WorldWideScience

Sample records for barley rna-directed rna

  1. Identification and characterization of barley RNA-directed RNA polymerases

    DEFF Research Database (Denmark)

    Madsen, Christian Toft; Stephens, Jennifer; Hornyik, Csaba

    2009-01-01

    in dicot species. In this report, we identi!ed and characterized HvRDR1, HvRDR2 and HvRDR6 genes in the monocot plant barley (Hordeum vulgare). We analysed their expression under various biotic and abiotic stresses including fungal and viral infections, salicylic acid treatment as well as during plant...... development. The different classes and subclasses of barley RDRs displayed contrasting expression patterns during pathogen challenge and development suggesting their involvement in speci!c regulatory pathways. Their response to heat and salicylic acid treatment suggests a conserved pattern of expression...

  2. Achieving HIV-1 Control through RNA-Directed Gene Regulation

    Directory of Open Access Journals (Sweden)

    Vera Klemm

    2016-12-01

    Full Text Available HIV-1 infection has been transformed by combined anti-retroviral therapy (ART, changing a universally fatal infection into a controllable infection. However, major obstacles for an HIV-1 cure exist. The HIV latent reservoir, which exists in resting CD4+ T cells, is not impacted by ART, and can reactivate when ART is interrupted or ceased. Additionally, multi-drug resistance can arise. One alternate approach to conventional HIV-1 drug treatment that is being explored involves gene therapies utilizing RNA-directed gene regulation. Commonly known as RNA interference (RNAi, short interfering RNA (siRNA induce gene silencing in conserved biological pathways, which require a high degree of sequence specificity. This review will provide an overview of the silencing pathways, the current RNAi technologies being developed for HIV-1 gene therapy, current clinical trials, and the challenges faced in progressing these treatments into clinical trials.

  3. RNA-directed DNA methylation and demethylation in plants

    Institute of Scientific and Technical Information of China (English)

    CHINNUSAMY; Viswanathan

    2009-01-01

    RNA-directed DNA methylation (RdDM) is a nuclear process in which small interfering RNAs (siRNAs) direct the cytosine methylation of DNA sequences that are complementary to the siRNAs. In plants, double stranded-RNAs (dsRNAs) generated by RNA-dependent RNA polymerase 2 (RDR2) serve as precursors for Dicer-like 3 dependent biogenesis of 24-nt siRNAs. Plant specific RNA polymerase IV (Pol IV) is presumed to generate the initial RNA transcripts that are substrates for RDR2. siRNAs are loaded onto an argonaute4-containing RISC (RNA-induced silencing complex) that targets the de novo DNA methyltransferase DRM2 to RdDM target loci. Nascent RNA transcripts from the target loci are generated by another plant-specific RNA polymerase, Pol V, and these transcripts help recruit com- plementary siRNAs and the associated RdDM effector complex to the target loci in a transcrip- tion-coupled DNA methylation process. Small RNA binding proteins such as ROS3 may direct tar- get-specific DNA demethylation by the ROS1 family of DNA demethylases. Chromatin remodeling en- zymes and histone modifying enzymes also participate in DNA methylation and possibly demethylation. One of the well studied functions of RdDM is transposon silencing and genome stability. In addition, RdDM is important for paramutation, imprinting, gene regulation, and plant development. Lo- cus-specific DNA methylation and demethylation, and transposon activation under abiotic stresses suggest that RdDM is also important in stress responses of plants. Further studies will help illuminate the functions of RdDM in the dynamic control of epigenomes during development and environmental stress responses.

  4. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-07-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

  5. piRNA-directed cleavage of meiotic transcripts regulates spermatogenesis.

    Science.gov (United States)

    Goh, Wee Siong Sho; Falciatori, Ilaria; Tam, Oliver H; Burgess, Ralph; Meikar, Oliver; Kotaja, Noora; Hammell, Molly; Hannon, Gregory J

    2015-05-15

    MIWI catalytic activity is required for spermatogenesis, indicating that piRNA-guided cleavage is critical for germ cell development. To identify meiotic piRNA targets, we augmented the mouse piRNA repertoire by introducing a human meiotic piRNA cluster. This triggered a spermatogenesis defect by inappropriately targeting the piRNA machinery to mouse mRNAs essential for germ cell development. Analysis of such de novo targets revealed a signature for pachytene piRNA target recognition. This enabled identification of both transposable elements and meiotically expressed protein-coding genes as targets of native piRNAs. Cleavage of genic targets began at the pachytene stage and resulted in progressive repression through meiosis, driven at least in part via the ping-pong cycle. Our data support the idea that meiotic piRNA populations must be strongly selected to enable successful spermatogenesis, both driving the response away from essential genes and directing the pathway toward mRNA targets that are regulated by small RNAs in meiotic cells.

  6. RNA-directed DNA methylation and demethylation in plants

    Institute of Scientific and Technical Information of China (English)

    CHINNUSAMY Viswanathan; ZHU Jian-Kang

    2009-01-01

    A-dlrected DNA methylation (RdDM) Is a nuclear process in which small Interfering RNAs (siRNAs)direct the cytosine methylation of DNA sequences that are complementary to the siRNAs. In plants,double stranded-RNAs (dsRNAs) generated by RNA-dependent RNA polymerase 2 (RDR2) serve as precursors for Dicer-like 3 dependent biogenesis of 24-nt siRNAs. Plant specific RNA polymerase IV (Pol IV) is presumed to generate the initial RNA transcripts that are substrates for RDR2. siRNAs are loaded onto an argonaute4-containlng RlSC (RNA-induced silencing complex) that targets the de novo DNA methyltransferase DRM2 to RdDM target locl. Nascent RNA transcripts from the target loci are generated by another plant-specific RNA polymerase, Pol V, and these transcripts help recruit com-plementary siRNAs and the associated RdDM effector complex to the target loci in a transcrip-tion-coupled DNA methylation process. Small RNA binding proteins such as ROS3 may direct tar-get-specific DNA demethyiation by the ROS1 family of DNA demethylases. Chromatin remodeling en-zymes and histone modifying enzymes also participate in DNA methylation and possibly demethylation.One of the well studied functions of RdOM is transposon silencing and genome stability. In addition,RdDM is important for paramutation, imprinting, gene regulation, and plant development. Locus-specific DNA methylation and demethylation, and transposon activation under abiotic stresses suggest that RdDM is also important in stress responses of plants. Further studies will help illuminate the functions of RdDM in the dynamic control of epigenomes during development and environmental stress responses.

  7. Cas9-Guide RNA Directed Genome Editing in Soybean.

    Science.gov (United States)

    Li, Zhongsen; Liu, Zhan-Bin; Xing, Aiqiu; Moon, Bryan P; Koellhoffer, Jessica P; Huang, Lingxia; Ward, R Timothy; Clifton, Elizabeth; Falco, S Carl; Cigan, A Mark

    2015-10-01

    Recently discovered bacteria and archaea adaptive immune system consisting of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) endonuclease has been explored in targeted genome editing in different species. Streptococcus pyogenes Cas9-guide RNA (gRNA) was successfully applied to generate targeted mutagenesis, gene integration, and gene editing in soybean (Glycine max). Two genomic sites, DD20 and DD43 on chromosome 4, were mutagenized with frequencies of 59% and 76%, respectively. Sequencing randomly selected transgenic events confirmed that the genome modifications were specific to the Cas9-gRNA cleavage sites and consisted of small deletions or insertions. Targeted gene integrations through homology-directed recombination were detected by border-specific polymerase chain reaction analysis for both sites at callus stage, and one DD43 homology-directed recombination event was transmitted to T1 generation. T1 progenies of the integration event segregated according to Mendelian laws and clean homozygous T1 plants with the donor gene precisely inserted at the DD43 target site were obtained. The Cas9-gRNA system was also successfully applied to make a directed P178S mutation of acetolactate synthase1 gene through in planta gene editing.

  8. Small RNA-directed epigenetic natural variation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jixian Zhai

    2008-04-01

    Full Text Available Progress in epigenetics has revealed mechanisms that can heritably regulate gene function independent of genetic alterations. Nevertheless, little is known about the role of epigenetics in evolution. This is due in part to scant data on epigenetic variation among natural populations. In plants, small interfering RNA (siRNA is involved in both the initiation and maintenance of gene silencing by directing DNA methylation and/or histone methylation. Here, we report that, in the model plant Arabidopsis thaliana, a cluster of approximately 24 nt siRNAs found at high levels in the ecotype Landsberg erecta (Ler could direct DNA methylation and heterochromatinization at a hAT element adjacent to the promoter of FLOWERING LOCUS C (FLC, a major repressor of flowering, whereas the same hAT element in ecotype Columbia (Col with almost identical DNA sequence, generates a set of low abundance siRNAs that do not direct these activities. We have called this hAT element MPF for Methylated region near Promoter of FLC, although de novo methylation triggered by an inverted repeat transgene at this region in Col does not alter its FLC expression. DNA methylation of the Ler allele MPF is dependent on genes in known silencing pathways, and such methylation is transmissible to Col by genetic crosses, although with varying degrees of penetrance. A genome-wide comparison of Ler and Col small RNAs identified at least 68 loci matched by a significant level of approximately 24 nt siRNAs present specifically in Ler but not Col, where nearly half of the loci are related to repeat or TE sequences. Methylation analysis revealed that 88% of the examined loci (37 out of 42 were specifically methylated in Ler but not Col, suggesting that small RNA can direct epigenetic differences between two closely related Arabidopsis ecotypes.

  9. IMP3 RNP safe houses prevent miRNA-directed HMGA2 mRNA decay in cancer and development

    DEFF Research Database (Denmark)

    Jønson, Lars; Christiansen, Jan; Hansen, Thomas van Overeem;

    2014-01-01

    The IMP3 RNA-binding protein is associated with metastasis and poor outcome in human cancer. Using solid cancer transcriptome data, we found that IMP3 correlates with HMGA2 mRNA expression. Cytoplasmic IMP3 granules contain HMGA2, and IMP3 dose-dependently increases HMGA2 mRNA. HMGA2 is regulated...... that IMP3 RNPs may function as cytoplasmic safe houses and prevent miRNA-directed mRNA decay of oncogenes during tumor progression....

  10. A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

    KAUST Repository

    Law, Julie A.

    2010-05-01

    DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

  11. A Viral Protein Suppresses siRNA-directed Interference in Tobacco Mosaic Virus Infection

    Institute of Scientific and Technical Information of China (English)

    Ming-Min ZHAO; De-Rong AN; Guang-Hua HUANG; Zu-Hua HE; Jiang-Ye CHEN

    2005-01-01

    Plant viruses encode suppressors of post-transcriptional gene silencing (PTGS), an adaptive defense response that limits virus replication and its spread in plants. The helper component proteinase (HCPro) of the potato virus A (PVA, genus Potyvirus) suppresses PTGS of silenced transgenes. Here, the effect of HC-Pro on siRNA-directed interference in the tobacco mosaic virus (TMV) was examined by using a transient Agrobacterium tumefaciens-based delivery system in intact tissues. It was shown that the interference effect was completely blocked by co-infiltration with HC-Pro plus siRNA constructs in both systemic and hypersensitive hosts. In the system host, all plants agro-infiltrated with HC-Pro plus siRNA constructs displayed the same symptoms as the negative control. Meanwhile, TMV RNA accumulation was found to be abundant in the upper leaves using reverse transcriptase-PCR (RT-PCR) and Northern blot assays. On the contrary, plants agro-infiltrated with the siRNA construct alone were free of symptoms. Therefore, our study suggests that the transient expression of HC-Pro inhibited the siRNA-directed host defenses against TMV infection.

  12. RNA-directed DNA methylation enforces boundaries between heterochromatin and euchromatin in the maize genome.

    Science.gov (United States)

    Li, Qing; Gent, Jonathan I; Zynda, Greg; Song, Jawon; Makarevitch, Irina; Hirsch, Cory D; Hirsch, Candice N; Dawe, R Kelly; Madzima, Thelma F; McGinnis, Karen M; Lisch, Damon; Schmitz, Robert J; Vaughn, Matthew W; Springer, Nathan M

    2015-11-24

    The maize genome is relatively large (∼ 2.3 Gb) and has a complex organization of interspersed genes and transposable elements, which necessitates frequent boundaries between different types of chromatin. The examination of maize genes and conserved noncoding sequences revealed that many of these are flanked by regions of elevated asymmetric CHH (where H is A, C, or T) methylation (termed mCHH islands). These mCHH islands are quite short (∼ 100 bp), are enriched near active genes, and often occur at the edge of the transposon that is located nearest to genes. The analysis of DNA methylation in other sequence contexts and several chromatin modifications revealed that mCHH islands mark the transition from heterochromatin-associated modifications to euchromatin-associated modifications. The presence of an mCHH island is fairly consistent in several distinct tissues that were surveyed but shows some variation among different haplotypes. The presence of insertion/deletions in promoters often influences the presence and position of an mCHH island. The mCHH islands are dependent upon RNA-directed DNA methylation activities and are lost in mop1 and mop3 mutants, but the nearby genes rarely exhibit altered expression levels. Instead, loss of an mCHH island is often accompanied by additional loss of DNA methylation in CG and CHG contexts associated with heterochromatin in nearby transposons. This suggests that mCHH islands and RNA-directed DNA methylation near maize genes may act to preserve the silencing of transposons from activity of nearby genes.

  13. IDN2 and its paralogs form a complex required for RNA-directed DNA methylation.

    Directory of Open Access Journals (Sweden)

    Cui-Jun Zhang

    Full Text Available IDN2/RDM12 has been previously identified as a component of the RNA-directed DNA methylation (RdDM machinery in Arabidopsis thaliana, but how it functions in RdDM remains unknown. By affinity purification of IDN2, we co-purified two IDN2 paralogs IDP1 and IDP2 (IDN2 PARALOG 1 and 2. The coiled-coil domain between the XS and XH domains of IDN2 is essential for IDN2 homodimerization, whereas the IDN2 C-terminal XH domain but not the coiled-coil domain is required for IDN2 interaction with IDP1 and IDP2. By introducing the wild-type IDN2 sequence and its mutated derivatives into the idn2 mutant for complementation testing, we demonstrated that the previously uncharacterized IDN2 XH domain is required for the IDN2-IDP1/IDP2 complex formation as well as for IDN2 function. IDP1 is required for de novo DNA methylation, siRNA accumulation, and transcriptional gene silencing, whereas IDP2 has partially overlapping roles with IDP1. Unlike IDN2, IDP1 and IDP2 are incapable of binding double-stranded RNA, suggesting that the roles of IDP1 and IDP2 are different from those of IDN2 in the IDN2-IDP1/IDP2 complex and that IDP1 and IDP2 are essential for the functioning of the complex in RdDM.

  14. MiRNA-directed regulation of VEGF and other angiogenic factors under hypoxia.

    Directory of Open Access Journals (Sweden)

    Zhong Hua

    Full Text Available MicroRNAs (miRNAs are a class of 20-24 nt non-coding RNAs that regulate gene expression primarily through post-transcriptional repression or mRNA degradation in a sequence-specific manner. The roles of miRNAs are just beginning to be understood, but the study of miRNA function has been limited by poor understanding of the general principles of gene regulation by miRNAs. Here we used CNE cells from a human nasopharyngeal carcinoma cell line as a cellular system to investigate miRNA-directed regulation of VEGF and other angiogenic factors under hypoxia, and to explore the principles of gene regulation by miRNAs. Through computational analysis, 96 miRNAs were predicted as putative regulators of VEGF. But when we analyzed the miRNA expression profile of CNE and four other VEGF-expressing cell lines, we found that only some of these miRNAs could be involved in VEGF regulation, and that VEGF may be regulated by different miRNAs that were differentially chosen from 96 putative regulatory miRNAs of VEGF in different cells. Some of these miRNAs also co-regulate other angiogenic factors (differential regulation and co-regulation principle. We also found that VEGF was regulated by multiple miRNAs using different combinations, including both coordinate and competitive interactions. The coordinate principle states that miRNAs with independent binding sites in a gene can produce coordinate action to increase the repressive effect of miRNAs on this gene. By contrast, the competitive principle states when multiple miRNAs compete with each other for a common binding site, or when a functional miRNA competes with a false positive miRNA for the same binding site, the repressive effects of miRNAs may be decreased. Through the competitive principle, false positive miRNAs, which cannot directly repress gene expression, can sometimes play a role in miRNA-mediated gene regulation. The competitive principle, differential regulation, multi-miRNA binding sites, and false

  15. An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

    KAUST Repository

    Gao, Zhihuan

    2010-04-21

    DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.

  16. A Pre-mRNA-splicing factor is required for RNA-directed DNA methylation in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Chao-Feng Huang

    Full Text Available Cytosine DNA methylation is a stable epigenetic mark that is frequently associated with the silencing of genes and transposable elements (TEs. In Arabidopsis, the establishment of DNA methylation is through the RNA-directed DNA methylation (RdDM pathway. Here, we report the identification and characterization of RDM16, a new factor in the RdDM pathway. Mutation of RDM16 reduced the DNA methylation levels and partially released the silencing of a reporter gene as well as some endogenous genomic loci in the DNA demethylase ros1-1 mutant background. The rdm16 mutant had morphological defects and was hypersensitive to salt stress and abscisic acid (ABA. Map-based cloning and complementation test led to the identification of RDM16, which encodes a pre-mRNA-splicing factor 3, a component of the U4/U6 snRNP. RNA-seq analysis showed that 308 intron retention events occurred in rdm16, confirming that RDM16 is involved in pre-mRNA splicing in planta. RNA-seq and mRNA expression analysis also revealed that the RDM16 mutation did not affect the pre-mRNA splicing of known RdDM genes, suggesting that RDM16 might be directly involved in RdDM. Small RNA expression analysis on loci showing RDM16-dependent DNA methylation suggested that unlike the previously reported putative splicing factor mutants, rdm16 did not affect small RNA levels; instead, the rdm16 mutation caused a decrease in the levels of Pol V transcripts. ChIP assays revealed that RDM16 was enriched at some Pol V target loci. Our results suggest that RDM16 regulates DNA methylation through influencing Pol V transcript levels. Finally, our genome-wide DNA methylation analysis indicated that RDM16 regulates the overall methylation of TEs and gene-surrounding regions, and preferentially targets Pol IV-dependent DNA methylation loci and the ROS1 target loci. Our work thus contributes to the understanding of RdDM and its interactions with active DNA demethylation.

  17. The silent defense: Micro-RNA directed defense against HIV-1 replication

    Directory of Open Access Journals (Sweden)

    Kumar Ajit

    2007-04-01

    Full Text Available Abstract MicroRNAs play critical role in regulating gene expression. MicroRNA profile of particular cell type bears the signature of cell type specific gene expression. Given that viral pathogens replicate by evading host defenses, research is now focused on the miRNA-regulated genes that critically regulate HIV-1 propagation in human host cells.

  18. LncRNA Directs Cooperative Epigenetic Regulation Downstream of Chemokine Signals

    OpenAIRE

    Xing, Zhen; Lin, Aifu; Li, Chunlai; Liang, Ke; Wang, Shouyu; Liu, Yang; Park, Peter; Li QIN; Wei, Yongkun; Hawke, David; Hung, Mien-Chie; Lin, Chunru; Yang, Liuqing

    2014-01-01

    LncRNAs are known to regulate a number of different development and tumorigenic processes. Here we report a role for lncRNA BCAR4 in breast cancer metastasis that is mediated by chemokine-induced binding of BCAR4 to two transcription factors with extended regulatory consequences. BCAR4 binding of SNIP1 and PNUTS in response to CCL21 releases the SNIP1's inhibition of p300-dependent histone acetylation that in turn enables the BCAR4-recruited PNUTS to bind H3K18ac and relieve inhibition of RNA...

  19. LncRNA Directs Cooperative Epigenetic Regulation Downstream of Chemokine Signals

    Science.gov (United States)

    Wang, Shouyu; Liu, Yang; Park, Peter; Qin, Li; Wei, Yongkun; Hawke, David; Hung, Mien-Chie; Lin, Chunru; Yang, Liuqing

    2014-01-01

    Summary LncRNAs are known to regulate a number of different development and tumorigenic processes. Here we report a role for lncRNA BCAR4 in breast cancer metastasis that is mediated by chemokine-induced binding of BCAR4 to two transcription factors with extended regulatory consequences. BCAR4 binding of SNIP1 and PNUTS in response to CCL21 releases the SNIP1's inhibition of p300-dependent histone acetylation that in turn enables the BCAR4-recruited PNUTS to bind H3K18ac and relieve inhibition of RNA Pol II via activation of the PP1 phosphatase. This mechanism activates a noncanonical Hedgehog/GLI2 transcriptional program that promotes cell migration. BCAR4 expression correlates with advanced breast cancers and therapeutic delivery of Locked Nucleic Acids (LNAs) targeting BCAR4 strongly suppresses breast cancer metastasis in mouse models. The findings reveal a disease-relevant lncRNA mechanism consisting of both direct coordinated protein recruitment and indirect regulation of transcription factors. PMID:25416949

  20. Small RNA-directed epigenetic programming of embryonic stem cell cardiac differentiation

    Science.gov (United States)

    Ghanbarian, Hossein; Wagner, Nicole; Michiels, Jean-François; Cuzin, François; Wagner, Kay-Dietrich; Rassoulzadegan, Minoo

    2017-01-01

    Microinjection of small noncoding RNAs in one-cell embryos was reported in several instances to result in transcriptional activation of target genes. To determine the molecular mechanisms involved and to explore whether such epigenetic regulations could play a role in early development, we used a cell culture system as close as possible to the embryonic state. We report efficient cardiac differentiation of embryonic stem (ES) cells induced by small non-coding RNAs with sequences of Cdk9, a key player in cardiomyocyte differentiation. Transfer of oligoribonucleotides representing parts of the Cdk9 mRNA into ES and mouse embryo fibroblast cultures resulted in upregulation of transcription. Dependency on Argonaute proteins and endogenous antisense transcripts indicated that the inducer oligoribonucleotides were processed by the RNAi machinery. Upregulation of Cdk9 expression resulted in increased efficiency of cardiac differentiation suggesting a potential tool for stem cell-based regenerative medicine. PMID:28165496

  1. Gene Editing With CRISPR/Cas9 RNA-Directed Nuclease.

    Science.gov (United States)

    Doetschman, Thomas; Georgieva, Teodora

    2017-03-03

    Genetic engineering of model organisms and cultured cells has for decades provided important insights into the mechanisms underlying cardiovascular development and disease. In the past few years the development of several nuclease systems has broadened the range of model/cell systems that can be engineered. Of these, the CRISPR (clustered regularly interspersed short palindromic repeats)/Cas9 (CRISPR-associated protein 9) system has become the favorite for its ease of application. Here we will review this RNA-guided nuclease system for gene editing with respect to its usefulness for cardiovascular studies and with an eye toward potential therapy. Studies on its off-target activity, along with approaches to minimize this activity will be given. The advantages of gene editing versus gene targeting in embryonic stem cells, including the breadth of species and cell types to which it is applicable, will be discussed. We will also cover its use in iPSC for research and possible therapeutic purposes; and we will review its use in muscular dystrophy studies where considerable progress has been made toward dystrophin correction in mice. The CRISPR/Ca9s system is also being used for high-throughput screening of genes, gene regulatory regions, and long noncoding RNAs. In addition, the CRISPR system is being used for nongene-editing purposes such as activation and inhibition of gene expression, as well as for fluorescence tagging of chromosomal regions and individual mRNAs to track their cellular location. Finally, an approach to circumvent the inability of post-mitotic cells to support homologous recombination-based gene editing will be presented. In conclusion, applications of the CRISPR/Cas system are expanding at a breath-taking pace and are revolutionizing approaches to gain a better understanding of human diseases.

  2. IMP3 RNP safe houses prevent miRNA-directed HMGA2 mRNA decay in cancer and development

    DEFF Research Database (Denmark)

    Jønson, Lars; Christiansen, Jan; Hansen, Thomas van Overeem

    2014-01-01

    The IMP3 RNA-binding protein is associated with metastasis and poor outcome in human cancer. Using solid cancer transcriptome data, we found that IMP3 correlates with HMGA2 mRNA expression. Cytoplasmic IMP3 granules contain HMGA2, and IMP3 dose-dependently increases HMGA2 mRNA. HMGA2 is regulated...... embryos show dose-dependent Hmga2 mRNA downregulation. Finally, IMP3 ribonucleoproteins (RNPs) contain other let-7 target mRNAs, including LIN28B, and a global gene set enrichment analysis demonstrates that miRNA-regulated transcripts in general are upregulated following IMP3 induction. We conclude...

  3. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  4. Cystoviral polymerase complex protein P7 uses its acidic C-terminal tail to regulate the RNA-directed RNA polymerase P2.

    Science.gov (United States)

    Alphonse, Sébastien; Arnold, Jamie J; Bhattacharya, Shibani; Wang, Hsin; Kloss, Brian; Cameron, Craig E; Ghose, Ranajeet

    2014-07-15

    In bacteriophages of the cystovirus family, the polymerase complex (PX) encodes a 75-kDa RNA-directed RNA polymerase (P2) that transcribes the double-stranded RNA genome. Also a constituent of the PX is the essential protein P7 that, in addition to accelerating PX assembly and facilitating genome packaging, plays a regulatory role in transcription. Deletion of P7 from the PX leads to aberrant plus-strand synthesis suggesting its influence on the transcriptase activity of P2. Here, using solution NMR techniques and the P2 and P7 proteins from cystovirus ϕ12, we demonstrate their largely electrostatic interaction in vitro. Chemical shift perturbations on P7 in the presence of P2 suggest that this interaction involves the dynamic C-terminal tail of P7, more specifically an acidic cluster therein. Patterns of chemical shift changes induced on P2 by the P7 C-terminus resemble those seen in the presence of single-stranded RNA suggesting similarities in binding. This association between P2 and P7 reduces the affinity of the former toward template RNA and results in its decreased activity both in de novo RNA synthesis and in extending a short primer. Given the presence of C-terminal acidic tracts on all cystoviral P7 proteins, the electrostatic nature of the P2/P7 interaction is likely conserved within the family and could constitute a mechanism through which P7 regulates transcription in cystoviruses.

  5. De novo transcriptome sequence assembly from coconut leaves and seeds with a focus on factors involved in RNA-directed DNA methylation.

    Science.gov (United States)

    Huang, Ya-Yi; Lee, Chueh-Pai; Fu, Jason L; Chang, Bill Chia-Han; Matzke, Antonius J M; Matzke, Marjori

    2014-09-04

    Coconut palm (Cocos nucifera) is a symbol of the tropics and a source of numerous edible and nonedible products of economic value. Despite its nutritional and industrial significance, coconut remains under-represented in public repositories for genomic and transcriptomic data. We report de novo transcript assembly from RNA-seq data and analysis of gene expression in seed tissues (embryo and endosperm) and leaves of a dwarf coconut variety. Assembly of 10 GB sequencing data for each tissue resulted in 58,211 total unigenes in embryo, 61,152 in endosperm, and 33,446 in leaf. Within each unigene pool, 24,857 could be annotated in embryo, 29,731 could be annotated in endosperm, and 26,064 could be annotated in leaf. A KEGG analysis identified 138, 138, and 139 pathways, respectively, in transcriptomes of embryo, endosperm, and leaf tissues. Given the extraordinarily large size of coconut seeds and the importance of small RNA-mediated epigenetic regulation during seed development in model plants, we used homology searches to identify putative homologs of factors required for RNA-directed DNA methylation in coconut. The findings suggest that RNA-directed DNA methylation is important during coconut seed development, particularly in maturing endosperm. This dataset will expand the genomics resources available for coconut and provide a foundation for more detailed analyses that may assist molecular breeding strategies aimed at improving this major tropical crop.

  6. Enhancement of RNA-directed DNA methylation of a transgene by simultaneously downregulating a ROS1 orthologue using a virus vector in Nicotiana benthamiana

    Directory of Open Access Journals (Sweden)

    Shungo eOtagaki

    2013-04-01

    Full Text Available Cytosine methylation can be induced by double-stranded RNAs through the RNA-directed DNA methylation (RdDM pathway. A DNA glycosylase REPRESSOR OF SILENCING 1 (ROS1 participates in DNA demethylation in Arabidopsis and may possibly counteract RdDM. Here, we isolated an orthologue of ROS1 (NbROS1 from Nicotiana benthamiana and examined the antagonistic activity of NbROS1 against virus-induced RdDM by simultaneously inducing RdDM and NbROS1 knockdown using a vector based on Cucumber mosaic virus. Plants were inoculated with a virus that contained a portion of the CaMV 35S promoter, which induced RdDM of the promoter integrated in the plant genome and transcriptional silencing of the green fluorescent protein gene driven by the promoter. Plants were also inoculated with a virus that contained a portion of NbROS1, which induced downregulation of NbROS1. Simultaneous induction of RdDM and NbROS1 knockdown resulted in an increase in the level of cytosine methylation of the target promoter. These results provide evidence for the presence of antagonistic activity of NbROS1 against virus-induced RdDM and suggest that the simultaneous induction of promoter-targeting RdDM and NbROS1 knockdown by a virus vector is useful as a tool to enhance targeted DNA methylation.

  7. RNA Polymerase V Functions in Arabidopsis Interphase Heterochromatin Organization Independently of the 24-nt siRNA-Directed DNA Methylation Pathway

    Institute of Scientific and Technical Information of China (English)

    Olga Pontes; Pedro Costa-Nunes; Paul Vithayathil; Craig S.Pikaard

    2009-01-01

    In Arabidopsis,pericentromeric repeats,retroelements,and silenced rRNA genes are assembled into heterochromatin within nuclear structures known as chromocenters.The mechanisms governing higher-order heterochromatin organization are poorly understood but 24-nt small interfering RNAs (siRNAs) are known to play key roles in heterochromatin formation.Nuclear RNA polymerase IV (Pol IV),RNA-DEPENDENT RNA POLYMERASE 2 (RDR2),and DICER-LIKE 3 (DCL3) are required for biogenesis of 24-nt siRNAs that associate with ARGONAUTE 4 (AGO4).Nuclear RNA polymerase V (Pol V) collaborates with DRD1 (DEFICIENT IN RNA-DEPENDENT DNA METHYLATION 1) to generate transcripts at heterochromatic loci that are hypothesized to bind to siRNA-AGO4 complexes and subsequently recruit the de-novo DNA methylation and/or histone modifying machinery.Here,we report that decondensation of the major pericentromeric repeats and depletion of the heterochromatic mark histone H3 lysine 9 dimethylation at chromocenters occurs specifically in pol V and drd1 mutants.Disruption of pericentromeric repeats condensation is coincident with transcriptional reactivation of specific classes of pericentromeric 180-bp repeats.We further demonstrate that Pol V functions independently of Pol IV,RDR2,and DCL3-mediated siRNA production to affect interphase heterochromatin organization,possibly by involving RNAs that recruit structural or chromatin-modifying proteins.

  8. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Directory of Open Access Journals (Sweden)

    Jolanta Kwasniewska

    Full Text Available In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley by maleic hydrazide (MH cells was performed. Simultaneously fluorescence in situ hybridization (FISH with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment.

  9. MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for arabidopsis lateral root development.

    Science.gov (United States)

    Guo, Hui-Shan; Xie, Qi; Fei, Ji-Feng; Chua, Nam-Hai

    2005-05-01

    Although several plant microRNAs (miRNAs) have been shown to play a role in plant development, no phenotype has yet been associated with a reduction or loss of expression of any plant miRNA. Arabidopsis thaliana miR164 was predicted to target five NAM/ATAF/CUC (NAC) domain-encoding mRNAs, including NAC1, which transduces auxin signals for lateral root emergence. Here, we show that miR164 guides the cleavage of endogenous and transgenic NAC1 mRNA, producing 3'-specific fragments. Cleavage was blocked by NAC1 mutations that disrupt base pairing with miR164. Compared with wild-type plants, Arabidopsis mir164a and mir164b mutant plants expressed less miR164 and more NAC1 mRNA and produced more lateral roots. These mutant phenotypes can be complemented by expression of the appropriate MIR164a and MIR164b genomic sequences. By contrast, inducible expression of miR164 in wild-type plants led to decreased NAC1 mRNA levels and reduced lateral root emergence. Auxin induction of miR164 was mirrored by an increase in the NAC1 mRNA 3' fragment, which was not observed in the auxin-insensitive mutants auxin resistant1 (axr1-12), axr2-1, and transport inhibitor response1. Moreover, the cleavage-resistant form of NAC1 mRNA was unaffected by auxin treatment. Our results indicate that auxin induction of miR164 provides a homeostatic mechanism to clear NAC1 mRNA to downregulate auxin signals.

  10. Analysis of single nucleotide polymorphisms based on RNA sequencing data of diverse bio-geographical accessions in barley

    Science.gov (United States)

    Takahagi, Kotaro; Uehara-Yamaguchi, Yukiko; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo; Mochida, Keiichi; Saisho, Daisuke

    2016-01-01

    Barley is one of the founder crops of Old world agriculture and has become the fourth most important cereal worldwide. Information on genome-scale DNA polymorphisms allows elucidating the evolutionary history behind domestication, as well as discovering and isolating useful genes for molecular breeding. Deep transcriptome sequencing enables the exploration of sequence variations in transcribed sequences; such analysis is particularly useful for species with large and complex genomes, such as barley. In this study, we performed RNA sequencing of 20 barley accessions, comprising representatives of several biogeographic regions and a wild ancestor. We identified 38,729 to 79,949 SNPs in the 19 domesticated accessions and 55,403 SNPs in the wild barley and revealed their genome-wide distribution using a reference genome. Genome-scale comparisons among accessions showed a clear differentiation between oriental and occidental barley populations. The results based on population structure analyses provide genome-scale properties of sub-populations grouped to oriental, occidental and marginal groups in barley. Our findings suggest that the oriental population of domesticated barley has genomic variations distinct from those in occidental groups, which might have contributed to barley’s domestication. PMID:27616653

  11. Elucidation of the nucleotide sequence of chicken calcitonin mRNA: direct evidence for the expression of a lower vertebrate calcitonin-like gene in man and rat.

    OpenAIRE

    Lasmoles, F.; Jullienne, A; Day, F; Minvielle, S.; Milhaud, G; Moukhtar, M S

    1985-01-01

    Calcitonin shows considerable divergence in amino acid sequence between lower vertebrates and higher vertebrates. Immunoreactive salmon-like calcitonin molecules are present in the thyroid of man and rat. Elucidation of the almost complete sequence of chicken calcitonin mRNA revealed that the calcitonin precursor in chickens had the same organisation as in higher vertebrates (man and rat) but showed considerable differences in amino acid sequence. cDNA probes specific for chicken calcitonin m...

  12. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  13. Extraction of high-quality RNA from germinating barley (Hordeum vulgare L.) seeds containing high levels of starch.

    Science.gov (United States)

    Comparative evaluation of gene expression levels can lead to improved understanding of the gene networks underlying traits of economic importance. Extraction of high-quality RNA from germinating barley seeds that contain high levels of starch is of vital importance for analysing the expression of ca...

  14. siRNA对烟草原生质体中TMV RNA积累的干扰作用研究%siRNA-directed Interference of TMV RNA Accumulation in Tobacco Protoplast

    Institute of Scientific and Technical Information of China (English)

    赵明敏; 杨向东; 鲁红学; 张长青

    2007-01-01

    RNA interference(RNAi)is a mechanism of post-transcriptional gene silencing(PTGS)that has been described in plants.RNAi silences gene expression through small interfering RNA(siRNA)that guides mRNA degradation in a sequence-specific manner.Here,we report that siRNA inhibits virus accumulation by targeting TMV 126 kD protein gene in tobacco protoplasts.ELISA and Northern blot assays displayed that protoplasts electroporated with siRNA+TMV showed a sigmficant reduction of TMV RNA concentration.In hypersensitive host.leaves inoculated by protoplast transfected with siRNA+TMV displayed a few local lesions compared with the controls.These indicated that siRNA could interfere with TMV infection in tobacco protoplasts.Therefore,this protoplast system could facilitate rapid and quantitative analysis for siRNA-mediated interference on plant virus infection.%RNA干扰被认为是转录后基因沉默的一种机制.RNA干扰通过小干扰RNA特异性降解目标mRNA来沉默基因表达.本文以烟草花叶病毒126 kD蛋白为靶蛋白,在原生质体水平上研究了小干扰RNA对病毒侵染的干扰和抑制作用.ELISA和Northern杂交的实验结果表明,共转染小干扰RNA和TMV的原生质体内检测到较低的病毒含量.在枯斑寄主上,叶片接种小干扰RNA和TMV共转染原生质体后,与对照叶片相比,仅有很少量的病斑产生.这说明,小干扰RNA能够在原生质体水平对病毒起到干扰和抑制作用.因此认为,烟草原生质体系统有利于快速和定量分析小干扰RNA介导对植物病毒的抑制作用.

  15. Light-induced appearance of polysomal poly(A)-rich messenger RNA during greening of barley plants.

    Science.gov (United States)

    Heinze, H; Herzfeld, F; Kiper, M

    1980-10-01

    Changes in polysomal poly(A)-rich mRNA during greening of etiolated barley plants were studied by the technique of cDNA-mRNa hybridization. Hybridizaiton data of the homologous reactions reveal that in etiolated as well as in greened shoots a complexity of 5 X 10(7) nucleotides or about 33000 different average-sized mRNAs are present. These are organized in different abundancy classes with 94% of the total complexicity present in each of the slowest reacting class representing rare messengers. Heterologous hybridizations indicate that 92% of all polysomal poly(A)-rich mRNAs in etiolated shoots are complementary to those of greened and 82% of 'green' poly(A)-rich mRNAs are complementary to white ones. It is shown that the abundant mRNA clases are essentially responsible for these differences. The prevalent classes making up 15% ('white') and 31% ('green') of the poly(A)-rich mRNA mass but comprising only a complexity of 1.8 X 10(4) and 2.1 X 10(4) nucleotides are identical to 50% with each other. Hybridization of isolated prevalent 'green' cDNA with whole 'white' poly(A)-rich mRNA indicates that the additionally appearing 50% prevalent green messengers must be regarded as green-specific, only present in polysomal poly(A)-rich mRNA after illumination. This conclusion is underlined by the hybridization of the 'green' cDNA with total polysomal RNa of etiolated shoots. Evidently appearance of these prevalent messengers in functional polysomes is not caused by a shift from poly(A)-free mRNA to poly(A)-rich mRNA. The results clearly demonstrate that light induces greening by turning on genes or influencing post-transcriptional processing to produce mature green-specific poly(A)-rich mRNA.

  16. Phosphate utilization efficiency correlates with expression of low-affinity phosphate transporters and noncoding RNA, IPS1, in barley.

    Science.gov (United States)

    Huang, Chun Y; Shirley, Neil; Genc, Yusuf; Shi, Bujun; Langridge, Peter

    2011-07-01

    Genetic variation in phosphorus (P) efficiency exists among wheat (Triticum aestivum) and barley (Hordeum vulgare) genotypes, but the underlying mechanisms for the variation remain elusive. High- and low-affinity phosphate (Pi) PHT1 transporters play an indispensable role in P acquisition and remobilization. However, little is known about genetic variation in PHT1 gene expression and association with P acquisition efficiency (PAE) and P utilization efficiency (PUE). Here, we present quantitative analyses of transcript levels of high- and low-affinity PHT1 Pi transporters in four barley genotypes differing in PAE. The results showed that there was no clear pattern in the expression of four paralogs of the high-affinity Pi transporter HvPHT1;1 among the four barley genotypes, but the expression of a low-affinity Pi transporter, HvPHT1;6, and its close homolog HvHPT1;3 was correlated with the genotypes differing in PUE. Interestingly, the expression of HvPHT1;6 and HvPHT1;3 was correlated with the expression of HvIPS1 (for P starvation inducible; noncoding RNA) but not with HvIPS2, suggesting that HvIPS1 plays a distinct role in the regulation of the low-affinity Pi transporters. In addition, high PUE was found to be associated with high root-shoot ratios in low-P conditions, indicating that high carbohydrate partitioning into roots occurs simultaneously with high PUE. However, high PUE accompanying high carbon partitioning into roots could result in low PAE. Therefore, the optimization of PUE through the modification of low-affinity Pi transporter expression may assist further improvement of PAE for low-input agriculture systems.

  17. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    Energy Technology Data Exchange (ETDEWEB)

    Deikman, J.; Jones, R.L.

    1985-01-01

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  18. Isolation and Translation of Hordein Messenger RNA from Wild Type and Mutant Endosperms in Barley

    DEFF Research Database (Denmark)

    Brandt, Anders Bøving; Ingwersen, J.

    1978-01-01

    Nucleotide sequences of four cDNA clones coding for the carboxy-terminal portion of at least two different B1 hordein polypeptides are presented. The open reading frame in the nucleotide sequence of the the largest clone (pc hor2-4, 720 nucleotides) translates into the 181 carboxy-terminal amino...... was found to be a major constituent of the total messenger RNA population of the endosperm cell. Polyadenylated hordein messenger RNA sedimented at 11S in sucrose gradients and electrophoretic analysis reveals the presence of at least three RNA species with apparent molecular weights of 0.45, 0.36 and 0.......30 megadaltons. The 11S messenger RNA was translated in vitro into hordein precursor polypeptides which are 2–4 kilodaltons larger than the native hordein polypeptides. The endosperm cell of mutant No. 1508 contained twice as much RNA as the wild type endosperm cell but the same amount of polyadenylated 11S RNA...

  19. RNA Directed Modulation of Phenotypic Plasticity in Human Cells.

    Science.gov (United States)

    Trakman, Laura; Hewson, Chris; Burdach, Jon; Morris, Kevin V

    2016-01-01

    Natural selective processes have been known to drive phenotypic plasticity, which is the emergence of different phenotypes from one genome following environmental stimulation. Long non-coding RNAs (lncRNAs) have been observed to modulate transcriptional and epigenetic states of genes in human cells. We surmised that lncRNAs are governors of phenotypic plasticity and drive natural selective processes through epigenetic modulation of gene expression. Using heat shocked human cells as a model we find several differentially expressed transcripts with the top candidates being lncRNAs derived from retro-elements. One particular retro-element derived transcripts, Retro-EIF2S2, was found to be abundantly over-expressed in heat shocked cells. Over-expression of Retro-EIF2S2 significantly enhanced cell viability and modulated a predisposition for an adherent cellular phenotype upon heat shock. Mechanistically, we find that this retro-element derived transcript interacts directly with a network of proteins including 40S ribosomal protein S30 (FAU), Eukaryotic translation initiation factor 5A (EIF5A), and Ubiquitin-60S ribosomal protein L40 (UBA52) to affect protein modulated cell adhesion pathways. We find one motif in Retro-EIF2S2 that exhibits binding to FAU and modulates phenotypic cell transitions from adherent to suspension states. The observations presented here suggest that retroviral derived transcripts actively modulate phenotypic plasticity in human cells in response to environmental selective pressures and suggest that natural selection may play out through the action of retro-elements in human cells.

  20. Barley germination

    DEFF Research Database (Denmark)

    Daneri-Castro, Sergio N.; Svensson, Birte; Roberts, Thomas H.

    2016-01-01

    conditions continue to be key to discovering the roles of individual protein forms and posttranslational modifications, such as glycosylation. Activity-based proteomics, particularly in combination with new gene editing technologies, has great potential to elucidate the network of enzymes in barley...

  1. Genome comparison of barley and maize smut fungi reveals targeted loss of RNA silencing components and species-specific presence of transposable elements.

    Science.gov (United States)

    Laurie, John D; Ali, Shawkat; Linning, Rob; Mannhaupt, Gertrud; Wong, Philip; Güldener, Ulrich; Münsterkötter, Martin; Moore, Richard; Kahmann, Regine; Bakkeren, Guus; Schirawski, Jan

    2012-05-01

    Ustilago hordei is a biotrophic parasite of barley (Hordeum vulgare). After seedling infection, the fungus persists in the plant until head emergence when fungal spores develop and are released from sori formed at kernel positions. The 26.1-Mb U. hordei genome contains 7113 protein encoding genes with high synteny to the smaller genomes of the related, maize-infecting smut fungi Ustilago maydis and Sporisorium reilianum but has a larger repeat content that affected genome evolution at important loci, including mating-type and effector loci. The U. hordei genome encodes components involved in RNA interference and heterochromatin formation, normally involved in genome defense, that are lacking in the U. maydis genome due to clean excision events. These excision events were possibly a result of former presence of repetitive DNA and of an efficient homologous recombination system in U. maydis. We found evidence of repeat-induced point mutations in the genome of U. hordei, indicating that smut fungi use different strategies to counteract the deleterious effects of repetitive DNA. The complement of U. hordei effector genes is comparable to the other two smuts but reveals differences in family expansion and clustering. The availability of the genome sequence will facilitate the identification of genes responsible for virulence and evolution of smut fungi on their respective hosts.

  2. Genome Comparison of Barley and Maize Smut Fungi Reveals Targeted Loss of RNA Silencing Components and Species-Specific Presence of Transposable Elements[W

    Science.gov (United States)

    Laurie, John D.; Ali, Shawkat; Linning, Rob; Mannhaupt, Gertrud; Wong, Philip; Güldener, Ulrich; Münsterkötter, Martin; Moore, Richard; Kahmann, Regine; Bakkeren, Guus; Schirawski, Jan

    2012-01-01

    Ustilago hordei is a biotrophic parasite of barley (Hordeum vulgare). After seedling infection, the fungus persists in the plant until head emergence when fungal spores develop and are released from sori formed at kernel positions. The 26.1-Mb U. hordei genome contains 7113 protein encoding genes with high synteny to the smaller genomes of the related, maize-infecting smut fungi Ustilago maydis and Sporisorium reilianum but has a larger repeat content that affected genome evolution at important loci, including mating-type and effector loci. The U. hordei genome encodes components involved in RNA interference and heterochromatin formation, normally involved in genome defense, that are lacking in the U. maydis genome due to clean excision events. These excision events were possibly a result of former presence of repetitive DNA and of an efficient homologous recombination system in U. maydis. We found evidence of repeat-induced point mutations in the genome of U. hordei, indicating that smut fungi use different strategies to counteract the deleterious effects of repetitive DNA. The complement of U. hordei effector genes is comparable to the other two smuts but reveals differences in family expansion and clustering. The availability of the genome sequence will facilitate the identification of genes responsible for virulence and evolution of smut fungi on their respective hosts. PMID:22623492

  3. Brewing with fractionated barley

    OpenAIRE

    Donkelaar, van, CC René

    2016-01-01

    Brewing with fractionated barley Beer is a globally consumed beverage, which is produced from malted barley, water, hops and yeast. In recent years, the use of unmalted barley and exogenous enzymes have become more popular because they enable simpler processing and reduced environmental impact. Raw barley, however, contains less endogenous enzymes and more undesired components for the use of beer brewing, compared to malted barley.  The overall aim of this thesis is to investigate how ba...

  4. RNA genetics

    Energy Technology Data Exchange (ETDEWEB)

    Domingo, E. (Instituto de Biologia Molecular, Facultad de Ciencias, Universidad Autonoma de Madrid, Canto Blanco, Madrid (ES)); Holland, J.J. (California Univ., San Diego, La Jolla, CA (USA). Dept. of Biology); Ahlquist, P. (Wisconsin Univ., Madison, WI (USA). Dept. of Plant Pathology)

    1988-01-01

    This book contains the proceedings on RNA genetics: RNA-directed virus replication Volume 1. Topics covered include: Replication of the poliovirus genome; Influenza viral RNA transcription and replication; and Relication of the reoviridal: Information derived from gene cloning and expression.

  5. Brewing with fractionated barley

    NARCIS (Netherlands)

    Donkelaar, van L.H.G.

    2016-01-01

    Brewing with fractionated barley Beer is a globally consumed beverage, which is produced from malted barley, water, hops and yeast. In recent years, the use of unmalted barley and exogenous enzymes have become more popular because they enable simpler processing and reduced environmental impact. Raw

  6. Barley peroxidase isozymes

    Science.gov (United States)

    Laugesen, Sabrina; Bak-Jensen, Kristian Sass; Hägglund, Per; Henriksen, Anette; Finnie, Christine; Svensson, Birte; Roepstorff, Peter

    2007-12-01

    Thirteen peroxidase spots on two-dimensional gels were identified by comprehensive proteome analysis of the barley seed. Mass spectrometry tracked multiple forms of three different peroxidase isozymes: barley seed peroxidase 1, barley seed-specific peroxidase BP1 and a not previously identified putative barley peroxidase. The presence of multiple spots for each of the isozymes reflected variations in post-translational glycosylation and protein truncation. Complete sequence coverage was achieved by using a series of proteases and chromatographic resins for sample preparation prior to mass spectrometric analysis. Distinct peroxidase spot patterns divided the 16 cultivars tested into two groups. The distribution of the three isozymes in different seed tissues (endosperm, embryo, and aleurone layer) suggested the peroxidases to play individual albeit partially overlapping roles during germination. In summary, a subset of three peroxidase isozymes was found to occur in the seed, whereas products of four other barley peroxidase genes were not detected. The present analysis documents the selective expression profiles and post-translational modifications of isozymes from a large plant gene family.

  7. Stability of Barley stripe mosaic virus induced gene silencing in barley

    DEFF Research Database (Denmark)

    Bruun-Rasmussen, Marianne; Madsen, Christian Toft; Jessing, Stine;

    2007-01-01

    Virus-induced gene silencing (VIGS) can be used as a powerful tool for functional genomics studies in plants. With this approach, it is possible to target most genes and downregulate the messenger (m)RNA in a sequence-specific manner. Barley stripe mosaic virus (BSMV) is an established VIGS vecto...... inoculation, although large parts of the insert had been lost from the virus vector. The instability of the insert, observed consistently throughout our experiments, offers an explanation for the transient nature of silencing when using BSMV as a VIGS vector.......Virus-induced gene silencing (VIGS) can be used as a powerful tool for functional genomics studies in plants. With this approach, it is possible to target most genes and downregulate the messenger (m)RNA in a sequence-specific manner. Barley stripe mosaic virus (BSMV) is an established VIGS vector...... for barley and wheat; however, silencing using this vector is generally transient, with efficient silencing often being confined to the first two or three systemically infected leaves. To investigate this further, part of the barley Phytoene desaturase (PDS) gene was inserted into BSMV and the resulting...

  8. Malting barley BRS Borema

    Directory of Open Access Journals (Sweden)

    Euclydes Minella

    2006-01-01

    Full Text Available BRS Borema is an early maturing, two-rowed spring barley registered in 2003 for commercial production inSouthern Brazil, bred by Embrapa Trigo. It combines good yield potential with superior malting quality and a reasonable levelof disease (net blotch, powdery mildew, leaf rust resistance. It is well-adapted to all major production regions of maltingbarley in Brazil.

  9. HEALTH BENEFITS OF BARLEY

    Directory of Open Access Journals (Sweden)

    Akula Annapurna

    2013-09-01

    Full Text Available Prevalence of lifestyle diseases is increasing day by day. Mostly the younger generation do not have much awareness about healthy nutritional supplements. One such important cereal grain not used mostly by youngsters is barley It is a good old grain with so many health benefits like weight reduction, decreasing blood pressure, blood cholesterol, blood glucose in Type 2 diabetes and preventing colon cancer. It is easily available and cheap grain. It contains both soluble and insoluble fiber, protein, vitamins B and E, minerals selenium, magnesium and iron, copper, flavonoids and anthocynins. Barley contains soluble fiber, beta glucan binds to bile acids in the intestines and thereby decreasing plasma cholesterol levels. Absorbed soluble fiber decreases cholesterol synthesis by liver and cleansing blood vessels. Insoluble fiber provides bulkiness in the intestines, thereby satiety. decreased appetite. It promotes intestinal movements relieving constipation, cleansing colonic harmful bacteria and reduced incidence of colonic cancer. It is a good source of niacin ,reducing LDL levels and increasing HDL levels. Selenium and vitamin E providing beneficial antioxidant effects. Magnesium, a cofactor for many carbohydrate metabolism enzymes and high fiber content contributes for its blood glucose reducing effect in Type 2 diabetes. It is having good diuretic activity and is useful in urinary tract infections. Barley contains gluten, contraindicated in celiac disease.

  10. Involvement of Alternative Splicing in Barley Seed Germination.

    Science.gov (United States)

    Zhang, Qisen; Zhang, Xiaoqi; Wang, Songbo; Tan, Cong; Zhou, Gaofeng; Li, Chengdao

    2016-01-01

    Seed germination activates many new biological processes including DNA, membrane and mitochondrial repairs and requires active protein synthesis and sufficient energy supply. Alternative splicing (AS) regulates many cellular processes including cell differentiation and environmental adaptations. However, limited information is available on the regulation of seed germination at post-transcriptional levels. We have conducted RNA-sequencing experiments to dissect AS events in barley seed germination. We identified between 552 and 669 common AS transcripts in germinating barley embryos from four barley varieties (Hordeum vulgare L. Bass, Baudin, Harrington and Stirling). Alternative 3' splicing (34%-45%), intron retention (32%-34%) and alternative 5' splicing (16%-21%) were three major AS events in germinating embryos. The AS transcripts were predominantly mapped onto ribosome, RNA transport machineries, spliceosome, plant hormone signal transduction, glycolysis, sugar and carbon metabolism pathways. Transcripts of these genes were also very abundant in the early stage of seed germination. Correlation analysis of gene expression showed that AS hormone responsive transcripts could also be co-expressed with genes responsible for protein biosynthesis and sugar metabolisms. Our RNA-sequencing data revealed that AS could play important roles in barley seed germination.

  11. Mla- and Rom1-mediated control of microRNA398 and chloroplast copper/zinc superoxide dismutase regulates cell death in response to the barley powdery mildew fungus

    Science.gov (United States)

    Barley Mla (Mildew resistance locus a) confers allele-specific interactions with natural variants of the ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh), causal agent of powdery mildew disease. Significant reprogramming of host gene expression occurs upon infection by this obligate biotrop...

  12. Barley Transformation Using Biolistic Techniques

    Science.gov (United States)

    Harwood, Wendy A.; Smedley, Mark A.

    Microprojectile bombardment or biolistic techniques have been widely used for cereal transformation. These methods rely on the acceleration of gold particles, coated with plasmid DNA, into plant cells as a method of directly introducing the DNA. The first report of the generation of fertile, transgenic barley plants used biolistic techniques. However, more recently Agrobacterium-mediated transformation has been adopted as the method of choice for most cereals including barley. Biolistic procedures are still important for some barley transformation applications and also provide transient test systems for the rapid checking of constructs. This chapter describes methods for the transformation of barley using biolistic procedures and also highlights the use of the technology in transient assays.

  13. Functional proteomics of barley and barley chloroplasts – strategies, methods and perspectives

    DEFF Research Database (Denmark)

    Petersen, Jørgen; Rogowska-Wrzesinska, Adelina; Jensen, Ole Nørregaard

    2013-01-01

    tolerance, micronutrient utilization, and photosynthesis in barley. In the present review we present the current state of proteomics research for investigations of barley chloroplasts, i.e., the organelle that contain the photosynthetic apparatus in the plant. We describe several different proteomics...... strategies and discuss their applications in characterization of the barley chloroplast as well as future perspectives for functional proteomics in barley research....

  14. Characterization of Gibberellin Receptor Mutants of Barley (Hordeum vulgare L.)

    Institute of Scientific and Technical Information of China (English)

    Peter M.Chandler; Carol A.Harding; Anthony R.Ashton; Mark D.Mulcair; Nicholas E.Dixon; Lewis N.Mander

    2008-01-01

    The sequence of Gidl (a gene for a gibberellin (GA) receptor from rice) was used to identify a putative orthoIogue from barley.This was expressed in E.coil,and produced a protein that was able to bind GA in vitro with both structural specificity and saturability.Its potential role in GA responses was investigated using barley mutants with reduced GA sensitivity (gsel mutants).Sixteen different gsel mutants each carried a unique nucleotide substitution in this sequence.In all but one case,these changes resulted in single amino acid substitutions,and,for the remaining mutant,a substitution in the 5' untranslated region of the mRNA is proposed to interfere with translation initiation.There was perfect linkage in segregating populations between new mutant alleles and the gsel phenotype,leading to the conclusion that the putative GID1 GA receptor sequence in barley corresponds to the Gsel locus.Determination of endogenous GA contents in one of the mutants revealed enhanced accumulation of bioactive GA1,and a deficit of C20 GA precursors.All of the gsel mutants had reduced sensitivity to exogenous GA3,and to AC94377 (a GA analogue) at concentrations that are normally 'saturating',but,at much higher concentrations,there was often a considerable response.The comparison between barley and rice mutants reveals interesting differences between these two cereal species in GA hormonal physiology.

  15. Direct selection of expressed sequences on a YAC clone revealed proline-rich-like genes and BARE-1 sequences physically linked to the complex ¤Mla¤ powdery mildew resistance locus of barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Schwarz, G.; Michalek, W.; Jahoor, A.

    2002-01-01

    homology to the copia-like retroelement BA REI of barley, putatively involved in evolution of disease resistance loci. The high degree of clones representing barley rRNA sequences or false positives is a major disadvantage of direct selection of cDNAs in barley. (C) 2002 Elsevier Science Ireland Ltd. All...

  16. Alanine aminotransferase controls seed dormancy in barley

    Science.gov (United States)

    Sato, Kazuhiro; Yamane, Miki; Yamaji, Nami; Kanamori, Hiroyuki; Tagiri, Akemi; Schwerdt, Julian G.; Fincher, Geoffrey B.; Matsumoto, Takashi; Takeda, Kazuyoshi; Komatsuda, Takao

    2016-01-01

    Dormancy allows wild barley grains to survive dry summers in the Near East. After domestication, barley was selected for shorter dormancy periods. Here we isolate the major seed dormancy gene qsd1 from wild barley, which encodes an alanine aminotransferase (AlaAT). The seed dormancy gene is expressed specifically in the embryo. The AlaAT isoenzymes encoded by the long and short dormancy alleles differ in a single amino acid residue. The reduced dormancy allele Qsd1 evolved from barleys that were first domesticated in the southern Levant and had the long dormancy qsd1 allele that can be traced back to wild barleys. The reduced dormancy mutation likely contributed to the enhanced performance of barley in industrial applications such as beer and whisky production, which involve controlled germination. In contrast, the long dormancy allele might be used to control pre-harvest sprouting in higher rainfall areas to enhance global adaptation of barley. PMID:27188711

  17. Resistance to Barley Leaf Stripe

    DEFF Research Database (Denmark)

    Nørgaard Knudsen, J. C.

    1986-01-01

    Ten barley [Hordeum vulgare] genotypes were inoculated with twelve isolates of Pyrenophora graminea of diverse European and North African origin. Race specific resistance occurred. Four, possibly five, genetically different sources of race-specific resistance were found, three of them occurring i...

  18. Transcriptomics analysis of hulless barley during grain development with a focus on starch biosynthesis.

    Science.gov (United States)

    Tang, Yawei; Zeng, Xingquan; Wang, Yulin; Bai, Lijun; Xu, Qijun; Wei, Zexiu; Yuan, Hongjun; Nyima, Tashi

    2017-01-01

    Hulless barley, with its unique nutritional value and potential health benefits, has increasingly attracted attentions in recent years. However, the transcription dynamics during hulless barley grain development is not well understood. In the present study, we investigated the transcriptome changes during barley grain development using Illumina paired-end RNA-sequencing. Two datasets of the developing grain transcriptomes from two barley landraces with the differential seed starch synthesis traits were generated, and comparative transcriptome approach in both genotypes was performed. The results showed that 38 differentially expressed genes (DEGs) were found co-modulated in both genotypes during the barley grain development. Of those, the proteins encoded by most of those DGEs were found, such as alpha-amylase-related proteins, lipid-transfer protein, homeodomain leucine zipper (HD-Zip), NUCLEAR FACTOR-Y, subunit B (NF-YBs), as well as MYB transcription factors. More interestingly, two genes Hvulgare_GLEAN_10012370 and Hvulgare_GLEAN_10021199 encoding SuSy, AGPase (Hvulgare_GLEAN_10033640 and Hvulgare_GLEAN_10056301), as well as SBE2b (Hvulgare_GLEAN_10018352) were found to significantly contribute to the regulatory mechanism during grain development in both genotypes. Moreover, six co-expression modules associated with specific biological processes or pathways (M1 to M6) were identified by consensus co-expression network. Significantly enriched pathways of those module genes showed difference in both genotypes. These results will expand our understanding of the complex molecular mechanism of starch synthesis during barley grain development.

  19. Identification and Expression Analysis of the Barley (Hordeum vulgare L. Aquaporin Gene Family.

    Directory of Open Access Journals (Sweden)

    Runyararo M Hove

    Full Text Available Aquaporins (AQPs are major intrinsic proteins (MIPs that mediate bidirectional flux of water and other substrates across cell membranes, and play critical roles in plant-water relations, dehydration stress responses and crop productivity. However, limited data are available as yet on the contributions of these proteins to the physiology of the major crop barley (Hordeum vulgare. The present work reports the identification and expression analysis of the barley MIP family. A comprehensive search of publicly available leaf mRNA-seq data, draft barley genome data, GenBank transcripts and sixteen new annotations together revealed that the barley MIP family is comprised of at least forty AQPs. Alternative splicing events were likely in two plasma membrane intrinsic protein (PIP AQPs. Analyses of the AQP signature sequences and specificity determining positions indicated a potential of several putative AQP isoforms to transport non-aqua substrates including physiological important substrates, and respond to abiotic stresses. Analysis of our publicly available leaf mRNA-seq data identified notable differential expression of HvPIP1;2 and HvTIP4;1 under salt stress. Analyses of other gene expression resources also confirmed isoform-specific responses in different tissues and/or in response to salinity, as well as some potentially inter-cultivar differences. The work reports systematic and comprehensive analysis of most, if not all, barley AQP genes, their sequences, expression patterns in different tissues, potential transport and stress response functions, and a strong framework for selection and/or development of stress tolerant barley varieties. In addition, the barley data would be highly valuable for genetic studies of the evolutionarily closely related wheat (Triticum aestivum L..

