WorldWideScience

Sample records for banded mongooses mungos

  1. Pathology of the emerging Mycobacterium tuberculosis complex pathogen, M. mungi in the banded mongoose (Mungos mungo)

    Science.gov (United States)

    Wild banded mongooses (Mungos mungo) in northeastern Botswana and Northwest Zimbabwe are infected with a novel Mycobacterium tuberculosis complex pathogen (MTC), M. mungi. This pathogen is transmitted environmentally between mongoose hosts through exposure to infected scent marks used in olfactory c...

  2. Emerging tuberculosis pathogen hijacks social communication behavior in the group-living banded mongoose (Mungos mungo)

    Science.gov (United States)

    Mycobacterium mungi, a novel M. tuberculosis complex pathogen (MtbC), has emerged in wild banded mongoose (Mungos mungo) in Northern Botswana, causing significant mortality. Unlike other members of the MtbC, M. mungi is not transmitted through a primary aerosol route. Rather, pathogen invasion occur...

  3. Dominance, reproduction and survival in banded mongooses: towards an egalitarian social system?

    Science.gov (United States)

    de Luca, D. W.; Ginsberg, J. R.

    2001-01-01

    The banded mongoose, Mungos mungo, is a social species that forms multimale and multifemale family groups. Earlier studies suggest these family groups are relatively egalitarian with small differences in reproductive opportunities among individuals of different rank. In contrast, previous studies of other social mongooses have focused on species with more despotic control of reproduction (meerkats, Suricata suricatta, dwarf mongooses, Helogale parvula). In these species, the distribution of reproductive opportunities amongst individuals of different rank has met the predictions of reproductive skew theory: dominant individuals accrue greater reproductive benefits than subordinates, with subordinates breeding less often than dominants. In this paper we test how well two predictions of reproductive skew theory explain variance in measures of reproductive effort, and its correlates, in a wild population of banded mongooses in Queen Elizabeth National Park, Uganda. We measure dominance rank in males and females, and we investigate whether individuals of higher social rank accrue greater benefits than subordinates in terms of survival and reproduction. Banded mongoose dominance hierarchies showed linearity, but low reproductive skew. Rank was not significantly correlated with age. Furthermore, there were only small effects of dominance rank on nutritional levels, and no effects on reproduction and survival, suggesting that banded mongoose societies are indeed relatively egalitarian. No evidence of reproductive suppression was found and other forms of reproductive control were not observed. However, we do not exclude the possibility of increased reproductive competition in circumstances of higher ecological constraints. These findings show that reproductive skew theory is equally useful in explaining variation in reproduction in societies with low reproductive skew, as it is in explaining the allocation of reproductive effort in despotic social systems. Copyright 2001

  4. Mongoose for application development

    CERN Document Server

    Holmes, Simon

    2013-01-01

    This book is a mini tutorial full of code examples and strategies to give you plenty of options when building your own applications with MongoDB.This book is ideal for people who want to develop applications on the Node.js stack quickly and efficiently. Prior knowledge of the stack is not essential as the book briefly covers the installation of the core components and builds all aspects of the example application. The focus of the book is on what Mongoose adds to you applications, so experienced Node.js developers will also benefit.

  5. Mongoose ASIC microcontroller programming guide

    Science.gov (United States)

    Smith, Brian S.

    1993-01-01

    The 'Mongoose' ASIC microcontroller is a radiation-hard implementation of the R3000 microprocessor. This document describes the internals of the microcontroller in a level of detail necessary for someone implementing a software design.

  6. Comparative behaviour and ecology of two sympatric mongoose ...

    African Journals Online (AJOL)

    1994-12-12

    Dec 12, 1994 ... Galerefla frequented bush, whereas Cynictis frequented open fields. The yellow mongoose .... approach of a man walking slowly towards the mongoose). ... ences in time between the sunrise and the start of activity times, and ...

  7. Data collection and storage in long-term ecological and evolutionary studies: The Mongoose 2000 system.

    Science.gov (United States)

    Marshall, Harry H; Griffiths, David J; Mwanguhya, Francis; Businge, Robert; Griffiths, Amber G F; Kyabulima, Solomon; Mwesige, Kenneth; Sanderson, Jennifer L; Thompson, Faye J; Vitikainen, Emma I K; Cant, Michael A

    2018-01-01

    Studying ecological and evolutionary processes in the natural world often requires research projects to follow multiple individuals in the wild over many years. These projects have provided significant advances but may also be hampered by needing to accurately and efficiently collect and store multiple streams of the data from multiple individuals concurrently. The increase in the availability and sophistication of portable computers (smartphones and tablets) and the applications that run on them has the potential to address many of these data collection and storage issues. In this paper we describe the challenges faced by one such long-term, individual-based research project: the Banded Mongoose Research Project in Uganda. We describe a system we have developed called Mongoose 2000 that utilises the potential of apps and portable computers to meet these challenges. We discuss the benefits and limitations of employing such a system in a long-term research project. The app and source code for the Mongoose 2000 system are freely available and we detail how it might be used to aid data collection and storage in other long-term individual-based projects.

  8. Volatile components from the anal glands of the yellow mongoose ...

    African Journals Online (AJOL)

    1988-12-01

    Dec 1, 1988 ... sampling, gas-liquid chromatography and mass spectrome- try. The odour volatiles were ... tube and over the secretion at a flow rate of 15 cm3 min-1 .... behaviour of the yellow mongoose, Cynictis penicillata. (G. Cuvier).

  9. Vivipary in Ophiorrhiza mungos L. - a rare phenomenon in angiosperms.

    Science.gov (United States)

    Dintu, K P; Sibi, C V; Ravichandran, P; Satheeshkumar, K

    2015-01-01

    Vivipary, the precocious germination of seeds within the parent plant, is a specialised feature of evolutionary and biological importance that ensures survival of a plant. Reports on vivipary in angiosperms are rare, accounting for <0.1% of flowering plants. Here, we report a remarkable case of occurrence of vivipary in Ophiorrhiza mungos. A study was conducted to collect information on the morphology of the capsules that support vivipary, environmental factors that induce vivipary, survival mode and the survival of viviparous seedlings. The hydroscopic movement of the cup-shaped capsules of O. mungos was found to help in viviparous germination during the rainy season. Of the total seeds in a capsule, 70% showed viviparous germination. The seedlings remaining inside the capsule attain a height of 0.98 ± 0.4 cm and reach the ground when the capsule falls. On the ground, seedlings obtain easy anchorage to the substratum since they have already germinated. Vivipary appears to be an adaptation of O. mungos to the rainy season for ensuring viable offspring. This suggests that vivipary in this species might be artificially induced by continuous spraying with water to rescue seeds in all seasons for use in large-scale propagation to meet increasing market demand and conservation of this valuable anticancer medicinal herb. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  10. Mongoose: Creation of a Rad-Hard MIPS R3000

    Science.gov (United States)

    Lincoln, Dan; Smith, Brian

    1993-01-01

    This paper describes the development of a 32 Bit, full MIPS R3000 code-compatible Rad-Hard CPU, code named Mongoose. Mongoose progressed from contract award, through the design cycle, to operational silicon in 12 months to meet a space mission for NASA. The goal was the creation of a fully static device capable of operation to the maximum Mil-883 derated speed, worst-case post-rad exposure with full operational integrity. This included consideration of features for functional enhancements relating to mission compatibility and removal of commercial practices not supported by Rad-Hard technology. 'Mongoose' developed from an evolution of LSI Logic's MIPS-I embedded processor, LR33000, code named Cobra, to its Rad-Hard 'equivalent', Mongoose. The term 'equivalent' is used to infer that the core of the processor is functionally identical, allowing the same use and optimizations of the MIPS-I Instruction Set software tool suite for compilation, software program trace, etc. This activity was started in September of 1991 under a contract from NASA-Goddard Space Flight Center (GSFC)-Flight Data Systems. The approach affected a teaming of NASA-GSFC for program development, LSI Logic for system and ASIC design coupled with the Rad-Hard process technology, and Harris (GASD) for Rad-Hard microprocessor design expertise. The program culminated with the generation of Rad-Hard Mongoose prototypes one year later.

  11. Exposure to Rabies in Small Indian Mongooses (Herpestes auropunctatus) from Two Regions in Puerto Rico.

    Science.gov (United States)

    Berentsen, Are R; Johnson, Shylo R; Gilbert, Amy T; VerCauteren, Kurt C

    2015-10-01

    The small Indian mongoose (Herpestes auropunctatus) was introduced to several Caribbean Islands to control rat (Rattus spp.) damage to sugarcane plantations. Mongooses failed at suppressing rat populations and are now considered pests throughout most of their introduced range. Importantly, mongooses are rabies reservoirs on several Caribbean Islands. In Puerto Rico, mongooses have been implicated in up to 70% of reported animal rabies cases. There is no rabies vaccination program for wildlife in Puerto Rico, and data on rabies in mongooses are limited. We conducted a serosurvey of mongooses in two different ecologic environments in Puerto Rico: El Yunque National Forest and Cabo Rojo National Wildlife Refuge. We collected 119 serum samples from 112 mongooses, 44 (39.3%) of which were positive for rabies virus-neutralizing antibodies. We also collected oral swabs from 147 mongooses, including 88 from which we also collected serum. No oral swabs were positive for rabies virus RNA. Our data support previous research suggesting rabies virus is circulating within the mongoose population on Puerto Rico.

  12. DEVELOPMENTAL CHANGES IN THE GERMINATION, GROWTH AND CHLOROPHYLLASE ACTIVITY OF VIGNA MUNGO L. USING SEAWEED EXTRACT OF ULVA RETICULATA FORSSKAL.

    OpenAIRE

    Ganapathy Selvam G.; Balamurugan M.; Thinakaran T.; Sivakumar K

    2013-01-01

    The effect of seaweed extract prepared from Ulva reticulata on seed germination, seedling growth and chlorophyllase activity of Vigna mungo L. was studied. 100% germination was recorded in the seeds treated with lower concentration of seaweed extract. The V. mungo seeds soaked with lower concentrations of the seaweed extracts showed higher rates of germination, while the higher concentrations of the extracts inhibited the germination.

  13. Evaluation of the Antioxidant and Melanogenesis Inhibitory Properties of Pracparatum Mungo (Lu-Do Huang

    Directory of Open Access Journals (Sweden)

    Yu-Yu Kao

    2013-07-01

    Full Text Available Pracparatum mungo (Lu-Do Huang is a traditional Chinese functional medicine made from the natural fermentation of mung bean (綠豆 Lǜ Dòu mixed with other Chinese medicines. It has been recognized as having liver protecting and detoxifying effects. As mung beans have been verified to possess anti-inflammatory, antioxidant, antipyretic, and whitening actions, the present research utilized the in vitro, ex vivo, and in vivo experimental models to investigate the antioxidant and melanin inhibiting effects of P. mungo on the skin. The in vitro experiment revealed that P. mungo methanol extract (PMME and P. mungo ethanol extract (PMEE possess the capacity to clear α,α-diphenyl-2-picrylhydrazyl (DPPH radicals and inhibit tyrosinase activity. The ex vivo experiment indicated that PMEE can promote the growth of MDCK cells and increase the enzymatic activities of superoxide dismutase (SOD and catalase in MDCK cells. On the other hand, PMME and PMEE can suppress the proliferation of A375 cells, and PMEE can reduce the enzymatic activities of SOD and catalase in A375 cells. The in vivo results showed that P. mungo can enhance the enzymatic performance of SOD, Catalase, and glutathione peroxidase (GPx in the liver. The results also showed that P. mungo has antioxidant characteristics and can inhibit tyrosinase activity, thereby promoting the growth of skin tissues and suppressing the proliferation of A375 cells, and thus enhancing the effects that the antioxidant enzymatic performance has on the liver. These results can be applied in the development of tyrosinase inhibitors or antioxidants used for the inhibition of melanin biosynthesis or for auto-oxidation in further industrial applications, particularly those relating to functional food or cosmetic compositions.

  14. Nodulation studies with induced mutants of black gram (Vigna mungo L.)

    International Nuclear Information System (INIS)

    Mahna, S.K.; Garg, Rekha; Parvateesam, M.

    1990-01-01

    Mutation breeding has been widely used to generate genetic variability in plants, but reports of mutations affecting the root system are less common. In the present work, black gram (Vigna mungo L. var T9), has been used for studies on the effect of induced mutations on nodulation patterns

  15. Growth Response of Two Phaseolus mungo L. Cultivars Induced by Arbuscular Mycorrhizal Fungi and Trichoderma viride

    Directory of Open Access Journals (Sweden)

    Navnita Sharma

    2016-01-01

    Full Text Available The present investigation aimed to quantify the difference in response of two Phaseolus mungo L. cultivars (i.e., UH-1 and IPU-94-1 to Glomus mosseae (G, that is, Funneliformis mosseae, Acaulospora laevis (A, and Trichoderma viride (T, in different combinations or alone. All the treatments were inoculated with Bradyrhizobium japonicum to ensure nodulation as soil used in the experiment was sterilized. After 120 days of inoculation, plants were analyzed for chlorophyll content, nodulation, mycorrhization, leaf area, and protein content. Results indicate variation in growth response of two cultivars with different treatments. Triple inoculation of plants with G + A + T proved to be the best treatment for growth followed by G + T in both cultivars. Our work allowed the selection of P. mungo L. cultivar UH-1 as highly mycorrhizal responsive as compared to IPU-94-1 and G. mosseae to be an efficient bioinoculant as compared to A. laevis for growth enhancement of P. mungo. Further characterization of P. mungo genotypes will enhance our knowledge of physiological and genetic mechanism behind increase in plant growth and yield due to AM symbiosis.

  16. Failure of survival strategies in adaption of heavy metal environment in lens culinaris and phaseolus mungo

    International Nuclear Information System (INIS)

    Haider, S.; Azmat, R.

    2012-01-01

    Lead (Pb)-treated Lens culinaris and Phaseolus mungo seedlings leaves showed considerable reduction in the size with enhance proline and phenol contents while peroxidase and lignin activity was Pb/sup 2+/ dose dependent. The reduced leaves sizes of both seedlings were correlated with an increase in Pb/sup 2+/levels, and activities of peroxidase and lignin deposition in it. The intensification of activities of peroxidase and phenol in the Pb/sup 2+/ treated plants were accompanied by an increase in the biosynthesis of the lignin contents as their function is of scavenging ROS radical. A strong correlation (r/sup 2/=0.8570) was observed between Pb/sup 2+/ and lignin deposition in the Lens culinaris whereas it was non-significant in Phaseolus mungo (r/sup 2/=0.466). Increased in the lignin contents in the Lens culinaris as a chemical adaptation of the cell walls of various leaves tissues for endurance while decrease in the lignin contents in Phaseolus mungo at high dose of Pb/sup 2+/ may be attributed with the decline in the peroxidase activity. Investigations revealed that although plants adopt several biochemical strategies for their survival but toxicity of Pb/sup 2+/was significant due to which plant fails to continue in stay alive. (author)

  17. Endemic Marsh Mongoose Herpestes palustris (Carnivora: Herpestidae of East Kolkata Wetlands, India: a status report

    Directory of Open Access Journals (Sweden)

    J.K. Mallick

    2009-04-01

    Full Text Available Marsh Mongoose Herpestes palustris is the only extant endemic mammal of the East Kolkata wetlands, which has been declared a RAMSAR site in 2002. Since its first description by the scientists of the Zoological Survey of India, the population of this species has dwindled to an alarming state due to reclamation of the Salt Lake City and Rajarhat expansion, as well as from other anthropogenic causes. Recently, during a field survey only a small population of this endangered mongoose was found in a single location. Immediate conservation measures are required to be taken by the concerned authorities to stop its probable extinction in the near future.

  18. Fish otolith geochemistry, environmental conditions and human occupation at Lake Mungo, Australia

    Science.gov (United States)

    Long, Kelsie; Stern, Nicola; Williams, Ian S.; Kinsley, Les; Wood, Rachel; Sporcic, Katarina; Smith, Tegan; Fallon, Stewart; Kokkonen, Harri; Moffat, Ian; Grün, Rainer

    2014-03-01

    Fish otoliths from the Willandra Lakes Region World Heritage Area (south-western New South Wales, Australia) have been analysed for oxygen isotopes and trace elements using in situ techniques, and dated by radiocarbon. The study focused on the lunettes of Lake Mungo, an overflow lake that only filled during flooding events and emptied by evaporation, and Lake Mulurulu, which was part of the running Willandra Creek system. Samples were collected from two different contexts: from hearths directly associated with human activity, and isolated surface finds. AMS radiocarbon dating constrains the human activity documented by five different hearths to a time span of less than 240 years around 19,350 cal. BP. These hearths were constructed in aeolian sediments with alternating clay and sand layers, indicative of fluctuating lake levels and occasional drying out. The geochemistry of the otoliths confirms this scenario, with shifts in Sr/Ca and Ba/Ca marking the entry of the fish into Lake Mungo several years before their death, and a subsequent increase in the δ18O by ˜4‰ indicating increasing evaporation of the lake. During sustained lake-full conditions there are considerably fewer traces of human presence. It seems that the evaporating Lake Mungo attracted people to harvest fish that might have become sluggish through oxygen starvation in an increasingly saline water body (easy prey hypothesis). In contrast, surface finds have a much wider range in radiocarbon age as a result of reworking, and do not necessarily indicate evaporative conditions, as shown by comparison with otoliths from upstream Lake Mulurulu.

  19. Identification of Mungbean yellow mosaic India virus infecting Vigna mungo var. silvestris L.

    Directory of Open Access Journals (Sweden)

    Kamaal NAIMUDDIN

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabella normale"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Yellow mosaic of Vigna mungo var.  silvestris, a wild relative of blackgram (Vigna mungo [L.] Hepper, was noticed at the Indian Institute of Pulses Research, Kanpur, India during 2008–2010, with an incidence of 100 per cent. The observed symptoms, consisting of veinal yellowing and scattered bright yellow spots, were suggestive of infection with a begomovirus. To characterize the virus, several sets of primer pairs were designed to amplify the targeted DNA fragments of the causal virus. The sequence data revealed that the coat protein (AV1 gene of the begomovirus under study contained a single open reading frame with 774 nucleotides, coding for 257 amino acids. Comparative analysis of the coat protein (AV1 gene of the virus under study (FJ821189 showed a 97 and 99% similarity with Mungbean yellow mosaic India virus (MYMIV-Mungbean strain at the nucleotide and the amino acid levels respectively. Sequence homology of different genes (AC1, AC2, AC3 and AC4 of the isolate under study (FJ663015 with MYMIV-Mungbean (EU523045 was 94–97% for the nucleotides and 91–99% for the amino acids sequence. Therefore, the begomovirus infecting V. mungo var. silvestris at Kanpur is to be considered a strain of MYMIV and is

  20. Thermoluminescence dates for the Lake Mungo aboriginal fireplaces and the implications for radiocarbon dating

    International Nuclear Information System (INIS)

    Bell, W.T.

    1991-01-01

    During the Quaternary period in Australia large areas of western New South Wales and northern Victoria were covered by hundreds of lakes, both large and small. Nearly all are dry today but some may still be recognized by the long low dunes that follow the eastern shorelines. Many traces of early human occupation have been found along the shorelines of nearly all the major lakes and some of the best exposures have occurred on the lunette along the eastern shore of Lake Mungo. This lunette, has suffered massive erosion in recent times and this has uncovered the sites of many ancient fireplaces. Charcoal from some of these fireplaces has been dated by Barbetti and Polach (1973) using the radiocarbon method and the ages place the lakeside dwellers at Mungo in an area of Australian prehistory around 30 000 years ago. The baked sediment from below the fireplaces appears to have been heated to a temperature in excess of 400 o C according to archaeomagnetic studies carried out by Barbetti (1973) and this indicated that the fireplaces might lend themselves to the technique of thermoluminescence (TL) dating. The results of the TL dating programme are described elsewhere. (author)

  1. Thermoluminescence dates for the Lake Mungo aboriginal fireplaces and the implications for radiocarbon dating

    Energy Technology Data Exchange (ETDEWEB)

    Bell, W T [Australian National Univ., Canberra (Australia)

    1991-02-01

    During the Quaternary period in Australia large areas of western New South Wales and northern Victoria were covered by hundreds of lakes, both large and small. Nearly all are dry today but some may still be recognized by the long low dunes that follow the eastern shorelines. Many traces of early human occupation have been found along the shorelines of nearly all the major lakes and some of the best exposures have occurred on the lunette along the eastern shore of Lake Mungo. This lunette, has suffered massive erosion in recent times and this has uncovered the sites of many ancient fireplaces. Charcoal from some of these fireplaces has been dated by Barbetti and Polach (1973) using the radiocarbon method and the ages place the lakeside dwellers at Mungo in an area of Australian prehistory around 30 000 years ago. The baked sediment from below the fireplaces appears to have been heated to a temperature in excess of 400{sup o}C according to archaeomagnetic studies carried out by Barbetti (1973) and this indicated that the fireplaces might lend themselves to the technique of thermoluminescence (TL) dating. The results of the TL dating programme are described elsewhere. (author).

  2. Structural characterization of silver nanoparticles phyto-mediated by a plant waste, seed hull of Vigna mungo and their biological applications

    Science.gov (United States)

    Varadavenkatesan, Thivaharan; Vinayagam, Ramesh; Selvaraj, Raja

    2017-11-01

    Nanobiotechnology has rapidly become a critical facet of nanotechnology. The green synthesis of silver nanoparticles, making use of the hull of black gram (Vigna mungo), paves the way for a simple and eco-friendly utilization of a domestic waste to a product with antioxidant and anticoagulant activities. The emergence of silver nanoparticles was characterized by a variety of methods UV-visible spectrophotometry, scanning electron microscopy added to energy dispersive spectroscopy, X-ray diffractometry, particle size distribution and FT-IR spectroscopy analyses. A discrete band at 421 nm was obtained from UV-visible spectroscopy of the silver nanoparticle suspension. The extract sourced from the hull of black gram showed evidence of the presence of a variety of functional moieties of phytochemicals using FTIR spectroscopy. These were also deemed responsible for maintaining the stability of silver nanoparticles. SEM and EDAX techniques combined, proved that the zero-valent silver nanoparticles were lesser than 100 nm in size. The crystallinity of the nanoparticles was confirmed, as deduced by the (1 1 1) plane, from XRD analysis. The potential of the phytochemicals in maintaining the steadiness of nanoparticles was implied by the zeta potential value that stood at -30.3 mV. In the current study, we have endeavored to comprehend the antioxidant and anticoagulant nature of the green-synthesized benign silver nanoparticles.

  3. First report of natural infection of Vigna mungo var. silvestris L. by Groundnut bud necrosis virus, a tospovirus

    Directory of Open Access Journals (Sweden)

    Mohammad AKRAM

    2010-09-01

    Full Text Available In the autumn of 2008, Vigna mungo var. silvestris growing in the experimental field of the Indian Institute of Pulses Research, Kanpur, India, showed chlorosis around some lateral veins and vein branches (mainly near the leaflet margin, downward curling of the leaf margins, necrosis of the stems and petioles, and twisting of the leaflets. Disease incidence was 20%. Symptoms indicated that the cause was Groundnut bud necrosis virus. The virus was identified on the basis of the symptoms on the diagnostic host, and the reverse transcription polymerase chain reaction (RT-PCR using specific primers of the NSm and NP genes. To our knowledge this is the first report of Groundnut bud necrosis virus on V. mungo var. silvestris.

  4. The tropics and the rise of the British Empire: Mungo Park's perspective on Africa in the late eighteenth century.

    Science.gov (United States)

    Viana, Larissa

    2011-03-01

    The young Scottish physician Mungo Park, aged 23, arrived in Africa in 1795 with a mission as specific as it was complex in those bygone days, namely to travel the entire length of the River Niger. In 1799, the story of this journey was published in a book that sold 1500 copies in the first month alone, with two further editions published that same year, as well as the translation of the work into French and German the following year. In this article, the narrative of Mungo Park is examined by taking due consideration of the relationship between the tropics, science and travel in the early days of British expansionism into the heart of Africa.

  5. The effect of sodium chloride salinity on germination and productivity of mung bean (Vigna Mungo Linn.)

    International Nuclear Information System (INIS)

    Jabeen, M.; Azim, F.; Ibrar, M.; Hussain, F.; Ilahi, I.

    2003-01-01

    The germination was significantly declined at salinity levels of 5.0 dSm/sup -1/ and above in the laboratory experiment while in the pot experiment germination significantly reduced at salinity levels of 7.5 dSm/sup -1/ and above. Radicle and plumule lengths were also significantly reduced at 5.0 dSm/sup -1/ and higher levels of NaCl. Plant height, number of branches and number of leaves significantly decreased at 10.0 dSm/sup -1/ and higher levels of salinity. The number of seeds was significantly dwindled at 7.5 dSm/sup -1/ and above. Similarly, chlorophyll contents were also significantly low at 7.5 dSm/sup -1/ and higher concentrations. It was concluded that Vigna mungo might not show promising growth and productivity in saline habitats. However, under mild saline conditions it might be grown not only to supplement the crop yield, but also as a source of fodder and soil reclamation measure. (author)

  6. Effect of simulated acid rain (sar) on some morphochemical aspects of mash (vigna mungo l.)

    International Nuclear Information System (INIS)

    Imran, H.A.; Hussain, M.; Hussain, S.

    2014-01-01

    The studies were conducted to evaluate the effect of simulated acid rain (SAR) at early plant growth on some morphochemical characters of two varieties of Mash (Vigna mungo L.) namely Mash 97 and Var. 95009. Different pH values were made by using H/sub 2/SO/sub 4/, HNO/sub 3/, and combination of both. The data revealed that low pH (3.5) of either sulphuric acid or the combination of H/sub 2/SO/sub 4/ and HNO/sub 3/ affected more severely at all parameters including number of leaves, shoot: root ratio, water contents of shoot and Potassium ion concentration. Whereas for a few parameters like plant height and number of branches the simulated acid rain of solution of pH 4.5 and 3.5 by using HNO/sub 3/ proved a bit better for plant growth, the root length was increased in case of SAR of solution of pH 3.5 by using H/sub 2/SO/sub 4/+HNO/sub 3/. Foliar application of SAR of solution of pH greater than 4.5 showed some improvement in crop growth due to fertilizer effect of solution's components. (author)

  7. Bruchid egg induced transcript dynamics in developing seeds of black gram (Vigna mungo.

    Directory of Open Access Journals (Sweden)

    Indrani K Baruah

    Full Text Available Black gram (Vigna mungo seeds are a rich source of digestible proteins, however, during storage these seeds are severely damaged by bruchids (Callosobruchus spp., reducing seed quality and yield losses. Most of the cultivated genotypes of black gram are susceptible to bruchids, however, few tolerant genotypes have also been identified but the mechanism of tolerance is poorly understood. We employed Suppression Subtractive Hybridization (SSH to identify specifically, but rarely expressed bruchid egg induced genes in black gram. In this study, Suppression Subtractive Hybridization (SSH library was constructed to study the genes involved in defense response in black gram against bruchid infestation. An EST library of 277 clones was obtained for further analyses. Based on CAP3 assembly, 134 unigenes were computationally annotated using Blast2GOPRO software. In all, 20 defense related genes were subject to quantitative PCR analysis (qPCR out of which 12 genes showed up-regulation in developing seeds of the pods oviposited by bruchids. Few major defense genes like defensin, pathogenesis related protein (PR, lipoxygenase (LOX showed high expression levels in the oviposited population when compared with the non-oviposited plants. This is the first report on defense related gene transcript dynamics during the bruchid-black gram interaction using SSH library. This library would be useful to clone defense related gene(s such as defensin as represented in our library for crop improvement.

