) evaluating a fed-batch substrate...... feeding strategy to increase the substrate loading in the hydrolysis reaction. The substrate for the enzymatic hydrolysis was primarily steam pretreated wheat and barley straw since these substrates were the primary feedstocks for the Babilafuente Bioethanol process. The initial work showed that there was...... different pretreatment conditions; hot water extraction and acid- or water impregnation followed by steam explosion showed there were slight differences between the effect of pretreatment conditions in relation to the overall yield from enzymatic hydrolysis. The highest glucose concentration was found for...

  14. Genetic variation for seed protein in barley germplasm

    International Nuclear Information System (INIS)

    Barley accessions collected from three regions of Pakistan were evaluated for seed protein (%) for two seasons. A wide range of variation (9 to 21%) was found in the germplasm studied during both seasons. Maximum accessions exhibited protein 12.1 - 16.0% protein whereas few accessions produced more than 18.0% protein. Correlation between two seasons' data was highly significant indicating the influence of genetic component. Germplasm were classified on the basis of regions. Accessions from Northern areas possessed average higher protein percentage followed by NWFP, Baluchistan and check varieties. Classification on the basis of altitude showed that the accessions collected from 200-800 masl had low protein while those collected from 2601-3000 masl had high protein. This study provides information on important protein sources of germplasm. (author)

  15. Cyclitols in maturing grains of wheat, triticale and barley

    Directory of Open Access Journals (Sweden)

    Lesław B. Lahuta


    Full Text Available In the present study, the feeding of stem-flag leaf-ear explants of wheat, triticale and barley with d-chiro-inositol and d-pinitol was used for modification of the composition of soluble carbohydrates in grains without genetic transformation of plants. Maturing grains indicated ability to uptake exogenously applied cyclitols, not occurring naturally in cereal plants, and synthesized their a-d-galactosides. The pattern of changes in soluble carbohydrates during grain maturation and germination was not disturbed by the uptake and accumulation of cyclitols. Both, d-chiro-inositol and d-pinitol as well as their a-d-galactosides can be an additional pool of soluble carbohydrates accumulated by maturing grains, without decreasing seeds viability. This is the first report indicating the possibility of introduction of cyclitols with potentially human health benefits properties into cereal grains.

  16. The effect of irradiation treatment on Beta-Glucan and protein quality of barley

    International Nuclear Information System (INIS)

    Samples of barley (hordeum vulgare L) grains were tested for nutritional value after being irradiated at dose levels of 10, 20, and 30 KGy. The gross composition of raw and irradiated beans was similar. Soluble protein was reduced by 16.76%, 28.84% and 44.76% when barley grains were irradiated at 10, 20, and 30 KGy, respectively, The amount of water-soluble beta-glucan in raw barley was increased linearly from 1.76 to 2.40 g/100 g of sample as a function of dose. Meanwhile, the effect of irradiation treatment on total beta-glucan (3.90 g/100 g) was insignificant while the level of insoluble beta-glucan was decreased with increasing the dose levels of irradiation. The protein efficiency ratio (PER) of processed barley grains at the doses applied was increased by 6.38%, 12.77%, and 1135%, respectively as compared with the value for raw grains. The data showed that the radiation processing of raw barley grains increased the solubility of beta-glucan, the most anti nutritional factor in the grains and improved the PER in rats. Therefore it could be concluded thal the irradiation treatment (up tp 30 KGy) up-grade the biological value of barley through increase the solubility of Beta-glucan that affect the performance of animals

  17. Consolidated conversion of hulled barley into fermentable sugars using chemical, thermal, and enzymatic (CTE) treatment. (United States)

    Kim, Tae Hyun; Nghiem, Nhuan P; Taylor, Frank; Hicks, Kevin B


    A novel process using chemical, thermal, and enzymatic treatment for conversion of hulled barley into fermentable sugars was developed. The purpose of this process is to convert both lignocellulosic polysaccharides and starch in hulled barley grains into fermentable sugars simultaneously without a need for grinding and hull separation. In this study, hulled barley grains were treated with 0.1 and 1.0 wt.-% sulfuric acid at various temperatures ranging from 110 to 170 °C in a 63-ml flow-through packed-bed stainless steel reactor. After sulfuric acid pretreatment, simultaneous conversion of lignocellulose and starch in the barley grains into fermentable sugars was performed using an enzyme cocktail, which included α-amylase, glucoamylase, cellulase, and β-glucosidase. Both starch and non-starch polysaccharides in the pre-treated barley grains were readily converted to fermentable sugars. The treated hulled barley grains, including their hull, were completely hydrolyzed to fermentable sugars with recovery of almost 100% of the available glucose and xylose. The pretreatment conditions of this chemical, thermal, and enzymatic (CTE) process for achieving maximum yield of fermentable sugars were 1.0 wt.% sulfuric acid and 110 °C. In addition to starch, the acid pretreatment also retained most of the available proteins in solid form, which is essential for subsequent production of fuel ethanol and high protein distiller's dried grains with solubles co-product. PMID:21229334

  18. Diversity for seedling vigor in wild barley (hordeum vulgare L. subs. simpatina) germplasm

    International Nuclear Information System (INIS)

    Seedling vigor is important for improving stand establishment of barley crops, particularly in arid regions and areas where the soil temperature is low at sowing time. Three hundred and fifteen wild barley accessions from the Wild Barley Diversity Collection (WBDC) were evaluated for nine seedling vigor traits in a poly house and growth chamber under hydroponic conditions. The accessions exhibited significant differences for all traits investigated. Traits showing greatest phenotypic variation were seedling visual score, plant height, shoot fresh weight, shoot dry weight and shoot length. Seed weight exhibited the least variation. Seed weight was significantly correlated with visual seedling score and shoot and seedling fresh and dry weight. Correlation analysis showed that the visual seedling score was a reliable method for estimating seedling vigor in wild barley. The first three principal components (PC) explained 82.3% of the variation present in the WBDC with PC1(54.0%) associated with shoot fresh weight, shoot dry weight, seedling dry weight, seedling fresh weight, shoot length and seedling length. Accessions from the southwest portion of the Fertile Crescent, like WBDC020 (Turkey), WBDC238 (Jordan) and WBDC244 (Jordan) exhibited the highest positive values for most of the plant vigor traits investigated. These wild barley accessions likely carry alleles that will be useful for the improvement of plant vigor traits in cultivated barley. (author)

  19. Allelopathic effect of ryegrass (lolium persicum) and wild mustard (sinapis arvensis) on barley

    International Nuclear Information System (INIS)

    Most crop plants and weeds have allelopathic effects and analysis of these effects on plants in crop alteration and successive planting is very important. In this research the allelopathic ability of different parts and concentrations of two weeds, Lolium Persicum (Ryegrass) and Sinapis arvensis (wild mustered), on growth characteristics of two barley varieties was studied in the greenhouse using a completely randomized design with four replications. Test factors consisted of two barley varieties (Valfajr and Rehane), three weed organs (root, stalk, leaf) and four concentrations of extracts of weed organs (25, 50, 75 and control or distilled water). After the preparation of extracts of different weed organs with different concentrations, their effect on growth characteristics of barley plant was evaluated. Finally, seedling length, rootlet length caulicle length, wet weight of seedling, dry weight of seedling were measured. Also, the above two seeds had significant effects on the two strains of barley and could influence growth characteristics of barley. Based on the results of present study, one can argue that Ryegrass (Lolium Persicum) and wild mustard (Sinapis arvensis) can strongly affect germination, growth and performance of barley through production of chemical materials with allelopathic properties, leading unfavorable growth and product yield. (author)

  20. Investigation of the effect of nitrogen on severity of Fusarium Head Blight in barley

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, J.D.; Spliid, N.H.;


    The effect of nitrogen on Fusarium Head Blight (FHB) in a susceptible barley cultivar was investigated using gel-based proteomics. Barley grown with either 15 or 100 kg ha(-1)N fertilizer was inoculated with Fusarium graminearum (Fg). The storage protein fraction did not change significantly in r...... indicated that increased Fusarium infection occurred in barley with low N and suggests control of N fertilization as a possible way to minimise FHB in barley.......The effect of nitrogen on Fusarium Head Blight (FHB) in a susceptible barley cultivar was investigated using gel-based proteomics. Barley grown with either 15 or 100 kg ha(-1)N fertilizer was inoculated with Fusarium graminearum (Fg). The storage protein fraction did not change significantly in...... degraded by fungal proteases. Greater spot volume changes occurred in response to Fg in plants grown with low nitrogen, although proteomes of uninfected plants were similar for both treatments. Correlation of proteome changes with measurement of Fusarium-damaged kernels, fungal biomass and mycotoxin levels...

  1. Acrylamide elution from roasted barley grains into mugicha and its formation during roasting. (United States)

    Mizukami, Yuzo; Yoshida, Mitsuru; Ono, Hiroshi


    This paper investigated acrylamide elution from roasted barley grain into mugicha and its formation during roasting of the grain. Mugicha is an infusion of roasted barley grains. Highly water-soluble acrylamide was easily extracted to mugicha from milled roasted barley grains in teabags. On the other hand, the acrylamide concentration in mugicha prepared from loose grain increased with longer simmering and steeping times. During roasting in a drum roaster, the acrylamide concentration of the grain increased as the surface temperature rose, reaching a maximum at 180-240°C. Above this temperature, the acrylamide concentration decreased with continued roasting, exhibiting an inverted 'U'-shaped curve. For most of the samples, the acrylamide concentration showed good correlation with the value of the colour space parameter L*. The dark-coloured roasted barley grains with lower L* values contained lower amounts of acrylamide as a result of deep roasting. The level of asparagine in barley grains was found to be a significant factor related to acrylamide formation in roasted barley products. The data are an important contribution to the mitigation of acrylamide intake from mugicha. PMID:26678848

  2. Advances in the use of mutation induction for genetic improvement of barley and native grains in Peru

    International Nuclear Information System (INIS)

    Barley seeds of two varieties were treated with several doses of gamma rays and sodium azide. Seeds of a quinoa (Chenopodium) variety were treated with three doses of gamma rays. Yield trials were conducted also for doubled haploid lines of barley derived from earlier mutagenic treatments. Some promising new barley mutant lines were identified in the yield trials. The results from the Chenopodium trials facilitate the determination of the optimum dose of gamma rays for the PRQ-22 variety. (author)

  3. Some quality attributes of low fat ice cream substituted with hulless barley flour and barley ß-glucan. (United States)

    Abdel-Haleem, Amal M H; Awad, R A


    The purpose of this paper is to investigate some quality attributes of low fat ice cream (LFIC) substituted with hulless barley flour (HBF) and barley ß-glucan (BBG). The methodology included in this paper is based on adding HBF (1, 2, 3 and 4 %) as a partial substitution of skim milk powder (SMP) and BBG (0.40 %) as a complete substitution of carboxy methyl cellulose (CMC). All mixes and resultant ice cream samples were evaluated for their physicochemical properties as well as the sensory quality attributes.The results indicated that substitution of SMP with HBF significantly increased total solids (TS), fat and crude fiber, while crude protein and ash significantly decreased in ice cream mixes. BBG exhibited the same manner of control. Specific gravity was gradually increased with adding HBFand BBG in the mixes and therefore the overrun percent was significantly changed in the resultant ice cream. Adding HBF in ice cream formula led to significant decrease in acidity with higher freezing point and the product showed higher ability to meltdown. BBG treatment showed the same trend of control. Values of flow time and viscosity significantly increased with increasing HBF in the ice cream mixes, but these values significantly decreased in BBG mix. The time required to freeze ice cream mixes was decreased with increasing the ratio of HBF but, increased in BBG treatment. The substitution of SMP with 1 and 2 % HBF significantly (P ≤ 0.05) enhanced sensory attributes of ice cream samples. While, BBG treatment achieved mild score and acceptability. PMID:26396387

  4. Combining mechanical rhizome removal and cover crops for Elytrigia repens control in organic barley systems

    DEFF Research Database (Denmark)

    Melander, B; Nørremark, M; Kristensen, E F


    -vetch-mustard mixture) on Elytrigia repens rhizome removal, shoot growth and suppression of a subsequent barley crop was examined in two growing seasons. Four passes with a modified rotary cultivator, where each pass was followed by rhizome removal, reduced E. repens shoot growth in barley by 84% and 97%. In general......, the cover crop developed poorly and did not affect barley or E. repens. Barley yield was only affected by treatments in the first season, where yield was negatively correlated with E. repens shoot biomass. The concept has potential for the control of severe E. repens infestations, but future research...

  5. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid


    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  6. Programmable RNA-binding protein composed of repeats of a single modular unit. (United States)

    Adamala, Katarzyna P; Martin-Alarcon, Daniel A; Boyden, Edward S


    The ability to monitor and perturb RNAs in living cells would benefit greatly from a modular protein architecture that targets unmodified RNA sequences in a programmable way. We report that the RNA-binding protein PumHD (Pumilio homology domain), which has been widely used in native and modified form for targeting RNA, can be engineered to yield a set of four canonical protein modules, each of which targets one RNA base. These modules (which we call Pumby, for Pumilio-based assembly) can be concatenated in chains of varying composition and length, to bind desired target RNAs. The specificity of such Pumby-RNA interactions was high, with undetectable binding of a Pumby chain to RNA sequences that bear three or more mismatches from the target sequence. We validate that the Pumby architecture can perform RNA-directed protein assembly and enhancement of translation of RNAs. We further demonstrate a new use of such RNA-binding proteins, measurement of RNA translation in living cells. Pumby may prove useful for many applications in the measurement, manipulation, and biotechnological utilization of unmodified RNAs in intact cells and systems. PMID:27118836

  7. Sources of uncertainty in nitrous oxide emissions from winter barley biofuel feedstock life cycles (United States)

    Speers, C. M.; Gurian, P. L.; Adler, P. R.; Del Grosso, S.; Spatari, S.


    Winter barley is an attractive feedstock for first generation biofuel production in the US Mid-Atlantic region that can serve East Coast transportation fuel markets. Recently designated advanced fuel standing by US EPA, the influence of barley grown as a winter crop on N2O emissions is uncertain because of high spatial and temporal variability. Our objective is to examine the sensitivity of direct and indirect N2O emissions to different management and environmental factors within a 20 year winter barley rotation in two Mid-Atlantic counties (Lenoir, North Carolina, and Queen Anne's, Maryland) using first order uncertainty methods. Specifically, we conducted simulations using the DayCent biogeochemical model, where winter barley was introduced in a two-year rotation following corn and preceding soybean, and grown in four-year cycles that alternate with winter wheat and fallow periods. We tested different model input parameters and analyzed the level of uncertainty each contributes to both direct and indirect N2O emissions with the introduction of barley into the crop rotation. The input values for pH, precipitation, temperature, soil texture, and fertilizer quantity applied were altered from base values and outputs for rotations with and without winter barley were compared by calculating partial derivatives for each parameter to estimate the relative change in N2O emitted. Fertilizer, followed by soil texture, introduces the greatest uncertainty in N2O emissions, with the remaining parameters contributing to lesser, but still significant uncertainty. Therefore, as barley is introduced onto a farm for biofuel production, it is most important to carefully control the fertilizer additions, and to monitor the soil texture class characteristics.

  8. Barley Leaf Area and Leaf Growth Rates Are Maximized during the Pre-Anthesis Phase

    Directory of Open Access Journals (Sweden)

    Ahmad M. Alqudah


    Full Text Available Leaf developmental traits are an important component of crop breeding in small-grain cereals. Surprisingly, little is known about the genetic basis for the differences in barley (Hordeum vulgare L. leaf development. The two barley row-type classes, i.e., two- and six-rowed, show clear-cut differences in leaf development. To quantify these differences and to measure the genetic component of the phenotypic variance for the leaf developmental differences in both row-type classes we investigated 32 representative spring barley accessions (14 two- and 18 six-rowed accessions under three independent growth conditions. Leaf mass area is lower in plants grown under greenhouse (GH conditions due to fewer, smaller, and lighter leaf blades per main culm compared to pot- and soil-grown field plants. Larger and heavier leaf blades of six-rowed barley correlate with higher main culm spike grain yield, spike dry weight, and harvest index; however, smaller leaf area (LA in two-rowed barley can be attributed to more spikes, tillers, and biological yield (aboveground parts. In general, leaf growth rate was significantly higher between awn primordium and tipping stages. Moderate to very high broad-sense heritabilities (0.67–0.90 were found under all growth conditions, indicating that these traits are predominantly genetically controlled. In addition, our data suggests that GH conditions are suitable for studying leaf developmental traits. Our results also demonstrated that LA impacts single plant yield and can be reconsidered in future breeding programs. Six-rowed spike 1 (Vrs1 is the major determinate of barley row-types, the differences in leaf development between two- and six-rowed barleys may be attributed to the regulation of Vrs1 in these two classes, which needs further testing.