  20. Spatial and temporal regulation of DNA fragmentation in the aleurone of germinating barley

    NARCIS (Netherlands)

    Wang, M.; Oppedijk, B.J.; Caspers, M.P.M.; Lamers, G.E.M.; Boot, M.J.; Geerlings, D.N.G.; Bakhuizen, B.; Meijer, A.H.; Duijn, B. van

    1998-01-01

    During germination of barley grains, the appearance of DNA fragmentation started in aleurone cells near the embryo and extended to the distal end in a time-dependent manner. DNA fragmentation was demonstrated to occur only after the expression of α-amylase mRNA in the aleurone layer. In addition, ce

  1. Cisgenic barley for animal feed

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik

    2011-01-01

    Service and Sejet Plant Breeding based on the Cisgenesis concept. Cisgenesis implies that the plants are transformed only with its own or very closely related genetic material and that the final Cisgenic plants have to be free of any foreign genes. The Cisgenesis concept allows for the introduction...... of extra gene copies of a particular gene whereby a particular trait can be accentuated. Transgenic crops generated by the Cisgenesis concept are accordingly very similar to those generated by conventional breeding. In our part of the project we are focusing on barley phytases as candidate genes...... using a genomic barley lambda library. The clone has been inserted into a Cisgenic Agrobacterium vector where both the gene of interest and the selection gene are flanked by their own T-DNA borders in order to promote integration of the two genes at unlinked places in the plant genome. T0-plants show...

  2. Organization and expression of two tandemly oriented genes encoding ribulosebisphosphate carboxylase/oxygenase activase in barley.

    Science.gov (United States)

    Rundle, S J; Zielinski, R E

    1991-03-15

    We have isolated and structurally characterized genomic DNA and cDNA sequences encoding ribulose-1,5-bisphosphate carboxylase/oxygenase (Rbu-P2 carboxylase) activase from barley (Hordeum vulgare L.). Three Rbu-P2 carboxylase activase (Rca) polypeptides are encoded in the barley genome by two closely linked, tandemly oriented nuclear genes (RcaA and RcaB); cDNAs encoding each of the three Rbu-P2 carboxylase activase polypeptides were isolated from cDNA libraries of barley leaf mRNA. RcaA produces two mRNAs, which encode polypeptides of 42 and 46 kDa, by an alternative splicing mechanism identical to that previously reported for spinach and Arabidopsis Rca genes (Werneke, J.M., Chatfield, J.M., and Ogren, W. L. (1989) Plant Cell 1, 815-825). RcaB is transcribed to produce a single mRNA, which encodes a mature peptide of 42 kDa. Genomic Southern blots indicate that RcaA and RcaB represent the entire Rbu-P2 carboxylase activase gene family in barley. The genes share 80% nucleotide sequence identity, and the 42-kDa polypeptides encoded by RcaA and RcaB share 87% amino acid sequence identity. Coding regions of the two barley Rca genes are separated by 1 kilobase pair of flanking DNA. DNA sequence motifs similar to those thought to control light-regulated gene expression in other nuclear-encoded plastid polypeptide genes are found at the 5' end of both barley Rca genes. Probes specific to three mRNAs were used to determine the relative contribution each species makes to the total Rca mRNA pool.

  3. Response of barley aleurone layers to abscisic acid

    Energy Technology Data Exchange (ETDEWEB)

    Ho, D.T.H.; Varner, J.E.

    1976-02-01

    Cordycepin, an inhibitor of RNA synthesis in barley (Hordeum vulgare L.) aleurone cells, does not inhibit the gibberellic acid-enhanced ..cap alpha..-amylase (EC 3.2.1.1.) synthesis in barley aleurone layers if it is added 12 hours or more after the addition of the hormone. However, the accumulation of ..cap alpha..-amylase activity after 12 hours of gibberellic acid can be decreased by abscisic acid. The accumulation of ..cap alpha..-amylase activity is sustained or quickly restored when cordycepin is added simultaneously or some time after abscisic acid, indicating that the response of aleurone layers to abscisic acid depends on the continuous synthesis of a short lived RNA. By analysis of the newly synthesized proteins by gel electrophoresis with sodium dodecylsulfate, it was observed that the synthesis of ..cap alpha..-amylase is decreased in the presence of abscisic acid while the synthesis of most of the other proteins remains unchanged. From the rate of resumption of ..cap alpha..-amylase production in the presence of cordycepin and abscisic acid, it appears that abscisic acid does not have a measurable effect on the stability of ..cap alpha..-amylase mRNA.

  4. Molecular analysis of Korean isolate of barley yellow mosaic virus.

    Science.gov (United States)

    Lee, Kui Jae; Choi, Min Kyung; Lee, Wang Hyu; Rajkumar, Mani

    2006-04-01

    The complete sequences of both RNAs of an isolate of barley yellow mosaic virus (BaYMV) from Haenam, Korea, were determined. RNA1 is 7639 nucleotides long [excluding the 3'-poly(A)], and codes for a 270 kDa polyprotein of 2411 amino acids which contains the capsid protein (CP) at the C terminus and seven putative non-structural proteins. RNA2 is 3582 nucleotides long and codes for a polyprotein of 890 amino acids, which contains a 28 kDa putative proteinase (P1) and a 73 kDa polypeptide (P2). The whole sequences of Korean isolate (BaYMV-K) closely resembled those of an isolate from Japan (BaYMV-J) (99.6 identical nucleotides for RNA1; 99.4 for RNA2) and china (BaYMV-C) (96.7 and 96.2%, respectively) than from Germany (BaYMV-G) (93.6 and 90.4%, respectively). The greatest differences between the BaYMV-K and BaYMV-J isolates were in the 3'-NCRs of RNA1 and 5' NCRs of RNA2 and there were also some other regions of difference in Nib Pro (RNA1) and P1 (RNA2). Further, the phylogenetic analysis of CP region showed that Asian and European isolates formed distinct clusters. However, molecular variations between isolates could not be linked to earlier results showing differences in cultivar response.

  5. Molecular characterization of two lipoxygenases from barley

    NARCIS (Netherlands)

    Mechelen, J.R. van; Schuurink, R.C.; Smits, M.; Graner, A.; Douma, A.C.; Sedee, N.J.A.; Schmitt, N.F.; Valk, B.E.

    1999-01-01

    Two full-length lipoxygenase cDNA sequences (LoxB and LoxC) from barley (Hordeum distichum cv. L. Triumph) are described. The cDNAs share high homology with the barley LoxA cDNA. Southern blotting experiments indicate single copy numbers of the three lipoxygenase genes. RFLP mapping revealed the pre

  6. Issues surrounding health claims for barley.

    Science.gov (United States)

    Ames, Nancy P; Rhymer, Camille R

    2008-06-01

    Government-approved health claims support dietary intervention as a safe and practical approach to improving consumer health and provide industry with regulatory guidelines for food product labels. Claims already allowed in the United States, United Kingdom, Sweden, and The Netherlands for reducing cholesterol through consumption of oat or barley soluble fiber provide a basis for review, but each country may have different criteria for assessing clinical evidence for a physiological effect. For example, the FDA-approved barley health claim was based on a petition that included 39 animal model studies and 11 human clinical trials. Since then, more studies have been published, but with few exceptions, clinical data continue to demonstrate that the consumption of barley products is effective for lowering total and LDL cholesterol. More research is needed to fully understand the mechanism of cholesterol reduction and the role of beta-glucan molecular weight, viscosity, and solubility. In an assessment of the physiological efficacy of a dietary intervention, consideration should also be given to the potential impact of physical and thermal food-processing treatments and genotypic variation in the barley source. New barley cultivars have been generated specifically for food use, possessing increased beta-glucan, desirable starch composition profiles, and improved milling/processing traits. These advances in barley production, coupled with the establishment of a government-regulated health claim for barley beta-glucan, will stimulate new processing opportunities for barley foods and provide consumers with reliable, healthy food choices.

  7. Induction of beta-1,3-glucanase in barley in response to infection by fungal pathogens.

    Science.gov (United States)

    Jutidamrongphan, W; Andersen, J B; Mackinnon, G; Manners, J M; Simpson, R S; Scott, K J

    1991-05-01

    The sequence of a partial cDNA clone corresponding to an mRNA induced in leaves of barley (Hordeum vulgare) by infection with fungal pathogens matched almost perfectly with that of a cDNA clone coding for beta-1,-3-glucanase isolated from the scutellum of barley. Western blot analysis of intercellular proteins from near-isogenic barley lines inoculated with the powdery mildew fungus (Erysiphe graminis f. sp. hordei) showed a strong induction of glucanase in all inoculated lines but was most pronounced in two resistant lines. These data were confirmed by beta-1,3-glucanase assays. The barley cDNA was used as a hybridization probe to detect mRNAs in barley, wheat (Triticum aestivum), rice (oryza sativus), and sorghum (Sorghum bicolor), which are induced by infection with the necrotrophic pathogen Bipolaris sorokiniana. These results demonstrate that activation of beta-1,3-glucanase genes may be a general response of cereals to infection by fungal pathogens.

  8. Calcium homeostasis in barley aleurone

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.L.

    1990-02-21

    Under the auspices of the Department of Energy we investigated calcium homeostasis in aleurone cells of barley. This investigation was initiated to explore the role played by extracellular Ca{sup 2+} in gibberellic acid (GA)-induced synthesis and secretion of hydrolases in the aleurone layer. We have focused our attention on four topics that relate to the role of Ca{sup 2+} in regulating the synthesis of {alpha}-amylase. First, we determined the stoichiometry of Ca{sup 2+} binding to the two principal classes of barley {alpha}-amylase and examined some of the biochemical and physical properties of the native and Ca{sup 2+}-depleted forms of the enzyme. Second, since {alpha}-amylase is a Ca{sup 2+} containing metalloenzyme that binds one atom of Ca{sup 2+} per molecule, we developed methods to determine the concentration of Ca{sup 2+} in the cytosol of the aleurone cell. We developed a technique for introducing Ca{sup 2+}-sensitive dyes into aleurone protoplasts that allows the measurement of Ca{sup 2+} in both cytosol and endoplasmic reticulum (ER). Third, because the results of our Ca{sup 2+} measurements showed higher levels of Ca{sup 2+} in the ER than in the cytosol, we examined Ca{sup 2+} transport into the ER of control and GA-treated aleurone tissue. And fourth, we applied the technique of patch-clamping to the barley aleurone protoplast to examine ion transport at the plasma membrane. Our results with the patch-clamp technique established the presence of K{sup +} channels in the plasma membrane of the aleurone protoplast, and they showed that this cell is ideally suited for the application of this methodology for studying ion transport. 34 refs.

  9. Antidepressant-like effects of young green barley leaf (Hordeum vulgare L. in the mouse forced swimming test

    Directory of Open Access Journals (Sweden)

    Katsunori Yamaura

    2012-01-01

    Full Text Available Background: Young green barley leaf is one of the richest sources of antioxidants and has been widely consumed for health management in Japan. In this study, we examined whether oral administration of young green barley leaf has an antidepressant effect on the forced swimming test in mice. Materials and Methods: Mice were individually forced to swim in an open cylindrical container, one hour after oral administration of young green barley leaf (400 or 1000 mg / kg or imipramine (100 mg / kg. Expression of mRNA for nerve growth factor (NGF, brain-derived neurotrophic factor, and glucocorticoid receptor in the brain was analyzed using real-time quantitative polymerase chain reaction (PCR. Results: There was a significant antidepressant-like effect in the forced swimming test; both 400 and 1000 mg / kg young green barley leaves, as well as the positive control imipramine (100 mg / kg, reduced the immobility duration compared to the vehicle group. The expression of mRNA for NGF detected in the hippocampus immediately after the last swimming test was higher than that in the non-swimming group (Nil. Oral administration of imipramine suppressed this increase to the level of the Nil group. Young green barley leaf (400 and 1000 mg / kg also showed a moderate decrease in the expression of mRNA for NGF, in a dose-dependent manner. Conclusion: Oral administration of young green barley leaf is able to produce an antidepressant-like effect in the forced swimming test. Consequently it is possible that the antidepressant-like effects of the young green barley leaf are, at least in part, mediated by an inhibition of the increase in the hippocampus levels of NGF.

  10. Global Identification of MicroRNAs and Their Targets in Barley under Salinity Stress.

    Science.gov (United States)

    Deng, Pingchuan; Wang, Le; Cui, Licao; Feng, Kewei; Liu, Fuyan; Du, Xianghong; Tong, Wei; Nie, Xiaojun; Ji, Wanquan; Weining, Song

    2015-01-01

    Salinity is a major limiting factor for agricultural production worldwide. A better understanding of the mechanisms of salinity stress response will aid efforts to improve plant salt tolerance. In this study, a combination of small RNA and mRNA degradome sequencing was used to identify salinity responsive-miRNAs and their targets in barley. A total of 152 miRNAs belonging to 126 families were identified, of which 44 were found to be salinity responsive with 30 up-regulated and 25 down-regulated respectively. The majority of the salinity-responsive miRNAs were up-regulated at the 8h time point, while down-regulated at the 3h and 27h time points. The targets of these miRNAs were further detected by degradome sequencing coupled with bioinformatics prediction. Finally, qRT-PCR was used to validate the identified miRNA and their targets. Our study systematically investigated the expression profile of miRNA and their targets in barley during salinity stress phase, which can contribute to understanding how miRNAs respond to salinity stress in barley and other cereal crops.

  11. Transcriptional Responses to Gibberellin and Abscisic Acid in Barley Aleurone

    Institute of Scientific and Technical Information of China (English)

    Kegui Chen; Yong-Qiang Charles An

    2006-01-01

    Cereal aleurone has been established as a model system to investigate giberrellin (GA) and abscisic acid (ABA) responses. Using Barley 1 GeneChip, we examined the mRNA accumulation of over 22 000 genes in de-embryonated barley aleurone treated with GA and ABA. We observed that 1328 genes had more than a threefold change in response to GA treatment, whereas 206 genes had a more than threefold change in response to ABA treatment. Interestingly, approximately 2.5-fold more genes were up-regulated than downregulated by ABA. Eighty-three genes were differentially regulated by both GA and ABA. Most of the genes were subject to antagonistic regulation by ABA and GA, particularly for genes related to seed maturation and germination, such as genes encoding late embryogenesis abundant proteins and storage mobilization enzymes. This supports the antagonistic roles of GA and ABA in seed maturation and seed germination.Interestingly, we observed that a significant percentage of the genes were coordinately regulated by both GA and ABA. Some GA-responsive genes encoded proteins involved in ethylene, jasmonate, brassinosteroid and auxin metabolic and signaling transduction pathways, suggesting their potential interaction with the GA response. We also identified a group of transcription factor genes, such as MYB and Homeobox genes, that were differentially regulated by GA. In addition, a number of GA- and/or ABA-responsive genes encoded components potentially involved in GA and ABA signal transduction pathway. Overall, the present study provides a comprehensive and global view of transcript expression accompanying the GA and ABA response in barley aleurone and identifies a group of genes with potential regulatory functions in GA- and ABA-signaling pathways for future functional validation.

  12. MicroRNA Delivery for Regenerative Medicine

    OpenAIRE

    Peng, Bo; Chen, Yongming; Leong, Kam W.

    2015-01-01

    MicroRNA (miRNA) directs post-transcriptional regulation of a network of genes by targeting mRNA. Although relatively recent in development, many miRNAs direct differentiation of various stem cells including induced pluripotent stem cells (iPSCs), a major player in regenerative medicine. An effective and safe delivery of miRNA holds the key to translating miRNA technologies. Both viral and nonviral delivery systems have seen success in miRNA delivery, and each approach possesses advantages an...

  13. 2015 nationwide survey revealed Barley stripe mosaic virus in Korean barley fields

    Science.gov (United States)

    A seed-transmitted virus has consistently caused significant economic damage to barley crops in Korea in recent years, and may be increasing because many farmers save seed for replanting. Because some barley seed is imported, there is the potential for introduction of new seed-transmitted viruses, c...

  14. Functional Analysis of Barley Powdery Mildew Effector Candidates and Identification of their Barley Targets

    DEFF Research Database (Denmark)

    Ahmed, Ali Abdurehim

    The genome of barley powdery mildew fungus (Blumeria graminis f. sp. hordei, Bgh) encodes around 500 Candidate Secreted Effector Proteins (CSEPs), which are believed to be delivered to the barley cells either to interfere with plant defence and/or promote nutrient uptake. So far, little is known...

  15. Structure and function of the bacterial root microbiota in wild and domesticated barley.

    Science.gov (United States)

    Bulgarelli, Davide; Garrido-Oter, Ruben; Münch, Philipp C; Weiman, Aaron; Dröge, Johannes; Pan, Yao; McHardy, Alice C; Schulze-Lefert, Paul

    2015-03-11

    The microbial communities inhabiting the root interior of healthy plants, as well as the rhizosphere, which consists of soil particles firmly attached to roots, engage in symbiotic associations with their host. To investigate the structural and functional diversification among these communities, we employed a combination of 16S rRNA gene profiling and shotgun metagenome analysis of the microbiota associated with wild and domesticated accessions of barley (Hordeum vulgare). Bacterial families Comamonadaceae, Flavobacteriaceae, and Rhizobiaceae dominate the barley root-enriched microbiota. Host genotype has a small, but significant, effect on the diversity of root-associated bacterial communities, possibly representing a footprint of barley domestication. Traits related to pathogenesis, secretion, phage interactions, and nutrient mobilization are enriched in the barley root-associated microbiota. Strikingly, protein families assigned to these same traits showed evidence of positive selection. Our results indicate that the combined action of microbe-microbe and host-microbe interactions drives microbiota differentiation at the root-soil interface.

  16. Identification of Mild Freezing Shock Response Pathways in Barley Based on Transcriptome Profiling.

    Science.gov (United States)

    Wang, Xiaolei; Wu, Dezhi; Yang, Qian; Zeng, Jianbin; Jin, Gulei; Chen, Zhong-Hua; Zhang, Guoping; Dai, Fei

    2016-01-01

    Low temperature is a major abiotic stress affecting crop growth and productivity. A better understanding of low temperature tolerance mechanisms is imperative for developing the crop cultivars with improved tolerance. We herein performed an Illumina RNA-sequencing experiment using two barley genotypes differing in freezing tolerance (Nure, tolerant and Tremois, sensitive), to determine the transcriptome profiling and genotypic difference under mild freezing shock treatment after a very short acclimation for gene induction. A total of 6474 differentially expressed genes, almost evenly distributed on the seven chromosomes, were identified. The key DEGs could be classified into six signaling pathways, i.e., Ca(2+) signaling, PtdOH signaling, CBFs pathway, ABA pathway, jasmonate pathway, and amylohydrolysis pathway. Expression values of DEGs in multiple signaling pathways were analyzed and a hypothetical model of mild freezing shock tolerance mechanism was proposed. Expression and sequence profile of HvCBFs cluster within Frost resistance-H2, a major quantitative trait locus on 5H being closely related to low temperature tolerance in barley, were further illustrated, considering the crucial role of HvCBFs on freezing tolerance. It may be concluded that multiple signaling pathways are activated in concert when barley is exposed to mild freezing shock. The pathway network we presented may provide a platform for further exploring the functions of genes involved in low temperature tolerance in barley.

  17. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    DEFF Research Database (Denmark)

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren;

    2001-01-01

    Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When result...

  18. Triple Hybridization with Cultivated Barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Bothmer, R. von; Claesson, L.; Flink, J.;

    1989-01-01

    represented species closely or distantly related to H. jubatum and H. lechleri. In trispecific crosses with diploid barley, the seed set was 5.7%. Crosses with tetraploid barley were highly unsuccessful (0.2% seed set). Three lines of diploid barley were used in the crosses, i.e. 'Gull', 'Golden Promise...

  19. MS Based Imaging of Barley Seed Development

    Institute of Scientific and Technical Information of China (English)

    Manuela Peukert; Andrea Matros; Hans-Peter Mock

    2012-01-01

    Spatially resolved analysis of metabolites and proteins is essential to model compartmentalized cellular processes in plants.Within recent years,tremendous progress has been made in MS based imaging (MSI) techniques,mostly MALDI MSI.The technology has been pioneered and is now widely applied in medicinal and pharmacological studies,and in recent years found its way into plant science (Kaspar et al.,2011; Peukert etal.,2012).We are interested in the elucidation of spatially resolved metabolic networks related to barley grain development.An understanding of developmentally and ecologically regulated processes affecting agronomical traits such as final grain weight,seed quality and stress tolerance is of outmost importance,as barley provides one of the staple foods.Barley also serves as a model plant for other cereals such as wheat.The presentation will introduce an untargeted MALDI MSI approach to the analysis of me-tabolite patterns during barley grain development.We analyzed longitudinal and cross sections from developing barley grains (3,7,10 and 14 days after pollination).In the presentation we will address spatial resolution,sensitivity and identification of unknown compounds will also be discussed.A major task is to connect the metabolite patterns to distinct cellular and physiological events.As an example,particular metabolite distributions indicative for nutrient transport into the developing endosperm will be shown.

  20. Evaluation of Barley as Human Food

    Directory of Open Access Journals (Sweden)

    Mehmet Köten

    2013-12-01

    Full Text Available Barley, as animal feed, raw material for malting and human food, constitute an important part among cereal sources in the world. Majority of barley that produced both in Turkey and other countries of the world, is being used as animal feed. Poor baking quality, taste and appearance of barley restricted its use in human nutrition. However, recently high protein, fiber, especially β-glucan and high starch content appeal to food industry. Many scientific researches established that β-glucan, a soluble fiber, has an effect in healing coronary-hearth diseases, lowering blood cholesterol level, balancing blood sugar level, preventing obesity. Being a healthy cereal that can be used in various purposes, and an additive in many food products, barley is considered a very promising cereal, and research to increase possibilities of its use in human nutrition is being increased. In the literature, there has been researches on making noodles, bulgur, kavut (roasted cereal, breakfast cereals. In this study the researches relating to evaluation of barley, importance of which is increased every day, as human food was reviewed.

  1. Immigration of the barley mildew pathogen into field plots of barley

    DEFF Research Database (Denmark)

    O'Hara, R.B.; Brown, J.K.M.

    1996-01-01

    Immigration of the barley powdery mildew pathogen (Erysiphe graminis f.sp. hordei) into field plots of the spring barley variety Tyra (carrying the resistance allele Mla1) was investigated. Spores were trapped from the top of the plot canopies, as well as from control plots of wheat with no barley...... nearby. Comparison of the frequencies of virulent and avirulent single-colony isolates showed that the amount of immigration, relative to the amount of inoculum being produced within the plot, reduced very rapidly, until it could not be detected in the middle of the growing season (mid-June)....

  2. Barley seed proteomics from spots to structures

    DEFF Research Database (Denmark)

    Finnie, Christine; Svensson, Birte

    2009-01-01

    with information from rice and other cereals facilitate identification of barley proteins. Several hundred barley seed proteins are identified and lower abundance proteins including membrane proteins are now being analysed. In the present review we focus on variation in protein profiles of seed tissues during...... forms on 2D-gels. Specific protein families, including peroxidases and alpha-amylases have been subjected to in-depth analysis resulting in characterisation of different isozymes, post-translational. modifications and processing. A functional proteomics study focusing on the seed thioredoxin system has...

  3. Application of proteomics to investigate barley-Fusarium graminearum interaction

    DEFF Research Database (Denmark)

    Yang, Fen

    , the molecular mechanisms of barley defense to Fusarium graminearum at the early infection stage were studied. Antibodies against barley β-amylases were shown to be the markers for infection at proteome level and for selection of the time for proteome analysis before extensive degradation caused by the fungus...... proteases which could be responsible for proteolysis of β-amylases in the infected barley. In Chapter 4, the in vitro secretome of F. graminearum on the 2-D gels in the presence of substrates of barley or wheat grain was studied. Totally 69 unique fungal proteins identified were mainly cell....... In addition, sharper increase in fungal biomass was observed in barley than in wheat and fungal induced proteolytic fragments of - amylases were only observed in barley not in wheat. Furthermore, a barley PR17 protein and a fungal hypothetical protein were expressed in E. coli and purified in Chapter 5...

  4. Adaptation of barley to harsh Mediterranean environments.

    NARCIS (Netherlands)

    Oosterom, van E.

    1993-01-01

    Research ObjectivesBarley is in Syria the dominant crop in areas receiving less than 300 mm annual precipitation. Grain yield is often below 1 ton ha -1, and is reduced by low temperatures in winter and terminal drought stress in spring. Variation i

  5. Endoproteolytic activity assay in malting barley

    Directory of Open Access Journals (Sweden)

    Blanca Gómez Guerrero

    2013-12-01

    Full Text Available Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four classes of endo-proteases have been described: serine-proteases, cysteine-proteases, aspartic-proteases and metallo-proteases. The objective of this work was to develop a rapid and colorimetric enzymatic assay to determine the endo-proteolytic activity of the four endo-protease classes using two different substrates: azo-gelatin and azo-casein. Optimum conditions for the assays such as: pH,reaction time and temperature and absorbance scale were determined. Azo-gelatin presented several difficulties in standardizing an “in solution” assay. On the other hand, azo-casein allowed standardization of the assay for the four enzyme classes to produce consistent results. The endo-proteoteolytic method developed was applied to determine the endo-protease activity in barley, malt and wort.

  6. The barley Jip23b gene

    DEFF Research Database (Denmark)

    Müller-Uri, Frieder; Cameron-Mills, Verena; Mundy, John

    2002-01-01

    The barley gene (Jip23) encoding a 23,000-Da protein of unknown function was isolated and shown to be induced by jasmonate methyl ester (MeJA) in leaves. 5'upstream Jip23 sequence was isolated and fused to the beta-glucuronidase gene (GUS), and this reporter was introduced by particle bombardment...

  7. Abscisic acid effects on activity and expression of barley (Hordeum vulgare) plastidial glucose-6-phosphate dehydrogenase.

    Science.gov (United States)

    Cardi, Manuela; Chibani, Kamel; Cafasso, Donata; Rouhier, Nicolas; Jacquot, Jean-Pierre; Esposito, Sergio

    2011-07-01

    Total glucose-6-phosphate dehydrogenase (G6PDH) activity, protein abundance, and transcript levels of G6PDH isoforms were measured in response to exogenous abscisic acid (ABA) supply to barley (Hordeum vulgare cv Nure) hydroponic culture. Total G6PDH activity increased by 50% in roots treated for 12 h with exogenous 0.1 mM ABA. In roots, a considerable increase (35%) in plastidial P2-G6PDH transcript levels was observed during the first 3 h of ABA treatment. Similar protein variations were observed in immunoblotting analyses. In leaves, a 2-fold increase in total G6PDH activity was observed after ABA treatment, probably related to an increase in the mRNA level (increased by 50%) and amount of protein (increased by 85%) of P2-G6PDH. Together these results suggest that the plastidial P2-isoform plays an important role in ABA-treated barley plants.

  8. Differential Synthesis in Vitro of Barley Aleurone and Starchy Endosperm Proteins

    DEFF Research Database (Denmark)

    Mundy, John; Hejgaard, Jørn; Hansen, Annette

    1986-01-01

    RNAs from isolated endosperm and aleurone tissues (developing and mature grain) and from cultured (germinating) aleurone layers treated with abscisic acid (ABA) and GA(3). B and C hordein polypeptides and the salt-soluble proteins beta-amylase, protein Z, protein C, the chymotrypsin inhibitors (CI-1 and 2......To widen the selection of proteins for gene expression studies in barley seeds, experiments were performed to identify proteins whose synthesis is differentially regulated in developing and germinating seed tissues. The in vitro synthesis of nine distinct barley proteins was compared using m......, expression of genes encoding ASI, PSI, protein C, and PAPI is tissue and stage-specific during seed development. Only ASI, CI-1, and PAPI were synthesized in significant amounts with mRNA from cultured aleurone layers. The levels of synthesis of PAPI and CI-1 were independent of hormone treatment...

  9. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

    1991-01-01

    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C......-terminal amino acid residues of mature BP 1. The clone pcR7 encodes an additional C-terminal sequence of 22 residues, which apparently are removed during processing. BP 1 is less than 50% identical to other sequenced plant peroxidases. Analyses of RNA and protein from aleurone, endosperm and embryo tissue showed...

  10. Heat Stress Affects Pi-related Genes Expression and Inorganic Phosphate Deposition/Accumulation in Barley

    DEFF Research Database (Denmark)

    Pacak, Andrzej; Barciszewska-Pacak, Maria; Swida-Barteczka, Aleksandra;

    2016-01-01

    of heat stress, Pi accumulated in barley shoots but not in the roots, and transcriptomic data analysis as well as RT-qPCR led us to propose an explanation for this phenomenon. Pi transport inhibition from soil to roots is balanced by lower Pi efflux from roots to shoots directed by the PHO1 transporter....... In shoots, the PHO2 mRNA level is decreased, leading to an increased Pi level. We concluded that Pi homeostasis in barley during heat stress is maintained by dynamic changes in Pi-related genes expression....... accumulation in shoots. In contrast, the pho1 mutant shows a decreased level of Pi concentration in shoots. Finally, Pi starvation leads to decreased Pi concentration in all plant tissues. Little is known about plant Pi homeostasis in other abiotic stress conditions. We found that, during the first hour...

  11. Transgenic barley: a prospective tool for biotechnology and agriculture.

    Science.gov (United States)

    Mrízová, Katarína; Holasková, Edita; Öz, M Tufan; Jiskrová, Eva; Frébort, Ivo; Galuszka, Petr

    2014-01-01

    Barley (Hordeum vulgare L.) is one of the founder crops of agriculture, and today it is the fourth most important cereal grain worldwide. Barley is used as malt in brewing and distilling industry, as an additive for animal feed, and as a component of various food and bread for human consumption. Progress in stable genetic transformation of barley ensures a potential for improvement of its agronomic performance or use of barley in various biotechnological and industrial applications. Recently, barley grain has been successfully used in molecular farming as a promising bioreactor adapted for production of human therapeutic proteins or animal vaccines. In addition to development of reliable transformation technologies, an extensive amount of various barley genetic resources and tools such as sequence data, microarrays, genetic maps, and databases has been generated. Current status on barley transformation technologies including gene transfer techniques, targets, and progeny stabilization, recent trials for improvement of agricultural traits and performance of barley, especially in relation to increased biotic and abiotic stress tolerance, and potential use of barley grain as a protein production platform have been reviewed in this study. Overall, barley represents a promising tool for both agricultural and biotechnological transgenic approaches, and is considered an ancient but rediscovered crop as a model industrial platform for molecular farming.

  12. The role of alpha-glucosidase in germinating barley grains.

    Science.gov (United States)

    Stanley, Duncan; Rejzek, Martin; Naested, Henrik; Smedley, Mark; Otero, Sofía; Fahy, Brendan; Thorpe, Frazer; Nash, Robert J; Harwood, Wendy; Svensson, Birte; Denyer, Kay; Field, Robert A; Smith, Alison M

    2011-02-01

    The importance of α-glucosidase in the endosperm starch metabolism of barley (Hordeum vulgare) seedlings is poorly understood. The enzyme converts maltose to glucose (Glc), but in vitro studies indicate that it can also attack starch granules. To discover its role in vivo, we took complementary chemical-genetic and reverse-genetic approaches. We identified iminosugar inhibitors of a recombinant form of an α-glucosidase previously discovered in barley endosperm (ALPHA-GLUCOSIDASE97 [HvAGL97]), and applied four of them to germinating grains. All four decreased the Glc-to-maltose ratio in the endosperm 10 d after imbibition, implying inhibition of maltase activity. Three of the four inhibitors also reduced starch degradation and seedling growth, but the fourth did not affect these parameters. Inhibition of starch degradation was apparently not due to inhibition of amylases. Inhibition of seedling growth was primarily a direct effect of the inhibitors on roots and coleoptiles rather than an indirect effect of the inhibition of endosperm metabolism. It may reflect inhibition of glycoprotein-processing glucosidases in these organs. In transgenic seedlings carrying an RNA interference silencing cassette for HvAgl97, α-glucosidase activity was reduced by up to 50%. There was a large decrease in the Glc-to-maltose ratio in these lines but no effect on starch degradation or seedling growth. Our results suggest that the α-glucosidase HvAGL97 is the major endosperm enzyme catalyzing the conversion of maltose to Glc but is not required for starch degradation. However, the effects of three glucosidase inhibitors on starch degradation in the endosperm indicate the existence of unidentified glucosidase(s) required for this process.

  13. Reconstitution of functional eukaryotic ribosomes from Dictyostelium discoideum ribosomal proteins and RNA.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S

    1997-08-08

    40 and 60 S ribosomal subunits have been reconstituted in vitro from purified ribosomal RNA and ribosomal proteins of Dictyostelium discoideum. The functionality of the reconstituted ribosomes was demonstrated in in vitro mRNA-directed protein synthesis. The reassembly proceeded well with immature precursors of ribosomal RNA but poorly if at all with mature cytoplasmic RNA species. Reassembly also required a preparation of small nuclear RNA(s), acting as morphopoietic factor(s).

  14. Cloning and characterization of a gibberellin-induced RNase expressed in barley aleurone cells

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, S.W.; Rogers, J.C. (Washington State Univ., Pullman, WA (United States). Inst. of Biological Chemistry)

    1999-04-01

    The authors cloned a cDNA for a gibberellin-induced ribonuclease (RNase) expressed in barley (Hordeum vulgare) aleurone and the gene for a second barley RNase expressed in leaf tissue. The protein encoded by the cDNA is unique among RNases described to date in that it contains a novel 23-amino acid insert between the C2 and C3 conserved sequences. Expression of the recombinant protein in tobacco (Ncotiana tabacum) suspension-cultured protoplasts gave an active RNase of the expected size, confirming the enzymatic activity of the protein. Analyses of hormone regulation of re-expression of mRNA for the aleurone RNase revealed that, like the pattern for [alpha]-amylase, mRNA levels increased in the presence of gibberellic acid, and its antagonist abscisic acid prevented this effect. Quantitative studies at early times demonstrated that cycloheximide treatment of aleurone layers increased mRNA levels 4-fold, whereas a combination of gibberellin plus cycloheximide treatment was required to increase [alpha]-amylase mRNA levels to the same extent. These results are consistent with loss of repression as an initial effect of gibberellic acid on transcription of those genes, although the regulatory pathways for the two genes may differ.

  15. Barley grain for ruminants: A global treasure or tragedy

    Directory of Open Access Journals (Sweden)

    Nikkhah Akbar

    2012-07-01

    Full Text Available Abstract Barley grain (Hordeum vulgare L. is characterized by a thick fibrous coat, a high level of ß-glucans and simply-arranged starch granules. World production of barley is about 30 % of that of corn. In comparison with corn, barley has more protein, methionine, lysine, cysteine and tryptophan. For ruminants, barley is the third most readily degradable cereal behind oats and wheat. Due to its more rapid starch fermentation rate compared with corn, barley also provides a more synchronous release of energy and nitrogen, thereby improving microbial nutrient assimilation. As a result, feeding barley can reduce the need for feeding protected protein sources. However, this benefit is only realized if rumen acidity is maintained within an optimal range (e.g., > 5.8 to 6.0; below this range, microbial maintenance requirements and wastage increase. With a low pH, microbial endotoxines cause pro-inflammatory responses that can weaken immunity and shorten animal longevity. Thus, mismanagement in barley processing and feeding may make a tragedy from this treasure or pearl of cereal grains. Steam-rolling of barley may improve feed efficiency and post-rumen starch digestion. However, it is doubtful if such processing can improve milk production and feed intake. Due to the need to process barley less extensively than other cereals (as long as the pericarp is broken, consistent and global standards for feeding and processing barley could be feasibly established. In high-starch diets, barley feeding reduces the need for capacious small intestinal starch assimilation, subsequently reducing hindgut starch use and fecal nutrient loss. With its nutritional exclusivities underlined, barley use will be a factual art that can either matchlessly profit or harm rumen microbes, cattle production, farm economics and the environment.

  16. Agrobacterium-mediated transformation of barley (Hordeum vulgare L.).

    Science.gov (United States)

    Ismagul, Ainur; Mazonka, Iryna; Callegari, Corinne; Eliby, Serik

    2014-01-01

    Barley biotechnology requires efficient genetic engineering tools for producing transgenic plants necessary for conducting reverse genetics analyses in breeding and functional genomics research. Agrobacterium-mediated genetic transformation is an important technique for producing barley transgenics with simple low-copy number transgenes. This chapter reports a refined protocol for the systematic high-throughput transformation of the advanced Australian spring barley breeding line WI4330.

  17. Analysis of Pregerminated Barley Using Hyperspectral Image Analysis

    DEFF Research Database (Denmark)

    Arngren, Morten; Hansen, Per Waaben; Eriksen, Birger

    2011-01-01

    Pregermination is one of many serious degradations to barley when used for malting. A pregerminated barley kernel can under certain conditions not regerminate and is reduced to animal feed of lower quality. Identifying pregermination at an early stage is therefore essential in order to segregate...... the barley kernels into low or high quality. Current standard methods to quantify pregerminated barley include visual approaches, e.g. to identify the root sprout, or using an embryo staining method, which use a time-consuming procedure. We present an approach using a near-infrared (NIR) hyperspectral...

  18. Changes of Limiting Dextrinase in Germinating Process of Malting Barley

    Institute of Scientific and Technical Information of China (English)

    LIANG Xiu-mei; LI Fen; WANG Hong-zhen; WANG Xing-zhi

    2002-01-01

    Based on five different species of barley, the foot layer analytic method was used to examine the activity and heat-resistance of the limiting dextrinase. The study was conducted on the dynamic changes of several types of the dextrinase in barley germinating process, the effect of temperature on the dextrinase and the divergence of dextrinase in different barley variety. The probability of the dextrinase that as reference index is used for screening and evaluating beer barley was discussed. The importance of dextrinase in brewing and its significant function was also discussed.

  19. Cisgenic Barley with Improved Phytase Activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik

    2010-01-01

    based on the cisgenesis concept. In contrast to transgenesis, cisgenesis implies that the plant is transformed only with its own or very closely related genetic material. Furthermore, all “helper” genes and gene sequences of foreign nature are removed from the transformed plant lines. Cisgenic crops...... are accordingly very similar to those generated by conventional breeding. The cisgenesis concept allows for the introduction of extra gene copies of a particular gene to accentuate the trait. We are using a barley purple acid phosphatase expressed during grain filling as candidate gene for cisgenesis. A genomic...... barley lambda library has been used to isolate the genomic clone of this phytase including 2.3 kb of the promoter region and 600 bp of the terminator region. The clone has been inserted into a cisgenic Agrobacterium vector where both the gene of interest and the selection gene are flanked by their own T...

  20. Cisgenic barley with improved phytase activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik

    2012-01-01

    The cisgenesis concept implies that plants are transformed only with their own genetic materials or genetic materials from closely related species capable of sexual hybridization. Furthermore, foreign sequences such as selection genes and vector-backbone sequences should be absent. We used a barley...... phytase gene (HvPAPhy_a) expressed during grain filling to evaluate the cisgenesis concept in barley. The marker gene elimination method was used to obtain marker-free plant lines. Here, the gene of interest and the selection gene are flanked by their own T-DNA borders to allow unlinked integration...... of the two genes. We analysed the transformants for co-transformation efficiency, increased phytase activities in the grain, integration of the kanamycin resistance gene of the vector-backbone and segregation between the HvPAPhy_a insert and the hygromycin resistance gene. The frequencies of the four...

  1. Cisgenic barley with improved phytase activity

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik

    2010-01-01

    based on the cisgenesis concept. In contrast to transgenesis, cisgenesis implies that the plant is transformed only with its own or very closely related genetic material. Furthermore, all “helper” genes and gene sequences of foreign nature are removed from the transformed plant lines. Cisgenic crops...... are accordingly very similar to those generated by conventional breeding. The cisgenesis concept allows for the introduction of extra gene copies of a particular gene to accentuate the trait. We are using a barley purple acid phosphatase expressed during grain filling as candidate gene for cisgenesis. A genomic...... barley lambda library has been used to isolate the genomic clone of this phytase including 2.3 kb of the promoter region and 600 bp of the terminator region. The clone has been inserted into a cisgenic Agrobacterium vector where both the gene of interest and the selection gene are flanked by their own T...

  2. FERTILIZING BREWING BARLEY (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    I. Kádár

    2000-12-01

    Full Text Available Four levels of N, P and K nutrition (poor, moderate, satisfactory and high and all their possible combinations with 64 treatments in two replications (128 plots were studied in a long term field trial on barley yield and malting quality. A standard East-European spring barley "Opal" (bred in Czechoslovakia was grown in 1986, 13th year of the agricultural experiment, involving various crops in previous years, on a calcareous loamy chernozem soil. The optimum fertility levels for yield enhancement resulted in the poorest malting quality: low modification and extract but long saccharification time and high protein. To solve this problem the brewing industry will have to apply the well-known technological methods available since growers are not likely to give up their fertilizers. Applying soil and plant analysis data, having knowledge about both soil and plant optimum values, the danger of the excessive use of fertilizers can be realized and decreased.

  3. Search for endophytic diazotrophs in barley seeds

    Directory of Open Access Journals (Sweden)

    Myriam S. Zawoznik

    2014-06-01

    Full Text Available Eight endophytic isolates assigned to Pseudomonas, Azospirillum, and Bacillus genera according to pheno-genotypic features were retrieved from barley seeds under selective pressure for nitrogen-fixers. Genetic relationships among related isolates were investigated through RAPD. Six isolates displayed nitrogen-fixing ability, while all could biosynthesize indolacetic acid in vitro and showed no antibiosis effects against Azospirillum brasilense Az39, a recognized PGPR.

  4. Search for endophytic diazotrophs in barley seeds.

    Science.gov (United States)

    Zawoznik, Myriam S; Vázquez, Susana C; Díaz Herrera, Silvana M; Groppa, María D

    2014-01-01

    Eight endophytic isolates assigned to Pseudomonas, Azospirillum, and Bacillus genera according to pheno-genotypic features were retrieved from barley seeds under selective pressure for nitrogen-fixers. Genetic relationships among related isolates were investigated through RAPD. Six isolates displayed nitrogen-fixing ability, while all could biosynthesize indolacetic acid in vitro and showed no antibiosis effects against Azospirillum brasilense Az39, a recognized PGPR.

  5. The NAC transcription factors of barley

    DEFF Research Database (Denmark)

    Wagner, Michael; Holm, Preben Bach; Gregersen, Per L.

    2011-01-01

    ). From these data we have identified not only putative regulators of leaf senescence (HvNAC005, HvNAC027 and HvNAC029), but also possible regulators of secondary wall synthesis (HvNAC033, HvNAC034 and HvNAC039), lateral root formation (HvNAC022) and seed development (HvNAC017, HvNAC018, HvNAC019 and Hv...... genes characterized so far have regulatory functions in a broad range of plant developmental processes and tolerances to both biotic and abiotic stresses. This makes the NAC family highly interesting target genes for plant researchers and breeders. As part of a larger project on the identification...... of Hordeum vulgare (barley) leaf senescence regulators, we have attempted to characterize for the first time all presently available barley NAC genes (HvNACs). By searching the NCBI barley EST database using the tBLASTn function, with all known NAC genes from Brachypodium and rice as input, in combination...

  6. Combining unmalted barley and pearling gives good quality brewing

    NARCIS (Netherlands)

    Donkelaar, van Laura H.G.; Hageman, Jos A.; Oguz, Serhat; Noordman, Tom R.; Boom, Remko M.; Goot, van der Atze Jan

    2016-01-01

    Brewing with unmalted barley can reduce the use of raw materials, thereby increasing the efficiency of the brewing process. However, unmalted barley contains several undesired components for brewing and has a low enzymatic activity. Pearling, an abrasive milling method, has been proposed as a pre

  7. Low Phytic Acid Barley Responses to Phosphorus Rates

    Science.gov (United States)

    Low phytic acid (LPA) barley (Hordeum vulgare L.) cultivars partition phosphorus in seed tissue differently than conventional barley cultivars through a reduction in seed phytic acid (myo-inositol-1,2,3,4,5,6-hexkisphosphate) coupled with an increase in inorganic phosphorus. The response of the LPA...

  8. Progressive hull removal from barley using the Fitzpatrick comminuting mill

    Science.gov (United States)

    The objective of the study was to explore an alternative use of the Fitzpatrick Comminuting Machine: to use it to remove the hull from hulled barley while keeping the barley kernel intact. Traditionally, this mill is used to grind material, but we have recently discovered that it also has the abili...

  9. Barley Stripe Mosaic Virus and the Frequency of Triploids and Aneuploids in Barley

    DEFF Research Database (Denmark)

    Sandfær, J.

    1973-01-01

    BSMV infection caused a pronounced increase in the frequency of triploid and aneuploid seeds in eleven barley varieties, but with considerable variation in frequency among varieties. In some of the varieties triploids exceeded three per cent. In virus-free material a few triploids were found in m...

  10. Giemsa C-banding of Barley Chromosomes. IV. Chromosomal Constitution of Autotetraploid Barley

    DEFF Research Database (Denmark)

    Linde-Laursen, Ib

    1984-01-01

    The progeny of an autotetraploid barley plant (C1) consisted of 45 tetraploids and 33 aneuploids. Giemsa C-banding was used to identify each of the chromosomes in 20 euploid and 31 aneuploid C2--seedlings, and in 11 C3--offspring of aneuploid C2--plants. The euploid C2--seedlings all had four hom...

  11. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  12. A novel major gene on chromosome 6H for resistance of barley against the barley yellow dwarf virus

    NARCIS (Netherlands)

    Niks, R.E.; Habekuss, A.; Bekele, B.; Ordon, F.

    2004-01-01

    In a mapping population derived from the Ethiopian barley line L94 x Vada, natural infection by barley yellow dwarf virus (BYDV) occurred. While line L94 hardly showed symptoms, Vada was severely affected. The 103 recombinant inbred lines segregated bimodally. The major gene responsible for this res

  13. Replication of DNA during barley endosperm development

    DEFF Research Database (Denmark)

    Giese, H.

    1992-01-01

    The incorporation of [6-H-3]-thymidine into DNA of developing barley end sperm was examined by autoradiography of cross sections of seeds and DNA analysis. The majority of nuclear divisions took place in the very young endosperm, but as late as 25 days after anthesis there was evidence for DNA...... replication. The DNA content of the endosperm increases during development and in response to nitrogen application in parallel to the storage protein synthesis profile. The hordein genes were hypersensitive to DNase I treatment throughout development....

  14. Transglycosylation by barley α-amylase 1

    DEFF Research Database (Denmark)

    Mótyán, János A.; Fazekas, Erika; Mori, Haruhide;

    2011-01-01

    The transglycosylation activity of barley α-amylase 1 (AMY1) and active site AMY1 subsite mutant enzymes was investigated. We report here the transferase ability of the V47A, V47F, V47D and S48Y single mutants and V47K/S48G and V47G/S48D double mutant AMY1 enzymes in which the replaced amino acids...... DP 2, DP 3 and DP 5 were successfully applied to detect activity of Bacillus stearothermophilus maltogenic α-amylase, human salivary α-amylase and Bacillus licheniformis α-amylase, respectively in a fast and simple fluorometric assay....

  15. Dynamic Allocation of Sugars in Barley

    Science.gov (United States)

    Cumberbatch, L. C.; Crowell, A. S.; Fallin, B. A.; Howell, C. R.; Reid, C. D.; Weisenberger, A. G.; Lee, S. J.; McKisson, J. E.

    2014-03-01

    Allocation of carbon and nitrogen is a key factor for plant productivity. Measurements are carried out by tracing 11C-tagged sugars using positron emission tomography and coincidence counting. We study the mechanisms of carbon allocation and transport from carbohydrate sources (leaves) to sinks (stem, shoot, roots) under various environmental conditions such as soil nutrient levels and atmospheric CO2 concentration. The data are analyzed using a transfer function analysis technique to model transport and allocation in barley plants. The experimental technique will be described and preliminary results presented. This work was supported in part by USDOE Grant No. DE-FG02-97-ER41033 and DE-SC0005057.

  16. Systemic responses of barley to the 3-hydroxy-decanoyl-homoserine lactone producing plant beneficial endophyte Acidovorax radicis N35

    Directory of Open Access Journals (Sweden)

    Shengcai Han

    2016-12-01

    Full Text Available Quorum sensing auto-inducers of the N-acyl homoserine lactone (AHL type produced by Gram-negative bacteria have different effects on plants including stimulation on root growth and/or priming or acquirement of systemic resistance in plants. In this communication the influence of AHL production of the plant growth promoting endophytic rhizosphere bacterium Acidovorax radicis N35 on barley seedlings was investigated. A. radicis N35 produces 3-hydroxy-C10-homoserine lactone (3-OH-C10-HSL as the major AHL compound. To study the influence of this QS autoinducer on the interaction with barley, the araI-biosynthesis gene was deleted. The comparison of inoculation effects of the A. radicis N35 wild type and the araI mutant resulted in remarkable differences. While the N35 wild type colonized plant roots effectively in microcolonies, the araI mutant occurred at the root surface as single cells. Furthermore, in a mixed inoculum the wild type was much more prevalent in colonization than the araI mutant documenting that the araI mutation affected root colonization. Nevertheless, a significant plant growth promoting effect could be shown after inoculation of barley with the wild type and the araI mutant in soil after two months cultivation. While A. radicis N35 wild type showed only a very weak induction of early defense responses in plant RNA expression analysis, the araI mutant caused increased expression of flavonoid biosynthesis genes. This was corroborated by the accumulation of several flavonoid compounds such as saponarin and lutonarin in leaves of root inoculated barley seedlings. Thus, although the exact role of the flavonoids in this plant response is not clear yet, it can be concluded, that the synthesis of AHLs by A. radicis has implications on the perception by the host plant barley and thereby contributes to the establishment and function of the bacteria-plant interaction.

  17. Systemic Responses of Barley to the 3-hydroxy-decanoyl-homoserine Lactone Producing Plant Beneficial Endophyte Acidovorax radicis N35

    Science.gov (United States)

    Han, Shengcai; Li, Dan; Trost, Eva; Mayer, Klaus F.; Vlot, A. Corina; Heller, Werner; Schmid, Michael; Hartmann, Anton; Rothballer, Michael

    2016-01-01

    Quorum sensing auto-inducers of the N-acyl homoserine lactone (AHL) type produced by Gram-negative bacteria have different effects on plants including stimulation on root growth and/or priming or acquirement of systemic resistance in plants. In this communication the influence of AHL production of the plant growth promoting endophytic rhizosphere bacterium Acidovorax radicis N35 on barley seedlings was investigated. A. radicis N35 produces 3-hydroxy-C10-homoserine lactone (3-OH-C10-HSL) as the major AHL compound. To study the influence of this QS autoinducer on the interaction with barley, the araI-biosynthesis gene was deleted. The comparison of inoculation effects of the A. radicis N35 wild type and the araI mutant resulted in remarkable differences. While the N35 wild type colonized plant roots effectively in microcolonies, the araI mutant occurred at the root surface as single cells. Furthermore, in a mixed inoculum the wild type was much more prevalent in colonization than the araI mutant documenting that the araI mutation affected root colonization. Nevertheless, a significant plant growth promoting effect could be shown after inoculation of barley with the wild type and the araI mutant in soil after 2 months cultivation. While A. radicis N35 wild type showed only a very weak induction of early defense responses in plant RNA expression analysis, the araI mutant caused increased expression of flavonoid biosynthesis genes. This was corroborated by the accumulation of several flavonoid compounds such as saponarin and lutonarin in leaves of root inoculated barley seedlings. Thus, although the exact role of the flavonoids in this plant response is not clear yet, it can be concluded, that the synthesis of AHLs by A. radicis has implications on the perception by the host plant barley and thereby contributes to the establishment and function of the bacteria-plant interaction. PMID:28018401

  18. Influence of Temperature on the Extractibility of Polysaccharides in Barley

    Directory of Open Access Journals (Sweden)

    Rodica Căpriţă

    2011-10-01

    Full Text Available Barley contains substantial amounts of both soluble and insoluble non-starch polysaccharides (NSP. The main watersoluble NSP in barley are highly viscous β-glucans. Monogastric animals, including humans and birds, cannotsynthesize β-glucanase, and the amount of β-glucanase derived from barley grain and bacteria in the gastrointestinaltract is insufficient to completely hydrolyze β-glucans. In the present investigation, we have studied the influence oftemperature and heating time on the extractibility of soluble polysaccharides in barley. Heating the barley samples at60°C and 80°C before extraction has the effect of lowering the soluble fraction of the polysaccharides. The dynamicviscosity values of water extracts from barley decreased up to 21.68% when heating at 60ºC for 15 minutes, and upto 25.30% when heating at 80ºC for 15 minutes, when the determinations were made immediately after extractseparation. Heating the barley samples for 15 minutes at 80°C deactivates the endogenous hydrolytic enzymes.

  19. Regulation of pri-miRNA processing by a long noncoding RNA transcribed from an ultraconserved region.

    Science.gov (United States)

    Liz, Julia; Portela, Anna; Soler, Marta; Gómez, Antonio; Ling, Hui; Michlewski, Gracjan; Calin, George A; Guil, Sònia; Esteller, Manel

    2014-07-03

    Noncoding RNAs (ncRNAs) control cellular programs by affecting protein-coding genes, but evidence increasingly points to their involvement in a network of ncRNA-ncRNA interactions. Here, we show that a long ncRNA, Uc.283+A, controls pri-miRNA processing. Regulation requires complementarity between the lower stem region of the pri-miR-195 transcript and an ultraconserved sequence in Uc.283+A, which prevents pri-miRNA cleavage by Drosha. Mutation of the site in either RNA molecule uncouples regulation in vivo and in vitro. We propose a model in which lower-stem strand invasion by Uc.283+A impairs microprocessor recognition and efficient pri-miRNA cropping. In addition to identifying a case of RNA-directed regulation of miRNA biogenesis, our study reveals regulatory networks involving different ncRNA classes of importance in cancer.

  20. Methane emissions from feedlot cattle fed barley or corn diets.

    Science.gov (United States)

    Beauchemin, K A; McGinn, S M

    2005-03-01

    Methane emitted from the livestock sector contributes to greenhouse gas emissions worldwide. Understanding the variability in enteric methane production related to diet is essential to decreasing uncertainty in greenhouse gas emission inventories and to identifying viable greenhouse gas reduction strategies. Our study focused on measuring methane in growing beef cattle fed corn- or barley-based diets typical of those fed to cattle in North American feedlots. The experiment was designed as a randomized complete block (group) design with two treatments, barley and corn. Angus heifer calves (initial BW = 328 kg) were allocated to two groups (eight per group), with four cattle in each group fed a corn or barley diet. The experiment was conducted over a 42-d backgrounding phase, a 35-d transition phase and a 32-d finishing phase. Backgrounding diets consisted of 70% barley silage or corn silage and 30% concentrate containing steam-rolled barley or dry-rolled corn (DM basis). Finishing diets consisted of 9% barley silage and 91% concentrate containing barley or corn (DM basis). All diets contained monensin (33 mg/kg of DM). Cattle were placed into four large environmental chambers (two heifers per chamber) during each phase to measure enteric methane production for 3 d. During the backgrounding phase, DMI was greater by cattle fed corn than for those fed barley (10.2 vs. 7.6 kg/d, P cattle were in the chambers; thus, methane emissions (g/d) reported may underestimate those of the feedlot industry. Methane emissions per kilogram of DMI and as a percentage of GE intake were not affected by grain source during the backgrounding phase (24.6 g/kg of DMI; 7.42% of GE), but were less (P methane emissions of cattle fed high-forage backgrounding diets and barley-based finishing diets. Mitigating methane losses from cattle will have long-term environmental benefits by decreasing agriculture's contribution to greenhouse gas emissions.

  1. STUDIES ON SYNBIOTIC BARLEY GRAIN EXTRACT AGAINST SOME HUMAN PATHOGENS

    Directory of Open Access Journals (Sweden)

    T. Sheela

    2012-01-01

    Full Text Available This study evaluated that effect of prebiotic food containing oligosaccharide to enhance the growth and activity of probiotic strains. Barley grains probioticated using different strains of probiotics are Lactobacillus kefiranofaciens, Candida kefir,and saccharomyces boluradii. To select a suitable prebiotics like inulin for the development of Synbiotic barley and tested for antibacterial activity against diarrhoea causing pathogen such as Esherichia coli, Staphylococcus aureus, Salmonella paratyphi A, Shigella dysenteriae, Vibrio cholerae. Analysis of identified compound from synbiotic barley grain using GC-MS.

  2. Effect of phytase supplementation to barley-canola meal and barley-soybean meal diets on phosphorus and calcium balance in growing pigs

    NARCIS (Netherlands)

    Sauer, W.C.; Cervantes, M.; He, J.M.M.; Schulze, H.

    2003-01-01

    Two metabolism experiments were carried out, to determine the effect of microbial phytase addition to barley-canola meal and barley-soybean meal diets on P and Ca balance in growing. pigs; In experiment 1, six barrows (29.6kg: initial LW) were fed a barley-canola meal diet, without or. with phytase

  3. Differences in phytase activity and phytic acid content between cultivated and Tibetan annual wild barleys.

    Science.gov (United States)

    Dai, Fei; Qiu, Long; Xu, Yang; Cai, Shengguan; Qiu, Boyin; Zhang, Guoping

    2010-11-24

    The Qinghai-Tibetan Plateau in China is considered to be one of the original centers of cultivated barley. At present, little is known about the phytase activity (Phy) or phytic acid content (PA) in grains of Tibetan annual wild barley. Phy and PA were determined in grains of 135 wild and 72 cultivated barleys. Phy ranged from 171.3 to 1299.2 U kg(-1) and from 219.9 to 998.2 U kg(-1) for wild and cultivated barleys, respectively. PA and protein contents were much higher in wild barley than in cultivated barley. Tibetan annual wild barley showed a larger genetic diversity in phytase activity and phytic acid and protein contents and is of value for barley breeding. There is no significant correlation between phytase activity and phytic acid or protein content in barley grains, indicating that endogenous phytase activity had little effect on the accumulation of phytic acid.

  4. Barley starch bioengineering for high phosphate and amylose

    DEFF Research Database (Denmark)

    Blennow, Per Gunnar Andreas; Carciofi, Massimiliano; Shaik, Shahnoor Sultana;

    2011-01-01

    Starch is a biological polymer that can be industrially produced in massive amounts in a very pure form. Cereals is the main source for starch production and any improvement of the starch fraction can have a tremendous impact in food and feed applications. Barley ranks number four among cereal...... crops and barley is a genetically very well characterized. Aiming at producing new starch qualities in the cereal system, we used RNAi and overexpression strategies to produce pure amylose and high-phosphate starch, respectively, using the barley kernel as a polymer factory. By simultaneous silencing...... of the three genes encoding the starch-branching enzymes SBEI, SBEIIa, and SBEIIb using a triple RNAi chimeric hairpin construct we generated a virtually amylopectin-free barley. The grains of the transgenic lines were shrunken and had a yield of around 80% of the control line. The starch granules were...

  5. Implementation of biochemical screening to improve baking quality of barley

    DEFF Research Database (Denmark)

    Vincze, Éva; Dionisio, Giuseppe; Aaslo, Per;

    2011-01-01

    Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact...... proteins. Changing the storage protein composition can lessen this problem. Our working hypothesis was that exploiting the substantial genetic variation within the gene pool for storage proteins could enable improving the baking qualities of barley flour. We characterised forty-nine barley cultivars...... for variations in storage protein and AA composition. These cultivars were selected based on their higher protein contents (11.8–17.6%). The results obtained indicated that substantial variation not only in the distribution of the hordein polypeptides but also in the relative proportions of the storage proteins...

  6. Hydrothermal liquefaction of barley straw to bio-crude oil

    DEFF Research Database (Denmark)

    Zhu, Zhe; Rosendahl, Lasse; Toor, Saqib;

    2015-01-01

    Hydrothermal liquefaction (HTL) of barley straw with K2CO3 at different temperatures (280–400 C) was conducted and compared to optimize its process conditions; the aqueous phase as a co-product from this process was recycled to explore the feasibility of implementing wastewater reuse for bio...... a detailed insight into the HTL behavior of barley straw, and offers potential opportunities and benefits for bio-crude oil production through the reuse of aqueous phase....