  8. Biofertilizing efficiency of Sargassum polycystum extract on growth and biochemical composition of Vigna radiata and Vigna mungo

    Directory of Open Access Journals (Sweden)

    B Bharath

    2018-01-01

    Full Text Available Objective: To evaluate the effect of marine brown alga Sargassum polycystum extract on growth and biochemical parameters of Vigna radiata and Vigna mungo.Methods: Different concentrations of algal extracts (0.5%, 1.0%, 2.0%, 3.0%, 4.0%, and 5.0% were prepared and applied to the crops at every 10-day intervals under natural conditions. After 30 d, the plants were harvested to evaluate the growth and biochemical parameters.Results: Seaweed liquid fertilizers treated seedlings showed maximum growth in 3.0% concentration when compared to the untreated seedlings. Similarly, biochemical parameters such as photosynthetic pigments, protein, reducing sugar, total sugar and amino acids exhibited increases in 3.0% concentration seaweed extract. Decreases in growth and biochemical parameters were noticed in concentrations higher than 3.0%.Conclusions: Presence of micronutrients and growth regulating substances in the liquid extract help healthier and faster productivity of the crop.

  9. Screening and Identification of putative long non coding RNAs from transcriptome data of a high yielding blackgram (Vigna mungo, Cv. T9

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Singh

    2018-04-01

    Full Text Available Blackgram (Vigna mungo is one of primary legumes cultivated throughout India, Cv.T9 being one of its common high yielding cultivar. This article reports RNA sequencing data and a pipeline for prediction of novel long non-coding RNAs from the sequenced data. The raw data generated during sequencing are available at Sequence Read Archive (SRA of NCBI with accession number- SRX1558530 Keywords: Blackgram, Long non-coding RNA, Legumes, RNA sequencing data

  10. Initial experience with the 3.3 Fr Mongoose® pigtail catheter for aortic angiography during patent ductus arteriosus closure in small patients.

    Science.gov (United States)

    Hena, Zachary; Sutton, Nicole J; Gates, Gregory J; Taragin, Benjamin H; Pass, Robert H

    2017-01-01

    Smaller femoral arterial sheaths may be associated with fewer vascular complications. The 3.3 Fr Mongoose ® Pediavascular pigtail catheter is a catheter that allows higher flow rates, potentially resulting in improved angiographic quality. We reviewed our experience with this small catheter during patent ductus arteriosus (PDA) closure. Review of patients ≤20 kg in whom the Mongoose ® catheter was used during PDA closure from 12/13 to 4/15. Angiographic efficacy and procedural details were compared to ten 4 Fr catheter cases. Comparisons were performed using Mann-Whitney U-test; P closure in small children.

  11. Snapshot of Viral Infections in Wild Carnivores Reveals Ubiquity of Parvovirus and Susceptibility of Egyptian Mongoose to Feline Panleukopenia Virus

    Science.gov (United States)

    Duarte, Margarida D.; Henriques, Ana Margarida; Barros, Sílvia Carla; Fagulha, Teresa; Mendonça, Paula; Carvalho, Paulo; Monteiro, Madalena; Fevereiro, Miguel; Basto, Mafalda P.; Rosalino, Luís Miguel; Barros, Tânia; Bandeira, Victor; Fonseca, Carlos; Cunha, Mónica V.

    2013-01-01

    The exposure of wild carnivores to viral pathogens, with emphasis on parvovirus (CPV/FPLV), was assessed based on the molecular screening of tissue samples from 128 hunted or accidentally road-killed animals collected in Portugal from 2008 to 2011, including Egyptian mongoose (Herpestes ichneumon, n = 99), red fox (Vulpes vulpes, n = 19), stone marten (Martes foina, n = 3), common genet (Genetta genetta, n = 3) and Eurasian badger (Meles meles, n = 4). A high prevalence of parvovirus DNA (63%) was detected among all surveyed species, particularly in mongooses (58%) and red foxes (79%), along with the presence of CPV/FPLV circulating antibodies that were identified in 90% of a subset of parvovirus-DNA positive samples. Most specimens were extensively autolysed, restricting macro and microscopic investigations for lesion evaluation. Whenever possible to examine, signs of active disease were not present, supporting the hypothesis that the parvovirus vp2 gene fragments detected by real-time PCR possibly correspond to viral DNA reminiscent from previous infections. The molecular characterization of viruses, based on the analysis of the complete or partial sequence of the vp2 gene, allowed typifying three viral strains of mongoose and four red fox’s as feline panleukopenia virus (FPLV) and one stone marten’s as newCPV-2b type. The genetic similarity found between the FPLV viruses from free-ranging and captive wild species originated in Portugal and publicly available comparable sequences, suggests a closer genetic relatedness among FPLV circulating in Portugal. Although the clinical and epidemiological significance of infection could not be established, this study evidences that exposure of sympatric wild carnivores to parvovirus is common and geographically widespread, potentially carrying a risk to susceptible populations at the wildlife-domestic interface and to threatened species, such as the wildcat (Felis silvestris) and the critically

  12. Spectrum and frequency of chlorophyll mutations in urdbean (Vigna mungo L. Hepper) induced by EMS and gamma rays

    International Nuclear Information System (INIS)

    Sharma, A.K.; Singh, V.P.; Sarma, M.K.

    2006-01-01

    In mutation breeding experiment, plants with altered characteristics such as chlorophyll changes, sterility, plant lethality etc. could be the marker of the mutability of a variety. In fact, spectrum and frequency of chlorophyll mutations have been studied in the great detail. The chlorophyll mutation is the clear-cut indication of non-directional nature of mutation and possibility of induction of useful mutations. The spectrum and frequency of chlorophyll mutation was estimated by using gamma rays (100, 200, 300 and 400 Gy doses), EMS (0.2, 0.4, 0.6 and 0.8%) and combination of gamma rays (100, 200, 300 400 Gy) with 0.2 % concentration EMS on two cultivars, namely, Pant Urd-19 and Pant Urd-30 of urdbean ( Vigna mungo L. Hepper). Five different types of chlorophyll mutations viz., albina, xantha, viridis, chlorina and maculata were identified in both the cultivars. Almost all the combination treatments produced maximum frequency and wider spectrum of chlorophyll mutations followed by single treatment of gamma rays or EMS. The frequency of chlorophyll mutation increased with higher doses of mutagens but decreased at highest dose. Proc. Nat. Acad. Sci. India. 76(8), I, 2006. 64-68. (author)

  13. MGS Esmeralda: new large seed mungbean cultivar MGS Esmeralda: nova cultivar de mungo-verde de sementes grandes

    Directory of Open Access Journals (Sweden)

    Rogério Faria Vieira

    2008-06-01

    Full Text Available Mungbean cultivar MGS Esmeralda was developed by Asian Vegetable Research and Development Center (Shanhua, Taiwan, as a result of crossing between the lines VC 1973A and VC 2768A. In ten trials conducted in the State of Minas Gerais, Brazil, it produced 13.5% more grains than 'Ouro Verde MG-2' (control cultivar, and its highest yield was 2,550 kg ha-1. The cultivar MGS Esmeralda is more susceptible to lodging, and its pods mature more uniformly than Ouro Verde MG-2 pods. One hundred-seed mass of 'MGS Esmeralda' ranged between 5.5 and 6.8 g. Both cultivars are susceptible to powdery mildew and cercospora leaf spot.A cultivar de mungo-verde MGS Esmeralda foi criada pelo Asian Vegetable Research and Development Center, localizado em Shanhua, Formosa. Ela é resultado do cruzamento entre as linhagens VC 1973A e VC 2768A. Em dez ensaios conduzidos em Minas Gerais, ela produziu 13,5% mais grãos do que a cultivar Ouro Verde MG-2 (testemunha, e sua produtividade mais alta foi 2.550 kg ha-1. A cultivar MGS Esmeralda é mais suscetível ao acamamento do que a Ouro Verde MG-2, mas suas vagens amadurecem mais uniformemente. A massa de 100 grãos da 'MGS Esmeralda' varia de 5,5 a 6,8 g. Ambas as cultivares são suscetíveis ao oídio e à cercosporiose.

  14. Leaf crinkle disease in urdbean (Vigna mungo L. Hepper): An overview on causal agent, vector and host.

    Science.gov (United States)

    Gautam, Narinder Kumar; Kumar, Krishna; Prasad, Manoj

    2016-05-01

    Urdbean leaf crinkle disease (ULCD) is an economically significant widespread and devastating disease resulting in extreme crinkling, puckering and rugosity of leaves inflicting heavy yield losses annually in major urdbean-producing countries of the world. This disease is caused by urdbean leaf crinkle virus (ULCV). Urdbean (Vigna mungo L. Hepper) is relatively more susceptible than other pulses to leaf crinkle disease. Urdbean is an important and useful crop cultivated in various parts of South-East Asia and well adapted for cultivation under semi-arid and subtropical conditions. Aphids, insects and whiteflies have been reported as vectors of the disease. The virus is also transmitted through sap inoculation, grafting and seed. The loss in seed yield in ULCD-affected urdbean crop ranges from 35 to 81%, which is dependent upon type of genotype location and infection time. The diseased material and favourable climatic conditions contribute for the widespread viral disease. Anatomical and biochemical changes take place in the affected diseased plants. Genetic variations have been reported in the germplasm screening which suggest continuous screening of available varieties and new germplasm to search for new traits (new genes) and identify new sources of disease resistance. There are very few reports on breeding programmes for the development and release of varieties tolerant to ULCD. Mostly random amplified polymorphic DNA (RAPD) as well as inter-simple sequence repeat (ISSR) molecular markers have been utilized for fingerprinting of blackgram, and a few reports are there on sequence-tagged micro-satellite site (STMS) markers. There are so many RNA viruses which have also developed strategies to counteract silencing process by encoding suppressor proteins that create hindrances in the process. But, in the case of ULCV, there is no report available indicating which defence pathway is operating for its resistance in the plants and whether same silencing suppression

  15. The Occurrence of Some Nonblood Protozoan Parasites in Wild and Domestic Mammals in South Africa.

    Science.gov (United States)

    Lukášová, Radka; Halajian, Ali; Bártová, Eva; Kobédová, Kateřina; Swanepoel, Lourens H; O'Riain, M Justin

    2018-04-01

    Relatively little is known about protozoan parasites in African animals. Here we investigated the occurrence of protozoan parasites in mammals from South Africa. Oocysts of protozoan parasites were detected in 13 of 56 (23%) fecal samples using conventional microscopic examination methods. Cryptosporidium spp. and Cystoisospora spp. were detected in eight (14%) and five (9%) samples, respectively. Mixed parasitic infection of Cryptosporidium spp. and Cystoisospora spp. was recorded in banded mongoose ( Mungos mungo). Cryptosporidium spp. was detected for the first time in cheetah ( Acinonyx jubatus), spotted hyena ( Crocuta crocuta), and African polecat ( Ictonyx striatus). Antibodies to Toxoplasma gondii and Neospora caninum were not detected by enzyme-linked immunosorbent assay in any of 32 sera tested. We detected T. gondii by PCR in tissues of five of 243 (2%) animals: domestic dog ( Canis lupus familiaris), gerbil ( Gerbilliscus spp.), greater kudu ( Tragelaphus strepsiceros), honey badger ( Mellivora capensis), and white-tailed mongoose ( Ichneumia albicauda). Our isolation of T. gondii from white-tailed mongoose and honey badger was a unique finding. All tissue samples were negative for N. caninum. The study increases our knowledge on the occurrence of protozoan parasites in populations of wild and domestic animals in South Africa.

  16. Vigna mungo L. Hepper

    African Journals Online (AJOL)

    satyam

    2013-03-13

    Mar 13, 2013 ... Genetic engineering allows these genes to be transferred to cultivated varieties in order to enhance the tolerance to various stresses and hence stabilize .... primer: 5'. AATATCACGGGTAGCCAACG 3' and reverse primer 5'.

  17. Vigna mungo (L.) Hepper

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... Available online at http://www.academicjournals.org/AJB .... g/100 g, Trifolium alexandrianum green manure (GM) @ 4 g/100 g. (on dry weight ... MN-S with concentrated sugar solution as an ad- ..... as an alternative fertilizer.

  18. Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation.

    Science.gov (United States)

    Mohamed Abubakkar, M; Saraboji, K; Ponnuswamy, M N

    2013-02-01

    Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively.

  19. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. �UG157� and �DPU915� were good general combiners. Two crosses namely �PDB 88-31�/�DPU 915� and �PLU 277�/�KAU7� had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  20. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. UG157 and DPU915 were good general combiners. Two crosses namely PDB 88-31/DPU 915 and PLU 277/KAU7 had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  1. Structural characterization of neutral and acidic oligosaccharides in the milks of strepsirrhine primates: greater galago, aye-aye, Coquerel's sifaka and mongoose lemur.

    Science.gov (United States)

    Taufik, Epi; Fukuda, Kenji; Senda, Akitsugu; Saito, Tadao; Williams, Cathy; Tilden, Chris; Eisert, Regina; Oftedal, Olav; Urashima, Tadasu

    2012-04-01

    The structures of milk oligosaccharides were characterized for four strepsirrhine primates to examine the extent to which they resemble milk oligosaccharides in other primates. Neutral and acidic oligosaccharides were isolated from milk of the greater galago (Galagidae: Otolemur crassicaudatus), aye-aye (Daubentoniidae: Daubentonia madagascariensis), Coquerel's sifaka (Indriidae: Propithecus coquereli) and mongoose lemur (Lemuridae: Eulemur mongoz), and their chemical structures were characterized by (1)H-NMR spectroscopy. The oligosaccharide patterns observed among strepsirrhines did not appear to correlate to phylogeny, sociality or pattern of infant care. Both type I and type II neutral oligosaccharides were found in the milk of the aye-aye, but type II predominate over type I. Only type II oligosaccharides were identified in other strepsirrhine milks. α3'-GL (isoglobotriose, Gal(α1-3)Gal(β1-4)Glc) was found in the milks of Coquerel's sifaka and mongoose lemur, which is the first report of this oligosaccharide in the milk of any primate species. 2'-FL (Fuc(α1-2)Gal(β1-4)Glc) was found in the milk of an aye-aye with an ill infant. Oligosaccharides containing the Lewis x epitope were found in aye-aye and mongoose lemur milk. Among acidic oligosaccharides, 3'-N-acetylneuraminyllactose (3'-SL-NAc, Neu5Ac(α2-3)Gal(β1-4)Glc) was found in all studied species, whereas 6'-N-acetylneuraminyllactose (6'-SL-NAc, Neu5Ac(α2-6)Gal(β1-4)Glc) was found in all species except greater galago. Greater galago milk also contained 3'-N-glycolylneuraminyllactose (3'-SL-NGc, Neu5Gc(α2-3)Gal(β1-4)Glc). The finding of a variety of neutral and acidic oligosaccharides in the milks of strepsirrhines, as previously reported for haplorhines, suggests that such constituents are ancient rather than derived features, and are as characteristic of primate lactation is the classic disaccharide, lactose.

  2. Ouro Verde MG 2: nova cultivar de mungo-verde para Minas Gerais Ouro Verde MG 2: new mungbean cultivar for Minas Gerais State, Brazil

    Directory of Open Access Journals (Sweden)

    Rogério F. Vieira

    2002-03-01

    Full Text Available Dentre várias linhagens introduzidas do "Asian Vegetable Research and Development Center" (AVRDC, sobressaiu a linhagem VC 3984-B-2-B-4-1-B, que recebeu o nome de Ouro Verde MG 2. Suas sementes são verde-brilhantes e o peso de 1000 unidades varia de 43 a 51 g. O início da floração ocorre em torno de 33 dias após a emergência e a primeira vagem madura surge entre 23 e 33 dias. Por se tratar de espécie de maturação desuniforme, podem ser necessárias duas a quatro colheitas. As plantas podem atingir 95 cm de altura. As vagens são marrom-escuras e concentram-se na parte superior da planta. É suscetível a duas doenças que geralmente aparecem no final do ciclo de vida do mungo-verde: míldio-pulverulento (Erysiphe polygoni e mancha-foliar-de-cercospora (Cercospora canescens. A 'Ouro Verde MG 2' é resistente ao acamamento, e o seu rendimento, em três ensaios instalados em dezembro, janeiro e fevereiro, variou de 1,5 a 2,0 t/ha. Esses rendimentos foram, em média, 12% superior ao da cultivar Ouro Verde.Among many accessions introduced from Asian Vegetable Research and Development Center (AVRDC, the VC 3984-B-2-B-4-1-B stood out and was named 'Ouro Verde MG 2'. The seeds are bright green and 1000-seed weight ranges from 43 to 51 g. Flowering starts approximately 33 days after emergence and the first pod ripens between 23 and 33 days later. As mungbean is a non-uniform maturation species, two to four harvests could be necessary. The plant can reach 95 cm high. The pods are dark brown and concentrated in the upper canopy. This cv. is susceptible to two diseases which generally appear late in the crop: powdery mildew (Erysiphe polygoni and cercospora leaf spot (Cercospora canescens. 'Ouro Verde MG 2' is resistant to lodging. The yield measured in three experiments carried out in December, January, and February, ranged from 1.5 to 2.0 t/ha. In average, these yields were 12% superior than the achieved by the cultivar 'Ouro Verde'.

  3. De novo Assembly, Characterization of Immature Seed Transcriptome and Development of Genic-SSR Markers in Black Gram [Vigna mungo (L. Hepper].

    Directory of Open Access Journals (Sweden)

    J Souframanien

    Full Text Available Black gram [V. mungo (L. Hepper] is an important legume crop extensively grown in south and south-east Asia, where it is a major source of dietary protein for its predominantly vegetarian population. However, lack of genomic information and markers has become a limitation for genetic improvement of this crop. Here, we report the transcriptome sequencing of the immature seeds of black gram cv. TU94-2, by Illumina paired end sequencing technology to generate transcriptome sequences for gene discovery and genic-SSR marker development. A total of 17.2 million paired-end reads were generated and 48,291 transcript contigs (TCS were assembled with an average length of 443 bp. Based on sequence similarity search, 33,766 TCS showed significant similarity to known proteins. Among these, only 29,564 TCS were annotated with gene ontology (GO functional categories. A total number of 138 unique KEGG (Kyoto Encyclopedia of Genes and Genomes pathways were identified, of which majority of TCS are grouped into purine metabolism (678 followed by pyrimidine metabolism (263. A total of 48,291 TCS were searched for SSRs and 1,840 SSRs were identified in 1,572 TCS with an average frequency of one SSR per 11.9 kb. The tri-nucleotide repeats were most abundant (35% followed by di-nucleotide repeats (32%. PCR primer pairs were successfully designed for 933 SSR loci. Sequences analyses indicate that about 64.4% and 35.6% of the SSR motifs were present in the coding sequences (CDS and untranslated regions (UTRs respectively. Tri-nucleotide repeats (57.3% were preferentially present in the CDS. The rate of successful amplification and polymorphism were investigated using selected primers among 18 black gram accessions. Genic-SSR markers developed from the Illumina paired end sequencing of black gram immature seed transcriptome will provide a valuable resource for genetic diversity, evolution, linkage mapping, comparative genomics and marker-assisted selection in black gram.

  4. De novo Assembly, Characterization of Immature Seed Transcriptome and Development of Genic-SSR Markers in Black Gram [Vigna mungo (L.) Hepper

    Science.gov (United States)

    Souframanien, J.; Reddy, Kandali Sreenivasulu

    2015-01-01

    Black gram [V. mungo (L.) Hepper] is an important legume crop extensively grown in south and south-east Asia, where it is a major source of dietary protein for its predominantly vegetarian population. However, lack of genomic information and markers has become a limitation for genetic improvement of this crop. Here, we report the transcriptome sequencing of the immature seeds of black gram cv. TU94-2, by Illumina paired end sequencing technology to generate transcriptome sequences for gene discovery and genic-SSR marker development. A total of 17.2 million paired-end reads were generated and 48,291 transcript contigs (TCS) were assembled with an average length of 443 bp. Based on sequence similarity search, 33,766 TCS showed significant similarity to known proteins. Among these, only 29,564 TCS were annotated with gene ontology (GO) functional categories. A total number of 138 unique KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways were identified, of which majority of TCS are grouped into purine metabolism (678) followed by pyrimidine metabolism (263). A total of 48,291 TCS were searched for SSRs and 1,840 SSRs were identified in 1,572 TCS with an average frequency of one SSR per 11.9 kb. The tri-nucleotide repeats were most abundant (35%) followed by di-nucleotide repeats (32%). PCR primer pairs were successfully designed for 933 SSR loci. Sequences analyses indicate that about 64.4% and 35.6% of the SSR motifs were present in the coding sequences (CDS) and untranslated regions (UTRs) respectively. Tri-nucleotide repeats (57.3%) were preferentially present in the CDS. The rate of successful amplification and polymorphism were investigated using selected primers among 18 black gram accessions. Genic-SSR markers developed from the Illumina paired end sequencing of black gram immature seed transcriptome will provide a valuable resource for genetic diversity, evolution, linkage mapping, comparative genomics and marker-assisted selection in black gram. PMID

  5. Comportamento de linhagens de feijão-mungo(Vigna radiata L. em Santa Catarina Behaviour of mungbean (Vigna radiata L. in Santa Catarina

    Directory of Open Access Journals (Sweden)

    Shong Lin Shiow

    2002-08-01

    Full Text Available Foram conduzidos três experimentos na fazenda experimental do Centro de Ciências Agrárias da Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil. A finalidade do trabalho foi avaliar o comportamento de 29 linhagens de feijão mungo provenientes do "Asian Vegetable Research and Development Center" (AVRDC. Avaliaram-se as características agronômicas (formacão da primeira flor, primeiro legume maduro, estatura da planta, o peso de mil sementes e o rendimento. As linhagens foram testadas em blocos ao acaso, com quatro repetições. Cada parcela foi constituída por 4 linhas de 6m de comprimento, espaçadas de 50cm, com vinte sementes por metro de sulco. A floração inicial das linhagens ocorreu entre os 33 e 49 dias após o plantio, enquanto a maturação do primeiro legume se deu entre os 70 e 78 dias após a semeadura. A estatura das plantas e o peso de mil sementes variaram entre 22,5 e 63,8cm e 33,0 e 76,4g respectivamente. As linhagens mais produtivas foram: VC 3890B, VC 1973C e VC 2764B com rendimento acima de 1140kg.ha-1. Estas linhagens apresentaram peso de mil sementes e estatura de planta boas para cultivo e um ciclo biológico médio. A colheita foi feita em uma única operação, entre 80 e 85 dias após a semeadura no primeiro e segundo experimentos. No terceiro experimento, a colheita foi feita em duas vezes, aos 80 e 85 dias e aos 95 e 100 dias, sendo que na primeira colheita foram colhidos 78% dos legumes; os restantes 22% foram colhidos 15 dias após a primeira.Three experiments were conducted at the experimental farm of the Agricultural Science Center, Federal University of Santa Catarina, Ressacada, Florianópolis, SC. Brazil. Twenty nine lines of mungbean from the Asian Vegetable Research and Development Center (AVRDC, Taiwan, Republic of China were evaluated about their agronomic characters (first flower formation, first legume mature, plant height, thousand seeds weight and yield. The experimental design

  6. Congenital Constriction Band Syndrome

    OpenAIRE

    Rajesh Gupta, Fareed Malik, Rishabh Gupta, M.A.Basit, Dara Singh

    2008-01-01

    Congenital constriction bands are anomalous bands that encircle a digit or an extremity. Congenitalconstriction band syndrome is rare condition and is mostly associated with other musculoskeletaldisorders.We report such a rare experience.

  7. Association with humans and seasonality interact to reverse predictions for animal space use.

    Science.gov (United States)

    Laver, Peter N; Alexander, Kathleen A

    2018-01-01

    Variation in animal space use reflects fitness trade-offs associated with ecological constraints. Associated theories such as the metabolic theory of ecology and the resource dispersion hypothesis generate predictions about what drives variation in animal space use. But, metabolic theory is usually tested in macro-ecological studies and is seldom invoked explicitly in within-species studies. Full evaluation of the resource dispersion hypothesis requires testing in more species. Neither have been evaluated in the context of anthropogenic landscape change. In this study, we used data for banded mongooses ( Mungos mungo ) in northeastern Botswana, along a gradient of association with humans, to test for effects of space use drivers predicted by these theories. We used Bayesian parameter estimation and inference from linear models to test for seasonal differences in space use metrics and to model seasonal effects of space use drivers. Results suggest that space use is strongly associated with variation in the level of overlap that mongoose groups have with humans. Seasonality influences this association, reversing seasonal space use predictions historically-accepted by ecologists. We found support for predictions of the metabolic theory when moderated by seasonality, by association with humans and by their interaction. Space use of mongooses living in association with humans was more concentrated in the dry season than the wet season, when historically-accepted ecological theory predicted more dispersed space use. Resource richness factors such as building density were associated with space use only during the dry season. We found negligible support for predictions of the resource dispersion hypothesis in general or for metabolic theory where seasonality and association with humans were not included. For mongooses living in association with humans, space use was not associated with patch dispersion or group size over both seasons. In our study, living in association

  8. Creeping in the night: What might ecologists be missing?

    Directory of Open Access Journals (Sweden)

    Carol Anne Nichols

    Full Text Available Wildlife activity patterns tend to be defined by terms such as diurnal and nocturnal that might not fully depict the complexity of a species' life history strategy and behavior in a given system. These activity pattern categories often influence the methodological approaches employed, including the temporal period of study (daylight or nighttime. We evaluated banded mongoose (Mungos mungo behavior in Northern Botswana through the use of remote sensing cameras at active den sites in order to characterize early morning behavior for this diurnal species. Our approach, however, provided the facility to capture unexpected nocturnal activity in a species that had otherwise only been studied during daylight hours. Camera traps were deployed for 215 trap days (24 hour data capture period at den sites, capturing 5,472 photos over all events. Nocturnal activity was identified in 3% of trap days at study den sites with both vigilant and non-vigilant nocturnal behaviors identified. While vigilant behaviors involved troop fleeing responses, observations of non-vigilant behaviors suggest nonresident mongoose may investigate den sites of other troops during nocturnal time periods. There was no association between the occurrence of nocturnal activity and lunar phase (Fisher's exact test, n = 215, p = 0.638 and thus, increased moonlight was not identified as a factor influencing nocturnal behavior. The drivers and fitness consequences of these nocturnal activities remain uncertain and present intriguing areas for future research. Our findings highlight the need for ecological studies to more explicitly address and evaluate the potential for temporal variability in activity periods. Modifying our approach and embracing variation in wildlife activity patterns might provide new insights into the interaction between ecological phenomenon and species biology that spans the diurnal-nocturnal spectrum.