  9. Research on mutant barley population under biotic and abiotic stress condition

    International Nuclear Information System (INIS)

    Barley is one of the most important cereal with 8,5 million tons production, 3,5 million hectares of sowing area in Turkey which is also one of the gene centres of barley. Barley is grown in every regions of Turkey where climatic conditions are available for the crop. But barley is the predominant crop in the driest land areas throughout the Anatolian plateau. Winters on that plateau are especially severe. Summers are hot and dry with temperatures above 30 degree C. Annual precipitation averages about 300 to 400 millimeters and rains mainly in winter. Because of all of these prerequisite conditions, winter barley dominates in Turkey, which indirectly refers to water economy. According to the above mentioned reasons the objectives of this investigation were: 1) Improvement of drought resistance, loading resistance and high yielding barley varieties by mutation breeding in Central Anatolian Region. 2) Determination and selection of abiotic stress such as salt resistance In our barley mutation breeding programme under Central Anatolian conditions well adapted Tokak 157/37 variety has been used. We applied 250 Gy-300 Gy gamma ray doses . Selection began at M2 generation. Agronomical characters including earliness, straw length, lodging resistance and disease resistance are monitored in the field and greenhouse. Mutant lines have been tested for salt resistance in the hydrophonic culture which contains 180 mMol and 220 mMol NaCl concentrations. Preliminary yield trial and advanced yield trial are started after M4 generations. In M6 generation, we had some desirable lines those are 25-30 days earlier than its parents, so these lines escape from drought period. Some lines that have grown in the hydrophonic cultures, contains 180mMol NaCl still surviving.

  10. Effect of Enzyme Supplementation and Irradiation of Barley on Broiler Chicks Performance

    International Nuclear Information System (INIS)

    The experiments were conducted to study the influence of irradiation treatment at dose levels of 0.20 and 60 kGy on barley beta-glucan and the effect of enzyme supplementation and irradiation of barley on broiler chicks performance. The amount of total and water-soluble beta-glucan in raw barley was 36 kg-1, respectively. The effect of irradiation treatment on total beta-glucan was insignificant while the level of soluble beta-glucan was increased with increasing the dose levels of irradiation. The effect of irradiation treatment and enzyme supplementation of barley diets on growth and conversion performance of broiler chicks indicated that birds fed raw barley diet had lower body weight, body weight gain and feed conversion than those fed control diet throughout the experimental period. Irradiation of barley at dose of 20 kGy did not affect the chick performance (feed consumption, weight gain feed-gain ratio) that received the B 20 diet from 7 to 21 days of age, but when bird maintained on B 20 diet from 7 28 days of age, only feed-gain ratio was improved by 14.4%. The results indicate that there was a significant effect of irradiation of barley at 60 kGy (B 60) on feed -gain ratio of chicks when were fed B 60 diet from 7 to 21 days of age. The corresponding improvement in feed-gain ratio was 16.4%. When birds were fed B 60 diet from 7-28 days of age, the improvement in body weight and feed-gain ratio was 25.5 and 19.6%, respectively

  11. Hamowanie syntezy chlorofilu i RNA w izolowanych liścieniach ogórka przez N-hydroksymocznik [Inhibition of chlorophyll and RNA synthesis by N-hydroxyurea in detached cucumber cotyledons


    A. Rennert; J. S. Knypl


    N-hydroxyurea (HU) at the concentration of 5 x 10-4 M decreased the content of chlorophyll in detached cucumber cotyledons; at this concentration it has no inhibitory effect on growth. Benzylaminopurine, gibberelic acid and KCl partially reversed the inhibitory effect of HU on chlorophyll synthesis. HU stimulated yellowing of barley first leaf sections. The compound had little effect on leucine-14C incorporation to protein, and markedly inhibited uracil-14C incorporation in to RNA of the gree...

  12. Observed and predicted changes over eight years in frequency of barley powdery mildew avirulent to spring barley in France and Denmark

    DEFF Research Database (Denmark)

    Bousset, L.; Hovmøller, M.S.; Caffier, V.; Vallavieille-Pope, C. de; Østergård, Hanne


    Aerial populations of Blumeria graminis f.sp. hordei were studied in two French and two Danish regions from 1991 to 1999, at a time of year when only winter barley was present. A high frequency of genotypes not able to grow on the spring-sown crop of the previous growing season (denoted 'spring-a...

  13. Mapping genes in barley for resistance to Puccinia coronata from couch grass and to P. striiformis from brome, wheat and barley

    NARCIS (Netherlands)

    Niks, R.E.; Alemu, Sisay K.; Marcel, T.C.; Heyzen, van Skye


    Barley (Hordeum vulgare L.) mapping populations have been developed that are useful to study the inheritance of quantitative resistance to adapted and unadapted rust fungi. In a recent host range study, we found that the parents of those mapping populations also differed in their resistance to th

  14. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage


    Guo, P; Baum, M.; Grando, S.; Ceccarelli, S.; Bai, G.; Li, R; Von Korff, M; Varshney, R.,; Graner, A.; Valkoun, V.


    Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas worldwide. Identification of the genes responsible for drought tolerance in barley (Hordeum vulgare L.) will facilitate understanding of the molecular mechanisms of drought tolerance, and also facilitate the genetic improvement of barley through marker-assisted selection or gene transformation. To monitor the changes in gene expression at the transcriptional level in barley leaves during the repro...

  15. [RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer]. (United States)

    Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente


    RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer. PMID:20415061

  16. Enzymatic fractionation of SAA-pretreated barley straw for production of fuel ethanol and astaxanthin as a value-added co-product (United States)

    Barley straw was used to demonstrate a process for production of ethanol and astaxanthin as a value-added co-product. Barley straw was pretreated by soaking in aqueous ammonia (SAA) using the previously determined optimum conditions. The pretreated barley straw was first hydrolyzed with Accellerase®...

  17. A root hairless barley mutant for elucidating genetic of root hairs and phosphorus uptake (Correction in v. 242, 2002, p. 299)

    DEFF Research Database (Denmark)

    Gahoonia, T.S.; Nielsen, N.E.; Priyavadan, A.J.; Jahoor, A.


    This paper reports a new barley mutant missing root hairs. The mutant was spontaneously discovered among the population of wild type (Pallas, a spring barley cultivar), producing normal, 0.8 mm long root hairs. We have called the mutant bald root barley (brb). Root anatomical studies confirmed the...

  18. Functional Diversification of Maize RNA Polymerase IV and V subtypes via Alternative Catalytic Subunits

    Energy Technology Data Exchange (ETDEWEB)

    Haag, Jeremy R.; Brower-Toland, Brent; Krieger, Elysia K.; Sidorenko, Lyudmila; Nicora, Carrie D.; Norbeck, Angela D.; Irsigler, Andre; LaRue, Huachun; Brzeski, Jan; Mcginnis, Karen A.; Ivashuta, Sergey; Pasa-Tolic, Ljiljana; Chandler, Vicki L.; Pikaard, Craig S.


    Unlike nuclear multisubunit RNA polymerases I, II, and III, whose subunit compositions are conserved throughout eukaryotes, plant RNA polymerases IV and V are nonessential, Pol II-related enzymes whose subunit compositions are still evolving. Whereas Arabidopsis Pols IV and V differ from Pol II in four or five of their 12 subunits, respectively, and differ from one another in three subunits, proteomic ana- lyses show that maize Pols IV and V differ from Pol II in six subunits but differ from each other only in their largest subunits. Use of alternative catalytic second subunits, which are nonredundant for development and paramutation, yields at least two sub- types of Pol IV and three subtypes of Pol V in maize. Pol IV/Pol V associations with MOP1, RMR1, AGO121, Zm_DRD1/CHR127, SHH2a, and SHH2b extend parallels between paramutation in maize and the RNA-directed DNA methylation pathway in Arabidopsis.

  19. Identification of barley genotypes with low grain Cd accumulation and its interaction with four microelements. (United States)

    Chen, Fei; Dong, Jing; Wang, Fang; Wu, Feibo; Zhang, Guoping; Li, Guoming; Chen, Zhefeng; Chen, Jingxing; Wei, Kang


    The variation in grain cadmium (Cd) concentrations was evaluated among 600 barley genotypes grown in the same field condition to select low Cd accumulating genotypes. The results showed that there is considerable genotypic variation in grain Cd concentrations in barley grain samples, with the mean concentration of 0.16 mg kg(-1) DW and the variation of 0 (not detected) to 1.21 mg kg(-1) DW, and 47.2% of the grain samples exceeded the maximum permissible concentration (MPC) for Cd in cereal grains. In addition, differences between genotypes over the two years were fairly consistent, and Beitalys and Shang 98-128 showed the lowest grain Cd concentration, being 97.5% lower than that in the two highest Cd accumulators E-barley 6 and Zhenong 8 in the second harvest year. The great genotypic differences in Cd concentrations indicated that it is possible to lower Cd content of barley through cultivar selection and breeding for use at sites where Cd concentration in grain exceeds the MPC. Significant genotypic difference was also found in microelement concentrations. Correlation analysis showed that only Mn accumulation is synergetic with Cd accumulation, despite slightly positive relationship between Cd and Zn, Cu, or Fe in accumulation in barley grains. PMID:17257649


    Directory of Open Access Journals (Sweden)

    Ivica Strelec


    Full Text Available Applicability of electrophoretic separations of albumins/globulins, followed by nonspecific protein staining and specific glycoprotein and aminopeptidase detection has been examined for barley variety discrimination. Albumins/globulins extracted from dry grains and green malt of six barley varieties were separated by polyacrylamide gel electrophoresis (10 % T, pH=8.9 of native and sodium dodecyl sulfate denatured proteins, and by isoelectric focusing in pH gradient of 3.5-9.5 and 4.0-6.5. Analysis of dry grain extracts gave better results than green malt extracts. Obtained data indicate that SDS-PAGE of albumins/globulins and IEF in pH gradient 3.5-9.5 followed by Coomassie Blue staining could be useful in Croatian barley variety discrimination. Angora barley could be clearly distinguished from the other varieties which were grouped as follows: Rodnik/Sladoran, Barun/Rex, and Martin. Glycoprotein patterns did not improve the recognition of individual varieties. Broad specificity, phenylalanine and leucine preferring, and arginine specific aminopeptidase were not found as applicable markers for discrimination of examined barley varieties.

  1. [Hordein locus polymorphism of cultivated barley (Hordeum vulgare L.) in Turkey]. (United States)

    Pomortsev, A A; Martynov, S P; Lialina, E V


    Starch gel electrophoresis has been used to study the polymorphism of hordeins encoded by the Hrd A, Hrd B, and Hrd F loci in 93 landrace specimens of barley assigned to 17 ancient provinces located in modem Turkey. Forty-five alleles of Hrd A with frequencies of 0.11-29.34%, 51 alleles of Hrd B with frequencies of 0.11-8.07%, and 5 alleles of Hrd F with frequencies of 0.75-41.29% have been detected. Cluster analysis of the matrix of allele frequencies has demonstrated that barley populations from different old provinces of Turkey are similar to one another. Cluster structure of local barley populations has been found, most populations (82%) falling into three clusters. The first cluster comprises barley populations from six provinces (Thracia, Bithynia, Pontus, Lydia, Cappadocia, and Armenia); the second cluster, populations from five provinces (Paphlagonia, Galatia, Lycaonia, Cilicia, and Mesopotamia); and the third one, populations from three provinces (Phrygia, Karia, and Lycia). Barley populations from Mysia, Pamphlya, and Syria do not fall in any cluster. PMID:18186193


    Directory of Open Access Journals (Sweden)

    Pavol Trebichalsky


    Full Text Available The influence of applied inorganic nutrients in soil, the method of tillage conventional and minimalization on accumulation of Fe and K into the grain of selected varieties of barley was observed. Small parcel experiments were carried out on fields with size 14 m2 in three parallels. Four levels of fertilization were done: 1 control not fertilized variant; 2 N70 + P4,36 + K16,6; 3 N60 + P22,7 + K36; 4 N60 + P22,7 + K36 + Ca25. Fe, K in grain of barley were mineralized by the method of Koppova and their content was assessed by the method of flame AAS at instrument VARIAN 240FS. Content of Fe in dry matter of barley grain in analyzed samples were v interval 34.7 1 and of potassium 293,1 658, 1. Application of macro elements N, P, K into the soil had on the accumulation of Fe into the barley grain reduction effect beside KM2084 variety and contrary, in comparison with control variant increased influence on intake of mentioned element in winter varieties beside variety Malwinta not dependent on the method of amendments of soil by tillage. Addition of CaCO3 in fertilizers affected with contrary reducing effect of contents Fe and K in barley grain.

  3. Evaluation of Toxic Effects and Bioaccumulation of Cadmium and Copper in Spring Barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Jūratė Žaltauskaitė


    Full Text Available This paper deals with the analysis of toxic effects of cadmium and copper on the growth of spring barley (Hordeum vulgare L. cultivated in hydroponics. The seedlings of barley were treated with four different concentrations of cadmium and copper, ranging from 0.1 to 10 mg L-1. The aim of the study was to assess toxic effects of cadmium (Cd and copper (Cu on the growth of spring barley, and to determine metal accumulation in above-ground and underground parts of the plant. The impact of Cu and Cd on photosynthetic pigments (chlorophyll a, b, the content of malondialdehyde (MDA, and the essential micronutrients (Mn, Fe were examined. Metal treatment reduced the growth of roots (by 60%, shoots (Cd – 48 %, Cu – 57% and dry weight (Cd – 47 %, Cu – 52% of barley. Exposure to metals altered the content of photosynthetic pigments and caused lipid peroxidation. Regression analysis revealed that there was significant negative relationship between MDA content and biomass of barley treated with Cu (r=-0.99, p=0.01. The examined heavy metals were accumulated mainly in the roots and bioconcentration of Cu there was higher than that of Cd, indicating that roots tended to accumulate higher amounts of Cu than Cd. Though translocation of Cd from roots to above-ground tissues was higher, higher levels of Cd were observed in leaves.DOI:

  4. Barley-derived beta-D-glucan induces immunostimulation via a dectin-1-mediated pathway. (United States)

    Tada, Rui; Ikeda, Futoshi; Aoki, Kosuke; Yoshikawa, Masashi; Kato, Yuya; Adachi, Yoshiyuki; Tanioka, Asuka; Ishibashi, Ken-ichi; Tsubaki, Kazufumi; Ohno, Naohito


    Barley-derived beta-glucan, a linear mixed-linkage beta-glucan composed of 1,3- and 1,4-beta-D-glucopyranose polymers, binds to dectin-1. However, whether it can trigger signal transduction via dectin-1 remains unclear. In this study, we used a reporter gene assay to determine whether barley-derived beta-d-glucan can activate NF-kappaB via dectin-1-mediated signaling when dectin-1 is cotransfected with Syk, CARD9, and Bcl10 in 293T cells. We found that barley-derived beta-D-glucan can activate NF-kappaB leading to cytokine production when dectin-1, Syk, CARD9, and Bcl10 are coexpressed in the cells. We also found that barley-derived beta-D-glucan can induce the phosphorylation of Syk and production of IL-6 in thioglycolate-elicited peritoneal macrophages. These results indicated that the immunostimulatory effects of barley-derived beta-d-glucan might be exerted, at least in part, via dectin-1. PMID:19428562

  5. Grain Composition and Functional Ingredients of Barley Varieties Created in Latvia

    Directory of Open Access Journals (Sweden)

    Šterna Vita


    Full Text Available Cereals, including barley, have been recognised as functional foods that provide beneficial effect on the health of the consumer and decrease the risk of various diseases. The aim of investigation was to determine the grain composition of barley varieties and perspective breeding lines bred in Latvia and to evaluate its functional ingredients. The results of analysis showed that protein content among varieties ranged from 106.6-146.8 g·kg-1, total dietary fibre 187.4-208.2 g·kg-1, β-glucans 42.8 g-49.4 g·kg-1, and amount of α-tocopherol 6.03-8.93 mg·kg-1. The sum of essential amino acids in barley grain samples was from 32.90 g·kg-1 to 38.71 g·kg-1. All varieties of hulled and hulless barley grain were found to be sources of protein with high biological value. Comparison of barley varieties bred in Latvia suggests that variety ‘Kornelija’ outperforms others in protein, dietary fibre and micronutrient content.