  7. Androgenesis in anther culture of Lithuanian spring barley cultivars

    OpenAIRE

    Asakavičiūtė, Rita; Pašakinskienė, Izolda

    2006-01-01

    The method of anther culture was used for the production of doubled haploids in Lithuanian spring barley cultivars. Two methods, (i) regeneration from callus (Szarjeko’s method) and (ii) direct regeneration from embryoids (Caredda’s method) were applied to determine the androgenic potential according to the green regenerant yield and other morphogenetic factors. Green double haploid regenerants were obtained in four Lithuanian spring barley cultivars (‘Aura’, ‘Aidas’, ‘Alsa’ and ‘Auksiniai’) ...

  8. The spontaneous chlorophyll mutation frequency in barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms; Jensen, Hans Peter

    1986-01-01

    A total of 1866 barley plants were progeny tested in the greenhouse. Twenty-five plants segregated for newly arisen, spontaneous chlorophyll mutant genes. Among the total of 470,129 seedlings screened there were 79 mutants (1.7 .+-. 0.6 .times. 10-4). The data are added to data from three similar...... materials and the resulting estimate of the chlorophyll mutant frequency is 1.6 .times. 10-4 in about 1.43 million seedlings. The estimate of the chlorophyll mutation rate per generation is close to 67.3 .times. 10-4 per diploid genome or in the order of 6 .times. 10-7 per locus and haploid genome....

  9. The Barley Chromosome 5 Linkage Map

    DEFF Research Database (Denmark)

    Jensen, J.; Jørgensen, Jørgen Helms

    1975-01-01

    The literature is surveyed for data on recombination between loci on chromosome 5 of barley; 13 loci fall into the category “mapped” loci, more than 20 into the category “associated” loci and nine into the category “loci once suggested to be on chromosome 5”. A procedure was developed...... for estimating a linkage map; it involves (1) transformation by the Kosambi mapping function of the available recombination percentages to additive map distances, (2) calculations of a set of map distances from the transformed recombination percentages by a maximum likelihood method in which all the available...... data are utilized jointly, and (3) omission of inconsistent data and determination of the most likely order of the loci. This procedure was applied to the 42 recombination percentages available for the 13 “mapped” loci. Due to inconsistencies 14 of the recombination percentages and, therefore, two...

  10. Weed suppression ability of spring barley varieties

    DEFF Research Database (Denmark)

    Christensen, Svend

    1995-01-01

    Three years of experiments with spring barley showed significant differences in weed suppression ability among varieties. Weed dry matter in the most suppressive variety, Ida, was 48% lower than the mean weed dry matter of all varieties, whereas it was 31% higher in the least suppressive variety......, Grit. Ranking varietal responses to weed competition in terms of grain yield loss corresponded well to ranking weed dry matter produced in crop weed mixtures. There was no correspondence between the varietal grain yields in pure stands and their competitiveness, suggesting that breeding to optimize...... interception model was developed to describe the light interception profiles of the varieties. A study of the estimated parameters showed significant correlation between weed dry matter, rate of canopy height development and the light interception profile. However, when estimates were standardized to eliminate...

  11. No effect of 5-fluorouracil on the properties of purified. cap alpha. -amylase from barley half-seeds

    Energy Technology Data Exchange (ETDEWEB)

    Rodaway, S.J.; Kende, H.

    1978-01-01

    Amylase has been purified from de-embryonated seeds of barley (Horedeum vulgare L. cv. Betzes) which have been incubated on 10/sup 6/M gibberellic acid (GA/sub 3/) following 3 days of imbibition in buffer. Incubation of the half-seeds in up to 10/sup -2/ M 5-fluorouracil (5-FU) during the entire incubation period, including imbibition, had no effect on any of the following characteristics of purified ..cap alpha..-amylase: thermal stability in the absence of calcium, molecular weight of the enzyme, isozyme composition, specific activity, or the amount of ..cap alpha..-amylase synthesized by the aleurone tissue. The synthesis of rRNA and tRNA was strongly inhibited by 5-FU, indicating that the analog had entered the aleurone cells. These results are not in agreement with those of Carlson (Nature New Biology 237: 39-41 (1972)) who found that treatment of barley aleurone with 10/sup -4/ M 5-FU to the addition of GA/sub 3/ resulted in decreased thermal stability of GA/sub 3/-induced ..cap alpha..-amylase and who interpreted this as evidence that the mRNA for ..cap alpha..-amylase was synthesized during the imbibition of the aleurone tissue and independently of gibberellin action. Results of the present experiments indicate that the thermal stability of highly purified ..cap alpha..-amylase is not altered by treatment of barley half-seeds with 5-FU, and that 5-FU cannot be used as a probe to examine the timing of ..cap alpha..-amylase mRNA synthesis.

  12. The effect of added enzymes on process potentials derived from different qualities of barley

    DEFF Research Database (Denmark)

    Shetty, Radhakrishna; Zhuang, Shiwen; Hansen, Preben Bøje;

    Barley sorting is an important step for picking up grain of desired quality. Whilst brewing with 100% sorted barley (picked high quality) has become realistic with the addition of exogenous enzymes, the effect of added enzymes on process potentials derived from un-sorted barley (mixed) and sorted...... filterability, the Ondea® Pro treatment resulted in significantly lower turbidity and smaller particle size compared to Cellic® CTec2; however, this effect was observed in sorted and un-sorted barley but not in sorted-out barley. Consequently the un-sorted barley demonstrated great potential in brewing process...

  13. Long-term reconstitution of dry barley increased phosphorus digestibility in pigs

    DEFF Research Database (Denmark)

    Ton Nu, Mai Anh; Blaabjerg, Karoline; Poulsen, Hanne Damgaard

    of reconstitution compared to dry stored barley on phosphorus (P) digestibility in pigs. Materials and Methods: Dry barley (13% moisture; phytate P, 1.7 g/kg DM) was rolled and stored directly or reconstituted with water to produce rolled barley with 35% moisture that was stored in air-tight conditions. After 49......: Reconstituted barley had higher soluble P (2.56 g/kg DM) and lower phytate P (0.93 g/ kg DM) compared with dry barley (0.78 and 1.7 g/kg DM, respectively). Pigs fed the reconstituted barley diet showed increased P absorption (52%) and decreased P excretion in feces (21%) (P

  14. Constructing the barley model for genetic transformation in Triticeae

    Institute of Scientific and Technical Information of China (English)

    LÜ Bo; WU Jia-jie; FU Dao-lin

    2015-01-01

    Barley (Hordeum vulgare L.) is one of the oldest domesticated crops, showing dramatic adaptation to various climate and environmental conditions. As a major cereal crop, barley ranks the 4th after wheat, maize and rice in terms of planting area and production al over the world. Due to its diploid nature, the cultivated barley is considered as an ideal model to study the polyploid wheat and other Triticeae species. Here, we reviewed the development, optimization, and application of transgenic approaches in barley. The most efifcient and robust genetic transformation has been built on the Agrobacterium-mediated transfer in conjunction with the immature embryo-based regeneration. We then discussed future considerations of using more practical technologies in barley transformation, such as the T-DNA/transposon tagging and the genome editing. As a cereal crop amenable to genetic transformation, barley wil serve as the most valuable carrier for global functional genomics in Triticeae and is becoming the most practical model for generating value-added products.

  15. Glycaemic response to barley porridge varying in dietary fibre content.

    Science.gov (United States)

    Thondre, Pariyarath S; Wang, Ke; Rosenthal, Andrew J; Henry, Christiani J K

    2012-03-01

    The interest in barley as a food is increasing worldwide because of its high dietary fibre (DF) content and low glycaemic index (GI). DF in cereals may prove beneficial in improving blood glucose response in the long term. However, a dose-dependent effect of insoluble fibre on reducing postprandial blood glucose levels is yet to be proven. The objective of the present study was to determine the glycaemic response to two barley porridges prepared from whole barley grains varying in fibre content. In two separate non-blind randomised crossover trials, ten human subjects consumed barley porridge with 16 g/100 g and 10 g/100 g fibre content provided in different serving sizes (equivalent to 25 and 50 g available carbohydrate). The glycaemic response to both barley porridges was significantly lower than the reference glucose (P porridges. We concluded that irrespective of the difference in total fibre content or serving size of barley porridges, their GI values did not differ significantly.

  16. Comparative transcriptome profiling of two Tibetan wild barley genotypes in responses to low potassium.

    Directory of Open Access Journals (Sweden)

    Jianbin Zeng

    Full Text Available Potassium (K deficiency is one of the major factors affecting crop growth and productivity. Development of low-K tolerant crops is an effective approach to solve the nutritional deficiency in agricultural production. Tibetan annual wild barley is rich in genetic diversity and can grow normally under poor soils, including low-K supply. However, the molecular mechanism about low K tolerance is still poorly understood. In this study, Illumina RNA-Sequencing was performed using two Tibetan wild barley genotypes differing in low K tolerance (XZ153, tolerant and XZ141, sensitive, to determine the genotypic difference in transcriptome profiling. We identified a total of 692 differentially expressed genes (DEGs in two genotypes at 6 h and 48 h after low-K treatment, including transcription factors, transporters and kinases, oxidative stress and hormone signaling related genes. Meanwhile, 294 low-K tolerant associated DEGs were assigned to transporter and antioxidant activities, stimulus response, and other gene ontology (GO, which were mainly involved in starch and sucrose metabolism, lipid metabolism and ethylene biosynthesis. Finally, a hypothetical model of low-K tolerance mechanism in XZ153 was presented. It may be concluded that wild barley accession XZ153 has a higher capability of K absorption and use efficiency than XZ141 under low K stress. A rapid response to low K stress in XZ153 is attributed to its more K uptake and accumulation in plants, resulting in higher low K tolerance. The ethylene response pathway may account for the genotypic difference in low-K tolerance.

  17. Quantitative analysis of proteome extracted from barley crowns grown under different drought conditions.

    Science.gov (United States)

    Vítámvás, Pavel; Urban, Milan O; Škodáček, Zbynek; Kosová, Klára; Pitelková, Iva; Vítámvás, Jan; Renaut, Jenny; Prášil, Ilja T

    2015-01-01

    Barley cultivar Amulet was used to study the quantitative proteome changes through different drought conditions utilizing two-dimensional difference gel electrophoresis (2D-DIGE). Plants were cultivated for 10 days under different drought conditions. To obtain control and differentially drought-treated plants, the soil water content was kept at 65, 35, and 30% of soil water capacity (SWC), respectively. Osmotic potential, water saturation deficit, (13)C discrimination, and dehydrin accumulation were monitored during sampling of the crowns for proteome analysis. Analysis of the 2D-DIGE gels revealed 105 differentially abundant spots; most were differentially abundant between the controls and drought-treated plants, and 25 spots displayed changes between both drought conditions. Seventy-six protein spots were successfully identified by tandem mass spectrometry. The most frequent functional categories of the identified proteins can be put into the groups of: stress-associated proteins, amino acid metabolism, carbohydrate metabolism, as well as DNA and RNA regulation and processing. Their possible role in the response of barley to drought stress is discussed. Our study has shown that under drought conditions barley cv. Amulet decreased its growth and developmental rates, displayed a shift from aerobic to anaerobic metabolism, and exhibited increased levels of several protective proteins. Comparison of the two drought treatments revealed plant acclimation to milder drought (35% SWC); but plant damage under more severe drought treatment (30% SWC). The results obtained revealed that cv. Amulet is sensitive to drought stress. Additionally, four spots revealing a continuous and significant increase with decreasing SWC (UDP-glucose 6-dehydrogenase, glutathione peroxidase, and two non-identified) could be good candidates for testing of their protein phenotyping capacity together with proteins that were significantly distinguished in both drought treatments.

  18. 核糖核酸干扰%The RNA interference

    Institute of Scientific and Technical Information of China (English)

    孔祥平; LiXing W.Reneker

    2004-01-01

    The phenomenon of RNA interference (RNAi) is highly conserved mechanism in the organism evolution. As a immune system ,RNAi is a ubiquitous mechanism against invading microorganism in plant and animal cells. Recently, it has been found that RNAi is the process by which double-strand RNA(dsRNA) directs sequence-specific degradation of messenger RNA and the mediations of sequence specific messenger RNA degradation are 21-and 23-nucleotide small interfering RNAs that generate by ribonuclease from endogenous longer dsRNA or by transfectious technics from heterologous dsRNA. Over the past few years, the way in which cells respond to dsRNA by silencing homologous genes has revealed a new regulating paradigm in biology.

  19. Dynamics of phosphorus compounds in ripening and germinating cereal grains. Part II. Changes in phosphorus compounds content during germination of wheat, barley and rye grains

    Directory of Open Access Journals (Sweden)

    J. Tłuczkiewicz

    2015-01-01

    Full Text Available The dynamics of phosphorus compounds was investigated in the embryos and endosperm of wheat (Grana, barley (Kosmos and rye (Pancerne grain after 2, 4 and 6 days of germination. In germinating grain the phosphorus compounds transformations ran along the way of synthesis in the embryo and of breakdown in the endosperm. The level of phosphorus: inorganic, nucleotides, saccharides esters and their metabolites, lipid, RNA, DNA, phytin free and phytin bound with proteins and proteins rapidly increased in germinating seed embryos. The content of phosphorus free phytin and that bound with proteins, lipids, RNA and DNA in the endosperm rapidly decreased during germination. On the other hand, the saccharides phosphorus and that of their metabolites did not change, and inorganic, nuclotides and proteins-P slightly increased. Germinating rye grains showed a higher rate of synthesis in the embryos and of breakdown in the endosperm of the investigated phosphorus compounds than wheat and barley grains.

  20. Competition and Facilitation in Hairy Vetch-Barley Intercrops

    Directory of Open Access Journals (Sweden)

    Giacomo Tosti

    2010-09-01

    Full Text Available Intercrops between legumes and non-legumes are widely used for fodder production and as cover crops, but little quantitative data are available on competition between species in the mixture. The objective of the present study was to assess the interaction between hairy vetch (Vicia villosa Roth. and barley (Hordeum vulgare L. grown as pure crops or intercrops with different proportions of seed rates at sowing. A 4-year field study was conducted using hairy vetch and barley as pure stands at full sowing density and as intercrops at different proportions of their own full seed rate according to the replacement principle. Interaction between species was evaluated on the basis of Land Equivalent Ratio (LER, Relative Neighbour Effect (RNE and Aggressivity (A calculated on biomass and nitrogen (N accumulation. The N accumulation of the mixed crops increased linearly with the legume proportion in the mixture. The mixtures were more efficient than the pure crops in terms of N use (LER > 1. Partial LER values indicated that the barley component benefited from the presence of the legume, while the hairy vetch partial LER decreased with increasing barley proportion in the mixture. The competitive response in terms of biomass accumulation was high for both species when their density in the mixture was high. Concerning N accumulation, barley benefited from an asymmetric interspecific facilitation while the vetch behaviour was similar to that observed for biomass accumulation. Barley dominance progressively increased reaching a maximum just before the last sampling date. At the last sampling date the competitive ability of hairy vetch showed a considerable increase in all mixtures (A ≈ 0. These findings indicate that the use of mixtures between hairy vetch and barley allows an increase in the use efficiency of N resource with respect to pure crops. Barley is the dominant component of the mixture and the hairy vetch is able to cope with the cereal

  1. Expression of the betaine aldehyde dehydrogenase gene in barley in response to osmotic stress and abscisic acid.

    Science.gov (United States)

    Ishitani, M; Nakamura, T; Han, S Y; Takabe, T

    1995-01-01

    When subjected to salt stress or drought, some vascular plants such as barley respond with an increased accumulation of the osmoprotectant glycine betaine (betaine), being the last step of betaine synthesis catalyzed by betaine aldehyde dehydrogenase (BADH). We report here cloning and characterization of BADH cDNA from barley, a monocot, and the expression pattern of a BADH transcript. An open reading frame of 1515 bp encoded a protein which showed high homology to BADH enzymes present in other plants (spinach and sugar-beet) and in Escherichia coli. Transgenic tobacco plants harboring the clone expressed high levels of both BADH protein and its enzymatic activity. Northern blot analyses indicated that BADH mRNA levels increased almost 8-fold and 2-fold, respectively, in leaves and roots of barley plants grown in high-salt conditions, and that these levels decreased upon release of the stress, whereas they did not decrease under continuous salt stress. BADH transcripts also accumulate in response to water stress or drought, indicating a common response of the plant to osmotic changes that affect its water status. The addition of abscisic acid (ABA) to plants during growth also increased the levels of BADH transcripts dramatically, although the response was delayed when compared to that found for salt-stressed plants. Removal of plant roots before transferring the plants to high-salt conditions reduced only slightly the accumulation of BADH transcripts in the leaves.

  2. Identification of reference genes for quantitative expression analysis of microRNAs and mRNAs in barley under various stress conditions.

    Science.gov (United States)

    Ferdous, Jannatul; Li, Yuan; Reid, Nicolas; Langridge, Peter; Shi, Bu-Jun; Tricker, Penny J

    2015-01-01

    For accurate and reliable gene expression analysis using quantitative real-time reverse transcription PCR (qPCR), the selection of appropriate reference genes as an internal control for normalization is crucial. We hypothesized that non-coding, small nucleolar RNAs (snoRNAs)would be stably expressed in different barley varieties and under different experimental treatments,in different tissues and at different developmental stages of plant growth and therefore might prove to be suitable reference genes for expression analysis of both microRNAs (miRNAs)and mRNAs. In this study, we examined the expression stability of ten candidate reference genes in six barley genotypes under five experimental stresses, drought, fungal infection,boron toxicity, nutrient deficiency and salinity. We compared four commonly used housekeeping genes; Actin (ACT), alpha-Tubulin (α-TUB), Glycolytic glyceraldehyde-3-phosphate dehydrogenase(GAPDH), ADP-ribosylation factor 1-like protein (ADP), four snoRNAs; (U18,U61, snoR14 and snoR23) and two microRNAs (miR168, miR159) as candidate reference genes. We found that ADP, snoR14 and snoR23 were ranked as the best of these candidates across diverse samples. Additionally, we found that miR168 was a suitable reference gene for expression analysis in barley. Finally, we validated the performance of our stable and unstable candidate reference genes for both mRNA and miRNA qPCR data normalization under different stress conditions and demonstrated the superiority of the stable candidates. Our data demonstrate the suitability of barley snoRNAs and miRNAs as potential reference genes form iRNA and mRNA qPCR data normalization under different stress treatments [corrected].

  3. Efficient production of tetraploid barley (Hordeum vulgare L. by colchicine treatment of diploid barley

    Directory of Open Access Journals (Sweden)

    Ayed Sourour

    2014-03-01

    Full Text Available An experiment was conducted to induce tetraploidy in three diploid barley varieties (Martin, Rihane and Manel through different colchicines treatments. Colchicine was added for three different concentrations at three different stages of plant development i.e. on seed (0.05% for 48 hours, on pre-germinated seeds (0.1% for 2 hours and on three leaf stage (0.1% for 16 hours. Colchicine application reduced significantly germination percentage and viability of plants. Seed germination was completely inhibited in Martin, while a reduction of 20% and 30% for germination percentage compared to control was recorded in varieties Manel and Rihane, respectively at 0.1% colchicine concentration. Ploidy evaluation showed no tetraploidy in all the three tested varieties by colchicine application of 0.05% for 48 hours on seeds and 0.1% for 2 hours on pre-germinated seeds. However, tetraploid plants were produced only by treatment with 0.1% for 16 hours of seedlings. The percentages of plants were 40%, 44% and 100% for Rihane, Manel and Martin, respectively. Cytological analyses showed the increase of chromosome numbers from 2n=2x=14 to 2n=4x=28. The increase of ploidy levels caused major changes in some morphological traits. In fact, the induced tetraploids in barley was accompanied by significant (P<0.01 decrease in plant height, tiller height, leaf number and leaf length compared to diploid control plants. colchicine treatment induce successfully the production of tetraploid barley plants and could be used in breeding programs.

  4. Molecular characterization of barley 3H semi-dwarf genes.

    Directory of Open Access Journals (Sweden)

    Haobing Li

    Full Text Available The barley chromosome 3H accommodates many semi-dwarfing genes. To characterize these genes, the two-rowed semi-dwarf Chinese barley landrace 'TX9425' was crossed with the Australian barley variety 'Franklin' to generate a doubled haploid (DH population, and major QTLs controlling plant height have been identified in our previous study. The major QTL derived from 'TX9425' was targeted to investigate the allelism of the semi-dwarf gene uzu in barley. Twelve sets of near-isogenic lines and a large NILF2 fine mapping population segregating only for the dwarfing gene from 'TX9425' were developed. The semi-dwarfing gene in 'TX9425' was located within a 2.8 cM region close to the centromere on chromosome 3H by fine mapping. Molecular cloning and sequence analyses showed that the 'TX9425'-derived allele contained a single nucleotide substitution from A to G at position 2612 of the HvBRI1 gene. This was apparently the same mutation as that reported in six-rowed uzu barley. Markers co-segregating with the QTL were developed from the sequence of the HvBRI1 gene and were validated in the 'TX9425'/'Franklin' DH population. The other major dwarfing QTL derived from the Franklin variety was distally located on chromosome 3HL and co-segregated with the sdw1 diagnostic marker hv20ox2. A third dwarfing gene, expressed only in winter-sown trials, was identified and located on chromosome 3HS. The effects and interactions of these dwarfing genes under different growing conditions are discussed. These results improve our understanding of the genetic mechanisms controlling semi-dwarf stature in barley and provide diagnostic markers for the selection of semi-dwarfness in barley breeding programs.

  5. Towards systems genetic analyses in barley: Integration of phenotypic, expression and genotype data into GeneNetwork

    Directory of Open Access Journals (Sweden)

    Druka Arnis

    2008-11-01

    Full Text Available Abstract Background A typical genetical genomics experiment results in four separate data sets; genotype, gene expression, higher-order phenotypic data and metadata that describe the protocols, processing and the array platform. Used in concert, these data sets provide the opportunity to perform genetic analysis at a systems level. Their predictive power is largely determined by the gene expression dataset where tens of millions of data points can be generated using currently available mRNA profiling technologies. Such large, multidimensional data sets often have value beyond that extracted during their initial analysis and interpretation, particularly if conducted on widely distributed reference genetic materials. Besides quality and scale, access to the data is of primary importance as accessibility potentially allows the extraction of considerable added value from the same primary dataset by the wider research community. Although the number of genetical genomics experiments in different plant species is rapidly increasing, none to date has been presented in a form that allows quick and efficient on-line testing for possible associations between genes, loci and traits of interest by an entire research community. Description Using a reference population of 150 recombinant doubled haploid barley lines we generated novel phenotypic, mRNA abundance and SNP-based genotyping data sets, added them to a considerable volume of legacy trait data and entered them into the GeneNetwork http://www.genenetwork.org. GeneNetwork is a unified on-line analytical environment that enables the user to test genetic hypotheses about how component traits, such as mRNA abundance, may interact to condition more complex biological phenotypes (higher-order traits. Here we describe these barley data sets and demonstrate some of the functionalities GeneNetwork provides as an easily accessible and integrated analytical environment for exploring them. Conclusion By

  6. Pearling barley to alter the composition of the raw material before brewing

    NARCIS (Netherlands)

    Donkelaar, van L.H.G.; Noordman, T.R.; Boom, R.M.; Goot, van der A.J.

    2015-01-01

    Partly replacing malt with unmalted barley is a trend in brewing. The use of unmalted barley, however, leads to issues such as haze and high mash viscosity, due to its higher content of undesired components. Pearling, an abrasive method to remove the outer layers of the barley kernels has been shown

  7. 7 CFR 457.102 - Wheat or barley winter coverage endorsement.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Wheat or barley winter coverage endorsement. 457.102... INSURANCE CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.102 Wheat or barley... Wheat or Barley Winter Coverage Endorsement (This is a continuous endorsement) 1. In return for...

  8. Interaction between powdery mildew and barley with ¤mlo5¤ mildew resistance

    DEFF Research Database (Denmark)

    Lyngkjær, M.F.; Østergård, Hanne

    1998-01-01

    Powdery mildew infection of barley with the mlo5 barley powdery mildew resistance gene was examined, using near-isogenic barley lines, with and without mlo5 resistance, and two near-isogenic powdery mildew isolates, HL3/5 and GE3 with high (virulent) or low (avirulent) penetration efficiency...

  9. Products based on a high fiber barley genotype, but not on common barley or oats, lower postprandial glucose and insulin responses in healthy humans.

    Science.gov (United States)

    Liljeberg, H G; Granfeldt, Y E; Björck, I M

    1996-02-01

    Postprandial blood glucose and insulin responses to cereal products made from common barley, oats or a barley genotype containing elevated levels of beta-glucans were evaluated in nine healthy subjects. Porridges were made from commercial Swedish whole-meal barley or oat flours, and a mixed whole-meal porridge using the high fiber barley genotype and commercial Swedish common barley (50:50). Also studied were two types of flour-based bread products composed of high fiber barley and common barley in ratios of 50:50 or 80:20, respectively. The common oat and barley porridges produced postprandial glucose and insulin responses similar to the white wheat bread reference, suggesting that the naturally occurring dietary fiber in these whole-meal flours has no impact on the glucose tolerance. In contrast, all high fiber barley products induced significantly lower responses than did the reference product, with the glycemic and insulin indices ranging from 57 to 72 or 42 to 72%, respectively. It is concluded that "lente" products of high sensory quality can be prepared from a barley genotype with an elevated content of soluble dietary fiber. The glycemic index of these products compares favorably with that of products made from common cereals, suggesting their use as a potential component of diets for patients with diabetes and hyperlipidemia, and for individuals predisposed to metabolic disease.

  10. The role of root hairs in cadmium acquisition by barley

    Energy Technology Data Exchange (ETDEWEB)

    Zheng Ruilun; Li Huafen [Key Laboratory of Plant-Soil Interactions of the Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100094 (China); Jiang Rongfeng, E-mail: rfjiang@cau.edu.c [Key Laboratory of Plant-Soil Interactions of the Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100094 (China); Roemheld, Volker [Institute of Plant Nutrition, University of Hohenheim, D-70593 Stuttgart (Germany); Zhang Fusuo [Key Laboratory of Plant-Soil Interactions of the Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100094 (China); Zhao Fangjie [Soil Science Department, Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ (United Kingdom)

    2011-02-15

    The role of root hairs in Cd acquisition from soil was investigated in three pot experiments using a root hairless mutant (bald root barley, brb) and its wild-type (WT) cultivar of barley (Hordeum vulgare). brb had significantly lower concentrations and lower total amounts of Cd in shoots than WT. The Cd uptake efficiency based on total root length was 8-45% lower in brb than in WT. The difference between brb and WT increased with increasing extractable Cd in soil under the experimental conditions used. Additions of phosphate to soil decreased Cd extractability. Both soil and foliar additions of phosphate decreased root length, and root hair formation in WT. These effects resulted in decreased Cd uptake with increasing P supply. Cd uptake in WT correlated significantly with root length, root hair length and density, and soil extractable Cd. Root hairs contribute significantly to Cd uptake by barley. - Research highlights: The Cd uptake efficiency was significantly lower in brb than in WT. Additions of phosphate to soil decreased Cd extractability and Cd uptake. Both soil and foliar additions of phosphate decreased root length, and root hair formation in WT. Root hairs contribute significantly to Cd uptake by barley. - The Cd uptake efficiency based on total root length was 8-45% lower in a barley root hairless mutant than in its wild-type, indicating an important role of root hairs in Cd acquisition.

  11. Identification of a phytase gene in barley (Hordeum vulgare L..

    Directory of Open Access Journals (Sweden)

    Fei Dai

    Full Text Available BACKGROUND: Endogenous phytase plays a crucial role in phytate degradation and is thus closely related to nutrient efficiency in barley products. The understanding of genetic information of phytase in barley can provide a useful tool for breeding new barley varieties with high phytase activity. METHODOLOGY/PRINCIPAL FINDINGS: Quantitative trait loci (QTL analysis for phytase activity was conducted using a doubled haploid population. Phytase protein was purified and identified by the LC-ESI MS/MS Shotgun method. Purple acid phosphatase (PAP gene was sequenced and the position was compared with the QTL controlling phytase activity. A major QTL for phytase activity was mapped to chromosome 5 H in barley. The gene controlling phytase activity in the region was named as mqPhy. The gene HvPAP a was mapped to the same position as mqPhy, supporting the colinearity between HvPAP a and mqPhy. CONCLUSIONS/SIGNIFICANCE: It is the first report on QTLs for phytase activity and the results showed that HvPAP a, which shares a same position with the QTL, is a major phytase gene in barley grains.

  12. A roadmap for zinc transport into the developing barley grain. Gene expression profiling using laser microdissection

    DEFF Research Database (Denmark)

    Borg, Søren; Tauris, Birgitte

    2011-01-01

    Nutrients destined for the developing cereal grain encounter several restricting barriers on their path towards their final storage sites in the grain. In order to identify transporters and chelating agents that may be involved in transport and deposition of zinc in the barley grain, expression...... profiles have been generated of four different tissue types: the transfer cells, the aleurone layer, the endosperm, and the embryo. Cells from these tissues were isolated with the 'laser capture microdissection' technology and the extracted RNA was subjected to three rounds of T7-based amplification...... were taken into account. On the basis of the expression levels of a number of metal homeostasis genes, a working model is proposed for the translocation of zinc from the phloem to the storage sites in the developing grain....

  13. Isolation and characterization of Phi class glutathione transferase partial gene from Iranian barley

    Directory of Open Access Journals (Sweden)

    Hassan Mohabatkar

    2012-01-01

    Full Text Available Glutathione transferases are multifunctional proteins involved in several diverse intracellular events such as primary and secondary metabolisms, signaling and stress metabolism. These enzymes have been subdivided into eight classes in plants. The Phi class, being plant specific, is the most represented. In the present study, based on the sequences available at GenBank, different primers were designed for amplifying the Phi class of glutathione transferase gene in the genome and transcriptome of Iranian barley, Karoun cultivar. After extraction of DNA and total RNA, Phi class was amplified and sequenced. Bioinformatics analysis predicted that the deduced protein sequence has two ß-sheets, eight α-helices and some intermediate loops in its secondary structure. Consequently, the sequences were submitted to NCBI GenBank with GS262333 and GW342614 accession numbers. Phylogenic relationships of the sequences were compared with existing sequences in GenBank.

  14. Origin of worldwide cultivated barley revealed by NAM-1 gene and grain protein content

    Directory of Open Access Journals (Sweden)

    Yonggang eWang

    2015-09-01

    Full Text Available The origin, evolution and distribution of cultivated barley provides powerful insights into the historic origin and early spread of agrarian culture. Here, population-based genetic diversity and phylogenetic analyses were performed to determine the evolution and origin of barley and how domestication and subsequent introgression have affected the genetic diversity and changes in cultivated barley on a worldwide scale. A set of worldwide cultivated and wild barleys from Asia and Tibet of China were analyzed using the sequences for NAM-1 gene and gene-associated traits-GPC (grain protein content. Our results showed Tibetan wild barley distinctly diverged from Near Eastern barley, and confirmed that Tibet is one of the origin and domestication centers for cultivated barley, and in turn supported a polyphyletic origin of domesticated barley. Comparison of haplotype composition among geographic regions revealed gene flow between Eastern and Western barley populations, suggesting that the Silk Road might have played a crucial role in the spread of genes. The GPC in the 118 cultivated and 93 wild barley accessions ranged from 6.73% to 12.35% with a mean of 9.43%. Overall, wild barley had higher averaged GPC (10.44% than cultivated barley. Two unique haplotypes (Hap2 and Hap7 caused by a base mutations (at position 544 in the coding region of the NAM-1 gene might have a significant impact on the GPC. SNPs and haplotypes of NAM-1 associated with GPC in barley could provide a useful method for screening GPC in barley germplasm. The Tibetan wild accessions with lower GPC could be useful for malt barley breeding

  15. Effects of n-butanol on barley microspore embryogenesis

    DEFF Research Database (Denmark)

    Castillo, Ana Maria; Nielsen, Nanna; Jensen, Anni;

    2014-01-01

    Doubled haploid (DH) production is an efficient tool in barley breeding, but efficiency of DH methods is not consistent. Hence, the aim of this study was to study the effect of n-butanol application on DH barley plant production efficiency. Five elite cultivars of barley and thirteen breeding...... crosses with different microspore embryogenesis capacities were selected for n-butanol application in anther and isolated microspore cultures. Application of 0.1 % n-butanol after a mannitol stress treatment in anther culture significantly increased the number of embryos (up to almost twice) and green...... plants (from 1.7 to 3 times) in three low-responding cultivars: Albacete, Astoria and Majestic. No significant differences on microspore embryogenesis efficiency were observed in medium and high responding cultivars. The application of n-butanol treatment to isolated microspores from cold treated spikes...

  16. Oligosaccharide binding to barley alpha-amylase 1

    DEFF Research Database (Denmark)

    Robert, X.; Haser, R.; Mori, H.;

    2005-01-01

    Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... insight into the substrate binding by describing residues defining 9 subsites, namely -7 through +2. These structures support that the pseudotetrasaccharide inhibitor acarbose is hydrolyzed by the active enzymes. Moreover, sugar binding was observed to the starch granule-binding site previously determined...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active site...

  17. Lysine metabolism in antisense C-hordein barley grains

    DEFF Research Database (Denmark)

    Schmidt, Daiana; Rizzi, Vanessa; Gaziola, Salete A;

    2015-01-01

    ) and five antisense C-hordein transgenic barley lines. Considering the amounts of soluble and protein-bound aspartate-derived amino acids together with the analysis of key enzymes of aspartate metabolic pathway, we suggest that the C-hordein suppression did not only alter the metabolism of at least one......The grain proteins of barley are deficient in lysine and threonine due to their low concentrations in the major storage protein class, the hordeins, especially in the C-hordein subgroup. Previously produced antisense C-hordein transgenic barley lines have an improved amino acid composition......, with increased lysine, methionine and threonine contents. The objective of the study was to investigate the possible changes in the regulation of key enzymes of the aspartate metabolic pathway and the contents of aspartate-derived amino acids in the nontransgenic line (Hordeum vulgare L. cv. Golden Promise...

  18. Factors underlying restricted crossover localization in barley meiosis.

    Science.gov (United States)

    Higgins, James D; Osman, Kim; Jones, Gareth H; Franklin, F Chris H

    2014-01-01

    Meiotic recombination results in the formation of cytological structures known as chiasmata at the sites of genetic crossovers (COs). The formation of at least one chiasma/CO between homologous chromosome pairs is essential for accurate chromosome segregation at the first meiotic division as well as for generating genetic variation. Although DNA double-strand breaks, which initiate recombination, are widely distributed along the chromosomes, this is not necessarily reflected in the chiasma distribution. In many species there is a tendency for chiasmata to be distributed in favored regions along the chromosomes, whereas in others, such as barley and some other grasses, chiasma localization is extremely pronounced. Localization of chiasma to the distal regions of barley chromosomes restricts the genetic variation available to breeders. Studies reviewed herein are beginning to provide an explanation for chiasma localization in barley. Moreover, they suggest a potential route to manipulating chiasma distribution that could be of value to plant breeders.

  19. Search for antisense copies of beta-globin mRNA in anemic mouse spleen

    Directory of Open Access Journals (Sweden)

    Taylor John M

    2001-03-01

    Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

  20. Gene Targeting Without DSB Induction Is Inefficient in Barley.

    Science.gov (United States)

    Horvath, Mihaly; Steinbiss, Hans-Henning; Reiss, Bernd

    2016-01-01

    Double strand-break (DSB) induction allowed efficient gene targeting in barley (Hordeum vulgare), but little is known about efficiencies in its absence. To obtain such data, an assay system based on the acetolactate synthase (ALS) gene was established, a target gene which had been used previously in rice and Arabidopsis thaliana. Expression of recombinases RAD51 and RAD54 had been shown to improve gene targeting in A. thaliana and positive-negative (P-N) selection allows the routine production of targeted mutants without DSB induction in rice. We implemented these approaches in barley and analysed gene targeting with the ALS gene in wild type and RAD51 and RAD54 transgenic lines. In addition, P-N selection was tested. In contrast to the high gene targeting efficiencies obtained in the absence of DSB induction in A. thaliana or rice, not one single gene targeting event was obtained in barley. These data suggest that gene targeting efficiencies are very low in barley and can substantially differ between different plants, even at the same target locus. They also suggest that the amount of labour and time would become unreasonably high to use these methods as a tool in routine applications. This is particularly true since DSB induction offers efficient alternatives. Barley, unlike rice and A. thaliana has a large, complex genome, suggesting that genome size or complexity could be the reason for the low efficiencies. We discuss to what extent transformation methods, genome size or genome complexity could contribute to the striking differences in the gene targeting efficiencies between barley, rice and A. thaliana.

  1. PHYSIOLOGICAL AND AGROECOLOGICAL ASPECTS OF CADMIUM INTERACTIONS WITH BARLEY PLANTS: AN OVERVIEW

    Directory of Open Access Journals (Sweden)

    A VASSILEV

    2003-07-01

    Full Text Available This work is a review of author’s previous publications, unpublished results as well as available literature on barley responses to Cd contamination. The physiological backgrounds of the acute Cd toxicity in barley plants are briefly described. Some data characterizing the chronic Cd toxicity in barley have been also provided in relation to its possible use for seed production and Cd phytoextraction on Cd-contaminated agricultural soils. Information about the main physiological factors limiting growth of Cd-exposed barley plants and grain yield, seedling quality as well as Cd phytoextraction capacity of barley grown in Cd-contaminated soils is presented.

  2. The transfer of {sup 137}Cs from barley to beer

    Energy Technology Data Exchange (ETDEWEB)

    Proehl, G.; Mueller, H.; Voigt, G. [Institut fuer Strahlenschutz, Oberschleibheim (Germany)] [and others

    1997-01-01

    Beer has been brewed from barley contaminated with {sup 137}Cs as a consequence of the Chernobyl accident. The {sup 137}Cs activity has been measured in all intermediate steps and in the by-products of the production process. About 35 % of the {sup 137}Cs in barley were recovered in beer. Processing factors defined as the concentration ratio of processed and raw products were determined to be 0.61, 3.3, 0.1 and 0.11 for malt, malt germs, spent grains and beer, respectively. 4 refs., 2 tabs.

  3. Implementation of biochemical screening to improve baking quality of Barley

    DEFF Research Database (Denmark)

    Aaslo, Per; Langkilde, Ane; Dionisio, Giuseppe

    2011-01-01

    Barley (Hordeum vulgare) is mostly used in feed and malt production but has the ability to provide humans nutritional benefits. The current wheat based “barley” breads can unfortunately not exceed more than 20% barley flour mixed into the dough due to poor leavening properties. Therefore...... the opportunity to give a forecast of the taste of the bread, as the AA composition is known to control certain aspects of the taste. We uses a MSE approach on a time of flight instrument coupled to a UPLC and in gel digestion to identify and characterize the different D-hordeins responsible for baking quality...

  4. Biotin Carboxyl Carrier Protein in Barley Chloroplast Membranes

    DEFF Research Database (Denmark)

    Kannangara, C. G.; Jense, C J

    1975-01-01

    Biotin localized in barley chloroplast lamellae is covalently bound to a single protein with an approximate molecular weight of 21000. It contains one mole of biotin per mole of protein and functions as a carboxyl carrier in the acetyl-CoA carboxylase reaction. The protein was obtained by solubil......Biotin localized in barley chloroplast lamellae is covalently bound to a single protein with an approximate molecular weight of 21000. It contains one mole of biotin per mole of protein and functions as a carboxyl carrier in the acetyl-CoA carboxylase reaction. The protein was obtained...

  5. DDR complex facilitates global association of RNA polymerase V to promoters and evolutionarily young transposons.

    Science.gov (United States)

    Zhong, Xuehua; Hale, Christopher J; Law, Julie A; Johnson, Lianna M; Feng, Suhua; Tu, Andy; Jacobsen, Steven E

    2012-09-01

    The plant-specific DNA-dependent RNA polymerase V (Pol V) evolved from Pol II to function in an RNA-directed DNA methylation pathway. Here, we have identified targets of Pol V in Arabidopsis thaliana on a genome-wide scale using ChIP-seq of NRPE1, the largest catalytic subunit of Pol V. We found that Pol V is enriched at promoters and evolutionarily recent transposons. This localization pattern is highly correlated with Pol V-dependent DNA methylation and small RNA accumulation. We also show that genome-wide chromatin association of Pol V is dependent on all members of a putative chromatin-remodeling complex termed DDR. Our study presents a genome-wide view of Pol V occupancy and sheds light on the mechanistic basis of Pol V localization. Furthermore, these findings suggest a role for Pol V and RNA-directed DNA methylation in genome surveillance and in responding to genome evolution.

  6. Characterization of the entire cystatin gene family in barley and their target cathepsin L-like cysteine-proteases, partners in the hordein mobilization during seed germination.

    Science.gov (United States)

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-11-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds.

  7. RNA Interference

    Science.gov (United States)

    ... NIGMS Home > Science Education > RNA Interference Fact Sheet RNA Interference Fact Sheet Tagline (Optional) Middle/Main Content Area What is RNA interference? RNA interference (RNAi) is a natural process ...

  8. Coupling of double-stranded RNA synthesis and siRNA generation in fission yeast RNAi.

    Science.gov (United States)

    Colmenares, Serafin U; Buker, Shane M; Buhler, Marc; Dlakić, Mensur; Moazed, Danesh

    2007-08-03

    The fission yeast centromeric repeats are transcribed and ultimately processed into small interfering RNAs (siRNAs) that are required for heterochromatin formation. siRNA generation requires dsRNA synthesis by the RNA-directed RNA polymerase complex (RDRC) and processing by the Dicer ribonuclease. Here we show that Dcr1, the fission yeast Dicer, is physically associated with RDRC. Dcr1 generates siRNAs in an ATP-dependent manner that requires its conserved N-terminal helicase domain. Furthermore, C-terminal truncations of Dcr1 that abolish its interaction with RDRC, but can generate siRNA in vitro, abolish siRNA generation and heterochromatic gene silencing in vivo. Finally, reconstitution experiments show that the association of Dcr1 with RDRC strongly stimulates the dsRNA synthesis activity of RDRC. Our results suggest that heterochromatic dsRNA synthesis and siRNA generation are physically coupled processes. This coupling has implications for cis-restriction of siRNA-mediated heterochromatin assembly and for mechanisms that give rise to siRNA strand polarity.

  9. Reactive oxygen species are involved in gibberellin/abscisic acid signaling in barley aleurone cells.

    Science.gov (United States)

    Ishibashi, Yushi; Tawaratsumida, Tomoya; Kondo, Koji; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Zheng, Shao-Hui; Yuasa, Takashi; Iwaya-Inoue, Mari

    2012-04-01

    Reactive oxygen species (ROS) act as signal molecules for a variety of processes in plants. However, many questions about the roles of ROS in plants remain to be clarified. Here, we report the role of ROS in gibberellin (GA) and abscisic acid (ABA) signaling in barley (Hordeum vulgare) aleurone cells. The production of hydrogen peroxide (H2O2), a type of ROS, was induced by GA in aleurone cells but suppressed by ABA. Furthermore, exogenous H2O2 appeared to promote the induction of α-amylases by GA. In contrast, antioxidants suppressed the induction of α-amylases. Therefore, H2O2 seems to function in GA and ABA signaling, and in regulation of α-amylase production, in aleurone cells. To identify the target of H2O2 in GA and ABA signaling, we analyzed the interrelationships between H2O2 and DELLA proteins Slender1 (SLN1), GA-regulated Myb transcription factor (GAmyb), and ABA-responsive protein kinase (PKABA) and their roles in GA and ABA signaling in aleurone cells. In the presence of GA, exogenous H2O2 had little effect on the degradation of SLN1, the primary transcriptional repressor mediating GA signaling, but it promoted the production of the mRNA encoding GAMyb, which acts downstream of SLN1 and involves induction of α-amylase mRNA. Additionally, H2O2 suppressed the production of PKABA mRNA, which is induced by ABA:PKABA represses the production of GAMyb mRNA. From these observations, we concluded that H2O2 released the repression of GAMyb mRNA by PKABA and consequently promoted the production of α-amylase mRNA, thus suggesting that the H2O2 generated by GA in aleurone cells is a signal molecule that antagonizes ABA signaling.

  10. RNA helicases

    OpenAIRE

    Owttrim, George W.

    2013-01-01

    Similar to proteins, RNA molecules must fold into the correct conformation and associate with protein complexes in order to be functional within a cell. RNA helicases rearrange RNA secondary structure and RNA-protein interactions in an ATP-dependent reaction, performing crucial functions in all aspects of RNA metabolism. In prokaryotes, RNA helicase activity is associated with roles in housekeeping functions including RNA turnover, ribosome biogenesis, translation and small RNA metabolism. In...

  11. RNA topology

    OpenAIRE

    Frank-Kamenetskii, Maxim D.

    2013-01-01

    A new variety on non-coding RNA has been discovered by several groups: circular RNA (circRNA). This discovery raises intriguing questions about the possibility of the existence of knotted RNA molecules and the existence of a new class of enzymes changing RNA topology, RNA topoisomerases.

  12. A weed suppressive index for spring barley (Hordeum vulgare) varieties

    DEFF Research Database (Denmark)

    Hansen, P K; Kristensen, K; Willas, J

    2008-01-01

    A screening programme for crop variety competitiveness would ideally be based on only a few, non-destructive measurements of key growth traits. In this study we measured the weed suppressive ability of 79 varieties of spring barley in two ways: (i) directly, by weed coverage assessments under wee...

  13. Zinc biofortification of cereals: rice differs from wheat and barley

    NARCIS (Netherlands)

    Stomph, T.J.; Jiang, W.; Struik, P.C.

    2009-01-01

    In their review, mainly focused on bread wheat (Triticum aestivum), durum wheat (Triticum durum) and barley (Hordeum vulgare), Palmgren et al. 1 M.G. Palmgren et al., Zinc biofortification of cereals: problems and solutions, Trends Plant Sci. 13 (2008), pp. 464–473. Article | PDF (905 K) | View Reco

  14. Evaluation of a malting barley quality assessment system

    NARCIS (Netherlands)

    Lonkhuijsen, H.J. van; Douma, A.C.; Angelino, S.A.G.F.

    1998-01-01

    New malting barley varieties are annually tested for their malting and brewing potential according to a field trial set-up combined with quality evaluation on pilot scale. To assess the effects of trial year and location on quality evaluation data, a data base consisting of quality data from Dutch m

  15. Synthesis of the major storage protein, hordein, in barley

    DEFF Research Database (Denmark)

    Giese, Nanna Henriette; Andersen, B.; Doll, Hans

    1983-01-01

    A liquid culture system for culturing detached spikes of barley (Hordeum vulgare L.) at different nutritional levels was established. The synthesis of hordein polypeptides was studied by pulse-labeling with [14C]sucrose at different stages of development and nitrogen (N) nutrition. All polypeptid...

  16. Radiation hybrid map of barley chromosome 3H

    Science.gov (United States)

    Assembly of the barley genome is complicated by its large size (5.1 Gb) and proportion of repetitive elements (84%). This process is facilitated by high resolution maps for aligning BAC contigs along chromosomes. Available genetic maps; however, do not provide accurate information on the physical po...

  17. Registration of Harriman low-phytate, hulled spring barley

    Science.gov (United States)

    The Agricultural Research Service, U.S. Department of Agriculture (USDA-ARS), has released 'Harriman', (Hordeum vulgare L.) (Reg. No. xxxxxx, P.I. xxxxxx). Harriman is a hulled, low-phytate barley, the second to be developed and released by the USDA-ARS. Compared to the previously released hulled, l...

  18. Barley coleoptile peroxidases. Purification, molecular cloning, and induction by pathogens

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Bloch, H.; Rasmussen, Søren Kjærsgård

    1999-01-01

    A cDNA clone encoding the Prx7 peroxidase from barley (Hordeum vulgare L.) predicted a 341-amino acid protein with a molecular weight of 36,515. N- and C-terminal putative signal peptides were present, suggesting a vacuolar location of the peroxidase. Immunoblotting and reverse-transcriptase poly...

  19. Reclamation of Sodic-Saline Soils. Barley Crop Response

    Directory of Open Access Journals (Sweden)

    Giovanna Cucci

    2008-12-01

    Full Text Available The research was aimed at assessing the salinity and sodicity effects of two soil types submitted to correction on barley crop. The two soils, contained in cylindrical pots (0.40 m in size and 0.60 m h supplied with a bottom valve for the collection of drainage water and located under shed to prevent the leaching action of rainfall, were clay-textured and saline and sodic-saline at barley seeding, as they had been cultivated for 4 consecutive years with different herbaceous species irrigated with 9 types of brackish water. In 2002-2003 the 2 salinized and sodium-affected soils (ECe and ESP ranging respectively from 5.84-20.27 dSm-1 to 2.83-11.19%, submitted to correction, were cultivated with barley cv Micuccio, and irrigated with fresh water (ECw = 0.5 dS m-1 and SAR = 0.45 whenever 30% of the maximum soil available moisture was lost by evapotranspiration. Barley was shown to be a salt-tolerant species and did not experience any salt stress when grown in soils with an initial ECe up to 11 dS m-1. When it was grown in more saline soils (initial ECe of about 20 dS m-1, despite the correction, it showed a reduction in shoot biomass and kernel yield by 26% and 36% respectively, as compared to less saline soils.

  20. Microgeographic Edaphic Differentiation in Hordein Polymorphisms of Wild Barley

    DEFF Research Database (Denmark)

    Nevo, E.; Beiles, A.; Storch, N.

    1983-01-01

    and topography. Likewise, significant correlations were found between hordein phenotypes and allozyme types detected in a previous study. Our results suggest that at least part of the hordein polymorphisms in wild barley is adaptive and selected by soil and topographic differences over very short distances....

  1. Wheat and barley differently affect porcine intestinal microbiota

    DEFF Research Database (Denmark)

    Weiss, Eva; Aumiller, Tobias; Spindler, Hanns K

    2016-01-01

    Diet influences the porcine intestinal microbial ecosystem. Barrows were fitted with ileal T-cannulas to compare short-term effects of eight different wheat or barley genotypes and period-to-period effects on seven bacterial groups in ileal digesta and faeces by qPCR. Within genotypes of wheat an...

  2. Classification and salt tolerance analysis of barley varieties

    NARCIS (Netherlands)

    Katerji, N.; Hoorn, van J.W.; Hamdy, A.; Mastrorilli, M.; Fares, C.; Ceccarelli, S.; Grando, S.; Oweis, T.

    2006-01-01

    Six varieties of barley (Hordeum vulgare), five of which were provided by ICARDA, were tested in a green house experiment for their salt tolerance. Afterwards the ICARDA variety Melusine, selected from this experiment for its combination of high yield and salt tolerance, was compared in a lysimeter

  3. Durum wheat and barley productivity in saline-drought environments

    NARCIS (Netherlands)

    Katerji, N.; Mastrorilli, M.; Hoorn, van J.W.; Lahmer, F.Z.; Hamdy, A.; Oweis, T.

    2009-01-01

    In two Successive years, durum wheat (Triticum turgidum Desf.) and barley (Hodeum vulgare L.) were tested in a factorial salinity-drought experiment, combining three levels of salinity and two levels of drought. The two drought treatments were obtained by applying irrigation water when the pre-dawn

  4. Expression of lipoxygenase isoenzymes in developing barley grains

    NARCIS (Netherlands)

    Schmitt, N.F.; Mechelen, J.R. van

    1997-01-01

    Expression of lipoxygenase was studied in whole developing barley grains from 5 days after flowering (DAF) to full maturity. Lipoxygenase showed two distinct peaks of activity. The first peak of activity occurred in the early stages of grain development from 5 until 20 DAF, whereas the second peak o

  5. Biotic stress in barley: disease problems and solutions

    Science.gov (United States)

    Barley (Hordeum vulgare L.) is cultivated over a wider geographic range than almost any other major crop species. It can be found growing from the tropics to the high latitudes and from the seacoast to the highest arable mountaintops. On marginal lands where alkaline soils, drought, or cold summer t...

  6. Wheat and barley seed systems in Ethiopia and Syria

    NARCIS (Netherlands)

    Bishaw, Z.

    2004-01-01

    Keywords: Wheat,Triticumspp., Barley,Hordeumvulgare L., Seed Systems, Formal Seed Sector, Informal Seed Sector, National Seed Program, Seed Source, Seed Selection, Seed Management, Seed Quality,

  7. Wheat and barley exposure to nanoceria: Implications for agricultural productivity

    Science.gov (United States)

    The impacts of man-made nanomaterials on agricultural productivity are not yet well understood. A soil microcosm study was performed to assess the physiological, phenological, and yield responses of wheat (Triticum aestivum) and barley (Hordeum vulgare L.) exposed to nanoceria (n...

  8. Evaluation of Wheat and Barley Cultivars Tolerance to Metribuzine Application

    Directory of Open Access Journals (Sweden)

    E Izadi Darbandi

    2013-08-01

    Full Text Available In order to study of barely and wheat cultivars tolerance to metribuzin, a factorial experiment was conducted as a completely randomized design, with three replications in Greenhouse of Agricultural Research at Ferdowsi University of Mashhad. Treatments included wheat cultivars (Backcross roshan, Cross Arvand, Bahar, Sepahan, Gascosion, Sayonez, Bam garmsiry, Garmsiri, Ghods, Pishtaz, Chamran and Shoori 6, barely cultivars (Macouyi, Karoon and Bahman and metribuzin application rates ( 0, 175, 350, 700, 1050, 1400 and 2100 gr. ai.ha-1. Metribuzine was applied at 3-4 leaf stage and 3 weeks after herbicide spraying, plants survival and their biomass were determined. Results showed that metribuzin application had a significant effect (p≤0.01 on barley and wheat dry weight. Based on results, mertibuzin application did not affect on barley cultivars up to 30 g.a.i.ha-1 but in wheat varieties lead to significant reduction in their biomass and survival. Increasing of metribuzin rates reduced wheat and barley cultivars biomass (p≤0.01. Barely varieties were less sensitive than wheat cultivars to metribuzine. The highest and the lowest ED50 in wheat cultivars were observed in cross arvand (940 and shoori (25 varieties, respectively. In barley cultivars the highest and lowest ED50 were observed in Macouyi (614 and Karoon (396, respectively.

  9. Spatial aggregation of pathotypes of barley powdery mildew

    DEFF Research Database (Denmark)

    O'Hara, R.B.; Brown, J.K.M.

    1997-01-01

    Aggregation in the distribution of pathotypes of Erysiphe graminis f.sp. hordei, the barley powdery mildew pathogen, was investigated in field plots of 'Golden Promise', 'Proctor' and 'Tyra'. 'Golden Promise' and 'Proctor' have no effective mildew resistance alleles, whereas 'Tyra' has Mla1, which...

  10. Dormant barley aleurone shows heterogeneity and a specific cytodifferentiation

    NARCIS (Netherlands)

    Schuurink, R.C.; Bakhuizen, R.; Libbenga, K.R.; Boulanger, F.; Sinjorgo, K.M.C.

    1997-01-01

    In response to gibberellic acid, aleurone layers isolated from dormant barley (Hordeum distichum L. cv. Triumph) kernels produced significantly less alpha-amylase than aleurones from non-dormant kernels. Light microscopical investigations using the dye acridine orange as well as electron microscopic

  11. Aspects of the barley seed proteome during development and germination

    DEFF Research Database (Denmark)

    Finnie, Christine; Maeda, K.; Østergaard, O.;

    2004-01-01

    Analysis of the water-soluble barley seed proteome has led to the identification of proteins by MS in the major spots on two-dimensional gels covering the pi ranges 4-7 and 6-11. This provides the basis for in-depth studies of proteome changes during seed development and germination, tissue...

  12. Chromatographic evidence that the AAA-coding isoacceptor of lysine tRNA primes DNA synthesis in murine mammary tumor virus

    Energy Technology Data Exchange (ETDEWEB)

    Waters, L.C.

    1981-07-30

    Most of the tRNA encapsulated within the murine mammary tumor virus is tRNA/sup LYS/. The reversed-phase chromatographic pattern of tRNA/sup LYS/ isoacceptors in the viral free tRNA and in the 70 S-associated tRNA that is released at 65/sup 0/ is similar to the pattern in virus-producing cells. However, the more tightly bound 70 S-associated tRNA/sup LYS/ is significantly enriched in the AAA-coding isoacceptor. This isoacceptor, but not the AAG-coding one, primes MuMTV 35 S RNA-directed DNA synthesis in vitro.

  13. Allelopathic effects of barley straw on germination and seedling growth of corn, sugar beet and sunflower

    Directory of Open Access Journals (Sweden)

    mohamad taghi naseri poor yazdi

    2009-06-01

    Full Text Available Allelopathic effects of barley straw and root on germination and growth of maize, sugar beet, and sunflower were investigated under glasshouse and laboratory experiments in Faculty of Agriculture, Ferdowsi University of Mashhad in 2006. The glasshouse experiment was designed based on randomized complete block design with three replications, treatments included: 0, 200, 400, 600 g/m² of grounded barley straw and also 0 and 50 g/m2 barley root. A laboratory experiment was carried out in order to study the effect of different concentrations of barley water extracts on germination and seedling characteristics of corn, sugar beet and sunflower. Treatments in laboratory trial included 0, 33, 50 and 100 percent of barley extracts. Results showed that leaf area of corn was significantly affected by barley straw treatments. Shoot dry matter and seed weight per plant in corn , leaf and tuber weight in sugar beet and leaf , stem weights , plant per plant in corn , leaf and tuber weight in sugar beet and leaf, stem weights, plant height, head diameter, head weight and seed weight in sunflower were significantly higher in treatment of 50g/m² barley roots. Crop seed germination decreased with increasing the amount of barley straw. The best germination response to barley extract was observed in corn. Maize radicle weight was significantly decreased with increasing concentration of barley water extract.

  14. iTAG Barley: A 9-12 curriculum to explore inheritance of traits and genes using Oregon Wolfe barley

    Science.gov (United States)

    Segregating plants from the Informative & Spectacular Subset (ISS) of the Oregon Wolfe doubled haploid barley (OWB) population are easily grown on a lighted window bench in the classroom. These lines originate from a wide cross and have exceptionally diverse and dramatic phenotypes, making this an i...

  15. Tocopherols and tocotrienols in barley oil prepared from germ and other fractions from scarification and sieving of hulless barley

    Science.gov (United States)

    Two cultivars of hulless barley (Doyce and Merlin), were scarified to abrade the outer layers of the kernels (germ, pericarp, and aleurone). The resulting scarification fines fractions were then separated into four particle size subfractions using sieves. Each of the size subfractions was then extr...

  16. The plant host can affect the encapsidation of brome mosaic virus (BMV) RNA: BMV virions are surprisingly heterogeneous.

    Science.gov (United States)

    Ni, Peng; Vaughan, Robert C; Tragesser, Brady; Hoover, Haley; Kao, C Cheng

    2014-03-01

    Brome mosaic virus (BMV) packages its genomic and subgenomic RNAs into three separate viral particles. BMV purified from barley, wheat, and tobacco have distinct relative abundances of the encapsidated RNAs. We seek to identify the basis for the host-dependent differences in viral RNA encapsidation. Sequencing of the viral RNAs revealed recombination events in the 3' untranslated region of RNA1 of BMV purified from barley and wheat, but not from tobacco. However, the relative amounts of the BMV RNAs that accumulated in barley and wheat are similar and RNA accumulation is not sufficient to account for the difference in RNA encapsidation. Virions purified from barley and wheat were found to differ in their isoelectric points, resistance to proteolysis, and contacts between the capsid residues and the RNA. Mass spectrometric analyses revealed that virions from the three hosts had different post-translational modifications that should impact the physiochemical properties of the virions. Another major source of variation in RNA encapsidation was due to the purification of BMV particles to homogeneity. Highly enriched BMV present in lysates had a surprising range of sizes, buoyant densities, and distinct relative amounts of encapsidated RNAs. These results show that the encapsidated BMV RNAs reflect a combination of host effects on the physiochemical properties of the viral capsids and the enrichment of a subset of virions. The previously unexpected heterogeneity in BMV should influence the timing of the infection and also the host innate immune responses.

  17. Determination of ergosterol levels in barley and malt varieties in the Czech Republic via HPLC.

    Science.gov (United States)

    Jedlicková, Lenka; Gadas, David; Havlová, Pavla; Havel, Josef

    2008-06-11

    Ergosterol is considered to be a suitable indicator of mold infestation in barley and malt. In this study ergosterol levels in different varieties of barley and malt produced in the Czech Republic were determined. A modified high-performance liquid chromatography (HPLC) method was statistically processed, validated (Effivalidation program), and applied to 124 samples of barley and malt. Ergosterol was isolated by extraction and saponification, and the quantification was performed using HPLC with diode array detection. The content of ergosterol ranged between the limit of detection (LOD) and 36.3 mg/kg in barley and between the LOD and 131.1 mg/kg in malt. Ergosterol is presumably connected with metabolites generated when barley grain is attacked by pathogens, and such barley often shows a high overfoaming (gushing) value. However, it was found that the content of ergosterol does not correlate with the degree of beer gushing.