  9. Band structure of semiconductors

    CERN Document Server

    Tsidilkovski, I M

    2013-01-01

    Band Structure of Semiconductors provides a review of the theoretical and experimental methods of investigating band structure and an analysis of the results of the developments in this field. The book presents the problems, methods, and applications in the study of band structure. Topics on the computational methods of band structure; band structures of important semiconducting materials; behavior of an electron in a perturbed periodic field; effective masses and g-factors for the most commonly encountered band structures; and the treatment of cyclotron resonance, Shubnikov-de Haas oscillatio

  10. Evidence of Oxidative Shielding of Offspring in a Wild Mammal

    Directory of Open Access Journals (Sweden)

    Emma I. K. Vitikainen

    2016-05-01

    Full Text Available Oxidative damage has been proposed as a potential mechanism underlying a life history tradeoff between survival and reproduction. However, evidence that reproduction is associated with increased oxidative damage is equivocal, and some studies have found that breeding females exhibit reduced, rather than elevated, levels of oxidative damage compared to equivalent non-breeders. Recently it was hypothesized that oxidative damage could have negative impacts on developing offspring, and that mothers might down-regulate oxidative damage during reproduction to shield their offspring from such damage. We tested this hypothesis through a longitudinal study of adult survival, reproduction, and oxidative damage in wild banded mongooses (Mungos mungo in Uganda. High levels of oxidative damage as measured by malondialdehyde (MDA were associated with reduced survival in both sexes. Levels of protein carbonyls were not linked to survival. Mothers showed reduced levels of MDA during pregnancy, and individuals with higher MDA levels gestated fewer offspring and had lower pup survival. These results suggest that maternal oxidative damage has transgenerational costs, and are consistent with the idea that mothers may attempt to shield their offspring from particularly harmful types of oxidative damage during pregnancy. We suggest that further advance in understanding of life history variation could benefit from theoretical and empirical exploration of the potential transgenerational costs of reproduction.

  11. Fenólicos totais e atividade antioxidante do extrato aquoso de broto de feijão-mungo (Vigna radiata L. Total phenolics and antioxidant activity of the aqueous extract of mung bean sprout (Vigna radiata L.

    Directory of Open Access Journals (Sweden)

    Vera Lúcia Arroxelas Galvão de Lima

    2004-03-01

    Full Text Available OBJETIVO: Considerando a importância dos compostos fenólicos em alimentos e que o broto de feijão-mungo vem sendo incluído na culinária brasileira, este estudo teve como objetivo quantificar o teor de fenólicos totais deste vegetal e avaliar a ação antioxidante do seu extrato aquoso. MÉTODOS: Os compostos fenólicos foram extraídos por quatro sistemas de solventes e dois métodos de extração, os quais foram diferenciados no tempo (2 e 1h e número de extrações (2 e 3 extrações. Os fenólicos totais dos extratos foram quantificados por método espectrofotométrico. RESULTADOS: Os extratos obtidos com água à temperatura ambiente (28ºC, nos dois métodos de extração, foram os que apresentaram maior quantidade de fenólicos totais, sem contudo apresentar diferença significativa entre eles. O método II, que consistiu de três extrações em 1h, pode ser considerado o melhor por ter utilizado menor tempo de extração. O extrato aquoso em sistema modelo b-caroteno/ácido linoléico exibiu ação antioxidante (48,07% de inibição da oxidação, entretanto foi inferior ao padrão BHT. CONCLUSÃO: O broto de feijão-mungo possui considerável quantidade de fenólicos totais, compostos responsáveis por sua ação antioxidante, cujo consumo pode proporcionar efeitos benéficos à saúde.OBJECTIVE: Considering the importance of phenolic compounds in foods and the increasing consumption of mung bean sprouts in Brazil, this study had the objective of quantifying the total phenolic content in this vegetable and to assess the antioxidant activity of its aqueous extract. METHODS: The phenolic compounds were extracted by four solvent systems and two extraction methods, which were different in time (2 and 1h and in number of extractions (2 and 3 extractions. The total phenolic content of the extracts were quantified by the spectrophotometric method. RESULTS: The extracts obtained with water at room temperature (28ºC in both extraction

  12. Wide Band to ''Double Band'' upgrade

    International Nuclear Information System (INIS)

    Kasper, P.; Currier, R.; Garbincius, P.; Butler, J.

    1988-06-01

    The Wide Band beam currently uses electrons obtained from secondary photon conversions to produce the photon beam incident on the experimental targets. By transporting the positrons produced in these conversions as well as the electrons it is possible to almost double the number of photons delivered to the experiments per primary beam proton. 11 figs

  13. Amniotic constriction bands

    Science.gov (United States)

    ... Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Amniotic band sequence URL of this page: //medlineplus.gov/ency/ ... birth. The baby should be delivered in a medical center that has specialists experienced in caring for babies ... or partial loss of function of a body part. Congenital bands affecting large parts of the body cause the ...

  14. Band parameters of phosphorene

    International Nuclear Information System (INIS)

    Lew Yan Voon, L C; Wang, J; Zhang, Y; Willatzen, M

    2015-01-01

    Phosphorene is a two-dimensional nanomaterial with a direct band-gap at the Brillouin zone center. In this paper, we present a recently derived effective-mass theory of the band structure in the presence of strain and electric field, based upon group theory. Band parameters for this theory are computed using a first-principles theory based upon the generalized-gradient approximation to the density-functional theory. These parameters and Hamiltonian will be useful for modeling physical properties of phosphorene. (paper)

  15. Infrared diffuse interstellar bands

    Science.gov (United States)

    Galazutdinov, G. A.; Lee, Jae-Joon; Han, Inwoo; Lee, Byeong-Cheol; Valyavin, G.; Krełowski, J.

    2017-05-01

    We present high-resolution (R ˜ 45 000) profiles of 14 diffuse interstellar bands in the ˜1.45 to ˜2.45 μm range based on spectra obtained with the Immersion Grating INfrared Spectrograph at the McDonald Observatory. The revised list of diffuse bands with accurately estimated rest wavelengths includes six new features. The diffuse band at 15 268.2 Å demonstrates a very symmetric profile shape and thus can serve as a reference for finding the 'interstellar correction' to the rest wavelength frame in the H range, which suffers from a lack of known atomic/molecular lines.

  16. Band parameters of phosphorene

    DEFF Research Database (Denmark)

    Lew Yan Voon, L. C.; Wang, J.; Zhang, Y.

    2015-01-01

    Phosphorene is a two-dimensional nanomaterial with a direct band-gap at the Brillouin zone center. In this paper, we present a recently derived effective-mass theory of the band structure in the presence of strain and electric field, based upon group theory. Band parameters for this theory...... are computed using a first-principles theory based upon the generalized-gradient approximation to the density-functional theory. These parameters and Hamiltonian will be useful for modeling physical properties of phosphorene....

  17. CSF oligoclonal banding - slideshow

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/presentations/100145.htm CSF oligoclonal banding - series—Normal anatomy To use the ... 5 out of 5 Overview The cerebrospinal fluid (CSF) serves to supply nutrients to the central nervous ...

  18. Decay of superdeformed bands

    International Nuclear Information System (INIS)

    Carpenter, M.P.; Khoo, T.L.; Lauritsen, T.

    1995-01-01

    One of the major challenges in the study of superdeformation is to directly connect the large number of superdeformed bands now known to the yrast states. In this way, excitation energies, spins and parities can be assigned to the levels in the second well which is essential to establish the collective and single-particle components of these bands. This paper will review some of the progress which has been made to understand the decay of superdeformed bands using the new arrays including the measurement of the total decay spectrum and the establishment of direct one-step decays from the superdeformed band to the yrast line in 194 Hg. 42 refs., 5 figs

  19. Laparoscopic gastric banding

    Science.gov (United States)

    ... eat by making you feel full after eating small amounts of food. After surgery, your doctor can adjust the band ... You will feel full after eating just a small amount of food. The food in the small upper pouch will ...

  20. Ultra wide band antennas

    CERN Document Server

    Begaud, Xavier

    2013-01-01

    Ultra Wide Band Technology (UWB) has reached a level of maturity that allows us to offer wireless links with either high or low data rates. These wireless links are frequently associated with a location capability for which ultimate accuracy varies with the inverse of the frequency bandwidth. Using time or frequency domain waveforms, they are currently the subject of international standards facilitating their commercial implementation. Drawing up a complete state of the art, Ultra Wide Band Antennas is aimed at students, engineers and researchers and presents a summary of internationally recog

  1. Band-notched spiral antenna

    Science.gov (United States)

    Jeon, Jae; Chang, John

    2018-03-13

    A band-notched spiral antenna having one or more spiral arms extending from a radially inner end to a radially outer end for transmitting or receiving electromagnetic radiation over a frequency range, and one or more resonance structures positioned adjacent one or more segments of the spiral arm associated with a notch frequency band or bands of the frequency range so as to resonate and suppress the transmission or reception of electromagnetic radiation over said notch frequency band or bands.

  2. The hierarchically organized splitting of chromosome bands into sub-bands analyzed by multicolor banding (MCB).

    Science.gov (United States)

    Lehrer, H; Weise, A; Michel, S; Starke, H; Mrasek, K; Heller, A; Kuechler, A; Claussen, U; Liehr, T

    2004-01-01

    To clarify the nature of chromosome sub-bands in more detail, the multicolor banding (MCB) probe-set for chromosome 5 was hybridized to normal metaphase spreads of GTG band levels at approximately 850, approximately 550, approximately 400 and approximately 300. It could be observed that as the chromosomes became shorter, more of the initial 39 MCB pseudo-colors disappeared, ending with 18 MCB pseudo-colored bands at the approximately 300-band level. The hierarchically organized splitting of bands into sub-bands was analyzed by comparing the disappearance or appearance of pseudo-color bands of the four different band levels. The regions to split first are telomere-near, centromere-near and in 5q23-->q31, followed by 5p15, 5p14, and all GTG dark bands in 5q apart from 5q12 and 5q32 and finalized by sub-band building in 5p15.2, 5q21.2-->q21.3, 5q23.1 and 5q34. The direction of band splitting towards the centromere or the telomere could be assigned to each band separately. Pseudo-colors assigned to GTG-light bands were resistant to band splitting. These observations are in concordance with the recently proposed concept of chromosome region-specific protein swelling. Copyright 2003 S. Karger AG, Basel

  3. Noise exposure in marching bands

    Science.gov (United States)

    Keefe, Joseph

    2005-09-01

    Previous studies involving orchestras have shown that music ensembles can produce hazardous noise levels. There are no similar data for marching bands and pep bands. In order to evaluate the noise levels produced by marching and pep bands, 1/3-octave-band sound-pressure levels were measured while these groups rehearsed and performed. Data were collected while marching with the bands to ensure a realistic environment. Comparing these data to OSHA and NIOSH criteria, marching and pep band exposures often exceed safe values. For typical exposures, OSHA doses range from 11% to 295%, while NIOSH doses range from 35% to 3055%. Exposures that would be considered hazardous in the workplace are common in marching and pep bands; students and band directors should take steps to recognize the risk posed by various instruments and various locations, and should implement hearing conservation efforts.

  4. Semiconductors bonds and bands

    CERN Document Server

    Ferry, David K

    2013-01-01

    As we settle into this second decade of the twenty-first century, it is evident that the advances in micro-electronics have truly revolutionized our day-to-day lifestyle. The technology is built upon semiconductors, materials in which the band gap has been engineered for special values suitable to the particular application. This book, written specifically for a one semester course for graduate students, provides a thorough understanding of the key solid state physics of semiconductors. It describes how quantum mechanics gives semiconductors unique properties that enabled the micro-electronics revolution, and sustain the ever-growing importance of this revolution.

  5. Degenerate band edge laser

    Science.gov (United States)

    Veysi, Mehdi; Othman, Mohamed A. K.; Figotin, Alexander; Capolino, Filippo

    2018-05-01

    We propose a class of lasers based on a fourth-order exceptional point of degeneracy (EPD) referred to as the degenerate band edge (DBE). EPDs have been found in parity-time-symmetric photonic structures that require loss and/or gain; here we show that the DBE is a different kind of EPD since it occurs in periodic structures that are lossless and gainless. Because of this property, a small level of gain is sufficient to induce single-frequency lasing based on a synchronous operation of four degenerate Floquet-Bloch eigenwaves. This lasing scheme constitutes a light-matter interaction mechanism that leads also to a unique scaling law of the laser threshold with the inverse of the fifth power of the laser-cavity length. The DBE laser has the lowest lasing threshold in comparison to a regular band edge laser and to a conventional laser in cavities with the same loaded quality (Q ) factor and length. In particular, even without mirror reflectors the DBE laser exhibits a lasing threshold which is an order of magnitude lower than that of a uniform cavity laser of the same length and with very high mirror reflectivity. Importantly, this novel DBE lasing regime enforces mode selectivity and coherent single-frequency operation even for pumping rates well beyond the lasing threshold, in contrast to the multifrequency nature of conventional uniform cavity lasers.

  6. Wide band ENDOR spectrometer

    International Nuclear Information System (INIS)

    Mendonca Filho, C.

    1973-01-01

    The construction of an ENDOR spectrometer operating from 0,5 to 75 MHz within a single band, with ore Klystron and homodine detection, and no fundamental changes on the electron spin resonance spectrometer was described. The ENDOR signal can be detected both by amplitude modulation of the frequency field, or direct detection of the ESR output, which is taken to a signal analyser. The signal-to-noise ratio is raised by averaging rather than filtering avoiding the use of long time constants, providing natural line widths. The experimental apparatus and the spectra obtained are described. A discussion, relating the ENDOR line amplitudes with the experimental conditions is done and ENDOR mechanism, in which there is a relevant presence of cross relaxation is proposed

  7. Electronic band structure

    International Nuclear Information System (INIS)

    Grosso, G.

    1986-01-01

    The aim of this chapter is to present, in detail, some theoretical methods used to calculate electronic band structures in crystals. The basic strategies employed to attack the problem of electronic-structure calculations are presented. Successive sections present the basic formulations of the tight-binding, orthogonalized-plane-wave, Green'sfunction, and pseudopotential methods with a discussion of their application to perfect solids. Exemplifications in the case of a few selected problems provide further insight by the author into the physical aspects of the different methods and are a guide to the use of their mathematical techniques. A discussion is offered of completely a priori Hartree-Fock calculations and attempts to extend them. Special aspects of the different methods are also discussed in light of recently published related work

  8. Report from the banding lab

    Science.gov (United States)

    Tautin, J.

    1995-01-01

    Mr. Tautin reported on the seemingly everchanging structure of biological science units within the Interior Department. Current Congressional proposals would either change the name of the Bird Banding Lab's parent agency or make it part of the Geological Survey. The current Congress has not looked favorably on science budgets within the Interior Department, and the Banding Lab's budget is being squeezed ever tighter.

  9. Dual-band infrared camera

    Science.gov (United States)

    Vogel, H.; Schlemmer, H.

    2005-10-01

    Every year, numerous accidents happen on European roads due to bad visibility (fog, night, heavy rain). Similarly, the dramatic aviation accidents of year 2001 in Milan and Zurich have reminded us that aviation safety is equally affected by reduced visibility. A dual-band thermal imager was developed in order to raise human situation awareness under conditions of reduced visibility especially in the automotive and aeronautical context but also for all transportation or surveillance tasks. The chosen wavelength bands are the Short Wave Infrared SWIR and the Long Wave Infrared LWIR band which are less obscured by reduced visibility conditions than the visible band. Furthermore, our field tests clearly show that the two different spectral bands very often contain complementary information. Pyramidal fusion is used to integrate complementary and redundant features of the multi-spectral images into a fused image which can be displayed on a monitor to provide more and better information for the driver or pilot.

  10. SINGLE-BAND, TRIPLE-BAND, OR MULTIPLE-BAND HUBBARD MODELS

    NARCIS (Netherlands)

    ESKES, H; SAWATZKY, GA

    1991-01-01

    The relevance of different models, such as the one-band t-J model and the three-band Emery model, as a realistic description of the electronic structure of high-T(c) materials is discussed. Starting from a multiband approach using cluster calculations and an impurity approach, the following

  11. Reproduction in the yellow mongoose revisited

    African Journals Online (AJOL)

    1991-03-12

    Mar 12, 1991 ... studies on known females provide clear evidence of the production of two litters annually within a period of .... suckling stimulus does not appear to result in a long-term inhibition .... Population dynamics and food habits of the.

  12. The 3 micron ice band

    International Nuclear Information System (INIS)

    Greenberg, J.M.; Bult, C.E.P.M. van de

    1984-01-01

    Ever since it was proposed that H 2 O could be a dominant constituent of interstellar grains, its detection, or lack thereof, has played a large role in theories of grains and their evolution. It now appears possible to provide a basic theoretical structure for the evolution of grains in molecular clouds based on current observational evidence and laboratory experiments on the ice band. Both band strengths and shapes can be reasonably predicted by grain models. (U.K.)

  13. Superdeformed bands in 130Ce

    International Nuclear Information System (INIS)

    Paul, E.S.; Semple, A.T.; Boston, A.J.; Joss, D.T.; Nolan, P.J.; Shepherd, S.L.

    1997-01-01

    Four superdeformed bands have been assigned to 130 Ce following a high-statistics γ-ray study using the EUROGAM II spectrometer. The strongest band exhibits two distinct backbends which, in one scenario, may be interpreted as crossings between high-j N = 6 neutron orbitals (νi 13/2 ) and low-j N = 4 orbitals (νd 3/2 ) in an unpaired system. (author)

  14. Dipole Bands in 196Hg

    International Nuclear Information System (INIS)

    Lawrie, J. J.; Lawrie, E. A.; Newman, R. T.; Sharpey-Schafer, J. F.; Smit, F. D.; Msezane, B.; Benatar, M.; Mabala, G. K.; Mutshena, K. P.; Federke, M.; Mullins, S. M.; Ncapayi, N. J.; Vymers, P.

    2011-01-01

    High spin states in 196 Hg have been populated in the 198 Pt(α,6n) reaction at 65 MeV and the level scheme has been extended. A new dipole band has been observed and a previously observed dipole has been confirmed. Excitation energies, spins and parities of these bands were determined from DCO ratio and linear polarization measurements. Possible quasiparticle excitations responsible for these structures are discussed.

  15. Single-Band and Dual-Band Infrared Detectors

    Science.gov (United States)

    Ting, David Z. (Inventor); Gunapala, Sarath D. (Inventor); Soibel, Alexander (Inventor); Nguyen, Jean (Inventor); Khoshakhlagh, Arezou (Inventor)

    2017-01-01

    Bias-switchable dual-band infrared detectors and methods of manufacturing such detectors are provided. The infrared detectors are based on a back-to-back heterojunction diode design, where the detector structure consists of, sequentially, a top contact layer, a unipolar hole barrier layer, an absorber layer, a unipolar electron barrier, a second absorber, a second unipolar hole barrier, and a bottom contact layer. In addition, by substantially reducing the width of one of the absorber layers, a single-band infrared detector can also be formed.

  16. Adhesives for fixed orthodontic bands.

    Science.gov (United States)

    Millett, Declan T; Glenny, Anne-Marie; Mattick, Rye Cr; Hickman, Joy; Mandall, Nicky A

    2016-10-25

    Orthodontic treatment involves using fixed or removable appliances (dental braces) to correct the positions of teeth. It has been shown that the quality of treatment result obtained with fixed appliances is much better than with removable appliances. Fixed appliances are, therefore, favoured by most orthodontists for treatment. The success of a fixed orthodontic appliance depends on the metal attachments (brackets and bands) being attached securely to the teeth so that they do not become loose during treatment. Brackets are usually attached to the front and side teeth, whereas bands (metal rings that go round the teeth) are more commonly used on the back teeth (molars). A number of adhesives are available to attach bands to teeth and it is important to understand which group of adhesives bond most reliably, as well as reducing or preventing dental decay during the treatment period. To evaluate the effectiveness of the adhesives used to attach bands to teeth during fixed appliance treatment, in terms of:(1) how often the bands come off during treatment; and(2) whether they protect the banded teeth against decay during fixed appliance treatment. The following electronic databases were searched: Cochrane Oral Health's Trials Register (searched 2 June 2016), Cochrane Central Register of Controlled Trials (CENTRAL; 2016, Issue 5) in the Cochrane Library (searched 2 June 2016), MEDLINE Ovid (1946 to 2 June 2016) and EMBASE Ovid (1980 to 2 June 2016). We searched ClinicalTrials.gov and the World Health Organization International Clinical Trials Registry Platform for ongoing trials. No restrictions were placed on the language or date of publication when searching the electronic databases. Randomised and controlled clinical trials (RCTs and CCTs) (including split-mouth studies) of adhesives used to attach orthodontic bands to molar teeth were selected. Patients with full arch fixed orthodontic appliance(s) who had bands attached to molars were included. All review authors

  17. 47 CFR 90.531 - Band plan.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Band plan. 90.531 Section 90.531...-805 MHz Bands § 90.531 Band plan. This section sets forth the band plan for the 763-775 MHz and 793... and portables subject to Commission-approved regional planning committee regional plans. Transmitter...

  18. Metaphyseal bands in osteogenesis imperfecta

    Directory of Open Access Journals (Sweden)

    Suresh S

    2010-01-01

    Full Text Available An increasing number of patients with osteogenesis imperfecta are undergoing pamidronate therapy to prevent the incidence of fragility fractures. The authors herein report a child aged 3 years who received five cycles of pamidronate, resulting in metaphyseal bands, known as "zebra lines."

  19. Metaphyseal bands in osteogenesis imperfecta

    International Nuclear Information System (INIS)

    Suresh, SS; Thomas, John K

    2010-01-01

    An increasing number of patients with osteogenesis imperfecta are undergoing pamidronate therapy to prevent the incidence of fragility fractures. The authors herein report a child aged 3 years who received five cycles of pamidronate, resulting in metaphyseal bands, known as “zebra lines.”

  20. Identical and shifted identical bands

    International Nuclear Information System (INIS)

    Dodder, R.S; Jones, E.F.; Hamilton, J.H.

    1997-01-01

    Spontaneous fission of 252 Cm was studied with 72 large Compton suppressed Ge detectors in Gamma sphere. New isotopes 160 Sm and 162 Gd were identified. Through X-ray-γ and γ-γ-γ) coincidence measurements, level energies were established to spins 14 + to 20 + in 152 , 154 156 60 Nd 92 94 96 , 156 , 158 , 160 62 Sm 94 , 96 , 98 , and 160 , 162 64 Gd 96 , 98 . These nuclei exhibit a remarkable variety of identical bands and bands where the energies and moments of inertia are shifted by the same constant amount for every spin state from 2 + to 12 + for various combinations of nuclei differing by 2n, 4n, 2p, 4p, and α

  1. NCenter wide band neutrino beam

    International Nuclear Information System (INIS)

    Stutte, L.G.

    1985-01-01

    This memo describes the physical properties of the currently operating N-Center wide band neutrino beam---commonly called the triplet train, following a past tradition of a triplet lens configuration. In reality, in order to gain a larger momentum acceptance and to minimize the angular divergence of the beam, a quadruplet beam (4 lenses) employing point-to-parallel optics at a central momentum of 300 GeV was built. 6 refs., 13 figs., 1 tab

  2. [Gastric band erosion: Alternative management].

    Science.gov (United States)

    Echaverry-Navarrete, Denis José; Maldonado-Vázquez, Angélica; Cortes-Romano, Pablo; Cabrera-Jardines, Ricardo; Mondragón-Pinzón, Erwin Eduardo; Castillo-González, Federico Armando

    2015-01-01

    Obesity is a public health problem, for which the prevalence has increased worldwide at an alarming rate, affecting 1.7 billion people in the world. To describe the technique employed in incomplete penetration of gastric band where endoscopic management and/or primary closure is not feasible. Laparoscopic removal of gastric band was performed in five patients with incomplete penetrance using Foley catheterization in the perforation site that could lead to the development of a gastro-cutaneous fistula. The cases presented include a leak that required surgical lavage with satisfactory outcome, and one patient developed stenosis 3 years after surgical management, which was resolved endoscopically. In all cases, the penetration site closed spontaneously. Gastric band erosion has been reported in 3.4% of cases. The reason for inserting a catheter is to create a controlled gastro-cutaneous fistula, allowing spontaneous closure. Various techniques have been described: the totally endoscopic, hybrid techniques (endoscopic/laparoscopic) and completely laparoscopic. A technique is described here that is useful and successful in cases where the above-described treatments are not viable. Copyright © 2015. Published by Masson Doyma México S.A.

  3. More on Estimation of Banded and Banded Toeplitz Covariance Matrices

    OpenAIRE

    Berntsson, Fredrik; Ohlson, Martin

    2017-01-01

    In this paper we consider two different linear covariance structures, e.g., banded and bended Toeplitz, and how to estimate them using different methods, e.g., by minimizing different norms. One way to estimate the parameters in a linear covariance structure is to use tapering, which has been shown to be the solution to a universal least squares problem. We know that tapering not always guarantee the positive definite constraints on the estimated covariance matrix and may not be a suitable me...

  4. High macro rubber band ligature

    Directory of Open Access Journals (Sweden)

    José A. Reis Neto

    2013-07-01

    Full Text Available Purpose: The goal of a rubber band ligature is to promote fibrosis of the submucosa with subsequent fixation of the anal epithelium to the underlying sphincter. Following this principle, a new technique of ligature was developed based on two aspects: 1. macro banding: to have a better fibrosis and fixation by banding a bigger volume of mucosa and 2. higher ligature: to have this fixation at the origin of the hemorrhoidal cushion displacement. Methods: 1634 patients with internal hemorrhoidal disease grade II or III were treated by the technique called high macro rubber band. There was no distinction as to age, gender or race. To perform this technique a new hemorrhoidal device was specially designed with a larger diameter and a bigger capacity for mucosal volume aspiration. It is recommended to utilize a longer and wider anoscope to obtain a better view of the anal canal, which will facilitate the injection of submucosa higher in the anal canal and the insertion of the rubber band device. The hemorrhoidal cushion must be banded higher in the anal canal (4 cm above the pectinate line. It is preferable to treat all the hemorrhoids in one single session (maximum of three areas banded. Results: The analysis was retrospective without any comparison with conventional banding. The period of evaluation extended from one to twelve years. The analysis of the results showed perianal edema in 1.6% of the patients, immediate tenesmus in 0.8%, intense pain (need for parenteral analgesia in 1.6%, urinary retention in 0.1% of the patients and a symptomatic recurrence rate of 4.2%. All patients with symptomatic recurrence were treated with a new session of macro rubber banding. None of the patients developed anal or rectal sepsis. Small post-ligature bleeding was observed only in 0.8% of the patients. Conclusions: The high macro rubber banding technique represents an alternative method for the treatment of hemorrhoidal disease grades II or III, with good

  5. Band Subset Selection for Hyperspectral Image Classification

    Directory of Open Access Journals (Sweden)

    Chunyan Yu

    2018-01-01

    Full Text Available This paper develops a new approach to band subset selection (BSS for hyperspectral image classification (HSIC which selects multiple bands simultaneously as a band subset, referred to as simultaneous multiple band selection (SMMBS, rather than one band at a time sequentially, referred to as sequential multiple band selection (SQMBS, as most traditional band selection methods do. In doing so, a criterion is particularly developed for BSS that can be used for HSIC. It is a linearly constrained minimum variance (LCMV derived from adaptive beamforming in array signal processing which can be used to model misclassification errors as the minimum variance. To avoid an exhaustive search for all possible band subsets, two numerical algorithms, referred to as sequential (SQ and successive (SC algorithms are also developed for LCMV-based SMMBS, called SQ LCMV-BSS and SC LCMV-BSS. Experimental results demonstrate that LCMV-based BSS has advantages over SQMBS.