  6. Genetics of the induced and natural phenotypic variation in cultivated barley

    International Nuclear Information System (INIS)

    The Bowman series of nearly isogenic lines (NILs) developed by Prof. J. Franckowiak contain almost all of the classically described morphological mutations in barley. The unique feature of the collection is that the original mutated donor plants have all been backcrossed into a single recurrent parent, the cultivar Bowman (generally to > BC4F3). We applied a 1536-plex SNP genotyping platform developed as part of a transatlantic collaboration (BBSRC/RERAD funded AGOUEB and USDA funded Barley CAP projects) to characterise the introgressed segments containing the mutated alleles in about 1000 of the Bowman NILs. In parallel, to facilitate rapid forward genetics-based gene isolation, we generated high density barley genetic linkage map by integrating recently developed eQTL mapping data in the barley SNP-based genetic linkage map. The SNP map was constructed by genotyping three different bi-parental DH populations with 4600 SNP markers. The integrated barley map was then anchored to the rice genome sequence. We have also developed about 200 F2 populations representing 40 different genes and alleles from the phenotypic classes such as awn development, grain size, spikelet density and the lateral spikelet development. We will present an update of the strategy and our initial results. (author)

  7. Regrowth in Barley (Hordeum vulgare L.) and Rye (Secale cereale L.)

    DEFF Research Database (Denmark)

    Christiansen, J L; Jørgensen, Johannes Ravn; Jørnsgård, B; Stölen, O


    Regrowth after cutting at four development stages, from heading to grain maturity, was investigated in a pot experiment containing three rye and four barley varieties (including 2 Hordeum spontaneum lines). Regrowth in the barley varieties decreased strongly from heading to grain maturity. Rye ge...

  8. NAC Transcription Factors of Barley (Hordeum vulgare L.) and their Involvement in Leaf Senescence

    DEFF Research Database (Denmark)

    Wagner, Michael

    parts of the senescence process. The specific aims of this study were therefore (1) to establish and characterise the NAC transcription factors of the model cereal crop barley (Hordeum vulgare L.) (2) to identify and study putative barley NAC transcription factors involved in the regulation of leaf...

  9. Sequencing of 15,622 gene-bearing BACs clarifies the gene-dense regions of the barley genome (United States)

    Barley (Hordeum vulgare L.) possesses a large and highly repetitive genome of 5.1 Gb that has hindered the development of a complete sequence. In 2012, the International Barley Sequencing Consortium released a resource integrating whole-genome shotgun sequences with a physical and genetic framework....

  10. Influence of crop rotation and meteorological conditons on biodiversity of weed communities in spring barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Magdalena Jastrzębska


    Full Text Available The paper presents the analysis of changes in weed biodiversity in spring barley cultivated in the years 1990-2004 in crop rotation with a 25% proportion of this cereal (potato - spring barley - sowing peas - winter triticale, when it was grown after potato, and in crop rotation with its 75% proportion (potato - spring barley - spring barley - spring barley, when it was grown once or twice after spring barley. In the experiment, no weed control was applied. Every year in the spring (at full emergence of the cereal and before the harvest, the composition of weed species and numbers of particular weed species were determined, and before the harvest also their biomass. On this basis, the constancy of species in particular years, Shannon-Wiener species diversity indices and diversity profiles according to Rényi were determined. Weed species richness increased linearly at all plots during the 15-year period. Chenopodium album was a constant and dominant species in terms of weed species density and biomass year after year. The quality of the plot had no clear influence on the diversity of weeds in barley. Weed density and biomass showed high year-to-year variability and a positive correlation with the amount of precipitation and a negative correlation with temperature during the period of the study. The significance of the correlation between the productivity of barley and weed diversity was not confirmed.

  11. Influence of crop rotation and meteorological conditons on biodiversity of weed communities in spring barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Marta K. Kostrzewska


    Full Text Available The paper presents the analysis of changes in weed biodiversity in spring barley cultivated in the years 1990-2004 in crop rotation with a 25% proportion of this cereal (potato - spring barley - sowing peas - winter triticale, when it was grown after potato, and in crop rotation with its 75% proportion (potato - spring barley - spring barley - spring barley, when it was grown once or twice after spring barley. In the experiment, no weed control was applied. Every year in the spring (at full emergence of the cereal and before the harvest, the composition of weed species and numbers of particular weed species were determined, and before the harvest also their biomass. On this basis, the constancy of species in particular years, Shannon-Wiener species diversity indices and diversity profiles according to Rényi were determined. Weed species richness increased linearly at all plots during the 15-year period. Chenopodium album was a constant and dominant species in terms of weed species density and biomass year after year. The quality of the plot had no clear influence on the diversity of weeds in barley. Weed density and biomass showed high year-to-year variability and a positive correlation with the amount of precipitation and a negative correlation with temperature during the period of the study. The significance of the correlation between the productivity of barley and weed diversity was not confirmed.

  12. Economic analysis of fuel ethanol production from hulled barley by the EDGE (Enhanced Dry Grind Enzymatic) process (United States)

    A cost model was developed for fuel ethanol production from barley based on the EDGE (Enhanced Dry Grind Enzymatic) process (Nghiem, et al., 2008). In this process, in addition to beta-glucanases, which is added to reduce the viscosity of the barley mash for efficient mixing, another enzyme, beta-...

  13. Comparison of mobile and stationary spore-sampling techniques for estimating virulence frequencies in aerial barley powdery mildew populations

    DEFF Research Database (Denmark)

    Hovmøller, M.S.; Munk, L.; Østergård, Hanne


    Gene frequencies in samples of aerial populations of barley powdery mildew (Erysiphe graminis f.sp. hordei), which were collected in adjacent barley areas and in successive periods of time, were compared using mobile and stationary sampling techniques. Stationary samples were collected from trap ...

  14. Influence of crop rotation and meteorological conditons on density and biomass of weeds in spring barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Maria Wanic


    Full Text Available The paper presents the analysis of changes in weed infestation in spring barley cultivated in the years 1990-2004 in crop rotation with a 25% proportion of this cereal (potato - spring barley - sowing peas - winter triticale, when it was grown after potato, and in crop rotation with its 75% proportion (potato - spring barley - spring barley - spring barley, when it was grown once or twice after spring barley. In the experiment, no weed control was applied. Every year in the spring (at full emergence of the cereal and before the harvest, the composition of weed species and weed density of particular weed species were determined, and before the harvest also their biomass. Weed density increased linearly on all plots during the 15-year period. The average values confirm the increase in weed biomass in the case when spring barley was grown once or twice after this crop; however, those differences were influenced by the previous situation only during some seasons. Weed density and biomass showed high year-to-year variability and a positive correlation with the amount of precipitation and a negative correlation with temperature during the period of the study. A negative correlation between the yield of barley and weed biomass was shown.

  15. Quantitative trait loci of barley malting quality trait components in the Stellar/01Ab8219 mapping population (United States)

    Malting barley is of high economic and scientific importance. Determining barley grains that are suitable for malting involves measuring malting quality, which is an expensive and complex process. In order to decrease the cost of phenotyping and accelerate the process of developing superior malting ...

  16. Induction by chromium ions of chitinases and polyamines in barley (Hordeum vulgare L.) and rape (Brassica napus L. ssp. oleifera)

    DEFF Research Database (Denmark)

    Jacobsen, S.; Hauschild, M.Z.; Rasmussen, U.


    Barley and rape seedlings were grown in hydroponic culture with increasing concentrations of CrO3 (Cr(VI)) or CrCl3 (Cr(III)). The chitinase activity and the concentrations of putrescine, spennidine and spermine were determined in the third leaf of barley seed-lings and in the second leaf of rape...

  17. Management of diabetic dyslipidemia with subatmospheric dehydrated barley grass powder

    Directory of Open Access Journals (Sweden)

    Venugopal Shonima


    Full Text Available Diabetes is a chronic, potentially debilitating and often fatal disease. The prevalence of type 2 diabetes is increasing in all populations worldwide. The investigation was carried out to study the impact of barley grass powder (BGP supplementation on the carbohydrate and lipid metabolism of stable type 2 diabetes mellitus (T2DM subjects. A total of 59 stable type 2 diabetic subjects were enrolled in the study from pathology laboratories and divided into experimental (n=36 and control groups (n=23. BGP (1.2 g/day in the form of capsules (n=4 was given to the experimental group subjects for a period of 60 days. Fasting blood sugar (FBS, glycated haemoglobin (HbA1c and lipid profile levels were monitored at baseline and at 60 days. Paired t test was applied using Microsoft® Office Excel 2003. Supplementation with BGP resulted in a significant decrease in FBS, HbA1c, total cholesterol (TC, low-density lipoprotein cholesterol (LDL-C and non-high-density lipoprotein cholesterol (Non-HDL-C and a significant increase in high-density lipoprotein cholesterol (HDL-C levels. In conclusion, the results obtained suggest that BGP holds promise to be used as a functional food to optimise the health of diabetic subjects.

  18. Lil3 Assembles with Proteins Regulating Chlorophyll Synthesis in Barley.

    Directory of Open Access Journals (Sweden)

    Astrid Mork-Jansson

    Full Text Available The light-harvesting-like (LIL proteins are a family of membrane proteins that share a chlorophyll a/b-binding motif with the major light-harvesting antenna proteins of oxygenic photoautotrophs. LIL proteins have been associated with the regulation of tetrapyrrol biosynthesis, and plant responses to light-stress. Here, it was found in a native PAGE approach that chlorophyllide, and chlorophyllide plus geranylgeraniolpyrophosphate trigger assembly of Lil3 in three chlorine binding fluorescent protein bands, termed F1, F2, and F3. It is shown that light and chlorophyllide trigger accumulation of protochlorophyllide-oxidoreductase, and chlorophyll synthase in band F3. Chlorophyllide and chlorophyll esterified to geranylgeraniol were identified as basis of fluorescence recorded from band F3. A direct interaction between Lil3, CHS and POR was confirmed in a split ubiquitin assay. In the presence of light or chlorophyllide, geranylgeraniolpyrophosphate was shown to trigger a loss of the F3 band and accumulation of Lil3 and geranylgeranyl reductase in F1 and F2. No direct interaction between Lil3 and geranylgeraniolreductase was identified in a split ubiquitin assay; however, accumulation of chlorophyll esterified to phytol in F1 and F2 corroborated the enzymes assembly. Chlorophyll esterified to phytol and the reaction center protein psbD of photosystem II were identified to accumulate together with psb29, and APX in the fluorescent band F2. Data show that Lil3 assembles with proteins regulating chlorophyll synthesis in etioplasts from barley (Hordeum vulgare L..

  19. The strategy of carbon utilization in uniculm barley

    International Nuclear Information System (INIS)

    Following exposure of the youngest mature leaf of uniculm barley to 14CO2, groups of plants were harvested over a 72 h period to determine the fate of 14C in the photosynthesizing leaf and in growing leaves and roots. Initially, 14C was mainly present in sucrose with a little in starch and charged compounds; transport out of the fed leaf was rapid and, by 7 and 24 h, 56 and 93% respectively of the 14C had been translocated about equally to growing leaves and roots. Sucrose entering meristems was quickly metabolized to protein and structural carbohydrate (40 and 60% of the 14C in these organs at 7 and 24 h respectively), while the remainder was converted to short-term storage products or intermediary metabolites. By the end of the first day c.35% of the 14C originally assimilated had been lost in respiration. The metabolism of the leaf appeared to be organized on a diurnal basis, for it exported nearly all its carbon within 24 h of assimilation. In contrast, some of the assimilate imported into growing leaves and, to a lesser extent, roots was not immediately used for growth but persisted as temporary metabolites and was subsequently used for growth in the following days. (author)

  20. UV-B response of green and etiolated barley seedlings

    International Nuclear Information System (INIS)

    Seven-d-old etiolated and green barley seedlings (Hordeum vulgare cv. Alfa) were irradiated with UV-B for 30 min and then kept for 24 h in light or darkness. Chlorophyll (Chl) synthesis was inhibited by about 30% as a result of UV-B irradiation, but there were no significant changes in photochemical activity measured by variable to maximum fluorescence ratio (Fv/Fm), quantum yield and oxygen evolution rate. Electron transport of etiolated seedlings was similar to that of green ones, nevertheless, the Chl content was more then 2-fold lower. Ribulose-1,5-bisphosphate carboxylase/oxygenase large and small subunits were diminished as a result of UV-B irradiation in both etiolated and green plants, especially in those kept in the darkness. Catalase activity decreased and total superoxide dismutase activity increased in both types of plants following UV-B treatment. When benzidine was used as a substrate, an isoform located between guaiacol peroxidases 2 and 3 (guaiacol peroxidase X) appeared, which was specific for UV-B treatment. As a result of irradiation, the contents of UV-B absorbing and UV-B induced compounds increased in green seedlings but not in etiolated ones

  1. Numerical simulation static-bed drying of barley

    Energy Technology Data Exchange (ETDEWEB)

    Mandas, N. [Universita di Cagliari (Italy). Dipartimento d' Ingegneria Meccanica; Habte, M. [Addis Ababa University (Ethiopia). Mechanical Engineering Department


    The last decade has seen enormous progress in mathematical modelling and numerical simulation in areas related with fluid dynamics and heat and mass transfer. This is because of the increasingly widespread use of powerful, low-cost digital computers. Future efforts should be directed towards developing computer codes that can be implemented by users who may not be well versed in computational skills. Here a computer program has been developed, for simulating a non-equilibrium mathematical model for static-deep-bed drying of barley. The model consists of a set of four non-linear partial differential equations as a result of mass and energy balances and heat transfer equations, together with appropriate diffusion equation. The set of equations is solved by means of a finite-difference method, using a second-order iterative predictor-corrector process to solve the first two equations in the time domain, and a first-order iterative process for the second two, in the space domain. Published experimental results are used to validate the model. The numerical results are in good agreement with the experimental data relative to heated-air drying system, and the prediction accuracy is enhanced with respect to equilibrium models. (author)

  2. The Mutation Frequency in Different Spike Categories in Barley

    DEFF Research Database (Denmark)

    Frydenberg, O.; Doll, Hans; Sandfær, J.


    treatment (denoted as post-formed spikes). The task was attempted in two ways. First, comparisons were made between plant groups with different numbers of tillers. This analysis revealed no significant differences. Secondly, we compared the mutant frequencies of spikes ranked within each X1 plant according......After gamma irradiation of barley seeds, a comparison has been made between the chlorophyll-mutant frequencies in X1 spikes that had multicellular bud meristems in the seeds at the time of treatment (denoted as pre-formed spikes) and X1 spikes having no recognizable meristems at the time of...... to their number of flowers, a ranking which was shown to reflect the embryological status of the spike. In this comparison it was found that (a) the frequency of mutated X1 spikes is larger by a factor of 1·5–2 in pre-formed than in post-formed spikes, (b) the frequency of mutated X2 plants among all...

  3. Agronomic evaluation of barley mutants under semi-arid conditions

    International Nuclear Information System (INIS)

    A mutant line, Cyp M9, selected from a population of the barley variety Attiki treated with gamma rays, was evaluated against commercial varieties for the grain yield, yield components, and the protein content and yield in 15 trials. The grain yield of Cyp M9 was 14% higher than that of its mother variety, Attiki, and similar to those of the best commercial varieties, Athenais and Kantara. The protein yield of the mutant line (711 kg/ha) was higher than those of the commercial varieties. Regression analyses of the varietal grain yield and the environmental mean showed that the response of Cyp M9 to improved environmental conditions was greater than those of the commercial varieties. Furthermore, Cyp M9 showed a better response to higher rainfall conditions than Kantara. In general, the mutant Cyp M9 responded to environmental changes in the semi-arid environment in a manner similar to, or better than, those of the commercial varieties. (author). 5 refs, 1 fig., 1 tab

  4. Golgi localized barley MTP8 proteins facilitate Mn transport

    DEFF Research Database (Denmark)

    Pedas, Pai Rosager; Schiller, Michaela; Hegelund, Josefine Nymark;


    Many metabolic processes in plants are regulated by manganese (Mn) but limited information is available on the molecular mechanisms controlling cellular Mn homeostasis. In this study, a yeast assay was used to isolate and characterize two genes, MTP8.1 and MTP8.2 , which encode membrane-bound pro......Many metabolic processes in plants are regulated by manganese (Mn) but limited information is available on the molecular mechanisms controlling cellular Mn homeostasis. In this study, a yeast assay was used to isolate and characterize two genes, MTP8.1 and MTP8.2 , which encode membrane......-bound proteins belonging to the cation diffusion facilitator (CDF) family in the cereal species barley (Hordeum vulgare). Transient expression in onion epidermal cells showed that MTP8.1 and MTP8.2 proteins fused to the green fluorescent protein (GFP) are localized to Golgi. When heterologously expressed......8 proteins are involved in Mn loading to the Golgi apparatus and play a role in Mn homeostasis by delivering Mn to Mn-dependent enzymes and/or by facilitating Mn efflux via secretory vesicles. This study highlights the importance of MTP transporters in Mn homeostasis and is the first report of Golgi...