  18. Cultivar and Environmental Variation of β-glucan Content in Chinese Barleys

    Institute of Scientific and Technical Information of China (English)

    CHEN Jin-xin; Zhang Guo-ping; QIANG Xiao-lin; WANG Jun-mei; DING Shou-ren

    2002-01-01

    β-glucan is a polysaccharide compound closely related to the quality of barley used as malting,feed and food. Low β-glucan content is expected for brewing and feed barley, while high β-glucan content is desirable for food barley. The β-glucan content of barley genotypes collected from various areas of China as well as from Canada and Australia were assayed. Meanwhile a multi-locations trial was conducted to determineβ-glucan content of 10 barley cultivars in 8 locations for two successive planting years. The results showed that barley genotypes from Tibet and Xinjiang had higher β-glucan content and the genotypes with higher than 8%of β-glucan content were detected in Tibet barleys, being valuable for use in the development of healthy food.Barley cultivars being planted now in winter-sowing areas of China had basically the same β-glucan content as those from Canada and Australia. Barley seeds produced in Hangzhou had lower β-glucan content than seeds from the original areas. There was a highly significant difference in β-glucan content among 10 barleys, 8locations and between years. On an average of two years, Xiumei 3 and Kongpei 1 had the highest and lowestβ-glucan content, respectively, and Taian and Hangzhou produced the highest and lowest β-glucan content barley seeds, respectively. Analysis of AMMI model showed that interaction effect between cultivar and environment was highly significant in both experimental years, and was dependent on cuitivar, suggesting that it is important to plant the suitable cultivars in a particular area in order to obtain barley seeds with reasonableβ-glucan content.

  19. Retention and growth performance of chicks given low-phytate conventional or hull-less barleys

    Science.gov (United States)

    Four low-phytate, hulled lines, M2 422 (now referred to as barley lpa1-1), M2 635 (now referred to as barley lpa3-1), M2 955 and M2 1070 (now referred to as barley lpa2-1), and a "hulless" version of M2 422, were evaluated in a chick feeding experiment. The diets were provided in meal form, with the...

  20. Assessment of the Seedling Reactions of Some Hulless Barley Genotypes to Drechslera teres f. maculata

    OpenAIRE

    Gerlegiz, Emine Tuba; KARAKAYA, Aziz; Celik Oguz, Arzu; MERT, Zafer; Sayim, İsmail; Ergun, Namuk; Aydogan, Sinan

    2015-01-01

    The seedling reactions of three barley cultivars, one hulless barley cultivar, two candidate hulless barley lines and nine hulless barley genotypes were determined under greenhouse conditions to ten isolates of Drechslera teres f. maculata, the causal agent of spot form of net blotch. Isolates were obtained from Ankara, Çankırı, Eskişehir, Kayseri, Konya and Şanlıurfa provinces. The reactions of the cultivars and hulless cultivar ranged between suscepible-resistant. The reactions of the hulle...

  1. Barley Sprouts Extract Attenuates Alcoholic Fatty Liver Injury in Mice by Reducing Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Yun-Hee Lee

    2016-07-01

    Full Text Available It has been reported that barley leaves possess beneficial properties such as antioxidant, hypolipidemic, antidepressant, and antidiabetic. Interestingly, barley sprouts contain a high content of saponarin, which showed both anti-inflammatory and antioxidant activities. In this study, we evaluated the effect of barley sprouts on alcohol-induced liver injury mediated by inflammation and oxidative stress. Raw barley sprouts were extracted, and quantitative and qualitative analyses of its components were performed. The mice were fed a liquid alcohol diet with or without barley sprouts for four weeks. Lipopolysaccharide (LPS-stimulated RAW 264.7 cells were used to study the effect of barley sprouts on inflammation. Alcohol intake for four weeks caused liver injury, evidenced by an increase in serum alanine aminotransferase and aspartate aminotransferase activities and tumor necrosis factor (TNF-α levels. The accumulation of lipid in the liver was also significantly induced, whereas the glutathione (GSH level was reduced. Moreover, the inflammation-related gene expression was dramatically increased. All these alcohol-induced changes were effectively prevented by barley sprouts treatment. In particular, pretreatment with barley sprouts significantly blocked inducible nitric oxide synthase (iNOS and cyclooxygenase (COX-2 expression in LPS-stimulated RAW 264.7. This study suggests that the protective effect of barley sprouts against alcohol-induced liver injury is potentially attributable to its inhibition of the inflammatory response induced by alcohol.

  2. Archaeogenetic evidence of ancient nubian barley evolution from six to two-row indicates local adaptation.

    Directory of Open Access Journals (Sweden)

    Sarah A Palmer

    Full Text Available BACKGROUND: Archaeobotanical samples of barley (Hordeum vulgare L. found at Qasr Ibrim display a two-row phenotype that is unique to the region of archaeological sites upriver of the first cataract of the Nile, characterised by the development of distinctive lateral bracts. The phenotype occurs throughout all strata at Qasr Ibrim, which range in age from 3000 to a few hundred years. METHODOLOGY AND FINDINGS: We extracted ancient DNA from barley samples from the entire range of occupancy of the site, and studied the Vrs1 gene responsible for row number in extant barley. Surprisingly, we found a discord between the genotype and phenotype in all samples; all the barley had a genotype consistent with the six-row condition. These results indicate a six-row ancestry for the Qasr Ibrim barley, followed by a reassertion of the two-row condition. Modelling demonstrates that this sequence of evolutionary events requires a strong selection pressure. CONCLUSIONS: The two-row phenotype at Qasr Ibrim is caused by a different mechanism to that in extant barley. The strength of selection required for this mechanism to prevail indicates that the barley became locally adapted in the region in response to a local selection pressure. The consistency of the genotype/phenotype discord over time supports a scenario of adoption of this barley type by successive cultures, rather than the importation of new barley varieties associated with individual cultures.

  3. Barley Sprouts Extract Attenuates Alcoholic Fatty Liver Injury in Mice by Reducing Inflammatory Response

    Science.gov (United States)

    Lee, Yun-Hee; Kim, Joung-Hee; Kim, Sou Hyun; Oh, Ji Youn; Seo, Woo Duck; Kim, Kyung-Mi; Jung, Jae-Chul; Jung, Young-Suk

    2016-01-01

    It has been reported that barley leaves possess beneficial properties such as antioxidant, hypolipidemic, antidepressant, and antidiabetic. Interestingly, barley sprouts contain a high content of saponarin, which showed both anti-inflammatory and antioxidant activities. In this study, we evaluated the effect of barley sprouts on alcohol-induced liver injury mediated by inflammation and oxidative stress. Raw barley sprouts were extracted, and quantitative and qualitative analyses of its components were performed. The mice were fed a liquid alcohol diet with or without barley sprouts for four weeks. Lipopolysaccharide (LPS)-stimulated RAW 264.7 cells were used to study the effect of barley sprouts on inflammation. Alcohol intake for four weeks caused liver injury, evidenced by an increase in serum alanine aminotransferase and aspartate aminotransferase activities and tumor necrosis factor (TNF)-α levels. The accumulation of lipid in the liver was also significantly induced, whereas the glutathione (GSH) level was reduced. Moreover, the inflammation-related gene expression was dramatically increased. All these alcohol-induced changes were effectively prevented by barley sprouts treatment. In particular, pretreatment with barley sprouts significantly blocked inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2 expression in LPS-stimulated RAW 264.7. This study suggests that the protective effect of barley sprouts against alcohol-induced liver injury is potentially attributable to its inhibition of the inflammatory response induced by alcohol. PMID:27455313

  4. Silencing structural and nonstructural genes in baculovirus by RNA interference.

    Science.gov (United States)

    Flores-Jasso, C Fabian; Valdes, Victor Julian; Sampieri, Alicia; Valadez-Graham, Viviana; Recillas-Targa, Felix; Vaca, Luis

    2004-06-01

    We review several aspects of RNAi and gene silencing with baculovirus. We show that the potency of RNAi in Spodoptera frugiperda (Sf21) insect cells correlates well with the efficiency of transfection of the siRNA. Using a fluorescein-labeled siRNA we found that the siRNA localized in areas surrounding the endoplasmic reticulum (ER). Both long (700 nucleotides long) and small ( approximately 25 nucleotides long) interfering RNAs were equally effective in initiating RNA interference (RNAi), and the duration of the interfering effect was indistinguishable. Even though RNAi in Sf21 cells is very effective, in vitro experiments show that these cells fragment the long dsRNA into siRNA poorly, when compared to HEK cells. Finally, we show that in vivo inhibition of baculovirus infection with dsRNA homologous to genes that are essential for baculovirus infectivity depends strongly on the amount of dsRNA used in the assays. Five hundred nanogram of dsRNA directly injected into the haemolymph of insects prevent animal death to over 95%. In control experiments, over 96% of insects not injected with dsRNA or injected with an irrelevant dsRNA died within a week. These results demonstrate the efficiency of dsRNA for in vivo prevention of a viral infection by virus that is very cytotoxic and lytic in animals.

  5. Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    Directory of Open Access Journals (Sweden)

    Nilsson Lena

    2010-11-01

    Full Text Available Abstract Background Gene silencing vectors based on Barley stripe mosaic virus (BSMV are used extensively in cereals to study gene function, but nearly all studies have been limited to genes expressed in leaves of barley and wheat. However since many important aspects of plant biology are based on root-expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species have created a need for tools to study gene function in these species. Results Here we demonstrate the successful BSMV-mediated virus induced gene silencing (VIGS of three different genes in barley roots, i.e. the barley homologues of the IPS1, PHR1, and PHO2 genes known to participate in Pi uptake and reallocation in Arabidopsis. Attempts to silence two other genes, the Pi transporter gene HvPht1;1 and the endo-β-1,4-glucanase gene HvCel1, in barley roots were unsuccessful, probably due to instability of the plant gene inserts in the viral vector. In B. distachyon leaves, significant silencing of the PHYTOENE DESATURASE (BdPDS gene was obtained as shown by photobleaching as well as quantitative RT-PCR analysis. On the other hand, only very limited silencing of the oat AsPDS gene was observed in both hexaploid (A. sativa and diploid (A. strigosa oat. Finally, two modifications of the BSMV vector are presented, allowing ligation-free cloning of DNA fragments into the BSMV-γ component. Conclusions Our results show that BSMV can be used as a vector for gene silencing in barley roots and in B. distachyon leaves and possibly roots, opening up possibilities for using VIGS to study cereal root biology and to exploit the wealth of genome information in the new cereal model plant B. distachyon. On the other hand, the silencing induced by BSMV in oat seemed too

  6. Enzymatic hydrolysis of pretreated barley and wheat straw

    DEFF Research Database (Denmark)

    Rosgaard, Lisa

    2007-01-01

    pretreatment conditions; hot water extraction and acid- or water impregnation followed by steam explosion showed there were slight differences between the effect of pretreatment conditions in relation to the overall yield from enzymatic hydrolysis. The highest glucose concentration was found for barley straw...... subjected to acid impregnation followed by steam explosion; however when the glucose concentration was related to the glucose potential in the substrates, the highest yield was obtained with hot water extracted. Analysis of the supernatants from the pretreatments by mass spectrometry showed that the water...... feeding strategy to increase the substrate loading in the hydrolysis reaction. The substrate for the enzymatic hydrolysis was primarily steam pretreated wheat and barley straw since these substrates were the primary feedstocks for the Babilafuente Bioethanol process. The initial work showed...

  7. Environmental and transgene expression effects on the barley seed proteome

    DEFF Research Database (Denmark)

    Finnie, Christine; Steenholdt, T.; Noguera, O.R.;

    2004-01-01

    The barley (Hordeum vulgare) cultivar Golden Promise is no longer widely used for malting, but is amenable to transformation and is therefore a valuable experimental cultivar. Its characteristics include high salt tolerance, however it is also susceptible to several fungal pathogens. Proteome....... Eleven of these were identified by mass spectrometric peptide mass mapping, including an abundant chitinase implicated in defence against fungal pathogens and a small heat-shock protein. To enable a comparison with transgenic seed protein patterns, differences in spot patterns between field...... with extra nitrogen. Finally, the fate of transgene products in barley seeds was followed. Spots containing two green fluorescent protein constructs and the herbicide resistance marker phosphinothricin acetyltransferase were observed in 2D-gel patterns of transgenic seeds and identified by mass spectrometry...

  8. Effect of ozone pretreatment on hydrogen production from barley straw.

    Science.gov (United States)

    Wu, Jiangning; Ein-Mozaffari, Farhad; Upreti, Simant

    2013-09-01

    Application of ozone technology to lignocellulosic biohydrogen production was explored with a barley straw. Ozone pretreatment effectively degraded the straw lignin and increased reducing sugar yield. A simultaneous enzyme hydrolysis and dark fermentation experiment was conducted using a mixed anaerobic consortium together with saccharification enzymes. Both untreated and ozonated samples produced hydrogen. Compared to the untreated group, hydrogen produced by the groups ozonated for 15, 30, 45 and 90 min increased 99%, 133%, 166% and 94%, respectively. Some inhibitory effect on hydrogen production was observed with the samples ozonated for 90 min, and the inhibition was on the fermentative microorganisms, not the saccharification enzymes. These results demonstrate that production of biohydrogen from barley straw, a lignocellulosic biomass, can be significantly enhanced by ozone pretreatment.

  9. In vitro fermentation of ten cultivars of barley silage

    Directory of Open Access Journals (Sweden)

    Federico Infascelli

    2010-01-01

    Full Text Available The fermentation characteristics of whole-crop barley silages from ten different cultivars were evaluated by the in vitro gas production technique. The organic matter degradability of barley silage (62.9% in average was comparable to those reported in our previous trials for oat (59.7% and sorghum silages (65.5%; while the maximum gas production rate (5.38 ml/h in average was slightly lower respect to oat (6.71 ml/h and sorghum silage (6.74 ml/h. The mean nutritive value (4.00 MJ/kg DM calculated on the basis of both chemical composition and in vitro fermentation data was comparable to that (4.16 MJ/kg DM obtained in our previous research performed on corn silage, from crop sowed in the same area.

  10. Pollen grain of barley (Hordeum vulgare L. - pattern of development

    Directory of Open Access Journals (Sweden)

    Maria Charzyńska

    2014-01-01

    Full Text Available Pollen development in barley follows the general pattern established for other species of Poaceae: 1 microspore division occurs at the vacuolate microspore stage with polarly located nucleus; 2 microspore mitosis is immediately followed by phragmoplast and cell plate formation; 3 in consequence or unequal microspore division, the generative cell, at first attached to the pollen wall, is separated from the vegetative cell by a callosic wall; 4 during the postmitotic two-cell stage of development, the vegetative nucleus migrates to the aperture pole and is followed by the generative cell that is detached and free of callose wall. In this position the generative cell divides into two sperm cells. These data do not confirm the interpretation of pollen grain development in barley given by Cass and Karas in Can. J. Bot. 53: 1051-1062, 1975.

  11. Barley grain enrichement with essential elements by agronomic biofortification

    Directory of Open Access Journals (Sweden)

    Dragičević Vesna D.

    2016-01-01

    Full Text Available Barley grain is rich in mineral nutrients, but their bioavailability to humans depends on antinutrients that restrain bioavailability and promoters that promote bioavailability. The aim of this study was to examine composition of barley grain, including phytate and phenolics as antinutrients, carotenoids and glutathione as promoters and mineral elements, such as Ca, Mg, Fe, Si, Zn and Mn influenced by various non-standard foliar fertilizers (Zircon, Chitosan, Siliplant, Propikonazole, including some hormonal growth-stimulators (Epin Extra, Benzyladenine, as potential biofortification measure. Chitosan increased glutathione concentration in grain. Unfavorable meteorological conditions were partly mitigated by application of Benzyladenine and Siliplant, reflected through increased potential bioavailability of P, Mg, Ca and Fe. [Projekat Ministarstva nauke Republike Srbije, br. TR-31037

  12. Resistance in winter barley against Ramularia leaf spot

    DEFF Research Database (Denmark)

    Hjortshøj, Rasmus Lund

    Ramularia leaf spot is an emerging disease in barley caused by R. collo-cygni. At present little is known about the resistance mechanisms carried out by the host plant to avoid disease development. Nor is the lifecycle of the fungus or its populations structure fully understood. To gain insight...... into these aspects four experiments were set up; (1) a mapping experiment aiming at identifying QTL’s controlling disease levels under field conditions was conducted in two winterbarley populations. (2) a toxin assay testing the parental lines used in the mapping populations for response to Rubellin D was developed....... (3) microarray analysis of transcriptional response in barley to inoculation with R. collo-cygni was carried out, and finally the (4) population genetic structure of R. collo-cygni was assessed by AFLP and gene sequencing. Based on these experiments interaction was compared to the interactions of C...

  13. Suppression of Zn stress on barley by irradiated chitosan

    Energy Technology Data Exchange (ETDEWEB)

    Nagasawa, N.; Mitomo, H. [Gunma Univ., Faculty of Engineering, Department of Biological and Chemical Engineering, Kiryu, Gunma (Japan); Ha, P.T.L. [Nuclear Research Institute, Dalat (Viet Nam); Watanabe, S.; Ito, T.; Takeshita, H.; Yoshii, F.; Kume, T. [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment

    2001-03-01

    Chitosan was irradiated up to 1000 kGy in solid state. Irradiation of chitosan caused the reduction of molecular weight. The molecular weight of the chitosan reduced from ca. 4 x 10{sup 5} to ca. 6 x 10{sup 3} by irradiation at 1000 kGy. For the barley growth promotion, irradiated chitosan showed the significant effect and 1000 kGy irradiated chitosan improved 20% of growth. Using the positron emitting tracer imaging system (PETIS), the effect of chitosan on uptake and transportation of {sup 62}Zn in barley were investigated. It was found that the transportation of Zn from root to shoot and the damage of plant by Zn were suppressed with irradiated chitosan. (author)

  14. Drivers of phosphorus uptake by barley following secondary resource application

    Directory of Open Access Journals (Sweden)

    Eva eBrod

    2016-05-01

    Full Text Available Minable rock phosphate is a finite resource. Replacing mineral phosphorus (P fertilizer with P-rich secondary resources is one way to manage P more efficiently, but the importance of physicochemical and microbial soil processes induced by secondary resources for plant P uptake are still poorly understood. Using radioactive labelling techniques, the fertilization effects of dairy manure, fish sludge, meat bone meal and wood ash were studied as P uptake by barley after 44 days and compared with those of water-soluble mineral P (MinP and an unfertilized control (NoP in a pot experiment with an agricultural soil containing little available P at two soil pH levels, approximately pH 5.3 (unlimed soil and pH 6.2 (limed soil. In a parallel incubation experiment, the effects of the secondary resources on physicochemical and microbial soil processes were studied. The results showed that the relative agronomic efficiency compared with MinP decreased in the order: manure ≥ fish sludge ≥ wood ash ≥ meat bone meal. The solubility of inorganic P in secondary resources was the main driver for P uptake by barley (Hordeum vulgare. The effects of secondary resources on physicochemical and microbial soil processes were of little overall importance. Application of organic carbon with manure resulted in microbial P immobilisation and decreased uptake by barley of P derived from the soil. On both soils, P uptake by barley was best explained by a positive linear relationship with the H2O + NaHCO3-soluble inorganic P fraction in fertilizers, or by a linear negative relationship with the HCl-soluble inorganic P fraction in fertilizers.

  15. Golgi localized barley MTP8 proteins facilitate Mn transport.

    Science.gov (United States)

    Pedas, Pai; Schiller Stokholm, Michaela; Hegelund, Josefine Nymark; Ladegård, Anne Hald; Schjoerring, Jan Kofod; Husted, Søren

    2014-01-01

    Many metabolic processes in plants are regulated by manganese (Mn) but limited information is available on the molecular mechanisms controlling cellular Mn homeostasis. In this study, a yeast assay was used to isolate and characterize two genes, MTP8.1 and MTP8.2, which encode membrane-bound proteins belonging to the cation diffusion facilitator (CDF) family in the cereal species barley (Hordeum vulgare). Transient expression in onion epidermal cells showed that MTP8.1 and MTP8.2 proteins fused to the green fluorescent protein (GFP) are localized to Golgi. When heterologously expressed in yeast, MTP8.1 and MTP8.2 were found to be Mn transporters catalysing Mn efflux in a similar manner as the Golgi localized endogenous yeast protein Pmr1p. The level of MTP8.1 transcripts in barley roots increased with external Mn supply ranging from deficiency to toxicity, while MTP8.2 transcripts decreased under the same conditions, indicating non-overlapping functions for the two genes. In barley leaves, the expression of both MTP8 genes declined in response to toxic Mn additions to the roots suggesting a role in ensuring proper delivery of Mn to Golgi. Based on the above we suggest that barley MTP8 proteins are involved in Mn loading to the Golgi apparatus and play a role in Mn homeostasis by delivering Mn to Mn-dependent enzymes and/or by facilitating Mn efflux via secretory vesicles. This study highlights the importance of MTP transporters in Mn homeostasis and is the first report of Golgi localized Mn2+ transport proteins in a monocot plant species.

  16. Ethylene production and peroxidase activity in aphid-infested barley.

    Science.gov (United States)

    Argandoña, V H; Chaman, M; Cardemil, L; Muñoz, O; Zúñiga, G E; Corcuera, L J

    2001-01-01

    The purpose of this work was to investigate whether ethylene is involved in the oxidative and defensive responses of barley to the aphids Schizaphis graminum (biotype C) and Rhopalophum padi. The effect of aphid infestation on ethylene production was measured in two barley cultivars (Frontera and Aramir) that differ in their susceptibility to aphids. Ethylene evolution was higher in plants infested for 16 hr than in plants infested for 4 hr in both cultivars. Under aphid infestation, the production of ethylene was higher in cv. Frontera than in Aramir, the more aphid susceptible cultivar. Ethylene production also increases with the degree of infestation. Maximum ethylene evolution was detected after 16 hr when plants were infested with 10 or more aphids. Comparing the two species of aphids, Schizaphis graminum induced more ethylene evolution than Rhopalosiphum padi. Infestation with S. graminum increased hydrogen peroxide content and total soluble peroxidase activity in cv. Frontera, with a maximum level of H2O2 observed after 20 min of infestation and the maximum in soluble peroxidase activity after 30 min of infestation. When noninfested barley seedlings from cv. Frontera were exposed to ethylene, an increase in hydrogen peroxide and in total peroxidase activity was detected at levels similar to those of infested plants from cv. Frontera. When noninfested plants were treated with 40 ppm of ethylene, the maximum levels of H2O2 and soluble peroxidase activity were at 10 and 40 min, respectively. Ethylene also increased the activity of both cell-wall-bound peroxidases types (ionically and covalently bound), comparable with infestation. These results suggest that ethylene is involved in the oxidative responses of barley plants induced by infestation.

  17. Nutritional assessment of barley, talbina and their germinated products

    Directory of Open Access Journals (Sweden)

    Mohamed kamal El-Sayed Youssef

    2013-02-01

    Full Text Available Talbina is a food product with high potential applications as a functional food. Talbina was prepared from two barley varieties namely: Giza126 and Giza130 by adding whole barley flour to water (1:10 w/v and (1:5 w/v for germinated barley then heating at  80° C for 5 minutes with continuous stirring until reaching a porridge like texture. The present investigation was carried out in an attempt to clearly the nutritional assessment of talbina as a functional food. The study included the determination of gross chemical composition, caloric value, mineral composition, vitamins composition and the amino acids composition. Meanwhile, computation of the chemical scores (CS and A/E ratios were carried out for raw, germinated barley, talbina, germinated talbina and commercial talbina. The data revealed that protein content of the all raw studied and processing treatments ranged from 8.75-18.34g/100g on dry weight basis. Besides, the all treatments recorded rather slight decrease in crude fat content. Likewise, ash and carbohydrates ranged between 2.29-2.86 and 73.40-82.66%, respectively. Whereas crude fiber had an increase after treatments and it ranged from 3.83-4.37%. On the other hand by making talbina iron, manganese, copper and zinc increased especially zinc, which recorded higher value than that recommended daily. Furthermore, germinated talbina130 recorded the highest amounts of vitamins B2, Nicotinic acid, B6 and folic acid. Moreover, the present study indicated that phenylalanine was the highest essential amino acid, followed by leucine.

  18. Dynamics of phosphorus compounds in ripening and germinating cereal grains. Part I. Changes in phosphorus compounds content during ripening of wheat, barley and rye grains

    Directory of Open Access Journals (Sweden)

    J. Tłuczkiewicz

    2015-01-01

    Full Text Available The dynamics of phosphorus compounds was followed in ripening wheat (Grana, barley (Kosmos and rye (Pancerne seeds. In the investigated ontogenesis period the content in the seeds of total and acid-soluble phosphorus doubled. The phosphorus of free phytin and phytin that bound with proteins increased to the end of maturation. In dormant seeds the contribution of phosphorus bound with phytin was 62-70 per cent of total P. As the seeds ripened, the content of inorganic and nucleotides-P decreased, while that of saccharides-P and their metabolites started to decrease from the moment of wax ripeness. Later RNA-P and DNA-P level decreased only slight.ly and that of lipids-P markedly. Phosphoproteid content diminished at the beginning of ripening and further remained at almost the same level. Wheat, barley and rye seed exhibited similar dynamics of metabolically active (nucleotides, saccharide-P esters and their metabolites, functional (nucleic acids and structural (phospholipids phosphorus compounds. Accumulation of storage forms (phytin of phosphorus was higher in wheat and successively lower in rye and barley.

  19. The promoter of the barley aleurone-specific gene encoding a putative 7 kDa lipid transfer protein confers aleurone cell-specific expression in transgenic rice.

    Science.gov (United States)

    Kalla, R; Shimamoto, K; Potter, R; Nielsen, P S; Linnestad, C; Olsen, O A

    1994-12-01

    This paper describes the aleurone-specific gene Ltp2 from barley, which encodes a putative 7 kDa non-specific lipid transfer protein. As shown by Northern and in situ hybridization analyses, the Ltp2 transcript is present in barley aleurone cells shortly after the initiation of aleurone cell differentiation. The expression of Ltp2 increases until grain mid-maturity, but the mRNA is absent from mature grains. The Ltp2 transcript is undetectable in the embryo and vegetative tissues, confirming the aleurone specificity of the Ltp2 gene. The ability of the isolated 801 bp Ltp2 promoter to direct aleurone-specific expression in immature barley grains is demonstrated by particle bombardment experiments. In these experiments, the activity of the Ltp2 promoter is 5% of the activity of the strong constitutive Actin1 promoter from rice, as quantified by GUS activity measurements. In stably transformed rice plants containing the Ltp2 promoter-Gus construct, the specificity of the Ltp2 promoter is confirmed in vivo by the presence of GUS activity exclusively in the aleurone layer. This study demonstrates the conserved nature of the regulatory signals involved in aleurone-specific gene transcription in cereal grains.

  20. Effects of ethylene on root elongation in barley and rice

    Energy Technology Data Exchange (ETDEWEB)

    John, A.; Hall, M.A.; Crossett, R.N.

    1972-01-01

    Experiments were performed to determine the effects of rice and barley to growth inhibition by ethylene. The mechanism of growth inhibition was investigated at the cellular level and a detailed comparison was made between the responses of the two species. The following measurements were made on intact plants in short (up to 200 minutes), medium (up to 3 days) or long (up to 10 days) experiments: the rate of extension growth of main root axes; the final cell length and number of elongating cells produced; and the extensibility of the apical growing region. Results indicate that the effects of ethylene on the elongation of roots of rice and barley plants are different. In barley there is a rapid inhibition of root extension which persists with prolonged exposure to the gas but with little effect on the production of growing cells. However, rice roots exhibit no rapid growth inhibition response, but a reduction does occur after prolonged exposure. Low concentrations promote extension rice roots. The inhibition of root growth is reflected in a reduced extensibility of the apical growing region.

  1. Nitrate Uptake into Barley (Hordeum vulgare) Plants 1

    Science.gov (United States)

    Deane-Drummond, Celia E.; Glass, Anthony D. M.

    1982-01-01

    Evidence is presented that chlorate is an extremely good analog for nitrate during nitrate uptake by intact barley (Hordeum vulgare cv. Fergus) roots. The depletion of ClO3− or NO3− from uptake media over 2 to 6 hours by seedlings was found to be dependent on combined NO3− plus ClO3− concentrations, and total anion uptake was equivalent at different NO3−/ClO3− ratios. After loading barley seedlings with 36ClO3− for 6 hours, kinetic parameters were derived from the analysis of efflux of [36Cl] chlorate into unlabeled solution. On the basis of this analysis, the half times for exchange for the cytoplasmic and vacuolar phases were 17 minutes and 20 hours, respectively. Data pooled from a number of different experiments were used to calculate kinetic constants (Km and Vmax) for 36ClO3− influx into barley roots at different external ClO3−/NO3− ratios, using short (10 minutes) influx times. There appeared to be no discrimination by the root cells between ClO3− and NO3−. Lineweaver-Burk analysis of the interaction between nitrate and chlorate were characteristic of competitive inhibition at low nitrate concentrations (0-0.5 mm). At higher concentrations, in the range of >1 mm, similar interactions between these ions were evident. PMID:16662478

  2. The Metabolic Signature of Biomass Formation in Barley.

    Science.gov (United States)

    Ghaffari, Mohammad R; Shahinnia, Fahimeh; Usadel, Björn; Junker, Björn; Schreiber, Falk; Sreenivasulu, Nese; Hajirezaei, Mohammad R

    2016-09-01

    The network analysis of genome-wide transcriptome responses, metabolic signatures and enzymes' relationship to biomass formation has been studied in a diverse panel of 12 barley accessions during vegetative and reproductive stages. The primary metabolites and enzymes involved in central metabolism that determine the accumulation of shoot biomass at the vegetative stage of barley development are primarily being linked to sucrose accumulation and sucrose synthase activity. Interestingly, the metabolic and enzyme links which are strongly associated with biomass accumulation during reproductive stages are related to starch accumulation and tricarboxylic acid (TCA) cycle intermediates citrate, malate, trans-aconitate and isocitrate. Additional significant associations were also found for UDP glucose, ATP and the amino acids isoleucine, valine, glutamate and histidine during the reproductive stage. A network analysis resulted in a combined identification of metabolite and enzyme signatures indicative for grain weight accumulation that was correlated with the activity of ADP-glucose pyrophosphorylase (AGPase), a rate-limiting enzyme involved in starch biosynthesis, and with that of alanine amino transferase involved in the synthesis of storage proteins. We propose that the mechanism related to vegetative and reproductive biomass formation vs. seed biomass formation is being linked to distinct fluxes regulating sucrose, starch, sugars and amino acids as central resources. These distinct biomarkers can be used to engineer biomass production and grain weight in barley.

  3. Genetic analysis of aluminum tolerance in Brazilian barleys

    Directory of Open Access Journals (Sweden)

    Minella Euclydes

    2002-01-01

    Full Text Available Aluminum (Al toxicity is a major factor limiting barley growth in acid soils, and genotypes with adequate level of tolerance are needed for improving barley adaptation in Brazil. To study the inheritance of Al tolerance in Brazilian barleys, cultivars Antarctica 1, BR 1 and FM 404 were crossed to sensitive Kearney and PFC 8026, and intercrossed. Parental, F1, F2 and F6 generations were grown in nutrient solution containing 0.03, 0.05 and 0.07 mM of Al and classified for tolerance by the root tip hematoxylin staining assay. Tolerant by sensitive F2 progenies segregated three tolerant to one sensitive, fitting the 3:1 ratio expected for a single gene. The F6 populations segregated one tolerant to one sensitive also fitting a monogenic ratio. The F2 seedlings from crosses among tolerant genotypes scored the same as the parents. Since the population size used would allow detection of recombination as low as 7%, the complete absence of Al sensitive recombinants suggests that tolerance in these cultivars is most probably, controlled by the same gene. Thus, the potential for improving Al tolerance through recombination of these genotypes is very low and different gene sources should be evaluated.

  4. Alleviation of Al Toxicity in Barley by Addition of Calcium

    Institute of Scientific and Technical Information of China (English)

    GUO Tian-rong; CHEN Ying; ZHANG Yan-hua; JIN Ye-fei

    2006-01-01

    The potential mechanism by which Ca alleviates Al toxicity was investigated in barley seedlings. It was found that 100 μM Al-alone treatment inhibited barley plant growth and thereby reduced shoot height and root length, and dry weights of root, shoot and leaf; promoted Al accumulation but inhibited Ca absorption in plant tissues; and induced an increase in the activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) and in the level of lipid peroxidation (MDA content) in leaves. Except for the increase in Ca concentration in plant tissues, treatment with 0.5 mM Ca in the absence of Al had less effect on the above-mentioned parameters, compared with the control. Addition of Ca efficiently reduced Al toxicity, which is reflected by the promotion of plant growth, reduction in Al concentration and MDA content,increase in Ca concentration and in SOD, POD, and CAT activities compared with the Al-alone-treatment; with increase in Ca level (3.0 mM), the ameliorative effect became more dominant. This indicated that the alleviation of aluminum toxicity in barley seedlings with Ca supplementation could be associated with less absorption of Al and the enhancement of the protective ability of the cell because of increased activity of the antioxidative enzyme.

  5. Pysicochemical properties of Tibetan hull-less barley starch.

    Science.gov (United States)

    Yangcheng, Hanyu; Gong, Lingxiao; Zhang, Ying; Jane, Jay-lin

    2016-02-10

    Objectives of this study were to (1) determine the starch physicochemical properties of two commercial Tibetan hull-less barley varieties, Beiqing (BQ) and Kangqing (KQ); and (2) understand the relationship between unique properties of the starches, their structures, and impacts of growing conditions. The BQ barleys were grown at a location with lower temperature and less rainfall compared with the KQ barleys. The BQ starches showed significantly lower onset-gelatinization temperature (54.1-54.9 °C), larger gelatinization-temperature range (9.4-10.6 °C), and higher peak-viscosities (138.9-153.9RVU) than the KQ starches (55.1-56.1 °C, 7.4-8.8 °C, and 63.4-64.7RVU, respectively). After a treatment with 2% sodium-dodecyl-sulphate solution, the KQ starches showed substantially greater increases in peak viscosities than the BQ starches. Annealing of starch and enhanced amylose-lipid complex formation, resulting from higher growing temperature during the development of the KQ starches, likely contributed to the differences in thermal and pasting properties between the BQ and KQ starches.

  6. Screening of the aerodynamic and biophysical properties of barley malt

    Science.gov (United States)

    Ghodsvali, Alireza; Farzaneh, Vahid; Bakhshabadi, Hamid; Zare, Zahra; Karami, Zahra; Mokhtarian, Mohsen; Carvalho, Isabel. S.

    2016-10-01

    An understanding of the aerodynamic and biophysical properties of barley malt is necessary for the appropriate design of equipment for the handling, shipping, dehydration, grading, sorting and warehousing of this strategic crop. Malting is a complex biotechnological process that includes steeping; germination and finally, the dehydration of cereal grains under controlled temperature and humidity conditions. In this investigation, the biophysical properties of barley malt were predicted using two models of artificial neural networks as well as response surface methodology. Stepping time and germination time were selected as the independent variables and 1 000 kernel weight, kernel density and terminal velocity were selected as the dependent variables (responses). The obtained outcomes showed that the artificial neural network model, with a logarithmic sigmoid activation function, presents more precise results than the response surface model in the prediction of the aerodynamic and biophysical properties of produced barley malt. This model presented the best result with 8 nodes in the hidden layer and significant correlation coefficient values of 0.783, 0.767 and 0.991 were obtained for responses one thousand kernel weight, kernel density, and terminal velocity, respectively. The outcomes indicated that this novel technique could be successfully applied in quantitative and qualitative monitoring within the malting process.

  7. RNA Crystallization

    Science.gov (United States)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  8. MicroRNA-mediated regulation of flower development in grasses.

    Science.gov (United States)

    Smoczynska, Aleksandra; Szweykowska-Kulinska, Zofia

    2016-01-01

    Flower structure in grasses is very unique. There are no petals or sepals like in eudicots but instead flowers develop bract-like structures - palea and lemma. Reproductive organs are enclosed by round lodicule that not only protects reproductive organs but also plays an important role during flower opening. The first genetic model for floral organ development was proposed 25 years ago and it was based on the research on model eudicots. Since then, studies have been carried out to answer the question whether this model could be applicable in the case of monocots. Genes from all classes found in eudicots have been also identified in genomes of such monocots like rice, maize or barley. What's more, it seems that miRNA-mediated regulation of floral organ genes that was observed in the case of Arabidopsis thaliana also takes place in monocots. MiRNA172, miRNA159, miRNA171 and miRNA396 regulate expression of floral organ identity genes in barley, rice and maize, affecting various features of the flower structure, ranging from formation of lemma and palea to the development of reproductive organs. A model of floral development in grasses and its genetic regulation is not yet fully characterized. Further studies on both, the model eudicots and grasses, are needed to unravel this topic. This review provides general overview of genetic model of flower organ identity specification in monocots and it's miRNA-mediated regulation.

  9. Expression levels of barley Cbf genes at the Frost resistance-H2 locus are dependent upon alleles at Fr-H1 and Fr-H2.

    Science.gov (United States)

    Stockinger, Eric J; Skinner, Jeffrey S; Gardner, Kip G; Francia, Enrico; Pecchioni, Nicola

    2007-07-01

    Genetic analyses have identified two loci in wheat and barley that mediate the capacity to overwinter in temperate climates. One locus co-segregates with VRN-1, which affects the vernalization requirement. This locus is known as Frost resistance-1 (Fr-1). The second locus, Fr-2, is coincident with a cluster of more than 12 Cbf genes. Cbf homologs in Arabidopsis thaliana play a key regulatory role in cold acclimatization and the acquisition of freezing tolerance. Here we report that the Hordeum vulgare (barley) locus VRN-H1/Fr-H1 affects expression of multiple barley Cbf genes at Fr-H2. RNA blot analyses, conducted on a 'Nure'x'Tremois' barley mapping population segregating for VRN-H1/Fr-H1 and Fr-H2, revealed that transcript levels of all cold-induced Cbf genes at Fr-H2 were significantly higher in recombinants harboring the vrn-H1 winter allele than in recombinants harboring the Vrn-H1 spring allele. Steady-state Cbf2 and Cbf4 levels were also significantly higher in recombinants harboring the Nure allele at Fr-H2. Additional experiments indicated that, in vrn-H1 genotypes requiring vernalization, Cbf expression levels were dampened after plants were vernalized, and dampened Cbf expression was accompanied by robust expression of Vrn-1. Cbf levels were also significantly higher in plants grown under short days than under long days. Experiments in wheat and rye indicated that similar regulatory mechanisms occurred in these plants. These results suggest that VRN-H1/Fr-H1 acts in part to repress or attenuate expression of the Cbf at Fr-H2; and that the greater level of low temperature tolerance attributable to the Nure Fr-H2 allele may be due to the greater accumulation of Cbf2 and Cbf4 transcripts during normal growth and development.

  10. Influence of diurnal photosynthetic activity on the morphology, structure, and thermal properties of normal and waxy barley starch

    DEFF Research Database (Denmark)

    Goldstein, Avi; Annor, George; Vamadevan, Varatharajan

    2017-01-01

    This study investigated the influence of diurnal photosynthetic activity on the morphology, molecular composition, crystallinity, and gelatinization properties of normal barley starch (NBS) and waxy barley starch (WBS) granules from plants cultivated in a greenhouse under normal diurnal (16h light...... that normal barley starch is less influenced by the diurnal photosynthetic lighting regime than amylose-free barley starch suggesting a role of amylose to prevent structural disorder and increase starch granule robustness against environmental cues....

  11. Messenger RNAs from the Scutellum and Aleurone of Germinating Barley Encode (1-->3,1-->4)-beta-d-Glucanase, alpha-Amylase and Carboxypeptidase

    DEFF Research Database (Denmark)

    Mundy, John; Brandt, Anders; Fincher, Geoffrey B

    1985-01-01

    Polyclonal antibodies raised against barley (1-->3,1-->4)-beta-d-glucanase, alpha-amylase and carboxypeptidase were used to detect precursor polypeptides of these hydrolytic enzymes among the in vitro translation products of mRNA isolated from the scutellum and aleurone of germinating barley....... In the scutellum, mRNA encoding carboxypeptidase appeared to be relatively more abundant than that encoding alpha-amylase or (1-->3,1-->4)-beta-d-glucanase, while in the aleurone alpha-amylase and (1-->3,1-->4)-beta-d-glucanase mRNAs predominated. The apparent molecular weights of the precursors for (1......-->3,1-->4)-beta-d-glucanase, alpha-amylase, and carboxypeptidase were 33,000, 44,000, and 35,000, respectively. In each case these are slightly higher (1,500-5,000) than molecular weights of the mature enzymes. Molecular weights of precursors immunoprecipitated from aleurone and scutellum mRNA translation...

  12. Removal and isolation of germ-rich fractions from hull-less barley using a fitzpatrick comminuting mill

    Science.gov (United States)

    A process was developed to produce a germ-enriched fraction from hull-less barley using a Fitzpatrick Comminuting Mill followed by sieving. Hulled and hull-less barleys contain 1.5-2.5% oil and, like wheat kernels which contain wheat germ oil, much of the oil in barley kernels is in the germ fracti...

  13. Identification of Circular RNAs From the Parental Genes Involved in Multiple Aspects of Cellular Metabolism in Barley

    Directory of Open Access Journals (Sweden)

    Behrooz eDarbani

    2016-06-01

    Full Text Available RNA circularization made by head-to-tail back-splicing events is involved in the regulation of gene expression from transcriptional to post-translational levels. By exploiting RNA-Seq data and down-stream analysis, we shed light on the importance of circular RNAs in plants. The results introduce circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes including protein coding transcripts, microRNA, rRNA, and long non-coding/microprotein coding RNAs. The results shed light on the mitochondrial exonic circular RNAs and imply the importance of circular RNAs for regulation of mitochondrial genes. Importantly, we introduce circular RNAs in barley and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs' functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear transcripts.Keywords: circular RNAs, coding and non-coding transcripts, leaves, seeds, transfer cells, micronutrients, mitochondria

  14. Dryland malt barley yield and quality affected by tillage, cropping sequence, and nitrogen fertilization

    Science.gov (United States)

    Information is needed on the effects of management practices on dryland malt barley (Hordeum vulgaris L.) and pea (Pisum sativum L.) yields and quality. We evaluated the effects of tillage and cropping sequence combination and N fertilization on dryland malt barley and pea yields, grain characterist...

  15. Malt barley yield and quality affected by irrigation, tillage, crop rotation, and nitrogen fertilization

    Science.gov (United States)

    Little is known about the comparison of management practices on malt barley (Hordeum vulgare L.) yield and quality in irrigated and non-irrigated cropping systems. We evaluated the effects of irrigation, tillage, cropping system, and N fertilization on malt barley yield and quality in a sandy loam s...

  16. Influence of alkali catalyst on product yield and properties via hydrothermal liquefaction of barley straw

    DEFF Research Database (Denmark)

    Zhu, Z.; Toor, Saqib; Rosendahl, Lasse

    2015-01-01

    Barley straw was successfully converted to bio-crude by hydrothermal liquefaction at temperature of 280 e400 C using an alkali catalyst (K2CO3) in our previous work, and the maximum bio-crude yield was obtained at 300 C. This paper extends previous work on studying liquefaction behavior of barley...

  17. Regrowth in Barley (Hordeum vulgare L.) and Rye (Secale cereale L.)

    DEFF Research Database (Denmark)

    Christiansen, J L; Jørgensen, Johannes Ravn; Jørnsgård, B;

    1998-01-01

    Regrowth after cutting at four development stages, from heading to grain maturity, was investigated in a pot experiment containing three rye and four barley varieties (including 2 Hordeum spontaneum lines). Regrowth in the barley varieties decreased strongly from heading to grain maturity. Rye ge...

  18. Integration of weed management and tillage practices in spring barley production

    Science.gov (United States)

    Spring barley can be used to diversify and intensify winter wheat-based production systems in the U.S. Pacific Northwest, but the response of barley to conservation tillage systems, which are needed to reduce the risk of soil erosion, is not well documented. The objective of this study was to descri...

  19. Lysine Rich Proteins in the Salt-Soluble Protein Fraction of Barley

    DEFF Research Database (Denmark)

    Ingversen, J.; Køie, B.

    1973-01-01

    Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2.......Fractionation of the protein complex from Emir barley showed that the salt-soluble fraction accounts for 44% of the total lysine content but only for 2....

  20. Transformation of Barley (Hordeum vulgar L.) by Agrobacterium tumefasciens Infection of In Vitro Cultured Ovules

    DEFF Research Database (Denmark)

    Holme, Inger Bæksted; Brinch-Pedersen, Henrik; Lange, Mette;

    2012-01-01

    Agrobacterium-mediated transformation of in vitro cultured barley ovules is an attractive alternative to well-established barley transformation methods of immature embryos. The ovule culture system can be used for transformation with and without selection and has successfully been used to transform...

  1. Compositional equivalence of barleys differing only in low and normal phytate levels

    Science.gov (United States)

    Recent breeding advances have led to the development of several barley lines with reduced levels of phytate. One of them was further developed and released as a hulless low phytate cultivar (Clearwater). Because barley oil contains high levels of tocotrienols and other functional lipids, we conduc...

  2. Investigation of the effect of nitrogen on severity of Fusarium Head Blight in barley

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, J.D.; Spliid, N.H.;

    2010-01-01

    The effect of nitrogen on Fusarium Head Blight (FHB) in a susceptible barley cultivar was investigated using gel-based proteomics. Barley grown with either 15 or 100 kg ha(-1)N fertilizer was inoculated with Fusarium graminearum (Fg). The storage protein fraction did not change significantly...

  3. Localization to Chromosomes of Structural Genes for the Major Protease Inhibitors of Barley Grains

    DEFF Research Database (Denmark)

    Hejgaard, Jørn; Bjørn, S.E.; Nielsen, Gunnar Gissel

    1984-01-01

    Wheat-barley chromosome addition lines were compared by isoelectric focusing of protein extracts to identify chromosomes carrying loci for the major immunochemically distinct protease inhibitors of barley grains. Structural genes for the following inhibitors were localized: an inhibitor of both...

  4. Determinants of barley grain yield in a wide range of Mediterranean environments

    NARCIS (Netherlands)

    Francia, E.; Tondelli, A.; Rizza, F.; Badeck, F.W.; Li Destri Nicosia, O.; Akar, T.; Grando, S.; Al-Yassin, A.; Benkelkacim, A.; Thomas, W.T.B.; Eeuwijk, van F.A.; Romagosa, I.; Stanca, A.M.; Pechionni, N.

    2011-01-01

    Barley grain yield in rainfed Mediterranean regions can be largely influenced by terminal drought events. In this study the ecophysiological performance of the ‘Nure’ (winter) × ‘Tremois’ (spring) barley mapping population (118 Doubled Haploids, DHs) was evaluated in a multi-environment trial of eig

  5. Dilute-acid pretreatment of barley straw for biological hydrogen production using Caldicellulosiruptor saccharolyticus

    NARCIS (Netherlands)

    Panagiotopoulos, I.A.; Bakker, R.R.C.; Vrije, de G.J.; Claassen, P.A.M.; Koukios, E.G.

    2012-01-01

    The main objective of this study was to use the fermentability test to investigate the feasibility of applying various dilute acids in the pretreatment of barley straw for biological hydrogen production. At a fixed acid loading of 1% (w/w dry matter) 28-32% of barley straw was converted to soluble m

  6. A comparison of energy use and productivity of wheat and barley (case study

    Directory of Open Access Journals (Sweden)

    S.M. Ziaei

    2015-01-01

    Full Text Available Comparison of energy productivity of different crops can be used as an effective tool to prioritize crops planting in each area. This study was conducted in order to compare wheat and barley farms of Sistan and Baluchestan province in Iran in relation to various aspects of energy consumption at 2009. 100 wheat and 100 barley fields were selected randomly from main 11 cities in the studied region. Input data and yield of wheat and barley fields were collected in the form of questionnaires in a face-to-face interview. Results showed that total energy inputs of wheat and barley fields were 32492.97 and 25655.81 MJ ha−1, respectively. Total energy outputs for wheat and barley fields were 48517.24 and 49800.87 MJ ha−1, respectively. Based on these results the amount of energy use efficiency for wheat and barley fields were 1.49 and 1.94, respectively, and the amount of energy productivity for mentioned fields were 0.056 and 0.066. The share of renewable energy as one of the sustainability indexes of agricultural systems was 19.60 for wheat and 14.60 for barley fields. Therefore, it seems that barley production is more efficient from various aspects of energy consumption rather than wheat in the studied region.

  7. Quantifying relationships between rooting traits and water uptake under drought in Mediterranean barley and durum wheat

    Institute of Scientific and Technical Information of China (English)

    Pedro Carvalho; Sayed AzamAli; M. John Foulkes

    2014-01-01

    In Mediterranean regions drought is the major factor limiting spring barley and durum wheat grain yields. This study aimed to compare spring barley and durum wheat root and shoot responses to drought and quantify relationships between root traits and water uptake under terminal drought. One spring barley (Hordeum vulgare L. cv. Rum) and two durum wheat Mediterranean cultivars (Triticum turgidum L. var durum cvs Hourani and Karim) were examined in soil-column experi-ments under wel watered and drought conditions. Root system architecture traits, water uptake, and plant growth were measured. Barley aerial biomass and grain yields were higher than for durum wheat cultivars in wel watered conditions. Drought decreased grain yield more for barley (47%) than durum wheat (30%, Hourani). Root-to-shoot dry matter ratio increased for durum wheat under drought but not for barley, and root weight increased for wheat in response to drought but decreased for barley. The critical root length density (RLD) and root volume density (RVD) for 90%available water capture for wheat were similar to (cv. Hourani) or lower than (cv. Karim) for barley depending on wheat cultivar. For both species, RVD accounted for a slightly higher proportion of phenotypic variation in water uptake under drought than RLD.

  8. High capacity of plant regeneration from callus of interspecific hybrids with cultivated barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Jensen, C. J.; Andersen, B.

    1986-01-01

    Callus was induced from hybrids between cultivated barley (Hordeum vulgare L. ssp. vulgare) and ten species of wild barley (Hordeum L.) as well as from one backcross line ((H. lechleri .times. H. vulgare) .times. H. vulgare). Successful callus induction and regeneration of plants were achieved from...

  9. A promising low beta-glucan barley mutation of m351 for better bioethanol production use

    Science.gov (United States)

    Bioethanol is an important liquid fuel complement. Barley is an alternative raw material for ethanol production and its byproduct is a nutritious feed. The barley m351mutant line, which has a mutation for low beta-glucan content, was tested for its ethanol production efficiency and feed fraction qua...

  10. Quantitative Analysis of the Early Powdery Mildew Infection Stages on Resistant Barley Genotypes

    DEFF Research Database (Denmark)

    Andersen, J. B.; Torp, J.

    1986-01-01

    A classification system was developed, that allowed quantification of the leaf surface development of the barley powdery mildew fungus on barley. An experiment with Manchuria and Pallas as susceptible controls and 4 resistance gene each represented by three lines with different gene backgrounds s...

  11. Differential levels of mite infestation of wheat and barley in Czech grain stores

    Institute of Scientific and Technical Information of China (English)

    Jan Hubert; Zuzana Kucerova; Radek Aulicky; Marta Nesvoma; Vaclav Stejskal

    2009-01-01

    While mites are able to utilize numerous food sources, the suitability of the food strongly influences population growth. The different suitabilities of various stored agricultural products will thus affect the level of infestation. In this study, we compared field mite infestation rates in two stored cereals: wheat and barley. We analyzed mite abundance, frequency and species composition in samples of grain obtained from 79 selected Czech grain stores. Stored barley seemed to be more vulnerable to mite attack than wheat, as we consistently found more infested samples, more species and higher mean and median mite abundance per sample in barley as compared to wheat. The mean mite abundance per sample were 55 and 506 individuals for wheat and barley, respectively. In barley, 10% of samples exceeded allergen risk threshold (i.e., 1 000 individuals per kg of grain). Altogether, 25 species were identified from approximately 35 000 individuals. The most frequently identified species were the same in wheat and barley, that is, Tydeus interruptus Sig Thor, Acarus siro L., Tarsonemus granarius Lindquist, Lepidoglyphus destructor (Schrank) and 1),rophagusputrescentiae (Schrank). Based on principal components analysis, we found a closer association of T. interruptus, T. putrescentiae, L. destructor and Cheyletus eruditus (Schrank) with barley samples, corresponding to the high frequency and abundance values of these mites. The probable reasons for the higher infestation, especially mite abundance in barley, are discussed in relation to the higher proportion of crushed parts, which may release favorable nutrient sources and amplify the abundance values.

  12. Immunomodulatory properties of oat and barley β-glucan populations on bone marrow derived dendritic cells

    NARCIS (Netherlands)

    Rosch, Christiane; Meijerink, Marjolein; Delahaije, Roy J.B.M.; Taverne, Nico; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.

    2016-01-01

    Specific structures of oat and barley β(1,3)(1,4)-glucans induced different in vitro immunomodulatory effects in bone marrow derived dendritic cells (BMDC) from TLR2/4 knock out mice. All barley β-glucan fractions induced larger amounts of cytokines in BMDCs than their oat equivalents. The particula

  13. A roadmap for zinc trafficking in the developing barley grain based on laser capture microdissection and gene expression profiling

    DEFF Research Database (Denmark)

    Tauris, Birgitte; Borg, Søren; Gregersen, Per L;

    2009-01-01

    Nutrients destined for the developing cereal grain encounter several restricting barriers on their path towards their final storage sites in the grain. In order to identify transporters and chelating agents that may be involved in transport and deposition of zinc in the barley grain, expression...... profiles have been generated of four different tissue types: the transfer cells, the aleurone layer, the endosperm, and the embryo. Cells from these tissues were isolated with the ‘laser capture microdissection' technology and the extracted RNA was subjected to three rounds of T7-based amplification...... were taken into account. On the basis of the expression levels of a number of metal homeostasis genes, a working model is proposed for the translocation of zinc from the phloem to the storage sites in the developing grain....

  14. Effects of processing technologies combined with cell wall degrading enzymes on in vitro degradability of barley.

    Science.gov (United States)

    de Vries, S; Pustjens, A M; Schols, H A; Hendriks, W H; Gerrits, W J J

    2012-12-01

    Effects of processing technologies and cell wall degrading enzymes on in vitro degradation of barley were tested in a 5 × 2 factorial arrangement: 5 technologies (unprocessed, wet-milling, extrusion, autoclaving, and acid-autoclaving), with or without enzymes. Upper gastrointestinal tract digestion (Boisen incubation) and large intestinal fermentation (gas production technique) were simulated in duplicate. All technologies increased digestion of DM (13 to 43% units) and starch (22 to 51% units) during Boisen incubation, compared with the unprocessed control (P starch (≈ 20% units), and CP (≈ 10% units) in unprocessed and autoclaved barley (P starch present in the Boisen residues. In conclusion, wet-milling, extrusion, and acid-autoclaving improved in vitro starch and CP digestion in barley, which is related to the cell wall matrix disruption. Addition of xylanases and β-glucanases improved in vitro starch and CP digestion only in unprocessed barley or barley poorly affected by processing.

  15. Efficacy of imidacloprid for control of cereal leaf beetle (Coleoptera: Chrysomelidae) in barley.

    Science.gov (United States)

    Tharp, C; Blodgett, S L; Johnson, G D

    2000-02-01

    The toxicity of imidacloprid to the cereal leaf beetle, Oulema melanopus (L.), was measured under laboratory and field conditions. Insect mortality and plant damage were determined from artificial and natural infestations of O. melanopus applied to various growth stages of barley. All rates of imidacloprid formulated and applied as a seed treatment caused >90% mortality to cereal leaf beetle larvae when barley was infested with eggs at the 4-leaf stage, but were ineffective when barley was infested with eggs at the early tillering or flag-leaf stages of barley. This window of susceptibility influenced results obtained in field trials where peak larval emergence did not occur until the early tillering stage of barley. The resulting mortality in plants from treated seeds never exceeded 40% in the field. Foliar imidacloprid, however, caused >90% mortality in the field, and may be another option in the management of the cereal leaf beetle.

  16. Early changes in protein expression of barley following inoculation with erysiphe graminis f. sp. hordei

    Energy Technology Data Exchange (ETDEWEB)

    Simons, S.P.; Somerville, S.C. (Michigan State Univ., East Lansing (USA))

    1989-04-01

    Erysiphe graminis f. sp. hordei is an obligate pathogen of barley causing the powdery mildew disease. Resistance to this disease is the product of a highly specific interaction between barley lines with specific resistance alleles and pathogen races carrying complementary avirulence alleles. Using congenic barley lines which differ at the M1-a disease reaction locus, we hope to define the early molecular events of this interaction. Accordingly, resistant and susceptible barley seedlings were labelled with {sup 35}S-methionine and examined by two-dimensional electrophoresis at two hour intervals following inoculation. Infection related changes were observed with both isolines during the four to twelve hour time period. Additional differences existed constitutively between the barley lines. These differences have been quantified. Further characterization of these proteins will yield useful markers for events preceding or coinciding with cytological responses any may lead to identification and cloning of the M1-a gene.

  17. Targeted modification of storage protein content resulting in improved amino acid composition of barley grain

    DEFF Research Database (Denmark)

    Sikdar, Md. Shafiqul Islam; Bowra, S; Schmidt, Daiana;

    2016-01-01

    family members. Analysis of the AA composition of the transgenic lines showed that the level of essential amino acids increased with a concomitant reduction in proline and glutamine. Both the barley C-hordein and wheat ω-gliadin genes proved successful for RNAi-gene mediated suppression of barley C......C-hordein in barley and ω-gliadins in wheat are members of the prolamins protein families. Prolamins are the major component of cereal storage proteins and composed of non-essential amino acids (AA) such as proline and glutamine therefore have low nutritional value. Using double stranded RNAi...... silencing technology directed towards C-hordein we obtained transgenic barley lines with up to 94.7 % reduction in the levels of C-hordein protein relative to the parental line. The composition of the prolamin fraction of the barley parental line cv. Golden Promise was resolved using SDS...

  18. RNA Origami

    DEFF Research Database (Denmark)

    Sparvath, Steffen Lynge

    2017-01-01

    for biosensorer,  der kan spore enten microRNA’er eller små molekyler, eksemplificeret ved S-adenosylmethionin (SAM). Slutteligt indikerer foreløbige resultater, at apta-FRET SAM sensoren kan udtrykkes i Escherichia coli-celler, hvilket viser, at RNA-origami arkitekturen muliggør cotransskriptionel foldning af......RNA-nanoteknologi feltet har demonstreret alsidigheden af RNA som byggemateriale, og rationelt designede RNA-nanostrukturer er blevet brugt i udviklingen af strukturelle platforme og dynamiske anordninger med anvendelser både in vitro og in vivo. Naturlige RNA-strukturer foldes cotransskriptionelt...... fra en enkelt RNA-streng, og udfører en lang række komplekse cellulære funktioner. Mange af funktionerne er blevet udnyttet til at skabe funktionelle RNA-baserede nanoapparater, men den nuværende litteratur giver kun få eksempler på cotranskriptionel produktion af RNA-nanostrukturer. I 2014...

  19. RNA granules

    OpenAIRE

    Anderson, Paul; Kedersha, Nancy

    2006-01-01

    Cytoplasmic RNA granules in germ cells (polar and germinal granules), somatic cells (stress granules and processing bodies), and neurons (neuronal granules) have emerged as important players in the posttranscriptional regulation of gene expression. RNA granules contain various ribosomal subunits, translation factors, decay enzymes, helicases, scaffold proteins, and RNA-binding proteins, and they control the localization, stability, and translation of their RNA cargo. We review the relationshi...

  20. Assessment of genetic diversity among barley cultivars and breeding lines adapted to the US Pacific Northwest, and its implications in breeding barley for imidazolinone-resistance.

    Directory of Open Access Journals (Sweden)

    Sachin Rustgi

    Full Text Available Extensive application of imidazolinone (IMI herbicides had a significant impact on barley productivity contributing to a continuous decline in its acreage over the last two decades. A possible solution to this problem is to transfer IMI-resistance from a recently characterized mutation in the 'Bob' barley AHAS (acetohydroxy acid synthase gene to other food, feed and malting barley cultivars. We focused our efforts on transferring IMI-resistance to barley varieties adapted to the US Pacific Northwest (PNW, since it comprises ∼23% (335,000 ha of the US agricultural land under barley production. To effectively breed for IMI-resistance, we studied the genetic diversity among 13 two-rowed spring barley cultivars/breeding-lines from the PNW using 61 microsatellite markers, and selected six barley genotypes that showed medium to high genetic dissimilarity with the 'Bob' AHAS mutant. The six selected genotypes were used to make 29-53 crosses with the AHAS mutant and a range of 358-471 F1 seeds were obtained. To make informed selection for the recovery of the recipient parent genome, the genetic location of the AHAS gene was determined and its genetic nature assessed. Large F2 populations ranging in size from 2158-2846 individuals were evaluated for herbicide resistance and seedling vigor. Based on the results, F3 lines from the six most vigorous F2 genotypes per cross combination were evaluated for their genetic background. A range of 20%-90% recovery of the recipient parent genome for the carrier chromosome was observed. An effort was made to determine the critical dose of herbicide to distinguish between heterozygotes and homozygotes for the mutant allele. Results suggested that the mutant can survive up to the 10× field recommended dose of herbicide, and the 8× and 10× herbicide doses can distinguish between the two AHAS mutant genotypes. Finally, implications of this research in sustaining barley productivity in the PNW are discussed.