  6. The DSS-14 C-band exciter

    Science.gov (United States)

    Rowan, D. R.

    1989-01-01

    The development and implementation of a C-band exciter for use with the Block IV Receiver-Exciter Subsystem at Deep Space Station 14 (DSS-14) has been completed. The exciter supplements the standard capabilities of the Block IV system by providing a drive signal for the C-band transmitter while generating coherent translation frequencies for C-band (5-GHz) to S-band (2.2- to 2.3-GHz) Doppler extraction, C-band to L-band (1.6-GHz) zero delay measurements, and a level calibrated L-band test signal. Exciter functions are described, and a general explanation and description of the C-band uplink controller is presented.

  7. Study of rotational band in 111Sn

    International Nuclear Information System (INIS)

    Ganguly, S.; Banerjee, P.; Ray, I.; Kshetri, R.; Raut, R.; Goswami, A.; Saha Sarkar, M.; Bhattacharya, S.; Mukherjee, A.; Mukherjee, G.; Basu, S.K.; Mukhopadhyay, S.

    2006-01-01

    The motivation of the present work is to study the negative-parity rotational band in 111 Sn. Study of the lifetimes of the states of the rotational band is expected to provide information on their structures as well as the band termination phenomenon

  8. Prenatal diagnosis of amniotic band syndrome

    Directory of Open Access Journals (Sweden)

    Laxmi Devi Padmanabhan

    2016-01-01

    Full Text Available Amniotic band can cause a broad spectrum of anomalies ranging from simple band constrictions to major craniofacial and visceral defects. It can cause significant neonatal morbidity. Accurate diagnosis will help in the management of the present pregnancy and in counseling with regard to future pregnancies. Here we report three cases of amniotic band syndrome detected in the prenatal period.

  9. Complex band structure and electronic transmission eigenchannels

    DEFF Research Database (Denmark)

    Jensen, Anders; Strange, Mikkel; Smidstrup, Soren

    2017-01-01

    and complex band structure, in this case individual eigenchannel transmissions and different complex bands. We present calculations of decay constants for the two most conductive states as determined by complex band structure and standard DFT Landauer transport calculations for one semi-conductor and two...

  10. High-energy band structure of gold

    DEFF Research Database (Denmark)

    Christensen, N. Egede

    1976-01-01

    The band structure of gold for energies far above the Fermi level has been calculated using the relativistic augmented-plane-wave method. The calculated f-band edge (Γ6-) lies 15.6 eV above the Fermi level is agreement with recent photoemission work. The band model is applied to interpret...

  11. Multi-band Modelling of Appearance

    DEFF Research Database (Denmark)

    Stegmann, Mikkel Bille; Larsen, Rasmus

    2003-01-01

    the appearance of both derived feature bands and an intensity band. As a special case of feature-band augmented appearance modelling we propose a dedicated representation with applications to face segmentation. The representation addresses a major problem within face recognition by lowering the sensitivity...

  12. Multi-band Modelling of Appearance

    DEFF Research Database (Denmark)

    Stegmann, Mikkel Bille; Larsen, Rasmus

    2002-01-01

    the appearance of both derived feature bands and an intensity band. As a special case of feature-band augmented appearance modelling we propose a dedicated representation with applications to face segmentation. The representation addresses a major problem within face recognition by lowering the sensitivity...

  13. L-band brightness temperature disaggregation for use with S-band and C-band radiometer data for WCOM

    Science.gov (United States)

    Yao, P.; Shi, J.; Zhao, T.; Cosh, M. H.; Bindlish, R.

    2017-12-01

    There are two passive microwave sensors onboard the Water Cycle Observation Mission (WCOM), which includes a synthetic aperture radiometer operating at L-S-C bands and a scanning microwave radiometer operating from C- to W-bands. It provides a unique opportunity to disaggregate L-band brightness temperature (soil moisture) with S-band C-bands radiometer data. In this study, passive-only downscaling methodologies are developed and evaluated. Based on the radiative transfer modeling, it was found that the TBs (brightness temperature) between the L-band and S-band exhibit a linear relationship, and there is an exponential relationship between L-band and C-band. We carried out the downscaling results by two methods: (1) downscaling with L-S-C band passive measurements with the same incidence angle from payload IMI; (2) downscaling with L-C band passive measurements with different incidence angle from payloads IMI and PMI. The downscaling method with L-S bands with the same incident angle was first evaluated using SMEX02 data. The RMSE are 2.69 K and 1.52 K for H and V polarization respectively. The downscaling method with L-C bands is developed with different incident angles using SMEX03 data. The RMSE are 2.97 K and 2.68 K for H and V polarization respectively. These results showed that high-resolution L-band brightness temperature and soil moisture products could be generated from the future WCOM passive-only observations.

  14. Thematic mapper studies band correlation analysis

    Science.gov (United States)

    Ungar, S. G.; Kiang, R.

    1976-01-01

    Spectral data representative of thematic mapper candidate bands 1 and 3 to 7 were obtained by selecting appropriate combinations of bands from the JSC 24 channel multispectral scanner. Of all the bands assigned, only candidate bands 4 (.74 mu to .80 mu) and 5 (.80 mu to .91 mu) showed consistently high intercorrelation from region to region and time to time. This extremely high correlation persisted when looking at the composite data set in a multitemporal, multilocation domain. The GISS investigations lend positive confirmation to the hypothesis, that TM bands 4 and 5 are redundant.

  15. Dust bands in the asteroid belt

    International Nuclear Information System (INIS)

    Sykes, M.V.; Greenberg, R.; Dermott, S.F.; Nicholson, P.D.; Burns, J.A.

    1989-01-01

    This paper describes the original IRAS observations leading to the discovery of the three dust bands in the asteroid belt and the analysis of data. Special attention is given to an analytical model of the dust band torus and to theories concerning the origin of the dust bands, with special attention given to the collisional equilibrium (asteroid family), the nonequilibrium (random collision), and the comet hypotheses of dust-band origin. It is noted that neither the equilibrium nor nonequilibrium models, as currently formulated, present a complete picture of the IRAS dust-band observations. 32 refs

  16. Table of members of quasi-bands

    International Nuclear Information System (INIS)

    Sakai, Mitsuo.

    1984-04-01

    The probable members of the quasi-bands in even-even nuclei for Z between 6 and 100 are listed in this table. The terms quasi-bands have been introduced in the so-called spherical regions as the counter parts of the collective bands in the deformed regions. In the present compilation, the data for deformed nuclei are classified for convenience under the same titles, Quasi-Ground Band, Quasi-Beta Band and Quasi-Gamma Band, as are used for other nuclear regions. The present edition covers the literature through September, 1983. Fifteen newly discovered nuclides are included. The classification of energy level into quasi-bands is made on the basis of the systematic trend in the data over large groups of nuclei. (Kato, T.)

  17. A Novel Ku-Band/Ka-Band and Ka-Band/E-Band Multimode Waveguide Couplers for Power Measurement of Traveling-Wave Tube Amplifier Harmonic Frequencies

    Science.gov (United States)

    Wintucky, Edwin G.; Simons, Rainee N.

    2015-01-01

    This paper presents the design, fabrication and test results for a novel waveguide multimode directional coupler (MDC). The coupler, fabricated from two dissimilar frequency band waveguides, is capable of isolating power at the second harmonic frequency from the fundamental power at the output port of a traveling-wave tube (TWT) amplifier. Test results from proof-of-concept demonstrations are presented for a Ku-band/Ka-band MDC and a Ka-band/E-band MDC. In addition to power measurements at harmonic frequencies, a potential application of the MDC is in the design of a satellite borne beacon source for atmospheric propagation studies at millimeter-wave (mm-wave) frequencies (Ka-band and E-band).

  18. Dual-band frequency selective surface with large band separation and stable performance

    Science.gov (United States)

    Zhou, Hang; Qu, Shao-Bo; Peng, Wei-Dong; Lin, Bao-Qin; Wang, Jia-Fu; Ma, Hua; Zhang, Jie-Qiu; Bai, Peng; Wang, Xu-Hua; Xu, Zhuo

    2012-05-01

    A new technique of designing a dual-band frequency selective surface with large band separation is presented. This technique is based on a delicately designed topology of L- and Ku-band microwave filters. The two band-pass responses are generated by a capacitively-loaded square-loop frequency selective surface and an aperture-coupled frequency selective surface, respectively. A Faraday cage is located between the two frequency selective surface structures to eliminate undesired couplings. Based on this technique, a dual-band frequency selective surface with large band separation is designed, which possesses large band separation, high selectivity, and stable performance under various incident angles and different polarizations.

  19. Photonic band gap structure simulator

    Science.gov (United States)

    Chen, Chiping; Shapiro, Michael A.; Smirnova, Evgenya I.; Temkin, Richard J.; Sirigiri, Jagadishwar R.

    2006-10-03

    A system and method for designing photonic band gap structures. The system and method provide a user with the capability to produce a model of a two-dimensional array of conductors corresponding to a unit cell. The model involves a linear equation. Boundary conditions representative of conditions at the boundary of the unit cell are applied to a solution of the Helmholtz equation defined for the unit cell. The linear equation can be approximated by a Hermitian matrix. An eigenvalue of the Helmholtz equation is calculated. One computation approach involves calculating finite differences. The model can include a symmetry element, such as a center of inversion, a rotation axis, and a mirror plane. A graphical user interface is provided for the user's convenience. A display is provided to display to a user the calculated eigenvalue, corresponding to a photonic energy level in the Brilloin zone of the unit cell.

  20. Broad-band beam buncher

    International Nuclear Information System (INIS)

    Goldberg, D.A.; Flood, W.S.; Arthur, A.A.; Voelker, F.

    1986-01-01

    This patent describes a broad-band beam buncher. This beam buncher consists of: a housing adapted to be eacuated, an electron gun in the housing for producing a beam of electrons, buncher means in the housing forming a buncher cavity which has an entrance opening for receiving the electron beam and an exit opening through which the electron beam passes out of the buncher cavity, a drift tube electrode in the buncher cavity and disposed between the entrance opening and the exit opening with first and second gaps between the drift tube electrode and the entrance and exit openings, the drift tube electrode which has a first drift space through which the electron beam passes in traveling between the entrance and exit openings, modulating means for supplying an ultrahigh frequeny modulating signal to the drift tube electrode for producing velocity modulation of the electrons in the electron beam as the electrons pass through the buncher cavity and the drift tube electrode between the entrance opening and the exit opening, drift space means in the housing forming a second drift space for receiving the velocity modulated electron beam from the exit opening, the velocity modulated electron beam being bunched as it passes along the second drift space, the drift space means has a discharge opening through which the electron beam is discharged from the second drift space after being bunched therein, the modulating means containing a signal source for producing an ultrahigh frequency signal, a transmission line connected between the signal source and the drift tube electrode, and terminating means connected to the drift tube electrode for terminating the transmission line in approximately its characteristic impedance to afford a broad response band with minimum 6 variations therein

  1. Band 3 in aging and neurological disease.

    Science.gov (United States)

    Kay, M M

    1991-01-01

    Senescent cell antigen appears on old cells and marks them for death by initiating the binding of IgG autoantibody and subsequent removal by phagocytes in mammals and other vertebrates. We have created a synthetic aging antigen that blocks binding of IgG to senescent cells in vitro. Synthetic senescent cell antigen might be effective in preventing cellular destruction in vivo in certain diseases, and can be used to manipulate cellular life span in situ. Senescent cell antigen is generated by the modification of an important structural and transport membrane molecule, protein band 3. Band 3 is present in cellular, nuclear, Golgi, and mitochondrial membranes as well as in cell membranes. Band 3 proteins in nucleated cells participate in cell surface patching and capping. Band 3 maintains acid-base balance by mediating the exchange of anions (e.g., chloride, bicarbonate), and is the binding site for glycolytic enzymes. It is responsible for CO2 exchange in all tissues and organs. Thus, it is the most heavily used anion transport system in the body. Band 3 is a major transmembrane structural protein which attaches the plasma membrane to the internal cell cytoskeleton by binding to band 2.1 (ankyrin). Oxidation generates senescent cell antigen in situ. Band 3 is present in the central nervous system, and differences have been described in band 3 between young and aging brain tissue. One autosomal recessive neurological disease, choreoacanthocytosis, is associated with band 3 abnormalities. The 150 residues of the carboxyl terminus segment of band 3 appear to be altered. In brains from Alzheimer's disease patients, antibodies to aged band 3 label the amyloid core of classical plaques and the microglial cells located in the middle of the plaque in tissue sections, and an abnormal band 3 in immunoblots. Band 3 protein(s) in mammalian brain performs the same functions as that of erythroid band 3. These functions is anion transport, ankyrin binding, and generation of

  2. The dynamics of a shear band

    Science.gov (United States)

    Giarola, Diana; Capuani, Domenico; Bigoni, Davide

    2018-03-01

    A shear band of finite length, formed inside a ductile material at a certain stage of a continued homogeneous strain, provides a dynamic perturbation to an incident wave field, which strongly influences the dynamics of the material and affects its path to failure. The investigation of this perturbation is presented for a ductile metal, with reference to the incremental mechanics of a material obeying the J2-deformation theory of plasticity (a special form of prestressed, elastic, anisotropic, and incompressible solid). The treatment originates from the derivation of integral representations relating the incremental mechanical fields at every point of the medium to the incremental displacement jump across the shear band faces, generated by an impinging wave. The boundary integral equations (under the plane strain assumption) are numerically approached through a collocation technique, which keeps into account the singularity at the shear band tips and permits the analysis of an incident wave impinging a shear band. It is shown that the presence of the shear band induces a resonance, visible in the incremental displacement field and in the stress intensity factor at the shear band tips, which promotes shear band growth. Moreover, the waves scattered by the shear band are shown to generate a fine texture of vibrations, parallel to the shear band line and propagating at a long distance from it, but leaving a sort of conical shadow zone, which emanates from the tips of the shear band.

  3. Intruder bands in Z = 51 nuclei

    International Nuclear Information System (INIS)

    LaFosse, D.R.

    1993-01-01

    Recent investigations of h 11/2 proton intruder bands in odd 51 Sb nuclei are reported. In addition to experiments performed at SUNY Stony Brook and Chalk River, data from Early Implementation of GAMMASPHERE (analysis in progress) are presented. In particular, the nuclei 109 Sb and 111 Sb are discussed. Rotational bands based on the πh 11/2 orbital coupled to a 2p2h deformed state of the 50 Sn core have been observed. These bands have been observed to high spin, and in the case of 109 Sb to a rotational frequency of 1.4 MeV, the highest frequency observed in a heavy nucleus. The dynamic moments of inertia in these bands decrease slowly with frequency, suggesting a gradual band termination. The systematics of such bands in 109-119 Sb will be discussed

  4. Amniotic band syndrome: A clinical brief

    Directory of Open Access Journals (Sweden)

    Dasaradha Ramireddy Malireddy

    2017-01-01

    Full Text Available Amniotic band syndrome (ABS results from bands of amnion entangling fetal parts. They may manifest as constriction rings or complex congenital anomalies resulting in stillbirth. Karyotyping is important for exclusion of inherited disorders and proper counseling. Two case reports one stillbirth and the other with constriction ring of fingers and mild hydronephrosis are presented. The aim of this paper is to make awareness and stress the need for doing thorough work-up in all cases of constriction bands.

  5. Fade Mitigation Techniques at Ka-Band

    Science.gov (United States)

    Dissanayake, Asoka (Editor)

    1996-01-01

    Rain fading is the dominant propagation impairment affecting Ka-band satellite links and rain fade mitigation is a key element in the design of Ka-band satellite networks. Some of the common fade mitigation techniques include: power control, diversity, adaptive coding, and resource sharing. The Advanced Communications Technology Satellite (ACTS) provides an excellent opportunity to develop and test Ka-band rain impairment amelioration techniques. Up-link power control and diversity are discussed in this paper.

  6. Computational Design of Flat-Band Material

    Science.gov (United States)

    Hase, I.; Yanagisawa, T.; Kawashima, K.

    2018-02-01

    Quantum mechanics states that hopping integral between local orbitals makes the energy band dispersive. However, in some special cases, there are bands with no dispersion due to quantum interference. These bands are called as flat band. Many models having flat band have been proposed, and many interesting physical properties are predicted. However, no real compound having flat band has been found yet despite the 25 years of vigorous researches. We have found that some pyrochlore oxides have quasi-flat band just below the Fermi level by first principles calculation. Moreover, their valence bands are well described by a tight-binding model of pyrochlore lattice with isotropic nearest neighbor hopping integral. This model belongs to a class of Mielke model, whose ground state is known to be ferromagnetic with appropriate carrier doping and on-site repulsive Coulomb interaction. We have also performed a spin-polarized band calculation for the hole-doped system from first principles and found that the ground state is ferromagnetic for some doping region. Interestingly, these compounds do not include magnetic element, such as transition metal and rare-earth elements.

  7. Reward banding to determine reporting rate of recovered mourning dove bands

    Science.gov (United States)

    Tomlinson, R.E.

    1968-01-01

    Reward bands placed on the other leg of certain regularly banded immature mourning doves (Zenaidura macroura) were used to develop information on reporting rates of recovered dove bands. Reports from 15 widely separated sections of the United States showed considerable variation in recovery rate of doves both with and without reward bands. The overall percentages of banded doves that were reported as recovered were 9.69% for those with reward bands and 3.83% for controls. The bandreporting rate for states influenced by publicity was 66%; that for states not influenced was 32%.

  8. Solid State KA-Band, Solid State W-Band and TWT Amplifiers, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Phase I of the proposal describes plans to develop a state of the art transmitter for the W-Band and KA -Band Cloud Radar system. Our focus will be concentrated in...

  9. Multiple band structure in 156Er

    International Nuclear Information System (INIS)

    Sunyar, A.W.; Der Mateosian, E.; Kistner, O.C.; Johnson, A.; Lumpkin, A.H.; Thieberger, P.

    1976-01-01

    The 142 Nd( 18 O,4n) 156 Er reaction at 90-95 MeV was used to study 156 Er high-spin states to spin 24. In addition to the background ground-state band, two well developed off-spin side bands, one of each parity, were observed. (Auth.)

  10. 47 CFR 90.1213 - Band plan.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Band plan. 90.1213 Section 90.1213 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES PRIVATE LAND... § 90.1213 Band plan. The following channel center frequencies are permitted to be aggregated for...

  11. Signature effects in 2-qp rotational bands

    International Nuclear Information System (INIS)

    Jain, A.K.; Goel, A.

    1992-01-01

    The authors briefly review the progress in understanding the 2-qp rotational bands in odd-odd nuclei. Signature effects and the phenomenon of signature inversion are discussed. The Coriolis coupling appears to have all the ingredients to explain the inversion. Some recent work on signature dependence in 2-qp bands of even-even nuclei is also discussed; interesting features are pointed out

  12. Does the chromatic Mach bands effect exist?

    Science.gov (United States)

    Tsofe, Avital; Spitzer, Hedva; Einav, Shmuel

    2009-06-30

    The achromatic Mach bands effect is a well-known visual illusion, discovered over a hundred years ago. This effect has been investigated thoroughly, mainly for its brightness aspect. The existence of Chromatic Mach bands, however, has been disputed. In recent years it has been reported that Chromatic Mach bands are not perceived under controlled iso-luminance conditions. However, here we show that a variety of Chromatic Mach bands, consisting of chromatic and achromatic regions, separated by a saturation ramp, can be clearly perceived under iso-luminance and iso-brightness conditions. In this study, observers' eye movements were recorded under iso-brightness conditions. Several observers were tested for their ability to perceive the Chromatic Mach bands effect and its magnitude, across different cardinal and non-cardinal Chromatic Mach bands stimuli. A computational model of color adaptation, which predicted color induction and color constancy, successfully predicts this variation of Chromatic Mach bands. This has been tested by measuring the distance of the data points from the "achromatic point" and by calculating the shift of the data points from predicted complementary lines. The results suggest that the Chromatic Mach bands effect is a specific chromatic induction effect.

  13. Low band gap polymers for organic photovoltaics

    DEFF Research Database (Denmark)

    Bundgaard, Eva; Krebs, Frederik C

    2007-01-01

    Low band gap polymer materials and their application in organic photovoltaics (OPV) are reviewed. We detail the synthetic approaches to low band gap polymer materials starting from the early methodologies employing quinoid homopolymer structures to the current state of the art that relies...

  14. Band mixing in /sup 160/Dy

    Energy Technology Data Exchange (ETDEWEB)

    Hasiza, M L; Singh, K; Sahota, H S [Punjabi Univ., Patiala (India). Dept. of Physics

    1982-11-01

    The intensities of the gamma transitions in /sup 160/Dy have been measured precisely by a 45 cc Ge(Li) detector. Unequal quadrupole moments for the ground and gamma vibrational bands have been proposed in order to remove the inconsistencies in the values of band mixing parameter Z sub(gamma) for this doubly even deformed nucleus of /sup 160/Dy.

  15. Convex Banding of the Covariance Matrix.

    Science.gov (United States)

    Bien, Jacob; Bunea, Florentina; Xiao, Luo

    2016-01-01

    We introduce a new sparse estimator of the covariance matrix for high-dimensional models in which the variables have a known ordering. Our estimator, which is the solution to a convex optimization problem, is equivalently expressed as an estimator which tapers the sample covariance matrix by a Toeplitz, sparsely-banded, data-adaptive matrix. As a result of this adaptivity, the convex banding estimator enjoys theoretical optimality properties not attained by previous banding or tapered estimators. In particular, our convex banding estimator is minimax rate adaptive in Frobenius and operator norms, up to log factors, over commonly-studied classes of covariance matrices, and over more general classes. Furthermore, it correctly recovers the bandwidth when the true covariance is exactly banded. Our convex formulation admits a simple and efficient algorithm. Empirical studies demonstrate its practical effectiveness and illustrate that our exactly-banded estimator works well even when the true covariance matrix is only close to a banded matrix, confirming our theoretical results. Our method compares favorably with all existing methods, in terms of accuracy and speed. We illustrate the practical merits of the convex banding estimator by showing that it can be used to improve the performance of discriminant analysis for classifying sound recordings.

  16. Atomic-Monolayer MoS2 Band-to-Band Tunneling Field-Effect Transistor

    KAUST Repository

    Lan, Yann Wen

    2016-09-05

    The experimental observation of band-to-band tunneling in novel tunneling field-effect transistors utilizing a monolayer of MoS2 as the conducting channel is demonstrated. Our results indicate that the strong gate-coupling efficiency enabled by two-dimensional materials, such as monolayer MoS2, results in the direct manifestation of a band-to-band tunneling current and an ambipolar transport.

  17. Energy correlations for mixed rotational bands

    International Nuclear Information System (INIS)

    Doessing, T.

    1985-01-01

    A schematic model for the mixing of rotational bands above the yrast line in well deformed nuclei is considered. Many-particle configurations of a rotating mean field form basis bands, and these are subsequently mixed due to a two body residual interaction. The energy interval over which a basis band is spread out increases with increasing excitation energy above the yrast line. Conversely, the B(E2) matrix element for rotational decay out of one of the mixed band states is spread over an interval which is predicted to become more narrow with increasing excitation energy. Finally, the implication of band mixing for γ-ray energy correlations is briefly discussed. (orig.)

  18. Fluctuation diamagnetism in two-band superconductors

    Science.gov (United States)

    Adachi, Kyosuke; Ikeda, Ryusuke

    2016-04-01

    Anomalously large fluctuation diamagnetism around the superconducting critical temperature has been recently observed in iron selenide (FeSe) [Kasahara et al. (unpublished)]. This indicates that superconducting fluctuations (SCFs) play a more significant role in FeSe, which supposedly has a two-band structure, than in the familiar single-band superconductors. Motivated by the data on FeSe, SCF-induced diamagnetism is examined in a two-band system, on the basis of a phenomenological approach with a Ginzburg-Landau functional. The obtained results indicate that the SCF-induced diamagnetism may be more enhanced than that in a single-band system due to the existence of two distinct fluctuation modes. Such enhancement of diamagnetism unique to a two-band system seems consistent with the large diamagnetism observed in FeSe, though still far from a quantitative agreement.

  19. Design of a side-band-separating heterodyne mixer for band 9 of ALMA

    NARCIS (Netherlands)

    Baryshev, AM; Kooi, J; Mena, FR; Lodewijk, CRJ; Wild, W

    2005-01-01

    A side-band-separating (SBS) heterodyne mixer has been designed for the Atacama Large Millimeter Array (ALMA) 602-720 GHz band, as it will present a great improvement over the current double-side-band configuration under development at the moment. Here we present design details and the results of

  20. Absorption band Q model for the earth

    International Nuclear Information System (INIS)

    Anderson, D.L.; Given, J.W.