  5. Structural lability of Barley stripe mosaic virus virions.

    Directory of Open Access Journals (Sweden)

    Valentin V Makarov

    Full Text Available Virions of Barley stripe mosaic virus (BSMV were neglected for more than thirty years after their basic properties were determined. In this paper, the physicochemical characteristics of BSMV virions and virion-derived viral capsid protein (CP were analyzed, namely, the absorption and intrinsic fluorescence spectra, circular dichroism spectra, differential scanning calorimetry curves, and size distributions by dynamic laser light scattering. The structural properties of BSMV virions proved to be intermediate between those of Tobacco mosaic virus (TMV, a well-characterized virus with rigid rod-shaped virions, and flexuous filamentous plant viruses. The BSMV virions were found to be considerably more labile than expected from their rod-like morphology and a distant sequence relation of the BSMV and TMV CPs. The circular dichroism spectra of BSMV CP subunits incorporated into the virions, but not subunits of free CP, demonstrated a significant proportion of beta-structure elements, which were proposed to be localized mostly in the protein regions exposed on the virion outer surface. These beta-structure elements likely formed during virion assembly can comprise the N- and C-terminal protein regions unstructured in the non-virion CP and can mediate inter-subunit interactions. Based on computer-assisted structure modeling, a model for BSMV CP subunit structural fold compliant with the available experimental data was proposed.

  6. Antioxidant-guided isolation and mass spectrometric identification of the major polyphenols in barley (Hordeum vulgare) grain. (United States)

    Gangopadhyay, Nirupama; Rai, Dilip K; Brunton, Nigel P; Gallagher, Eimear; Hossain, Mohammad B


    In the present study, the relative contribution of individual/classes of polyphenols in barley, to its antioxidant properties, was evaluated. Flash chromatography was used to fractionate the total polyphenol extract of Irish barley cultivar 'Irina', and fractions with highest antioxidant properties were identified using total phenolic content and three in vitro antioxidant assays: DPPH, FRAP, and ORAC. Flavanols (catechin, procyanidin B, prodelphinidin B, procyanidin C) and a novel substituted flavanol (catechin dihexoside, C27H33O16(-), m/z 613.17), were identified as constituents of the fraction with highest antioxidant capacity. Upon identification of phenolics in the other active fractions, the order of most potent contributors to observed antioxidant capacity of barley extract were, flavanols>flavonols (quercetin)>hydroxycinnamic acids (ferulic, caffeic, coumaric acids). The most abundant polyphenol in the overall extract was ferulic acid (277.7μg/gdw barley), followed by procyanidin B (73.7μg/gdw barley). PMID:27211640

  7. High-Level Accumulation of Exogenous Small RNAs Not Affecting Endogenous Small RNA Biogenesis and Function in Plants

    Institute of Scientific and Technical Information of China (English)

    SHEN Wan-xia; Neil A Smith; ZHOU Chang-yong; WANG Ming-bo


    RNA silencing is a fundamental plant defence and gene control mechanism in plants that are directed by 20-24 nucleotide (nt) small interfering RNA (siRNA) and microRNA (miRNA). Infection of plants with viral pathogens or transformation of plants with RNA interference (RNAi) constructs is usually associated with high levels of exogenous siRNAs, but it is unclear if these siRNAs interfere with endogenous small RNA pathways and hence affect plant development. Here we provide evidence that viral satellite RNA (satRNA) infection does not affect siRNA and miRNA biogenesis or plant growth despite the extremely high level of satRNA-derived siRNAs. We generated transgenic Nicotiana benthamiana plants that no longer develop the speciifc yellowing symptoms generally associated with infection by Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat). We then used these plants to show that CMV Y-Sat infection did not cause any visible phenotypic changes in comparison to uninfected plants, despite the presence of high-level Y-Sat siRNAs. Furthermore, we showed that the accumulation of hairpin RNA (hpRNA)-derived siRNAs or miRNAs, and the level of siRNA-directed transgene silencing, are not signiifcantly affected by CMV Y-Sat infection. Taken together, our results suggest that the high levels of exogenous siRNAs associated with viral infection or RNAi-inducing transgenes do not saturate the endogenous RNA silencing machineries and have no signiifcant impact on normal plant development.

  8. Cereal bioengineering: Amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Shaik, Shahnoor Sultana; Jensen, Susanne Langgård;


    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were made by transgenic methods. Cereals producing these kind of starches have not been reported before. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch...... branching enzymes SBEIIa, SBEIIb and SBEI by a chimeric hairpin. The construct was inherited as a single locus with a distinct 1:3 segregation in consecutive generations. The transgenic grains were shrunken and the yield was around 80% of that found in wildtype. The starch granules were irregularly......, elongated and globose shaped. Transgenic grains also had a higher beta-glucan content. In order to increase barley starch phosphorylation, endosperm specific overexpression of glucan water dikinase from potato (StGWD) was conducted. The content of phosphate esters in starch from consecutive generations (T0...

  9. The effect of nitrogen fertilization and irradiation on barley susceptibility to net blotch disease

    International Nuclear Information System (INIS)

    Isolates of Drechslera teres f. sp. teres that cause net blotch symptoms on barley were collected from fields in different regions of Syria. there virulence spectra were determined using 11 barley cultivars. Cultivars exhibited a continuos range of response from very susceptible to moderately resistant. Isolate Raqa 13 had the highest mean virulence, then Halap 2, whereas ICARDA 3 was the lowest virulent. The effect of three concentrations (1000, 1500, 2000 ppm) of nitrogen (Urea 45%) fertilizer, and two doses of gamma ray (10 and 20 Gy), on susceptibility to infection by Drechslera teres were studied. Two barley cultivars (Thibaut and Furia) were used in this study. Results showed that 1000 ppm (N) and 15 Gy dose treatment had a positive effect on decreasing the susceptibility. (author)

  10. Interactions between Barley a-Amylases, Substrates, Inhibitors and Regulatory Proteins

    DEFF Research Database (Denmark)

    Hachem, Maher Abou; Bozonnet, Sophie; Willemoës, Martin;


    Barley a-amylase binds sugars at two sites on the enzyme surface in addition to the active site. Crystallography and site-directed mutagenesis highlight the importance of aromatic residues at these surface sites as demonstrated by Kd values determined for ß-cyclodextrin by surface plasmon resonance...... is studied by mutagenesis, crystallography and microcalorimetry. Further improvement of recombinant AMY2 production allows future direct mutational analysis in this isozyme. Specific proteinaceous inhibitors act on a-amylases of different origin. In the complex of barley a-amylase...... are targets of the disulphide reductase thioredoxin h that attacks a specific disulphide bond in BASI and, remarkably, reduces two different disulphide bonds in the barley monomeric and dimeric amylase inhibitors that both belong to the CM-proteins and inhibit animal a-amylase....

  11. The comparison of nitrogen use and leaching in sole cropped versus intercropped pea and barley

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, H.; Ambus, P.; Jensen, E.S.


    harvested in sole cropped barley. Calculation of the LER showed that plant growth resources were used from 17 to 31% more efficiently by the intercrop than by the sole crops. Pea increased the N derived from N-2 fixation from 70% when sole cropped to 99% of the total aboveground N accumulation when...... significantly different from the sole cropped pea and barley lysimeters. Soil N balances indicated depletion of N in the soil-plant system during the experimental period, independent of cropping system and residue management. N complementarity in the cropping system and the synchrony between residual N......The effect of sole and intercropping of field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) and of crop residue management on crop yield, NO3- leaching and N balance in the cropping system was tested in a 2-year lysimeter experiment on a temperate sandy loam soil. The crop rotation...

  12. Comparison of foliar anatomy of ten bread wheat (triticum, poaceae) and ten barley (hordeum, poaceae) cultivars

    International Nuclear Information System (INIS)

    The aim of this study is to determine anatomical differences and classification of leaf and leaf cell characteristics (cuticle thickness, upper epidermis thickness, lower epidermis thickness, mesophyll thickness, parenchyma thickness and leaf thickness) between 10 bread wheat cultivars (Triticum aestivum L.) and 10 barley cultivars (Hordeum vulgare L.). Classification of leaf characteristics in bread wheat and barley cultivars and relationship between leaf characteristics are made by principal component and correlation analyses. Highest thickness belongs to W8 Mufitbey cultivar in mesophyll and lower epidermis and W1 Sonmez 01 cultivar have the lowest thickness of upper epidermis in bread wheat. In Barley, B1 Ince cultivar has highest leaf thickness mesophyll and parenchyma; lowest thickness of cuticle is included B7 Cumhuriyet 50 cultivar. All other cultivars have homogenous contents of leaf characteristics. (author)

  13. Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison

    DEFF Research Database (Denmark)

    Li, Chengdao; Ni, Peixiang; Francki, Michael;


    . A major QTL controlling both pre-harvest sprouting and seed dormancy has been identified on the long arm of barley chromosome 5H, and it explains over 70% of the phenotypic variation. Comparative genomics approaches among barley, wheat and rice were used to identify candidate gene(s) controlling...... seed dormancy and hence one aspect of pre-harvest sprouting. The barley seed dormancy/pre-harvest sprouting QTL was located in a region that showed good synteny with the terminal end of the long arm of rice chromosome 3. The rice DNA sequences were annotated and a gene encoding GA20-oxidase was......Pre-harvest sprouting results in significant economic loss for the grain industry around the world. Lack of adequate seed dormancy is the major reason for pre-harvest sprouting in the field under wet weather conditions. Although this trait is governed by multiple genes it is also highly heritable...

  14. Engineering high-level aluminum tolerance in barley with the ALMT1 gene. (United States)

    Delhaize, Emmanuel; Ryan, Peter R; Hebb, Diane M; Yamamoto, Yoko; Sasaki, Takayuki; Matsumoto, Hideaki


    Acidity is a serious limitation to plant production on many of the world's agricultural soils. Toxic aluminium (Al) cations solubilized by the acidity rapidly inhibit root growth and limit subsequent uptake of water and nutrients. Recent work has shown that the ALMT1 gene of wheat (Triticum aestivum) encodes a malate transporter that is associated with malate efflux and Al tolerance. We generated transgenic barley (Hordeum vulgare) plants expressing ALMT1 and assessed their ability to exude malate and withstand Al stress. ALMT1 expression in barley conferred an Al-activated efflux of malate with properties similar to those of Al-tolerant wheat. The transgenic barley showed a high level of Al tolerance when grown in both hydroponic culture and on acid soils. These findings provide additional evidence that ALMT1 is a major Al-tolerance gene and demonstrate its ability to confer effective tolerance to acid soils through a transgenic approach in an important crop species. PMID:15471989

  15. Improving the nutritional quality of the barley and wheat grain storage proteins by antisense technology

    DEFF Research Database (Denmark)

    Sikdar, Md. Shafiqul Islam; Lange, Mette; Aaslo, Per;


    genetic modification with antisense or the more drastic RNAi suppression technology and study the change in protein pattern under different environmental conditions. We have five antisense and 12 RNAi C-hordein lines of barley (RNAi lines are under characterisation) and wheat RNAi lines (gamma and alpha...... result, a considerable amount of research is focused on improving the quality and quantity of seed storage protein both by traditional plant breeding and by modern genetic engineering technology. In our research program we are trying to enrich the nutritional quality of barley and wheat grains using...... plan to construct wheat omega RNAi lines using RNAi technology. The cloning of the omega gliadin from wheat is in progress. Finally, the agronomic properties and nutritional values of the genetically modified barley and wheat will be evaluated. References Hansen, M., Lange, M., Friis, M., Dionisio. G...

  16. Effect of Soil Erosion on Spring Barley Growth in East Anglia,England:Preliminary Results

    Institute of Scientific and Technical Information of China (English)



    The effect of soil erosion on spring barley growth was studied on a deep loamy soil in East Anglia,England,in 1992,Soil erosion was simulated by three levels of soil desurfacing,7.5,18and 30cm with three replicates.Significant differences in crop height,ground cover and crop yield were observed between the three levels of desurfacing.Soil desurfacing also has a singnificant effect on soil moisture at the 20cm depth.The interaction between soil removal and crop performance affected soil moisture at the depths of 50 and 100cm,No significant differences were found in runoff and sediment etween the three topsoil removals due to very dry growing season.Regression equations were developed between spring barley yield and soil desurfacing Spring barley grain yield declined by 97.6kg/ha per cm soil desurfacing.

  17. Matrix attachment regions (MARs) enhance transformation frequencies and reduce variance of transgene expression in barley

    DEFF Research Database (Denmark)

    Petersen, K.; Leah, R.; Knudsen, S.;


    this crop by biotechnology. Two plant MAR sequences were tested both for their ability to bind to the nuclear matrix of barley leaf nuclei and to regulate the expression of a reporter gene in transgenic barley. Competitive in vitro MAR binding assays with the 520 bp P1-MAR from soybean and the 516 bp......Nuclear matrix attachment regions (MARs) are defined as genomic DNA sequences, located at the physical boundaries of chromatin loops. They are suggested to play a role in the cis unfolding and folding of the chromatin fibre associated with the regulation of gene transcription. Inclusion of MARs in...... transgene cassettes enhances their expression and reduces position-effect variations in the transgenic host. The present study is the first to investigate the influence of MAR sequences on transformation frequencies and transgene expression in barley, which is highly relevant to the future improvement of...

  18. Pea-barley intercropping and short-term subsequent crop effects across European organic cropping conditions

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, Henrik; Gooding, M.; Ambus, Per;


    asses the effect of intercropping pea and barley on the N supply to subsequent wheat in organic cropping systems. Pea and barley were grown either as sole crops at the recommended plant density (P100 and B100, respectively) or in replacement (P50B50) or additive (P100B50) intercropping designs. In the...... grain N yield with 25–30% using the Land Equivalent ratio. In terms of absolute quantities, sole cropped pea accumulated more N in the grains as compared to the additive design followed by the replacement design and then sole cropped barley. The post harvest soil mineral N content was unaffected by the...... preceding crops. Under the following winter wheat, the lowest mineral N content was generally found in early spring. Variation in soil mineral N content under the winter wheat between sites and seasons indicated a greater influence of regional climatic conditions and long-term cropping history than annual...

  19. Comparison of different pretreatment strategies for enzymatic hydrolysis of wheat and barley straw

    DEFF Research Database (Denmark)

    Rosgaard, Lisa; Pedersen, Sven; Meyer, Anne Boye Strunge


    generally produced higher glucose concentrations after enzymatic hydrolysis than wheat straw. Acid or water impregnation followed by steam explosion of barley straw was the best pretreatment in terms of resulting glucose concentration in the liquid hydrolysate after enzymatic hydrolysis. When the glucose...... a glucose yield of similar to 39% (g g(-1)). Addition of extra enzyme (Celluclast 1.5 L (R)+Novozyme 188) during enzymatic hydrolysis resulted in the highest total glucose concentrations from barley straw, 32-39 g L-1, but the relative increases in glucose yields were higher on wheat straw than on......In biomass-to-ethanol processes a physico-chemical pretreatment of the lignocellulosic biomass is a critical requirement for enhancing the accessibility of the cellulose substrate to enzymatic attack. This report evaluates the efficacy on barley and wheat straw of three different pretreatment...