  1. Effects of Pleurotus sapidus (Schulzer Sacc. treatment on nutrient composition and ruminal fermentability of barley straw, barley rootless, and a mixture of the two

    Directory of Open Access Journals (Sweden)

    Alfonso Soto-Sánchez

    2015-09-01

    Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.

  2. Long-term reconstitution with water of dry barley before feeding increases phosphorus digestibility in pigs1

    DEFF Research Database (Denmark)

    Ton Nu, Mai Anh; Blaabjerg, Karoline; Poulsen, Hanne Damgaard

    2016-01-01

    compared to dry stored barley on apparent total tract digestibility (ATTD) of P in pigs. Dry barley (12% moisture; total P, 3.3 g/kg DM; phytate P, 1.7 g/kg DM) was rolled and stored directly or reconstituted with water to produce rolled barley with 35% moisture that was stored in air-tight conditions...... numerically more soluble P (2.56 g/kg DM) and less phytate P (0.93 g/kg DM) than dry barley (0.78 and 1.7 g/kg DM). Pigs fed the reconstituted barley diet showed an increase in P absorption (54%, P

  3. New starch phenotypes produced by TILLING in barley.

    Directory of Open Access Journals (Sweden)

    Francesca Sparla

    Full Text Available Barley grain starch is formed by amylose and amylopectin in a 1:3 ratio, and is packed into granules of different dimensions. The distribution of granule dimension is bimodal, with a majority of small spherical B-granules and a smaller amount of large discoidal A-granules containing the majority of the starch. Starch granules are semi-crystalline structures with characteristic X-ray diffraction patterns. Distinct features of starch granules are controlled by different enzymes and are relevant for nutritional value or industrial applications. Here, the Targeting-Induced Local Lesions IN Genomes (TILLING approach was applied on the barley TILLMore TILLING population to identify 29 new alleles in five genes related to starch metabolism known to be expressed in the endosperm during grain filling: BMY1 (Beta-amylase 1, GBSSI (Granule Bound Starch Synthase I, LDA1 (Limit Dextrinase 1, SSI (Starch Synthase I, SSIIa (Starch Synthase IIa. Reserve starch of nine M3 mutant lines carrying missense or nonsense mutations was analysed for granule size, crystallinity and amylose/amylopectin content. Seven mutant lines presented starches with different features in respect to the wild-type: (i a mutant line with a missense mutation in GBSSI showed a 4-fold reduced amylose/amylopectin ratio; (ii a missense mutations in SSI resulted in 2-fold increase in A:B granule ratio; (iii a nonsense mutation in SSIIa was associated with shrunken seeds with a 2-fold increased amylose/amylopectin ratio and different type of crystal packing in the granule; (iv the remaining four missense mutations suggested a role of LDA1 in granule initiation, and of SSIIa in determining the size of A-granules. We demonstrate the feasibility of the TILLING approach to identify new alleles in genes related to starch metabolism in barley. Based on their novel physicochemical properties, some of the identified new mutations may have nutritional and/or industrial applications.

  4. RNA epigenetics

    OpenAIRE

    Liu, Nian; Pan, Tao

    2014-01-01

    Mammalian messenger and long non-coding RNA contain tens of thousands of post-transcriptional chemical modifications. Among these, the N6-methyl-adenosine (m6A) modification is the most abundant and can be removed by specific mammalian enzymes. M6A modification is recognized by families of RNA binding proteins that affect many aspects of mRNA function. mRNA/lncRNA modification represents another layer of epigenetic regulation of gene expression, analogous to DNA methylation and histone modifi...

  5. Leaf senescence and nutrient remobilisation in barley and wheat

    DEFF Research Database (Denmark)

    Gregersen, P L; Holm, P B; Krupinska, K

    2008-01-01

    Extensive studies have been undertaken on senescence processes in barley and wheat and their importance for the nitrogen use efficiency of these crop plants. During the senescence processes, proteins are degraded and nutrients are re-mobilised from senescing leaves to other organs, especially...... in degradative, metabolic and regulatory processes that could be used in future strategies aimed at modifying the senescence process. The breeding of crops for characters related to senescence processes, e.g. higher yields and better nutrient use efficiency, is complex. Such breeding has to cope with the dilemma...

  6. Modelling phytate degradation kinetics in soaked wheat and barley

    DEFF Research Database (Denmark)

    Blaabjerg, Karoline; Strathe, A B; Poulsen, Hanne Damgaard

    2012-01-01

    for describing the phytate degradation profiles of the soaked wheat and barley. The in vitro results showed that heat-treatment of the cereals increased the F0 and reduced the K although the plant phytase activity was reduced. This was possible due to induced structural changes of the grain that increased...... the contact between phytate and plant phytases. The lack of effect of additions of Phytase 1 or Phytase 2 on the phytate degradation in the cereals was possible due to a poor access of the microbial phytases to phytate. Therefore, more knowledge is needed about processing technologies that increase the access...... of plant and microbial phytases to phytate in the grains....

  7. The plasma membrane proteome of germinating barley embryos

    DEFF Research Database (Denmark)

    Hynek, Radovan; Svensson, Birte; Jensen, O.N.;

    2009-01-01

    with amphiphilicity and low abundance of membrane proteins. A fraction enriched in plasma membranes was prepared from embryos dissected from 18 h germinated barley seeds using aqueous two-phase partitioning. Reversed-phase chromatography on C-4 resin performed in micro-spin columns with stepwise elution by 2-propanol...... was used to reduce soluble protein contamination and enrich for hydrophobic proteins. Sixty-one proteins in 14 SDS-PAGE bands were identified by LC-MS/MS and database searches. The identifications provide new insight into the plasma membrane functions in seed germination....

  8. Further molecular evidence for the Hordeum vulgare ssp. spontaneum in Tibet as ultimate progenitor of Chinese cultivated barley

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    106 accessions of Tibetan wild barley, including 50 accessions of the two-rowed wild barley Hordeum vulgare ssp. spontaneum(HS), 27 accessions of the six-rowed bottle-shaped wild barley H. lagunculiforme(HL) and 29 accessions of the six-rowed wild barley H. agriocrithon(HA) that separately represent different agrigeographical regions of Tibet, were used to study the genetic diversity and genetic differentiation using SSR markers selected from seven barley linkage groups. 229 allelic variants were identified with an average of 7.6 alleles/locus. The average of total number of alleles per locus in HA(6.4) is much higher than that in HS(3.9) and HL(3.4). The genetic diversity and its standard deviation among the three subspecies were in the order of HS>HL>HA. Very significant genetic differentiation was observed among the three subspecies of wild barley. Comparisons of the results from this and previous studies showed a strong Oriental-Occidental differentiation of barley, and that Shannan region of Tibet might be the center of origin of the Tibetan two-rowed wild barley, thus supporting not only the hypothesis of a mono-phyletic origin of cultivated barley but also the proposition that the Tibetan two-rowed wild barley as ultimate progenitor of Chinese cultivated barley.

  9. 大麦雄性不育的遗传研究%Genetic Study on Barley Male Sterility

    Institute of Scientific and Technical Information of China (English)

    张凤英; 刘志萍; 包海柱

    2009-01-01

    [Objective] The aim was to research the genetic mechanism of barley male sterility, and provide the theoretical reference for breeding strong heterosis hybrid of barley. [Method] Fertility segregation phenomenon, morphological characteristics and main agronomic characters of male sterility character of 4 kinds of barley male sterility materials 2001-17, 2001-37, 2001-84 and 2001-116 and their derived lines were observed and researched. [Result] Barley male sterility existed genetic phenomenon of single dominant nuclear gene caused by environmental stimulation, its sterility controlled by MS, the sterile genotype was MSms. There was stable nucleo-cytoplasmic inheritance on barley male sterility which was controlled by cytoplasmic male sterile gene S and nuclear gene rr, and its genotype was S(rr), this male sterility belonged to CMS type sterility. Temperature had no effect on fertility. [Conclusion] There was stable nucleo-cytoplasmic inheritance on barley male sterility, this result played a positively promoting role in barley practical production.

  10. Alterations in barley ribulose-1,5-bisphosphate carboxylase/oxygenase activase gene expression during development and in response to illumination.

    Science.gov (United States)

    Rundle, S J; Zielinski, R E

    1991-08-05

    Two genes encode Rbu-P2-carboxylase activase in barley (RcaA and RcaB): RcaA encodes polypeptides of 46 and 42 kDa, which are generated by the alternatively spliced RcaA1 and RcaA2 mRNAs, respectively; RcaB encodes a 42-kDa polypeptide (Rundle, S. J., and Zielinski, R. E. (1991) J. Biol. Chem. 266, 4677-4685). In the cellular differentiation gradient of the first leaf of barley, the three Rca mRNAs accumulate differentially. RcaA1 and A2 mRNAs accumulate predominantly in the mature, most photosynthetically active regions of the leaf in a pattern that parallels accumulation of total Rbu-P2-carboxylase activase protein. However, the kinetics of accumulation of RcaA1 and RcaA2 mRNA differ slightly, indicating that either changes in RcaA pre-mRNA splicing or mRNA turnover occur during development. RcaB mRNA, in contrast, accumulates in the youngest and oldest cell populations at the base and tip of the leaf, respectively. In the mid-region of the leaf, the difference in accumulation between RcaA and RcaB mRNAs is largely attributable to differences in the rates of transcription of the two Rca genes. In this region of the leaf, the three Rca mRNAs accumulate differentially throughout the course of the diurnal cycle. Steady state levels of the three Rca mRNA species increase in parallel in response to increasing irradiance; these changes were accompanied by increased Rbu-P2-carboxylase activase protein accumulation.

  11. Comparative Proteomic Analysis of Two Barley Cultivars (Hordeum vulgare L.) with Contrasting Grain Protein Content

    Science.gov (United States)

    Guo, Baojian; Luan, Haiye; Lin, Shen; Lv, Chao; Zhang, Xinzhong; Xu, Rugen

    2016-01-01

    Grain protein contents (GPCs) of barley seeds are significantly different between feed and malting barley cultivars. However, there is still no insight into the proteomic analysis of seed proteins between feed and malting barley cultivars. Also, the genetic control of barley GPC is still unclear. GPCs were measured between mature grains of Yangsimai 3 and Naso Nijo. A proteome profiling of differentially expressed protein was established by using a combination of 2-DE and tandem mass spectrometry. In total, 502 reproducible protein spots in barley seed proteome were detected with a pH range of 4–7 and 6–11, among these 41 protein spots (8.17%) were detected differentially expressed between Yangsimai 3 and Naso Nijo. Thirty-four protein spots corresponding to 23 different proteins were identified, which were grouped into eight categories, including stress, protein degradation and post-translational modification, development, cell, signaling, glycolysis, starch metabolism, and other functions. Among the identified proteins, enolase (spot 274) and small subunit of ADP-glucose pyrophosphorylase (spot 271) are exclusively expressed in barley Yangsimai 3, which may be involved in regulating seed protein expression. In addition, malting quality is characterized by an accumulation of serpin protein, Alpha-amylase/trypsin inhibitor CMb and Alpha-amylase inhibitor BDAI-1. Most noticeably, globulin, an important storage protein in barley seed, undergoes post-translational processing in both cultivars, and also displays different expression patterns. PMID:27200019

  12. Effects of barley chromosome addition to wheat on behavior and development of Locusta migratoria nymphs.

    Science.gov (United States)

    Suematsu, Shunji; Harano, Ken-ichi; Tanaka, Seiji; Kawaura, Kanako; Ogihara, Yasunari; Watari, Yasuhiko; Saito, Osamu; Tokuda, Makoto

    2013-01-01

    Locusta migratoria feeds on various Poaceae plants but barley. Barley genes related to feeding deterrence may be useful for developing novel resistant crops. We investigated the effects of barley cultivar Betzes, wheat cultivar Chinese Spring (CS), and six barley chromosome disomic addition lines of wheat (2H-7H) on locomotor activity, feeding behavior, survival and development of L. migratoria nymphs. Locomotor activity was similar in nymphs kept with wheat and 2H-7H in an actograph, whereas it was generally high in those kept with barely. No-choice and choice feeding tests suggested that barley genes related to inhibition of feeding by L. migratoria are located on barley chromosomes 5H and 6H and those related to the palatability of plants on chromosomes 2H, 5H and 6H. Rearing experiments suggested the presence of barley genes negatively affecting the survival and growth of locust nymphs on chromosomes 5H and 2H, respectively, and the effects are phase-dependent.

  13. Genetic structure and linkage disequilibrium in landrace populations of barley in Sardinia.

    Science.gov (United States)

    Rodriguez, Monica; Rau, Domenico; O'Sullivan, Donal; Brown, Anthony H D; Papa, Roberto; Attene, Giovanna

    2012-06-01

    Multilocus digenic linkage disequilibria (LD) and their population structure were investigated in eleven landrace populations of barley (Hordeum vulgare ssp. vulgare L.) in Sardinia, using 134 dominant simple-sequence amplified polymorphism markers. The analysis of molecular variance for these markers indicated that the populations were partially differentiated (F(ST) = 0.18), and clustered into three geographic areas. Consistent with this population pattern, STRUCTURE analysis allocated individuals from a bulk of all populations into four genetic groups, and these groups also showed geographic patterns. In agreement with other molecular studies in barley, the general level of LD was low (13% of locus pairs, with P landrace populations, but that epistatic homogenising or diversifying selection was also present. Notably, the variance of the disequilibrium component was relatively high, which implies caution in the pooling of barley lines for association studies. Finally, we compared the analyses of multilocus structure in barley landrace populations with parallel analyses in both composite crosses of barley on the one hand and in natural populations of wild barley on the other. Neither of these serves as suitable mimics of landraces in barley, which require their own study. Overall, the results suggest that these populations can be exploited for LD mapping if population structure is controlled.

  14. Effect of supplementation with barley and calcium hydroxide on intake of Mediterranean shrubs

    Directory of Open Access Journals (Sweden)

    Dragan Skobic

    2011-04-01

    Full Text Available Maquis plant communities are one of the most varied vegetation types in the Mediterranean region and an important habitat for wild and domestic herbivores. Although the majority of these shrubs are nutritious, the secondary compounds are main impediments that reduce their forage value. In five experiments we determined the effect of supplementing goats with calcium hydroxide plus barley, and barley alone on intake of five dominant shrubs (Quercus ilex, Erica multiflora, Arbutus unedo, Viburnum tinus and Pistacia lentiscus of the Mediterranean maquis community. The combination of calcium hydroxide plus barley and barley alone increased utilization of all five investigated Mediterranean shrubs; therewith that intake of Arbutus unedo and Viburnum tinus was not statistically significant. Supplemented goats with calcium hydroxide plus barley or barley alone could be effective in controlling secondary compounds-rich Mediterranean shrubs where their abundance threatens biodiversity. This control can be facilitated by browsing dominant Mediterranean shrubs, which has been shown to be effective in managing Mediterranean maquis density. Calcium hydroxide and barley (energy enhance use of secondary compounds-containing plants, which may increase production of alternate forages and create a more diverse mix of plant species in the Mediterranean maquis plant community.

  15. Homeopathically prepared gibberellic acid and barley seed germination.

    Science.gov (United States)

    Hamman, B; Koning, G; Lok, K Him

    2003-07-01

    The potentisation process by which homeopathic preparations are produced raises the concern that these medicines have placebo effects only, since they theoretically no longer contain active molecules of the diluted substance. Plant models offer a method of examining the efficacy of homeopathically prepared solutions. This study examined the effects of homeopathically prepared gibberellic acid (HGA3) on the germination performance of barley (Hordeum vulgare L.) seeds. The effect of HGA3 (4-200 cH) on seed germination rate and seedling development was compared to that of the most commonly used form of gibberellic acid (GA3), 0.5 g l(-1), and control (distilled water). The extent and type of response was dependent on the vigour level of the seedlot. Treating seeds from three vigour groups in HGA3 consistently resulted in larger seedlings. High-vigour seeds treated with HGA3 4, 30 and 200 cH germinated faster, and roots of medium-vigour seedlots treated in HGA3 15 cH were longer. Biphasic effects of HGA3 were also demonstrated. As a plant model, germinating barley seeds successfully demonstrated the ability of HGA3 to produce a biological response.

  16. How barley growing conditions and its output change in Hungary

    Directory of Open Access Journals (Sweden)

    Éva Erdélyi

    2010-11-01

    Full Text Available There is no doubt that climate change has started. It is very important to make effort in developing impact analyses and adaptation strategies. First we were investigated how theproduction risk of winter barley is changing with time using the E,V efficiency criterion. Based on the regional yearly production data of the crop, we can conclude that beside other non-climatic effects, the changing climate has considerable impact on crops yield; its variability is increasing with the variability of meteorological parameters. We have used production data from 1951 to nowadays. Next, using comparison analyses for climate scenarios, we predict what we can expect in the future. For detecting the reasons of risk increase in the past, and forecasting the potential main points of future risk we have analysed statistically whether the climate needs of winter barley will be satisfied ornot in its important periods of growing. Frequency calculations were made based on the daily meteorological data. The situation doesn’t show big change, but It is no doubt that the anomalies of the indicators have been becoming more and more frequent. The morefrequent the extreme weather events are, the more we can be convinced of uncertainty.

  17. Effect of cultivar and year on phyllochron in winter barley

    Directory of Open Access Journals (Sweden)

    Pržulj Novo M.

    2013-01-01

    Full Text Available Development and growth of leaves in cereals significantly affects grain yield since dry matter accumulation depends on the leaf area that intercepts light. Phyllochron (PHY is defined as time interval between the emergences of successive leaves on the main stem. The aim of this study was to determine the effect of year and cultivar on phyllochron in winter barley. Twelve cultivars of winter barley differing in origin and time of anthesis were tested during six growing seasons (GS, from 2002/03 to 2007/08. The highest PHY across GSs was determined in the two-rowed cultivar Cordoba (81.6°Cd and the lowest in the two-rowed cultivar Novosadski 581 (71.0°Cd. The early cultivars had fast leaf development, the medium cultivars medium and the late cultivars slow development, 72.5°Cd, 75.6°Cd and 78.9°Cd, respectively. The tested cultivars showed significant variability in the PHY, which can be used for selecting most adaptable genotypes for specific growing conditions.

  18. Accumulation of Transcripts Abundance after Barley Inoculation with Cochliobolus sativus

    Directory of Open Access Journals (Sweden)

    Mohammad Imad Eddin Arabi

    2015-03-01

    Full Text Available Spot blotch caused by the hemibiotrophic pathogen Cochliobolus sativus has been the major yield-reducing factor for barley production during the last decade. Monitoring transcriptional reorganization triggered in response to this fungus is an essential first step for the functional analysis of genes involved in the process. To characterize the defense responses initiated by barley resistant and susceptible cultivars, a survey of transcript abundance at early time points of C. sativus inoculation was conducted. A notable number of transcripts exhibiting significant differential accumulations in the resistant and susceptible cultivars were detected compared to the non-inoculated controls. At the p-value of 0.0001, transcripts were divided into three general categories; defense, regulatory and unknown function, and the resistant cultivar had the greatest number of common transcripts at different time points. Quantities of differentially accumulated gene transcripts in both cultivars were identified at 24 h post infection, the approximate time when the pathogen changes trophic lifestyles. The unique and common accumulated transcripts might be of considerable interest for enhancing effective resistance to C. sativus.

  19. Barley β-glucans extraction and partial characterization.

    Science.gov (United States)

    Limberger-Bayer, Valéria M; de Francisco, Alicia; Chan, Aline; Oro, Tatiana; Ogliari, Paulo J; Barreto, Pedro L M

    2014-07-01

    Barley is rarely used in the food industry, even though it is a main source of β-glucans, which have important health benefits and a technological role in food. This work evaluated the humid extraction of barley β-glucans and partially characterized them. The extraction was studied using surface response methodology with both temperature and pH as variables. The extracted β-glucans were characterized by chemical and rheological analysis, infrared spectroscopy and scanning electron microscopy. The effect on extraction of linear and quadratic terms of pH and temperature corresponding to the regression model was significant, and we obtained a maximum concentration of 53.4% at pH 7.56 and temperature 45.5°C, with protein and mainly starch contamination. The extracted β-glucans presented a higher apparent viscosity than the commercial ones, the behavior of the commercial and extracted samples can be described as Newtonian and pseudoplastic, respectively. The results of infrared spectroscopy and scanning electron microscopy were characteristic of commercial β-glucans, indicating that this method is efficient for extracting β-glucans.

  20. Golgi localized barley MTP8 proteins facilitate Mn transport

    DEFF Research Database (Denmark)

    Pedas, Pai Rosager; Schiller, Michaela; Hegelund, Josefine Nymark

    2014-01-01

    8 proteins are involved in Mn loading to the Golgi apparatus and play a role in Mn homeostasis by delivering Mn to Mn-dependent enzymes and/or by facilitating Mn efflux via secretory vesicles. This study highlights the importance of MTP transporters in Mn homeostasis and is the first report of Golgi......-bound proteins belonging to the cation diffusion facilitator (CDF) family in the cereal species barley (Hordeum vulgare). Transient expression in onion epidermal cells showed that MTP8.1 and MTP8.2 proteins fused to the green fluorescent protein (GFP) are localized to Golgi. When heterologously expressed...... in yeast, MTP8.1 and MTP8.2 were found to be Mn transporters catalysing Mn efflux in a similar manner as the Golgi localized endogenous yeast protein Pmr1p. The level of MTP8.1 transcripts in barley roots increased with external Mn supply ranging from deficiency to toxicity, while MTP8.2 transcripts...

  1. In Vitro Biochemical Characterization of All Barley Endosperm Starch Synthases

    Directory of Open Access Journals (Sweden)

    Jose Antonio Cuesta-Seijo

    2016-01-01

    Full Text Available Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs. While the overall starch synthase (SS reaction is known, the functional differences between the five SS classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes. Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has maltoligosaccharides and not polysaccharides as its preferred substrates.

  2. Analysis on Interaction between Genotype of Four Main Flavonoids of Barley Grain and Environment

    Institute of Scientific and Technical Information of China (English)

    Tao YANG; Chengli DUAN; Yawen ZENG; Juan DU; Shuming YANG; Xiaoying PU; Shengchao YANG

    2012-01-01

    [Objective] This study aimed to analyze the interaction between genotype of flavonoids of barley grain and environment, to increase the flavonoid content of barley grain in cultivation and breeding. [Method] In this study, the content of cate- chin, myricetin, quercetin and kaempferol of barley grain planted in Kunming, Qujing and Baoshan were determined by HPLC, and the genotype, environment, genotype- environment interaction of the flavonoid content of barley grain were analyzed. [Result] According to the experimental results, the genotype variance, environmental variance and G x E interaction variance of catechin and kaempferol contents show the same trend: genotype variation 〉 environmental variation 〉 G × E interaction variation, which all reach a extremely significant level; the genotype variance, envi- ronmental variance and G × E interaction variance of quercetin and total flavonoid contents show the same trend: genetype variation 〉 G × E interaction variation 〉 environmental variation, which all reach a extremely significant level; the genotype variance and environmental variance of myricetin content both reach a extremely sig- nificant level, while the G × E interaction variance reaches a significant level, showing an order of genotype variation 〉 environmental variation 〉 G × E interaction variation; the genotype variance, environmental variance and G x E interaction vari- ance of total flavonoid content show an order of genotype variation 〉 environmental variation 〉 G × E interaction variation. Among different barley varieties, Ziguang- mangluoerling and Kuanyingdamai in Qujing, Kunming and Baoshan have relatively high content of quercetin, while other barley varieties barely contain any quercetin. The grains of Ziguangmangluoerling and Kuanyingdamai are purple, while the grains of other barley varieties are yellow. [Conclusion] Four main flavonoids and the total flavonoids of barley grain are mainly under genetic control and

  3. Extraction of starch from hulled and hull-less barley with papain and aqueous sodium hydroxide.

    Science.gov (United States)

    Sharma, Priyanka; Tejinder, S

    2014-12-01

    Starch was isolated from hulled (VJM 201) and hull-less (BL 134) barley with papain and aqueous sodium hydroxide treatments. For enzyme-assisted extraction, barley was steeped in water containing 0.2 % SO2 + 0.55 % lactic acid at 50° ± 2 °C for 4-5 h. The slurry was mixed with 0.4-2.0 g papain/kg barley and incubated at 50° ± 2 °C for 1-5 h. Aqueous sodium hydroxide (0.01-0.05 M) was added to the finely ground barley meal. The alkaline slurry was incubated at ambient temperature (25° ± 2 °C) for 15-60 min. The starch and grain fractions were isolated by screening and centrifugation. Increases in the time of treatment significantly affected the fiber, centrifugation and non-starch residue losses. Concentration of papain and sodium hydroxide had negligible effect on extraction losses. The enzyme-assisted extraction efficiency of starch was higher (80.7-84.6 %) than the alkaline method (70.9-83.7 %). The hulled barley showed higher extraction efficiency than the hull-less barley. The slurry treated with 0.4 g papain/kg barley for 5 h and 0.03 M sodium hydroxide for 60 min produced maximal yield of starch. Barley starch showed desirably high pasting temperature, water binding capacity and hold viscosity; and low final and setback viscosity compared with the commercial corn starch. The alkaline extracted hull-less barley starch showed exceptionally high peak and hold viscosities.

  4. Biotesting of radioactively contaminated forest soils using barley-based bioassay

    Science.gov (United States)

    Mel’nikova, T. V.; Polyakova, L. P.; Oudalova, A. A.

    2017-01-01

    Findings from radioactivity and phytotoxicity study are presented for soils from nine study-sites of the Klintsovsky Forestry located in the Bryansk region that were radioactively contaminated after the Chernobyl accident. According to the bioassay based on barley as test-species, stimulating effect of the soils analyzed is revealed for biological indexes of the length of barley roots and sprouts. From data on 137Cs specific activities in soils and plant biomass, the migration potential of radionuclide in the "soil-plant" system is assessed as a transfer factor. With correlation analysis, an impact of 137Cs in soil on the biological characteristics of barley is estimated.

  5. Effect of pulsed electric field on the germination of barley seeds

    DEFF Research Database (Denmark)

    Dymek, Katarzyna; Dejmek, Petr; Panarese, Valentina;

    2012-01-01

    This study explores metabolic responses of germinating barley seeds upon the application of pulsed electric fields (PEF). Malting barley seeds were steeped in aerated water for 24 h and PEF-treated at varying voltages (0 (control), 110, 160, 240, 320, 400 and 480 V). The seeds were then allowed...... to finish germination in saturated air. It is shown that exposure of germinating barley to PEF affects radicle emergence without significantly affecting the seeds’ gross metabolic activity, as quantified by isothermal calorimetry. An exploration of protein 2-DE profiles of both the embryo and the starchy...

  6. Barley (Hordeum vulgare L.) cysteine proteases: heterologous expression, purification and characterization

    DEFF Research Database (Denmark)

    Rosenkilde, Anne Lind; Dionisio, Giuseppe; Holm, Preben Bach

    2011-01-01

    During germination of barley seeds, mobilization of protein is essential and cysteine proteases accounts for more than 90 % of the total proteolytic activity in the degradation of barley seed storage proteins. Cysteine proteases exist as pro-enzyme and is activated through reduction of the active...... site cysteines and by removal of the pro-domain. The complement of cysteine proteases is comprehensive and for detailed studies of the individual components of this complement, a fast and efficient eukaryotic expression platform is highly desirable. A cDNA clone of the barley key cysteine endoprotease...

  7. Heterologous expression and purification of barley (Hordeum vulgare L.) cysteine protease in yeast

    DEFF Research Database (Denmark)

    Rosenkilde, Anne Lind; Dionisio, Giuseppe; Holm, Preben Bach

    2011-01-01

    The mobilization of protein during germination of barley seeds is essential and Cysteine Proteases accounts for more than 90 % of the total proteolytic activity in the degradation of barley seed storage proteins [1]. Cysteine proteases exist as pro-enzyme until activated through reduction...... of the active site cysteines and via removal of the pro-domain. The complement of cysteine proteases is comprehensive and for detailed studies of the individual components of this complement, a fast and efficient eukaryotic expression platform is highly desirable. The barley key cysteine protease, endoprotease...

  8. Distinct developmental defense activations in barley embryos identified by transcriptome profiling

    DEFF Research Database (Denmark)

    Nielsen, ME; Lok, F; Nielsen, Henrik Bjørn

    2006-01-01

    analyses of > 22,000 genes, which together with measurements of jasmonic acid and salicylic acid during embryo development provide new information on the initiation in the developing barley embryo of at least two distinct types of developmental defense activation (DDA). Early DDA is characterized by the up......-regulation of several PR genes is notable. Throughout barley embryo development, there are no indications of an increased biosynthesis of either jasmonic acid or salicylic acid. Collectively, the results help explain how the proposed DDA enables protection of the developing barley embryo and grain for purposes...

  9. The wide distribution of endornaviruses, large double-stranded RNA replicons with plasmid-like properties.

    Science.gov (United States)

    Fukuhara, T; Koga, R; Aoki, N; Yuki, C; Yamamoto, N; Oyama, N; Udagawa, T; Horiuchi, H; Miyazaki, S; Higashi, Y; Takeshita, M; Ikeda, K; Arakawa, M; Matsumoto, N; Moriyama, H

    2006-05-01

    The International Committee on Taxonomy of Viruses (ICTV) recently accepted Endornavirus as a new genus of plant dsRNA virus. We have determined the partial nucleotide sequences of the RNA-dependent RNA polymerase regions from the large dsRNAs (about 14 kbp) isolated from barley (Hordeum vulgare), kidney bean (Phaseolus vulgaris), melon (Cucumis melo), bottle gourd (Lagenaria siceraria), Malabar spinach (Basella alba), seagrass (Zostera marina), and the fungus Helicobasidium mompa. Phylogenetic analyses of these seven dsRNAs indicate that these dsRNAs are new members of the genus Endornavirus that are widely distributed over the plant and fungal kingdoms.

  10. RNA. Introduction.

    Science.gov (United States)

    Bao, Marie Z; Kruger, Robert P; Rivas, Fabiola; Smith, Orla; Szewczak, Lara

    2009-02-20

    Two scientists walk into a bar. After a pint and an exchange of pleasantries, one says to the other, "Where do you come from? Scientifically, I mean." The queried scientist responds, "Out of the RNA world." "Don't we all," the asker responds chuckling. Fifteen years ago, the joke would have been made with a nod to the notion that life arose from an RNA-based precursor, the so-called "RNA world." Yet had this conversation happened last week, the scientists would also be grinning in appreciation of the extent to which contemporary cellular biology is steeped in all things RNA. Ours is truly an RNA world.In this year's special review issue, the Cell editorial team has brought together articles focused on RNA in the modern world, providing perspectives on classical and emerging areas of inquiry. We extend our thanks to the many distinguished experts who contributed their time and effort as authors and reviewers to make the issue informative, thought-provoking, and timely. We hope that this collection of articles, written as we stand on the verge of a new wave of RNA biology, edifies and inspires by revealing the inner workings of these versatile molecules and by highlighting the next key questions that need to be addressed as we strive to understand the full functional scope of RNA in cells.

  11. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.

    2015-01-01

    RNA modification has attracted increasing interest as it is realized that epitranscriptomics is important in disease development. In type 2 diabetes we have suggested that high urinary excretion of 8-oxo-2'-Guanosine (8oxoGuo), as a measure of global RNA oxidation, is associated with poor survival.......9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...... diabetes. In agreement with our previous finding, DNA oxidation did not show any prognostic value. RNA oxidation represents oxidative stress intracellularly, presumably predominantly in the cytosol. The mechanism of RNA oxidation is not clear, but hypothesized to result from mitochondrial dysfunction...

  12. Expression of Nudix hydrolase genes in barley under UV irradiation

    Science.gov (United States)

    Tanaka, Sayuri; Sugimoto, Manabu; Kihara, Makoto

    Seed storage and cultivation should be necessary to self-supply foods when astronauts would stay and investigate during long-term space travel and habitation in the bases on the Moon and Mars. Thought the sunlight is the most importance to plants, both as the ultimate energy source and as an environmental signal regulating growth and development, UV presenting the sunlight can damage many aspects of plant processes at the physiological and DNA level. Especially UV-C, which is eliminated by the stratospheric ozone layer, is suspected to be extremely harmful and give a deadly injury to plants in space. However, the defense mechanism against UV-C irradiation damage in plant cells has not been clear. In this study, we investigated the expression of Nudix hydrolases, which defense plants from biotic / abiotic stress, in barley under UV irradiation. The genes encoding the amino acid sequences, which show homology to those of 28 kinds of Nudix hydrolases in Arabidopsis thaliana, were identified in the barley full-length cDNA library. BLAST analysis showed 14 kinds of barley genes (HvNUDX1-14), which encode the Nudix motif sequence. A phylogenetic tree showed that HvNUDX1, HvNUDX7, HvNUDX9 and HvNUDX11 belonged to the ADP-ribose pyrophosphohydrolase, ADP-sugar pyrophosphohydrolase, NAD(P)H pyrophosphohydrolase and FAD pyrophosphohydrolase subfamilies, respectively, HvNUDX3, HvNUDX6, and HvNUDX8 belonged to the Ap _{n}A pyrophosphohydrolase subfamilies, HvNUDX5 and HvNUDX14 belonged to the coenzyme A pyrophosphohydrolase subfamilies, HvNUDX12 and HvNUDX13 belonged to the Ap _{4}A pyrophosphohydrolase subfamilies. Induction of HvNUDX genes by UV-A (340nm), UV-B (312nm), and UV-C (260nm) were analyzed by quantitative RT-PCR. The results showed that HvNUDX4 was induced by UV-A and UV-B, HvNUDX6 was induced by UV-B and UV-C, and HvNUDX7 and HvNUDX14 were induced by UV-C, significantly. Our results suggest that the response of HvNUDXs to UV irradiation is different by UV

  13. Differentially Expressed Genes between Two Barley Cultivars Contrasting in Drought Tolerance

    Institute of Scientific and Technical Information of China (English)

    P.G. Guo; M. Baum; R.H. Li; S. Grando; R.K. Varshney; J. Valkoun; S. Ceccarelli; A. Grane

    2007-01-01

    @@ Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas. A number of genes have been described that respond to drought at the transcriptional level (Seki et al., 2002; Cheong et al.,2003).

  14. The effect of hydrolyzed Spirulina by malted barley on forced swimming test in ICR mice.

    Science.gov (United States)

    Kim, Na-Hyung; Jeong, Hyun-Ja; Lee, Ju-Young; Go, Hoyeon; Ko, Seong-Gyu; Hong, Seung-Heon; Kim, Hyung-Min; Um, Jae-Young

    2008-11-01

    Spirulina is a true puree of a filamentous, spiral-shaped blue alga and exerts the useful properties as a source of many biochemicals. This study investigated the antidepressant-like effect of hydrolyzed Spirulina by malted barley on the forced swimming test in mice. After the forced swimming test, we examined the levels of several blood biochemical parameters in mice. The effect of the hydrolyzed Spirulina by malted barley-treated group for 2 weeks on the immobility time was significantly reduced in comparison with the control group (p Spirulina by malted barley-treated group compared with the control group (p Spirulina by malted barley might be a candidate among antidepressant agents.

  15. Environmental impacts of barley cultivation under current and future climatic conditions

    DEFF Research Database (Denmark)

    Dijkman, Teunis Johannes; Birkved, Morten; Saxe, Henrik

    2017-01-01

    The purpose of this work is to compare the environmental impacts of spring barley cultivation in Denmark under current (year 2010) and future (year 2050) climatic conditions. Therefore, a Life Cycle Assessment was carried out for the production of 1 kg of spring barley in Denmark, at farm gate....... Both under 2010 and 2050 climatic conditions, four subscenarios were modelled, based on a combination of two soil types and two climates. Included in the assessment were seed production, soil preparation, fertilization, pesticide application, and harvest. When processes in the life cycle resulted in co...... categories, except human and freshwater eco-toxicity, are higher when the barley is produced under climatic circumstances representative for 2050. Comparison of the 2010 and 2050 climatic scenarios indicates that a predicted decrease in barley yields under the 2050 climatic conditions is the main driver...

  16. The enhanced callose deposition in barley with ml-o powdery mildew resistance genes

    DEFF Research Database (Denmark)

    Skou, Jens-Peder

    1985-01-01

    Carborundum treatment of barley leaves induced a callose deposition which was detected as diffuse blotches in the epidermal cells of susceptible barleys and as deeply stained tracks along the scratches in barleys with the ml-o powdery mildew resistance gene. Subsequent inoculation with powdery...... mildew resulted in appositions that enlarged inversely to their size in the respective varieties when inoculated without carborundum treatment. Aphids sucking the leaves resulted in rows of callose containing spots along the anticlinal cell walls. The spots were larger in the ml-o mutant than...... in the mother variety. Callose was deposited in connection with the pleiotropic necrotic spotting in barleys with the ml-o gene. Modification of the necrotic spotting by crossing the ml-o gene into other gene backgrounds did not result in any change in the size of appositions upon inoculation with powdery...

  17. Extraction of starch from hulled and hull-less barley with papain and aqueous sodium hydroxide

    OpenAIRE

    2013-01-01

    Starch was isolated from hulled (VJM 201) and hull-less (BL 134) barley with papain and aqueous sodium hydroxide treatments. For enzyme-assisted extraction, barley was steeped in water containing 0.2 % SO2 + 0.55 % lactic acid at 50° ± 2 °C for 4–5 h. The slurry was mixed with 0.4–2.0 g papain/kg barley and incubated at 50° ± 2 °C for 1–5 h. Aqueous sodium hydroxide (0.01–0.05 M) was added to the finely ground barley meal. The alkaline slurry was incubated at ambient temperature (25° ± 2 °C) ...

  18. Development and Meiosis of Three Interspecific Hybrids with Cultivated Barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Von Bothmer, R.; Flink, J.; Linde-Laursen, Ib

    1986-01-01

    The development and meiosis of three interspecific hybrids between cultivated barley (Hordeum vulgare L.) and H. secalinum Schreb., H. tetraploidum Covas, and H. parodii Covas, respectively, were studied. All three hybrid combinations developed very slowly vegetatively. Meiosis of the hybrids...

  19. Demarcation of mutant-carrying regions in barley plants after ethylmethane-sulfonate seed treatment

    DEFF Research Database (Denmark)

    Jacobsen, P.

    1966-01-01

    The branching pattern of the barley plant is analyzed and the anatomical structure of the resting barley embryo studied in longitudinal and cross-sections as well as by dissection techniques. The frequency and distribution of ethylmethane-sulfonate induced chloroplast and morphological seedling...... was obtained.The absence of cluster sharing allows the recognition in the barley plant of 8 mutually exclusive mutant sectors which never had a mutant cluster in common. The anatomical analysis proves that the barley embryo contains at least 6 separate shoot meristems or prospective shoot meristems, which...... will constitute mutually exclusive mutant sectors in the plant. The combined genetical and anatomical analysis reveals that in large seeds there are always 9 meristems leading to 9 mutually exclusive mutant sectors. Up to 7 additional meristems leading to mutually exclusive mutant sectors can be present...

  20. Exploring options for managing strategies for pea-barley intercropping using a modeling approach

    DEFF Research Database (Denmark)

    Launay, M.; Brisson, N.; Satger, S.;

    2009-01-01

    A modeling study was carried out into pea–barley intercropping in northern Europe. The two objectives were (a) to compare pea–barley intercropping to sole cropping in terms of grain and nitrogen yield amounts and stability, and (b) to explore options for managing pea–barley intercropping systems...... Kingdom and France), and using 10 years of weather records. A preliminary stage evaluated the STICS intercrop model's ability to predict grain and nitrogen yields of the two species, using a 2-year dataset from trials conducted at the three sites. The work was carried out in two phases, (a) the model......) intercropping made better use of environmental resources as regards yield amount and stability than sole cropping, with a noticeable site effect, (2) pea growth in intercrops was strongly linked to soil moisture, and barley yield was determined by nitrogen uptake and light interception due to its height...

  1. THE MALT EXTRACT, RELATIVE EXTRACT AND DIASTATIC POWER AS A VARIETAL CHARACTERISTIC OF MALTING BARLEY

    Directory of Open Access Journals (Sweden)

    Štefan Dráb

    2014-02-01

    Full Text Available Malting quality of barley depends on genetic and agro-ekological factors. Chemical composition of malting barley and its technological parameters are very important for malting and brewing, due to this fact the quality of barley must be strictly evaluated. The aim of this work was to evaluate the influence of variety, locality and year of production on the 5 technological parameters of malt: extract, relative extract at 45 °C, Kolbach index, diastatic power and friability. It was found out that the barley variety significantly influenced the following parameters: extract, relative extract and diastatic power. The growing locality weakly influenced qualitative parameters i.e. Kolbach index and relative extract at 45°C. The study confirmed the most significant impact of the year on the Kolbach index and friability.

  2. Standardized ileal digestibility of amino acids in eight genotypes of barley fed to growing pigs

    DEFF Research Database (Denmark)

    Spindler, H K; Mosenthin, R; Rosenfelder, Pia

    2016-01-01

    To determine chemical composition, physical characteristics and standardized ileal digestibility (SID) of CP and amino acids (AA) in eight current hulled barley genotypes, an experiment with growing pigs has been conducted. These genotypes included Yool, Campanile, Lomerit, Travira, Anisette...

  3. Linkage mapping of putative regulator genes of barley grain development characterized by expression profiling

    Directory of Open Access Journals (Sweden)

    Wobus Ulrich

    2009-01-01

    Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference

  4. Identification of thioredoxin target disulfides in proteins released from barley aleurone layers

    DEFF Research Database (Denmark)

    Hägglund, Per; Bunkenborg, J.; Yang, Fen

    2010-01-01

    Thioredoxins are ubiquitous disulfide reductases involved in a wide range of cellular processes including DNA synthesis, oxidative stress response and apoptosis. In cereal seeds thioredoxins are proposed to facilitate the germination process by reducing disulfide bonds in storage proteins and other...... targets in the starchy endosperm. Here we have applied a thiol-specific labeling approach to identify specific disulfide targets of barley thioredoxin in proteins released from barley aleurone layers incubated in buffer containing gibberellic acid....

  5. Identification of two key genes controlling chill haze stability of beer in barley (Hordeum vulgare L)

    OpenAIRE

    Ye, Lingzhen; Huang, Yuqing; Dai, Fei; Ning, Huajiang; Li, Chengdao; Zhou, Meixue; Zhang, Guoping

    2015-01-01

    Background In bright beer, haze formation is a serious quality problem, degrading beer quality and reducing its shelf life. The quality of barley (Hordeum vulgare L) malt, as the main raw material for beer brewing, largely affects the colloidal stability of beer. Results In this study, the genetic mechanism of the factors affecting beer haze stability in barley was studied. Quantitative trait loci (QTL) analysis of alcohol chill haze (ACH) in beer was carried out using a Franklin/Yerong doubl...

  6. Uzu mutation in barley (Hordeum vulgare L.) reduces the leaf unrolling response to brassinolide.

    Science.gov (United States)

    Honda, Ichiro; Zeniya, Haruko; Yoneyama, Koichi; Chono, Makiko; Kaneko, Shigenobu; Watanabe, Yoshiaki

    2003-05-01

    A sensitive method to examine the brassinolide (BL) response of barley (Hordeum vulgare L.) using dark-grown leaf segments was established based on the known method for wheat. BL responses of 53 dwarf isogenic lines of barley were examined, and two lines were found having a uzu gene that doesn't respond significantly. These results indicate that uzu dwarfism may be caused by the non-responding character to BL.

  7. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian;

    2016-01-01

    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS...... classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...

  8. The Role of alpha-Glucosidase in Germinating Barley Grains

    DEFF Research Database (Denmark)

    Stanley, Duncan; Rejzek, Martin; Næsted, Henrik;

    2011-01-01

    in the endosperm 10 d after imbibition, implying inhibition of maltase activity. Three of the four inhibitors also reduced starch degradation and seedling growth, but the fourth did not affect these parameters. Inhibition of starch degradation was apparently not due to inhibition of amylases. Inhibition......The importance of alpha-glucosidase in the endosperm starch metabolism of barley (Hordeum vulgare) seedlings is poorly understood. The enzyme converts maltose to glucose (Glc), but in vitro studies indicate that it can also attack starch granules. To discover its role in vivo, we took complementary...... silencing cassette for HvAgl97, alpha-glucosidase activity was reduced by up to 50%. There was a large decrease in the Glc-to-maltose ratio in these lines but no effect on starch degradation or seedling growth. Our results suggest that the alpha-glucosidase HvAGL97 is the major endosperm enzyme catalyzing...

  9. Inhibition of coagulation factors by recombinant barley serpin BSZx

    DEFF Research Database (Denmark)

    Dahl, Søren Weis; Rasmussen, S.K.; Petersen, L..C.;

    1996-01-01

    Barley serpin BSZx is a potent inhibitor of trypsin and chymotrypsin at overlapping reactive sites (Dahl, S.W., Rasmussen, S.K. and Hejgaard, J. (1996) J. Biol, Chem., in press), We have now investigated the interactions of BSZx with a range of serine proteinases from human plasma, pancreas...... as substrate, Complexes of these proteinase with BSZx resisted boiling in SDS, and amino acid sequencing showed that cleavage in the reactive center loop only occurred after P-1 Arg. Activated protein C and leukocyte elastase were slowly inhibited by BSZx (k(ass) = 1-2 x 10(2) M(-1) s(-1)) whereas factor XIIa......, urokinase and tissue type plasminogen activator, plasmin and pancreas kallikrein and elastase were not or only weakly affected, The inhibition pattern with mammalian proteinases reveal a specificity of BSZx similar to that of antithrombin III. Trypsin from Fusarium was not inhibited while interaction...

  10. Biomechanics of Wheat/Barley Straw and Corn Stover

    Energy Technology Data Exchange (ETDEWEB)

    Christopher T. Wright; Peter A. Pryfogle; Nathan A. Stevens; Eric D. Steffler; J. Richard Hess; Thomas H. Ulrich

    2005-03-01

    The lack of understanding of the mechanical characteristics of cellulosic feedstocks is a limiting factor in economically collecting and processing crop residues, primarily wheat and barley stems and corn stover. Several testing methods, including compression, tension, and bend have been investigated to increase our understanding of the biomechanical behavior of cellulosic feedstocks. Biomechanical data from these tests can provide required input to numerical models and help advance harvesting, handling, and processing techniques. In addition, integrating the models with the complete data set from this study can identify potential tools for manipulating the biomechanical properties of plant varieties in such a manner as to optimize their physical characteristics to produce higher value biomass and more energy efficient harvesting practices.

  11. Brewing with 100 % unmalted grains: barley, wheat, oat and rye

    DEFF Research Database (Denmark)

    Zhuang, Shiwen; Shetty, Radhakrishna; Hansen, Mikkel;

    2016-01-01

    Whilst beers have been produced using various levels of unmalted grains as adjuncts along with malt, brewing with 100 % unmalted grains in combination with added mashing enzymes remains mostly unknown. The aim of this study was to investigate the brewing potential of 100 % unmalted barley, wheat......, oat and rye in comparison with 100 % malt. To address this, identical brewing methods were adopted at 10-L scale for each grain type by applying a commercial mashing enzyme blend (Ondea® Pro), and selected quality attributes were assessed for respective worts and beers. Different compositions...... and higher viscosity than malt wort. Furthermore, the use of 100 % unmalted grains resulted in a decrease in the levels of colour and brightness, as well as higher alcohols and esters in the final beers. Consequently, the study provides valuable information for exploring beer brewing with 100 % unmalted...

  12. Cadmium translocation and accumulation in developing barley grains

    DEFF Research Database (Denmark)

    Chen, Fei; Wu, Feibo; Dong, Jing

    2007-01-01

    nutrient solution containing the markers for phloem (rubidium) and xylem (strontium) transport. Cd concentration in each part of detached spikes increased with external Cd levels, and Cd concentration in various organs over the three Cd levels of 0.5, 2, 8 μM Cd on 15-day Cd exposure was in the order: awn...... Soil cadmium (Cd) contamination has posed a serious problem for safe food production and become a potential agricultural and environmental hazard worldwide. In order to study the transport of Cd into the developing grains, detached ears of two-rowed barley cv. ZAU 3 were cultured in Cd stressed...... dramatic reduction in Cd transport to developing grains. The results indicated that awn, rachis and glume may involve in Cd transport into developing grains, and suggested that Cd redistribution in maturing cereals be considered as an important physiological process influencing the quality of harvested...

  13. Regeneration of the Barley Zygote in In Vitro Cultured Ovules

    DEFF Research Database (Denmark)

    Holme, Inger B; Brinch-Pedersen, Henrik; Lange, Mette;

    2010-01-01

    In vitro cultures of zygotes and small embryos carry a lot of potential for studying plant embryogenesis and are also highly relevant for plant biotechnology. Several years ago we established an in vitro ovule culture technique for barley that allows the regeneration of plants from zygotes (Holm et...... al., 1995, Sex. Plant. Reprod. 8:49-59). This culture system proved to be highly effective and indications for genotype independency was obtained. To further sustain this we recently investigated the ovule culture response in the cultivar Golden Promise and three cultivars known for low tissue...... pollination. Ovules were grown for 3 weeks on a culture medium where after embryos could be isolated and transferred to regeneration medium. An average of 1.2 green plantlets per ovule could be regenerated from 50 % of the isolated ovules. No genotypic differences were found on embryo induction...

  14. Cyclitols in maturing grains of wheat, triticale and barley

    Directory of Open Access Journals (Sweden)

    Lesław B. Lahuta

    2011-01-01

    Full Text Available In the present study, the feeding of stem-flag leaf-ear explants of wheat, triticale and barley with d-chiro-inositol and d-pinitol was used for modification of the composition of soluble carbohydrates in grains without genetic transformation of plants. Maturing grains indicated ability to uptake exogenously applied cyclitols, not occurring naturally in cereal plants, and synthesized their a-d-galactosides. The pattern of changes in soluble carbohydrates during grain maturation and germination was not disturbed by the uptake and accumulation of cyclitols. Both, d-chiro-inositol and d-pinitol as well as their a-d-galactosides can be an additional pool of soluble carbohydrates accumulated by maturing grains, without decreasing seeds viability. This is the first report indicating the possibility of introduction of cyclitols with potentially human health benefits properties into cereal grains.

  15. Combinatorial pooling enables selective sequencing of the barley gene space.

    Directory of Open Access Journals (Sweden)

    Stefano Lonardi

    2013-04-01

    Full Text Available For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.

  16. Dynamics of Microbial Functional Groups in Rhizosphere of Spring Barley

    Directory of Open Access Journals (Sweden)

    Vlad Stoian

    2016-11-01

    Full Text Available Plant rhizosphere is the portion of soil which is in direct contact with the plant roots. From the microbiological point of view, this area is characterized by strong dynamic of functional groups with high specificity towards the substrate available. Spring barley is a crop with high requirements to the composition of the microflora in the rhizosphere, disturbances produced by agronomic inputs affecting the stability of rhizospheric contact interfaces and ultimately the plant growth. Analysis of changes within the microbial community was carried out with the purpose of defining the disruptive impact of mineral inputs and potential of zeolite to reduce these disruptions. Microbial functional groups were analyzed on the basis of the CO2 export under the specific conditions of soil inoculation on specific substrates over a time period of incubation. Microresp detection plates allow evaluation of a large number of samples under identical conditions of inoculation and the establishment of dynamics of the entire microbial community. The dynamics of the entire microbial communities (basal respiration is stimulated to increase in case of unilateral application of zeolite and zeolite as a buffer for urea fertilization. General growth trend of microbial communities follows proportional the associated application of zeolite with urea, the most powerful non-symbiotic nitrogen fixation processes being stimulated by this combination of fertilizers. Simultaneously, an increase in the dynamics of denitrifiers was observed, also the decomposition of lignin and cellulose and biological crust formation due to the proliferation of cyanobacteria. Rhizosphere of barley plants is characterized by the presence of actinomycetes as dominant in functional microbial community of all experimental variants analyzed with a high capacity for biological degradation and raised mineralization of organic matter.

  17. The barley Frost resistance-H2 locus.

    Science.gov (United States)

    Pasquariello, Marianna; Barabaschi, Delfina; Himmelbach, Axel; Steuernagel, Burkhard; Ariyadasa, Ruvini; Stein, Nils; Gandolfi, Francesco; Tenedini, Elena; Bernardis, Isabella; Tagliafico, Enrico; Pecchioni, Nicola; Francia, Enrico

    2014-03-01

    Frost resistance-H2 (Fr-H2) is a major QTL affecting freezing tolerance in barley, yet its molecular basis is still not clearly understood. To gain a better insight into the structural characterization of the locus, a high-resolution linkage map developed from the Nure × Tremois cross was initially implemented to map 13 loci which divided the 0.602 cM total genetic distance into ten recombination segments. A PCR-based screening was then applied to identify positive bacterial artificial chromosome (BAC) clones from two genomic libraries of the reference genotype Morex. Twenty-six overlapping BACs from the integrated physical-genetic map were 454 sequenced. Reads assembled in contigs were subsequently ordered, aligned and manually curated in 42 scaffolds. In a total of 1.47 Mbp, 58 protein-coding sequences were identified, 33 of which classified according to similarity with sequences in public databases. As three complete barley C-repeat Binding Factors (HvCBF) genes were newly identified, the locus contained13 full-length HvCBFs, four Related to AP2 Triticeae (RAPT) genes, and at least five CBF pseudogenes. The final overall assembly of Fr-H2 includes more than 90 % of target region: all genes were identified along the locus, and a general survey of Repetitive Elements obtained. We believe that this gold-standard sequence for the Morex Fr-H2 will be a useful genomic tool for structural and evolutionary comparisons with Fr-H2 in winter-hardy cultivars along with Fr-2 of other Triticeae crops.

  18. A barley PHD finger transcription factor that confers male sterility by affecting tapetal development.

    Science.gov (United States)

    Fernández Gómez, José; Wilson, Zoe A

    2014-08-01

    Controlling pollen development is of major commercial importance in generating hybrid crops and selective breeding, but characterized genes for male sterility in crops are rare, with no current examples in barley. However, translation of knowledge from model species is now providing opportunities to understand and manipulate such processes in economically important crops. We have used information from regulatory networks in Arabidopsis to identify and functionally characterize a barley PHD transcription factor MALE STERTILITY1 (MS1), which expresses in the anther tapetum and plays a critical role during pollen development. Comparative analysis of Arabidopsis, rice and Brachypodium genomes was used to identify conserved regions in MS1 for primer design to amplify the barley MS1 gene; RACE-PCR was subsequently used to generate the full-length sequence. This gene shows anther-specific tapetal expression, between late tetrad stage and early microspore release. HvMS1 silencing and overexpression in barley resulted in male sterility. Additionally, HvMS1 cDNA, controlled by the native Arabidopsis MS1 promoter, successfully complemented the homozygous ms1 Arabidopsis mutant. These results confirm the conservation of MS1 function in higher plants and in particular in temperate cereals. This has provided the first example of a characterized male sterility gene in barley, which presents a valuable tool for the future control of male fertility in barley for hybrid development.

  19. Intake and digestion of whole-crop barley and wheat silages by dairy heifers.

    Science.gov (United States)

    Rustas, B-O; Bertilsson, J; Martinsson, K; Elverstedt, T; Nadeau, E

    2011-12-01

    The effect of maturity at harvest on the digestibility and intake of large bale silage made from whole-crop barley and wheat when fed to growing heifers was evaluated. Two crops of spring barley (Hordeum distichum cv. Filippa and Kinnan) and 1 of winter wheat (Triticum aestivum cv. Olevin) were harvested at the heading, milk, and dough stages of maturity. The silage was fed to 36 dairy heifers in a balanced crossover experiment with 3 periods and 9 treatments (diets based on 3 crops and 3 stages of maturity), organized into 6 pairs of 3 × 3 Latin squares. No clear relationship was observed between intake and stage of maturity of whole-crop cereal silage, but intake was positively correlated to silage DM content (P silage (P = 0.034). The NDF digestibility decreased between the heading and milk stages in all crops (P < 0.001), whereas it decreased in 1 barley crop (P < 0.001), increased in the other barley (P = 0.025), and was unchanged in the wheat between the milk and dough stages of maturity. Starch digestibility was less in the 2 barley crops compared with the wheat at the dough stage of maturity (P < 0.001). The feeding value of the whole-crop barley and wheat declined between the heading and milk stages of maturity, but thereafter the effect of maturity on the feeding value was minor.

  20. The effect of fungicidal treatment on selected quality parameters of barley and malt.

    Science.gov (United States)

    Havlová, Pavla; Lancová, Katerina; Vánová, Marie; Havel, Josef; Hajslová, Jana

    2006-02-22

    Protection of barley grain against contamination by fungi such as Fusarium spp., particularly by those producing mycotoxins, secondary metabolites with adverse health effects, is of principal importance. Fungicides applied immediately after full heading of spring barley is one method of direct protection. In this work, extensive two-year field experiments combined with a detailed chemical laboratory analysis (barley and malt) were performed with the aim to study the effect of previous crops, different fungicides, and other conditions on the selected barley and malt quality parameters (content of beta-glucans, pentosans, oxalic acid, deoxynivalenol, and gushing), while the main task was to follow the effect of the fungicide (used as a treatment to protect against pathogens, mostly Fusarium) on changes of the chemical composition in barley and malt, and gushing. It was found that the relationship between the studied factors and the parameters usually applied to the evaluation of barley and malt quality is quite complex and not straightforward. The responses show typical features of a multifactorial influence with both positive and negative correlations resulting in a decrease or increase in grain quality (concentrations of beta-glucans, pentosans, deoxynivalenol, and other studied parameters). The role of previous crops was also found to be important. The fungicides should be applied at the time of heading but not at the very beginning of this period.

  1. Heterogeneity of Powdery Mildew Resistance Revealed in Accessions of the ICARDA Wild Barley Collection

    Science.gov (United States)

    Dreiseitl, Antonin

    2017-01-01

    The primary genepool of barley comprises two subspecies – wild barley (Hordeum vulgare subsp. spontaneum) and cultivated barley H. vulgare. subsp. vulgare. The former originated 5.5 million years ago in southwest Asia and is the immediate ancestor of cultivated barley, which arose around 10,000 years ago. In this study, the specific resistance of a set of 146 wild barley accessions, maintained by the International Center for Agriculture Research in the Dry Areas (ICARDA), to 32 isolates of barley powdery mildew caused by Blumeria graminis f. sp. hordei was evaluated. The set comprised 146 heterogeneous accessions of a previously tested collection. Seed was obtained by single seed descent and each accession was usually represented by five single plant progenies. In total, 687 plant progenies were tested. There were 211 phenotypes of resistance among the accessions, 87 of which were found in single plants, while 202 plants contained the eight most common phenotypes. The most frequent phenotype was found in 56 plants that were susceptible to all pathogen isolates, whereas the second most frequent phenotype, which occurred in 46 plants, was resistant to all isolates. The broad resistance diversity that was revealed is of practical importance and is an aid to determining the extent and role of resistance in natural ecosystems.

  2. Powerful regulatory systems and post-transcriptional gene silencing resist increases in cellulose content in cell walls of barley

    OpenAIRE

    Tan, Hwei-Ting; Shirley, Neil J; Singh, Rohan R; Henderson, Marilyn; Dhugga, Kanwarpal S; Mayo, Gwenda M; Fincher, Geoffrey B.; Burton, Rachel A.

    2015-01-01

    Background The ability to increase cellulose content and improve the stem strength of cereals could have beneficial applications in stem lodging and producing crops with higher cellulose content for biofuel feedstocks. Here, such potential is explored in the commercially important crop barley through the manipulation of cellulose synthase genes (CesA). Results Barley plants transformed with primary cell wall (PCW) and secondary cell wall (SCW) barley cellulose synthase (HvCesA) cDNAs driven b...

  3. Promoter-bound trinucleotide repeat mRNA drives epigenetic silencing in fragile X syndrome.

    Science.gov (United States)

    Colak, Dilek; Zaninovic, Nikica; Cohen, Michael S; Rosenwaks, Zev; Yang, Wang-Yong; Gerhardt, Jeannine; Disney, Matthew D; Jaffrey, Samie R

    2014-02-28

    Epigenetic gene silencing is seen in several repeat-expansion diseases. In fragile X syndrome, the most common genetic form of mental retardation, a CGG trinucleotide-repeat expansion adjacent to the fragile X mental retardation 1 (FMR1) gene promoter results in its epigenetic silencing. Here, we show that FMR1 silencing is mediated by the FMR1 mRNA. The FMR1 mRNA contains the transcribed CGG-repeat tract as part of the 5' untranslated region, which hybridizes to the complementary CGG-repeat portion of the FMR1 gene to form an RNA·DNA duplex. Disrupting the interaction of the mRNA with the CGG-repeat portion of the FMR1 gene prevents promoter silencing. Thus, our data link trinucleotide-repeat expansion to a form of RNA-directed gene silencing mediated by direct interactions of the trinucleotide-repeat RNA and DNA.