    1982-01-01

    Body wave, surface wave, and normal mode data are used to place constraints on the frequency dependence of Q in the mantle. With a simple absorption band model it is possible to satisfy the shear sensitive data over a broad frequency range. The quality factor Q/sub s/(ω) is proportional to ω/sup α/ in the band and to ω and ω -1 at higher and lower frequencies, respectively, as appropriate for a relaxation mechanism with a spectrum of relaxation time. The parameters of the band are Q(min) = 80, α = 0.15, and width, 5 decades. The center of the band varies from 10 1 seconds in the upper mantle, to 1.6 x 10 3 seconds in the lower mantle. The shift of the band with depth is consistent with the expected effects of temperature, pressure and stress. High Q, regions of the mantle are attributed to a shift of the absorption band to longer periods. To satisfy the gravest fundamental spheroidal modes and the ScS data, the absorption band must shift back into the short-period seismic band at the base of the mantle. This may be due to a high temperature gradient or high shear stresses. A preliminary attempt is also made to specify bulk dissipation in the mantle and core. Specific features of the absorption band model are low Q in the body wave band at both the top and the base of the mantle, low Q for long-period body waves in the outer core, an inner core Q 2 that increases with period, and low Q/sub p//Q/sub s/ at short periods in the middle mantel. The short-period Q/sub s/ increases rapidly at 400 km and is relatively constant from this depth to 2400 km. The deformational Q of the earth at a period of 14 months is predicted to be 463

  1. Band-type microelectrodes for amperometric immunoassays

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ga-Yeon; Chang, Young Wook; Ko, Hyuk [Department of Materials Science and Engineering, Yonsei University, 134 Shinchon-dong, Seodaemun-gu, Seoul, 120-749 (Korea, Republic of); Kang, Min-Jung [Korea Institute of Science and Technology (KIST), Seoul (Korea, Republic of); Pyun, Jae-Chul, E-mail: jcpyun@yonsei.ac.kr [Department of Materials Science and Engineering, Yonsei University, 134 Shinchon-dong, Seodaemun-gu, Seoul, 120-749 (Korea, Republic of)

    2016-07-20

    A band-type microelectrode was made using a parylene-N film as a passivation layer. A circular-type, mm-scale electrode with the same diameter as the band-type microelectrode was also made with an electrode area that was 5000 times larger than the band-type microelectrode. By comparing the amperometric signals of 3,5,3′,5′-tetramethylbenzidine (TMB) samples at different optical density (OD) values, the band-type microelectrode was determined to be 9 times more sensitive than the circular-type electrode. The properties of the circular-type and the band-type electrodes (e.g., the shape of their cyclic voltammograms, the type of diffusion layer used, and the diffusion layer thickness per unit electrode area) were characterized according to their electrode area using the COMSOL Multiphysics software. From these simulations, the band-type electrode was estimated to have the conventional microelectrode properties, even when the electrode area was 100 times larger than a conventional circular-type electrode. These results show that both the geometry and the area of an electrode can influence the properties of the electrode. Finally, amperometric analysis based on a band-type electrode was applied to commercial ELISA kits to analyze human hepatitis B surface antigen (hHBsAg) and human immunodeficiency virus (HIV) antibodies. - Highlights: • A band-type microelectrode was made using a parylene-N film as a passivation layer. • The band-type microelectrode was 14-times more sensitive than circular-type electrode. • The influence of geometry on microelectrode properties was simulated using COMSOL. • The band-type electrode was applied to ELISA kits for hHBsAg and hHIV-antibodies.

  2. Two-band superconductor magnesium diboride

    International Nuclear Information System (INIS)

    Xi, X X

    2008-01-01

    This review focuses on the most important features of the 40 K superconductor MgB 2 -the weakly interacting multiple bands (the σ and π bands) and the distinct multiple superconducting energy gaps (the σ and π gaps). Even though the pairing mechanism of superconductor MgB 2 is the conventional electron-phonon coupling, the prominent influence of the two bands and two gaps on its properties sets it apart from other superconductors. It leads to markedly different behaviors in upper critical field, vortex structure, magnetoresistance and many other superconducting and normal-state properties in MgB 2 from single-band superconductors. Further, it gives rise to new physics that does not exist in single-band superconductors, such as the internal Josephson effects between the two order parameters. These unique phenomena depend sensitively on scattering inside and between the two bands, and the intraband and interband scattering can be modified by chemical substitution and irradiation. MgB 2 has brought unprecedented attention to two-band superconductivity, which has been found to exist in other old and new superconductors. The legacy of MgB 2 will be long lasting because of this, as well as the lessons it teaches in terms of the search for new phonon-mediated higher T c superconductors

  3. Dual-band frequency selective surface with large band separation and stable performance

    International Nuclear Information System (INIS)

    Zhou Hang; Qu Shao-Bo; Lin Bao-Qin; Wang Jia-Fu; Ma Hua; Zhang Jie-Qiu; Peng Wei-Dong; Bai Peng; Wang Xu-Hua; Xu Zhuo

    2012-01-01

    A new technique of designing a dual-band frequency selective surface with large band separation is presented. This technique is based on a delicately designed topology of L- and Ku-band microwave filters. The two band-pass responses are generated by a capacitively-loaded square-loop frequency selective surface and an aperture-coupled frequency selective surface, respectively. A Faraday cage is located between the two frequency selective surface structures to eliminate undesired couplings. Based on this technique, a dual-band frequency selective surface with large band separation is designed, which possesses large band separation, high selectivity, and stable performance under various incident angles and different polarizations. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  4. Asymmetric acoustic transmission in multiple frequency bands

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Hong-xiang, E-mail: jsdxshx@ujs.edu.cn [Research Center of Fluid Machinery Engineering and Technology, Jiangsu University, Zhenjiang 212013 (China); Laboratory of Modern Acoustics, Institute of Acoustics, Collaborative Innovation Center of Advanced Microstructures, Nanjing University, Nanjing 210093 (China); State Key Laboratory of Acoustics, Institute of Acoustics, Chinese Academy of Sciences, Beijing 100190 (China); Yuan, Shou-qi, E-mail: Shouqiy@ujs.edu.cn [Research Center of Fluid Machinery Engineering and Technology, Jiangsu University, Zhenjiang 212013 (China); Zhang, Shu-yi [Laboratory of Modern Acoustics, Institute of Acoustics, Collaborative Innovation Center of Advanced Microstructures, Nanjing University, Nanjing 210093 (China)

    2015-11-23

    We report both experimentally and numerically that the multi-band device of the asymmetric acoustic transmission is realized by placing two periodic gratings with different periods on both sides of two brass plates immersed in water. The asymmetric acoustic transmission can exist in four frequency bands below 1500 kHz, which arises from the interaction between various diffractions from the two gratings and Lamb modes in the brass plates immersed in water. The results indicate that the device has the advantages of multiple band, broader bandwidth, and simpler structure. Our finding should have great potential applications in ultrasonic devices.

  5. Asymmetric acoustic transmission in multiple frequency bands

    International Nuclear Information System (INIS)

    Sun, Hong-xiang; Yuan, Shou-qi; Zhang, Shu-yi

    2015-01-01

    We report both experimentally and numerically that the multi-band device of the asymmetric acoustic transmission is realized by placing two periodic gratings with different periods on both sides of two brass plates immersed in water. The asymmetric acoustic transmission can exist in four frequency bands below 1500 kHz, which arises from the interaction between various diffractions from the two gratings and Lamb modes in the brass plates immersed in water. The results indicate that the device has the advantages of multiple band, broader bandwidth, and simpler structure. Our finding should have great potential applications in ultrasonic devices

  6. Observation of dipole bands in 144Sm

    International Nuclear Information System (INIS)

    Raut, R.; Ganguly, S.; Kshetri, R.; Banerjee, P.; Bhattacharya, S.; Dasmahapatra, B.; Mukherjee, A.; Sahasarkar, M.; Goswami, A.; Basu, S.K.; Bhattacharjee, T.; Mukherjee, G.; Chakraborty, A.; Ghughre, S.S.; Krishichayan; Mukhopadhyay, S.; Gangopadhyay, G.; Singh, A.K.

    2007-01-01

    The nucleus 144 Sm (Z=62, N=82), with its proximity to the shell closure and possibilities of particles and holes occupying high j orbitals, following appropriate excitations, is a suitable system for observation of dipole (MR) bands

  7. Silicone rubber band for laparoscopic tubal sterilization.

    Science.gov (United States)

    Ansari, A H; Sealey, R M; Gay, J W; Kang, I

    1977-12-01

    In 1974, Yoon and associates (Am J Obstet Gynecol 120:132, 1974) described a new approach in which laparoscopic tubal occlusion was accomplished by utilizing the silicone rubber band technique. Recognizing the great advantages of the new technique in eliminating potential thermal injury associated with electrocoagulation, the authors have utilized the Yoon silicone rubber band technique in these institutions over the past 20 months. Thus far the procedure has been performed in 304 patients without any major complications. In the hope of eliminating and/or reducing possible pregnancy-failure rates, in 110 cases. In addition to application of the silicone band, the tube within the band was transected with non-electrical Seigler biopsy forceps. This, we believe, should provide an interesting long-term comparative study.

  8. Microbial processes in banded iron formation deposition

    DEFF Research Database (Denmark)

    Posth, Nicole; Konhauser, Kurt; Kappler, Andreas

    2013-01-01

    , remains unresolved. Evidence of an anoxic Earth with only localized oxic areas until the Great Oxidation Event ca 2·45 to 2·32 Ga makes the investigation of O2-independent mechanisms for banded iron formation deposition relevant. Recent studies have explored the long-standing proposition that Archean......Banded iron formations have been studied for decades, particularly regarding their potential as archives of the Precambrian environment. In spite of this effort, the mechanism of their deposition and, specifically, the role that microbes played in the precipitation of banded iron formation minerals...... banded iron formations may have been formed, and diagenetically modified, by anaerobic microbial metabolisms. These efforts encompass a wide array of approaches including isotope, ecophysiological and phylogeny studies, molecular and mineral marker analysis, and sedimentological reconstructions. Herein...

  9. Simulating Precambrian banded iron formation diagenesis

    DEFF Research Database (Denmark)

    Posth, Nicole R.; K??hler, Inga; D. Swanner, Elizabeth

    2013-01-01

    Post-depositional diagenetic alteration makes the accurate interpretation of key precipitation processes in ancient sediments, such as Precambrian banded iron formations (BIFs), difficult. While microorganisms are proposed as key contributors to BIF deposition, the diagenetic transformation...

  10. The Novel Microwave Stop-Band Filter

    Directory of Open Access Journals (Sweden)

    R. E. Chernobrovkin

    2008-01-01

    Full Text Available The stop-band filter with the new band-rejection element is proposed. The element is a coaxial waveguide with the slot in the centre conductor. In the frame of this research, the numerical and experimental investigations of the amplitude-frequency characteristics of the filter are carried out. It is noted that according to the slot parameters the two typical resonances (half-wave and quarter-wave can be excited. The rejection band of the single element is defined by the width, depth, and dielectric filling of the slot. Fifth-order Chebyshev filter utilizing the aforementioned element is also synthesized, manufactured, and tested. The measured and simulated results are in good agreement. The experimental filter prototype exhibits the rejection band 0.86 GHz at the level −40 dB.

  11. Experimental study on the adiabatic shear bands

    International Nuclear Information System (INIS)

    Affouard, J.

    1984-07-01

    Four martensitic steels (Z50CDV5 steel, 28CND8 steel, 35NCDV16 steel and 4340 steel) with different hardness between 190 and 600 Hsub(B) (Brinell hardness), have been studied by means of dynamic compressive tests on split Hopkinson pressure bar. Microscopic observations show that the fracture are associated to the development of adiabatic shear bands (except 4340 steel with 190 Hsub(B) hardness). By means of tests for which the deformation is stopped at predetermined levels, the measurement of shear and hardness inside the band and the matrix indicates the chronology of this phenomenon: first the localization of shear, followed by the formation of adiabatic shear band and ultimatly crack initiation and propagation. These results correlated with few simulations by finite elements have permitted to suggest two mecanisms of deformation leading to the formation of adiabatic shear bands in this specific test [fr

  12. The cellular approach to band structure calculations

    International Nuclear Information System (INIS)

    Verwoerd, W.S.

    1982-01-01

    A short introduction to the cellular approach in band structure calculations is given. The linear cellular approach and its potantial applicability in surface structure calculations is given some consideration in particular

  13. Full L-S Band Telemetry System

    National Research Council Canada - National Science Library

    Jensen, Michael

    2001-01-01

    Recent changes in spectrum availability as well as higher demands for spectrum have motivated the development of telemetry transmit systems capable of fully operating over both L and S telemetry bands...

  14. Full L-S Band Telemetry System

    National Research Council Canada - National Science Library

    Jensen, Michael

    2003-01-01

    Recent changes in spectrum availability as well as higher demands for spectrum have motivated the development of telemetry transmit systems capable of fully operating over both L and S telemetry bands...

  15. Full L-S Band Telemetry System

    National Research Council Canada - National Science Library

    Jensen, Michael

    2002-01-01

    Recent changes in spectrum availability as well as higher demands for spectrum have motivated the development of telemetry transmit systems capable of fully operating over both L and S telemetry bands...

  16. Deployable Ka-Band Reflectarray, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Tyvak, in collaboration with UCLA, proposes a novel approach to the challenge of creating a large reflector for Ka-band high data rate links. We propose to attach...

  17. Confidence bands for inverse regression models

    International Nuclear Information System (INIS)

    Birke, Melanie; Bissantz, Nicolai; Holzmann, Hajo

    2010-01-01

    We construct uniform confidence bands for the regression function in inverse, homoscedastic regression models with convolution-type operators. Here, the convolution is between two non-periodic functions on the whole real line rather than between two periodic functions on a compact interval, since the former situation arguably arises more often in applications. First, following Bickel and Rosenblatt (1973 Ann. Stat. 1 1071–95) we construct asymptotic confidence bands which are based on strong approximations and on a limit theorem for the supremum of a stationary Gaussian process. Further, we propose bootstrap confidence bands based on the residual bootstrap and prove consistency of the bootstrap procedure. A simulation study shows that the bootstrap confidence bands perform reasonably well for moderate sample sizes. Finally, we apply our method to data from a gel electrophoresis experiment with genetically engineered neuronal receptor subunits incubated with rat brain extract

  18. Control Banding and Nanotechnology Synergist

    Energy Technology Data Exchange (ETDEWEB)

    Zalk, D; Paik, S

    2009-12-15

    The average Industrial Hygienist (IH) loves a challenge, right? Okay, well here is one with more than a few twists. We start by going through the basics of a risk assessment. You have some chemical agents, a few workers, and the makings of your basic exposure characterization. However, you have no occupational exposure limit (OEL), essentially no toxicological basis, and no epidemiology. Now the real handicap is that you cannot use sampling pumps, cassettes, tubes, or any of the media in your toolbox, and the whole concept of mass-to-dose is out the window, even at high exposure levels. Of course, by the title, you knew we were talking about nanomaterials (NM). However, we wonder how many IHs know that this topic takes everything you know about your profession and turns it upside down. It takes the very foundations that you worked so hard in college and in the field to master and pulls it out from underneath you. It even takes the gold standard of our profession, the quantitative science of exposure assessment, and makes it look pretty darn rusty. Now with NM there is the potential to get some aspect of quantitative measurements, but the instruments are generally very expensive and getting an appropriate workplace personal exposure measurement can be very difficult if not impossible. The potential for workers getting exposures, however, is very real, as evidenced by a recent publication reporting worker exposures to polyacrylate nanoparticles in a Chinese factory (Song et al. 2009). With something this complex and challenging, how does a concept as simple as Control Banding (CB) save the day? Although many IHs have heard of CB, most of their knowledge comes from its application in the COSHH Essentials toolkit. While there is conflicting published research on COSHH Essentials and its value for risk assessments, almost all of the experts agree that it can be useful when no OELs are available (Zalk and Nelson 2008). It is this aspect of CB, its utility with

  19. Modification in band gap of zirconium complexes

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Mayank, E-mail: mayank30134@gmail.com; Singh, J.; Chouhan, S. [Department of Physics, ISLE, IPS Academy, Indore (M.P.) (India); Mishra, A. [School of Physics, Devi Ahilya Vishwavidyalaya, Indore (M.P.) (India); Shrivastava, B. D. [Govt. P. G. College, Biora (M.P.) (India)

    2016-05-06

    The optical properties of zirconium complexes with amino acid based Schiff bases are reported here. The zirconium complexes show interesting stereo chemical features, which are applicable in organometallic and organic synthesis as well as in catalysis. The band gaps of both Schiff bases and zirconium complexes were obtained by UV-Visible spectroscopy. It was found that the band gap of zirconium complexes has been modified after adding zirconium compound to the Schiff bases.

  20. Theoretical Prediction of the Forming Limit Band

    International Nuclear Information System (INIS)

    Banabic, D.; Paraianu, L.; Vos, M.; Jurco, P.

    2007-01-01

    Forming Limit Band (FLB) is a very useful tool to improve the sheet metal forming simulation robustness. Until now, the study of the FLB was only experimental. This paper presents the first attempt to model the FLB. The authors have established an original method for predicting the two margins of the limit band. The method was illustrated on the AA6111-T43 aluminum alloy. A good agreement with the experiments has been obtained

  1. Theoretical Prediction of the Forming Limit Band

    Science.gov (United States)

    Banabic, D.; Vos, M.; Paraianu, L.; Jurco, P.

    2007-04-01

    Forming Limit Band (FLB) is a very useful tool to improve the sheet metal forming simulation robustness. Until now, the study of the FLB was only experimental. This paper presents the first attempt to model the FLB. The authors have established an original method for predicting the two margins of the limit band. The method was illustrated on the AA6111-T43 aluminum alloy. A good agreement with the experiments has been obtained.

  2. Home-use cancer detecting band aid

    Science.gov (United States)

    Zalevsky, Zeev; Rudnitsky, Arkady; Sheinman, Victor; Tzoy, Andrey; Toktosunov, Aitmamat; Adashov, Arkady

    2016-03-01

    In this paper we present a novel concept in which special band aid is developed for early detection of cancer. The band aid contains an array of micro needles with small detection array connected to each needle which inspects the color of the surface of the skin versus time after being pinched with the needles. We were able to show in pre-clinical trials that the color varies differently if the skin is close to tumor tissue.

  3. A superdeformed band in {sup 142}Sm

    Energy Technology Data Exchange (ETDEWEB)

    Hackman, G; Mullins, J M; Kuehner, J A; Prevost, D; Waddington, J C [McMaster Univ., Hamilton, ON (Canada). Dept. of Physics; Galindo-Uribarri, A; Janzen, V P; Radford, D C; Schmeing, N; Ward, D [Atomic Energy of Canada Ltd., Chalk River, ON (Canada). Chalk River Nuclear Labs.

    1992-08-01

    Observation of {gamma}-{gamma} coincidences from the reaction {sup 124}Sn({sup 24}Mg,6n){sup 142}Sm at 145 MeV indicates the existence of a rotational band with dynamic moment of inertia J{sup (2)} similar to that of the superdeformed band in the isotone {sup 143}Eu. This result is consistent with calculations predicting superdeformed structures in N = 80, Z {approx} 64 nuclei. (author). 8 refs., 4 figs.

  4. Band structures in near spherical 138Ce

    Science.gov (United States)

    Bhattacharjee, T.; Chanda, S.; Bhattacharyya, S.; Basu, S. K.; Bhowmik, R. K.; Das, J. J.; Pramanik, U. Datta; Ghugre, S. S.; Madhavan, N.; Mukherjee, A.; Mukherjee, G.; Muralithar, S.; Singh, R. P.

    2009-06-01

    The high spin states of N=80138Ce have been populated in the fusion evaporation reaction 130Te( 12C, 4n) 138Ce at E=65 MeV. The γ transitions belonging to various band structures were detected and characterized using an array of five Clover Germanium detectors. The level scheme has been established up to a maximum spin and excitation energy of 23 ℏ and 9511.3 keV, respectively, by including 53 new transitions. The negative parity ΔI=1 band, developed on the 6536.3 keV 15 level, has been conjectured to be a magnetic rotation band following a semiclassical analysis and comparing the systematics of similar bands in the neighboring nuclei. The said band is proposed to have a four quasiparticle configuration of [πgh]⊗[. Other band structures are interpreted in terms of multi-quasiparticle configurations, based on Total Routhian Surface (TRS) calculations. For the low and medium spin states, a shell model calculation using a realistic two body interaction has been performed using the code OXBASH.

  5. Electron correlations in narrow band systems

    International Nuclear Information System (INIS)

    Kishore, R.

    1983-01-01

    The effect of the electron correlations in narrow bands, such as d(f) bands in the transition (rare earth) metals and their compounds and the impurity bands in doped semiconductors is studied. The narrow band systems is described, by the Hubbard Hamiltonian. By proposing a local self-energy for the interacting electron, it is found that the results are exact in both atomic and band limits and reduce to the Hartree Fock results for U/Δ → 0, where U is the intra-atomic Coulomb interaction and Δ is the bandwidth of the noninteracting electrons. For the Lorentzian form of the density of states of the noninteracting electrons, this approximation turns out to be equivalent to the third Hubbard approximation. A simple argument, based on the mean free path obtained from the imaginary part of the self energy, shows how the electron correlations can give rise to a discontinous metal-nonmetal transition as proposed by Mott. The band narrowing and the existence of the satellite below the Fermi energy in Ni, found in photoemission experiments, can also be understood. (Author) [pt

  6. B(M1) values in the band-crossing of shears bands in 197Pb

    Science.gov (United States)

    Krücken, R.; Cooper, J. R.; Beausang, C. W.; Novak, J. R.; Dewald, A.; Klug, T.; Kemper, G.; von Brentano, P.; Carpenter, M.; Wiedenhöver, I.

    We present details of the band crossing mechanism of shears bands using the example of 197Pb. Absolute reduced matrix elements B(M1) were determined by means of a RDM lifetime measurement in one of the shears bands in 197Pb. The experiment was performed using the New Yale Plunger Device (NYPD) in conjunction with the Gammasphere array. Band mixing calculations on the basis of the semi-classical model of the shears mechanism are used to describe the transition matrix elements B(M1) and energies throughout the band-crossing regions. Good agreement with the data was obtained and the detailed composition of the states in the shears band are discussed.

  7. ISM band to U-NII band frequency transverter and method of frequency transversion

    Science.gov (United States)

    Stepp, Jeffrey David [Grandview, MO; Hensley, Dale [Grandview, MO

    2006-09-12

    A frequency transverter (10) and method for enabling bi-frequency dual-directional transfer of digitally encoded data on an RF carrier by translating between a crowded or otherwise undesirable first frequency band, such as the 2.4 GHz ISM band, and a less-crowded or otherwise desirable second frequency band, such as the 5.0 GHz 6.0 GHz U-NII band. In a preferred embodiment, the transverter (10) connects between an existing data radio (11) and its existing antenna (30), and comprises a bandswitch (12); an input RF isolating device (14); a transmuter (16); a converter (18); a dual output local oscillator (20); an output RF isolating device (22); and an antenna (24) tuned to the second frequency band. The bandswitch (12) allows for bypassing the transverter (10), thereby facilitating its use with legacy systems. The transmuter (14) and converter (16) are adapted to convert to and from, respectively, the second frequency band.

  8. Ferritin associates with marginal band microtubules

    International Nuclear Information System (INIS)

    Infante, Anthony A.; Infante, Dzintra; Chan, M.-C.; How, P.-C.; Kutschera, Waltraud; Linhartova, Irena; Muellner, Ernst W.; Wiche, Gerhard; Propst, Friedrich

    2007-01-01

    We characterized chicken erythrocyte and human platelet ferritin by biochemical studies and immunofluorescence. Erythrocyte ferritin was found to be a homopolymer of H-ferritin subunits, resistant to proteinase K digestion, heat stable, and contained iron. In mature chicken erythrocytes and human platelets, ferritin was localized at the marginal band, a ring-shaped peripheral microtubule bundle, and displayed properties of bona fide microtubule-associated proteins such as tau. Red blood cell ferritin association with the marginal band was confirmed by temperature-induced disassembly-reassembly of microtubules. During erythrocyte differentiation, ferritin co-localized with coalescing microtubules during marginal band formation. In addition, ferritin was found in the nuclei of mature erythrocytes, but was not detectable in those of bone marrow erythrocyte precursors. These results suggest that ferritin has a function in marginal band formation and possibly in protection of the marginal band from damaging effects of reactive oxygen species by sequestering iron in the mature erythrocyte. Moreover, our data suggest that ferritin and syncolin, a previously identified erythrocyte microtubule-associated protein, are identical. Nuclear ferritin might contribute to transcriptional silencing or, alternatively, constitute a ferritin reservoir

  9. Excited negative parity bands in 160Yb

    Science.gov (United States)

    Saha, A.; Bhattacharjee, T.; Curien, D.; Dedes, I.; Mazurek, K.; Banerjee, S. R.; Rajbanshi, S.; Bisoi, A.; de Angelis, G.; Bhattacharya, Soumik; Bhattacharyya, S.; Biswas, S.; Chakraborty, A.; Das Gupta, S.; Dey, B.; Goswami, A.; Mondal, D.; Pandit, D.; Palit, R.; Roy, T.; Singh, R. P.; Saha Sarkar, M.; Saha, S.; Sethi, J.

    2018-03-01

    Negative parity rotational bands in {} 70160Yb{}90 nucleus have been studied. They were populated in the 148Sm(16O, 4n)160Yb reaction at 90 MeV. The gamma-coincidence data have been collected using Indian National Gamma Array composed of twenty Compton suppressed clover germanium (Ge) detectors. Double gating on triple gamma coincidence data were selectively used to develop the decay scheme for these negative parity bands by identifying and taking care of the multiplet transitions. The even- and odd-spin negative parity bands in 160Yb have been studied by comparing the reduced transition probability ratios with the similar bands in neighbouring even-even rare earth nuclei. It is concluded that the concerned odd-spin and even-spin bands are not signature partners and that their structures are compatible with those of the ‘pear-shape’ and ‘pyramid-shape’ oscillations, respectively, the octupole shapes superposed with the quadrupole shape of the ground-state.

  10. Band gaps for the relativistic Mathieu potential

    International Nuclear Information System (INIS)

    Clerk, G.J.; McKellar, B.H.J.

    1992-01-01

    A study of the band structure of a massless particle in a cosine potential is made via the Dirac equation. It is shown that every alternate band gap disappears as a consequence of a periodicity of the potential combined with a peculiar symmetry of the Dirac equation. This basic potential is then used to study a simple one-dimensional model of the nucleus from which it is ascertained that modelling the mean field of the quarks in the nucleus via a pure scalar potential is unsatisfactory. A simple extension involving a combined scalar and vector potential is then proposed as a possible solution to this problem. The effect of the addition of this vector component to the band structure is also investigated. 32 refs

  11. What band rocks the MTB? (Invited)

    Science.gov (United States)

    Kind, J.; García-Rubio, I.; Gehring, A. U.

    2013-12-01

    Magnetotactic bacteria (MTB) are a polyphyletic group of bacteria that have been found in marine and lacustrine environments and soils [e.g. 1]. The hallmark of MTB is their intracellular formation of magnetosomes, single-domain ferrimagnetic particles that are aligned in chains. The chain configuration generates a strong magnetic dipole, which is used as magnetic compass to move the MTB into their favorable habit. The term band corresponds to a frequency window of microwaves in the gigahertz (GHz) range. Ferromagnetic resonance (FMR) spectroscopy uses the microwave absorption in a magnetic field to analyze the anisotropy properties and the domain state of magnetic materials. Specific microwave frequency causes absorption in a characteristic magnetic field range. For the investigation of MTB we use S-band (4.02 GHz), X-band (9.47 GHz), and Q-band (34.16 GHz). Experiments on cultured MTB and on sediment samples of Holocene age showed that absorption in X- and Q-band occurs when the sample is in a saturated or nearly saturated state [2, 3]. By contrast, absorption in the S-band appears in lower magnetic fields, where the sample is far from saturation. All FMR spectra show two distinct low-field features that can be assigned to magnetite particles in chains, aligned parallel and perpendicular to the external magnetic field. The detailed separation of the parallel and perpendicular components in the bulk samples is hampered, because of the random orientation of the chains in the sample. The comparison of S-, X-, and Q-band shows that the lower the frequency the better the separation of the components. In the S-band FMR spectroscopy, the separation of chains parallel to the external magnetic field is supported by the internal field of the sample. This field is caused by the remanence that contributes to the external magnetic field to fulfill the resonance condition [3,4]. Considering the different FMR responses, it can be postulated that a lower microwave frequency

  12. Some general constraints on identical band symmetries

    International Nuclear Information System (INIS)

    Guidry, M.W.; Strayer, M.R.; Wu, C.; Feng, D.H.