  20. The Hv NAC6 transcription factor: a positive regulator of penetration resistance in barley and Arabidopsis

    DEFF Research Database (Denmark)

    Jensen, Michael Krogh; Rung, Jesper Henrik; Gregersen, Per Langkjaer;


    Pathogens induce the expression of many genes encoding plant transcription factors, though specific knowledge of the biological function of individual transcription factors remains scarce. NAC transcription factors are encoded in plants by a gene family with proposed functions in both abiotic and...... biotic stress adaptation, as well as in developmental processes. In this paper, we provide convincing evidence that a barley NAC transcription factor has a direct role in regulating basal defence. The gene transcript was isolated by differential display from barley leaves infected with the biotrophic...... towards virulent Bgh. Complementing the effect of HvNAC6 gene silencing, transient overexpression of HvNAC6 increases the occurrence of penetration resistant cells towards Bgh attack. Quantitative RT-PCR shows the early and transient induction of HvNAC6 in barley epidermis upon Bgh infection. Additionally...

  1. Quality of rolled barley flakes as affected by batch of grain and processing technique. (United States)

    Sundberg, B; Abrahamsson, L; Aman, P


    Rolled barely flakes were prepared from three different batches of grain by pearling, steaming and rolling. Autoclaved and malted barleys from the three batches were also processed in the same way. Analysis of the nine products showed that both batch of barley and process had significant effects on chemical composition and viscosity. Puddings were prepared from the products and mechanical consistency, juiciness and grain consistency were graded on both newly prepared and heated puddings by a sensory taste panel. Batch of barley had no effect on mechanical consistency but significant effects on juiciness and grain consistency. Type of processing had significant effect on all three parameters for both newly prepared and heated puddings. PMID:8153065

  2. Should wheat, barley, rye, and/or gluten be avoided in a 6-food elimination diet? (United States)

    Kliewer, Kara L; Venter, Carina; Cassin, Alison M; Abonia, J Pablo; Aceves, Seema S; Bonis, Peter A; Dellon, Evan S; Falk, Gary W; Furuta, Glenn T; Gonsalves, Nirmala; Gupta, Sandeep K; Hirano, Ikuo; Kagalwalla, Amir; Leung, John; Mukkada, Vincent A; Spergel, Jonathan M; Rothenberg, Marc E


    Eosinophilic esophagitis (EoE), a food antigen-mediated disease, is effectively treated with the dietary elimination of 6 foods commonly associated with food allergies (milk, wheat, egg, soy, tree nuts/peanuts, and fish/shellfish). Because wheat shares homologous proteins (including gluten) with barley and rye and can also be processed with these grains, some clinicians have suggested that barley and rye might also trigger EoE as a result of cross-reaction and/or cross-contamination with wheat. In this article, we discuss the theoretical risks of cross-reactivity and cross-contamination among wheat, barley, and rye proteins (including gluten); assess common practices at EoE treatment centers; and provide recommendations for dietary treatment and future studies of EoE. PMID:26725190

  3. Iron transport, deposition and bioavailability in the wheat and barley grain

    DEFF Research Database (Denmark)

    Borg, Søren; Brinch-Pedersen, Henrik; Tauris, Birgitte; Holm, Preben B

    briefly review existing knowledge on the distribution and transport pathways of iron in the two small grained cereals, barley and wheat, and focus on the efforts made to increase the iron content in cereals in general. However, mineral content is not the only factor of relevance for improving the...... nutritional impact of increasing mineral content accordingly has to be seen in the context of mineral bioavailability. Finally, we will briefly report on recent data from barley, where laser capture microdissection of the different grain tissues combined with gene expression profiling has provided some...... insight into metal transport and deposition (Tauris et al. 2009). In the present paper we will provide a tentative and preliminary roadmap for iron trafficking in the barley grain...

  4. A comparative assessment of antioxidant properties, total phenolic content of einkorn, wheat, barley and their malts. (United States)

    Fogarasi, Attila-Levente; Kun, Szilárd; Tankó, Gabriella; Stefanovits-Bányai, Eva; Hegyesné-Vecseri, Beáta


    Two einkorn wheat, one barley, three optional winter cultivation wheat and five winter cultivation wheat samples harvested in Hungary in 2011, and their malts were evaluated for their DPPH radical and ABTS radical cation scavenging activity, ferric reduction capacity (FRAP) and total phenolic content (TPC). All einkorn and barley samples exhibited significant antioxidant activities determined by DPPH and ABTS radical scavenging activities. The einkorn samples show higher polyphenol content than the other wheat samples. In all cases the barley sample had the highest antioxidant potential and polyphenol content. The einkorn malts had high DPPH and ABTS radical cation scavenging activities, but the phenolic content was lower against wheat samples. There was significant difference between the antioxidant potential of optional and winter cultivation wheat samples except on ABTS scavenging activities. Einkorn wheat is potentially a new raw material to produce organic beer that might have beneficial effects with its increased antioxidant potential. PMID:25148951

  5. Maize, Sunflower and Barley Sensitivity to the Residual Activity of Clomazone in Soil

    Directory of Open Access Journals (Sweden)

    Jelena Gajić Umiljendić


    Full Text Available Sensitivity of maize, sunflower and barley to clomazone residues in loamy soil wasassessed in the study using bioassay. Clomazone was applied at a series of concentrationsfrom 0.12 to 12 mg a.i./kg of soil. After 14 days, morphological (shoot height, fresh and dryweight and physiological (content of carotenoids, chlorophyll a and chlorophyll b parameterswere measured. The results showed that morphological parameters are not valid indicatorsof clomazone sensitivity. Based on the results showing inhibition of the physiologicalparameters, I50 values were calculated and used to estimate the difference in sensitivitybetween the species tested. Sunflower was the most sensitive species, while the differencein sensitivity between maize and barley was not significant.Nomenclature: clomazone (2-(2-chlorbenzyl-4,4-dimethyl-1,2-oxazolidin-3-one, maize(Zea mays L., sunflower (Helianthus annuus L., barley (Hordeum vulgare L.

  6. Impact of Low Concentration of Cadmium on Photosynthesis and Growth of Pea and Barley

    Directory of Open Access Journals (Sweden)

    Irena Januškaitienė


    Full Text Available Photosynthetic gas exchange and growth characteristics were examined in pea and barley plants using 1 mM Cd treatment. Plants were sown into neutral peat substrate and at a leaf development stage were treated with 1 mM cadmium concentration solution. Gas exchange parameters (photosynthetic rate; intercellular CO2 concentration; transpiration rate; water use efficiency were measured with portable photosynthesis system LI-6400 on the fifth day after Cd treatment. Under Cd stress the photosynthetic rate of pea and barley plants decreased by 16.7 % (p 2 concentration decreased by 27.4 % (p 2 reduction processes of Cd treated pea leaves increased (because intercellular CO2 concentration decreased, but that had no positive effect on a photosynthetic rate, and the photosynthetic rate of pea decreased by 4 % more than that of barley. The changes of dry biomass of cadmium treated plants were weak and statistically insignificant.

  7. Development and characterization of polymorphic EST-SSR and genomic SSR markers for Tibetan annual wild barley.

    Directory of Open Access Journals (Sweden)

    Mian Zhang

    Full Text Available Tibetan annual wild barley is rich in genetic variation. This study was aimed at the exploitation of new SSRs for the genetic diversity and phylogenetic analysis of wild barley by data mining. We developed 49 novel EST-SSRs and confirmed 20 genomic SSRs for 80 Tibetan annual wild barley and 16 cultivated barley accessions. A total of 213 alleles were generated from 69 loci with an average of 3.14 alleles per locus. The trimeric repeats were the most abundant motifs (40.82% among the EST-SSRs, while the majority of the genomic SSRs were di-nuleotide repeats. The polymorphic information content (PIC ranged from 0.08 to 0.75 with a mean of 0.46. Besides this, the expected heterozygosity (He ranged from 0.0854 to 0.7842 with an average of 0.5279. Overall, the polymorphism of genomic SSRs was higher than that of EST-SSRs. Furthermore, the number of alleles and the PIC of wild barley were both higher than that of cultivated barley, being 3.12 vs 2.59 and 0.44 vs 0.37. Indicating more polymorphism existed in the Tibetan wild barley than in cultivated barley. The 96 accessions were divided into eight subpopulations based on 69 SSR markers, and the cultivated genotypes can be clearly separated from wild barleys. A total of 47 SSR-containing EST unigenes showed significant similarities to the known genes. These EST-SSR markers have potential for application in germplasm appraisal, genetic diversity and population structure analysis, facilitating marker-assisted breeding and crop improvement in barley.

  8. Hordein variation in Brazilian barley varieties (Hordeum vulgare L. and wild barley (H. euclaston Steud. and H. stenostachys Godr.

    Directory of Open Access Journals (Sweden)

    Echart-Almeida Cinara


    Full Text Available SDS-PAGE was used to analyze the hordein polypeptide patterns of Brazilian barley varieties (Hordeum vulgare L. and of two native species of Hordeum from southern Brazil (H. euclaston Steud. and H. stenostachys Godr.. Forty different hordein polypeptide bands with molecular weights ranging from 30 to 94 kDa were found in the seeds of the three species studied. Twelve of the 14 varieties examined showed intravarietal polymorphism. The number of bands ranged from 10 to 17, depending on the variety, and from 3 to 13 among individual seeds, with a total of 26 bands in H. vulgare. Phenograms using each seed as an operational taxonomic unit (OTU showed that the seeds from most varieties did not form distinct clusters. Seeds from different plants of the native species varied considerably. The molecular weights of the hordein polypeptides of the two native species were quite different from those of H. vulgare. There was a greater similarity between the native species than with H. vulgare, although H. stenostachys was slightly closer to the cultivated species than H. euclaston.

  9. High-moisture air-tight storage of barley and wheat improves nutrient digestibility. (United States)

    Poulsen, H D; Blaabjerg, K; Nørgaard, J V; Ton Nu, M A


    Barley (Hordeum vulgare) and wheat (Triticum aestivum) are often stored dry with 14% or less moisture, which during rainy periods may require that grains are dried after harvest. The hypothesis is that air-tight storage of high-moisture barley and wheat will increase nutrient digestibility due to chemical conversions prior to feeding. The objective was to evaluate the effect of high moisture compared to dry storage of barley and wheat on digestibility of P and CP. The crops were grown on 1 field keeping other factors constant. Half of the grains was harvested in the morning after a rainy day and stored in air-tight silos (DM, %: barley, 85.2; wheat, 82.8) and the other half was harvested later the same day (windy and sunny) and stored dry (DM, %: barley, 89.8; wheat, 88.3). After 6 mo of storage, 1 low- and 1 high-moisture diet were prepared with a barley:wheat ratio of 1:1 mixed with soybean (Glycine max) meal and rapeseed cake to produce a compound diet without inorganic P and microbial phytase. Sixteen 45-kg pigs housed in metabolism crates were fed either the low- or the high-moisture diet for 5 d for adaptation and 7 d for total collection of feces. Digestibility of P was 12% higher (P pigs. Therefore, high-moisture air-tight storage saved energy (without drying) and at the same time enhanced P digestibility and increased the nutritional value of grain probably through enzymatic activity during storage. PMID:23365343

  10. Transferability and polymorphism of barley EST-SSR markers used for phylogenetic analysis in Hordeum chilense

    Directory of Open Access Journals (Sweden)

    Dorado Gabriel


    Full Text Available Abstract Background Hordeum chilense, a native South American diploid wild barley, is a potential source of useful genes for cereal breeding. The use of this wild species to increase genetic variation in cereals will be greatly facilitated by marker-assisted selection. Different economically feasible approaches have been undertaken for this wild species with limited direct agricultural use in a search for suitable and cost-effective markers. The availability of Expressed Sequence Tags (EST derived microsatellites or simple sequence repeat (SSR markers, commonly called as EST-SSRs, for barley (Hordeum vulgare represents a promising source to increase the number of genetic markers available for the H. chilense genome. Results All of the 82 barley EST-derived SSR primer pairs tested for transferability to H. chilense amplified products of correct size from this species. Of these 82 barley EST-SSRs, 21 (26% showed polymorphism among H. chilense lines. Identified polymorphic markers were used to test the transferability and polymorphism in other Poaceae family species with the aim of establishing H. chilense phylogenetic relationships. Triticum aestivum-H. chilense addition lines allowed us to determine the chromosomal localizations of EST-SSR markers and confirm conservation of the linkage group. Conclusion From the present study a set of 21 polymorphic EST-SSR markers have been identified to be useful for diversity analysis of H. chilense, related wild barleys like H. murinum, and for wheat marker-assisted introgression breeding. Across-genera transferability of the barley EST-SSR markers has allowed phylogenetic inference within the Triticeae complex.

  11. Identification and Fine Mapping of a White Husk Gene in Barley (Hordeum vulgare L.). (United States)

    Hua, Wei; Zhang, Xiao-Qi; Zhu, Jinghuan; Shang, Yi; Wang, Junmei; Jia, Qiaojun; Zhang, Qisen; Yang, Jianming; Li, Chengdao


    Barley is the only crop in the Poaceae family with adhering husks at maturity. The color of husk at barely development stage could influence the agronomic traits and malting qualities of grains. A barley mutant with a white husk was discovered from the malting barley cultivar Supi 3 and designated wh (white husk). Morphological changes and the genetics of white husk barley were investigated. Husks of the mutant were white at the heading and flowering stages but yellowed at maturity. The diastatic power and α-amino nitrogen contents also significantly increased in wh mutant. Transmission electron microscopy examination showed abnormal chloroplast development in the mutant. Genetic analysis of F2 and BC1F1 populations developed from a cross of wh and Yangnongpi 5 (green husk) showed that the white husk was controlled by a single recessive gene (wh). The wh gene was initially mapped between 49.64 and 51.77 cM on chromosome 3H, which is syntenic with rice chromosome 1 where a white husk gene wlp1 has been isolated. The barley orthologous gene of wlp1 was sequenced from both parents and a 688 bp deletion identified in the wh mutant. We further fine-mapped the wh gene between SSR markers Bmac0067 and Bmag0508a with distances of 0.36 cM and 0.27 cM in an F2 population with 1115 individuals of white husk. However, the wlp1 orthologous gene was mapped outside the interval. New candidate genes were identified based on the barley genome sequence. PMID:27028408

  12. Influence of tannin on protein utilization in feedstuffs with special reference to barley

    International Nuclear Information System (INIS)

    To evaluate the effect of tannins on protein utilization, increasing amounts of tannin were added to diets fed to rats. Soybean meal was used as protein source. Tannin was found to exert a severe negative effect on protein digestibility. With tannin in the diet, availability of all amino acids decreased significantly, but to different degrees. Tannins are present in a number of plant materials at different levels, including barley. In feeding experiments using 29 barley samples varying in tannin content from 0.55 to 1.23%, tannin showed a significant negative correlation with protein digestibility. (author)

  13. Barley alpha-amylase/subtilisin inhibitor: structure, biophysics and protein engineering

    DEFF Research Database (Denmark)

    Nielsen, P.K.; Bønsager, Birgit Christine; Fukuda, Kenji;


    Bifunctional alpha-amylase/subtilisin inhibitors have been implicated in plant defence and regulation of endogenous alpha-amylase action. The barley alpha-amylase/subtilisin inhibitor (BASI) inhibits the barley alpha-amylase 2 (AMY2) and subtilisin-type serine proteases. BASI belongs to the Kunitz...... Ca2+-modulated kinetics of the AMY2/BASl interaction and found that the complex formation involves minimal structural changes. The modulation of the interaction by calcium ions makes it unique among the currently known binding mechanisms of proteinaceous alpha-amylase inhibitors....

  14. Influence of material's temperature on compression parameters of ground barley grains

    Directory of Open Access Journals (Sweden)

    Skonecki S.


    Full Text Available The paper presents the results of studies on the influence of temperature on the parameters of the pressure compression process and on indicators of material's compression ability for grains of four barley cultivars (Ars, Edgar, Klimek and Kos. The quality of the obtained agglomerates was also evaluated. During tests, the rise in compression temperature resulted in compression pressure and compression work drop and improved the compression ability of barley grains. The obtained agglomerates had higher density. Tests on the resistance of the agglomerate's compression and the coefficient of the ability to maintain shape, proved that the higher the temperature of compression, the better the quality of agglomerates obtained.

  15. Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Skau

    It is well accepted that dietary fibres, especially mixed linkage (1→3, 1→4)-β-Dglucans (β-glucan) from barley and oat, have beneficial effects on health and prevent modern lifestyle diseases. Even though recent research has shed some light on the mechanisms of action and structure-functionality ......It is well accepted that dietary fibres, especially mixed linkage (1→3, 1→4)-β-Dglucans (β-glucan) from barley and oat, have beneficial effects on health and prevent modern lifestyle diseases. Even though recent research has shed some light on the mechanisms of action and structure...