  4. Primer extension studies on alpha-amylase mRNAs in barley aleurone. II. Hormonal regulation of expression.

    Science.gov (United States)

    Chandler, P M; Jacobsen, J V

    1991-04-01

    Relative levels of different alpha-amylase mRNAs were assessed by primer extension experiments using RNA prepared from aleurone of barley (Hordeum vulgare L. cv. Himalaya). Three different aleurone systems were studied: protoplasts prepared from aleurone layers, isolated aleurone layers, and aleurone from germinated grain. Oligonucleotide primers specific for the low-pI and high-pI alpha-amylase groups allowed the levels of different alpha-amylase mRNAs to be assessed both within and between the two groups. In all aleurone systems the same set of alpha-amylase mRNAs was produced in response to either applied gibberellic acid (aleurone protoplasts, isolated aleurone layers) or, presumably, native gibberellin(s) (germinated grain). This result indicates that the same set of genes is being expressed in each case. Differences were observed between the different aleurone systems in regulation of levels of alpha-amylase mRNAs. In particular, the regulation of alpha-amylase mRNA levels in aleurone of germinated grain has unique features which are not adequately explained by the response of isolated aleurone layers to gibberellic acid.

  5. RNA interference-mediated inhibition of Hepatitis B Virus replication

    Institute of Scientific and Technical Information of China (English)

    TANG Ni; ZHANG Bingqiang; YAN Ge; PU Dan; GAO Xiaolin; Tong-Chuan He; HUANG Ailong

    2004-01-01

    Persistent and recurrent infection of hepatitis B virus (HBV) represents one of the most common and severe viral infections of humans, and has caused a formidable health problem in the affected countries. Currently used antiviral drugs have a very limited success on controlling HBV replication and infection. RNA interference (RNAi), a process by which double-stranded RNA (dsRNA) directs sequence-specific degradation of target mRNA in mammalian and plant cells, has recently been used to knockdown gene expression in various species. In this study, we sought to determine whether RNAi-mediated silencing of HBV viral gene expression could lead to the effective inhibition of HBV replication. We first developed RNAi vectors that expressed small interfering RNA (siRNA) and targeted the HBV core or surface gene sequence. Our results demonstrated that these specific siRNAs efficiently reduced the levels of corresponding viral RNAs and proteins, and thus suppressed viral replication. Treatment with siRNA gave the greatest reduction in the levels of HBsAg (92%) and in HBeAg (85%) respectively in the cultured cell medium. Our findings further demonstrated that the RNAi-mediated antiviral effect was sequence-specific and dose-dependent. Therefore, our findings strongly suggest that RNAi-mediated silencing of HBV viral genes could effectively inhibit the replication of HBV, hence RNAi-based strategy should be further explored as a more efficacious antiviral therapy of HBV infection.

  6. Some quality attributes of low fat ice cream substituted with hulless barley flour and barley ß-glucan.

    Science.gov (United States)

    Abdel-Haleem, Amal M H; Awad, R A

    2015-10-01

    The purpose of this paper is to investigate some quality attributes of low fat ice cream (LFIC) substituted with hulless barley flour (HBF) and barley ß-glucan (BBG). The methodology included in this paper is based on adding HBF (1, 2, 3 and 4 %) as a partial substitution of skim milk powder (SMP) and BBG (0.40 %) as a complete substitution of carboxy methyl cellulose (CMC). All mixes and resultant ice cream samples were evaluated for their physicochemical properties as well as the sensory quality attributes.The results indicated that substitution of SMP with HBF significantly increased total solids (TS), fat and crude fiber, while crude protein and ash significantly decreased in ice cream mixes. BBG exhibited the same manner of control. Specific gravity was gradually increased with adding HBFand BBG in the mixes and therefore the overrun percent was significantly changed in the resultant ice cream. Adding HBF in ice cream formula led to significant decrease in acidity with higher freezing point and the product showed higher ability to meltdown. BBG treatment showed the same trend of control. Values of flow time and viscosity significantly increased with increasing HBF in the ice cream mixes, but these values significantly decreased in BBG mix. The time required to freeze ice cream mixes was decreased with increasing the ratio of HBF but, increased in BBG treatment. The substitution of SMP with 1 and 2 % HBF significantly (P ≤ 0.05) enhanced sensory attributes of ice cream samples. While, BBG treatment achieved mild score and acceptability.

  7. The sexed shape of Helminthosporium gramineum Rabh. fungus involved in increasing disease damage of torn leaves in barley

    Directory of Open Access Journals (Sweden)

    Viorel FLORIAN

    1988-08-01

    Full Text Available The onset of some sclerotic formations are reported on barley straws on which the following microscopic investigations and biometrical measurements peritecia, ascia and ascospores of Pyrenophora graminea (Rabh. Ito et Kurib. were detected, representing the sexed multiplication of fungus Helminthosporium gramineum, the pathogenic factor causing leaf tearing in barley, a condition rarely encountered in nature. Owing to the great number of peritecia on barley straw residues, we are of the opinion that the sexed multiplication of fungus represents a real danger in barley cultivation assigning the efficient control steps against this pest.

  8. Evaluation of triticale dried distillers grains with solubles as a substitute for barley grain and barley silage in feedlot finishing diets.

    Science.gov (United States)

    Wierenga, K T; McAllister, T A; Gibb, D J; Chaves, A V; Okine, E K; Beauchemin, K A; Oba, M

    2010-09-01

    The objective of this study was to assess the value of triticale dried distillers grains with solubles (DDGS) as a replacement for barley silage in addition to a portion of the dry-rolled barley (DRB) in a grain-based feedlot finishing diet. The trial used 160 crossbred yearling steers: 144 noncannulated (478 +/- 84 kg) in a complete randomized design, and 16 ruminally cannulated (494 +/- 50 kg) in a replicated 4 x 4 Latin square design. The noncannulated steers were assigned to 8 standard pens (10 per pen) and 8 pens equipped with the GrowSafe system (GrowSafe Systems Ltd., Airdrie, Alberta, Canada; 8 per pen). The cannulated steers were placed (2 per pen) in the 8 GrowSafe pens and moved between pens at 28-d intervals. Each of 4 experimental diets was fed in 2 standard and 2 GrowSafe pens. The diets contained (DM basis) 1) 85% DRB and 10% barley silage (CON); 2) 65% DRB, 20% triticale DDGS, and 10% barley silage (D-10S), 3) 65% DRB, 25% triticale DDGS, and 5% barley silage, and 4) 65% DRB, 30% triticale DDGS, and no barley silage. Supplement (5% of dietary DM) was included in all diets. Ruminal pH was measured over four 7-d periods using indwelling electrodes. Replacing barley silage with triticale DDGS linearly decreased mean ruminal pH (P = 0.006), linearly increased duration (P = 0.006 and P = 0.01) and area under the curve (P = 0.02 and P = 0.05) below pH 5.5 and 5.2, and linearly increased the frequency of subacute (P = 0.005) and acute (P = 0.05) bouts of ruminal acidosis. Variation in mean ruminal pH decreased (P = 0.008) in steers fed D-10S compared with CON. Similarly, variation in DMI was less for steers fed triticale DDGS compared with CON. Steers fed D-10S tended to have greater DMI (P = 0.08) but similar ADG and G:F compared with CON steers. Replacing barley silage with triticale DDGS tended to linearly decrease DMI (P = 0.10) and increase (P = 0.06) G:F. Compared with CON, steers fed D-10S tended to have greater backfat thickness (P = 0.10) and

  9. Satellite RNAs interfere with the function of viral RNA silencing suppressors

    Directory of Open Access Journals (Sweden)

    Wanxia eShen

    2015-04-01

    Full Text Available Viral satellite RNAs (satRNAs are small subviral RNAs and depend on the helper virus for replication and spread. satRNAs can attenuate helper virus-induced symptoms, the mechanism of which remains unclear. Here, we show that two virus-encoded suppressors of RNA silencing (VSRs, Cucumber mosaic virus (CMV 2b and Tombusvirus P19, suppress hairpin RNA (hpRNA-induced silencing of a β-glucuronidase (GUS gene in Nicotiana benthamiana. This suppression can be overcome by CMV Y-satellite RNA (Y-Sat via the Y-Sat-derived small interfering RNAs (siRNAs, which bind to the VSRs and displace the bound hpGUS-derived siRNAs. We also show that microRNA target gene expression in N. tabacum was elevated by CMV infection, presumably due to function of the 2b VSR, but this upregulation of microRNA target genes was reversed in the presence of Y-Sat. These results suggest that satRNA infection minimizes the effect of VSRs on host siRNA and microRNA-directed silencing. Our results suggest that the high abundance of satRNA-derived siRNAs contributes to symptom attenuation by binding helper virus-encoded VSRs, minimizing the capacity of the VSRs to bind host siRNA and miRNA and interfere with their function.

  10. Regulation of gene expression in plants through miRNA inactivation.

    Directory of Open Access Journals (Sweden)

    Sergey Ivashuta

    Full Text Available Eukaryotic organisms possess a complex RNA-directed gene expression regulatory network allowing the production of unique gene expression patterns. A recent addition to the repertoire of RNA-based gene regulation is miRNA target decoys, endogenous RNA that can negatively regulate miRNA activity. miRNA decoys have been shown to be a valuable tool for understanding the function of several miRNA families in plants and invertebrates. Engineering and precise manipulation of an endogenous RNA regulatory network through modification of miRNA activity also affords a significant opportunity to achieve a desired outcome of enhanced plant development or response to environmental stresses. Here we report that expression of miRNA decoys as single or heteromeric non-cleavable microRNA (miRNA sites embedded in either non-protein-coding or within the 3' untranslated region of protein-coding transcripts can regulate the expression of one or more miRNA targets. By altering the sequence of the miRNA decoy sites, we were able to attenuate miRNA inactivation, which allowed for fine regulation of native miRNA targets and the production of a desirable range of plant phenotypes. Thus, our results demonstrate miRNA decoys are a flexible and robust tool, not only for studying miRNA function, but also for targeted engineering of gene expression in plants. Computational analysis of the Arabidopsis transcriptome revealed a number of potential miRNA decoys, suggesting that endogenous decoys may have an important role in natural modulation of expression in plants.

  11. Comparison of different methods for DNA-free RNA isolation from SK-N-MC neuroblastoma

    Directory of Open Access Journals (Sweden)

    Ferreira Ricardo B

    2011-01-01

    Full Text Available Abstract Background RNA quality and quantity are important factors for ensuring the accuracy of gene expression analysis and other RNA-based downstream applications. Extraction of high quality nucleic acids is difficult from neuronal cells and brain tissues as they are particularly rich in lipids. In addition, most common RNA extraction methods are phenol-based, resulting in RNA that may be incompatible with downstream applications such as gene expression. Findings In this work, a comparative analysis of the RNA quality obtained from SK-N-MC cells was performed using six commonly used RNA isolation kits: two phenol-based kits and four non-phenol based kits. The non-phenol based kits tested AxyPrep Multisource Total RNA Miniprep, RNeasy® Mini, EasySpin and Ilustra RNAspin Mini RNA Isolation, all performed well and resulted in the isolation of high quality RNA, as evaluated by A260/A280. The RNA extracted with AxyPrep Multisource Total RNA Miniprep, RNeasy® Mini and EasySpin provided the highest RNA yields. In particular, the RNA isolated by AxyPrep Multisource Total RNA Miniprep Kit did not show any detectable genomic DNA contamination even without previous DNase treatment or after RNA direct PCR amplification using universal 18S primers. Conclusions The RNA extracted from SK-N-MC cells with AxyPrep Multisource Total RNA Miniprep Kit was superior with respect to the RNA quality and concentration. This kit does not use aggressive organic solvents and RNA free of genomic DNA was isolated without the need for DNase treatment.

  12. UNcleProt (Universal Nuclear Protein database of barley): The first nuclear protein database that distinguishes proteins from different phases of the cell cycle.

    Science.gov (United States)

    Blavet, Nicolas; Uřinovská, Jana; Jeřábková, Hana; Chamrád, Ivo; Vrána, Jan; Lenobel, René; Beinhauer, Jana; Šebela, Marek; Doležel, Jaroslav; Petrovská, Beáta

    2017-01-02

    Proteins are the most abundant component of the cell nucleus, where they perform a plethora of functions, including the assembly of long DNA molecules into condensed chromatin, DNA replication and repair, regulation of gene expression, synthesis of RNA molecules and their modification. Proteins are important components of nuclear bodies and are involved in the maintenance of the nuclear architecture, transport across the nuclear envelope and cell division. Given their importance, the current poor knowledge of plant nuclear proteins and their dynamics during the cell's life and division is striking. Several factors hamper the analysis of the plant nuclear proteome, but the most critical seems to be the contamination of nuclei by cytosolic material during their isolation. With the availability of an efficient protocol for the purification of plant nuclei, based on flow cytometric sorting, contamination by cytoplasmic remnants can be minimized. Moreover, flow cytometry allows the separation of nuclei in different stages of the cell cycle (G1, S, and G2). This strategy has led to the identification of large number of nuclear proteins from barley (Hordeum vulgare), thus triggering the creation of a dedicated database called UNcleProt, http://barley.gambrinus.ueb.cas.cz/ .

  13. Comparison of different pretreatment strategies for enzymatic hydrolysis of wheat and barley straw.

    Science.gov (United States)

    Rosgaard, Lisa; Pedersen, Sven; Meyer, Anne S

    2007-12-01

    In biomass-to-ethanol processes a physico-chemical pretreatment of the lignocellulosic biomass is a critical requirement for enhancing the accessibility of the cellulose substrate to enzymatic attack. This report evaluates the efficacy on barley and wheat straw of three different pretreatment procedures: acid or water impregnation followed by steam explosion versus hot water extraction. The pretreatments were compared after enzyme treatment using a cellulase enzyme system, Celluclast 1.5 L from Trichoderma reesei, and a beta-glucosidase, Novozyme 188 from Aspergillus niger. Barley straw generally produced higher glucose concentrations after enzymatic hydrolysis than wheat straw. Acid or water impregnation followed by steam explosion of barley straw was the best pretreatment in terms of resulting glucose concentration in the liquid hydrolysate after enzymatic hydrolysis. When the glucose concentrations obtained after enzymatic hydrolyses were related to the potential glucose present in the pretreated residues, the highest yield, approximately 48% (g g-1), was obtained with hot water extraction pretreatment of barley straw; this pretreatment also produced highest yields for wheat straw, producing a glucose yield of approximately 39% (g g-1). Addition of extra enzyme (Celluclast 1.5 L+Novozyme 188) during enzymatic hydrolysis resulted in the highest total glucose concentrations from barley straw, 32-39 g L-1, but the relative increases in glucose yields were higher on wheat straw than on barley straw. Maldi-TOF MS analyses of supernatants of pretreated barley and wheat straw samples subjected to acid and water impregnation, respectively, and steam explosion, revealed that the water impregnated + steam-exploded samples gave a wider range of pentose oligomers than the corresponding acid-impregnated samples.

  14. Barley Leaf Area and Leaf Growth Rates Are Maximized during the Pre-Anthesis Phase

    Directory of Open Access Journals (Sweden)

    Ahmad M. Alqudah

    2015-04-01

    Full Text Available Leaf developmental traits are an important component of crop breeding in small-grain cereals. Surprisingly, little is known about the genetic basis for the differences in barley (Hordeum vulgare L. leaf development. The two barley row-type classes, i.e., two- and six-rowed, show clear-cut differences in leaf development. To quantify these differences and to measure the genetic component of the phenotypic variance for the leaf developmental differences in both row-type classes we investigated 32 representative spring barley accessions (14 two- and 18 six-rowed accessions under three independent growth conditions. Leaf mass area is lower in plants grown under greenhouse (GH conditions due to fewer, smaller, and lighter leaf blades per main culm compared to pot- and soil-grown field plants. Larger and heavier leaf blades of six-rowed barley correlate with higher main culm spike grain yield, spike dry weight, and harvest index; however, smaller leaf area (LA in two-rowed barley can be attributed to more spikes, tillers, and biological yield (aboveground parts. In general, leaf growth rate was significantly higher between awn primordium and tipping stages. Moderate to very high broad-sense heritabilities (0.67–0.90 were found under all growth conditions, indicating that these traits are predominantly genetically controlled. In addition, our data suggests that GH conditions are suitable for studying leaf developmental traits. Our results also demonstrated that LA impacts single plant yield and can be reconsidered in future breeding programs. Six-rowed spike 1 (Vrs1 is the major determinate of barley row-types, the differences in leaf development between two- and six-rowed barleys may be attributed to the regulation of Vrs1 in these two classes, which needs further testing.

  15. Heat processing of barley and enzyme supplementation of diets for broilers.

    Science.gov (United States)

    Gracia, M I; Latorre, M A; García, M; Lázaro, R; Mateos, G G

    2003-08-01

    The influence of heat processing (HP) of barley and enzyme supplementation (ES) of the diet on digestive and performance traits of broilers to 21 d was studied. There were four treatments arranged factorially with two barley-processing treatments (raw or heated), two levels of ES (0 or 500 ppm), and five replicates per treatment. Chicks fed HP barley grew faster than broilers fed raw barley until 8 d of age, but the effect disappeared thereafter. In general, ES improved broiler performance at all ages. Intestinal viscosity was increased by HP of barley (P viscosity caused by ES was greater for HP than for raw barley diets (HP x ES; P starch and neutral detergent fiber, retention increased linearly with age (P < or = 0.01), but for the remaining nutrients the retention decreased from d 4 to 8 and then increased until d 21 (P < or = 0.001). Also, the beneficial effects of HP on retention of nutrients were more pronounced at younger ages (HP x age; P < or = 0.05). Both HP (P < or = 0.001) and ES (P < or = 0.01) increased liver weight, and enzymes reduced the weights of pancreas (P < or = 0.05) and small intestine (P < or = 0.001). Villus height was improved by HP (P < or = 0.001) and ES (P < or = 0.01), but villus surface area was only improved by enzymes (P < or = 0.01). It was concluded that broiler performance is improved by HP of barley at early ages and by ES of the diet throughout the trial. Also, HP and ES increased apparent retention of nutrients, AMEn of the diet, and villus height.

  16. A study of ribonucleoproteins: The sequence of rabbit 18S ribosomal RNA and the identification of proteins associated with messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Connaughton, J.F. Jr.

    1989-01-01

    This study considers the functional role of ribosomal RNA and messenger ribonucleoproteins in the translational regulation of gene expression. The primary structure of rabbit 18S ribosomal RNA was determined by nucleotide sequence analysis of the RNA directly. Rabbit 18S RNA was cleaved with either T{sub 1} ribonuclease or RNase H, using a Pst 1 DNA linker to generate a unique set of overlapping fragments spanning the entire molecule. Both intact and fragmented 18S RNA were end-labeled with {sup 32}P and base-specifically cleaved enzymatically and chemically. Nucleotide sequences were determined from long polyacrylamide sequencing gels run in formamide. To assess functional roles of RNA in gene expression, specific mRNA-protein interactions were also examined. Eukaryotic mRNA is associated with specific proteins that may be important in translational regulation and mRNA stability; mRNP complexes were reconstituted in a message-dependent, cell-free rabbit reticulocyte translation system, using unique mRNA species transcribed in vitro with SP6 polymerase. Transcripts of both rabbit and human {beta}-globin cDNA were labeled with {sup 32}P either throughout the molecule ore selectively at the 5{prime} and 3{prime} terminus.

  17. Barley Yellow Mosaic Virus VPg Is the Determinant Protein for Breaking eIF4E-Mediated Recessive Resistance in Barley Plants

    Science.gov (United States)

    Li, Huangai; Kondo, Hideki; Kühne, Thomas; Shirako, Yukio

    2016-01-01

    In this study, we investigated the barley yellow mosaic virus (BaYMV, genus Bymovirus) factor(s) responsible for breaking eIF4E-mediated recessive resistance genes (rym4/5/6) in barley. Genome mapping analysis using chimeric infectious cDNA clones between rym5-breaking (JT10) and rym5-non-breaking (JK05) isolates indicated that genome-linked viral protein (VPg) is the determinant protein for breaking the rym5 resistance. Likewise, VPg is also responsible for overcoming the resistances of rym4 and rym6 alleles. Mutational analysis identified that amino acids Ser-118, Thr-120, and His-142 in JT10 VPg are the most critical residues for overcoming rym5 resistance in protoplasts. Moreover, the rym5-non-breaking JK05 could accumulate in the rym5 protoplasts when eIF4E derived from a susceptible barley cultivar was expressed from the viral genome. Thus, the compatibility between VPg and host eIF4E determines the ability of BaYMV to infect barley plants. PMID:27746794

  18. Do 14-3-3 proteins and plasma membrane H+-AtPases interact in the barley epidermis in response to the barley powdery mildew fungus?

    DEFF Research Database (Denmark)

    Finni, Christine; Andersen, Claus H; Borch, Jonas;

    2002-01-01

    , or treatment with fusicoccin, results in an increase in fusicoccin binding ability of barley leaf membranes. Overlay assays show a fungus-induced increase in binding of digoxygenin-labelled 14-3-3 protein to several proteins including a 100 kDa membrane protein, probably the plasma membrane H...

  19. Do 14-3-3 proteins and plasma membrane H+-ATPases interact in the barley epidermis in response to the barley powdery mildew fungus?

    DEFF Research Database (Denmark)

    Finnie, C.; Andersen, C.H.; Borch, J.;

    2002-01-01

    , or treatment with fusicoccin, results in an increase in fusicoccin binding ability of barley leaf membranes. Overlay assays show a fungus-induced increase in binding of digoxygenin-labelled 14-3-3 protein to several proteins including a 100 kDa membrane protein, probably the plasma membrane H...

  20. Mapping genes in barley for resistance to Puccinia coronata from couch grass and to P. striiformis from brome, wheat and barley

    NARCIS (Netherlands)

    Niks, R.E.; Alemu, Sisay K.; Marcel, T.C.; Heyzen, van Skye

    2015-01-01

    Barley (Hordeum vulgare L.) mapping populations have been developed that are useful to study the inheritance of quantitative resistance to adapted and unadapted rust fungi. In a recent host range study, we found that the parents of those mapping populations also differed in their resistance to th

  1. Effect of pH and Recombinant Barley (Hordeum vulgare L.) Endoprotease B2 on Degradation of Proteins in Soaked Barley

    DEFF Research Database (Denmark)

    Christensen, Jesper Bjerg; Dionisio, Giuseppe; Poulsen, Hanne Damgaard

    2014-01-01

    . Proteolysis evaluated by SDS-PAGE and differential proteomics confirmed a powerful effect of adding rec-HvEP-B2 to the soaked barley, regardless of the genotype. Our study addresses the use of rec-HvEP-B2 as an effective feed enzyme protease. HvEP-B2 has the potential to increase the digestibility of protein...

  2. Barley HvPAPhy_a as transgene provides high and stable phytase activities in mature barley straw and in grains

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Madsen, Claus Krogh

    2017-01-01

    , the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T2-generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase...

  3. Effect of feeding corn, hull-less or hulled barley on fermentation by mixed cultures of ruminal microorganisms.

    Science.gov (United States)

    Fellner, V; Burns, J C; Marshall, D S

    2008-05-01

    Increased demands for corn grain warrant the evaluation of alternative grain types for ruminant production systems. This study was conducted to determine the effects of hulled and hull-less barley (Hordeum vulgare L.) cultivars compared with corn (Zea mays L.) as an alternative grain type on fermentation in cultures of mixed ruminal microorganisms. Three continuous fermentors were fed 14 g of dry feed per day (divided equally between 2 feedings) consisting of alfalfa (Medicago sativa L.) hay pellets (40% of dry matter) and 1) ground corn, 2) hulled barley, or 3) hull-less barley concentrate (60% of dry matter) in each fermentor. Following an adaptation period of 5 d, culture samples were taken at 2 h after the morning feeding on d 6, 7, and 8 of each period for analysis. A second run of the fermentors followed the same treatment sequence to provide replication. Culture pH was reduced with corn (5.55) and did not differ between barley cultivars (average pH 5.89). Total volatile fatty acid concentration and acetate to propionate ratio were not different across grain type or barley cultivar with the exception of greater total volatile fatty acid concentrations with hull-less barley. Corn produced less methane (14.6 mmol/d) and ammonia-N (7.3 mg/100 mL) compared with barley (33.1 mmol/d and 22 mg/100 mL, respectively); methane was greater with hull-less barley but ammonia-N concentration was similar between the 2 barley cultivars. Hull-less barley had greater digestibility compared with hulled barley, and corn had reduced digestibility compared with barley. Concentrations of C18:0 were greater and those of C18:1 and C18:2 lesser in cultures fed hulled and hull-less barley compared with corn. Our data indicate that grain type and barley cultivar have an impact on ruminal fermentation. The lesser starch concentration of barley minimized the drop in culture pH and improved digestibility.

  4. Effects of sulfur nutritional level on cadmium toxicity in barley

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yichang; Huerta, A.J. (Miami Univ., Oxford, OH (United States))

    1993-05-01

    The effects of S levels on Cd toxicity were studied in barley (Hordeum vulgare L.cv.UC 476). Barley was grown hydroponically in half-strength Hoagland's solution containing either 100% or 10% S in a growth chamber at constant 20 C, 290 umole M[sup [minus]2] s[sup [minus]1] light intensity, and a 16/18 hour light/dark period. Five days after the first true leaf appeared, 15 uM Cd was added to the nutrient solutions where appropriate. At 14 days after beginning of Cd treatment, plants were analyzed for photosynthetic characteristics. The photosynthetic characteristics measured were CO[sub 2] response curves (measured with a LICOR 6200 portable photosynthesis system), and fluorescence measurement system. At 21 days they were analyzed for morphological and biomass measurements. The CO[sub 2] response curves for leaves of plants treated with 10% S did not significantly differ from those of plants treated with 100% S. Treatment with Cd significantly reduced the CO[sup 2] saturated rates of photosynthesis and the reduction was more significant in the 10% S than in the 100% S plants. Photochemical efficiency of PSII (FV/FM) and fluorescence quenching capacity (FQ) were not affected by 10% S as compared to 100% S treatment. Interestingly, treatment with Cd significantly increased both FV/FM and FQ as compared to control., However, S level had no effect on the fluorescence parameters of Cd-treated plants. Leaf and root length, leaf area, root and shoot dry weight were only slightly affected (increased or decreased) by 10% S as compared to 100% S but very significantly reduced by treatment with Cd. Our results agree with the previous reports which show that S (an important component of glutathione and phytochelatins which are low molecular weight Cd binding proteins), is important in regulating Cd detoxification in plants. However, we are continuing to conduct experiments as even lower S concentrations and different Cd concentrations.

  5. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage

    OpenAIRE

    Guo, P; Baum, M.; Grando, S.; Ceccarelli, S.; Bai, G.; Li, R; Von Korff, M.; Varshney, R.,; Graner, A.; Valkoun, V.

    2007-01-01

    Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas worldwide. Identification of the genes responsible for drought tolerance in barley (Hordeum vulgare L.) will facilitate understanding of the molecular mechanisms of drought tolerance, and also facilitate the genetic improvement of barley through marker-assisted selection or gene transformation. To monitor the changes in gene expression at the transcriptional level in barley leaves during the repro...

  6. Fermentation of barley by using Saccharomyces cerevisiae: examination of barley as a feedstock for bioethanol production and value-added products.

    Science.gov (United States)

    Gibreel, Amera; Sandercock, James R; Lan, Jingui; Goonewardene, Laksiri A; Zijlstra, Ruurd T; Curtis, Jonathan M; Bressler, David C

    2009-03-01

    The objective of this study was to examine the ethanol yield potential of three barley varieties (Xena, Bold, and Fibar) in comparison to two benchmarks, corn and wheat. Very high gravity (VHG; 30% solids) fermentations using both conventional and Stargen 001 enzymes for starch hydrolysis were carried out as simultaneous saccharification and fermentation. The grains and their corresponding dried distiller's grain with solubles (DDGS) were also analyzed for nutritional and value-added characteristics. A VHG traditional fermentation approach utilizing jet-cooking fermentation revealed that both dehulled Bold and Xena barley produced ethanol concentrations higher than that produced by wheat (12.3, 12.2, and 11.9%, respectively) but lower than that produced by corn (13.8%). VHG-modified Stargen-based fermentation of dehulled Bold barley demonstrated comparable performance (14.3% ethanol) relative to that of corn (14.5%) and wheat (13.3%). Several important components were found to survive fermentation and were concentrated in DDGS. The highest yield of phenolics was detected in the DDGS (modified Stargen 001, 20% solids) of Xena (14.6 mg of gallic acid/g) and Bold (15.0 mg of gallic acid/g) when the hull was not removed before fermentation. The highest concentration of sterols in DDGS from barley was found in Xena (3.9 mg/g) when the hull was included. The DDGS recovered from corn had the highest concentration of fatty acids (72.6 and 77.5 mg/g). The DDGS recovered from VHG jet-cooking fermentations of Fibar, dehulled Bold, and corn demonstrated similar levels of tocopherols and tocotrienols. Corn DDGS was highest in crude fat but was lowest in crude protein and in vitro energy digestibility. Wheat DDGS was highest in crude protein content, similar to previous studies. The barley DDGS was the highest in in vitro energy digestibility.

  7. Enzymatic fractionation of SAA-pretreated barley straw for production of fuel ethanol and astaxanthin as a value-added co-product

    Science.gov (United States)

    Barley straw was used to demonstrate a process for production of ethanol and astaxanthin as a value-added co-product. Barley straw was pretreated by soaking in aqueous ammonia (SAA) using the previously determined optimum conditions. The pretreated barley straw was first hydrolyzed with Accellerase®...

  8. The CesA gene family of barley. Quantitative analysis of transcripts reveals two groups of co-expressed genes.

    Science.gov (United States)

    Burton, Rachel A; Shirley, Neil J; King, Brendon J; Harvey, Andrew J; Fincher, Geoffrey B

    2004-01-01

    Sequence data from cDNA and genomic clones, coupled with analyses of expressed sequence tag databases, indicate that the CesA (cellulose synthase) gene family from barley (Hordeum vulgare) has at least eight members, which are distributed across the genome. Quantitative polymerase chain reaction has been used to determine the relative abundance of mRNA transcripts for individual HvCesA genes in vegetative and floral tissues, at different stages of development. To ensure accurate expression profiling, geometric averaging of multiple internal control gene transcripts has been applied for the normalization of transcript abundance. Total HvCesA mRNA levels are highest in coleoptiles, roots, and stems and much lower in floral tissues, early developing grain, and in the elongation zone of leaves. In most tissues, HvCesA1, HvCesA2, and HvCesA6 predominate, and their relative abundance is very similar; these genes appear to be coordinately transcribed. A second group, comprising HvCesA4, HvCesA7, and HvCesA8, also appears to be coordinately transcribed, most obviously in maturing stem and root tissues. The HvCesA3 expression pattern does not fall into either of these two groups, and HvCesA5 transcript levels are extremely low in all tissues. Thus, the HvCesA genes fall into two general groups of three genes with respect to mRNA abundance, and the co-expression of the groups identifies their products as candidates for the rosettes that are involved in cellulose biosynthesis at the plasma membrane. Phylogenetic analysis allows the two groups of genes to be linked with orthologous Arabidopsis CesA genes that have been implicated in primary and secondary wall synthesis.

  9. Review:Aluminium tolerance in barley (Hordeum vulgare L.): physiological mechanisms, genetics and screening methods

    Institute of Scientific and Technical Information of China (English)

    WANG Jun-ping; RAMAN Harsh; ZHANG Guo-ping; MENDHAM Neville; ZHOU Mei-xue

    2006-01-01

    Aluminium (Al) toxicity is one of the major limiting factors for barley production on acid soils. It inhibits root cell division and elongation, thus reducing water and nutrient uptake, consequently resulting in poor plant growth and yield. Plants tolerate Al either through external resistance mechanisms, by which Al is excluded from plant tissues or internal tolerance mechanisms, conferring the ability of plants to tolerate Al ion in the plant symplasm where Al that has permeated the plasmalemma is sequestered or converted into an innocuous form. Barley is considered to be most sensitive to Al toxicity among cereal species. Al tolerance in barley has been assessed by several methods, such as nutrient solution culture, soil bioassay and field screening. Genetic and molecular mapping research has shown that Al tolerance in barley is controlled by a single locus which is located on chromosome 4H. Molecular markers linked with Al tolerance loci have been identified and validated in a range of diverse populations. This paper reviews the (1) screening methods for evaluating Al tolerance, (2) genetics and (3) mechanisms underlying Al tolerance in barley.

  10. Histochemical characterization of early response to Cochliobolus sativus infection in selected barley genotypes.

    Science.gov (United States)

    Rodríguez-Decuadro, Susana; Silva, Paula; Bentancur, Oscar; Gamba, Fernanda; Pritsch, Clara

    2014-07-01

    Much effort is being made to breed barley with durable resistance to leaf spot blotch incited by Bipolaris sorokiniana (teleomorph: Cochliobolus sativus). We hypothesized that susceptibility and resistance traits in 11 diverse barley genotypes inoculated with a single C. sativus isolate might specify a range of distinct host cell responses. Quantitative descriptions of interaction microphenotypes exhibited by different barley genotype seedlings after infection with C. sativus are provided. Early oxidative responses occurring in epidermis and mesophyll leaf tissue were monitored by histochemical analysis of H2O2 accumulation at 8, 24, and 48 h after inoculation. Cell wall apposition (CWA) in epidermal cells and hypersensitive reaction (HR) of epidermal or mesophyll tissue were early defenses in both resistant and susceptible genotypes. There were differences in level, duration, and frequency of occurrence for CWA and HR for the different barley genotypes. Occurrence of HR in epidermal cells at post-penetration stages was indicative of compatibility. Patterns of cell responses were microphenotypically diverse between different resistant and susceptible genotypes. This suggests that timing and level of response are key features of microphenotypic diversity that distinguish different functional mechanisms of resistance and susceptibility present in barley.

  11. Evaluation of Toxic Effects and Bioaccumulation of Cadmium and Copper in Spring Barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Jūratė Žaltauskaitė

    2013-07-01

    Full Text Available This paper deals with the analysis of toxic effects of cadmium and copper on the growth of spring barley (Hordeum vulgare L. cultivated in hydroponics. The seedlings of barley were treated with four different concentrations of cadmium and copper, ranging from 0.1 to 10 mg L-1. The aim of the study was to assess toxic effects of cadmium (Cd and copper (Cu on the growth of spring barley, and to determine metal accumulation in above-ground and underground parts of the plant. The impact of Cu and Cd on photosynthetic pigments (chlorophyll a, b, the content of malondialdehyde (MDA, and the essential micronutrients (Mn, Fe were examined. Metal treatment reduced the growth of roots (by 60%, shoots (Cd – 48 %, Cu – 57% and dry weight (Cd – 47 %, Cu – 52% of barley. Exposure to metals altered the content of photosynthetic pigments and caused lipid peroxidation. Regression analysis revealed that there was significant negative relationship between MDA content and biomass of barley treated with Cu (r=-0.99, p=0.01. The examined heavy metals were accumulated mainly in the roots and bioconcentration of Cu there was higher than that of Cd, indicating that roots tended to accumulate higher amounts of Cu than Cd. Though translocation of Cd from roots to above-ground tissues was higher, higher levels of Cd were observed in leaves.DOI: http://dx.doi.org/10.5755/j01.erem.64.2.1951

  12. Utilization of barley or wheat bran to bioconvert glutamate to γ-aminobutyric acid (GABA).

    Science.gov (United States)

    Jin, Wen-Jie; Kim, Min-Ju; Kim, Keun-Sung

    2013-09-01

    This study deals with the utilization of agro-industrial wastes created by barley and wheat bran in the production of a value-added product, γ-aminobutyric acid (GABA). The simple and eco-friendly reaction requires no pretreatment or microbial fermentation steps but uses barley or wheat bran as an enzyme source, glutamate as a substrate, and pyridoxal 5'-phosphate (PLP) as a cofactor. The optimal reaction conditions were determined on the basis of the temperatures and times used for the decarboxylation reactions and the initial concentrations of barley or wheat bran, glutamate, and PLP. The optimal reactions produced 9.2 mM of GABA from 10 mM glutamate, yielding a 92% GABA conversion rate, when barley bran was used and 6.0 mM of GABA from 10 mM glutamate, yielding a 60% GABA conversion rate, when wheat bran was used. The results imply that barley bran is more efficient than wheat bran in the production of GABA.

  13. EFFECTS OF BARLEY PROCESSING ON THE BIOPRODUCTIVE INDICES IN FATTENING WEANED LAMBS

    Directory of Open Access Journals (Sweden)

    S. VOIA

    2013-12-01

    Full Text Available The objective of our researches was to observe the nutritive and productive effect of the ratio, offered at discretion, composed of alfalfa hay and barley under the following presentation forms: whole grains, roughly ground (4mm with and without addition of yeast, strain Yea-Sacc1026, to lambs submitted for fattening. The experiment lasted 54 days, the biological material was represented by Turcana lambs, grouped in three lots (n=12. Growth performances were significant bigger (p< 0.04 for the final body weight, total weight gain and average daily gain, but the specific intake was decreased with 0.49 UNC in lambs that consumed ground barley prior to those that consumed whole barley grains. The addition of Saccharomyces cerevisiae, strain Yea-Sacc1026 in the ground barley at 4 mm has a more productive and evident effect (p<0.02 regarding final body weight, total weight and average daily weigh compared to the lambs fed with whole barley grains, with a specific intake lower with 0.89 UNC.

  14. Enzymatic fingerprinting of arabinoxylan and β-glucan in triticale, barley and tritordeum grains.

    Science.gov (United States)

    Rakha, A; Saulnier, L; Aman, P; Andersson, R

    2012-10-15

    Enzymatic fingerprinting of arabinoxylan (AX) and β-glucan using endo-xylanase and lichenase, respectively, helps determine the structural heterogeneity between different cereals and within genotypes of the same cereal. This study characterised the structural features of AX and β-glucan in whole grains of eight triticale cultivars grown at two locations, 20 barley cultivars/lines with wide variation in composition and morphology and five tritordeum breeding lines. Principal component analysis (PCA) resulted in clear clustering of these cereals. In general, barley and tritordeum had a higher relative proportion of highly branched arabinoxylan oligosaccharides (AXOS) than triticale. Subsequent analysis of triticale revealed two clusters based on growing region along principal component (PC) 1, while PC2 explained the genetic variability and was based on mono-substitution and di-substitution in AX fragments. PCA of β-glucan features separated the three cereals based on β-glucan content. The molar ratio of trisaccharide to tetrasaccharide was 2.5-3.4 in triticale, 2.3-3.3 in barley and 2.8-3.4 in tritordeum. Barley showed a strong positive correlation (r=0.86) between β-glucan content and relative proportion of trisaccharide. The results show that structural features of AX and β-glucan vary between and within triticale, barley and tritordeum grains which might be important determinants of end-use quality of grains.

  15. Mathematical Modelling of Allelopathy: IV. Assessment of Contributions of Competition and Allelopathy to Interference by Barley.

    Science.gov (United States)

    Liu, De Li; An, Min; Johnson, I R; Lovett, J V

    2005-04-01

    One of the main challenges to the research on allelopathy is technically the separation of allelopathic effect from competition, and quantitatively, the assessment of the contribution of each component to overall interference. A simple mathematical model is proposed to calculate the contribution of allelopathy and competition to interference. As an example of applying the quantitative model to interference by barley (Hordeum vulgare cv. Triumph), the approach used was an addition of allelopathic effect, by an equivalent amount, to the environment of the test plant (white mustard, Sinapis alba), rather than elimination of competition. Experiments were conducted in glasshouse to determine the magnitude of the contributions of allelopathy and competition to interference by barley. The leachates of living barley roots significantly reduced the total dry weight of white mustard. The model involved the calculation of adjusted densities to an equivalent basis for modelling the contribution of allelopathy and competition to total interference. The results showed that allelopathy contributed 40%, 37% and 43% to interference by barley at 6, 12 and 18 white mustard pot(-1). The consistency in magnitude of the calculated contribution of allelopathic effect by barley across various densities of receiver plant suggested that the adjusted equivalent density is effective and that the model is able to assess the contribution of each component of interference regardless of the density of receiver plant.

  16. Grain Composition and Functional Ingredients of Barley Varieties Created in Latvia

    Directory of Open Access Journals (Sweden)

    Šterna Vita

    2015-09-01

    Full Text Available Cereals, including barley, have been recognised as functional foods that provide beneficial effect on the health of the consumer and decrease the risk of various diseases. The aim of investigation was to determine the grain composition of barley varieties and perspective breeding lines bred in Latvia and to evaluate its functional ingredients. The results of analysis showed that protein content among varieties ranged from 106.6-146.8 g·kg-1, total dietary fibre 187.4-208.2 g·kg-1, β-glucans 42.8 g-49.4 g·kg-1, and amount of α-tocopherol 6.03-8.93 mg·kg-1. The sum of essential amino acids in barley grain samples was from 32.90 g·kg-1 to 38.71 g·kg-1. All varieties of hulled and hulless barley grain were found to be sources of protein with high biological value. Comparison of barley varieties bred in Latvia suggests that variety ‘Kornelija’ outperforms others in protein, dietary fibre and micronutrient content.

  17. Growth curve registration for evaluating salinity tolerance in barley

    KAUST Repository

    Meng, Rui

    2017-03-23

    Background: Smarthouses capable of non-destructive, high-throughput plant phenotyping collect large amounts of data that can be used to understand plant growth and productivity in extreme environments. The challenge is to apply the statistical tool that best analyzes the data to study plant traits, such as salinity tolerance, or plant-growth-related traits. Results: We derive family-wise salinity sensitivity (FSS) growth curves and use registration techniques to summarize growth patterns of HEB-25 barley families and the commercial variety, Navigator. We account for the spatial variation in smarthouse microclimates and in temporal variation across phenotyping runs using a functional ANOVA model to derive corrected FSS curves. From FSS, we derive corrected values for family-wise salinity tolerance, which are strongly negatively correlated with Na but not significantly with K, indicating that Na content is an important factor affecting salinity tolerance in these families, at least for plants of this age and grown in these conditions. Conclusions: Our family-wise methodology is suitable for analyzing the growth curves of a large number of plants from multiple families. The corrected curves accurately account for the spatial and temporal variations among plants that are inherent to high-throughput experiments.

  18. Structural lability of Barley stripe mosaic virus virions.

    Directory of Open Access Journals (Sweden)

    Valentin V Makarov

    Full Text Available Virions of Barley stripe mosaic virus (BSMV were neglected for more than thirty years after their basic properties were determined. In this paper, the physicochemical characteristics of BSMV virions and virion-derived viral capsid protein (CP were analyzed, namely, the absorption and intrinsic fluorescence spectra, circular dichroism spectra, differential scanning calorimetry curves, and size distributions by dynamic laser light scattering. The structural properties of BSMV virions proved to be intermediate between those of Tobacco mosaic virus (TMV, a well-characterized virus with rigid rod-shaped virions, and flexuous filamentous plant viruses. The BSMV virions were found to be considerably more labile than expected from their rod-like morphology and a distant sequence relation of the BSMV and TMV CPs. The circular dichroism spectra of BSMV CP subunits incorporated into the virions, but not subunits of free CP, demonstrated a significant proportion of beta-structure elements, which were proposed to be localized mostly in the protein regions exposed on the virion outer surface. These beta-structure elements likely formed during virion assembly can comprise the N- and C-terminal protein regions unstructured in the non-virion CP and can mediate inter-subunit interactions. Based on computer-assisted structure modeling, a model for BSMV CP subunit structural fold compliant with the available experimental data was proposed.

  19. Mechanisms of Induced Resistance in Barley Against Drechslera teres.

    Science.gov (United States)

    Lyngs Jørgensen, H J; Lübeck, P S; Thordal-Christensen, H; de Neergaard, E; Smedegaard-Petersen, V

    1998-07-01

    ABSTRACT Quantitative and qualitative histopathological methods and molecular analyses were used to study the mechanisms by which preinoculation with either of the nonbarley pathogens, Bipolaris maydis and Septoria nodorum, inhibited growth of Drechslera teres. Collectively, our data suggest that induced resistance is the principal mechanism responsible for impeding the pathogen. The enhancement of resistance in the host was primarily manifested during penetration by D. teres, and after penetration, where growth of D. teres ceased soon after development of infection vesicles. Thus, 24 h after pretreatment with B. maydis or S. nodorum, the penetration frequency from D. teres appressoria was reduced from 42.7% in the controls to 9.5 and 14.8%, respectively. The reductions were associated with increased formation of fluorescent papillae in induced cells (early defense reaction). The postpenetrational inhibition of D. teres completely stopped fungal growth and was apparently linked to an enhancement of multicellular hypersensitive responses in inducer-treated leaves (late defense reaction). Papillae formation and multicellular hypersensitive reactions were also observed in fully susceptible, noninduced control leaves, but they were inadequate to stop fungal progress. Northern blots from leaves treated with either inducer alone support the conclusion that induced resistance is involved in suppression of D. teres by increased formation of papillae and hypersensitive reactions. Thus, the blots showed strong expression of several defense response genes that are involved in these reactions in barley attacked by Erysiphe graminis f. sp. hordei.

  20. Dynamic viscosity study of barley malt and chicory concentrates

    Directory of Open Access Journals (Sweden)

    G. O. Magomedov

    2016-01-01

    Full Text Available The purpose of research is to find optimal conditions for dispersing and subsequent dehydration of liquid food environments in the nozzle spray drying chamber through the study of dynamic changes in viscosity according to temperature, velocities gradients and dry residue content. The objects of study were roasted chicory and malt barley concentrates with dry residue content of 20, 40, 60 and 80%. Research of dynamic viscosity were carried out at the measuring complex based on the rotational viscometer Rheotest II, analog-to-digital converter, module Laurent and a personal computer with a unique software that allows to record in real time (not only on a tape recorder, but also in the form of graphic files the behavior of the viscosity characteristics of concentrates. Registration of changes of dynamic viscosity was carried out at a shear rate gradient from 1,0 с -1 to 27,0 с -1 and the products temperature thermostating : 35, 55, 75˚ C. The research results are presented in the form of graphic dependences of effective viscosity on shear rate and flow curves (dependencies of shear stresses on the velocity gradient, which defined flow regimes, the optimal modes of dispersion concentrates into spray dryer chambers in obtaining of powdered semi-finished products and instanting were found: dry residue content - 40 %, concentrate temperature - 75 ˚C, velocity gradient in the air channel of the nozzle at least 20 c-1

  1. Plastome Mutations and Recombination Events in Barley Chloroplast Mutator Seedlings.

    Science.gov (United States)

    Landau, Alejandra; Lencina, Franco; Pacheco, María G; Prina, Alberto R

    2016-05-01

    The barley chloroplast mutator (cpm) is an allele of a nuclear gene that when homozygous induces several types of cytoplasmically inherited chlorophyll deficiencies. In this work, a plastome Targeting Induced Local Lesions in Genomes (TILLING) strategy based on mismatch digestion was used on families that carried the cpm genotype through many generations. Extensive scanning of 33 plastome genes and a few intergenic regions was conducted. Numerous polymorphisms were detected on both genic and intergenic regions. The detected polymorphisms can be accounted for by at least 61 independent mutational events. The vast majority of the polymorphisms originated in substitutions and small indels (insertions/deletions) in microsatellites. The rpl23 and the rps16 genes were the most polymorphic. Interestingly, the variation observed in the rpl23 gene consisted of several combinations of 5 different one nucleotide polymorphisms. Besides, 4 large indels that have direct repeats at both ends were also observed, which appear to be originated from recombinational events. The cpm mutation spectrum suggests that the CPM gene product is probably involved in plastome mismatch repair. The numerous subtle molecular changes that were localized in a wide range of plastome sites show the cpm as a valuable source of plastome variability for plant research and/or plant breeding. Moreover, the cpm mutant appears to be an interesting experimental material for investigating the mechanisms responsible for maintaining the stability of plant organelle DNA.

  2. Proteome analysis of grain filling and seed maturation in barley.

    Science.gov (United States)

    Finnie, Christine; Melchior, Sabrina; Roepstorff, Peter; Svensson, Birte

    2002-07-01

    In monocotyledonous plants, the process of seed development involves the deposition of reserves in the starchy endosperm and development of the embryo and aleurone layer. The final stages of seed development are accompanied by an increase in desiccation tolerance and drying out of the mature seed. We have used two-dimensional gel electrophoresis for a time-resolved study of the changes in proteins that occur during seed development in barley (Hordeum vulgare). About 1,000 low-salt extractable protein spots could be resolved on the two-dimensional gels. Protein spots were divided into six categories according to the timing of appearance or disappearance during the 5-week period of comparison. Nineteen different proteins or protein fragments in 36 selected spots were identified by matrix-assisted laser-desorption ionization time of flight mass spectrometry (MS) or nano-electrospray tandem MS/MS. Some proteins were present throughout development (for example, cytosolic malate dehydrogenase), whereas others were associated with the early grain filling (ascorbate peroxidase) or desiccation (Cor14b) stages. Most noticeably, the development process is characterized by an accumulation of low-M(r) alpha-amylase/trypsin inhibitors, serine protease inhibitors, and enzymes involved in protection against oxidative stress. We present examples of proteins not previously experimentally observed, differential extractability of thiol-bound proteins, and possible allele-specific spot variation. Our results both confirm and expand on knowledge gained from previous analyses of individual proteins involved in grain filling and maturation.

  3. Alleviation of chromium toxicity by hydrogen sulfide in barley.

    Science.gov (United States)

    Ali, Shafaqat; Farooq, Muhammad Ahsan; Hussain, Sabir; Yasmeen, Tahira; Abbasi, G H; Zhang, Guoping

    2013-10-01

    A hydroponic experiment was carried out to examine the effect of hydrogen sulfide (H2 S) in alleviating chromium (Cr) stress in barley. A 2-factorial design with 6 replications was selected, including 3 levels of NaHS (0 μM, 100 μM, and 200 μM) and 2 levels of Cr (0 μM and 100 μM) as treatments. The results showed that NaHS addition enhances plant growth and photosynthesis slightly compared with the control. Moreover, NaHS alleviated the inhibition in plant growth and photosynthesis by Cr stress. Higher levels of NaHS exhibited more pronounced effects in reducing Cr concentrations in roots, shoots, and leaves. Ultrastructural examination of plant cells supported the facts by indication of visible alleviation of cell disorders in both root and leaf with exogenous application of NaHS. An increased number of plastoglobuli, disintegration, and disappearance of thylakoid membranes and starch granules were visualized inside the chloroplast of Cr-stressed plants. Starch accumulation in the chloroplasts was also noticed in the Cr-treated cells, with the effect being much less in Cr + NaHS-treated plants. Hence, it is concluded that H2 S produced from NaHS can improve plant tolerance under Cr stress.

  4. Management of diabetic dyslipidemia with subatmospheric dehydrated barley grass powder

    Directory of Open Access Journals (Sweden)

    Venugopal Shonima

    2010-01-01

    Full Text Available Diabetes is a chronic, potentially debilitating and often fatal disease. The prevalence of type 2 diabetes is increasing in all populations worldwide. The investigation was carried out to study the impact of barley grass powder (BGP supplementation on the carbohydrate and lipid metabolism of stable type 2 diabetes mellitus (T2DM subjects. A total of 59 stable type 2 diabetic subjects were enrolled in the study from pathology laboratories and divided into experimental (n=36 and control groups (n=23. BGP (1.2 g/day in the form of capsules (n=4 was given to the experimental group subjects for a period of 60 days. Fasting blood sugar (FBS, glycated haemoglobin (HbA1c and lipid profile levels were monitored at baseline and at 60 days. Paired t test was applied using Microsoft® Office Excel 2003. Supplementation with BGP resulted in a significant decrease in FBS, HbA1c, total cholesterol (TC, low-density lipoprotein cholesterol (LDL-C and non-high-density lipoprotein cholesterol (Non-HDL-C and a significant increase in high-density lipoprotein cholesterol (HDL-C levels. In conclusion, the results obtained suggest that BGP holds promise to be used as a functional food to optimise the health of diabetic subjects.

  5. Association mapping of grain hardness, polyphenol oxidase, total phenolics, amylose content, and ß-glucan in US barley breeding germplasm

    Science.gov (United States)

    A renewed interest in breeding barley specifically for food end-uses is being driven by increased consumer interest in healthier foods. We conducted association mapping on physicochemical properties of barley that play a role in food quality and processing including, grain hardness, polyphenol oxid...

  6. Nitrogen acquisition by pea and barley and the effect of their crop residues on available nitrogen for subsequent crops

    DEFF Research Database (Denmark)

    Jensen, E.S.

    1996-01-01

    . The uptake of soil-derived N by a test crop (N catch crop) of white mustard (Sinapis alba L.) grown in the autumn was higher after pea than after barley. The N uptake in the test crop was reduced by 27% and 34% after pea and barley residue incorporation, respectively, probably due to N immobilization...

  7. Accelerated rates of protein evolution in barley grain and pistil biased genes might be legacy of domestication.

    Science.gov (United States)

    Shi, Tao; Dimitrov, Ivan; Zhang, Yinling; Tax, Frans E; Yi, Jing; Gou, Xiaoping; Li, Jia

    2015-10-01

    Traits related to grain and reproductive organs in grass crops have been under continuous directional selection during domestication. Barley is one of the oldest domesticated crops in human history. Thus genes associated with the grain and reproductive organs in barley may show evidence of dramatic evolutionary change. To understand how artificial selection contributes to protein evolution of biased genes in different barley organs, we used Digital Gene Expression analysis of six barley organs (grain, pistil, anther, leaf, stem and root) to identify genes with biased expression in specific organs. Pairwise comparisons of orthologs between barley and Brachypodium distachyon, as well as between highland and lowland barley cultivars mutually indicated that grain and pistil biased genes show relatively higher protein evolutionary rates compared with the median of all orthologs and other organ biased genes. Lineage-specific protein evolutionary rates estimation showed similar patterns with elevated protein evolution in barley grain and pistil biased genes, yet protein sequences generally evolve much faster in the lowland barley cultivar. Further functional annotations revealed that some of these grain and pistil biased genes with rapid protein evolution are related to nutrient biosynthesis and cell cycle/division. Our analyses provide insights into how domestication differentially shaped the evolution of genes specific to different organs of a crop species, and implications for future functional studies of domestication genes.

  8. Influence of crop rotation and meteorological conditons on density and biomass of weeds in spring barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Maria Wanic

    2012-12-01

    Full Text Available The paper presents the analysis of changes in weed infestation in spring barley cultivated in the years 1990-2004 in crop rotation with a 25% proportion of this cereal (potato - spring barley - sowing peas - winter triticale, when it was grown after potato, and in crop rotation with its 75% proportion (potato - spring barley - spring barley - spring barley, when it was grown once or twice after spring barley. In the experiment, no weed control was applied. Every year in the spring (at full emergence of the cereal and before the harvest, the composition of weed species and weed density of particular weed species were determined, and before the harvest also their biomass. Weed density increased linearly on all plots during the 15-year period. The average values confirm the increase in weed biomass in the case when spring barley was grown once or twice after this crop; however, those differences were influenced by the previous situation only during some seasons. Weed density and biomass showed high year-to-year variability and a positive correlation with the amount of precipitation and a negative correlation with temperature during the period of the study. A negative correlation between the yield of barley and weed biomass was shown.

  9. Genome-wide association mapping of barley yellow dwarf virus tolerance in spring oat (Avena sativa L.)

    Science.gov (United States)

    Barley yellow dwarf (BYD) is one of the most destructive diseases of cereal crops worldwide. Barley yellow dwarf viruses (BYDVs) are responsible for BYD and affect many cereals including oat (Avena sativa L.). Until recently, the molecular marker technology in oat has not allowed for many marker-t...

  10. Accumulation of mixed linkage (1¿3) (1¿4)-ß-D-glucan during grain filling in barley

    DEFF Research Database (Denmark)

    Seefeldt, Helene Fast; Blennow, Per Gunnar Andreas; Jespersen, Birthe P Møller

    2009-01-01

    The accumulation of mixed linkage barley (1 → 3) (1 → 4)-β-d-glucan (BG) during grain filling at eight stages was studied using standard reference methods and infrared spectroscopy. Two mutant barley genotypes having higher (starch mutant lys5f) and lower (high lysine mutant lys3a) BG content tha...

  11. Sequencing of 15,622 gene-bearing BACs clarifies the gene-dense regions of the barley genome

    Science.gov (United States)

    Barley (Hordeum vulgare L.) possesses a large and highly repetitive genome of 5.1 Gb that has hindered the development of a complete sequence. In 2012, the International Barley Sequencing Consortium released a resource integrating whole-genome shotgun sequences with a physical and genetic framework....

  12. Isolate specificity and polygenic inheritance of resistance in barley to the heterologous rust pathogen Puccinia graminis f. sp. avenae

    NARCIS (Netherlands)

    Dracatos, P.M.; Nansamba, M.; Berlin, A.; Park, R.F.; Niks, R.E.

    2016-01-01

    Barley is a near-nonhost to numerous heterologous (nonadapted) rust pathogens because a small proportion of genotypes are somewhat susceptible. We assessed 66 barley accessions and three mapping populations (Vada x SusPtrit, Cebada Capa x SusPtrit, and SusPtrit x Golden Promise) for response to t

  13. Chloroindolyl-3-acetic Acid and its Methyl Ester Incorporation of 36Cl in Immature Seeds of Pea and Barley

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1974-01-01

    compounds besides Cl−. One compound, present in pea and probably in barley, cochromatographed with a mixture of 4- and 6-chloroindolyl-3-acetic acid methyl esters. Another, detected in pea, but probably not in barley, cochromatographed with a mixture of 4-and 6-chloroindolyl-3-acetic acids....

  14. The untranslated leader sequence of the barley lipoxygenase 1 (Lox1) gene confers embryo-specific expression

    NARCIS (Netherlands)

    Rouster, J.; Mechelen J. van; Cameron-Mills, V.

    1998-01-01

    The barley lipoxygenase 1 (Lox1) gene encodes a protein expressed in embryos during grain development and germination and in leaves after methyl-jasmonate (MeJA) treatment. Transient gene expression assays in germinating barley embryos were used to identify cis-regulatory elements involved in the em

  15. Knockdown of midgut genes by dsRNA-transgenic plant-mediated RNA interference in the hemipteran insect Nilaparvata lugens.

    Directory of Open Access Journals (Sweden)

    Wenjun Zha

    Full Text Available BACKGROUND: RNA interference (RNAi is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. METHODOLOGY/PRINCIPAL FINDINGS: The Hemipteran insect brown planthopper (Nilaparvata lugens Stål is a typical phloem sap feeder specific to rice (Oryza sativa L.. To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. CONCLUSIONS: Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants.

  16. Response of Barley Seedlings to Microwaves at 2.45 GHz

    Directory of Open Access Journals (Sweden)

    Iuliana Crețescu

    2013-05-01

    Full Text Available Abstract The objective of the present study was to investigate the changes induced upon germination and growth rate, expressed by vigor index of barley seeds exposed to microwave (MW treatment. As a microwave source was used a magnetron MWG20H, which emits radiation with a frequency of 2.45 GHz. In the experiment, barley seeds were exposed for 0s, 10s and 20s. The germination energy (GE and germination (G, cotyledon length (CL, leaves length (LL and roots length (RL in cm were determined on the 3th, 7th and 14th day after irradiation in order to estimate the influence of microwave treatment on them. The hypothesis was that seeds exposed to MW will behave differently than those unexposed. It was observed that the best results in terms of GE, G and vigor index (SVI were obtained in barley seeds for the treatment with output microwaves power of 400W for 20s.

  17. Comparison of different pretreatment strategies for enzymatic hydrolysis of wheat and barley straw

    DEFF Research Database (Denmark)

    Rosgaard, Lisa; Pedersen, Sven; Meyer, Anne Boye Strunge

    2007-01-01

    procedures: acid or water impregnation followed by steam explosion versus hot water extraction. The pretreatments were compared after enzyme treatment using a cellulase enzyme system, Celluclast 1.5 L (R) from Trichoderma reesei, and a beta-glucosidase, Novozyme 188 from Aspergillus niger. Barley straw...... generally produced higher glucose concentrations after enzymatic hydrolysis than wheat straw. Acid or water impregnation followed by steam explosion of barley straw was the best pretreatment in terms of resulting glucose concentration in the liquid hydrolysate after enzymatic hydrolysis. When the glucose...... straw. Maldi-TOF MS analyses of supernatants of pretreated barley and wheat straw samples subjected to acid and water impregnation, respectively, and steam explosion, revealed that the water impregnated + steam-exploded samples gave a wider range of pentose oligomers than the corresponding acid...

  18. Compared cycling in a soil-plant system of pea and barley residue nitrogen

    DEFF Research Database (Denmark)

    Jensen, E.S.

    1996-01-01

    and 35% of the pea residue N were unaccounted for. Since these apparent losses are comparable to almost twice the amounts of pea and barley residue N taken up by the perennial ryegrass crop, there seems to be a potential for improved crop residue management in order to conserve nutrients in the soil......Field experiments were carried out on a temperate soil to determine the decline rate, the stabilization in soil organic matter and the plant uptake of N from N-15-labelled crop residues. The fate of N from field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) residues was followed...... in the top 10 cm soil declined rapidly during the initial 86 DAI for all residue types. Leaching of soluble organic materials may have contributed to this decline. At 216 DAI 72, 59 and 45% of the barley, mature pea and green pea residue N, respectively, were present in organic N-forms in the topsoil. During...