    1993-01-01

    We argue on general grounds that nearly identical bands observed for superdeformation and less frequently for normal deformation must be explicable in terms of a symmetry having a microscopic basis. We assume that the unknown symmetry is associated with a Lie algebra generated by terms bilinear in fermion creation and annihilation operators. Observed features of these bands and the general properties of Lie groups are then used to place constraints on acceptable algebras. Additional constraints are placed by assuming that the collective spectrum is associated with a dynamical symmetry, and examining the subgroup structure required by phenomenology. We observe that requisite symmetry cannot be unitary, and that the simplest known group structures consistent with these minimal criteria are associated with the Ginocchio algebras employed in the fermion dynamical symmetry model. However, our arguments are general in nature, and we propose that they imply model-independent constraints on any candidate explanation for identical bands

  13. Simplicial band depth for multivariate functional data

    KAUST Repository

    López-Pintado, Sara

    2014-03-05

    We propose notions of simplicial band depth for multivariate functional data that extend the univariate functional band depth. The proposed simplicial band depths provide simple and natural criteria to measure the centrality of a trajectory within a sample of curves. Based on these depths, a sample of multivariate curves can be ordered from the center outward and order statistics can be defined. Properties of the proposed depths, such as invariance and consistency, can be established. A simulation study shows the robustness of this new definition of depth and the advantages of using a multivariate depth versus the marginal depths for detecting outliers. Real data examples from growth curves and signature data are used to illustrate the performance and usefulness of the proposed depths. © 2014 Springer-Verlag Berlin Heidelberg.

  14. Exact folded-band chaotic oscillator.

    Science.gov (United States)

    Corron, Ned J; Blakely, Jonathan N

    2012-06-01

    An exactly solvable chaotic oscillator with folded-band dynamics is shown. The oscillator is a hybrid dynamical system containing a linear ordinary differential equation and a nonlinear switching condition. Bounded oscillations are provably chaotic, and successive waveform maxima yield a one-dimensional piecewise-linear return map with segments of both positive and negative slopes. Continuous-time dynamics exhibit a folded-band topology similar to Rössler's oscillator. An exact solution is written as a linear convolution of a fixed basis pulse and a discrete binary sequence, from which an equivalent symbolic dynamics is obtained. The folded-band topology is shown to be dependent on the symbol grammar.

  15. Kπ=0+ band moment of inertia anomaly

    International Nuclear Information System (INIS)

    Zeng, J.Y.; Wu, C.S.; Cheng, L.; Lin, C.Z.; China Center of Advanced Science and Technology

    1990-01-01

    The moments of inertia of K π =0 + bands in the well-deformed nuclei are calculated by a particle-number-conserving treatment for the cranked shell model. The very accurate solutions to the low-lying K π =0 + bands are obtained by making use of an effective K truncation. Calculations show that the main contribution to the moments of inertia comes from the nucleons in the intruding high-j orbits. Considering the fact that no free parameter is involved in the calculation and no extra inert core contribution is added, the agreement between the calculated and the observed moments of inertia of 0 + bands in 168 Er is very satisfactory

  16. Band Edge Dynamics and Multiexciton Generation in Narrow Band Gap HgTe Nanocrystals.

    Science.gov (United States)

    Livache, Clément; Goubet, Nicolas; Martinez, Bertille; Jagtap, Amardeep; Qu, Junling; Ithurria, Sandrine; Silly, Mathieu G; Dubertret, Benoit; Lhuillier, Emmanuel

    2018-04-11

    Mercury chalcogenide nanocrystals and especially HgTe appear as an interesting platform for the design of low cost mid-infrared (mid-IR) detectors. Nevertheless, their electronic structure and transport properties remain poorly understood, and some critical aspects such as the carrier relaxation dynamics at the band edge have been pushed under the rug. Some of the previous reports on dynamics are setup-limited, and all of them have been obtained using photon energy far above the band edge. These observations raise two main questions: (i) what are the carrier dynamics at the band edge and (ii) should we expect some additional effect (multiexciton generation (MEG)) as such narrow band gap materials are excited far above the band edge? To answer these questions, we developed a high-bandwidth setup that allows us to understand and compare the carrier dynamics resonantly pumped at the band edge in the mid-IR and far above the band edge. We demonstrate that fast (>50 MHz) photoresponse can be obtained even in the mid-IR and that MEG is occurring in HgTe nanocrystal arrays with a threshold around 3 times the band edge energy. Furthermore, the photoresponse can be effectively tuned in magnitude and sign using a phototransistor configuration.

  17. Side-band-separating heterodyne mixer for band 9 of ALMA.

    NARCIS (Netherlands)

    Mena, F. P.; Baryshev, A. M.; Kooi, J.; Lodewijk, C. F. J.; Gerlofsma, G.; Hesper, R.; Wild, W.; Shen, XC; Lu, W; Zhang, J; Dou, WB

    2006-01-01

    Here we present the realization of a side-band-separating (2SB) heterodyne mixer for the frequency range from 602 to 720 GHz (corresponding to ALMA band 9). The mixer, in brief, consists of a quadrature hybrid, two LO injectors, two SIS junctions, and three dumping loads. All the parts were modeled

  18. Elastic band prediction equations for combined free-weight and elastic band bench presses and squats.

    Science.gov (United States)

    Shoepe, Todd C; Ramirez, David A; Almstedt, Hawley C

    2010-01-01

    Elastic bands added to traditional free-weight techniques have become a part of suggested training routines in recent years. Because of the variable loading patterns of elastic bands (i.e., greater stretch produces greater resistance), it is necessary to quantify the exact loading patterns of bands to identify the volume and intensity of training. The purpose of this study was to determine the length vs. tension properties of multiple sizes of a set of commonly used elastic bands to quantify the resistance that would be applied to free-weight plus elastic bench presses (BP) and squats (SQ). Five elastic bands of varying thickness were affixed to an overhead support beam. Dumbbells of varying weights were progressively added to the free end while the linear deformation was recorded with each subsequent weight increment. The resistance was plotted as a factor of linear deformation, and best-fit nonlinear logarithmic regression equations were then matched to the data. For both the BP and SQ loading conditions and all band thicknesses tested, R values were greater than 0.9623. These data suggest that differences in load exist as a result of the thickness of the elastic band, attachment technique, and type of exercise being performed. Facilities should adopt their own form of loading quantification to match their unique set of circumstances when acquiring, researching, and implementing elastic band and free-weight exercises into the training programs.

  19. Band-gap and band-edge engineering of multicomponent garnet scintillators from first principles

    Czech Academy of Sciences Publication Activity Database

    Yadav, S.K.; Uberuaga, B.P.; Nikl, Martin; Jiang, C.; Stanek, C.R.

    2015-01-01

    Roč. 4, č. 5 (2015), "054012-1"-"054012-9" ISSN 2331-7019 R&D Projects: GA ČR GAP204/12/0805 Institutional support: RVO:68378271 Keywords : scintillator * electronic band gap structure * garnets * band gap engineering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.061, year: 2015

  20. Interpolation of band-limited discrete-time signals by minimising out-of-band energy

    NARCIS (Netherlands)

    Janssen, A.J.E.M.; Vries, L.B.

    1984-01-01

    An interpolation method for restoring burst errors in discrete—time, band—limited signals is presented. The restoration is such that the restored signal has minimal out—of—band energy. The filter coefficients depend Only on the burst length and on the size of the band to which the signal is assumed

  1. Band to Band Tunneling (BBT) Induced Leakage Current Enhancement in Irradiated Fully Depleted SOI Devices

    Science.gov (United States)

    Adell, Phillipe C.; Barnaby, H. J.; Schrimpf, R. D.; Vermeire, B.

    2007-01-01

    We propose a model, validated with simulations, describing how band-to-band tunneling (BBT) affects the leakage current degradation in some irradiated fully-depleted SOI devices. The dependence of drain current on gate voltage, including the apparent transition to a high current regime is explained.

  2. Modelling band-to-band tunneling current in InP-based heterostructure photonic devices

    NARCIS (Netherlands)

    van Engelen, J.P.; Shen, L.; van der Tol, J.J.G.M.; Smit, M.K.; Kockaert, P.; Emplit, P.; Gorza, S.-P.; Massar, S.

    2015-01-01

    Some semiconductor photonic devices show large discontinuities in the band structure. Short tunnel paths caused by this band structure may lead to an excessive tunneling current, especially in highly doped layers. Modelling of this tunnelling current is therefore important when designing photonic

  3. Structure of dipole bands in 106In

    International Nuclear Information System (INIS)

    Deo, A. Y.; Palit, R.; Naik, Z.; Joshi, P. K.; Mazumdar, I.; Sihotra, S.; Mehta, D.; Kumar, S.; Chakrabarti, R.; Kshetri, R.; Jain, H. C.

    2009-01-01

    High spin states in neutron-deficient 106 In were investigated using 78 Se( 32 S,p3n) reaction at 125 MeV. The level scheme is extended up to 7 MeV of excitation energy for the negative parity states constituting four dipole bands, and the positive parity states which mainly exhibit single-particle excitations are extended up to 5 MeV. Projected deformed Hartree-Fock calculations were carried out to understand the configurations of different bands in this nucleus.

  4. Maximizing band gaps in plate structures

    DEFF Research Database (Denmark)

    Halkjær, Søren; Sigmund, Ole; Jensen, Jakob Søndergaard

    2006-01-01

    periodic plate using Bloch theory, which conveniently reduces the maximization problem to that of a single base cell. Secondly, we construct a finite periodic plate using a number of the optimized base cells in a postprocessed version. The dynamic properties of the finite plate are investigated......Band gaps, i.e., frequency ranges in which waves cannot propagate, can be found in elastic structures for which there is a certain periodic modulation of the material properties or structure. In this paper, we maximize the band gap size for bending waves in a Mindlin plate. We analyze an infinite...... theoretically and experimentally and the issue of finite size effects is addressed....

  5. Itinerant ferromagnetism in the narrow band limit

    CERN Document Server

    Liu, S H

    2000-01-01

    It is shown that in the narrow band, strong interaction limit the paramagnetic state of an itinerant ferromagnet is described by the disordered local moment state. As a result, the Curie temperature is orders of magnitude lower than what is expected from the large exchange splitting of the spin bands. An approximate analysis has also been carried out for the partially ordered state, and the result explains the temperature evolvement of the magnetic contributions to the resistivity and low-energy optical conductivity of CrO sub 2.

  6. Proximal iliotibial band syndrome: case report

    Directory of Open Access Journals (Sweden)

    Guilherme Guadagnini Falotico

    2013-08-01

    Full Text Available OBJECTIVE: The overuse injuries in the hip joint occur commonly in sports practitioners and currently due to technical advances in diagnostic imaging, especially magnetic resonance imaging (MRI, are often misdiagnosed. Recently, a group of people were reported, all female, with pain and swelling in the pelvic region.T2-weighted MRI showed increased signal in the enthesis of the iliotibial band (ITB along the lower border of the iliac tubercle. We report a case of a 34 year old woman, non-professional runner, with pain at the iliac crest with no history of trauma and whose MRI was compatible with the proximal iliotibial band syndrome.

  7. Electron currents associated with an auroral band

    International Nuclear Information System (INIS)

    Spiger, R.J.; Anderson, H.R.

    1975-01-01

    Measurements of electron pitch angle distributions and energy spectra over a broad auroral band were used to calculate net electric current carried by auroral electrons in the vicinity of the band. The particle energy spectrometers were carried by a Nike-Tomahawk rocket launched from Poker Flat, Alaska, at 0722 UT on February 25, 1972. Data are presented which indicate the existence of upward field-aligned currents of electrons in the energy range 0.5-20 keV. The spatial relationship of these currents to visual structure of the auroral arc and the characteristics of the electrons carrying the currents are discussed

  8. Electron currents associated with an auroral band

    Science.gov (United States)

    Spiger, R. J.; Anderson, H. R.

    1975-01-01

    Measurements of electron pitch angle distributions and energy spectra over a broad auroral band were used to calculate net electric current carried by auroral electrons in the vicinity of the band. The particle energy spectrometers were carried by a Nike-Tomahawk rocket launched from Poker Flat, Alaska, at 0722 UT on February 25, 1972. Data are presented which indicate the existence of upward field-aligned currents of electrons in the energy range 0.5-20 keV. The spatial relationship of these currents to visual structure of the auroral arc and the characteristics of the electrons carrying the currents are discussed.

  9. Ka-band waveguide rotary joint

    KAUST Repository

    Yevdokymov, Anatoliy

    2013-04-11

    The authors present a design of a waveguide rotary joint operating in Ka-band with central frequency of 33 GHz, which also acts as an antenna mount. The main unit consists of two flanges with a clearance between them; one of the flanges has three circular choke grooves. Utilisation of three choke grooves allows larger operating clearance. Two prototypes of the rotary joint have been manufactured and experimentally studied. The observed loss is from 0.4 to 0.8 dB in 1.5 GHz band.

  10. Band theory of metals the elements

    CERN Document Server

    Altmann, Simon L

    1970-01-01

    Band Theory of Metals: The Elements focuses on the band theory of solids. The book first discusses revision of quantum mechanics. Topics include Heisenberg's uncertainty principle, normalization, stationary states, wave and group velocities, mean values, and variational method. The text takes a look at the free-electron theory of metals, including heat capacities, density of states, Fermi energy, core and metal electrons, and eigenfunctions in three dimensions. The book also reviews the effects of crystal fields in one dimension. The eigenfunctions of the translations; symmetry operations of t

  11. Banding of connection standards for distributed generation

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-05-04

    This report presents the views of distributed network operators (DNOs), developers, equipment manufacturers and consultants on the current banding of distributed generation in terms of connection standards and recommendations. The Documents ER G59/1, ER G75/1, ER G83/1 and ETR 113/1 covering recommendations for the connection of embedded generating plant to distribution systems and guidance notes for the protection of embedded generating plant are examined. The way in which the recommendations are applied in practice is investigated. Multiple distribution generator installations, fault ride through, and banding are considered as well as both protection required and maximum generator sizes at respective voltage levels.

  12. Quantum numbers and band topology of nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Damnjanovic, M [Faculty of Physics, University of Belgrade, POB 368, 11001 Belgrade (Yugoslavia); Milosevic, I [Faculty of Physics, University of Belgrade, POB 368, 11001 Belgrade (Yugoslavia); Vukovic, T [Faculty of Physics, University of Belgrade, POB 368, 11001 Belgrade (Yugoslavia); Maultzsch, J [Institut fuer Festkoerper Physik, Technische Universitaet Berlin, Hardenbergstr. 36, 10623 Berlin (Germany)

    2003-05-30

    Nanotubes as well as polymers and quasi-1D subsystems of 3D crystals have line group symmetry. This allows two types of quantum numbers: roto-translational and helical. The roto-translational quantum numbers are linear and total angular (not conserved) momenta, while the helical quantum numbers are helical and complementary angular momenta. Their mutual relations determine some topological properties of energy bands, such as systematic band sticking or van Hove singularities related to parities. The importance of these conclusions is illustrated by the optical absorption in carbon nanotubes: parity may prevent absorption peaks at van Hove singularities.

  13. Quantum numbers and band topology of nanotubes

    International Nuclear Information System (INIS)

    Damnjanovic, M; Milosevic, I; Vukovic, T; Maultzsch, J

    2003-01-01

    Nanotubes as well as polymers and quasi-1D subsystems of 3D crystals have line group symmetry. This allows two types of quantum numbers: roto-translational and helical. The roto-translational quantum numbers are linear and total angular (not conserved) momenta, while the helical quantum numbers are helical and complementary angular momenta. Their mutual relations determine some topological properties of energy bands, such as systematic band sticking or van Hove singularities related to parities. The importance of these conclusions is illustrated by the optical absorption in carbon nanotubes: parity may prevent absorption peaks at van Hove singularities

  14. Quantum numbers and band topology of nanotubes

    CERN Document Server

    Damnjanovic, M; Vukovic, T; Maultzsch, J

    2003-01-01

    Nanotubes as well as polymers and quasi-1D subsystems of 3D crystals have line group symmetry. This allows two types of quantum numbers: roto-translational and helical. The roto-translational quantum numbers are linear and total angular (not conserved) momenta, while the helical quantum numbers are helical and complementary angular momenta. Their mutual relations determine some topological properties of energy bands, such as systematic band sticking or van Hove singularities related to parities. The importance of these conclusions is illustrated by the optical absorption in carbon nanotubes: parity may prevent absorption peaks at van Hove singularities.

  15. Neutron transmission bands in one dimensional lattices

    International Nuclear Information System (INIS)

    Monsivais, G.; Moshinsky, M.

    1999-01-01

    The original Kronig-Penney lattice, which had delta function interactions at the end of each of the equal segments, seems a good model for the motion of neutrons in a linear lattice if the strength b of the δ functions depends of the energy of the neutrons, i.e., b(E). We derive the equation for the transmission bands and consider the relations of b(E) with the R(E) function discussed in a previous paper. We note the great difference in the behavior of the bands when b(E) is constant and when it is related with a single resonance of the R function. (Author)

  16. Band gap and band offset of (GaIn)(PSb) lattice matched to InP

    Science.gov (United States)

    Köhler, F.; Böhm, G.; Meyer, R.; Amann, M.-C.

    2005-07-01

    Metastable (GaxIn1-x)(PySb1-y) layers were grown on (001) InP substrates by gas source molecular beam epitaxy. Low-temperature photoluminescence spectroscopy was applied to these heterostructures and revealed spatially indirect band-to-band recombination of electrons localized in the InP with holes in the (GaxIn1-x)(PySb1-y). In addition, samples with layer thicknesses larger than 100nm showed direct PL across the band gap of (GaxIn1-x)(PySb1-y). Band-gap energies and band offset energies of (GaxIn1-x)(PySb1-y) relative to InP were derived from these PL data. A strong bowing parameter was observed.

  17. ANALISIS TIPOGRAFI PADA LOGOTYPE BAND FORGOTTEN

    Directory of Open Access Journals (Sweden)

    Atang Riyan Isnandar

    2016-12-01

    Full Text Available Abstrak Forgotten merupakan band asal kota Bandung yang beraliran death metal. Band ini telah memiliki beberapa album yang cukup sukses. Salah satu faktor yang turut berperan penting dalam album-album Forgotten adalah desain sampul album. Sampul album merupakan identitas dan pesan dari musik yang dibawakan oleh Forgotten. Dalam sampul album, terdapat salah satu elemen visual yaitu Tipografi. Salah satu peran tipografi dalam sampul album Forgotten adalah sebagai logotype dari band. Yang menarik, dari lima album yang telah dirilis Forgotten yaitu “Future Syndrome” (1997, “Obsesi Mati” (2000, “Tuhan Telah Mati” (2001, “Tiga Angka Enam” (2003 dan “Laras Perlaya” (2011 adalah tampilan logotype band yang selalu berbeda. Perubahan logotype Forgotten disebabkan oleh beberapa faktor seperti adanya perubahan selera, transformasi musik dan pergantian personil yang dialami oleh band Forgotten. Perubahan ini berakibat pada munculnya kesan visual yang berbeda-beda dari masing-masing logotype di setiap sampul albumnya. Apalagi logotype band dengan genre death metal memiliki kecendrungan yang unik, dekoratif, bahkan sulit untuk dibaca. Oleh karena itu untuk mengetahui kesan visual yang dimunculkan oleh setiap logotype akan dilakukan penelitian dengan pendekatan tipografi. Tujuan dari penelitian ini adalah selain untuk mengetahui perubahan logotype dari kelima sampul album yang telah dirilis oleh Forgotten juga ingin mengetahui kesan visual terhadap tipografi terkait dengan prinsip kejelasan (legibility, keterbacaan (readability dan kemampuannya untuk dilihat pada jarak tertentu (visibility. Kata Kunci: Sampul Album, Tipografi, Logotype, Forgotten Abstract Forgotten is a band from Bandung, the death metal genre. The band has had some fairly successful album. One of important factor in albums Forgotten is the album cover design. The album cover are the identity and the message of the music performed by the Forgotten. In the cover of the album

  18. 47 CFR 15.715 - TV bands database administrator.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false TV bands database administrator. 15.715 Section... Band Devices § 15.715 TV bands database administrator. The Commission will designate one or more entities to administer a TV bands database. Each database administrator shall: (a) Maintain a database that...

  19. New Kronig-Penney Equation Emphasizing the Band Edge Conditions

    Science.gov (United States)

    Szmulowicz, Frank

    2008-01-01

    The Kronig-Penney problem is a textbook example for discussing band dispersions and band gap formation in periodic layered media. For example, in photonic crystals, the behaviour of bands next to the band edges is important for further discussions of such effects as inhibited light emission, slow light and negative index of refraction. However,…

  20. 47 CFR 15.714 - TV bands database administration fees.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false TV bands database administration fees. 15.714... Television Band Devices § 15.714 TV bands database administration fees. (a) A TV bands database administrator may charge a fee for provision of lists of available channels to fixed and personal/portable TVBDs and...

  1. 47 CFR 15.713 - TV bands database.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false TV bands database. 15.713 Section 15.713... TV bands database. (a) Purpose. The TV bands database serves the following functions: (1) To... databases. (b) Information in the TV bands database. (1) Facilities already recorded in Commission databases...

  2. Bands and chromosome arrangement in interphase nuclei

    International Nuclear Information System (INIS)

    Bianchi, N.O.; Bianchi, M.A.; Matayoshi, T.

    1977-01-01

    Chromosomes from the vole mouse Akodon dolores and from laboratory mouse showed the presence of G-bands after 3 minutes digestion with trypsin and Giemsa stain. Simultaneously, 30- to 40% of the interphase nuclei exhibited a dark ring parallel to the nuclear contour and a radial array of the chromatin in the internal and external regions of the ring. The origin and meaning of this ring image was analyzed by combining progressive trypsinizations with other methods such as C-banding procedures, autoradiography with 3 HTdR, staining with quinacrine mustard and 33258 Hoechst fluorochromes. Moreover, the presence of the dark ring was also investigated in cells treated with actinomycin and in control cells not subjected to any treatment. The results obtained allowed to assume that in interphase nuclei the chromosomes have chromatin bridges which connect the dark G-bands and that these bridges are probably involved in maintaining an ordered architecture of the nucleus with fixed chromosome positions in regard to the nuclear envelope and in regard to other chromosomes. Trypsinization produces a disruption of the interphase chromatin arrangement and the subsequent appearance of a dark ring formed by the combination of constitutive heterochromatin and dark G-bands. (auth.)

  3. Deformed configurations, band structures and spectroscopic ...

    Indian Academy of Sciences (India)

    2014-03-20

    Mar 20, 2014 ... The deformed configurations and rotational band structures in =50 Ge and Se nuclei are studied by deformed Hartree–Fock with quadrupole constraint and angular momentum projection. Apart from the `almost' spherical HF solution, a well-deformed configuration occurs at low excitation. A deformed ...

  4. VIBRONIC PROGRESSIONS IN SEVERAL DIFFUSE INTERSTELLAR BANDS

    International Nuclear Information System (INIS)

    Duley, W. W.; Kuzmin, Stanislav

    2010-01-01

    A number of vibronic progressions based on low-energy vibrational modes of a large molecule have been found in the diffuse interstellar band (DIB) spectrum of HD 183143. Four active vibrational modes have been identified with energies at 5.18 cm -1 , 21.41 cm -1 , 31.55 cm -1 , and 34.02 cm -1 . The mode at 34.02 cm -1 was previously recognized by Herbig. Four bands are associated with this molecule, with origins at 6862.61 A, 6843.64 A, 6203.14 A, and 5545.11 A (14589.1 cm -1 , 14608.08 cm -1 , 16116.41 cm -1 , and 18028.9 cm -1 , respectively). The progressions are harmonic and combination bands are observed involving all modes. The appearance of harmonic, rather than anharmonic, terms in these vibronic progressions is consistent with torsional motion of pendant rings, suggesting that the carrier is a 'floppy' molecule. Some constraints on the type and size of the molecule producing these bands are discussed.

  5. Statistical study of auroral omega bands

    Directory of Open Access Journals (Sweden)

    N. Partamies

    2017-09-01

    Full Text Available The presence of very few statistical studies on auroral omega bands motivated us to test-use a semi-automatic method for identifying large-scale undulations of the diffuse aurora boundary and to investigate their occurrence. Five identical all-sky cameras with overlapping fields of view provided data for 438 auroral omega-like structures over Fennoscandian Lapland from 1996 to 2007. The results from this set of omega band events agree remarkably well with previous observations of omega band occurrence in magnetic local time (MLT, lifetime, location between the region 1 and 2 field-aligned currents, as well as current density estimates. The average peak emission height of omega forms corresponds to the estimated precipitation energies of a few keV, which experienced no significant change during the events. Analysis of both local and global magnetic indices demonstrates that omega bands are observed during substorm expansion and recovery phases that are more intense than average substorm expansion and recovery phases in the same region. The omega occurrence with respect to the substorm expansion and recovery phases is in a very good agreement with an earlier observed distribution of fast earthward flows in the plasma sheet during expansion and recovery phases. These findings support the theory that omegas are produced by fast earthward flows and auroral streamers, despite the rarity of good conjugate observations.

  6. Collective states in 230Th: band structure

    Directory of Open Access Journals (Sweden)

    A. I. Levon

    2009-12-01

    Full Text Available Experimental data for the excited states in the deformed nucleus 230Th studied in the (p, t reaction are analyzed. Sequences of the states are selected which can be treated as rotational bands and as multiplets of excitations. Experimental data are compared with the interacting boson model (IBM and the quasiparticle-phonon model (QPM calculations.

  7. Study on electromagnetic constants of rotational bands

    International Nuclear Information System (INIS)

    Abdurazakov, A.A.; Adib, Yu.Sh.; Karakhodzhaev, A.K.

    1991-01-01

    Values of electromagnetic constant S and rotation bands of odd nuclei with Z=64-70 within the mass number change interval A=153-173 are determined. Values of γ-transition mixing parameter with M1+E2 multipolarity are presented. ρ parameter dependence on mass number A is discussed

  8. High spin rotational bands in Zn

    Indian Academy of Sciences (India)

    We present here some preliminary results from our studies in the. ~ ¼ region in which we have observed an yrast band structure in Zn extending to spin (41/2 ). ... gaps implies that nuclei may exhibit different shapes at different excitation energies. .... uration, identifying previously unobserved states up to an excitation energy ...

  9. Energy bands and gaps near an impurity

    Czech Academy of Sciences Publication Activity Database

    Mihóková, Eva; Schulman, L. S.