  16. Effect of Three Methods of Processing Barley on Intake and Production of Lactating Cows


    Jauregui, Carlos Garcia


    Twenty-four lactating cows were randomly assigned to three treatments within eight each 3 x 3 latin squares with three periods of 21 days duration. Three processing treatments of barley were 1) steam-rolled, 2) ground (fine), and 3) soak-rolled (soaked in water for appr. 24 hours, rolled, and fed within 48 hours). All rations were fed ad libitum and were comprised of 24% alfalfa hay, 16% corn silage, 35.5% barley, 12% whole cottonseed, 12% wheat bran, 0.3% salt, and 0.3% dicalcium phosphate o...

  17. Morocco as a possible domestication center for barley: biochemical and agromorphological evidence. (United States)

    Molina-Cano, J L; Fra-Mon, P; Salcedo, G; Aragoncillo, C; de Togores, F R; García-Olmedo, F


    The distribution of genetic variants of a group of low molecular weight, chloroform-methanol soluble proteins (CM proteins), among Moroccan and non-Moroccan accessions of Hordeum spontaneum and among selections from several Moroccan landraces of H. vulgare and cultivars of the same species with widespread European origin, suggests that domestication of barley might have taken place in Morocco. An agromorphological characterization of the H. spontaneum accessions further supports this hypothesis. The possible Moroccan origin of the French cultivar 'Hatif de Grignon' and of several Spanish 6-rowed barleys is also presented. PMID:24241109

  18. Irradiation seed treatment reduces scald, common root rot and increases phosphorus absorption of barley

    International Nuclear Information System (INIS)

    The effect of low doses of gamma irradiation on severity of barley to scald and common root rot diseases, and phosphorus absorption was studied seeds were exposed to doses of 0, 10, 15, 20, 30, 40 and 50 Gy. A stimulatory effect was observed at irradiation doses of 30 and 40 Gy, which decreased the severity of barley to scald by 34% and 31% respectively. On the other hand, doses 20 and 30 Gy decreased the severity to CRR by 54% and 49% respectively, whereas, phosphorus absorption was significantly increased at doses of 15 and 20 Gy

  19. Hordein polypeptide patterns in relation to malting quality in Brazilian barley varieties

    Directory of Open Access Journals (Sweden)

    Echart-Almeida Cinara


    Full Text Available Since there is evidence that malting quality is related to the storage protein (hordein fraction, in the present work the hordein polypeptide patterns from 13 barley (Hordeum vulgare L. varieties of different malting quality were analysed in order to explore the feasibility of using hordein electrophoresis to assist in the selection of malting barleys. The formation of clusters separating the varieties with higher malting quality from the others with lower quality suggests that there is a relationship between the general hordein polypeptide pattern and malting quality in the varieties analysed. By the Sperman's correlation test three hordein bands correlated negatively with malting quality in the germplasm studied.

  20. Influence of alkali catalyst on product yield and properties via hydrothermal liquefaction of barley straw

    DEFF Research Database (Denmark)

    Zhu, Z.; Toor, Saqib; Rosendahl, Lasse;


    Barley straw was successfully converted to bio-crude by hydrothermal liquefaction at temperature of 280 e400 C using an alkali catalyst (K2CO3) in our previous work, and the maximum bio-crude yield was obtained at 300 C. This paper extends previous work on studying liquefaction behavior of barley...... compounds identified in bio-crude were carboxylic acids, phenolic compounds and ketones, irrespective of whether the catalyst was used. However, the distribution and relative content of these compounds were different. More phenolic compounds and less carboxylic acids were observed in the catalytic run. In...



    Pavol Trebichalsky; Juliana Molnarova; Peter Lazor; Tomas Toth; Julius Arvay


    The influence of applied inorganic nutrients in soil, the method of tillage (conventional and minimalization) on accumulation of Fe and K into the grain of selected varieties of barley was observed. Small-parcel experiments were carried out on fields with size 14 m2 in three parallels. Four levels of fertilization were done: 1) control – not fertilized variant; 2) N70 + P4,36 + K16,6; 3) N60 + P22,7 + K36; 4) N60 + P22,7 + K36 + Ca25. Fe, K in grain of barley were mineralized by the method of...

  2. Regeneration of the Barley Zygote in In Vitro Cultured Ovules

    DEFF Research Database (Denmark)

    Holme, Inger B; Brinch-Pedersen, Henrik; Lange, Mette;


    culture ability in immature embryo culture i.e. Femina, Salome and Corniche. Barley spikes were emasculated and hand pollinated 3 days after emasculation. In barley, fertilization takes place one hour after pollination and ovules with fertilized egg cells could therefore be isolated one hour after...... pollination. Ovules were grown for 3 weeks on a culture medium where after embryos could be isolated and transferred to regeneration medium. An average of 1.2 green plantlets per ovule could be regenerated from 50 % of the isolated ovules. No genotypic differences were found on embryo induction and...

  3. Replacing grass silage with pea-barley intercrop silage in the feeding of the dairy cow


    Pursiainen, Pirjo; Tuori, Mikko


    The effect of replacing wilted grass silage (GS) with pea-barley intercrop silage (PBS) on feed intake, diet digestibility and milk production was studied with 8 multiparous Ayrshire-cows in a replicated 4 × 4 Latin square experiment. Proportion of PBS was 0 (PBS0), 33 (PBS33), 67 (PBS67) or 100 (PBS100) % of silage dry matter (DM). The DM content was 559 and 255 g kg-1 for GS and PBS. Crude protein content was 131 and 170 g kg-1 DM, respectively. Pea-barley silage was more extensively fermen...

  4. Optimising root growth to improve uptake and utilization of water and nitrogen in wheat and barley


    César de Carvalho, Pedro Miguel


    Durum wheat (Triticum turgidum L. var durum) and spring barley (Hordeum vulgare L.) are the most widely grown crop species in the semi-arid to arid areas of the Mediterranean region. However, their average on-farm yields are relatively low, 1.95 and 2.60 t ha-1, respectively (FAO, 2007). Water is generally recognized as the most limiting factor for barley and durum wheat production in the Mediterranean, though it has been found, at least for some regions, that N fertilizer applications have b...


    DEFF Research Database (Denmark)

    Næsted, Henrik; Svensson, Birte

    α-glucosidase of glycoside hydrolase family 31 plays in barley seeds a crucial role in embryonic development. The concerted action of α-glucosidase, β-amylase, α-amylase, and limit dextrinase is responsible for supply of glucose in the germinating seed as energy source for the embryo and growing...... plantlet [1]. Recently, expression and characterization of the recombinant full length, fully functional barley high pI α-glucosidase in Pichia pastoris has been achieved. To enable production of recombinant protein in mg amounts, a transformant harbouring a clone encoding the N-terminally hexa histidine...

  6. Characterization of recombinant high pI Barley α-Glucosidase

    DEFF Research Database (Denmark)

    Næsted, Henrik; Svensson, Birte

    α-glucosidase activity in barley seeds plays a crucial role in embryonic development. The concerted action of α-glucosidase, α-amylase, β-amylase, and limit dextrinase serve as the machinery responsible for the supply of glucose as energy source for the developing embryo in the germinating seed...... (MacGregor A.W.). Here we present the recent results of the expression and characterization of the recombinant full length barley high pI α-glucosidase in Pichia Pastoris. In order to facilitate in the range of mg protein yield, a clone representing an N-terminal hexa histidine tagged recombinant form...

  7. Purification and characterization of recombinant high pI Barley α-Glucosidase

    DEFF Research Database (Denmark)

    Næsted, Henrik; Bojsen, Kirsten; Svensson, Birte

    α-glucosidase activity in barley seeds plays a crucial role in embryonic development. The concerted action of α-glucosidase, α-amylase, α-amylase, and limit dextrinase serves as the machinery responsible for the supply of glucose as energy source for the developing embryo in the germinating seed...... (MACGREGOR & sissons). recently expression and characterization of the recombinant full length and fully functional barley high pi α-glucosidase in pichia pastoris has been achieved. in order to facilitate protein yield in the mg range, a clone representing an n-terminal hexa histidine tagged recombinant...

  8. Compared cycling in a soil-plant system of pea and barley residue nitrogen

    DEFF Research Database (Denmark)

    Jensen, E.S.


    Field experiments were carried out on a temperate soil to determine the decline rate, the stabilization in soil organic matter and the plant uptake of N from N-15-labelled crop residues. The fate of N from field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) residues was followed in...... soil-plant system....... unplanted and planted plots and related to their chemical composition. In the top 10 cm of unplanted plots, inorganic N was immobilized after barley residue incorporation, whereas the inorganic N pool was increased during the initial 30 days after incorporation (DAI) of pea residues. Initial net...

  9. The Nutritive Value of Wastewater Grown Barley and its Utilization in Fish Feed


    A. M. Snow; Abdel E. Ghaly


    The feasibility of using wastewater grown barley plants as a component of fish feed was evaluated. The barley plants were grown in a hydroponics system on wastewater from a recirculating aquaculture facility. The effects of wastewater application rate on plant growth and pollution potential reduction were investigated. At the end of the experiment, the average crop heights and yields were 31.0 and 36.0 cm and 59 and 83 t ha -1 at wastewater application rates of 690 and 1380 mL compartment -1 ...

  10. Extracellular RNA Communication (ExRNA) (United States)

    Federal Laboratory Consortium — Until recently, scientists believed RNA worked mostly inside the cell that produced it. Some types of RNA help translate genes into proteins that are necessary for...

  11. Winter forage quality of oats (avena sativa), barley (hordeum vulgare) and vetch (vicia sativa) in pure stand and cereal legume mixture

    International Nuclear Information System (INIS)

    A field study was carried out for two consecutive years in subtropical rainfed conditions of Rawalpindi, Pakistan to evaluate the forage quality of oats, barley and vetch grown in pure stands and cereal-legume mixtures. Treatments comprised oats pure stand, oats in oats-vetch mixture, barley pure stand, barley in barley-vetch mixture, vetch pure stand, vetch in oats-vetch mixture and vetch in barley-vetch mixture. Forage yield and quality of oats and barley were improved in oats-vetch and barley-vetch mixtures than their respective pure stands. The higher values of crude protein (CP) and lower values of neutral detergent fiber (NDF) and acid detergent fiber (ADF) reflected quality forage. CP for oats in oats-vetch -1 -1 mixture and barley in barley-vetch mixture was 175 g kg and 170 g kg, -1 respectively. NDF and ADF for oats in oats-vetch mixture were 494 g kg /sup -1/ and 341 g kg, respectively; while these values for barley in barley-vetch -1 -1 mixture were 340 g kg and 176 g kg, respectively. (author)

  12. Hamowanie syntezy chlorofilu i RNA w izolowanych liścieniach ogórka przez N-hydroksymocznik [Inhibition of chlorophyll and RNA synthesis by N-hydroxyurea in detached cucumber cotyledons

    Directory of Open Access Journals (Sweden)

    A. Rennert


    Full Text Available N-hydroxyurea (HU at the concentration of 5 x 10-4 M decreased the content of chlorophyll in detached cucumber cotyledons; at this concentration it has no inhibitory effect on growth. Benzylaminopurine, gibberelic acid and KCl partially reversed the inhibitory effect of HU on chlorophyll synthesis. HU stimulated yellowing of barley first leaf sections. The compound had little effect on leucine-14C incorporation to protein, and markedly inhibited uracil-14C incorporation in to RNA of the greening cucumber cotyledons. It is suggested that the inhibition of RNA and chlorophyll synthesis in HU-treated cucumber cotyledons follows the HU-dependent inhibition of DNA replication.

  13. Structures required for poly(A) tail-independent translation overlap with, but are distinct from, cap-independent translation and RNA replication signals at the 3′ end of Tobacco necrosis virus RNA


    Shen, Ruizhong; Miller, W. Allen


    Tobacco necrosis necrovirus (TNV) RNA lacks both a 5′ cap and a poly(A) tail but is translated efficiently, owing in part to a Barley yellow dwarf virus (BYDV)-like cap-independent translation element (BTE) in its 3′ untranslated region (UTR). Here, we identify sequence downstream of the BTE that is necessary for poly(A) tail-independent translation in vivo by using RNA encoding a luciferase reporter gene flanked by viral UTRs. Deletions and point mutations caused loss of translation that was...

  14. Combinatorics of RNA-RNA interaction

    DEFF Research Database (Denmark)

    Li, Thomas J X; Reidys, Christian


    RNA-RNA binding is an important phenomenon observed for many classes of non-coding RNAs and plays a crucial role in a number of regulatory processes. Recently several MFE folding algorithms for predicting the joint structure of two interacting RNA molecules have been proposed. Here joint structure...

  15. Sequence elements controlling expression of Barley stripe mosaic virus subgenomic RNAs in vivo

    International Nuclear Information System (INIS)

    Barley stripe mosaic virus (BSMV) contains three positive-sense, single-stranded genomic RNAs, designated α, β, and γ, that encode seven major proteins and one minor translational readthrough protein. Three proteins (αa, βa, and γa) are translated directly from the genomic RNAs and the remaining proteins encoded on RNAβ and RNAγ are expressed via three subgenomic messenger RNAs (sgRNAs). sgRNAβ1 directs synthesis of the triple gene block 1 (TGB1) protein. The TGB2 protein, the TGB2' minor translational readthrough protein, and the TGB3 protein are expressed from sgRNAβ2, which is present in considerably lower abundance than sgRNAβ1. A third sgRNA, sgRNAγ, is required for expression of the γb protein. We have used deletion analyses and site-specific mutations to define the boundaries of promoter regions that are critical for expression of the BSMV sgRNAs in infected protoplasts. The results reveal that the sgRNAβ1 promoter encompasses positions -29 to -2 relative to its transcription start site and is adjacent to a cis-acting element required for RNAβ replication that maps from -107 to -74 relative to the sgRNAβ1 start site. The core sgRNAβ2 promoter includes residues -32 to -17 relative to the sgRNAβ2 transcriptional start site, although maximal activity requires an upstream hexanucleotide sequence residing from positions -64 to -59. The sgRNAγ promoter maps from -21 to +2 relative to its transcription start site and therefore partially overlaps the γa gene. The sgRNAβ1, β2, and γ promoters also differ substantially in sequence, but have similarities to the putative homologous promoters of other Hordeiviruses. These differences are postulated to affect competition for the viral polymerase, coordination of the temporal expression and abundance of the TGB proteins, and constitutive expression of the γb protein

  16. Deciphering Mineral Homeostasis in Barley Seed Transfer Cells at Transcriptional Level.

    Directory of Open Access Journals (Sweden)

    Behrooz Darbani

    Full Text Available In addition to the micronutrient inadequacy of staple crops for optimal human nutrition, a global downtrend in crop-quality has emerged from intensive breeding for yield. This trend will be aggravated by elevated levels of the greenhouse gas carbon dioxide. Therefore, crop biofortification is inevitable to ensure a sustainable supply of minerals to the large part of human population who is dietary dependent on staple crops. This requires a thorough understanding of plant-mineral interactions due to the complexity of mineral homeostasis. Employing RNA sequencing, we here communicate transfer cell specific effects of excess iron and zinc during grain filling in our model crop plant barley. Responding to alterations in mineral contents, we found a long range of different genes and transcripts. Among them, it is worth to highlight the auxin and ethylene signaling factors Arfs, Abcbs, Cand1, Hps4, Hac1, Ecr1, and Ctr1, diurnal fluctuation components Sdg2, Imb1, Lip1, and PhyC, retroelements, sulfur homeostasis components Amp1, Hmt3, Eil3, and Vip1, mineral trafficking components Med16, Cnnm4, Aha2, Clpc1, and Pcbps, and vacuole organization factors Ymr155W, RabG3F, Vps4, and Cbl3. Our analysis introduces new interactors and signifies a broad spectrum of regulatory levels from chromatin remodeling to intracellular protein sorting mechanisms active in the plant mineral homeostasis. The results highlight the importance of storage proteins in metal ion toxicity-resistance and chelation. Interestingly, the protein sorting and recycling factors Exoc7, Cdc1, Sec23A, and Rab11A contributed to the response as well as the polar distributors of metal-transporters ensuring the directional flow of minerals. Alternative isoform switching was found important for plant adaptation and occurred among transcripts coding for identical proteins as well as transcripts coding for protein isoforms. We also identified differences in the alternative-isoform preference between

  17. Effect of pH and Recombinant Barley (Hordeum vulgare L.) Endoprotease B2 on Degradation of Proteins in Soaked Barley

    DEFF Research Database (Denmark)

    Christensen, Jesper Bjerg; Dionisio, Giuseppe; Poulsen, Hanne Damgaard; Brinch-Pedersen, Henrik


    .3. Solubilized and degraded proteins evaluated by biuret, SDS-PAGE, and differential proteomics revealed that pH 4.3 had the greatest impact on both solubilization and degradation. In order to boost proteolysis, the recombinant barley endoprotease B2 (rec-HvEP-B2) was included after 8 h using the pH 4.3 regime....... Proteolysis evaluated by SDS-PAGE and differential proteomics confirmed a powerful effect of adding rec-HvEP-B2 to the soaked barley, regardless of the genotype. Our study addresses the use of rec-HvEP-B2 as an effective feed enzyme protease. HvEP-B2 has the potential to increase the digestibility of protein...