  19. Cereal bioengineering: Amylopectin-free and hyper-phosphorylated barley starch

    DEFF Research Database (Denmark)

    Carciofi, Massimiliano; Shaik, Shahnoor Sultana; Jensen, Susanne Langgård;

    2011-01-01

    Barley lines producing grains with either amylopectin-free or hyper-phosphorylated starches were made by transgenic methods. Cereals producing these kind of starches have not been reported before. Amylopectin-free barley was generated by simultaneously silencing the three genes encoding the starch...... branching enzymes SBEIIa, SBEIIb and SBEI by a chimeric hairpin. The construct was inherited as a single locus with a distinct 1:3 segregation in consecutive generations. The transgenic grains were shrunken and the yield was around 80% of that found in wildtype. The starch granules were irregularly......, elongated and globose shaped. Transgenic grains also had a higher beta-glucan content. In order to increase barley starch phosphorylation, endosperm specific overexpression of glucan water dikinase from potato (StGWD) was conducted. The content of phosphate esters in starch from consecutive generations (T0...

  20. Secretomics identifies Fusarium graminearum proteins involved in the interaction with barley and wheat

    DEFF Research Database (Denmark)

    Yang, Fen; Jensen, Jens D.; Svensson, Birte;

    2012-01-01

    of cell walls, starch and proteins. Of these proteins, 35% had not been identified in previous in planta or in vitro studies, 70% were predicted to contain signal peptides and a further 16% may be secreted in a nonclassical manner. Proteins identified in the 72 spots showing differential appearance...... between wheat and barley flour medium were mainly involved in fungal cell wall remodelling and the degradation of plant cell walls, starch and proteins. The in planta expression of corresponding F. graminearum genes was confirmed by quantitative reverse transcriptase‐polymerase chain reaction in barley...... and wheat spikelets harvested at 2−6 days after inoculation. In addition, a clear difference in the accumulation of fungal biomass and the extent of fungal‐induced proteolysis of plant β‐amylase was observed in barley and wheat. The present study considerably expands the current database of F. graminearum...

  1. Zinc Blotting Assay for Detection of Zinc-Binding Prolamin in Barley (Hordeum vulgare) Grain

    DEFF Research Database (Denmark)

    Uddin, Mohammad Nasir; Langkilde, Ane; Vincze, Éva

    2014-01-01

    In plants, zinc is commonly found bound to proteins. In barley (Hordeum vulgare), major storage proteins are alcohol-soluble prolamins known as hordeins, and some of them have the potential to bind or store zinc. 65Zn overlay and blotting techniques have been widely used for detecting zinc......-binding protein. However, to our knowledge so far this zinc blotting assay has never been applied to detect a prolamin fraction in barley grains. A radioactive zinc (65ZnCl2) blotting technique was optimized to detect zinc-binding prolamins, followed by development of an easy-to-follow nonradioactive colorimetric...... zinc blotting method with a zinc-sensing dye, dithizone. Hordeins were extracted from mature barley grain, separated by SDS-PAGE, blotted on a membrane, renatured, overlaid, and probed with zinc; subsequently, zinc-binding specificity of certain proteins was detected either by autoradiography or color...

  2. Screening for disease resistance in barley cultivars against Bipolaris sorokiniana using callus culture method.

    Science.gov (United States)

    Chand, Ramesh; Sen, Devyani; Prasad, K D; Singh, A K; Bashyal, B M; Prasad, L C; Joshi, A K

    2008-04-01

    Screening for resistant barley genotypes in response to fungal toxin of Bipolaris sorokiniana was assessed on standing barley plants as well as in selected callus lines of the same. For the standing lines tested, those manifesting chlorosis in response to toxin infiltration showed a significantly slower disease progress as compared to the necrotic lines. Also, necrosis in the callus tissues of the susceptible cultivar in MS medium supplemented with different concentrations of the crude toxin was significantly higher than in the callus tissues of the chlorotic lines studied. Similar host response to the toxin in in vitro and field situations open up the possibility of screening barley cultivars for resistance to spot blotch using callus culture as against classical methods of screening in order to increase accuracy and save time and space.

  3. Important Quality Attributes of Malt Barley (Hordeum vulgare L. ): Effect of Genetics, Environments and Agronomic Factors

    Institute of Scientific and Technical Information of China (English)

    Virender Sardana; ZHANG Guo-ping

    2003-01-01

    Barley has been in use as food and fodder for thousands of years, and also used currently as themost important raw material in malting and brewing. The quality of malt barley is not much satisfied with therequirement by malting and brewing industry worldwide, although the great effort has been devoted to its im-provement through breeding and agronomy. The quality of malt barley is involved in many physical and chemi-cal traits, including hydrolytic enzymes. Of them, kernel protein content, beta-amylase activity, beta-glucancontent and kernel plumpness have dramatic influence on malting or brewing quality. The expression of thesequality parameters varies greatly in genotypes and is easily changed by diverse environments and agronomicpractices. This paper reviewed the important role of various parameters influencing the quality of malt barleyand the effect of different factors on them.

  4. Impact of Low Concentration of Cadmium on Photosynthesis and Growth of Pea and Barley

    Directory of Open Access Journals (Sweden)

    Irena Januškaitienė

    2010-10-01

    Full Text Available Photosynthetic gas exchange and growth characteristics were examined in pea and barley plants using 1 mM Cd treatment. Plants were sown into neutral peat substrate and at a leaf development stage were treated with 1 mM cadmium concentration solution. Gas exchange parameters (photosynthetic rate; intercellular CO2 concentration; transpiration rate; water use efficiency were measured with portable photosynthesis system LI-6400 on the fifth day after Cd treatment. Under Cd stress the photosynthetic rate of pea and barley plants decreased by 16.7 % (p 2 concentration decreased by 27.4 % (p 2 reduction processes of Cd treated pea leaves increased (because intercellular CO2 concentration decreased, but that had no positive effect on a photosynthetic rate, and the photosynthetic rate of pea decreased by 4 % more than that of barley. The changes of dry biomass of cadmium treated plants were weak and statistically insignificant.

  5. Maize, Sunflower and Barley Sensitivity to the Residual Activity of Clomazone in Soil

    Directory of Open Access Journals (Sweden)

    Jelena Gajić Umiljendić

    2012-01-01

    Full Text Available Sensitivity of maize, sunflower and barley to clomazone residues in loamy soil wasassessed in the study using bioassay. Clomazone was applied at a series of concentrationsfrom 0.12 to 12 mg a.i./kg of soil. After 14 days, morphological (shoot height, fresh and dryweight and physiological (content of carotenoids, chlorophyll a and chlorophyll b parameterswere measured. The results showed that morphological parameters are not valid indicatorsof clomazone sensitivity. Based on the results showing inhibition of the physiologicalparameters, I50 values were calculated and used to estimate the difference in sensitivitybetween the species tested. Sunflower was the most sensitive species, while the differencein sensitivity between maize and barley was not significant.Nomenclature: clomazone (2-(2-chlorbenzyl-4,4-dimethyl-1,2-oxazolidin-3-one, maize(Zea mays L., sunflower (Helianthus annuus L., barley (Hordeum vulgare L.

  6. Rhizodeposition of N by pea and barley and its effect on soil N dynamics

    DEFF Research Database (Denmark)

    Jensen, E.S.

    1996-01-01

    Rhizodeposition of N during plant growth influences the microbial activity in the rhizosphere and constitutes a source of labile organic N, but has not been quantified to the same degree as the rhizodeposition of C. The rhizodeposition of N, defined as root-derived N present in the soil after...... removal of visible roots and root fragments, was determined during field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) growth in a sandy soil at a low concentration of mineral N using a continuous split-root N-15-labelling technique. The N rhizodeposition constituted 15 and 48...... plant(-1) (20% of total plant N) for barley. Incubation of soils, after removal of roots, showed that the N rhizodeposits were labile; 79% of the pea and 48% of the barley root-derived N present in soil at 7 WAP were mineralizable. The root-derived N present in soil at maturity was less labile, since...

  7. Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison

    DEFF Research Database (Denmark)

    Li, Chengdao; Ni, Peixiang; Francki, Michael;

    2004-01-01

    Pre-harvest sprouting results in significant economic loss for the grain industry around the world. Lack of adequate seed dormancy is the major reason for pre-harvest sprouting in the field under wet weather conditions. Although this trait is governed by multiple genes it is also highly heritable....... A major QTL controlling both pre-harvest sprouting and seed dormancy has been identified on the long arm of barley chromosome 5H, and it explains over 70% of the phenotypic variation. Comparative genomics approaches among barley, wheat and rice were used to identify candidate gene(s) controlling seed...... dormancy and hence one aspect of pre-harvest sprouting. The barley seed dormancy/pre-harvest sprouting QTL was located in a region that showed good synteny with the terminal end of the long arm of rice chromosome 3. The rice DNA sequences were annotated and a gene encoding GA20-oxidase was identified...

  8. Allelopathic potential of Chrozophora tinctoria on early growth of Barley and Wheat

    Directory of Open Access Journals (Sweden)

    Ali Asghar Aliloo

    2015-02-01

    Full Text Available A laboratory bioassay was conducted to investigate the allelopathic effects of Chrozophora tinctoria on germination and seedling growth of barley and wheat. Aqueous leave extracts of C. tinctoria at 5, 10, 15 and 20 % concentrations were prepared and distilled water was used as a control. Results showed that germination percentage of two species decreased with increasing the extract concentrations; however, wheat germination was relatively resistant to allelochemicals than barley. In contrast to germination behavior, seedling traits showed different responses. The extracts improved seedling dry weights, particularly barley, whereas seedling lengths were inhibited. Roots of both species were more affected than shoots by extracts. The extracts reduced seed reserve mobilization significantly (p≤0.05. It was concluded that the used extract had inhibitory effects on seed germination of the crops; however, at seedling stages the effects were severely reduced.

  9. Metabolite Profiling for Leaf Senescence in Barley Reveals Decreases in Amino Acids and Glycolysis Intermediates

    Directory of Open Access Journals (Sweden)

    Liliana Avila-Ospina

    2017-02-01

    Full Text Available Leaf senescence is a long developmental phase important for plant performance and nutrient management. Cell constituents are recycled in old leaves to provide nutrients that are redistributed to the sink organs. Up to now, metabolomic changes during leaf senescence have been mainly studied in Arabidopsis (Arabidopsis thaliana L.. The metabolite profiling conducted in barley (Hordeum vulgare L. during primary leaf senescence under two nitrate regimes and in flag leaf shows that amino acids, hexose, sucrose and glycolysis intermediates decrease during senescence, while minor carbohydrates accumulate. Tricarboxylic acid (TCA compounds changed with senescence only in primary leaves. The senescence-related metabolite changes in the flag leaf were globally similar to those observed in primary leaves. The effect of senescence on the metabolite changes of barley leaves was similar to that previously described in Arabidopsis except for sugars and glycolysis compounds. This suggests a different role of sugars in the control of leaf senescence in Arabidopsis and in barley.

  10. Effect of Soil Erosion on Spring Barley Growth in East Anglia,England:Preliminary Results

    Institute of Scientific and Technical Information of China (English)

    LUXI-XI; Y.BIOT

    1994-01-01

    The effect of soil erosion on spring barley growth was studied on a deep loamy soil in East Anglia,England,in 1992,Soil erosion was simulated by three levels of soil desurfacing,7.5,18and 30cm with three replicates.Significant differences in crop height,ground cover and crop yield were observed between the three levels of desurfacing.Soil desurfacing also has a singnificant effect on soil moisture at the 20cm depth.The interaction between soil removal and crop performance affected soil moisture at the depths of 50 and 100cm,No significant differences were found in runoff and sediment etween the three topsoil removals due to very dry growing season.Regression equations were developed between spring barley yield and soil desurfacing Spring barley grain yield declined by 97.6kg/ha per cm soil desurfacing.

  11. Dissecting molecular interactions involved in recognition of target disulfides by the barley thioredoxin system

    DEFF Research Database (Denmark)

    Björnberg, Olof; Maeda, Kenji; Svensson, Birte

    2012-01-01

    Thioredoxin reduces disulfide bonds, thus regulating activities of target proteins in various biological systems, e.g., inactivation of inhibitors of starch hydrolases and proteases in germinating plant seeds. In the three-dimensional structure of a complex with barley α-amylase/subtilisin inhibi......Thioredoxin reduces disulfide bonds, thus regulating activities of target proteins in various biological systems, e.g., inactivation of inhibitors of starch hydrolases and proteases in germinating plant seeds. In the three-dimensional structure of a complex with barley α......-amylase/subtilisin inhibitor (BASI), two loops in barley thioredoxin h2 (HvTrxh2), containing an invariant cis-proline (86EAMP89) and a conserved glycine (104VGA106), surround the active site cysteines ( 45WCGPC49) and contribute to binding of BASI through backbone-backbone hydrogen bonds [Maeda, K., Hägglund, P., Finnie, C...

  12. Transcriptome sequencing in a Tibetan barley landrace with high resistance to powdery mildew.

    Science.gov (United States)

    Zeng, Xing-Quan; Luo, Xiao-Mei; Wang, Yu-Lin; Xu, Qi-Jun; Bai, Li-Jun; Yuan, Hong-Jun; Tashi, Nyima

    2014-01-01

    Hulless barley is an important cereal crop worldwide, especially in Tibet of China. However, this crop is usually susceptible to powdery mildew caused by Blumeria graminis f. sp. hordei. In this study, we aimed to understand the functions and pathways of genes involved in the disease resistance by transcriptome sequencing of a Tibetan barley landrace with high resistance to powdery mildew. A total of 831 significant differentially expressed genes were found in the infected seedlings, covering 19 functions. Either "cell," "cell part," and "extracellular region" in the cellular component category or "binding" and "catalytic" in the category of molecular function as well as "metabolic process" and "cellular process" in the biological process category together demonstrated that these functions may be involved in the resistance to powdery mildew of the hulless barley. In addition, 330 KEGG pathways were found using BLASTx with an E-value cut-off of powdery mildew infection.

  13. Density and relative frequency effects on competitive interactions and resource use in pea–barley intercrops

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, H.; Andersen, H.K.; Jørnsgaard, B.;

    2006-01-01

    Intercropping advantages may be influenced by both plant density and relative frequency of the intercrop components. In a field study barley (Hordeum vulgare L.) and pea (Pisum sativum L.) were sole cropped and intercropped at three densities and with two relative frequencies when intercropped....... Earlier seedling emergence gave barley an initial growth advantage, assessed using the relative efficiency index (REIc), whereas pea was in general more growth efficient once the initial growth phase had been passed. This reversal in relative growth efficiency along with the observation that early barley...... of the growing period and more so in the pea dominated intercrop. At the final harvest land equivalent ratios (LER) of 0.9-1.2 express resource complementarity in almost all studied intercrops, complementarity that was not directly affected by changes in plant density or relative frequency. Intercropped pea did...

  14. Engineering Structurally Interacting RNA (sxRNA)

    Science.gov (United States)

    Doyle, Francis; Lapsia, Sameer; Spadaro, Salvatore; Wurz, Zachary E.; Bhaduri-McIntosh, Sumita; Tenenbaum, Scott A.

    2017-01-01

    RNA-based three-way junctions (3WJs) are naturally occurring structures found in many functional RNA molecules including rRNA, tRNA, snRNA and ribozymes. 3WJs are typically characterized as resulting from an RNA molecule folding back on itself in cis but could also form in trans when one RNA, for instance a microRNA binds to a second structured RNA, such as a mRNA. Trans-3WJs can influence the final shape of one or both of the RNA molecules and can thus provide a means for modulating the availability of regulatory motifs including potential protein or microRNA binding sites. Regulatory 3WJs generated in trans represent a newly identified regulatory category that we call structurally interacting RNA or sxRNA for convenience. Here we show that they can be rationally designed using familiar cis-3WJ examples as a guide. We demonstrate that an sxRNA “bait” sequence can be designed to interact with a specific microRNA “trigger” sequence, creating a regulatable RNA-binding protein motif that retains its functional activity. Further, we show that when placed downstream of a coding sequence, sxRNA can be used to switch “ON” translation of that sequence in the presence of the trigger microRNA and the amount of translation corresponded with the amount of microRNA present. PMID:28350000

  15. Ethnobotany, diverse food uses, claimed health benefits and implications on conservation of barley landraces in North Eastern Ethiopia highlands

    Directory of Open Access Journals (Sweden)

    Sopade Peter A

    2011-06-01

    Full Text Available Abstract Background Barley is the number one food crop in the highland parts of North Eastern Ethiopia produced by subsistence farmers grown as landraces. Information on the ethnobotany, food utilization and maintenance of barley landraces is valuable to design and plan germplasm conservation strategies as well as to improve food utilization of barley. Methods A study, involving field visits and household interviews, was conducted in three administrative zones. Eleven districts from the three zones, five kebeles in each district and five households from each kebele were visited to gather information on the ethnobotany, the utilization of barley and how barley end-uses influence the maintenance of landrace diversity. Results According to farmers, barley is the "king of crops" and it is put for diverse uses with more than 20 types of barley dishes and beverages reportedly prepared in the study area. The products are prepared from either boiled/roasted whole grain, raw- and roasted-milled grain, or cracked grain as main, side, ceremonial, and recuperating dishes. The various barley traditional foods have perceived qualities and health benefits by the farmers. Fifteen diverse barley landraces were reported by farmers, and the ethnobotany of the landraces reflects key quantitative and qualitative traits. Some landraces that are preferred for their culinary qualities are being marginalized due to moisture shortage and soil degradation. Conclusions Farmers' preference of different landraces for various end-use qualities is one of the important factors that affect the decision process of landraces maintenance, which in turn affect genetic diversity. Further studies on improving maintenance of landraces, developing suitable varieties and improving the food utilization of barley including processing techniques could contribute to food security of the area.

  16. MRI-assessed therapeutic effects of locally administered PLGA nanoparticles loaded with anti-inflammatory siRNA in a murine arthritis model

    DEFF Research Database (Denmark)

    Te Boekhorst, Bernard C M; Jensen, Linda B; Colombo, Stefano;

    2012-01-01

    for disease remission. We evaluated the anti-inflammatory effects of poly(dl-lactide-co-glycolide acid) (PLGA) nanoparticles loaded with small interfering RNA (siRNA) directed against TNF-a in vitro and in vivo. The siRNA-loaded PLGA nanoparticles mediated a dose-dependent TNF-a silencing....... In addition, proper siRNA dosing seems to be important for a positive therapeutic outcome in vivo. However, further studies are needed to fully clarify the mechanism(s) underlying the observed anti-inflammatory effects of the siRNA-loaded nanoparticles....... with nanoparticles loaded with TNF-a siRNA (1µg) resulted in a reduction in disease activity, evident by a significant decrease of the paw scores and joint effusions, as compared to treatment with PLGA nanoparticles loaded with non-specific control siRNA, whereas the degree of bone marrow edema in the tibial...

  17. phiC31 integrase-mediated site-specific recombination in barley.

    Directory of Open Access Journals (Sweden)

    Eszter Kapusi

    Full Text Available The Streptomyces phage phiC31 integrase was tested for its feasibility in excising transgenes from the barley genome through site-specific recombination. We produced transgenic barley plants expressing an active phiC31 integrase and crossed them with transgenic barley plants carrying a target locus for recombination. The target sequence involves a reporter gene encoding green fluorescent protein (GFP, which is flanked by the attB and attP recognition sites for the phiC31 integrase. This sequence disruptively separates a gusA coding sequence from an upstream rice actin promoter. We succeeded in producing site-specific recombination events in the hybrid progeny of 11 independent barley plants carrying the above target sequence after crossing with plants carrying a phiC31 expression cassette. Some of the hybrids displayed fully executed recombination. Excision of the GFP gene fostered activation of the gusA gene, as visualized in tissue of hybrid plants by histochemical staining. The recombinant loci were detected in progeny of selfed F(1, even in individuals lacking the phiC31 transgene, which provides evidence of stability and generative transmission of the recombination events. In several plants that displayed incomplete recombination, extrachromosomal excision circles were identified. Besides the technical advance achieved in this study, the generated phiC31 integrase-expressing barley plants provide foundational stock material for use in future approaches to barley genetic improvement, such as the production of marker-free transgenic plants or switching transgene activity.

  18. Capacity of Fusarium species isolated from brewer's barley to synthesise zearalenone

    Directory of Open Access Journals (Sweden)

    Kocić-Tanackov Sunčica D.

    2005-01-01

    Full Text Available Fungi of the genus Fusarium, known as toxigenic species, are very of- ten parasites and contaminants of brewer's barley. In this paper, the composition of the genus Fusarium species in brewer's barley samples and their potential in the zearalenone synthesis were investigated. The tests were done on different brewer's barley varieties, crop 2003, samples (SSK1, SSK2, SSK3 SSK4, SSK5, SSK6, SSK7, SSK8, SSK9, SSK10 and SSK12 from Kragujevac locality. The isolation and identification of the Fusarium species were done according to the methods described by N e l s o n et al. (1983. The identified Fusarium species (6 were tested for their capacity to synthesise zearalenone. The isolates were cultivated on sterilised barley grains at the temperature of 25°C for 14 days, and then the zearalenone concentration was determined by the fluorometric method on the fluorometer "VI- CAM" series 4. The following seven Fusarium species were isolated from barley samples: F. acuminatum, F. avenaceum, F. culmorum, F. equiseti, F. poae, F. sporotrichioides and F. tricinctum. F. poae was the most distributed species (10.26%. The zearalenone concentration within the range of 12.0 to 430.0 g kg-1 was determined in cultures of barley grain inoculated with F. avenacuem (SSK6 and SSK12, F. culmorum (SSK8, F. tricinctum (SSK1, F. sporotrichioides (SSK7 and SSK12 and F. poae (SSK5, SSK9 and SSK10. Isolates of F. equiseti (SSK2 and F. poae (SSK6 did not express capacity to synthesise this toxic metabolite.

  19. Glycemic index of cracked corn, oat groats and rolled barley in horses.

    Science.gov (United States)

    Jose-Cunilleras, E; Taylor, L E; Hinchcliff, K W

    2004-09-01

    Muscle glycogen synthesis depends on glucose availability. This study was undertaken to determine the glycemic and insulinemic response of horses to equal amounts of hydrolyzable carbohydrates (starch and sugar) in the form of one of three grain meals or intragastric administration of a glucose solution. In a randomized crossover design, seven horses were fed each of three grain meals (cracked corn, steamed oat groats, or rolled barley) or were infused intragastrically with glucose solution at 2 g of hydrolyzable carbohydrate (starch plus sugar) per kilogram of BW. The quantity of hydrolyzable carbohydrate ingested was not different among all treatments (P = 0.70). Plasma glucose concentration peaked in all four treatments by 1.5 to 2 h after feeding. Plasma glucose concentration remained higher than baseline in oat groats or barley-fed horses throughout 8 h, whereas plasma glucose returned to baseline by 5 to 6 h in corn-fed horses or after glucose administration. Meal consumption was slower in oat groats-fed horses than in corn-fed ones, which may confound the glycemic and insulinemic responses observed after grain feeding. Plasma glucose area under the curve (AUC) was 63% both in corn and oat groats and 57% in barley-fed horses compared with that of horses administered glucose (P = 0.13). Serum immunoreactive insulin concentration peaked between 2 and 3 h after feeding or glucose administration, and barley-fed horses had lower serum immunoreactive insulin concentration by 3 to 4 h than corn-fed horses or after glucose administration (P oat groats, corn, and barley result in similar plasma glucose AUC and, compared with the glycemic index of 100 as the glucose reference, corn, oat groats, and barley had a glycemic index of approximately 60.

  20. Identification of a novel gene (Hsdr4) involved in water-stress tolerance in wild barley.

    Science.gov (United States)

    Suprunova, Tatiana; Krugman, Tamar; Distelfeld, Assaf; Fahima, Tzion; Nevo, Eviatar; Korol, Abraham

    2007-05-01

    Drought is one of the most severe stresses limiting plant growth and yield. Genes involved in water stress tolerance of wild barley (Hordeum spontaneoum), the progenitor of cultivated barley, were investigated using genotypes contrasting in their response to water stress. Gene expression profiles of water-stress tolerant vs. water-stress sensitive wild barley genotypes, under severe dehydration stress applied at the seedling stage, were compared using cDNA-AFLP analysis. Of the 1100 transcript-derived fragments (TDFs) amplified about 70 displayed differential expression between control and stress conditions. Eleven of them showed clear difference (up- or down-regulation) between tolerant and susceptible genotypes. These TDFs were isolated, sequenced and tested by RT-PCR. The differential expression of seven TDFs was confirmed by RT-PCR, and TDF-4 was selected as a promising candidate gene for water-stress tolerance. The corresponding gene, designated Hsdr4 (Hordeum spontaneum dehydration-responsive), was sequenced and the transcribed and flanking regions were determined. The deduced amino acid sequence has similarity to the rice Rho-GTPase-activating protein-like with a Sec14 p-like lipid-binding domain. Analysis of Hsdr4 promoter region that was isolated by screening a barley BAC library, revealed a new putative miniature inverted-repeat transposable element (MITE), and several potential stress-related binding sites for transcription factors (MYC, MYB, LTRE, and GT-1), suggesting a role of the Hsdr4 gene in plant tolerance to dehydration stress. Furthermore, the Hsdr4 gene was mapped using wild barley mapping population to the long arm of chromosome 3H between markers EBmac541 and EBmag705, within a region that previously was shown to affect osmotic adaptation in barley.

  1. Response of Barley Seedlings to Microwaves at 2.45 GHz

    OpenAIRE

    Iuliana Crețescu; Rodica Căpriță; Giancarla Velicevici; Sorina Ropciuc; Genoveva Buzamat

    2013-01-01

    Abstract The objective of the present study was to investigate the changes induced upon germination and growth rate, expressed by vigor index of barley seeds exposed to microwave (MW) treatment. As a microwave source was used a magnetron MWG20H, which emits radiation with a frequency of 2.45 GHz. In the experiment, barley seeds were exposed for 0s, 10s and 20s. The germination energy (GE) and germination (G), cotyledon length (CL), leaves length (LL) and roots length (RL) in cm were determine...

  2. NAC Transcription Factors of Barley (Hordeum vulgare L.) and their Involvement in Leaf Senescence

    DEFF Research Database (Denmark)

    Wagner, Michael

    yielding cereal crops are generated. In cereals, the process of leaf senescence is of utmost relevance when discussing yield. It is during the senescence process that all nutrients are transported from the withering leaf to the developing grains. Furthermore, the timing of senescence determines...... parts of the senescence process. The specific aims of this study were therefore (1) to establish and characterise the NAC transcription factors of the model cereal crop barley (Hordeum vulgare L.) (2) to identify and study putative barley NAC transcription factors involved in the regulation of leaf...

  3. Effect of crop density on competition by wheat and barley with Agrostemma githago and other weeds

    DEFF Research Database (Denmark)

    Doll, H.; Holm, U.; Søgaard, B.

    1995-01-01

    The effect of Agrostemma githago L. and other naturally occurring weeds on biomass production and grain yield was studied in winter wheat and winter barley. Naturally occurring weeds had only a negligible effect on barley, but reduced wheat grain yield by 10% at a quarter of normal crop density...... had a better competitive ability than A. githago. Wheat and A. githago utilized resources for growth better when grown in mixture than when grown in pure stands as the relative yield totals were significantly larger than unity....

  4. Structure and Composition of Protein Bodies from Wild-Type and High-Lysine Barley Endosperm

    DEFF Research Database (Denmark)

    Ingversen, J.

    1975-01-01

    Protein bodies were isolated from 13 and 28 day old endosperms of barley mutant 1508 and its wild type, Bomi barley. The fine structure of the isolated protein bodies was determined by electron microscopy, and the proteins present in the preparations characterized by amino-acid analysis and SDS...... with a granular component. Particles with the same structure were present in the protein body preparation from the mutant, where, however, the granular component was the most prominent. Amino-acid composition and SDS-polyacrylamide gel electrophoresis of the proteins from the protein body preparation revealed...

  5. cDNA, amino acid carbohydrate sequence of barley seed-specific peroxidase BP 1

    DEFF Research Database (Denmark)

    Johansson, A.; Rasmussen, Søren Kjærsgård; Harthill, J.E.

    1992-01-01

    The major peroxidase of barley seed BP 1 was characterized. Previous studies showed a low carbohydrate content, low specific activity and tissue-specific expression, and suggested that this basic peroxidase could be particularly useful in the elucidation of the structure-function relationship...... plant modified-type structure, Man-alpha-1-6(Xyl-beta-1-2)Man-beta-1-4GlcNAc-beta-1-4(Fuc-alpha-1-3)GlcNAc. The BP 1 gene was RFLP-mapped on barley chromosome 3, and we propose Prx5 as the name for this new peroxidase locus....

  6. Expression of a defence-related intercellular barley peroxidase in transgenic tobacco

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Brandt, J.; Bojsen, K.

    1997-01-01

    Tobacco plants (Nicotiana benthamiana L.) have been transformed with a T-DNA vector construct carrying the cDNA pBH6-301, encoding the major pathogen induced leaf peroxidase (Prx8) of barley, under control of an enhanced CaMV 35S promoter. Progeny from three independent transformants were analyzed...... genetically, phenotypically and biochemically. The T-DNA was steadily inherited through three generations. The barley peroxidase is expressed and sorted to the intercellular space in the transgenic tobacco plants. The peroxidase can be extracted from the intercellular space in two molecular forms from both...

  7. Pea-barley intercropping and short-term subsequent crop effects across European organic cropping conditions

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, Henrik; Gooding, M.; Ambus, Per

    2009-01-01

    Grain legumes are known to increase the soil mineral nitrogen (N) content, reduce the infection pressure of soil borne pathogens, and hence enhance subsequent cereals yields. Replicated field experiments were performed throughout W. Europe (Denmark, United Kingdom, France, Germany and Italy....... In the replacement design the total relative plant density is kept constant, while the additive design uses the optimal sole crop density for pea supplementing with ‘extra’ barley plants. The pea and barley crops were followed by winter wheat with and without N application. Additional experiments in Denmark...

  8. Improving the nutritional quality of the barley and wheat grain storage proteins by antisense technology

    DEFF Research Database (Denmark)

    Sikdar, Md. Shafiqul Islam; Lange, Mette; Aaslo, Per

    2011-01-01

    Prolamins are the predominant storage proteins in barley and wheat grains, accounting for 50 to 80% of total seed protein. However, the prolamins are not optimal feed for monogastric animals as they have a low content of certain essential amino acids such as lysine, threonine and tryptophan...... gliadins) are also available from Germany and UK. We have grown them under different N regimes (high, medium and low N) in semi-field conditions. Previously five different antisense C-hordein lines of barley have been characterized in our laboratory. The analyses revealed that the lysine, threonine...

  9. Dominant species of dicot-weeds and weed biodiversity in spring barley in Latvia.

    Science.gov (United States)

    Vanaga, I; Mintale, Z; Smirnova, O

    2010-01-01

    The composition of weed species in spring barley and weed biodiversity was evaluated in experiments in different growing seasons and with different previous crops. The aim of the experiments was to evaluate the composition of weed species in spring barley during a four year period in weather conditions of different growing seasons and with different previous crop as well as to assess the biodiversity in the experiments where the different groups of herbicides were applied. Over years and previous crops, the dicotyledonous weed community was dominated by Chenopodium album, followed by Viola arvensis. The herbicides from different groups had significant influences on the biodiversity of weeds.

  10. Oligosaccharide and Substrate Binding in the Starch Debranching Enzyme Barley Limit Dextrinase

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Windahl, Michael Skovbo; Sim, Lyann;

    2015-01-01

    Complete hydrolytic degradation of starch requires hydrolysis of both the α-1,4- and α-1,6-glucosidic bonds in amylopectin. Limit dextrinase (LD) is the only endogenous barley enzyme capable of hydrolyzing the α-1,6-glucosidic bond during seed germination, and impaired LD activity inevitably...... reduces the maltose and glucose yields from starch degradation. Crystal structures of barley LD and active-site mutants with natural substrates, products and substrate analogues were sought to better understand the facets of LD-substrate interactions that αconfine high activity of LD to branched...... starch synthesis....

  11. A major baker's asthma allergen from rye flour is considerably more active than its barley counterpart.

    Science.gov (United States)

    García-Casado, G; Armentia, A; Sánchez-Monge, R; Sánchez, L M; Lopez-Otín, C; Salcedo, G

    1995-05-01

    A rye flour protein of about 13.5 kDa, as well as its barley homologue, have been isolated. The rye component was recognized in vitro by IgE of allergic patients and provoked positive responses in 15 out of 21 baker's asthma patients (71%) when skin prick tests were performed. Its barley homologue showed no detectable in vitro reactivity and caused positive responses in only one-third of patients. Although no inhibitory activity against different alpha-amylases or trypsin was found for these two proteins, their N-terminal sequencing revealed considerable similarity to several members of the cereal alpha-amylase/trypsin inhibitor family.

  12. Development of DNA markers associated with beer foam stability for barley breeding.

    Science.gov (United States)

    Iimure, Takashi; Kihara, Makoto; Ichikawa, Seiichiro; Ito, Kazutoshi; Takeda, Kazuyoshi; Sato, Kazuhiro

    2011-01-01

    Traits conferring brewing quality are important objectives in malting barley breeding. Beer foam stability is one of the more difficult traits to evaluate due to the requirement for a relatively large amount of grain to be malted and then the experimental costs for subsequent brewing trials. Consequently, foam stability tends to be evaluated with only advanced lines in the final stages of the breeding process. To simplify the evaluation and selection for this trait, efficient DNA makers were developed in this study. Previous studies have suggested that the level of both of the foam-associated proteins Z4 and Z7 were possible factors that influenced beer foam stability. To confirm the relationship between levels of these proteins in beer and foam stability, 24 beer samples prepared from malt made from 10 barley cultivars, were examined. Regression analyses suggested that beer proteins Z4 and Z7 could be positive and negative markers for beer foam stability, respectively. To develop DNA markers associated with contents of proteins Z4 and Z7 in barley grain, nucleotide sequence polymorphisms in barley cultivars in the upstream region of the translation initiation codon, where the promoter region might be located were compared. As a result, 5 and 23 nucleotide sequence polymorphisms were detected in protein Z4 and protein Z7, respectively. By using these polymorphisms, cleaved amplified polymorphic sequence (CAPS) markers were developed. The CAPS markers for proteins Z4 and Z7 were applied to classify the barley grain content of 23 barley cultivars into two protein Z4 (pZ4-H and pZ4-L) and three protein Z7 (the pZ7-H, pZ7-L and pZ7-L2) haplotypes, respectively. Barley cultivars with pZ4-H showed significantly higher levels of protein Z4 in grain, and those with pZ7-L and pZ7-L2 showed significantly lower levels of protein Z7 in grain. Beer foam stability in the cultivars with pZ4-H and pZ7-L was significantly higher than that with pZ4-L and pZ7-H, respectively. Our

  13. Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Skau

    It is well accepted that dietary fibres, especially mixed linkage (1→3, 1→4)-β-Dglucans (β-glucan) from barley and oat, have beneficial effects on health and prevent modern lifestyle diseases. Even though recent research has shed some light on the mechanisms of action and structure...... showed that consumption of 3.3 g/day extracted barley and oat β-glucan for 3 weeks does not significantly lower total and LDL cholesterol levels in young and healthy adults. However, an indicated potential effect of oat suggests the importance of solubility for β-glucan interference with the cholesterol...

  14. Effect of Barley and Enzyme on Performance, Carcass, Enzyme Activity and Digestion Parameters of Broilers

    Directory of Open Access Journals (Sweden)

    majid kalantar

    2016-04-01

    Full Text Available Introduction Corn has been recently used for producing ethanol fuel in the major corn-producing countries such as the US and Brazil. Recent diversion of corn for biofuel production along with the increased world's demand for this feedstuff has resulted in unprecedented rise in feed cost for poultry worldwide. Alternative grains such as wheat and barley can be successfully replaced for corn in poultry diets. These cereal grains can locally grow in many parts of the world as they have remarkably lower water requirement than corn. Wheat and barley are generally used as major sources of energy in poultry diets. Though the major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls (Olukosi et al. 2007; Mirzaie et al. 2012. NSPs are generally considered as anti-nutritional factors (Jamroz et al. 2002. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value (Olukosi et al. 2007.Wheat and barley are generally used as major sources of energy in poultry diets. The major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls. NSPs are generally considered as anti-nutritional factors. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value. The major part of NSPs in barley comprises polymers of (1→3 (1→4-β- glucans which could impede growth factors and consequently carcass quality through lowering the rate and amount of available nutrients in the mucosal surface of the intestinal. Materials and Methods This experiment was conducted to evaluate the effect of corn and barley based diets supplemented with multi-enzyme on growth, carcass, pancreas enzyme activity and physiological characteristics of broilers. A total number of 375 one day old

  15. Interaction of barley powdery mildew effector candidate CSEP0055 with the defence protein PR17c

    DEFF Research Database (Denmark)

    Zhang, Wenjing; Pedersen, Carsten; Kwaaitaal, Mark Adrianus Cornelis J;

    2012-01-01

    A large number of effector candidates have been identified recently in powdery mildew fungi. However, their roles and how they perform their functions remain unresolved. In this study, we made use of host-induced gene silencing and confirmed that the secreted barley powdery mildew effector...... with PR17c was confirmed by bimolecular fluorescence complementation analyses. Down-regulation and over-expression of PR17c in epidermal cells of barley confirmed that this protein is important for penetration resistance against the powdery mildew fungus. In line with this, PR17c was found...

  16. Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

    DEFF Research Database (Denmark)

    Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

    2013-01-01

    , barley, and barley mutant β-glucans of similar molecular mass. Before and after each period, fasting and postprandial blood samples were drawn and 3-d fecal samples were collected. Treatment did not affect changes in total, LDL, and HDL cholesterol compared with control; however, consumption of 3.3 g......:cellotetraosyl). Decreases in fasting triacylglycerol were substantially greater after oat β-glucan treatment compared with control (P = 0.03). Fecal dry and wet weight, stool frequency, fecal pH, and energy excretion were unaffected. The results do not fully support the hypocholesterolemic effects by differently structured...

  17. Obtained transgenic wheat expressing pac1 mediated by Agrobacterium is resistant against Barley yellow dwarf virus-GPV

    Institute of Scientific and Technical Information of China (English)

    YAN Fei; ZHENG Yinying; ZHANG Wenwei; XIAO Hong; LI Shifang; CHENG Zhuomin

    2006-01-01

    In fission yeast (Schizosaccharomyces pombe), pac1 gene was cloned with 99.3% nucleotide sequence similarity with published pac1 in GenBank. In pET-5α expression system, the expression product of cloned pac1 in E. coli showed activity to degrade the double-strand RNA. Harboring the binary vector pBI121, which contains pac1 gene, Agrobacterium tumefaciens strain LBA4404 was used to transform the wheat immature embryos precultured 7―10 d. After preregeneration, regeneration and selection culture stage, totally 41 G418 resistant plants were obtained, in which 25 lines were proved to integrate with transgene and express transgene normally by PCR, Dot blot, RT-PCR and ELISA detection. Antivirus test carried out on 25 positive lines with high dose of Barley yellow dwarf virus-GPV revealed that 12 lines had resistance to BVDV-GPV in low level, another 12 lines had resistance to BVDV- GPV in middle level, and 1 line showed resistance to BVDV-GPV in high level. However, both low and middle level of resistance plants showed no symptoms when infected by viruses at low dose, which suggested the dose-dependent effect of the resistance mediated by pac1 to BYDV-GPV.

  18. Radioprotective effects of ascorbic acid in barley seeds

    Energy Technology Data Exchange (ETDEWEB)

    Conger, B.V.

    1975-01-01

    Experiments were conducted to test the radioprotective effects of a naturally occurring reducing agent, ascorbic acid, on seeds (caryopses) of barley, Hordeum vulgare L. emend Lam. Seeds were soaked either before or after ..gamma.. or fission neutron irradiation in distilled water or ascorbic acid solutions ranging in concentration from 0.01 to 1.00 M. Results are reported as percentage germination, seedling height, seedling growth reduction, and (in one experiment) percent of cells with chromosome aberrations. As evidenced by both reduced germination and seedling growth, ascorbic acid was toxic when seeds were soaked for 1 hr at ambient temperature prior to irradiation and then planted immediately. When seeds were soaked in ascorbic acid before irradiation and soaked after irradiation in air-bubbled water at 0/sup 0/C for 18 hr, the toxicity disappeared, and a protective effect (which increased with increasing ascorbic acid concentration) was observed for ..gamma.. and, to a lesser extent, for neutron irradiation. Additional studies suggested that the protective effect was related to reduced hydration of the embryos of seeds soaked in ascorbic acid. Also, no radioprotective effect was observed when seeds were presoaked for 2 or 16 hr in 0.01 M ascorbic acid solutions buffered at pH 3 or pH 7. A protective effect was observed for seeds of 1.5 percent water content soaked after irradiation in an oxygen-bubbled ascorbic acid solution of 0.5 M but was not observed for seeds soaked in nitrogen-bubbled ascorbic acid. The protective effect against oxygen-dependent damage may be a result of interaction of ascorbic acid with radiation-induced free radicals.

  19. Gibberellic Acid enhancement of DNA turnover in barley aleurone cells.

    Science.gov (United States)

    Taiz, L; Starks, J E

    1977-08-01

    When imbibed, deembryonated halfseeds from barley (Hordeum vulgare L., var. Himalaya) are incubated in buffer, the DNA content of the aleurone layer increases 25 to 40% over a 24-hour period. In contrast, the DNA of isolated aleurone layers declines by 20% over the same time period. Gibberellic acid (GA) causes a reduction in DNA levels in both halfseed aleurone layers and isolated aleurone layers. GA also increases the specific radioactivity of [(3)H]thymidine-labeled halfseed aleurone layer DNA during the first 12 hours of treatment. Pulse-chase studies demonstrated that the newly synthesized DNA is metabolically labile.The buoyant density on CsCl density gradients of hormone-treated aleurone DNA is identical with that of DNA extracted from whole seedlings. After density-labeling halfseed DNA with 5-bromodeoxyuridine, a bimodal absorption profile is obtained in neutral CsCl. The light band (1.70 g/ml) corresponds to unsubstituted DNA, while the heavy band (1.725-1.74 g/ml) corresponds to a hybrid density-labeled species. GA increases the relative amount of the heavy (hybrid) peak in halfseed aleurone layer DNA, further suggesting that the hormone enhances semiconservative replication in halfseeds.DNA methylation was also demonstrated. Over 60% of the radioactivity from [(3)H-Me]methionine is incorporated into 5-methylcytosine. GA has no effect on the percentage distribution of label among the bases.It was concluded that GA enhances the rate of DNA degradation and DNA synthesis (turnover) in halfseeds, but primarily DNA degradation in isolated aleurone layers. Incorporation by isolated aleurone layers is due to DNA repair. Semiconservative replication apparently plays no physiological role in the hormone response, since both isolated aleurone layers and gamma-irradiated halfseeds respond normally. The hypothesis was advanced that endoreduplication and DNA degradation are means by which the seed stores and mobilizes deoxyribonucleotides for the embryo during

  20. Evaluation of qualitative and quantitative immunoassays to detect barley contamination in gluten-free beer with confirmation using LC/MS/MS.

    Science.gov (United States)

    Allred, Laura K; Sealey Voyksner, Jennifer A; Voyksner, Robert D

    2014-01-01

    To meet the need for the detection and quantitation of barley gluten in beer, qualitative screening and quantitative immunoassays based on the monoclonal antigluten antibody 401/21 (Skerritt) were validated in a single laboratory. Sample replicates were tested at each stage of beer production using multiple yeast strains and methods of end-stage protein removal. Quantitation was performed using barley-specific standards based on barley flour extracts. Immunoassay results were confirmed using LC/MS/MS for barley-specific peptides. The LOD for the qualitative screening test was 5 mg/L barley gluten. Recovery for the barley-spiked worts ranged from 81 to 128% in the quantitative ELISA assay; the LOD was methods were found to be fit for the purposes of detection of low levels of barley gluten in beer.

  1. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid

    2015-01-01

    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  2. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Science.gov (United States)

    Zahid, Kiran; Zhao, Jian-Hua; Smith, Neil A; Schumann, Ulrike; Fang, Yuan-Yuan; Dennis, Elizabeth S; Zhang, Ren; Guo, Hui-Shan; Wang, Ming-Bo

    2015-01-01

    Satellite RNAs (satRNAs) are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS) transgene fused with a Cucumber mosaic virus (CMV) Y satellite RNA (Y-Sat) sequence (35S-GUS:Sat) was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM) to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  3. Colonic gene silencing using siRNA-loaded calcium phosphate/PLGA nanoparticles ameliorates intestinal inflammation in vivo.

    Science.gov (United States)

    Frede, Annika; Neuhaus, Bernhard; Klopfleisch, Robert; Walker, Catherine; Buer, Jan; Müller, Werner; Epple, Matthias; Westendorf, Astrid M

    2016-01-28

    Cytokines and chemokines are predominant players in the progression of inflammatory bowel diseases. While systemic neutralization of these players with antibodies works well in some patients, serious contraindications and side effects have been reported. Therefore, the local interference of cytokine signaling mediated by siRNA-loaded nanoparticles might be a promising new therapeutic approach. In this study, we produced multi-shell nanoparticles consisting of a calcium phosphate (CaP) core coated with siRNA directed against pro-inflammatory mediators, encapsulated into poly(d,l-lactide-co-glycolide acid) (PLGA), and coated with a final outer layer of polyethyleneimine (PEI), for the local therapeutic treatment of colonic inflammation. In cell culture, siRNA-loaded CaP/PLGA nanoparticles exhibited a rapid cellular uptake, almost no toxicity, and an excellent in vitro gene silencing efficiency. Importantly, intrarectal application of these nanoparticles loaded with siRNA directed against TNF-α, KC or IP-10 to mice suffering from dextran sulfate sodium (DSS)-induced colonic inflammation led to a significant decrease of the target genes in colonic biopsies and mesenteric lymph nodes which was accompanied with a distinct amelioration of intestinal inflammation. Thus, this study provides evidence that the specific and local modulation of the inflammatory response by CaP/PLGA nanoparticle-mediated siRNA delivery could be a promising approach for the treatment of intestinal inflammation.

  4. Cell layer-specific distribution of transiently expressed barley ESCRT-III component HvVPS60 in developing barley endosperm.

    Science.gov (United States)

    Hilscher, Julia; Kapusi, Eszter; Stoger, Eva; Ibl, Verena

    2016-01-01

    The significance of the endosomal sorting complexes required for transport (ESCRT)-III in cereal endosperm has been shown by the identification of the recessive mutant supernumerary aleurone layer1 (SAL1) in maize. ESCRT-III is indispensable in the final membrane fission step during biogenesis of multivesicular bodies (MVBs), responsible for protein sorting to vacuoles and to the cell surface. Here, we annotated barley ESCRT-III members in the (model) crop Hordeum vulgare and show that all identified members are expressed in developing barley endosperm. We used fluorescently tagged core ESCRT-III members HvSNF7a/CHMP4 and HvVPS24/CHMP3 and the associated ESCRT-III component HvVPS60a/CHMP5 for transient localization studies in barley endosperm. In vivo confocal microscopic analyses show that the localization of recombinantly expressed HvSNF7a, HvVPS24 and HvVPS60a differs within barley endosperm. Whereas HvSNF7a induces large agglomerations, HvVPS24 shows mainly cytosolic localization in aleurone and subaleurone. In contrast, HvVPS60a localizes strongly at the plasma membrane in aleurone. In subaleurone, HvVPS60a was found to a lesser extent at the plasma membrane and at vacuolar membranes. These results indicate that the steady-state association of ESCRT-III may be influenced by cell layer-specific protein deposition or trafficking and remodelling of the endomembrane system in endosperm. We show that sorting of an artificially mono-ubiquitinated Arabidopsis plasma membrane protein is inhibited by HvVPS60a in aleurone. The involvement of HvVPS60a in different cell layer-specific trafficking pathways, reflected by localization of HvVPS60a at the plasma membrane in aleurone and at the PSV membrane in subaleurone, is discussed.

  5. Deciphering Mineral Homeostasis in Barley Seed Transfer Cells at Transcriptional Level.

    Directory of Open Access Journals (Sweden)

    Behrooz Darbani

    Full Text Available In addition to the micronutrient inadequacy of staple crops for optimal human nutrition, a global downtrend in crop-quality has emerged from intensive breeding for yield. This trend will be aggravated by elevated levels of the greenhouse gas carbon dioxide. Therefore, crop biofortification is inevitable to ensure a sustainable supply of minerals to the large part of human population who is dietary dependent on staple crops. This requires a thorough understanding of plant-mineral interactions due to the complexity of mineral homeostasis. Employing RNA sequencing, we here communicate transfer cell specific effects of excess iron and zinc during grain filling in our model crop plant barley. Responding to alterations in mineral contents, we found a long range of different genes and transcripts. Among them, it is worth to highlight the auxin and ethylene signaling factors Arfs, Abcbs, Cand1, Hps4, Hac1, Ecr1, and Ctr1, diurnal fluctuation components Sdg2, Imb1, Lip1, and PhyC, retroelements, sulfur homeostasis components Amp1, Hmt3, Eil3, and Vip1, mineral trafficking components Med16, Cnnm4, Aha2, Clpc1, and Pcbps, and vacuole organization factors Ymr155W, RabG3F, Vps4, and Cbl3. Our analysis introduces new interactors and signifies a broad spectrum of regulatory levels from chromatin remodeling to intracellular protein sorting mechanisms active in the plant mineral homeostasis. The results highlight the importance of storage proteins in metal ion toxicity-resistance and chelation. Interestingly, the protein sorting and recycling factors Exoc7, Cdc1, Sec23A, and Rab11A contributed to the response as well as the polar distributors of metal-transporters ensuring the directional flow of minerals. Alternative isoform switching was found important for plant adaptation and occurred among transcripts coding for identical proteins as well as transcripts coding for protein isoforms. We also identified differences in the alternative-isoform preference between

  6. Structural genes of wheat and barley 5-methylcytosine DNA glycosylases and their potential applications for human health.

    Science.gov (United States)

    Wen, Shanshan; Wen, Nuan; Pang, Jinsong; Langen, Gregor; Brew-Appiah, Rhoda A T; Mejias, Jaime H; Osorio, Claudia; Yang, Mingming; Gemini, Richa; Moehs, Charles P; Zemetra, Robert S; Kogel, Karl-Heinz; Liu, Bao; Wang, Xingzhi; von Wettstein, Diter; Rustgi, Sachin

    2012-12-11

    Wheat supplies about 20% of the total food calories consumed worldwide and is a national staple in many countries. Besides being a key source of plant proteins, it is also a major cause of many diet-induced health issues, especially celiac disease. The only effective treatment for this disease is a total gluten-free diet. The present report describes an effort to develop a natural dietary therapy for this disorder by transcriptional suppression of wheat DEMETER (DME) homeologs using RNA interference. DME encodes a 5-methylcytosine DNA glycosylase responsible for transcriptional derepression of gliadins and low-molecular-weight glutenins (LMWgs) by active demethylation of their promoters in the wheat endosperm. Previous research has demonstrated these proteins to be the major source of immunogenic epitopes. In this research, barley and wheat DME genes were cloned and localized on the syntenous chromosomes. Nucleotide diversity among DME homeologs was studied and used for their virtual transcript profiling. Functional conservation of DME enzyme was confirmed by comparing the motif and domain structure within and across the plant kingdom. Presence and absence of CpG islands in prolamin gene sequences was studied as a hallmark of hypo- and hypermethylation, respectively. Finally the epigenetic influence of DME silencing on accumulation of LMWgs and gliadins was studied using 20 transformants expressing hairpin RNA in their endosperm. These transformants showed up to 85.6% suppression in DME transcript abundance and up to 76.4% reduction in the amount of immunogenic prolamins, demonstrating the possibility of developing wheat varieties compatible for the celiac patients.

  7. Community dynamics and metabolite target analysis of spontaneous, backslopped barley sourdough fermentations under laboratory and bakery conditions.

    Science.gov (United States)

    Harth, Henning; Van Kerrebroeck, Simon; De Vuyst, Luc

    2016-07-02

    Barley flour is not commonly used for baking because of its negative effects on bread dough rheology and loaf volume. However, barley sourdoughs are promising ingredients to produce improved barley-based breads. Spontaneous barley sourdough fermentations were performed through backslopping (every 24h, 10days) under laboratory (fermentors, controlled temperature of 30°C, high dough yield of 400) and bakery conditions (open vessels, ambient temperature of 17-22°C, low dough yield of 200), making use of the same batch of flour. They differed in pH evolution, microbial community dynamics, and lactic acid bacteria (LAB) species composition. After ten backsloppings, the barley sourdoughs were characterized by the presence of the LAB species Lactobacillus fermentum, Lactobacillus plantarum, and Lactobacillus brevis in the case of the laboratory productions (fast pH decrease, pHsourdough productions, Saccharomyces cerevisiae was the sole yeast species. Breads made with wheat flour supplemented with 20% (on flour basis) barley sourdough displayed a firmer texture, a smaller volume, and an acceptable flavour compared with all wheat-based reference breads. Hence, representative strains of the LAB species mentioned above, adapted to the environmental conditions they will be confronted with, may be selected as starter cultures for the production of stable barley sourdoughs and flavourful breads.

  8. The effect of interspecies interactions and water deficit on spring barley and red clover biomass accumulation at successive growth stages

    Directory of Open Access Journals (Sweden)

    Magdalena Jastrzębska

    2016-12-01

    Full Text Available A pot experiment was conducted in a greenhouse in Olsztyn, Poland, in the period 2010–2012. The aim of the study was to examine whether soil water deficit would change biomass volume and distribution of pure sown spring barley and red clover as well as growth rate during their joint vegetation and mutual interactions. The interactions between spring barley and red clover were of a competitive character, and the cereal was the stronger crop. The strength of this competition increased in time with the growing season. Through most of the growing season, the competition was poorer in water deficit conditions. The impact of clover on barley before the heading stage showed facilitation symptoms. Interspecific competition reduced the rate of barley biomass accumulation and decreased stem and leaf biomass towards the end of the growing season. Intensified translocation of assimilates from the vegetative parts to grain minimized the decrease in spike biomass. Water deficit stress had a more inhibitory effect on the biomass and growth rate of barley than competition, and competition did not exacerbate the adverse influence of water deficit stress on barley. Competition from barley significantly reduced the biomass and biomass accumulation rate of clover. Water deficit stress did not exacerbate barley’s competitive effect on clover, but it strongly inhibited the growth of aboveground biomass in pure-sown clover.

  9. Weed infestation in canopy of spring barley in condition of different tillage systems and fertilization and plant protection levels

    Directory of Open Access Journals (Sweden)

    Piotr Kraska

    2012-12-01

    Full Text Available The purpose of this work was to determine the influence of conventional tillage (fall ploughing at 25 cm and minimum tillage systems (chisel ploughing at 30 cm and two differentiated fertilization and plant protection levels on number, species composition and air dry weed mass in spring barley cv. Rataj. This spring barley was cultivated in crop rotation potato - spring barley - winter rye. The analysis of field infestation was made prior to spring barley harvest with quantitative- weighting method. There was estimated number of weeds, weed species composition and air dry weight of weeds in two randomly chosen areas of each plot of 0.5 m2. The density of weeds and weed air dry weight was statistically analysed by means of variance analysis, and the mean values were estimated with Tukey's confidence intervals (p=0.05. Intensive level of fertilization and chemical crop protection decreased number of monocotyledonous weeds and total weeds in canopy of spring barley. Conventional system of soil cultivation decreased in a canopy of spring barley the following species of weeds: Geranium pusillum, Galinsoga parviflora, Stellaria media, Apera spica-venti, Poa annua and Echinochloa crusgalli. Conventional tillage increases number of Chamomilla suaveolens and Fallopia convolvulus in a canopy of spring barley. Intensive fertilization and plant protection levels decreased weed infestation first of all through Echinochloa crusgalli, Apera spica-venti, Fallopia convolvulus, Galinsoga parviflora, Geranium pusillum, Chenopodium album and Setaria pumila.

  10. In situ identification and quantification of starch-hydrolyzing bacteria attached to barley and corn grain in the rumen of cows fed barley-based diets.

    Science.gov (United States)

    Xia, Yun; Kong, Yunhong; Seviour, Robert; Yang, Hee-Eun; Forster, Robert; Vasanthan, Thavaratnam; McAllister, Tim

    2015-08-01

    Cereal grains rich in starch are widely used to meet the energy demands of high-producing beef and dairy cattle. Bacteria are important players in starch digestion in the rumen, and thus play an important role in the hydrolysis and fermentation of cereal grains. However, our understanding of the composition of the rumen starch-hydrolyzing bacteria (SHB) is limited. In this study, BODIPY FL DQ starch staining combined with fluorescence in situ hybridization (FISH) and quantitative FISH were applied to label, identify and quantify SHB possessing active cell-surface-associated (CSA) α-amylase activity in the rumen of heifers fed barley-based diets. When individual cells of SHB with active CSA α-amylase activity were enumerated, they constituted 19-23% of the total bacterial cells attached to particles of four different cultivars of barley grain and corn. Quantitative FISH revealed that up to 70-80% of these SHB were members of Ruminococcaceae in the phylum Firmicutes but were not Streptococcus bovis, Ruminobacter amylophilus, Succinomonas amylolytica, Bifidobacterium spp. or Butyrivibrio fibrisolvens, all of whose amylolytic activities have been demonstrated previously in vitro. The proportion of barley grain in the diet had a large impact on the percentage abundance of total SHB and Ruminococcaceae SHB in these animals.

  11. Yield and yield structure of spring barley (Hodeum vulgare L. grown in monoculture after different stubble crops

    Directory of Open Access Journals (Sweden)

    Dorota Gawęda

    2012-12-01

    Full Text Available A field experiment was conducted in the period 2006- 2008 in the Uhrusk Experimental Farm belonging to the University of Life Sciences in Lublin. The experimental factor was the type of stubble crop ploughed in each year after harvest of spring barley: white mustard, lacy phacelia, winter rape, and a mixture of narrow-leaf lupin with field pea. In the experiment, successive spring barley crops were grown one after the other (in continuous monoculture. The aim of the experiment was to evaluate the effect of stubble crops used on the size and structure of barley yield. The three-year study showed an increasing trend in grain yield of spring barley grown after the mixture of legumes, lacy phacelia, and white mustard compared to its size in the treatment with no cover crop. Straw yield was significantly higher when barley was grown after the mixture of narrowleaf lupin with field pea than in the other treatments of the experiment. The type of ploughed-in stubble crop did not modify significantly plant height, ear length, and grain weight per ear. Growing the mixture of leguminous plants as a cover crop resulted in a significant increase in the density of ears per unit area in barley by an average of 14.7% relative to the treatment with winter rape. The experiment also showed the beneficial effect of the winter rape cover crop on 1000-grain weight of spring barley compared to that obtained in the treatments with white mustard and the mixture of legumes. All the cover crops caused an increase in the number of grains per ear of barley relative to that found in the control treatment. However, this increase was statistically proven only for the barley crops grown after lacy phacelia and the mixture of legumes.

  12. Sequencing of 15 622 gene-bearing BACs clarifies the gene-dense regions of the barley genome.

    Science.gov (United States)

    Muñoz-Amatriaín, María; Lonardi, Stefano; Luo, MingCheng; Madishetty, Kavitha; Svensson, Jan T; Moscou, Matthew J; Wanamaker, Steve; Jiang, Tao; Kleinhofs, Andris; Muehlbauer, Gary J; Wise, Roger P; Stein, Nils; Ma, Yaqin; Rodriguez, Edmundo; Kudrna, Dave; Bhat, Prasanna R; Chao, Shiaoman; Condamine, Pascal; Heinen, Shane; Resnik, Josh; Wing, Rod; Witt, Heather N; Alpert, Matthew; Beccuti, Marco; Bozdag, Serdar; Cordero, Francesca; Mirebrahim, Hamid; Ounit, Rachid; Wu, Yonghui; You, Frank; Zheng, Jie; Simková, Hana; Dolezel, Jaroslav; Grimwood, Jane; Schmutz, Jeremy; Duma, Denisa; Altschmied, Lothar; Blake, Tom; Bregitzer, Phil; Cooper, Laurel; Dilbirligi, Muharrem; Falk, Anders; Feiz, Leila; Graner, Andreas; Gustafson, Perry; Hayes, Patrick M; Lemaux, Peggy; Mammadov, Jafar; Close, Timothy J

    2015-10-01

    Barley (Hordeum vulgare L.) possesses a large and highly repetitive genome of 5.1 Gb that has hindered the development of a complete sequence. In 2012, the International Barley Sequencing Consortium released a resource integrating whole-genome shotgun sequences with a physical and genetic framework. However, because only 6278 bacterial artificial chromosome (BACs) in the physical map were sequenced, fine structure was limited. To gain access to the gene-containing portion of the barley genome at high resolution, we identified and sequenced 15 622 BACs representing the minimal tiling path of 72 052 physical-mapped gene-bearing BACs. This generated ~1.7 Gb of genomic sequence containing an estimated 2/3 of all Morex barley genes. Exploration of these sequenced BACs revealed that although distal ends of chromosomes contain most of the gene-enriched BACs and are characterized by high recombination rates, there are also gene-dense regions with suppressed recombination. We made use of published map-anchored sequence data from Aegilops tauschii to develop a synteny viewer between barley and the ancestor of the wheat D-genome. Except for some notable inversions, there is a high level of collinearity between the two species. The software HarvEST:Barley provides facile access to BAC sequences and their annotations, along with the barley-Ae. tauschii synteny viewer. These BAC sequences constitute a resource to improve the efficiency of marker development, map-based cloning, and comparative genomics in barley and related crops. Additional knowledge about regions of the barley genome that are gene-dense but low recombination is particularly relevant.