    2016-01-01

    Roč. 380, č. 41 (2016), s. 3430-3433 ISSN 0375-9601 R&D Projects: GA ČR GA13-09876S Institutional support: RVO:68378271 Keywords : crystal structure * impurity * modeling * energy bands Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.772, year: 2016

  10. Ka-band waveguide rotary joint

    KAUST Repository

    Yevdokymov, Anatoliy; Sirenko, Kostyantyn; Kryzhanovskiy, Volodymyr; Pazynin, Vadim

    2013-01-01

    The authors present a design of a waveguide rotary joint operating in Ka-band with central frequency of 33 GHz, which also acts as an antenna mount. The main unit consists of two flanges with a clearance between them; one of the flanges has three

  11. A Shear Banding Model for Penetration Calculations

    Science.gov (United States)

    2000-04-01

    mechanism of strength reduction to zero within a shear band in three different steels, includ- ing AISI 4340 with RHC 44, which is reasonably similar to RHA...TECH LIB CHINA LAKE CA 93555-6001 CDR NAVAL SUR WAR CTR C S COFFEY PPARK FZERILLI CODE 4140 R K GARRET JR JMCKIRGAN TECH LIB 101 STRAUSS AVE

  12. Electron band theory 1952-1962

    International Nuclear Information System (INIS)

    Lomer, W.M.

    1980-01-01

    Work undertaken by the Theoretical Physics Division between 1952 and 1965 to obtain an understanding of electrons in metals, with uranium and the actinides and the structurally-important transition metals as the main targets is examined. A main result of that period was a conviction that the majority of the physical properties of all metals, except the 4f rare-earth series and the actinides beyond uranium, were dominated by band effects which could be described well enough for most purposes by simple one-electron calculations with simple self-consistent fields. The period from 1960 on showed increasingly clearly the necessity of incorporating relativistic spin-orbit coupling terms in the heavy metals, and some 'local exchange field' correction to the fields close to nuclei. The problems of the non-local interaction of spins - highly important for alloy theory and for antiferromagnetic instability -required the evolution of computers large enough to produce wave-functions at all wave-vectors for all bands so that the susceptibility at arbitrary wave-vector could be computed. This work has not proved to be very illuminating so far, and much interest again focusses today on heuristic arguments that give qualitative descriptions of band structures, such as canonical d-bands to account for crystal structure. (UK)

  13. Phononic band gap structures as optimal designs

    DEFF Research Database (Denmark)

    Jensen, Jakob Søndergaard; Sigmund, Ole

    2003-01-01

    In this paper we use topology optimization to design phononic band gap structures. We consider 2D structures subjected to periodic loading and obtain the distribution of two materials with high contrast in material properties that gives the minimal vibrational response of the structure. Both in...

  14. The end of the unique myocardial band

    DEFF Research Database (Denmark)

    MacIver, David H; Partridge, John B; Agger, Peter

    2018-01-01

    Two of the leading concepts of mural ventricular architecture are the unique myocardial band and the myocardial mesh model. We have described, in an accompanying article published in this journal, how the anatomical, histological and high-resolution computed tomographic studies strongly favour th...

  15. Piecewise planar Möbius bands

    DEFF Research Database (Denmark)

    Gravesen, Jens

    2005-01-01

    t is shown that a closed polygon with an odd number of vertices is the median of exactly one piecewise planar cylinder and one piecewise planar Möbius band, intersecting each other orthogonally. A closed polygon with an even number of vertices is in the generic case neither the median...

  16. PHARUS: A C-band Airborne SAR

    NARCIS (Netherlands)

    Hoogeboom, P.; Koomen, P.J.; Pouwels, H.; Snoeij, P.

    1990-01-01

    In The Netherlands a plan to design aircraft and build a polarimetric C-band SAR system of a novel design, called PHARUS (PHased Array Universal SAR) is carried out by three institutes. These institutes are the Physics and Electronics Laboratory TNO in The Hague (prime contractor and project

  17. Faraday Rotation and L Band Oceanographic Measurements

    DEFF Research Database (Denmark)

    Skou, Niels

    2003-01-01

    Spaceborne radiometric measurements of the L band brightness temperature over the oceans make it possible to estimate sea surface salinity. However, Faraday rotation in the ionosphere disturbs the signals and must be corrected. Two different ways of assessing the disturbance directly from...

  18. UWB Filtering Power Divider with Two Narrow Notch-bands and Wide Stop-band

    Science.gov (United States)

    Wei, Feng; Wang, Xin-Yi; Zou, Xin Tong; Shi, Xiao Wei

    2017-12-01

    A compact filtering ultra-wideband (UWB) microstrip power divider (PD) with two sharply rejected notch-bands and wide stopband is analyzed and designed in this paper. The proposed UWB PD is based on a conventional Wilkinson power divider, while two stub loaded resonators (SLRs) are coupled into two symmetrical output ports to achieve a bandpass filtering response. The simplified composite right/left-handed (SCRLH) resonators are employed to generate the dual notched bands. Defected ground structure (DGS) is introduced to improve the passband performance. Good insertion/return losses, isolation and notch-band rejection are achieved as demonstrated in both simulation and experiment.

  19. The marginal band system in nymphalid butterfly wings.

    Science.gov (United States)

    Taira, Wataru; Kinjo, Seira; Otaki, Joji M

    2015-01-01

    Butterfly wing color patterns are highly complex and diverse, but they are believed to be derived from the nymphalid groundplan, which is composed of several color pattern systems. Among these pattern systems, the marginal band system, including marginal and submarginal bands, has rarely been studied. Here, we examined the color pattern diversity of the marginal band system among nymphalid butterflies. Marginal and submarginal bands are usually expressed as a pair of linear bands aligned with the wing margin. However, a submarginal band can be expressed as a broken band, an elongated oval, or a single dot. The marginal focus, usually a white dot at the middle of a wing compartment along the wing edge, corresponds to the pupal edge spot, one of the pupal cuticle spots that signify the locations of color pattern organizing centers. A marginal band can be expressed as a semicircle, an elongated oval, or a pair of eyespot-like structures, which suggest the organizing activity of the marginal focus. Physical damage at the pupal edge spot leads to distal dislocation of the submarginal band in Junonia almana and in Vanessa indica, suggesting that the marginal focus functions as an organizing center for the marginal band system. Taken together, we conclude that the marginal band system is developmentally equivalent to other symmetry systems. Additionally, the marginal band is likely a core element and the submarginal band a paracore element of the marginal band system, and both bands are primarily specified by the marginal focus organizing center.

  20. Dosimetry of narrow band UVB treatments

    International Nuclear Information System (INIS)

    Goode, D.H.; Mannering, D.M.

    1996-01-01

    Full text: For many years psoriasis has been treated with broad band UVB lamps. These lamps have a bell shaped spectrum which peaks at 305 nm and extends from 280 nm to 350 nm. However research with monochromatic UV radiation has shown that wavelengths between 300 nm and 320 nm are the most efficacious for clearing psoriasis while wavelengths below 305 nm are most effective for producing the undesirable side effect of erythema (sunburn). In response to these findings Philips developed a narrow band UVB tube in which a large fraction of the output was confined to a narrow peak (bandwidth 2.5 nm) situated at 311 nm. Christchurch Hospital replaced broad band UVB with narrow band treatments in August 1995 and as this required UV exposures to be substantially increased new protocols had to be developed. Three aspects needed to be addressed. These were translating the dose from broad band to narrow band for current patients, determining the initial dose for new patients and developing a formula for increasing subsequent exposures to both types of patient. To translate doses the spectral irradiance (μW/cm 2 /nm) that would fall on the patient was measured in both the old broad band and the new narrow band treatment units and from this UV doses were calculated. All doses were expressed in mJ/cm 2 of unweighted UV over the range 250 nm to 400 nm. The erythemal effectiveness of the two units were compared by using the CIE 1987 curve to express doses in terms of the equivalent exposure of monochromatic 297 nm radiation. It was found that an exposure of 3.96 mJ/cm 2 from the broad band FS40 tubes and 12.79 mJ/cm 2 from the narrow band TL/01 tubes were both equivalent to 1.00 mJ/cm 2 of monochromatic 297 nm radiation so when transferring patients all broad band doses needed to be increased by a factor of 3.2. Before transferring any patients this factor was confirmed by conducting two minimal erythema dose (MED) tests on a normal subject, one in each unit. For new patients a

  1. 50 MW C-band pulse klystron; 50MW C band pulse klystron

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    C-band pulse klystron E3746 with an output of 50 MW class was developed jointly with the High-Energy Accelerator Research Organization in the Ministry of Education as the klystron for a linear accelerator. For a large-sized linear accelerator in the next generation, a klystron with higher operating frequency has been required to obtain a compact and efficient accelerator. In E3746, the problem of power resistance during high-frequency operation was solved by mounting a traveling-wave multi-cell output circuit. Moreover, stable operation in the pulse width of 2.5 {mu}s and the output of 54 MW was performed at the same operation efficiency (44%) as the conventional S-band tube by using the frequency (in a C-band frequency band) that is two times as high as the conventional general accelerator. (translated by NEDO)

  2. Comparison of band-to-band tunneling models in Si and Si—Ge junctions

    International Nuclear Information System (INIS)

    Jiao Yipeng; Wang Taihuan; Wei Kangliang; Du Gang; Liu Xiaoyan

    2013-01-01

    We compared several different band-to-band tunneling (BTBT) models with both Sentaurus and the two-dimensional full-band Monte Carlo simulator in Si homo-junctions and Si—Ge hetero-junctions. It was shown that in Si homo-junctions, different models could achieve similar results. However, in the Si—Ge hetero-junctions, there were significant differences among these models at high reverse biases (over 2 V). Compared to the nonlocal model, the local models in Sentaurus underrated the BTBT rate distinctly, and the Monte Carlo method was shown to give a better approximation. Additionally, it was found that in the Si region near the interface of the Si—Ge hetero-junctions, the direct tunneling rates increased largely due to the interaction of the band structures of Si and Ge. (semiconductor physics)

  3. Design of Dual-Band Two-Branch-Line Couplers with Arbitrary Coupling Coefficients in Bands

    Directory of Open Access Journals (Sweden)

    I. Prudyus

    2014-12-01

    Full Text Available A new approach to design dual-band two-branch couplers with arbitrary coupling coefficients at two operating frequency bands is proposed in this article. The method is based on the usage of equivalent subcircuits input reactances of the even-mode and odd-mode excitations. The exact design formulas for three options of the dual-band coupler with different location and number of stubs are received. These formulas permit to obtain the different variants for each structure in order to select the physically realizable solution and can be used in broad range of frequency ratio and power division ratio. For verification, three different dual-band couplers, which are operating at 2.4/3.9 GHz with different coupling coefficients (one with 3/6 dB, and 10/3 dB two others are designed, simulated, fabricated and tested. The measured results are in good agreement with the simulated ones.

  4. Band connectivity for topological quantum chemistry: Band structures as a graph theory problem

    Science.gov (United States)

    Bradlyn, Barry; Elcoro, L.; Vergniory, M. G.; Cano, Jennifer; Wang, Zhijun; Felser, C.; Aroyo, M. I.; Bernevig, B. Andrei

    2018-01-01

    The conventional theory of solids is well suited to describing band structures locally near isolated points in momentum space, but struggles to capture the full, global picture necessary for understanding topological phenomena. In part of a recent paper [B. Bradlyn et al., Nature (London) 547, 298 (2017), 10.1038/nature23268], we have introduced the way to overcome this difficulty by formulating the problem of sewing together many disconnected local k .p band structures across the Brillouin zone in terms of graph theory. In this paper, we give the details of our full theoretical construction. We show that crystal symmetries strongly constrain the allowed connectivities of energy bands, and we employ graph theoretic techniques such as graph connectivity to enumerate all the solutions to these constraints. The tools of graph theory allow us to identify disconnected groups of bands in these solutions, and so identify topologically distinct insulating phases.

  5. Band head spin assignment of superdeformed bands in 133Pr using two-parameter formulae

    Science.gov (United States)

    Sharma, Honey; Mittal, H. M.

    2018-03-01

    The two-parameter formulae viz. the power index formula, the nuclear softness formula and the VMI model are adopted to accredit the band head spin (I0) of four superdeformed rotational bands in 133Pr. The technique of least square fitting is used to accredit the band head spin for four superdeformed rotational bands in 133Pr. The root mean deviation among the computed transition energies and well-known experimental transition energies are attained by extracting the model parameters from the two-parameter formulae. The determined transition energies are in excellent agreement with the experimental transition energies, whenever exact spins are accredited. The power index formula coincides well with the experimental data and provides minimum root mean deviation. So, the power index formula is more efficient tool than the nuclear softness formula and the VMI model. The deviation of dynamic moment of inertia J(2) against the rotational frequency is also examined.

  6. Transport in bilayer and trilayer graphene: band gap engineering and band structure tuning

    Science.gov (United States)

    Zhu, Jun

    2014-03-01

    Controlling the stacking order of atomically thin 2D materials offers a powerful tool to control their properties. Linearly dispersed bands become hyperbolic in Bernal (AB) stacked bilayer graphene (BLG). Both Bernal (ABA) and rhombohedral (ABC) stacking occur in trilayer graphene (TLG), producing distinct band structures and electronic properties. A symmetry-breaking electric field perpendicular to the sample plane can further modify the band structures of BLG and TLG. In this talk, I will describe our experimental effort in these directions using dual-gated devices. Using thin HfO2 film deposited by ALD as gate dielectric, we are able to apply large displacement fields D > 6 V/nm and observe the opening and saturation of the field-induced band gap Eg in bilayer and ABC-stacked trilayer graphene, where the conduction in the mid gap changes by more than six decades. Its field and temperature dependence highlights the crucial role played by Coulomb disorder in facilitating hopping conduction and suppressing the effect of Eg in the tens of meV regime. In contrast, mid-gap conduction decreases with increasing D much more rapidly in clean h-BN dual-gated devices. Our studies also show the evolution of the band structure in ABA-stacked TLG, in particular the splitting of the Dirac-like bands in large D field and the signatures of two-band transport at high carrier densities. Comparison to theory reveals the need for more sophisticated treatment of electronic screening beyond self-consistent Hartree calculations to accurately predict the band structures of trilayer graphene and graphenic materials in general.

  7. Of mongooses and mitigation: ecological analogues to geoengineering

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, H Damon [Department of Geography, Planning and Environment, Concordia University, 1455 de Maisonneuve W, Montreal, QC, H3G 1M8 (Canada); Turner, Sarah E, E-mail: dmatthew@alcor.concordia.c [Department of Anthropology, University of Calgary, Calgary (Canada)

    2009-10-15

    Anthropogenic global warming is a growing environmental problem resulting from unintentional human intervention in the global climate system. If employed as a response strategy, geoengineering would represent an additional intentional human intervention in the climate system, with the intent of decreasing net climate impacts. There is a rich and fascinating history of human intervention in environmental systems, with many specific examples from ecology of deliberate human intervention aimed at correcting or decreasing the impact of previous unintentionally created problems. Additional interventions do not always bring the intended results, and in many cases there is evidence that net impacts have increased with the degree of human intervention. In this letter, we report some of the examples in the scientific literature that have documented such human interventions in environmental systems, which may serve as analogues to geoengineering. We argue that a high degree of system understanding is required for increased intervention to lead to decreased impacts. Given our current level of understanding of the climate system, it is likely that the result of at least some geoengineering efforts would follow previous ecological examples where increased human intervention has led to an overall increase in negative environmental consequences.

  8. Of mongooses and mitigation: ecological analogues to geoengineering

    International Nuclear Information System (INIS)

    Matthews, H Damon; Turner, Sarah E

    2009-01-01

    Anthropogenic global warming is a growing environmental problem resulting from unintentional human intervention in the global climate system. If employed as a response strategy, geoengineering would represent an additional intentional human intervention in the climate system, with the intent of decreasing net climate impacts. There is a rich and fascinating history of human intervention in environmental systems, with many specific examples from ecology of deliberate human intervention aimed at correcting or decreasing the impact of previous unintentionally created problems. Additional interventions do not always bring the intended results, and in many cases there is evidence that net impacts have increased with the degree of human intervention. In this letter, we report some of the examples in the scientific literature that have documented such human interventions in environmental systems, which may serve as analogues to geoengineering. We argue that a high degree of system understanding is required for increased intervention to lead to decreased impacts. Given our current level of understanding of the climate system, it is likely that the result of at least some geoengineering efforts would follow previous ecological examples where increased human intervention has led to an overall increase in negative environmental consequences.

  9. Agonistic behaviour patterns of the slender mongoose, Herpestes ...

    African Journals Online (AJOL)

    the shoulder of the other (Figure 2). One animal held its head in the horizontal position with the mouth opened vertically, while the other's head was twisted sideways with the mouth held horizontally. The only vocalizations that accompanied this threat were a spit and a growl, which were produced on two occasions.

  10. Methods of communication exhibited by captive slender mongooses ...

    African Journals Online (AJOL)

    4,6. Submissive grin. 4. 3,7. Urination. 79. 73,8. Defaecation. 43. 40,1. Anal drag. 38. 3S,S. Cheek rubbing. 12. 11,2. Grooming solicitation. 18. 16,8. peniS. ~t-___ scrotal sac anus j- - - - - opening to anal gland anal pouch rim 01 anal po uc h. Figure 5 External appearance of the anal pouch showing gland openings. R eprod.

  11. Development of softcopy environment for primary color banding visibility assessment

    Science.gov (United States)

    Min, Byungseok; Pizlo, Zygmunt; Allebach, Jan P.

    2008-01-01

    Fine-pitch banding is one of the most unwanted artifacts in laser electrophotographic (EP) printers. It is perceived as a quasiperiodic fluctuation in the process direction. Therefore, it is essential for printer vendors to know how banding is perceived by humans in order to improve print quality. Monochrome banding has been analyzed and assessed by many researchers; but there is no literature that deals with the banding of color laser printers as measured from actual prints. The study of color banding is complicated by the fact that the color banding signal is physically defined in a three-dimensional color space, while banding perception is described in a one-dimensional sense such as more banding or less banding. In addition, the color banding signal arises from the independent contributions of the four primary colorant banding signals. It is not known how these four distinct signals combine to give rise to the perception of color banding. In this paper, we develop a methodology to assess the banding visibility of the primary colorant cyan based on human visual perception. This is our first step toward studying the more general problem of color banding in combinations of two or more colorants. According to our method, we print and scan the cyan test patch, and extract the banding profile as a one dimensional signal so that we can freely adjust the intensity of banding. Thereafter, by exploiting the pulse width modulation capability of the laser printer, the extracted banding profile is used to modulate a pattern consisting of periodic lines oriented in the process direction, to generate extrinsic banding. This avoids the effect of the halftoning algorithm on the banding. Furthermore, to conduct various banding assessments more efficiently, we also develop a softcopy environment that emulates a hardcopy image on a calibrated monitor, which requires highly accurate device calibration throughout the whole system. To achieve the same color appearance as the hardcopy

  12. Structural Evolution of a Warm Frontal Precipitation Band During GCPEx

    Science.gov (United States)

    Colle, Brian A.; Naeger, Aaron; Molthan, Andrew; Nesbitt, Stephen

    2015-01-01

    A warm frontal precipitation band developed over a few hours 50-100 km to the north of a surface warm front. The 3-km WRF was able to realistically simulate band development, although the model is somewhat too weak. Band genesis was associated with weak frontogenesis (deformation) in the presence of weak potential and conditional instability feeding into the band region, while it was closer to moist neutral within the band. As the band matured, frontogenesis increased, while the stability gradually increased in the banding region. Cloud top generating cells were prevalent, but not in WRF (too stable). The band decayed as the stability increased upstream and the frontogenesis (deformation) with the warm front weakened. The WRF may have been too weak and short-lived with the band because too stable and forcing too weak (some micro issues as well).

  13. Strongly coupled band in 140Gd

    International Nuclear Information System (INIS)

    Falla-Sotelo, F.; Oliveira, J.R.B.; Rao, M.N.

    2005-01-01

    Several high-K states are known to exist in the mass 130-140 region. For the N=74 even-even isotopes, Kπ = 8 - isomers, with lifetimes ranging from ns to ms, are known in 128 Xe, 130 Ba, 132 Ce, 134 Nd, 136 Sm, and 138 Gd[. In 140 Gd, we have observed for the first time a band also based on an Iπ = 8 - state. This could be the first case of a Kπ = 8 - state observed in an N=76 even-even isotope. The systematics of the Kπ = 8 - isomeric states in N=74 isotopes has been studied by A.M. Bruce et al. These states decay towards the K = 0 ground state band, and the transitions are K-forbidden. The 140 Gd case presents strong similarities but also some significant differences with relation to the N=74 isotopes. We propose the same configuration but with larger deformation in 140 Gd

  14. Nanoindentation hardness of banded Australian sedimentary opal

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, P S; Smallwood, A S; Ray, A S [Department of Chemistry, Material and Forensic Science, University of Technology Sydney, PO Box 123, Broadway, NSW 2007 (Australia); Briscoe, B J; Parsonage, D [Department of Chemical Engineering and Chemical Technology, Imperial College of Science, Technology and Medicine, London, SW7 2AZ (United Kingdom)], E-mail: paul.thomas@uts.edu.au

    2008-04-07

    Nanoindentation hardness data in continuous stiffness mode are reported for banded potch and play of colour opals sourced from Lightning Ridge in New South Wales and Andamooka in South Australia. Despite the significant visible heterogeneities observed and the significant differences in origin and microstructures, as observed by SEM, and subtle differences in the elemental distributions between bands within specimens, little difference was observed in the mechanical properties. Specimens were found to be mechanically homogeneous and values of the hardness and moduli were found to be similar between samples. The creep behaviour of the specimens was also observed to be similar. It was concluded that the similarities in mechanical properties were due to the similarities in the silica morphology of the specimens, formed in similar geological environments, as differences in microstructure and trace element distribution were found not to significantly influence the observed bulk mechanical properties.

  15. L-Band RFI in Japan

    Science.gov (United States)

    Soldo, Yan; de Matthaeis, Paolo; Le Vine, David M.

    2016-01-01

    In recent years, three instruments have been launched into orbit with the aim of producing global maps of sea surface salinity and soil moisture using the 1400-1427 MHz band: SMOS, Aquarius and SMAP. Although this frequency band is allocated to passive measurements only, RFI (Radio-Frequency Interference) is present in the data of all three missions. On a global scale, the three sensors have observed approximately the same distribution of RFI. Japan is an important exception that has implications for the design of RFI detection algorithms. RFI in Japan is caused by a large number of emitters belonging to the same system (TV receivers) and for this reason some traditional RFI detection strategies detect little to no RFI over Japan. The study of this case has led to an improvement of the approach to detect RFI in Aquarius data.

  16. Design of an Electronic Chest-Band

    Science.gov (United States)

    Atakan, R.; Acikgoz Tufan, H.; Baskan, H.; Eryuruk, S. H.; Akalin, N.; Kose, H.; Li, Y.; Kursun Bahadir, S.; Kalaoglu, F.

    2017-10-01

    In this study, an electronic chest strap prototype was designed for measuring fitness level, performance optimization, mobility and fall detection. Knitting technology is used for production by using highly elastic nylon yarn. In order to evaluate comfort performance of the garment, yarn strength and elongation, air permeability, moisture management and FAST tests (Fabric Assurance Fabric Testing) were carried out, respectively. After testing of textile part of the chest band, IMU sensors were integrated onto the garment by means of conductive yarns. Electrical conductivity of the circuit was also assessed at the end. Results indicated that the weight and the thickness of the product are relatively high for sports uses and it has a negative impact on comfort properties. However, it is highly stretchable and moisture management properties are still in acceptable values. From the perspective of possible application areas, developed smart chest band in this research could be used in sports facilities as well as health care applications for elderly and disabled people.

  17. X-Band RF Gun Development

    International Nuclear Information System (INIS)

    Vlieks, A.E.

    2012-01-01

    In support of the MEGa-ray program at LLNL and the High Gradient research program at SLAC, a new X-band multi-cell RF gun is being developed. This gun, similar to earlier guns developed at SLAC for Compton X-ray source program, will be a standing wave structure made of 5.5 cells operating in the pi mode with copper cathode. This gun was designed following criteria used to build SLAC X-band high gradient accelerating structures. It is anticipated that this gun will operate with surface electric fields on the cathode of 200 MeV/m with low breakdown rate. RF will be coupled into the structure through a final cell with symmetric duel feeds and with a shape optimized to minimize quadrupole field components. In addition, geometry changes to the original gun, operated with Compton X-ray source, will include a wider RF mode separation, reduced surface electric and magnetic fields.

  18. W-band accelerator study in KEK

    International Nuclear Information System (INIS)

    Zhu Xiongwei; Nakajima, Kazuhisa

    2001-01-01

    In this paper, we summarize the W-band accelerator study in KEK. We present a design study on W-Band photocathode RF gun which is capable of generating and accelerating 300 pC electron bunch. The design system is made up of 91.392 GHz photocathode RF gun and 91.392 GHz traveling wave linac cells. Based on the numerical simulation using SUPERFISH and PARMELA and the conventional RF linac scaling law, the design will produce 300 pC at 1.74 MeV with bunch length 0.72 ps and normalized transverse emittance 0.55 mm mrad. We study the beam dynamics in high frequency and high gradient; due to the high gradient, the pondermotive effect plays an important role in beam dynamics; we found the pondermotive effect still exist with only the fundamental space harmonics (synchrotron mode) due to the coupling of the transverse and longitudinal motion

  19. Band mixing effects in mean field theories

    International Nuclear Information System (INIS)

    Kuyucak, S.; Morrison, I.

    1989-01-01

    The 1/N expansion method, which is an angular momentum projected mean field theory, is used to investigate the nature of electromagnetic transitions in the interacting boson model (IBM). Conversely, comparison with the exact IBM results sheds light on the range of validity of the mean field theory. It is shown that the projected mean field results for the E2 transitions among the ground, β and γ bands are incomplete for the spin dependent terms and it is essential to include band mixing effect for a correct (Mikhailov) analysis of E2 data. The algebraic expressions derived are general and will be useful in the analysis of experimental data in terms of both the sd and sdg boson models. 17 refs., 7 figs., 8 tabs

  20. Band engineering in twisted molybdenum disulfide bilayers

    Science.gov (United States)

    Zhao, Yipeng; Liao, Chengwei; Ouyang, Gang

    2018-05-01

    In order to explore the theoretical relationship between interlayer spacing, interaction and band offset at the atomic level in vertically stacked two-dimensional (2D) van der Waals (vdW) structures, we propose an analytical model to address the evolution of interlayer vdW coupling with random stacking configurations in MoS2 bilayers based on the atomic-bond-relaxation correlation mechanism. We found that interlayer spacing changes substantially with respect to the orientations, and the bandgap increases from 1.53 eV (AB stacking) to 1.68 eV (AA stacking). Our results reveal that the evolution of interlayer vdW coupling originates from the interlayer interaction, leading to interlayer separations and electronic properties changing with stacking configurations. Our predictions constitute a demonstration of twist engineering the band shift in the emergent class of 2D crystals, transition-metal dichalcogenides.