  18. Production and processing of siRNA precursor transcripts from the highly repetitive maize genome.

    Directory of Open Access Journals (Sweden)

    Christopher J Hale


    Full Text Available Mutations affecting the maintenance of heritable epigenetic states in maize identify multiple RNA-directed DNA methylation (RdDM factors including RMR1, a novel member of a plant-specific clade of Snf2-related proteins. Here we show that RMR1 is necessary for the accumulation of a majority of 24 nt small RNAs, including those derived from Long-Terminal Repeat (LTR retrotransposons, the most common repetitive feature in the maize genome. A genetic analysis of DNA transposon repression indicates that RMR1 acts upstream of the RNA-dependent RNA polymerase, RDR2 (MOP1. Surprisingly, we show that non-polyadenylated transcripts from a sampling of LTR retrotransposons are lost in both rmr1 and rdr2 mutants. In contrast, plants deficient for RNA Polymerase IV (Pol IV function show an increase in polyadenylated LTR RNA transcripts. These findings support a model in which Pol IV functions independently of the small RNA accumulation facilitated by RMR1 and RDR2 and support that a loss of Pol IV leads to RNA Polymerase II-based transcription. Additionally, the lack of changes in general genome homeostasis in rmr1 mutants, despite the global loss of 24 nt small RNAs, challenges the perceived roles of siRNAs in maintaining functional heterochromatin in the genomes of outcrossing grass species.

  19. Cell layer-specific distribution of transiently expressed barley ESCRT-III component HvVPS60 in developing barley endosperm. (United States)

    Hilscher, Julia; Kapusi, Eszter; Stoger, Eva; Ibl, Verena


    The significance of the endosomal sorting complexes required for transport (ESCRT)-III in cereal endosperm has been shown by the identification of the recessive mutant supernumerary aleurone layer1 (SAL1) in maize. ESCRT-III is indispensable in the final membrane fission step during biogenesis of multivesicular bodies (MVBs), responsible for protein sorting to vacuoles and to the cell surface. Here, we annotated barley ESCRT-III members in the (model) crop Hordeum vulgare and show that all identified members are expressed in developing barley endosperm. We used fluorescently tagged core ESCRT-III members HvSNF7a/CHMP4 and HvVPS24/CHMP3 and the associated ESCRT-III component HvVPS60a/CHMP5 for transient localization studies in barley endosperm. In vivo confocal microscopic analyses show that the localization of recombinantly expressed HvSNF7a, HvVPS24 and HvVPS60a differs within barley endosperm. Whereas HvSNF7a induces large agglomerations, HvVPS24 shows mainly cytosolic localization in aleurone and subaleurone. In contrast, HvVPS60a localizes strongly at the plasma membrane in aleurone. In subaleurone, HvVPS60a was found to a lesser extent at the plasma membrane and at vacuolar membranes. These results indicate that the steady-state association of ESCRT-III may be influenced by cell layer-specific protein deposition or trafficking and remodelling of the endomembrane system in endosperm. We show that sorting of an artificially mono-ubiquitinated Arabidopsis plasma membrane protein is inhibited by HvVPS60a in aleurone. The involvement of HvVPS60a in different cell layer-specific trafficking pathways, reflected by localization of HvVPS60a at the plasma membrane in aleurone and at the PSV membrane in subaleurone, is discussed. PMID:25796522

  20. Weed infestation in canopy of spring barley in condition of different tillage systems and fertilization and plant protection levels

    Directory of Open Access Journals (Sweden)

    Piotr Kraska


    Full Text Available The purpose of this work was to determine the influence of conventional tillage (fall ploughing at 25 cm and minimum tillage systems (chisel ploughing at 30 cm and two differentiated fertilization and plant protection levels on number, species composition and air dry weed mass in spring barley cv. Rataj. This spring barley was cultivated in crop rotation potato - spring barley - winter rye. The analysis of field infestation was made prior to spring barley harvest with quantitative- weighting method. There was estimated number of weeds, weed species composition and air dry weight of weeds in two randomly chosen areas of each plot of 0.5 m2. The density of weeds and weed air dry weight was statistically analysed by means of variance analysis, and the mean values were estimated with Tukey's confidence intervals (p=0.05. Intensive level of fertilization and chemical crop protection decreased number of monocotyledonous weeds and total weeds in canopy of spring barley. Conventional system of soil cultivation decreased in a canopy of spring barley the following species of weeds: Geranium pusillum, Galinsoga parviflora, Stellaria media, Apera spica-venti, Poa annua and Echinochloa crusgalli. Conventional tillage increases number of Chamomilla suaveolens and Fallopia convolvulus in a canopy of spring barley. Intensive fertilization and plant protection levels decreased weed infestation first of all through Echinochloa crusgalli, Apera spica-venti, Fallopia convolvulus, Galinsoga parviflora, Geranium pusillum, Chenopodium album and Setaria pumila.

  1. In situ identification and quantification of starch-hydrolyzing bacteria attached to barley and corn grain in the rumen of cows fed barley-based diets. (United States)

    Xia, Yun; Kong, Yunhong; Seviour, Robert; Yang, Hee-Eun; Forster, Robert; Vasanthan, Thavaratnam; McAllister, Tim


    Cereal grains rich in starch are widely used to meet the energy demands of high-producing beef and dairy cattle. Bacteria are important players in starch digestion in the rumen, and thus play an important role in the hydrolysis and fermentation of cereal grains. However, our understanding of the composition of the rumen starch-hydrolyzing bacteria (SHB) is limited. In this study, BODIPY FL DQ starch staining combined with fluorescence in situ hybridization (FISH) and quantitative FISH were applied to label, identify and quantify SHB possessing active cell-surface-associated (CSA) α-amylase activity in the rumen of heifers fed barley-based diets. When individual cells of SHB with active CSA α-amylase activity were enumerated, they constituted 19-23% of the total bacterial cells attached to particles of four different cultivars of barley grain and corn. Quantitative FISH revealed that up to 70-80% of these SHB were members of Ruminococcaceae in the phylum Firmicutes but were not Streptococcus bovis, Ruminobacter amylophilus, Succinomonas amylolytica, Bifidobacterium spp. or Butyrivibrio fibrisolvens, all of whose amylolytic activities have been demonstrated previously in vitro. The proportion of barley grain in the diet had a large impact on the percentage abundance of total SHB and Ruminococcaceae SHB in these animals. PMID:26142428

  2. Mechanistic and genetic overlap of barley host and non-host resistance to Blumeria graminis

    NARCIS (Netherlands)

    Trujillo, M.; Troeger, M.; Niks, R.E.; Kogel, K.H.; Huckelhoven, R.


    Non-host resistance of barley to Blumeria graminis f.sp. tritici (Bgt), an inappropriate forma specialis of the grass powdery mildew fungus, is associated with formation of cell wall appositions (papillae) at sites of attempted fungal penetration and a hypersensitive cell death reaction (HR) of sing

  3. Inactivation of barley limit dextrinase inhibitor by thioredoxin-catalysed disulfide reduction

    DEFF Research Database (Denmark)

    Jensen, Johanne Mørch; Hägglund, Per; Christensen, Hans Erik Mølager; Svensson, Birte


    Barley limit dextrinase (LD) that catalyses hydrolysis of α-1,6 glucosidic linkages in starch-derived dextrins is inhibited by limit dextrinase inhibitor (LDI) found in mature seeds. LDI belongs to the chloroform/methanol soluble protein family (CM-protein family) and has four disulfide bridges and...

  4. Frequency of Aneuploids in Progenies of Autotriploid Barley, Hordeum Vulgare L

    DEFF Research Database (Denmark)

    Sandfær, J.


    Chromosome counts of 863 progeny plants originating from 68 autotriploid barley plants revealed a considerable variation in chromosome numbers ranging from the diploid number (2n= 14) to 2n= 39. The most frequent groups were plants with 15 and 16 chromosomes each constituting about 27% of all pro...

  5. Use of recurrent irradiation in plant breeding of quantitative characters of barley and wheat

    International Nuclear Information System (INIS)

    In this work was applied recurrent irradiation by gamma radiation of cobalt 60 in different doses to barley and wheat seeds in order to generate genetic variation and facilitating the selection of quantitative characters. The first part of this work was realized without making any selection and the second one by means of selection toward the greatest number of tassel spikelets. The experimental evaluation of irradiated materials without selection indicated that in high doses it was obtained a best expression of the character and that this was greater increasing the generations of irradiation excepting the MI generation as in barley as wheat. According to the experimental evaluation, the selected lines of irradiated material of barley was greater yield that the original variety, but this did not occur with the wheat, because of the grain size of the selected lines was more little. The posterior selection for following increasing the spikelets number for tassel has been effective and in the barley the advances were greater than in the wheat. (Author). 4 refs, 5 figs

  6. Production of Butanol (A Biofuel) from Agricultural Residues: Part I - Use of Barley Straw Hydrolysate (United States)

    Fermentation of dilute sulfuric acid barley straw hydrolyzate (BSH; undiluted/untreated) by Clostridium beijerinckii P260 resulted in the production of 7.09 gL**-1 ABE (acetone butanol ethanol; AB or ABE), an ABE yield of 0.33, and productivity of 0.10 gL**-1h**-1. This level of ABE is much less th...

  7. Effects of calcium ion concentration on starch hydrolysis of barley α-amylase isozymes

    DEFF Research Database (Denmark)

    Yuk, Jeong-Bin; Choi, Seung-Ho; Lee, Tae-Hee;


    Barley (x-amylase genes, amyl and amy2, were separately cloned into the expression vector of pPICZ alpha A and recombinant Pichia strains were established by homologous recombination. Both AMYs from Pichia shared almost identical hydrolysis patterns on short maltooligosaccharides to result in...

  8. Complex Interspecific Hybridization in Barley (Hordeum vulgare L.) and the Possible Occurrence of Apomixis

    DEFF Research Database (Denmark)

    Bothmer, R. von; Bengtsson, M.; Flink, J.;


    mixoploid with respect to alien chromosomes (19-22). In one combination, chromosome no. 7 was duplicated. Meiosis in triple hybrids showed low, but variable pairing (1.3-5.5 chiasmata per cell). The syndesis probably did not include the barley chromosomes. Direct backcrosses to di- and tetraploid...

  9. Development and Meiosis of Three Interspecific Hybrids with Cultivated Barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Von Bothmer, R.; Flink, J.; Linde-Laursen, Ib


    The development and meiosis of three interspecific hybrids between cultivated barley (Hordeum vulgare L.) and H. secalinum Schreb., H. tetraploidum Covas, and H. parodii Covas, respectively, were studied. All three hybrid combinations developed very slowly vegetatively. Meiosis of the hybrids was...

  10. Marine eutrophication impacts from present and future production of spring barley

    DEFF Research Database (Denmark)

    Cosme, Nuno Miguel Dias; Niero, Monia


    Environmental emissions of nitrogen (N) from agriculture surplus may enrich coastal waters and trigger marine eutrophication impacts. We estimated these impacts for spring barley production in Denmark, under present and future climatic conditions with double carbon dioxide concentration and 5 °C ...

  11. Energy consumption in barley and turnip rape cultivation for bioethanol and biodiesel (RME) production

    Energy Technology Data Exchange (ETDEWEB)

    Mikkola, Hannu; Ahokas, Jukka [University of Helsinki, Faculty of Agriculture and Forestry, Department of Agricultural Sciences, FIN-00014 Helsingin yliopisto (Finland); Pahkala, Katri [MTT, Agrifood Research Finland, Crop Science and Technology, FIN-31600 Jokioinen (Finland)


    The energy consumption for six spring barley (Hordeum vulgare L.) production chains and five spring turnip rape (Brassica rapa ssp. oleifera (DC) Metsg.) production chains were compared with each other and in relation to the energy content of the seed yield. Two cultivation intensities, standard and intensive production, were used for barley. Fertiliser production and grain drying were the most energy consuming phases of the chains. The production of nitrogen fertiliser alone accounted for 1/3-1/2 of the total energy consumption of the production chains. If barley were direct drilled and the yield stored in airtight silos, instead of drying, the energy consumption would decrease by 30-34%. Use of wood-chips instead of oil for grain drying would decrease the use of fossil fuel to the same extent. The input-output ratios for the intensive barley production chains were 0.18-0.25. They were somewhat lower than the ratios for the standard production intensity. The intensive production was more energy efficient despite higher input rates. The input-output ratios for turnip rape production were 0.32-0.34. The energy consumption for manufacturing, repair and maintenance of machines and buildings requires more research because it is a significant factor but the data available are largely old and few studies have been conducted. (author)

  12. Evaluation of resistance and tolerance in wheat against Puccinia striiformis and in barley against Erysiphe graminis

    International Nuclear Information System (INIS)

    Greenhouse tests are reported in which components of a relative resistance of wheat to Puccinia striiformis were evaluated. Decrease in sporulation on the flag leaves correlated well to smaller yield reductions as measured in field tests. On the basis of further greenhouse and field experiments, tolerance of spring barley cultivars against Erysiphe graminis was calculated by means of a 'tolerance-quotient'. (author)

  13. Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys. (United States)

    Dai, Huaxin; Cao, Fangbin; Chen, Xianhong; Zhang, Mian; Ahmed, Imrul Mosaddek; Chen, Zhong-Hua; Li, Chengdao; Zhang, Guoping; Wu, Feibo


    Aluminum (Al) toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A) specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance. PMID:23691047

  14. Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys.

    Directory of Open Access Journals (Sweden)

    Huaxin Dai

    Full Text Available Aluminum (Al toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance.

  15. Root border cell development is a temperature-insensitive and Al-sensitive process in barley. (United States)

    Pan, Jian-Wei; Ye, Dan; Wang, Li-Ling; Hua, Jing; Zhao, Gu-Feng; Pan, Wei-Huai; Han, Ning; Zhu, Mu-Yuan


    In vivo and in vitro experiments showed that border cell (BC) survival was dependent on root tip mucigel in barley (Hordeum vulgare L. cv. Hang 981). In aeroponic culture, BC development was an induced process in barley, whereas in hydroponic culture, it was a kinetic equilibrium process during which 300-400 BCs were released into water daily. The response of root elongation to temperatures (10-35 degrees C) was very sensitive but temperature changes had no great effect on barley BC development. At 35 degrees C, the root elongation ceased whereas BC production still continued, indicating that the two processes might be regulated independently under high temperature (35 degrees C) stress. Fifty microM Al could inhibit significantly BC development by inhibiting pectin methylesterase activity in the root cap of cv. 2000-2 (Al-sensitive) and cv. Humai 16 (Al-tolerant), but 20 microM Al could not block BC development in cv. Humai 16. BCs and their mucigel of barley had a limited role in the protection of Al-induced inhibition of root elongation, but played a significant role in the prevention of Al from diffusing into the meristems of the root tip and the root cap. Together, these results suggested that BC development was a temperature-insensitive but Al-sensitive process, and that BCs and their mucigel played an important role in the protection of root tip and root cap meristems from Al toxicity. PMID:15215510

  16. Registration of 'Stoneham' spring feed barley resistant to Russian wheat aphid (United States)

    'Stoneham' (REG. No.; PI 641940) a Russian wheat aphid (RWA, Diuraphis noxia Kurdjumov)-resistant, spring, two-rowed, feed barley (Hordeum vulgare) tested as 97BX 27-132, was developed and released by the USDA-ARS, Stillwater, OK and Aberdeen, ID; Colorado State University; and the University of Neb...