  13. Inhibition of hepatitis C virus protein expression by RNA interference.

    Science.gov (United States)

    Sen, Adrish; Steele, Robert; Ghosh, Asish K; Basu, Arnab; Ray, Ranjit; Ray, Ratna B

    2003-10-01

    Hepatitis C virus (HCV) is a serious human pathogen and an estimated 170 million people are infected worldwide. Current therapeutic regimens have shown limited efficacy against selected genotypes of the virus. The phenomenon of RNA interference can be used to selectively block homologous genes post-transcriptionally, and has revolutionized approaches to study gene function. In this report, we have demonstrated that small interfering RNAs (siRNAs) targeted against NS5A of HCV genotype 1a specifically inhibit NS5A RNA and protein expression in a human hepatoma (HepG2) cell line. Expression of endogenous alpha-actin and the ds-RNA activated serine/threonine kinase-PKR were unaltered, demonstrating that the inhibitory effect observed from siRNA was specific to the HCV NS5A protein. We next examined whether siRNA directed against NS5A could inhibit core protein expression, the first gene product synthesized in virus infected cells due to its localization at the 5' end of the HCV polyprotein. For this purpose, a full-length cDNA clone from HCV (H77, genotype 1a) was used, and results indicated that the introduction of NS5A targeted siRNA resulted in an inhibition of NS5A and core protein expression. Moreover, we observed that this siRNA effectively inhibited NS5A mediated activation of the IL-8 promoter. Taken together, our results demonstrated that siRNA was effective in inhibiting HCV protein expression, and may have therapeutic potential to limit HCV replication in chronically infected patients.

  14. Conserved generation of short products at piRNA loci

    Directory of Open Access Journals (Sweden)

    Khorshid Mohsen

    2011-01-01

    Full Text Available Abstract Background The piRNA pathway operates in animal germ lines to ensure genome integrity through retrotransposon silencing. The Piwi protein-associated small RNAs (piRNAs guide Piwi proteins to retrotransposon transcripts, which are degraded and thereby post-transcriptionally silenced through a ping-pong amplification process. Cleavage of the retrotransposon transcript defines at the same time the 5' end of a secondary piRNA that will in turn guide a Piwi protein to a primary piRNA precursor, thereby amplifying primary piRNAs. Although several studies provided evidence that this mechanism is conserved among metazoa, how the process is initiated and what enzymatic activities are responsible for generating the primary and secondary piRNAs are not entirely clear. Results Here we analyzed small RNAs from three mammalian species, seeking to gain further insight into the mechanisms responsible for the piRNA amplification loop. We found that in all these species piRNA-directed targeting is accompanied by the generation of short sequences that have a very precisely defined length, 19 nucleotides, and a specific spatial relationship with the guide piRNAs. Conclusions This suggests that the processing of the 5' product of piRNA-guided cleavage occurs while the piRNA target is engaged by the Piwi protein. Although they are not stabilized through methylation of their 3' ends, the 19-mers are abundant not only in testes lysates but also in immunoprecipitates of Miwi and Mili proteins. They will enable more accurate identification of piRNA loci in deep sequencing data sets.

  15. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.

    1994-01-01

    is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  16. Latent manganese deficiency increases transpiration in barley (Hordeum vulgare)

    DEFF Research Database (Denmark)

    Hebbern, Christopher Alan; Laursen, Kristian Holst; Ladegaard, Anne Hald;

    2009-01-01

    To investigate if latent manganese (Mn) deficiency leads to increased transpiration, barley plants were grown for 10 weeks in hydroponics with daily additions of Mn in the low nM range. The Mn-starved plants did not exhibit visual leaf symptoms of Mn deficiency, but Chl a fluorescence measurements...

  17. In vitro gas production profiles and fermentation end-products in processed barley, maize and milo

    NARCIS (Netherlands)

    Azarfar, A.; Namgay, K.; Pellikaan, W.F.; Tamminga, S.; Poel, van der A.F.B.

    2009-01-01

    BACKGROUND: An experiment was carried out to establish whether using a pre-compacting device (expander) changes the contribution of dry matter (DM) and degradative behaviour of grains of barley, maize and milo pre-processed by grinding over the different DM fractions (non-washable (NWF), insoluble w

  18. Chromosomal loci associated with endosperm hardness in a malting barley cross.

    Science.gov (United States)

    Walker, Cassandra K; Panozzo, J F; Ford, R; Eckermann, P; Moody, D; Lehmensiek, A; Appels, R

    2011-01-01

    A breeding objective for the malting barley industry is to produce lines with softer, plumper grain containing moderate protein content (9-12%) as they are more likely to imbibe water readily and contain more starch per grain, which in turn produces higher levels of malt extract. In a malting barley mapping population, 'Arapiles' × 'Franklin', the most significant and robust quantitative trait locus (QTL) for endosperm hardness was observed on the short arm of chromosome 1H, across three environments over two growing seasons. This accounted for 22.6% (Horsham 2000), 26.8% (Esperance 2001), and 12.0% (Tarranyurk 2001) of the genetic variance and significantly increased endosperm hardness by 2.06-3.03 SKCS hardness units. Interestingly, Arapiles and Franklin do not vary in Ha locus alleles. Therefore, this region, near the centromere on chromosome 1H, may be of great importance when aiming to manipulate endosperm hardness and malting quality. Interestingly, this region, close to the centromere on chromosome 1H, in our study, aligns with the region of the genome that includes the HvCslF9 and the HvGlb1 genes. Potentially, one or both of these genes could be considered to be candidate genes that influence endosperm hardness in the barley grain. Additional QTLs for endosperm hardness were detected on chromosomes 2H, 3H, 6H and 7H, confirming that the hardness trait in barley is complex and multigenic, similar to many malting quality traits of interest.

  19. Root border cell development is a temperature-insensitive and Al-sensitive process in barley.

    Science.gov (United States)

    Pan, Jian-Wei; Ye, Dan; Wang, Li-Ling; Hua, Jing; Zhao, Gu-Feng; Pan, Wei-Huai; Han, Ning; Zhu, Mu-Yuan

    2004-06-01

    In vivo and in vitro experiments showed that border cell (BC) survival was dependent on root tip mucigel in barley (Hordeum vulgare L. cv. Hang 981). In aeroponic culture, BC development was an induced process in barley, whereas in hydroponic culture, it was a kinetic equilibrium process during which 300-400 BCs were released into water daily. The response of root elongation to temperatures (10-35 degrees C) was very sensitive but temperature changes had no great effect on barley BC development. At 35 degrees C, the root elongation ceased whereas BC production still continued, indicating that the two processes might be regulated independently under high temperature (35 degrees C) stress. Fifty microM Al could inhibit significantly BC development by inhibiting pectin methylesterase activity in the root cap of cv. 2000-2 (Al-sensitive) and cv. Humai 16 (Al-tolerant), but 20 microM Al could not block BC development in cv. Humai 16. BCs and their mucigel of barley had a limited role in the protection of Al-induced inhibition of root elongation, but played a significant role in the prevention of Al from diffusing into the meristems of the root tip and the root cap. Together, these results suggested that BC development was a temperature-insensitive but Al-sensitive process, and that BCs and their mucigel played an important role in the protection of root tip and root cap meristems from Al toxicity.

  20. The effect of long-term storage on quality of malting barley grain and malt

    Directory of Open Access Journals (Sweden)

    Tomáš KRAJČOVIČ

    2016-12-01

    Full Text Available In the grain samples of five malting barley varieties harvested in 2011, the amount of basic components as well as physiological characteristics of barley were determined. These samples were micromalted and resulting malt was analyzed mainly according to the European Brewery Convention (EBC and the Mitteleuropäische Brautechnische Analysenkommission (MEBAK methodologies. The same samples of malting barley grain and also samples of malt were placed in polyethylene bags, from which the air was exhausted and they were further stored at 4 °C until 2016. In 2016, grain and malt samples were subjected to the same analyses as in 2011. Results were statistically evaluated by t-test of dependent samples. Most of the monitored parameters has remained at the same level as in 2011 or has slightly improved. The exception was statistically very highly significant decrease (P ≤ 0.001 of friability and increase of amount of whole and partly unmodified grains. Under conditions described, long-term storage of malting barley grain has not significantly negatively affected its germination. Long-term storage of malt has had not a significant negative impact on its quality too.

  1. Frequency of Aneuploids in Progenies of Autotriploid Barley, Hordeum Vulgare L

    DEFF Research Database (Denmark)

    Sandfær, J.

    1979-01-01

    Chromosome counts of 863 progeny plants originating from 68 autotriploid barley plants revealed a considerable variation in chromosome numbers ranging from the diploid number (2n= 14) to 2n= 39. The most frequent groups were plants with 15 and 16 chromosomes each constituting about 27% of all pro...

  2. Hordein Variation in Wild (Hordeum Spontaneum) and Cultivated (H. Vulgare) Barley

    DEFF Research Database (Denmark)

    Doll, Hans; Brown, A. H. D.

    1979-01-01

    The storage protein hordein contains two major groups of polypeptides which are highly polymorphic in barley, and in its evolutionary progenitor Hordeum spontaneum Koch. Crosses between the two species showed that the complex electrophoretic phenotypes within the two groups of polypeptides are go...

  3. Characterization of barley [beta]-amylase for application in maltose production

    Energy Technology Data Exchange (ETDEWEB)

    Thacker, S.P.; Ramamurthy, V.; Kothari, R.M.

    1992-09-01

    A simple procedure is devised to extract [beta]-amylase preparation in a form suitable for commercial applications from germinated barley. [alpha]-Amylase activity in the [beta]-amylse preparation was neglibible to warrant its further purification. This preparation showed enzymatic activity over a braod pH and temperature range, suitable for conversion of starch to high purity maltose. (orig.).

  4. Multivariate analysis of stripe rust assessment and reactions of barley in multi-location nurseries

    Science.gov (United States)

    A total of 1357 entries, mainly consisting of hulled two-row, hulled six-row and hulless barley, were evaluated in stripe rust nurseries at Toluca, Mexico during 2007, Quito, Ecuador during 2007 and 2008, and Pullman and Mt. Vernon, USA [Pacific Northwest (PNW)] during 2007_2009. Disease screening d...

  5. Phytoremediation of Petroleum-Contaminated Soils around Isfahan Oil Refinery (Iran by Sorghum and Barley

    Directory of Open Access Journals (Sweden)

    Farida Irajy Asiabadi

    2014-04-01

    Full Text Available Petroleum compounds are one of the most frequently encountered pollutants in soils adjacent to oil refineries. Phytoremediation,where feasible, has become a cost-effective alternative to physicochemical methods of soil remediation. In this study, sorghum (Sorghum bicolor and barley (Hordeum vulgare were selected for phytoremediationand the diminution in the concentration of oil-based contaminants was measured during a 90-day period. Contaminated and control treatments were compared in terms of root and shoot dry weight. Comparisons revealed reductions of about 22% and 30% in root dry matter and 51% and 42% in shoot dry matter of sorghum and barley in contaminated soil, respectively. The control and planted soils were significantly different in total and oil-degrading bacterial counts. Moreover, the concentration of total petroleum hydrocarbons decreased by 52%-64% in 90 days. Since planting the contaminated soil with sorghum and barley resulted in an improvement of 30% compared to unplanted contaminated soil, the two plants were highly efficient in removing petroleum from oil-contaminated soils. Therefore, despite the necessity of further studies to enhance the efficacy of phytoremediation by assessing the appropriateness of various plant species, some genotypes like sorghum and barley were found suitable choices for phytoremediation of the investigated petroleum-contaminated soil.

  6. Primer Dependent and Independent Forms of Soluble Starch Synthetase from Developing Barley Endosperms

    DEFF Research Database (Denmark)

    Kreis, M.

    1980-01-01

    The activity of soluble starch synthetase (ADP-glucose: agr-1,4-glucan agr-4-glucosyltransferase) in the non-purified extract from 16 day-old Bomi barley endosperms (Hordeum vulgare L.) was low and the reaction was non-linear when plotted against protein concentration. Starch synthetase was purif...

  7. Degradability Characteristics of Treated and Untreated Barley Grain Using In situ Technique

    Directory of Open Access Journals (Sweden)

    Akbar Taghizadeh

    2008-01-01

    Full Text Available This study was carried out to determine of degradability characteristics of untreated barely grain (UBG and treated barley grain with autoclaving at 120°C, 5´ (TBG1 and 20' (TBG2, treated barley grain at 100°C, 5´ (TBG3 and 20' (TBG4, using in situ technique in Ghizel sheep’s. The sheep fed diet content 40% alfalfa: 60% concentrate containing 2.9 Mcal kg-1 DM and 14% CP. The incubation times were 0, 4, 8, 16, 24, 36 and 48 h and rumen degradation of cp and DM was measured. The equation of p = a+b (1-e-ct was used for fitting of dry matter and crude protein disappearance data. The dry matter disappearance of TBG1 and TBG2 at 24 and 48 h were lower than the other treatments (p<0.05. The crude protein disappearance of 24 and 48 h of UBG was more than the other treatment (p<0.05. Treating of barley grain of 120°C (5' and 20' can be decreased ruminal crude protein degradability of barley grain resulting high escaped crude protein into lower digestive tract.

  8. Biochemistry, Structure and Function of Non-Wheat Proteins: Case Study of Barley ß-Amylase

    Science.gov (United States)

    The importance of a protein is not always evident and may be due to its multifunctional nature. ß-Amylase in seeds of barley (Hordeum vulgare L.) constitutes approximately 2% of the total protein in mature seeds and is assumed to be important when storage proteins are mobilized to support protein s...

  9. CLIMATE CHANGE IN CENTRAL MEXICO: IMPACT ON BARLEY PRODUCTION (Hordeum vulgare IN TLAXCALA

    Directory of Open Access Journals (Sweden)

    Joel O. Calderón-García

    2015-07-01

    Full Text Available Historical production of barley for ten years (2003-2012 as well as under climate change scenarios for near future (2015-2039 and for near future (2075-2099 in Calpulalpan, Tlaxcala was evaluated. An assessment of suitable regions for production was performed as well as historical performance and barley considering future climate change scenarios through the model AquaCrop (FAO also was estimated. Finally, the average production costs in the region were estimated through surveys with barley producers. The results show that over 70% of the area of the municipality has some degree of aptitude for producing barley. Climate change scenarios indicate increases proficiency in 2% of the surface and reductions of up to 16%. The production model shows very close results with those obtained by farmers in the municipality yields (2.53 t/ha, thus estimated future changes show a decline in yields of about 5% up to 100% depending on the future horizon. Considering current production costs, the benefit-cost relationship could be reduced from 1.4 and to 0.0 in the future. This will certainly affect the economy of the producers in the region.

  10. Composition and Functional Lipid Profiles of Low-Phyate Barleys and Related Cultivars

    Science.gov (United States)

    Barley, one of the earliest cultivated cereal grains in the world, is gaining renewed interest for use in food, feed and as a bioethanol feedstock. Like other grains, its high phytate content is undesirable since phytate affects mineral bioavailability and contributes to P pollution to environment....

  11. Comparative Studies on Callose Formation in Powdery Mildew Compatible and Incompatible Barley

    DEFF Research Database (Denmark)

    Skou, Jens-Peder; Jørgensen, Jørgen Helms; Lilholt, Ulla

    1984-01-01

    . This is the 1st case where the effect of callose refers to the action of a specific gene. Six susceptible Japanese varieties formed large appositions but they were initiated as late as in other susceptible varieties, and their color was paler than in other barleys. Nine Hordeum spp. [H. capense, H. chilense, H...

  12. Barley (Hordeum vulgare L.) inositol monophosphatase: gene structure and enzyme characteristics

    Science.gov (United States)

    The de novo synthesis of myo-inositol (Ins) is catalyzed by two enzymatic activities; Ins(3)P1 synthase (MIPS; EC. 5.5.1.4) and Ins monophosphatase (IMPase; EC 3.1.3.25). The barley IMP-1 gene and gene products were studied to facilitate research into the regulation of Ins synthesis and supply. In m...

  13. Fine mapping of the barley chromosome 6H net form net blotch susceptibility locus

    Science.gov (United States)

    Net form net blotch (NFNB) caused by the necrotrophic fungal pathogen Pyrenophora teres f. teres (Ptt) is a destructive foliar disease of barley with the potential to cause significant yield loss in major production regions throughout the world. Characterization of diverse genetic resistances to thi...

  14. Protein mobilization and malting-specific proteinase expression during barley germination

    Science.gov (United States)

    Robust barley was germinated under three different conditions: 1) a production run in a commercial malting facility, 2) a micromalting protocol developed to generate malt with malting quality metrics similar to that from the commercial malting, and 3) a simple laboratory setting using a humidified ...

  15. Saccharification and fermentation of whole barley ground in the Szego mill

    Energy Technology Data Exchange (ETDEWEB)

    Wayman, M.; Parekh, S.R.; Parekh, R.S.; Trass, O.; Gandolfi, E.

    1988-11-01

    Barley, after steeping in water, was ground with ease and efficiency in the Szego mill, and its starch was liquefied, saccharified and fermented to very high yields of ethanol. The Szego mill consists of vertical rollers with helical grooves which rotate within a fixed cylinder, resulting in very fine grinding and a somewhat flaky product. The steeped barley was ground to a fine paste. This was readily liquefied and saccharified by amylolytic enzymes (dual enzyme process), and the resulting sugars were fermented in 24 h by ordinary bakers' yeast Saccharomyces cerevisiae, resulting in over 450 l ethanol/t of barley. Still shorter time, 12 h, and the same high yield were achieved when liquefied barley starch was simultaneously saccharified by glucoamylase and fermented. Fermentation to ethanol by a glucoamylase-producing yeast S. diastaticus strain 164A (from Labatt Brewing Company) enabled the amount of this enzyme required for saccharification to be reduced to about one-half the normal quantity, but at some cost in slower fermentation and slightly lower ethanol yield.

  16. Quality Control System for Beer Developed with Monoclonal Antibodies Specific to Barley Lipid Transfer Protein

    Directory of Open Access Journals (Sweden)

    Yukie Murakami-Yamaguchi

    2012-10-01

    Full Text Available Non-specific lipid transfer protein (LTP in barley grain reacted with the IgE in sera drawn from food allergy patients. A sandwich-type of enzyme-linked immunosorbent assay (ELISA was developed with mouse monoclonal antibodies raised against LTP purified with barley flour. This ELISA showed a practical working range of 0.3–3 ng/mL and no cross-reactivity with wheat, adlay and rye. Using this ELISA, LTP was determined in several types of barley-foods, including fermented foods such as malt vinegar, barley-malt miso and beer. LTP content in beer of the same kind was approximately constant, even if manufacturing factory and production days were different. Not only as a factor of foam formation and stability but also as an allergen, controlling and monitoring of LTP in beer should be considered. Taken together, our LTP-detecting ELISA can be proposed as an appropriate system for the quality control of beer.

  17. Determinants of barley grain yield in drought-prone Mediterranean environments

    NARCIS (Netherlands)

    Francia, E.; Tondelli, A.; Rizza, F.; Badeck, F.W.; Thomas, W.T.B.; Eeuwijk, van F.; Romagosa, I.; Stanca, A.M.; Pecchioni, N.

    2013-01-01

    The determinants of barley grain yield in drought-prone Mediterranean environments have been studied in the Nure x Tremois (NT) population. A large set of yield and other morpho-physiological data were recorded in 118 doubled-haploid lines of the population, in multi-environment field trials (18 sit

  18. Application of fluorescence-based semi-automated AFLP analysis in barley and wheat

    DEFF Research Database (Denmark)

    Schwarz, G.; Herz, M.; Huang, X.Q.

    2000-01-01

    Genetic mapping and the selection of closely linked molecular markers for important agronomic traits require efficient, large-scale genotyping methods. A semi-automated multifluorophore technique was applied for genotyping AFLP marker loci in barley and wheat. In comparison to conventional P-33...

  19. [The radiation-increased synthesis of phytochelatins in roots of gamma-irradiated barley seedlings].

    Science.gov (United States)

    Danilin, I A; Dikarev, V G; Geras'kin, S A

    2004-01-01

    It was shown that gamma-irradiation and cadmium nitrate increased synthesis of phytochelatins in roots of barley seedlings. The stimulation of synthesis of phytochelatins in gamma-irradiated plants was shown for the first time. The results obtained indicate more important role of phytochelatins in intercellular metabolism than heavy-metal-binding.

  20. Phytochelatin-metal(loid) transport into vacuoles shows different substrate preferences in barley and Arabidopsis.

    Science.gov (United States)

    Song, Won-Yong; Mendoza-Cózatl, David G; Lee, Youngsook; Schroeder, Julian I; Ahn, Sang-Nag; Lee, Hyun-Sook; Wicker, Thomas; Martinoia, Enrico

    2014-05-01

    Cadmium (Cd) and arsenic (As) are toxic to all living organisms, including plants and humans. In plants, Cd and As are detoxified by phytochelatins (PCs) and metal(loid)-chelating peptides and by sequestering PC-metal(loid) complexes in vacuoles. Consistent differences have been observed between As and Cd detoxification. Whereas chelation of Cd by PCs is largely sufficient to detoxify Cd, As-PC complexes must be sequestered into vacuoles to be fully detoxified. It is not clear whether this difference in detoxification pathways is ubiquitous among plants or varies across species. Here, we have conducted a PC transport study using vacuoles isolated from Arabidopsis and barley. Arabidopsis vacuoles accumulated low levels of PC2 -Cd, and vesicles from yeast cells expressing either AtABCC1 or AtABCC2 exhibited negligible PC2 -Cd transport activity compared with PC2 -As. In contrast, barley vacuoles readily accumulated comparable levels of PC2 -Cd and PC2 -As. PC transport in barley vacuoles was inhibited by vanadate, but not by ammonium, suggesting the involvement of ABC-type transporters. Interestingly, barley vacuoles exhibited enhanced PC2 transport activity when essential metal ions, such as Zn(II), Cu(II) and Mn(II), were added to the transport assay, suggesting that PCs might contribute to the homeostasis of essential metals and detoxification of non-essential toxic metal(loid)s.

  1. Complex Interspecific Hybridization in Barley (Hordeum vulgare L.) and the Possible Occurrence of Apomixis

    DEFF Research Database (Denmark)

    Bothmer, R. von; Bengtsson, M.; Flink, J.

    1988-01-01

    mixoploid with respect to alien chromosomes (19-22). In one combination, chromosome no. 7 was duplicated. Meiosis in triple hybrids showed low, but variable pairing (1.3-5.5 chiasmata per cell). The syndesis probably did not include the barley chromosomes. Direct backcrosses to di- and tetraploid...

  2. cDNA array analysis of stress-induced gene expression in barley androgenesis

    NARCIS (Netherlands)

    Maraschin, S.D.F.; Caspers, M.; Potokina, E.; Wülfert, F.; Graner, A.; Spaink, H.P.; Wang, M.

    2006-01-01

    Different aspects of androgenesis induction have been studied in detail, but little is known about the molecular mechanisms associated with this developmental switch. We have employed macroarrays containing 1421 expressed sequence tags covering the early stages of barley zygotic embryogenesis to com

  3. Inactivation of barley limit dextrinase inhibitor by thioredoxin-catalysed disulfide reduction

    DEFF Research Database (Denmark)

    Jensen, Johanne Mørch; Hägglund, Per; Christensen, Hans Erik Mølager;

    2012-01-01

    Barley limit dextrinase (LD) that catalyses hydrolysis of α-1,6 glucosidic linkages in starch-derived dextrins is inhibited by limit dextrinase inhibitor (LDI) found in mature seeds. LDI belongs to the chloroform/methanol soluble protein family (CM-protein family) and has four disulfide bridges a...

  4. Quantitative trait locus analysis of nitrogen use efficiency in barley (Hordeum vulgare L.)

    NARCIS (Netherlands)

    Kindu, G.A.; Tang, J.; Yin, X.; Struik, P.C.

    2014-01-01

    Quantitative trait locus (QTL) analysis of nitrogen use efficiency (NUE) of barley (Hordeum vulgare L.) was conducted on data generated from two pot experiments carried out in 2005 (using four nitrogen rates) and 2008 (with three rates) with AFLP markers and 94 recombinant inbred lines (RILs) of the

  5. The effect of fungicide dose on the composition of laboratory populations of barley powdery mildew

    DEFF Research Database (Denmark)

    O'Hara, R.B.; Nielsen, B.J.; Østergård, Hanne

    2000-01-01

    The effect of the use of different doses of the fungicide fenpropimorph on populations of barley powdery mildew Blumeria (Erysiphe) graminis f. sp. hordei was investigated in a laboratory selection experiment. A sample from the Danish aerial population of powdery mildew was split into populations...... to explain why this resistance has evolved at a slower rate than resistance towards other fungicides....

  6. Risk assessment by sowing date for barley (Hordeum vulgare) in northern Ethiopia

    NARCIS (Netherlands)

    Berhe, A.A.; Stroosnijder, L.; Habtu, S.; Keesstra, S.D.; Berhe, M.; Hadgu Meles, K.

    2012-01-01

    Risks of dry and wet sowing methods of rainfed barley were evaluated in northern Ethiopia. The evaluation was based on yield simulation using a validated AquaCrop model. Risks of failure (false start) were assessed by taking biomass threshold levels (

  7. An integrated resource for barley linkage map and malting quality QTL alignment

    Science.gov (United States)

    Barley (Hordeum vulgare subsp. vulgare) is an economically important model plant for genetics research that is currently served by a comprehensive set of tools for genetic analysis. High density genetic linkage maps constructed from the inheritance of robust gene-based Single Nucleotide Polymorphism...

  8. SNP Analysis and Haplotype Identification in Chymotrypsin Inhibitor-2 (CI-2) Gene of Barley

    Institute of Scientific and Technical Information of China (English)

    ZENG Xiang-hui; WEI Yu-ming; JIANG Qian-tao; QI Peng-fei; ZHENG You-liang

    2009-01-01

    Barley chymotrypsin inhibitor-2 (CI-2) was considered to be a promising candidate for enhancing the nutritional value of other cereals by increasing its concentration as it is rich in lysine than any other storage protein. Also, it was proposed that CI-2 might play an important role in the inhibition of proteolytic enzymes from pests or pathogens as CI-2 can strongly inhibit chymotrypsin and subtilisin. In this study, a total of 93 CI-2 gene sequences were isolated from wild and cultivated barley. 48 SNPs and 4 indels were detected across the entire sequences. The frequency of SNPs in the non-coding region (1 out of 9 bases) was slightly higher than that in the coding region (1 out of 10.7 bases). In all, 33.3% of the candidate cSNPs resulted in amino acid changes. As a total, the 24 cSNPs resulted in 15 amino acid changes. Ten distinguishable haplotypes were detected, among which 3 haplotypes were shared in the most barley accessions, whereas the rest of the haplotypes appeared at a lower frequency. In addition, three haplotypes (haplotype 4, 8, and 9) were unique for single accessions. These results suggested that low diversity at the CI-2 locus was detected among the cultivated and wild barley.

  9. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique;

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene...

  10. Effect of Initial Soluble Salt Composition of Saline Soil on Salinity Tolerance of Barley Plant

    Institute of Scientific and Technical Information of China (English)

    SHENQI-RONG; LIUZHAO-PU; 等

    1991-01-01

    A pot experiment was carried out on a marine saline soil to study the effect of initial soluble Na/Ca ratio of saline soil on the salinity tolerance of barley plant.The results showed that (1) the Na/Ca ratio affected significantly the dry weight of the plant at an earlier stage of growth,the critical values of initial Na/Ca ratio at which the plant could grow normally on soils containing salts of 2.5,3.5 and 4.5g kg-1 were 30,20 and 15,respectively;(2)smaller Na/Ca ratio resulted in a considerable decrease in Na accumulation but a great increase in K accumulation in the barley plant;and (3) the plasmallema of barley leaf were badly injured when the Na/Ca ratio was more than 30 and the increase of Na content of plant caused an exudation of K from the leaf cells.Some critical indexes were suggested for the cultivation of barley plant on marine saline soils and could be used as reference in the biological reclamation of marine saline soils.

  11. Programmed cell death: The life ambition of the barley aleurone layer

    DEFF Research Database (Denmark)

    Mark, Christina; Zor, Kinga; Heiskanen, Arto

    We have developed a 24-well multiplate tissue culture system with electrochemical and optical detection techniques for cultivation of immobilised barley aleurone layers. We have applied the system for the purpose of studying the underlying mechanisms of programmed cell death (PCD) in plants. We h...

  12. High diversity of genes for nonhost resistance of barley to heterologous rust fungi

    NARCIS (Netherlands)

    Jafary, H.; Albertazzi, G.; Marcel, T.C.; Niks, R.E.

    2008-01-01

    Inheritance studies on the nonhost resistance of plants would normally require interspecific crosses that suffer from sterility and abnormal segregation. Therefore, we developed the barley¿Puccinia rust model system to study, using forward genetics, the specificity, number, and diversity of genes in

  13. Lumbricus terrestris L. activity increases the availability of metals and their accumulation in maize and barley

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, E. [Department of Chemical Engineering, School of Civil Engineering, University of Castilla-La Mancha, Avenida Camilo Jose Cela, s/n, 13071 Ciudad Real (Spain); Alonso-Azcarate, J. [Department of Physical Chemistry, Faculty of Environmental Sciences, University of Castilla-La Mancha, Avenida Carlos III, s/n, 45071 Toledo (Spain); Rodriguez, L., E-mail: Luis.Rromero@uclm.es [Department of Chemical Engineering, School of Civil Engineering, University of Castilla-La Mancha, Avenida Camilo Jose Cela, s/n, 13071 Ciudad Real (Spain)

    2011-03-15

    The effect of the earthworm Lumbricus terrestris L. on metal availability in two mining soils was assessed by means of chemical extraction methods and a pot experiment using crop plants. Results from single and sequential extractions showed that L. terrestris had a slight effect on metal fractionation in the studied soils: only metals bound to the soil organic matter were significantly increased in some cases. However, we found that L. terrestris significantly increased root, shoot and total Pb and Zn concentrations in maize and barley for the soil with the highest concentrations of total and available metals. Specifically, shoot Pb concentration was increased by a factor of 7.5 and 3.9 for maize and barley, respectively, while shoot Zn concentration was increased by a factor of 3.7 and 1.7 for maize and barley, respectively. Our results demonstrated that earthworm activity increases the bioavailability of metals in soils. - Research highlights: > Lumbricus terrestris L. activity increases the bioavailability of metals in soils. > Earthworm activity can significantly increase total, shoot and root metal concentrations for crop plants. > Both bioassays and chemical extraction methods are necessary for assessing the bioavailability of metals in contaminated soils. - Lumbricus terrestris L. activity increases the bioavailability of metals in soils and total, shoot and root metal concentrations for maize and barley.

  14. Biochemical and Molecular Characterization of a Barley Seed ß-Glucosidase

    DEFF Research Database (Denmark)

    Leah, R.; Kigel, J.; Svendsen, I.

    1995-01-01

    A 60-kDa ß-glucosidase (BGQ60) was purified and characterized from seeds of barley (Hordeum vulgare L.). BGQ60 catalytic activity was restricted to the cleavage of short-chain oligosaccharides composed of(1, 2) -,(1, 2, 3) -, and/or(1, 2, 3, 4) -ß-linked glucose or mannose units. These oligosacch......A 60-kDa ß-glucosidase (BGQ60) was purified and characterized from seeds of barley (Hordeum vulgare L.). BGQ60 catalytic activity was restricted to the cleavage of short-chain oligosaccharides composed of(1, 2) -,(1, 2, 3) -, and/or(1, 2, 3, 4) -ß-linked glucose or mannose units....... These oligosaccharides are the primary products of endosperm cell wall polysaccharide hydrolysis by other enzymes. In keeping with this, complete hydrolysis of the major polysaccharide of barley starchy endosperm cell wall, (1-3,1-4)-ß-glucan, to free glucose was shown to require the concerted action of endo-(1-3,1-4)-ß...... interrupted by 9 introns. The complete nucleotide sequence of the bgq60 structural gene represents the first characterized plant gene encoding a ß-glucosidase. The barley BGQ60 is a novel plant ß-glucosidase with a hitherto undescribed specific enzymatic activity. The possible biological functions of BGQ60...

  15. Impact of removing straw from wheat and barley fields: A literature review

    Science.gov (United States)

    The sustainability of straw removal from wheat and barley fields from the standpoint of its effects on soil properties and nutrient cycling is a concern. A recent literature review reveals that there is no negative effect of small grain straw removal on soil organic carbon (SOC) content with irriga...

  16. Effects of Microbial Additives on Chemical Composition and Fermentation Characteristics of Barley Silage

    Science.gov (United States)

    Amanullah, S. M.; Kim, D. H.; Lee, H. J.; Joo, Y. H.; Kim, S. B.; Kim, S. C.

    2014-01-01

    This study examined the effects of bacterial inoculants on chemical composition and fermentation indices of barley silage. Barley forage (Youngyang) was harvested at 24% dry matter (DM) and wilted to 47.9% DM. The wilted barley forage was chopped to 3–5 cm length and applied with no inoculant (CON), L. plantarum (1×1010 cfu/g, LP) or Effective Microorganisms (0.5×109 cfu/g, EM). Then the forages were ensiled in four replications for each treatment in 20 L mini silos and stored for 100 days. The contents of crude protein and ether extract were higher in CON silage ensiled for 100-d, while the contents of DM and crude ash were higher in EM silage (p0.05). The pH, ammonia-N concentration and lactate to acetate ratio were higher (p<0.05) in CON silage, while lactate concentrations were higher (p<0.05) in CON and LP silage. Acetate concentration and lactic acid bacteria was increased (p<0.05) by both inoculants (LP and EM), but propionate concentration and yeast was increased (p<0.05) by EM and LP, respectively. These results indicated that the fermentation quality of barley silage was improved by the application of bacterial inoculants. PMID:25049981

  17. Penicillium verrucosum in wheat and barley indicates presence of ochratoxin A

    DEFF Research Database (Denmark)

    Lund, Flemming; Frisvad, Jens Christian

    2003-01-01

    Aims: The aims of this study were to isolate and identify ochratoxin A (OTA) producing fungi in cereals containing OTA and to determine the best selective and indicative medium for recovery of OTA producing fungi.Methods and Results: Seventy-six wheat, barley and rye samples from Europe containing...

  18. Selectivity of the surface binding site (SBS) on barley starch synthase I

    DEFF Research Database (Denmark)

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica

    2014-01-01

    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  19. Nitrogen deficiency in barley (Hordeum vulgare) seedlings induces molecular and metabolic adjustments that trigger aphid resistance.

    Science.gov (United States)

    Comadira, Gloria; Rasool, Brwa; Karpinska, Barbara; Morris, Jenny; Verrall, Susan R; Hedley, Peter E; Foyer, Christine H; Hancock, Robert D

    2015-06-01

    Agricultural nitrous oxide (N2O) pollution resulting from the use of synthetic fertilizers represents a significant contribution to anthropogenic greenhouse gas emissions, providing a rationale for reduced use of nitrogen (N) fertilizers. Nitrogen limitation results in extensive systems rebalancing that remodels metabolism and defence processes. To analyse the regulation underpinning these responses, barley (Horedeum vulgare) seedlings were grown for 7 d under N-deficient conditions until net photosynthesis was 50% lower than in N-replete controls. Although shoot growth was decreased there was no evidence for the induction of oxidative stress despite lower total concentrations of N-containing antioxidants. Nitrogen-deficient barley leaves were rich in amino acids, sugars and tricarboxylic acid cycle intermediates. In contrast to N-replete leaves one-day-old nymphs of the green peach aphid (Myzus persicae) failed to reach adulthood when transferred to N-deficient barley leaves. Transcripts encoding cell, sugar and nutrient signalling, protein degradation and secondary metabolism were over-represented in N-deficient leaves while those associated with hormone metabolism were similar under both nutrient regimes with the exception of mRNAs encoding proteins involved in auxin metabolism and responses. Significant similarities were observed between the N-limited barley leaf transcriptome and that of aphid-infested Arabidopsis leaves. These findings not only highlight significant similarities between biotic and abiotic stress signalling cascades but also identify potential targets for increasing aphid resistance with implications for the development of sustainable agriculture.

  20. Secretory expression of functional barley limit dextrinase by Pichia pastoris using high cell-density fermentation

    DEFF Research Database (Denmark)

    Vester-Christensen, Malene Bech; Abou Hachem, Maher; Næsted, Henrik

    2010-01-01

    Heterologous production of large multidomain proteins from higher plants is often cumbersome. Barley limit dextrinase (LD), a 98 kDa multidomain starch and alpha-limit dextrin debranching enzyme, plays a major role in starch mobilization during seed germination and is possibly involved in starch...

  1. Genetic mapping of the barley lodging resistance locus Erectoides-k

    DEFF Research Database (Denmark)

    Kristensen, Peter Skov; Dockter, Christoph; Lundqvist, Udda;

    2016-01-01

    The barley (Hordeum vulgare L.) mutant erectoides-k.32 (ert-k.32) was isolated in 1947 from an X-ray-mutant population of cultivar ‘Bonus’. The mutant was released as a cultivar in 1958 with the name ‘Pallas’ – one of the first cereal crop cultivars developed from induced mutants. ‘Pallas’ is a s...

  2. Barley aleurone cell death is not apoptotic: characterization of nuclease activities and DNA degradation.

    Science.gov (United States)

    Fath, A; Bethke, P C; Jones, R L

    1999-11-01

    Barley aleurone cells undergo programmed cell death (PCD) when exposed to gibberellic acid (GA), but incubation in abscisic acid (ABA) prevent PCD. We tested the hypothesis that PCD in aleurone cells occurs by apoptosis, and show that the hallmark of apoptosis, namely DNA cleavage into 180 bp fragments, plasma membrane blebbing, and the formation of apoptotic bodies do not occur when aleurone cells die. We show that endogenous barley aleurone nucleases and nucleases present in enzymes used for protoplast preparation degrade aleurone DNA and that DNA degradation by these nucleases is rapid and can result in the formation of 180 bp DNA ladders. Methods are described that prevent DNA degradation during isolation from aleurone layers or protoplasts. Barley aleurone cells contain three nucleases whose activities are regulated by GA and ABA. CA induction and ABA repression of nuclease activities correlate with PCD in aleurone cells. Cells incubated in ABA remain alive and do not degrade their DNA, but living aleurone cells treated with GA accumulate nucleases and hydrolyze their nuclear DNA. We propose that barley nucleases play a role in DNA cleavage during aleurone PCD.

  3. Loss-of-function of DELLA protein SLN1 activates GA signaling in barley aleurone

    Science.gov (United States)

    Gibberellic acid (GA) is a key phytohormone regulating seed germination and seedling growth. In cereal species, GA is synthesized in embyros and then translocated to aleurone tissues where it induces production of hydrolytic enzymes for mobolization of seed storage reserve. De-embyronated barley a...

  4. Multielemental Fingerprinting as a Tool for Authentication of Organic Wheat, Barley, Faba Bean, and Potato

    DEFF Research Database (Denmark)

    Laursen, Kristian Holst; Schjørring, Jan Kofod; Olesen, Jørgen E;

    2011-01-01

    The multielemental composition of organic and conventional winter wheat, spring barley, faba bean, and potato was analyzed with inductively coupled plasma−optical emission spectrometry (ICP-OES) and −mass spectrometry (ICP-MS). The crops were cultivated in two years at three geographically...

  5. Genetic differentiation and geographical Relationship of Asian barley landraces using SSRs

    Directory of Open Access Journals (Sweden)

    Rehan Naeem

    2011-01-01

    Full Text Available Genetic diversity in 403 morphologically distinct landraces of barley (Hordeum vulgare L. subsp. vulgare originating from seven geographical zones of Asia was studied using simple sequence repeat (SSR markers from regions of medium to high recombination in the barley genome. The seven polymorphic SSR markers representing each of the chromosomes chosen for the study revealed a high level of allelic diversity among the landraces. Genetic richness was highest in those from India, followed by Pakistan while it was lowest for Uzbekistan and Turkmenistan. Out of the 50 alleles detected, 15 were unique to a geographic region. Genetic diversity was highest for landraces from Pakistan (0.70 ± 0.06 and lowest for those from Uzbekistan (0.18 ± 0.17. Likewise, polymorphic information content (PIC was highest for Pakistan (0.67 ± 0.06 and lowest for Uzbekistan (0.15 ± 0.17. Diversity among groups was 40% compared to 60% within groups. Principal component analysis clustered the barley landraces into three groups to predict their domestication patterns. In total 51.58% of the variation was explained by the first two principal components of the barley germplasm. Pakistan landraces were clustered separately from those of India, Iran, Nepal and Iraq, whereas those from Turkmenistan and Uzbekistan were clustered together into a separate group.

  6. Comparative Transcriptional Profiling of Two Contrasting Barley Genotypes under Salinity Stress during the Seedling Stage

    Directory of Open Access Journals (Sweden)

    Runhong Gao

    2013-01-01

    Full Text Available Salinity is one of the major abiotic stresses that affect crop productivity. Identification of the potential novel genes responsible for salt tolerance in barley will contribute to understanding the molecular mechanism of barley responses to salt stress. We compared changes in transcriptome between Hua 11 (a salt-tolerant genotype and Hua 30 (a salt sensitive genotype in response to salt stress at the seedling stage using barley cDNA microarrays. In total, 557 and 247 salt-responsive genes were expressed exclusively in the shoot and root tissue of the salt-tolerant genotype, respectively. Among these genes, a number of signal-related genes, transcription factors and compatible solutes were identified and some of these genes were carefully discussed. Notably, a LysM RLK was firstly found involved in salt stress response. Moreover, key enzymes in the pathways of jasmonic acid biosynthesis, lipid metabolism and indole-3-acetic acid homeostasis were specifically affected by salt stress in salt tolerance genotype. These salt-responsive genes and biochemical pathways identified in this study could provide further information for understanding the mechanisms of salt tolerance in barley.

  7. Transcriptome study of storage protein genes of field-grown barley in response to inorganic nitrogen fertilizers

    DEFF Research Database (Denmark)

    Hansen, Michael; Bowra, Steve; Lange, Mette;

    2010-01-01

    The storage proteins of barley, in terms of both amino acid profile and quantity, are traits strongly influenced by the amount of nitrogen applied. Given this, we performed a developmental expression analysis of the genes from barley grains grown under field conditions to further our understanding...... of the molecular and biochemical mechanisms underpinning nitrogen utilization. A barley grain specific micro-array, where a comprehensive set of genes involved in nitrogen mobilization, storage protein synthesis and amino acid metabolism were assembled, was used to obtain a global but focused gene expression...

  8. Effects of split nitrogen fertilization on post-anthesis photoassimilates, nitrogen use efficiency and grain yield in malting barley

    DEFF Research Database (Denmark)

    Cai, Jian; Jiang, Dong; Liu, Fulai

    2011-01-01

    photosynthesis after anthesis, dry matter accumulation and assimilates remobilization, nitrogen use efficiency and grain yield to fraction of topdressed nitrogen treatments were investigated in malting barley. Net photosynthetic rate of the penultimate leaf, leaf area index and light extinction coefficient...... and agronomic nitrogen use efficiencies. The enhanced nitrogen use efficiency was corresponding to the improved photosynthetic nitrogen-use efficiency in the leaves at fraction of topdressed nitrogen of 30%. In conclusion, appropriate fraction of topdressed nitrogen application on malting barley improved...... assimilation rate and nitrogen use efficiency resulting in higher grain yields and proper grain protein content in malting barley....

  9. Kinetic and thermodynamic properties of two barley thioredoxin h isozymes, HvTrxh1 and HvTrxh2

    DEFF Research Database (Denmark)

    Maeda, Kenji; Hägglund, Per; Björnberg, Olof

    2010-01-01

    -dependent fluorescence, and the barley isozymes, reaction kinetics and thermodynamic properties were readily determined. The reaction constants were 60% higher for HvTrxh1 than HvTrxh2, while their redox potentials were very similar. The primary nucleophile, Cys(N), of the active site Trp-Cys(N)-Gly-Pro-Cys......Barley thioredoxin h isozymes 1 (HvTrxh1) and barley thioredoxin h isozymes 2 (HvTrxh2) show distinct spatiotemporal distribution in germinating seeds. Using a novel approach involving measurement of bidirectional electron transfer rates between Escherichia coli thioredoxin, which exhibits redox...

  10. Wild Barley,Hordeum spontaneum,a Genetic Resource for Crop Improvement in Cold and Arid Regions

    Institute of Scientific and Technical Information of China (English)

    Eviatar; Nevo

    2008-01-01

    Food security in cold and arid regions in the world is threatened by stressful and unpredictable environments.The sus-tainable and economically viable solution for increasing stability of food productivity in cold and arid regions is genetic improvement of crops towards high resistance to abiotic stresses,mainly cold and drought resistance.It is often empha-sized that crop genetic improvement lies in exploiting the gene pools of the wild relatives of the crop plant.Wild barley,H.spontaneum,the progenitor of cultivated barley,is a selfing annual grass of predominantly Mediterranean and Irano-Turanian distribution that penetrates into desert environments where it maintains stable populations.Wild barley is also found in cold regions,such as in Tibet.The adaptation of wild barley to the arid region in Israel and Jordan,and the cold region in Tibet has accumulated rich genetic diversities for drought,salt,and cold resistances in wild barley,which is the genetic resource for barley and other crop improvement in arid and cold regions.These genetic diversities are revealed by allozymes,DNA-based molecular markers,and morphological and physiological traits of wild barley plants.Quantita-tive trait loci(QTLs) related to drought resistance were identified in wild barley via the QTL mapping approach.Drought resistance genes such as dehydrins,hsdr4,and eibi1 were identified in wild barley based on the candidate gene approach,gene differential expression approach,and molecular genetic approach,respectively.Genetics and genomics of wild bar-ley cold resistance have not been exploited yet,remaining a huge treasure for future crop improvement of cold resistance.Advanced backcross QTL analysis,the introgression libraries based on wild barley as donors,a QTL approach based on wide crosses using wild barley,and positional cloning of natural QTLs will play prevailing roles to help us understand the molecular control of cold and drought tolerance.Integration of QTL information into a

  11. Cloning and characterization of a novel barley gene,HvORG4,induced by Fusarium graminearum infection

    Institute of Scientific and Technical Information of China (English)

    Theo; Van-Der; Lee

    2007-01-01

    Barley Fusarium head blight(FHB),caused by species of the Fusarium fungus,is a devastating disease that is reemerging worldwide in recent years.In this study,a novel gene,HvORG4,was cloned from barley by using cDNA library and suppression subtractive hybridization(SSH) library strategies.The SSH library and cDNA library were constructed from the Chinese barley cultivar Jing02-461(resistance to FHB) infected by Fusarium graminearum isolate Huanggang-1.For the SSH analysis,more than 120 differentially express...

  12. Digestibility of whole-crop barley and oat silages in dairy heifers.

    Science.gov (United States)

    Wallsten, J; Bertilsson, J; Nadeau, E; Martinsson, K

    2010-03-01

    This study evaluated the digestibility of whole-crop cereal silage (WCCS) made from oats and six-rowed barley harvested at the heading, early milk and early dough stages, and two-rowed barley harvested at the early milk and early dough stages of maturity. The eight WCCSs were fed to 32 Swedish Red heifers in a changeover design over three periods of 28 days each. The heifers were first fed ad libitum for 17 days and then at 0.95 of ad libitum for 11 days of each period. During the last 5 days all faeces and orts were collected to determine the digestibility of the silages. Only the maturity stage effect was significant for the WCCS organic matter (OM) digestibility and the average OM digestibility was higher at the heading stage (698 g/kg) than at early milk (647 g/kg) and early dough (652 g/kg) stages of maturity. For neutral detergent fibre (NDF) digestibility the crop × maturity stage effect was significant. The NDF digestibility decreased from the heading to the early milk stage for both six-rowed barley (746 to 607 g/kg) and oats (698 to 596 g/kg). There was no further significant decrease in NDF digestibility for six-rowed barley at the early dough stage (577 g/kg), but for two-rowed barley it decreased from the early milk (682 g/kg) to the early dough (573 g/kg) stage, and also for oats the NDF digestibility was lowest at the early dough stage (507 g/kg). The decrease in NDF digestibility during maturation was to a large extent compensated by an increase in starch concentration in the crops. The starch digestibility was lower for six-rowed barley at early dough stage (948 g/kg) than at early milk stage (977 g/kg), and was also lower compared with oats (979 g/kg) at early dough stage. The average crude protein (CP) digestibility was higher at the heading (646 g/kg) and the early milk (642 g/kg) stages than at the early dough stage (599 g/kg), and oats had higher average CP digestibility (650 g/kg) than six-rowed (613 g/kg) and two-rowed (624 g/kg) barley

  13. A cellular microRNA mediates antiviral defense in human cells.

    Science.gov (United States)

    Lecellier, Charles-Henri; Dunoyer, Patrice; Arar, Khalil; Lehmann-Che, Jacqueline; Eyquem, Stephanie; Himber, Christophe; Saïb, Ali; Voinnet, Olivier

    2005-04-22

    In eukaryotes, 21- to 24-nucleotide-long RNAs engage in sequence-specific interactions that inhibit gene expression by RNA silencing. This process has regulatory roles involving microRNAs and, in plants and insects, it also forms the basis of a defense mechanism directed by small interfering RNAs that derive from replicative or integrated viral genomes. We show that a cellular microRNA effectively restricts the accumulation of the retrovirus primate foamy virus type 1 (PFV-1) in human cells. PFV-1 also encodes a protein, Tas, that suppresses microRNA-directed functions in mammalian cells and displays cross-kingdom antisilencing activities. Therefore, through fortuitous recognition of foreign nucleic acids, cellular microRNAs have direct antiviral effects in addition to their regulatory functions.

  14. Functional Diversification of Maize RNA Polymerase IV and V subtypes via Alternative Catalytic Subunits

    Energy Technology Data Exchange (ETDEWEB)

    Haag, Jeremy R.; Brower-Toland, Brent; Krieger, Elysia K.; Sidorenko, Lyudmila; Nicora, Carrie D.; Norbeck, Angela D.; Irsigler, Andre; LaRue, Huachun; Brzeski, Jan; Mcginnis, Karen A.; Ivashuta, Sergey; Pasa-Tolic, Ljiljana; Chandler, Vicki L.; Pikaard, Craig S.

    2014-10-01

    Unlike nuclear multisubunit RNA polymerases I, II, and III, whose subunit compositions are conserved throughout eukaryotes, plant RNA polymerases IV and V are nonessential, Pol II-related enzymes whose subunit compositions are still evolving. Whereas Arabidopsis Pols IV and V differ from Pol II in four or five of their 12 subunits, respectively, and differ from one another in three subunits, proteomic ana- lyses show that maize Pols IV and V differ from Pol II in six subunits but differ from each other only in their largest subunits. Use of alternative catalytic second subunits, which are nonredundant for development and paramutation, yields at least two sub- types of Pol IV and three subtypes of Pol V in maize. Pol IV/Pol V associations with MOP1, RMR1, AGO121, Zm_DRD1/CHR127, SHH2a, and SHH2b extend parallels between paramutation in maize and the RNA-directed DNA methylation pathway in Arabidopsis.

  15. Assessment and introduction of quantitative resistance to Fusarium head blight in elite spring barley.

    Science.gov (United States)

    Linkmeyer, A; Götz, M; Hu, L; Asam, S; Rychlik, M; Hausladen, H; Hess, M; Hückelhoven, R

    2013-12-01

    Breeding for resistance is a key task to control Fusarium head blight (FHB), a devastating disease of small cereals leading to economic losses and grain contamination with mycotoxins harmful for humans and animals. In the present work, FHB resistance of the six-rowed spring barley 'Chevron' to FHB in Germany was compared with those of adapted German spring barley cultivars. Both under natural infection conditions and after spray inoculation with conidia of Fusarium culmorum, F. sporotrichioides, and F. avenaceum under field conditions, Chevron showed a high level of quantitative resistance to the infection and contamination of grain with diverse mycotoxins. This indicates that Chevron is not only a little susceptible to deoxynivalenol-producing Fusarium spp. but also to Fusarium spp. producing type A trichothecenes and enniatins. Monitoring the initial infection course of F. culmorum on barley lemma tissue by confocal laser-scanning microscopy provided evidence that FHB resistance of Chevron is partially mediated by a preformed penetration resistance, because direct penetration of floral tissue by F. culmorum was observed rarely on Chevron but was common on susceptible genotypes. Alternatively, F. culmorum penetrated Chevron lemma tissue via stomata, which was unusual for susceptible genotypes. We generated double-haploid barley populations segregating for the major FHB resistance quantitative trait loci (QTL) Qrgz-2H-8 of Chevron. Subsequently, we characterized these populations by spray inoculation with conidia of F. culmorum and F. sporotrichioides. This suggested that Qrgz-2H-8 was functional in the genetic background of European elite barley cultivars. However, the degree of achieved resistance was very low when compared with quantitative resistance of the QTL donor Chevron, and the introgression of Qrgz-2H-8 was not sufficient to mediate the cellular resistance phenotype of Chevron in the European backgrounds.

  16. From field barley to malt: detection and specification of microbial activity for quality aspects.

    Science.gov (United States)

    Noots, I; Delcour, J A; Michiels, C W

    1999-01-01

    Barley grain carries a numerous, variable, and complex microbial population that mainly consists of bacteria, yeasts, and filamentous fungi and that can partly be detected and quantified using plating methods and microscopic and molecular techniques. The extent and the activity of this microflora are determined by the altering state of the grain and the environmental conditions in the malt production chain. Three ecological systems can be distinguished: the growing cereal in the field, the dry barley grain under storage, and the germinating barley kernel during actual malting. Microorganisms interact with the malting process both by their presence and by their metabolic activity. In this respect, interference with the oxygen uptake by the barley grain and secretion of enzymes, hormones, toxins, and acids that may affect the plant physiological processes have been studied. As a result of the interaction, microorganisms can cause important losses and influence malt quality as measured by brewhouse performance and beer quality. Of particular concern is the occurrence of mycotoxins that may affect the safety of malt. The development of the microflora during malt production can to a certain extent be controlled by the selection of appropriate process conditions. Physical and chemical treatments to inactivate the microbial population on the barley grain are suggested. Recent developments, however, aim to control the microbial activity during malt production by promoting the growth of desirable microbial cultures, selected either as biocontrol agents inhibiting mycotoxin-producing molds or as starter cultures actively contributing to malt modification. Such techniques may offer natural opportunities to improve the quality and safety of malt.

  17. Additive effects of Na+ and Cl- ions on barley growth under salinity stress.

    Science.gov (United States)

    Tavakkoli, Ehsan; Fatehi, Foad; Coventry, Stewart; Rengasamy, Pichu; McDonald, Glenn K

    2011-03-01

    Soil salinity affects large areas of the world's cultivated land, causing significant reductions in crop yield. Despite the fact that most plants accumulate both sodium (Na(+)) and chloride (Cl(-)) ions in high concentrations in their shoot tissues when grown in saline soils, most research on salt tolerance in annual plants has focused on the toxic effects of Na(+) accumulation. It has previously been suggested that Cl(-) toxicity may also be an important cause of growth reduction in barley plants. Here, the extent to which specific ion toxicities of Na(+) and Cl(-) reduce the growth of barley grown in saline soils is shown under varying salinity treatments using four barley genotypes differing in their salt tolerance in solution and soil-based systems. High Na(+), Cl(-), and NaCl separately reduced the growth of barley, however, the reductions in growth and photosynthesis were greatest under NaCl stress and were mainly additive of the effects of Na(+) and Cl(-) stress. The results demonstrated that Na(+) and Cl(-) exclusion among barley genotypes are independent mechanisms and different genotypes expressed different combinations of the two mechanisms. High concentrations of Na(+) reduced K(+) and Ca(2+) uptake and reduced photosynthesis mainly by reducing stomatal conductance. By comparison, high Cl(-) concentration reduced photosynthetic capacity due to non-stomatal effects: there was chlorophyll degradation, and a reduction in the actual quantum yield of PSII electron transport which was associated with both photochemical quenching and the efficiency of excitation energy capture. The results also showed that there are fundamental differences in salinity responses between soil and solution culture, and that the importance of the different mechanisms of salt damage varies according to the system under which the plants were grown.

  18. CONTRIBUTION OF PRIMARY SPIKES VS TILLERS TO TOTAL DEOXYNIVALENOL IN HARVESTED GRAIN OF WHEAT AND BARLEY

    Directory of Open Access Journals (Sweden)

    Pravin Gautam

    2012-01-01

    Full Text Available Formation of higher number of tillers is desirable for higher grain yield in both wheat and barley; tillers have delayed physiological development. Studies addressing the contribution of secondary tillers in final DON concentration for wheat and barley are limited. This project aims to improve our understanding of the relationship between FHB symptoms and DON concentration by examining the contribution of primary spikes and secondary tillers as it relates to the final DON concentration. Experiments, established as split-split plot design with five replications, was be conducted in South Dakota with moderately resistant and susceptible cultivars of each spring wheat, winter wheat and barley. Two inoculation time treatments was applied; at the anthesis of primary spikes (Feekes 10.5 and at anthesis of tillers (Feekes 11.2. Primary spikes (inoculated at Feekes 10.5 and tillers (inoculated at Feekes 11.2 were harvested separately, analyzed for visually scabby kernels and deoxynivalenol following standard protocols. Levels of DON were statistically higher in main heads of barley and spring wheat in each cultivar compared to its tillers. In winter wheat, though there was higher DON level in tillers than main heads in each cultivar, it was not statistically different. Based upon our result, it is suggested that cultivars with high tillers number should be selected in breeding programs to develop cultivars with high yield and low DON. Similarly, planting density of wheat and barley can be adjusted such that it will result in higher numbers of tillers, increasing tillers proportion that might lower DON concentration in final harvest.

  19. 454 sequencing of pooled BAC clones on chromosome 3H of barley

    Directory of Open Access Journals (Sweden)

    Yamaji Nami

    2011-05-01

    Full Text Available Abstract Background Genome sequencing of barley has been delayed due to its large genome size (ca. 5,000Mbp. Among the fast sequencing systems, 454 liquid phase pyrosequencing provides the longest reads and is the most promising method for BAC clones. Here we report the results of pooled sequencing of BAC clones selected with ESTs genetically mapped to chromosome 3H. Results We sequenced pooled barley BAC clones using a 454 parallel genome sequencer. A PCR screening system based on primer sets derived from genetically mapped ESTs on chromosome 3H was used for clone selection in a BAC library developed from cultivar "Haruna Nijo". The DNA samples of 10 or 20 BAC clones were pooled and used for shotgun library development. The homology between contig sequences generated in each pooled library and mapped EST sequences was studied. The number of contigs assigned on chromosome 3H was 372. Their lengths ranged from 1,230 bp to 58,322 bp with an average 14,891 bp. Of these contigs, 240 showed homology and colinearity with the genome sequence of rice chromosome 1. A contig annotation browser supplemented with query search by unique sequence or genetic map position was developed. The identified contigs can be annotated with barley cDNAs and reference sequences on the browser. Homology analysis of these contigs with rice genes indicated that 1,239 rice genes can be assigned to barley contigs by the simple comparison of sequence lengths in both species. Of these genes, 492 are assigned to rice chromosome 1. Conclusions We demonstrate the efficiency of sequencing gene rich regions from barley chromosome 3H, with special reference to syntenic relationships with rice chromosome 1.

  20. Evolutionary history of barley cultivation in Europe revealed by genetic analysis of extant landraces

    Directory of Open Access Journals (Sweden)

    Jones Huw

    2011-11-01

    Full Text Available Abstract Background Understanding the evolution of cultivated barley is important for two reasons. First, the evolutionary relationships between different landraces might provide information on the spread and subsequent development of barley cultivation, including the adaptation of the crop to new environments and its response to human selection. Second, evolutionary information would enable landraces with similar traits but different genetic backgrounds to be identified, providing alternative strategies for the introduction of these traits into modern germplasm. Results The evolutionary relationships between 651 barley landraces were inferred from the genotypes for 24 microsatellites. The landraces could be divided into nine populations, each with a different geographical distribution. Comparisons with ear row number, caryopsis structure, seasonal growth habit and flowering time revealed a degree of association between population structure and phenotype, and analysis of climate variables indicated that the landraces are adapted, at least to some extent, to their environment. Human selection and/or environmental adaptation may therefore have played a role in the origin and/or maintenance of one or more of the barley landrace populations. There was also evidence that at least some of the population structure derived from geographical partitioning set up during the initial spread of barley cultivation into Europe, or reflected the later introduction of novel varieties. In particular, three closely-related populations were made up almost entirely of plants with the daylength nonresponsive version of the photoperiod response gene PPD-H1, conferring adaptation to the long annual growth season of northern Europe. These three populations probably originated in the eastern Fertile Crescent and entered Europe after the initial spread of agriculture. Conclusions The discovery of population structure, combined with knowledge of associated phenotypes and