  17. Composition and Functional Lipid Profiles of Low-Phyate Barleys and Related Cultivars (United States)

    Barley, one of the earliest cultivated cereal grains in the world, is gaining renewed interest for use in food, feed and as a bioethanol feedstock. Like other grains, its high phytate content is undesirable since phytate affects mineral bioavailability and contributes to P pollution to environment....

  18. Effects of Deoxynivalenol on Content of Chloroplast Pigments in Barley Leaf Tissues (United States)

    Fusarium head blight (scab) has been a devastating disease of wheat and barley in recent years across grain growing areas from Minnesota and the Dakotas to the Carolinas. The fungal pathogen causing the disease (Fusarium graminearum) produces a toxin, deoxynivalenol (DON) that can be toxic when inf...

  19. Barley and wheat foods: influence on plasma cholesterol concentrations in hypercholesterolemic men. (United States)

    McIntosh, G H; Whyte, J; McArthur, R; Nestel, P J


    Twenty-one mildly hypercholesterolemic men aged 30-59 y were provided with comparable barley and wheat foods for each of 4 wk in a crossover-designed experiment. The purpose of the study was to examine the influence of two sources of dietary fiber (nonstarch polysaccharides, NSP) on blood lipids and glucose concentrations. Barley contains beta-glucan as a source of soluble dietary fiber (DF) whereas wheat contains the largely insoluble cellulose and hemicellulose fiber. Total dietary fiber increased from a previous intake of 21-38 g/d during the period of study for the two groups. Consumption of barley relative to wheat foods was associated with a significant fall in both plasma total cholesterol (6%, P less than 0.05) and in low-density-lipoprotein cholesterol (7%, P less than 0.02) whereas triglyceride and glucose concentrations did not change significantly. It is concluded that barley dietary fiber is more effective than wheat dietary fiber at lowering blood cholesterol in hypercholesterolemic men. PMID:1850576

  20. A Comparison of Factors Involved in Starch Degradation in Barley Germination Under Laboratory and Malting Conditions (United States)

    Grains of the malting barley cultivar Legacy were laboratory germinated (LG) or micromalted (MM) and sampled daily from 0 to 5 days after imbibition/steeping. Alpha-amylase and beta-amylase activities and protein levels along with starch, osmolyte concentration (OC), and sugar (glucose, sucrose, fr...

  1. The Discovery of Resistant Sources of Spring Barley, Hordeum vulgare ssp. spontaneum, and Unique Greenbug Biotypes. (United States)

    Armstrong, J Scott; Mornhinweg, Dolores W; Payton, Mark E; Puterka, Gary J


    The genetic sources for host-plant resistance to the greenbug (Schizaphis graminum Rondani) in barley (Hordeum vulgare ssp. spontaneum) are limited in that only two single dominant genes Rsg1 and Rsg2 are available for the complex of greenbug biotypes. We evaluated four new barley lines from the Wild Barley Diversity Collection (WBDC) that previously showed potential for greenbug resistance. Three of those entries, WBDC 53, WBDC 117, WBDC 336, exhibited very dominant sources of resistance to older known biotypes B, C, E, F, H, I, and TX1, which also add to the host-plant differentials used to separate these greenbug biotypes. We also re-evaluated the earlier known set of greenbug biotypes that have been in culture for several years against the known host-plant differentials, and included seven newer greenbug isolates collected from Wyoming to the full complement of small grain differentials. This resulted in the discovery of five new greenbug biotypes, WY10 MC, WY81, WY10 B, WY12 MC, and WY86. Wyoming isolates WY4 A and WY4 B were identical in their phenotypic profile, and should be combined as a single unique greenbug biotype. These barley trials resulted in finding new sources of host-plant resistance, although more research needs to be conducted on what type of resistance was found, and how it can be used. We also document that the Wheatland, Wyoming area serves as a very conducive environment for the development of new greenbug biotypes. PMID:26527793

  2. Supplemental barley protein and casein similarly affect serum lipids in hypercholesterolemic women and men. (United States)

    Jenkins, David J A; Srichaikul, Korbua; Wong, Julia M W; Kendall, Cyril W C; Bashyam, Balachandran; Vidgen, Edward; Lamarche, Benoicirct; Rao, A Venketeshwer; Jones, Peter J H; Josse, Robert G; Jackson, Chung-Ja C; Ng, Vivian; Leong, Tracy; Leiter, Lawrence A


    High-protein diets have been advocated for weight loss and the treatment of diabetes. Yet animal protein sources are often high in saturated fat and cholesterol. Vegetable protein sources, by contrast, are low in saturated fat and without associated cholesterol. We have therefore assessed the effect on serum lipids of raising the protein intake by 5% using a cereal protein, barley protein, as part of a standard therapeutic diet. Twenty-three hypercholesterolemic men and postmenopausal women completed a randomized crossover study comparing a bread enriched with either barley protein or calcium caseinate [30 g protein, 8374 kJ (2000 kcal)] taken separately as two 1-mo treatment phases with a minimum 2-wk washout. Body weight and diet history were collected weekly during each treatment. Fasting blood samples were obtained at wk 0, 2, and 4. Palatability, satiety, and compliance were similar for both the barley protein- and casein-enriched breads, with no differences between the treatments in effects on serum LDL cholesterol or C-reactive protein, measures of oxidative stress, or blood pressure. Nevertheless, because no adverse effects were observed on cardiovascular risk factors, barley protein remains an additional option for raising the protein content of the diet. PMID:20668250

  3. Endogenous hormone levels affect the regeneration ability of callus derived from different organs in barley. (United States)

    Hisano, Hiroshi; Matsuura, Takakazu; Mori, Izumi C; Yamane, Miki; Sato, Kazuhiro


    Hordeum vulgare (barley) is an important agricultural crop worldwide. A simple and efficient transformation system is needed to analyze the functions of barley genes and generate lines with improved agronomic traits. Currently, Golden Promise and Igri are the most amenable barley cultivars for stable transformation. Here we evaluated the regeneration ratios and endogenous hormone levels of calli derived from various malting barley cultivars, including Golden Promise, Haruna Nijo, and Morex. We harvested samples not only from immature embryos, but also from different explants of juvenile plants, cotyledons, coleoptiles, and roots. The callus properties differed among genotypes and explant types. Calli derived from the immature embryos of Golden Promise, which showed the highest ratio of regeneration of green shoots, had the highest contents of indoleacetic acid, trans-zeatin, and cis-zeatin. By contrast, calli derived from the cotyledons of Morex and the immature embryos of Haruna Nijo had elevated levels of salicylic acid and abscisic acid, respectively. We thus propose that the former phytohormones are positively associated with the regeneration ability of callus but the later phytohormones are negatively associated. PMID:26735586

  4. Interaction of barley powdery mildew effector candidate CSEP0055 with the defence protein PR17c

    DEFF Research Database (Denmark)

    Zhang, Wen-Jing; Pedersen, Carsten; Kwaaitaal, Mark Adrianus Cornelis J; Gregersen, Per L.; Mørch, Sara Melhedegård; Hanisch, Susanne; Kristensen, Astrid; Fuglsang, Anja Thoe; Collinge, David B.; Thordal-Christensen, Hans


    A large number of effector candidates have been identified recently in powdery mildew fungi. However, their roles and how they perform their functions remain unresolved. In this study, we made use of host-induced gene silencing and confirmed that the secreted barley powdery mildew effector candid...

  5. Particle Size Effects on the Quality of Flour Tortillas Enriched with Whole Grain Waxy Barley (United States)

    Wheat tortillas were enriched with whole barley flour (WBF) of different particle sizes including 237 micros (regular-R), 131 micros (intermediate-IM), and 68 micros (microground-MG). Topographical and fluorescent microstructure images of flours, doughs and tortillas were examined. Flours and tort...

  6. Application of fluorescence-based semi-automated AFLP analysis in barley and wheat

    DEFF Research Database (Denmark)

    Schwarz, G.; Herz, M.; Huang, X.Q.; Michalek, W.; Jahoor, A.; Wenzel, G.; Mohler, V.

    Genetic mapping and the selection of closely linked molecular markers for important agronomic traits require efficient, large-scale genotyping methods. A semi-automated multifluorophore technique was applied for genotyping AFLP marker loci in barley and wheat. In comparison to conventional P-33-b...

  7. Osmotic stress at the barley root affects expression of circadian clock genes in the shoot. (United States)

    Habte, Ermias; Müller, Lukas M; Shtaya, Munqez; Davis, Seth J; von Korff, Maria


    The circadian clock is an important timing system that controls physiological responses to abiotic stresses in plants. However, there is little information on the effects of the clock on stress adaptation in important crops, like barley. In addition, we do not know how osmotic stress perceived at the roots affect the shoot circadian clock. Barley genotypes, carrying natural variation at the photoperiod response and clock genes Ppd-H1 and HvELF3, were grown under control and osmotic stress conditions to record changes in the diurnal expression of clock and stress-response genes and in physiological traits. Variation at HvELF3 affected the expression phase and shape of clock and stress-response genes, while variation at Ppd-H1 only affected the expression levels of stress genes. Osmotic stress up-regulated expression of clock and stress-response genes and advanced their expression peaks. Clock genes controlled the expression of stress-response genes, but had minor effects on gas exchange and leaf transpiration. This study demonstrated that osmotic stress at the barley root altered clock gene expression in the shoot and acted as a spatial input signal into the clock. Unlike in Arabidopsis, barley primary assimilation was less controlled by the clock and more responsive to environmental perturbations, such as osmotic stress. PMID:24895755

  8. A roadmap for zinc transport into the developing barley grain. Gene expression profiling using laser microdissection

    DEFF Research Database (Denmark)

    Borg, Søren; Tauris, Birgitte


    Nutrients destined for the developing cereal grain encounter several restricting barriers on their path towards their final storage sites in the grain. In order to identify transporters and chelating agents that may be involved in transport and deposition of zinc in the barley grain, expression p...

  9. Proteomic and activity profiles of ascorbate-glutathione cycle enzymes in germinating barley embryo

    DEFF Research Database (Denmark)

    Bønsager, Birgit Christine; Shahpiri, Azar; Finnie, Christine;


    Enzymes involved in redox control are important during seed germination and seedling growth. Ascorbate-glutathione cycle enzymes in barley embryo extracts were monitored both by 2D-gel electrophoresis and activity measurements from 4 to 144 h post imbibition (PI). Strikingly different activity...

  10. Elevated atmospheric CO2 decreases the ammonia compensation point of barley plants

    DEFF Research Database (Denmark)

    Wang, Liang; Pedas, Pai; Eriksson, Ulf Dennis;


    The ammonia compensation point (chi(NH3)) controls the direction and magnitude of NH3 exchange between plant leaves and the atmosphere. Very limited information is currently available on how chi(NH3) responds to anticipated climate changes. Young barley plants were grown for 2 weeks at ambient (4...... and reduces episodes of NH3 emission from plants....

  11. The effect of fungicide dose on the composition of laboratory populations of barley powdery mildew

    DEFF Research Database (Denmark)

    O'Hara, R.B.; Nielsen, B.J.; Østergård, Hanne


    The effect of the use of different doses of the fungicide fenpropimorph on populations of barley powdery mildew Blumeria (Erysiphe) graminis f. sp. hordei was investigated in a laboratory selection experiment. A sample from the Danish aerial population of powdery mildew was split into populations...

  12. Effect of Initial Soluble Salt Composition of Saline Soil on Salinity Tolerance of Barley Plant

    Institute of Scientific and Technical Information of China (English)



    A pot experiment was carried out on a marine saline soil to study the effect of initial soluble Na/Ca ratio of saline soil on the salinity tolerance of barley plant.The results showed that (1) the Na/Ca ratio affected significantly the dry weight of the plant at an earlier stage of growth,the critical values of initial Na/Ca ratio at which the plant could grow normally on soils containing salts of 2.5,3.5 and 4.5g kg-1 were 30,20 and 15,respectively;(2)smaller Na/Ca ratio resulted in a considerable decrease in Na accumulation but a great increase in K accumulation in the barley plant;and (3) the plasmallema of barley leaf were badly injured when the Na/Ca ratio was more than 30 and the increase of Na content of plant caused an exudation of K from the leaf cells.Some critical indexes were suggested for the cultivation of barley plant on marine saline soils and could be used as reference in the biological reclamation of marine saline soils.

  13. 2D-HPLC and MALDI-TOF/TOF analysis of barley proteins glycated during brewing

    Czech Academy of Sciences Publication Activity Database

    Petry-Podgorska, Inga; Žídková, Jitka; Flodrová, Dana; Bobálová, Janette


    Roč. 878, č. 30 (2010), s. 3143-3148. ISSN 1570-0232 R&D Projects: GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : 2D-HPLC * MALDI-TOF/TOF mass spectrometry * barley Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.971, year: 2010

  14. Starch and Prolamin Level in Single and Double High-Lysine Barley Mutants

    DEFF Research Database (Denmark)

    Kreis, M.; Doll, Hans


    At maturity the high-lysine barley (Hordeum vulgare L.) Ris0 mutants 1508, 527 and 29 kernels contained about 20% less starch and twice as much free sugars as the parent varieties Bomi and Carlsberg II. An enhanched effect on starch reduction and free sugar accumulation was observed during kernel...



    Buschena, David E.; Gray, Richard S.


    When free trade merges formally distinct non-competitive industries, welfare should increase. Additional incentives for mergers may reduce these gains from free trade. We show the importance of such arguments in an analysis of the malting barley industry in North America before and after the Canadian/U.S. free trade agreement.

  16. Phenotypic selection and regulation of reproduction in different environments in wild barley

    NARCIS (Netherlands)

    Volis, S.; Verhoeven, K.J.F.; Mendlinger, S.; Ward, D.


    Plasticity of the phenotypic architecture of wild barley, Hordeum spontaneum, was studied in response to water and nutrient stress. Direct and indirect selection on several vegetative and reproductive traits was estimated and path analysis used to reveal how regulating pathways via maternal investme

  17. Preparation of Barley Storage Protein, Hordein, for Analytical Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis

    DEFF Research Database (Denmark)

    Doll, Hans; Andersen, Bente


    The extraction, reduction, and alkylation of barley hordein for routine electrophoresis in sodium dodecyl sulfate-polyacrylamide gels were studied to set up a simple preparation procedure giving well-resolved bands in the electrophoresis gel. Hordein was extracted from single crushed seeds or flour...... in a buffer without propan-2-ol but containing sodium dodecyl sulfate....

  18. Induced Sterility as a Factor in the Competition between Barley Varieties

    DEFF Research Database (Denmark)

    Sandfær, Jens


    In a mixture of two spring barley varieties, ‘Tystofte Prentice’ and ‘Svaløf Freja’, a sterility interaction was found. The percentage of sterile flowers in ‘Freja’ showed an approximately six-fold increase over that in pure stand, whereas in ‘T. Prentice’ the percentage of sterile flowers showed...

  19. Quality Control System for Beer Developed with Monoclonal Antibodies Specific to Barley Lipid Transfer Protein

    Directory of Open Access Journals (Sweden)

    Yukie Murakami-Yamaguchi


    Full Text Available Non-specific lipid transfer protein (LTP in barley grain reacted with the IgE in sera drawn from food allergy patients. A sandwich-type of enzyme-linked immunosorbent assay (ELISA was developed with mouse monoclonal antibodies raised against LTP purified with barley flour. This ELISA showed a practical working range of 0.3–3 ng/mL and no cross-reactivity with wheat, adlay and rye. Using this ELISA, LTP was determined in several types of barley-foods, including fermented foods such as malt vinegar, barley-malt miso and beer. LTP content in beer of the same kind was approximately constant, even if manufacturing factory and production days were different. Not only as a factor of foam formation and stability but also as an allergen, controlling and monitoring of LTP in beer should be considered. Taken together, our LTP-detecting ELISA can be proposed as an appropriate system for the quality control of beer.

  20. Mildew-resistant mutants induced in North American two- and six-rowed malting barley cultivars

    DEFF Research Database (Denmark)

    Molina-Cano, J.L.; Simiand, J.P.; Sopena, A.;


    Mildew-resistant mutants were induced with sodium azide in three North American malting barley cultivars, two in the six-rowed Ursula (URS1 and URS2), one in the six-rowed Gertrud (GER1), and one in the two-rowed Prudentia (PRU1). Two of the mutants, URS1 and PRU1, showed complete resistance and...