  1. Portable, x-band, linear accelerator systems

    International Nuclear Information System (INIS)

    Schonberg, R.G.; Deruyter, H.; Fowkes, W.R.; Johnson, W.A.; Miller, R.H.; Potter, J.M.; Weaver, J.N.

    1985-01-01

    Three light-weight, x-band, electron accelerators have been developed to provide a series of highly portable sources of x-rays and neutrons for nondestructive testing. The 1.5 MeV x-ray unit has a 200 kW magnetron for an RF source and an air-cooled, traveling wave accelerating structure to minimize its weight. The 4 and 6 MeV units share the same drive system which contains a 1.2 MW magnetron. The 4 MeV unit uses a traveling-wave guide to produce x-rays and the 6MeV unit uses a standing-wave guide to produce x-rays or neutrons. The choice of 9.3 GHz was dictated by the availability of a high power coaxial magnetron and by the obvious dimensional and weight advantages of a higher frequency over the more common S-band frequencies around 3 GHz

  2. Decreasing patient identification band errors by standardizing processes.

    Science.gov (United States)

    Walley, Susan Chu; Berger, Stephanie; Harris, Yolanda; Gallizzi, Gina; Hayes, Leslie

    2013-04-01

    Patient identification (ID) bands are an essential component in patient ID. Quality improvement methodology has been applied as a model to reduce ID band errors although previous studies have not addressed standardization of ID bands. Our specific aim was to decrease ID band errors by 50% in a 12-month period. The Six Sigma DMAIC (define, measure, analyze, improve, and control) quality improvement model was the framework for this study. ID bands at a tertiary care pediatric hospital were audited from January 2011 to January 2012 with continued audits to June 2012 to confirm the new process was in control. After analysis, the major improvement strategy implemented was standardization of styles of ID bands and labels. Additional interventions included educational initiatives regarding the new ID band processes and disseminating institutional and nursing unit data. A total of 4556 ID bands were audited with a preimprovement ID band error average rate of 9.2%. Significant variation in the ID band process was observed, including styles of ID bands. Interventions were focused on standardization of the ID band and labels. The ID band error rate improved to 5.2% in 9 months (95% confidence interval: 2.5-5.5; P error rates. This decrease in ID band error rates was maintained over the subsequent 8 months.

  3. Photon side-bands in mesoscopics

    DEFF Research Database (Denmark)

    Jauho, Antti-Pekka

    1998-01-01

    This paper reviews several applications of photonic side bands, used by Buttiker and Landauer (Phys. Rev. Lett. 49, 1739 (1982)) in their theory of traversal time in tunneling, in transport and optics of mesoscopic systems. Topics include generalizations of the transmission theory of transport...... to time-dependent situations, optics and transport of mesoscopic systems in THz electromagnetic fields, and phase-measurements of photon-assisted tunneling through a quantum dot. (C) 1998 Academic Press Limited....

  4. Identifying chiral bands in real nuclei

    International Nuclear Information System (INIS)

    Shirinda, O.; Lawrie, E.A.

    2012-01-01

    The application of the presently used fingerprints of chiral bands (originally derived for strongly broken chirality) is investigated for real chiral systems. In particular the chiral fingerprints concerning the B(M1) staggering patterns and the energy staggering are studied. It is found that both fingerprints show considerable changes for real chiral systems, a behaviour that creates a significant risk for misinterpretation of the experimental data and can lead to a failure to identify real chiral systems. (orig.)

  5. Large Aperture, Scanning, L-Band SAR

    Science.gov (United States)

    Moussessian, Alina; DelCastillo, Linda; Bach, Vinh; Grando, Maurio; Quijano, Ubaldo; Smith, Phil; Zawadzki, Mark

    2011-01-01

    We have developed the first L-band membrane-based active phased array. The antenna is a 16x16 element patch array with dimensions of 2.3mx2.6m. The array uses membrane-compatible Transmit/Receive (T/R) modules for electronic beam steering. We will discuss the antenna design, the fabrication of this large array, the T/R module development, the signal distribution approach and the measured results of the array

  6. Shifted identical bands: A new phenomenon

    International Nuclear Information System (INIS)

    Jones, E.F.; Lima, A.P. de; Gore, P.M.; Hamilton, J.H.; Ramayya, A.V.; Dodder, R.S.; Kormicki, J.; Hwang, J.K.; Beyer, C.J.; Zhang, X.Q.; Zhu, S.J.; Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Daniel, A.V.; Rasmussen, J.O.; Lee, I.Y.; Cole, J.D.; Drigert, M.W.; Ma, W.-C.

    2001-01-01

    The levels in 162 Gd were identified in spontaneous fission studies. Its transition energies are remarkably similar to those in 160 Gd. From that work, an analysis of yrast bands in even-even proton to neutron-rich Ba to Pb nuclei led to the discovery of a new phenomenon, shifted identical bands (SIB). SIBs are yrast bands in neighboring nuclei (a, b) with moments of inertia which are identical when shifted by a constant amount κ, so J 1a (1 + κ) = J 1b , from 2 + to 8 + and higher to 16 + . Out of over 700 comparisons, 55 SIBs were found from stable to the most neutron-rich Ce-W nuclei with |κ-bar| between 1.5% and 13%, where the spread in κ is less than ± 1%, and only four identical bands (κ-bar congruent with 0). As examples, we found for 158 Sm- 160 Gd, κ-bar (-3.2 +0.1 -0.2 )% (where the ± is the total spread in κ from -3.1 to -3.4); 156 Nd- 160 Gd, (-10.6 +0.4 -0.2 )%; 158 Sm- 160 Sm, (3.4 +0.5 -0.3 )%. The J 1 values were fitted to a variable moment of inertia model with parameters J 0 and C whose values correlate with the SIB J 1 values. The SIBs are not correlated either with deformation or with the N p N n product of the IBA model

  7. Fermion dynamical symmetry and identical bands

    International Nuclear Information System (INIS)

    Guidry, M.

    1994-01-01

    Recent general attention has been directed to the phenomenon of identical bands in both normally deformed and superdeformed nuclei. This paper discusses the possibility that such behavior results from a dynamical symmetry of the nuclear many-body system. Phenomenology and the basic principles of Lie algebras are used to place conditions on the acceptable properties of a candidate symmetry. We find that quite general arguments require that such a symmetry have a minimum of 21 generators with a microscopic fermion interpretation

  8. Broadband S-band class E HPA

    NARCIS (Netherlands)

    Wanum, M.; van Dijk, R.; de Hek, A.P.; van Vliet, Frank Edward

    2009-01-01

    A broadband class E High Power Amplifier (HPA) is presented. This HPA is designed to operate at S-band (2.75 to 3.75 GHz). A power added efficiency of 50% is obtained for the two stage amplifier with an output power of 35.5 dBm on a chip area of 5.25 times 2.8 mm2.

  9. Comparison of eigensolvers for symmetric band matrices.

    Science.gov (United States)

    Moldaschl, Michael; Gansterer, Wilfried N

    2014-09-15

    We compare different algorithms for computing eigenvalues and eigenvectors of a symmetric band matrix across a wide range of synthetic test problems. Of particular interest is a comparison of state-of-the-art tridiagonalization-based methods as implemented in Lapack or Plasma on the one hand, and the block divide-and-conquer (BD&C) algorithm as well as the block twisted factorization (BTF) method on the other hand. The BD&C algorithm does not require tridiagonalization of the original band matrix at all, and the current version of the BTF method tridiagonalizes the original band matrix only for computing the eigenvalues. Avoiding the tridiagonalization process sidesteps the cost of backtransformation of the eigenvectors. Beyond that, we discovered another disadvantage of the backtransformation process for band matrices: In several scenarios, a lot of gradual underflow is observed in the (optional) accumulation of the transformation matrix and in the (obligatory) backtransformation step. According to the IEEE 754 standard for floating-point arithmetic, this implies many operations with subnormal (denormalized) numbers, which causes severe slowdowns compared to the other algorithms without backtransformation of the eigenvectors. We illustrate that in these cases the performance of existing methods from Lapack and Plasma reaches a competitive level only if subnormal numbers are disabled (and thus the IEEE standard is violated). Overall, our performance studies illustrate that if the problem size is large enough relative to the bandwidth, BD&C tends to achieve the highest performance of all methods if the spectrum to be computed is clustered. For test problems with well separated eigenvalues, the BTF method tends to become the fastest algorithm with growing problem size.

  10. Collective oblate bands in Pb nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Huebel, H; Baldsefen, G; Mehta, D [Bonn Univ. (Germany). Inst. fuer Strahlen- und Kernphysik; and others

    1992-08-01

    The coexistence of different nuclear shapes is a well established phenomenon in the Hg-Pb region, where spherical, oblate, prolate and superdeformed prolate shapes have been observed. In this work, the authors report on several new rotational bands in the normally spherical nuclei {sup 199-201}Pb. Similar structures were found previously in the lighter isotopes {sup 197,198}Pb. 11 refs., 1 tab., 3 figs.

  11. ''Identical'' bands in normally-deformed nuclei

    International Nuclear Information System (INIS)

    Garrett, J.D.; Baktash, C.; Yu, C.H.

    1990-01-01

    Gamma-ray transitions energies in neighboring odd- and even-mass nuclei for normally-deformed nuclear configurations are analyzed in a manner similar to recent analyses for superdeformed states. The moment of inertia is shown to depend on pair correlations and the aligned angular momentum of the odd nucleon. The implications of this analysis for ''identical'' super-deformed bands are discussed. 26 refs., 9 figs

  12. Proceedings of wide band gap semiconductors

    International Nuclear Information System (INIS)

    Moustakas, T.D.; Pankove, J.I.; Hamakawa, Y.

    1992-01-01

    This book contains the proceedings of wide band gap semiconductors. Wide band gap semiconductors are under intense study because of their potential applications in photonic devices in the visible and ultraviolet part of the electromagnetic spectrum, and devices for high temperature, high frequency and high power electronics. Additionally, due to their unique mechanical, thermal, optical, chemical, and electronic properties many wide band gap semiconductors are anticipated to find applications in thermoelectric, electrooptic, piezoelectric and acoustooptic devices as well as protective coatings, hard coatings and heat sinks. Material systems covered in this symposium include diamond, II-VI compounds, III-V nitrides, silicon carbide, boron compounds, amorphous and microcrystalline semiconductors, chalcopyrites, oxides and halides. The various papers addressed recent experimental and theoretical developments. They covered issues related to crystal growth (bulk and thin films), structure and microstructure, defects, doping, optoelectronic properties and device applications. A theoretical session was dedicated to identifying common themes in the heteroepitaxy and the role of defects in doping, compensation and phase stability of this unique class of materials. Important experimental milestones included the demonstrations of bright blue injection luminescence at room temperatures from junctions based on III-V nitrides and a similar result from multiple quantum wells in a ZnSe double heterojunction at liquid nitrogen temperatures

  13. Topological magnon bands in ferromagnetic star lattice

    International Nuclear Information System (INIS)

    Owerre, S A

    2017-01-01

    The experimental observation of topological magnon bands and thermal Hall effect in a kagomé lattice ferromagnet Cu(1–3, bdc) has inspired the search for topological magnon effects in various insulating ferromagnets that lack an inversion center allowing a Dzyaloshinskii–Moriya (DM) spin–orbit interaction. The star lattice (also known as the decorated honeycomb lattice) ferromagnet is an ideal candidate for this purpose because it is a variant of the kagomé lattice with additional links that connect the up-pointing and down-pointing triangles. This gives rise to twice the unit cell of the kagomé lattice, and hence more interesting topological magnon effects. In particular, the triangular bridges on the star lattice can be coupled either ferromagnetically or antiferromagnetically which is not possible on the kagomé lattice ferromagnets. Here, we study DM-induced topological magnon bands, chiral edge modes, and thermal magnon Hall effect on the star lattice ferromagnet in different parameter regimes. The star lattice can also be visualized as the parent material from which topological magnon bands can be realized for the kagomé and honeycomb lattices in some limiting cases. (paper)

  14. Topological magnon bands in ferromagnetic star lattice.

    Science.gov (United States)

    Owerre, S A

    2017-05-10

    The experimental observation of topological magnon bands and thermal Hall effect in a kagomé lattice ferromagnet Cu(1-3, bdc) has inspired the search for topological magnon effects in various insulating ferromagnets that lack an inversion center allowing a Dzyaloshinskii-Moriya (DM) spin-orbit interaction. The star lattice (also known as the decorated honeycomb lattice) ferromagnet is an ideal candidate for this purpose because it is a variant of the kagomé lattice with additional links that connect the up-pointing and down-pointing triangles. This gives rise to twice the unit cell of the kagomé lattice, and hence more interesting topological magnon effects. In particular, the triangular bridges on the star lattice can be coupled either ferromagnetically or antiferromagnetically which is not possible on the kagomé lattice ferromagnets. Here, we study DM-induced topological magnon bands, chiral edge modes, and thermal magnon Hall effect on the star lattice ferromagnet in different parameter regimes. The star lattice can also be visualized as the parent material from which topological magnon bands can be realized for the kagomé and honeycomb lattices in some limiting cases.

  15. Surface band structures on Nb(001)

    International Nuclear Information System (INIS)

    Fang, B.; Lo, W.; Chien, T.; Leung, T.C.; Lue, C.Y.; Chan, C.T.; Ho, K.M.

    1994-01-01

    We report the joint studies of experimental and theoretical surface band structures of Nb(001). Angle-resolved photoelectron spectroscopy was used to determine surface-state dispersions along three high-symmetry axes bar Γ bar M, bar Γ bar X, and bar M bar X in the surface Brillouin zone. Ten surface bands have been identified. The experimental data are compared to self-consistent pseudopotential calculations for the 11-layer Nb(001) slabs that are either bulk terminated or fully relaxed (with a 12% contraction for the first interlayer spacing). The band calculations for a 12% surface-contracted slab are in better agreement with the experimental results than those for a bulk-terminated slab, except for a surface resonance near the Fermi level, which is related to the spin-orbit interaction. The charge profiles for all surface states or resonances have been calculated. Surface contraction effects on the charge-density distribution and the energy position of surface states and resonances will also be discussed

  16. Frequency Arrangement For 700 MHz Band

    Directory of Open Access Journals (Sweden)

    Ancans G.

    2015-02-01

    Full Text Available The 694-790 MHz (700 MHz band was allocated by the 2012 World Radiocommunication Conference (WRC-12 in ITU Region 1 (Europe included, to the mobile service on a co-primary basis with other services to which this band was allocated on the primary basis and identified for the International Mobile Telecommunications (IMT. At the same time, the countries of Region 1 will be able also to continue using these frequencies for their broadcasting services if necessary. This allocation will be effective immediately after 2015 World Radiocommunication Conference (WRC-15. In order to make the best possible use of this frequency band for mobile service, a worldwide harmonized frequency arrangement is to be prepared to allow for large economies of scale and international roaming as well as utilizing the available spectrum in the best possible way, minimizing possible interference between services, facilitating deployment and cross-border coordination. The authors analyze different possible frequency arrangements and conclude on the frequency arrangement most suitable for Europe.

  17. Wakefield Band Partitioning in LINAC Structures

    International Nuclear Information System (INIS)

    Jones, Roger M

    2003-01-01

    In the NLC project multiple bunches of electrons and positrons will be accelerated initially to a centre of mass of 500 GeV and later to 1 TeV or more. In the process of accelerating 192 bunches within a pulse train, wakefields are excited which kick the trailing bunches off axis and can cause luminosity dilution and BBU (Beam Break Up). Several structures to damp the wakefield have been designed and tested at SLAC and KEK and these have been found to successfully damp the wakefield [1]. However, these 2π/3 structures suffered from electrical breakdown and this has prompted us to explore lower group velocity structures operating at higher fundamental mode phase advances. The wakefield partitioning amongst the bands has been found to change markedly with increased phase advance. Here we report on general trends in the kick factor and associated wakefield band partitioning in dipole bands as a function of phase advance of the synchronous mode in linacs. These results are applicable to both TW (travelling wave) and SW (standing wave) structures

  18. SHARPENDING OF THE VNIR AND SWIR BANDS OF THE WIDE BAND SPECTRAL IMAGER ONBOARD TIANGONG-II IMAGERY USING THE SELECTED BANDS

    Directory of Open Access Journals (Sweden)

    Q. Liu

    2018-04-01

    Full Text Available The Tiangong-II space lab was launched at the Jiuquan Satellite Launch Center of China on September 15, 2016. The Wide Band Spectral Imager (WBSI onboard the Tiangong-II has 14 visible and near-infrared (VNIR spectral bands covering the range from 403–990 nm and two shortwave infrared (SWIR bands covering the range from 1230–1250 nm and 1628–1652 nm respectively. In this paper the selected bands are proposed which aims at considering the closest spectral similarities between the VNIR with 100 m spatial resolution and SWIR bands with 200 m spatial resolution. The evaluation of Gram-Schmidt transform (GS sharpening techniques embedded in ENVI software is presented based on four types of the different low resolution pan band. The experimental results indicated that the VNIR band with higher CC value with the raw SWIR Band was selected, more texture information was injected the corresponding sharpened SWIR band image, and at that time another sharpened SWIR band image preserve the similar spectral and texture characteristics to the raw SWIR band image.

  19. Spectral band selection for classification of soil organic matter content

    Science.gov (United States)

    Henderson, Tracey L.; Szilagyi, Andrea; Baumgardner, Marion F.; Chen, Chih-Chien Thomas; Landgrebe, David A.

    1989-01-01

    This paper describes the spectral-band-selection (SBS) algorithm of Chen and Landgrebe (1987, 1988, and 1989) and uses the algorithm to classify the organic matter content in the earth's surface soil. The effectiveness of the algorithm was evaluated comparing the results of classification of the soil organic matter using SBS bands with those obtained using Landsat MSS bands and TM bands, showing that the algorithm was successful in finding important spectral bands for classification of organic matter content. Using the calculated bands, the probabilities of correct classification for climate-stratified data were found to range from 0.910 to 0.980.

  20. Retrospective biodosimetry with small tooth enamel samples using K-Band and X-Band

    International Nuclear Information System (INIS)

    Gomez, Jorge A.; Kinoshita, Angela; Leonor, Sergio J.; Belmonte, Gustavo C.; Baffa, Oswaldo

    2011-01-01

    In an attempt to make the in vitro electron spin resonance (ESR) retrospective dosimetry of the tooth enamel a lesser invasive method, experiments using X-Band and K-Band were performed, aiming to determine conditions that could be used in cases of accidental exposures. First, a small prism from the enamel was removed and ground with an agate mortar and pestle until particles reach a diameter of approximately less than 0.5 mm. This enamel extraction process resulted in lower signal artifact compared with the direct enamel extraction performed with a diamond burr abrasion. The manual grinding of the enamel does not lead to any induced ESR signal artifact, whereas the use of a diamond burr at low speed produces a signal artifact equivalent to the dosimetric signal induced by a dose of 500 mGy of gamma irradiation. A mass of 25 mg of enamel was removed from a sound molar tooth previously irradiated in vitro with a dose of 100 mGy. This amount of enamel was enough to detect the dosimetric signal in a standard X-Band spectrometer. However using a K-Band spectrometer, samples mass between 5 and 10 mg were sufficient to obtain the same sensitivity. An overall evaluation of the uncertainties involved in the process in this and other dosimetric assessments performed at our laboratory indicates that it is possible at K-Band to estimate a 100 mGy dose with 25% accuracy. In addition, the use of K-Band also presented higher sensitivity and allowed the use of smaller sample mass in comparison with X-Band. Finally, the restoration process performed on a tooth after extraction of the 25 mg of enamel is described. This was conducted by dental treatment using photopolymerizable resin which enabled complete recovery of the tooth from the functional and aesthetic viewpoint showing that this procedure can be minimally invasive.

  1. Retrospective biodosimetry with small tooth enamel samples using K-Band and X-Band

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, Jorge A. [Departamento de Fisica, FFCLRP, Universidade de Sao Paulo, 14040-901 Ribeirao Preto, Sao Paulo (Brazil); Kinoshita, Angela [Departamento de Fisica, FFCLRP, Universidade de Sao Paulo, 14040-901 Ribeirao Preto, Sao Paulo (Brazil); Universidade Sagrado Coracao - USC, 17011-160 Bauru, Sao Paulo (Brazil); Leonor, Sergio J. [Departamento de Fisica, FFCLRP, Universidade de Sao Paulo, 14040-901 Ribeirao Preto, Sao Paulo (Brazil); Belmonte, Gustavo C. [Universidade Sagrado Coracao - USC, 17011-160 Bauru, Sao Paulo (Brazil); Baffa, Oswaldo, E-mail: baffa@usp.br [Departamento de Fisica, FFCLRP, Universidade de Sao Paulo, 14040-901 Ribeirao Preto, Sao Paulo (Brazil)

    2011-09-15

    In an attempt to make the in vitro electron spin resonance (ESR) retrospective dosimetry of the tooth enamel a lesser invasive method, experiments using X-Band and K-Band were performed, aiming to determine conditions that could be used in cases of accidental exposures. First, a small prism from the enamel was removed and ground with an agate mortar and pestle until particles reach a diameter of approximately less than 0.5 mm. This enamel extraction process resulted in lower signal artifact compared with the direct enamel extraction performed with a diamond burr abrasion. The manual grinding of the enamel does not lead to any induced ESR signal artifact, whereas the use of a diamond burr at low speed produces a signal artifact equivalent to the dosimetric signal induced by a dose of 500 mGy of gamma irradiation. A mass of 25 mg of enamel was removed from a sound molar tooth previously irradiated in vitro with a dose of 100 mGy. This amount of enamel was enough to detect the dosimetric signal in a standard X-Band spectrometer. However using a K-Band spectrometer, samples mass between 5 and 10 mg were sufficient to obtain the same sensitivity. An overall evaluation of the uncertainties involved in the process in this and other dosimetric assessments performed at our laboratory indicates that it is possible at K-Band to estimate a 100 mGy dose with 25% accuracy. In addition, the use of K-Band also presented higher sensitivity and allowed the use of smaller sample mass in comparison with X-Band. Finally, the restoration process performed on a tooth after extraction of the 25 mg of enamel is described. This was conducted by dental treatment using photopolymerizable resin which enabled complete recovery of the tooth from the functional and aesthetic viewpoint showing that this procedure can be minimally invasive.

  2. Generalized seniority scheme for bands in odd-A nuclei

    International Nuclear Information System (INIS)

    Gai, M.; Arima, A.; Strottman, D.

    1980-01-01

    The microscopic generalized seniority scheme is applied for the description of bands in odd-A nuclei. A perturbation expansion in terms of the core-particle interaction is performed. The first-order correction for the band head and the first member of the band is discussed. The specific band structure of a given nucleus, as well as the systematic trend of bands, is described in an explicit N-dependent analytical formula. This formula involves a linear dependence on N which arises from the first-order perturbation expansion. This term is shown responsible for the large deviation of the 11/2 - ΔJ=2 band spacing in I isotopes from the spacing of the Te core. All observed band structures of an odd-A nucleus arise from one simple core-particle coupling. Hence decoupled-E2 bands and strongly coupled ΔJ=1 bands, particle or hole bands of low-spin or high-spin orbits, all follow one simple N-dependence. This uniformity of bands is manifested in E2 bands in 53 I isotopes and deltaJ=1 bands in 51 Sb that have the same 52 Te cores. For the calculations a particle-particle force with a large contribution from a g delta force is used with a coupling constant that is deduced from 210 Pb. 1 figure

  3. Superdeformed bands in 64147Gd83, a possible test of the existence of octupole correlations in superdeformed bands

    International Nuclear Information System (INIS)

    Zuber, K.; Balouka, D.; Beck, F.A.; Byrski, T.; Curien, D.; Duchene, G.; Gehringer, C.; Haas, B.; Merdinger, J.C.; Romain, P.; Santos, D.; Styczen, J.; Vivien, J.P.; Dudek, J.; Szymanski, Z.; Werner, T.

    1990-01-01

    Two discrete superdeformed bands (SD) have been identified in the nucleus 147 Gd. The transitions energies of the SD yrast band lie halfway between the γ-ray energies of the yrast SD band in 146 Gd while the transition energies of the excited band lie half way between the transition energies of the yrast SD band in 148 Gd. These two bands are shown to exhibit the presence of the pseudo SU(3) symmetry and also indicate the possible existence of octupole correlations at large elongations and high spins. (orig.)

  4. Intestinal malrotation and Ladd's bands in a young child | Gaido ...

    African Journals Online (AJOL)

    Intestinal malrotation and Ladd's bands in a young child. ... East African Medical Journal ... potentially more challenging, as it was not the most typical age for duodenal stenosis due to Ladd's bands, which is often mostly observed earlier in life.

  5. Magnetism and magnetostriction in a degenerate rigid band

    International Nuclear Information System (INIS)

    Kulakowski, K.; Barbara, B.

    1990-09-01

    We investigate the influence of the spin-orbit coupling on the magnetic and magnetoelastic phenomena in ferromagnetic band systems. The description is within the Stoner model of a degenerate rigid band, for temperature T = O. (author). 14 refs

  6. Active Multispectral Band Selection and Reflectance Measurement System

    National Research Council Canada - National Science Library

    Rennich, Bradley

    1999-01-01

    .... To aid in the selection of these bands, a novel multispectral band selection technique is presented based on the cross-correlation of the material class reflectance spectra over a wavelength range of 1 - 5 microns...

  7. Assessment of Multipath and Shadowing Effects on UHF Band in ...

    African Journals Online (AJOL)

    Sultan

    bands are used for television broadcasting, mobile cellular systems, Wi-Fi, satellite communications and many others. Effective communication link in the UHF band requires direct line of sight ..... ad-hoc 802.11 wireless LAN (WLAN) devices.

  8. Modeling direct band-to-band tunneling: From bulk to quantum-confined semiconductor devices

    Science.gov (United States)

    Carrillo-Nuñez, H.; Ziegler, A.; Luisier, M.; Schenk, A.

    2015-06-01

    A rigorous framework to study direct band-to-band tunneling (BTBT) in homo- and hetero-junction semiconductor nanodevices is introduced. An interaction Hamiltonian coupling conduction and valence bands (CVBs) is derived using a multiband envelope method. A general form of the BTBT probability is then obtained from the linear response to the "CVBs interaction" that drives the system out of equilibrium. Simple expressions in terms of the one-electron spectral function are developed to compute the BTBT current in two- and three-dimensional semiconductor structures. Additionally, a two-band envelope equation based on the Flietner model of imaginary dispersion is proposed for the same purpose. In order to characterize their accuracy and differences, both approaches are compared with full-band, atomistic quantum transport simulations of Ge, InAs, and InAs-Si Esaki diodes. As another numerical application, the BTBT current in InAs-Si nanowire tunnel field-effect transistors is computed. It is found that both approaches agree with high accuracy. The first one is considerably easier to conceive and could be implemented straightforwardly in existing quantum transport tools based on the effective mass approximation to account for BTBT in nanodevices.

  9. Modeling direct band-to-band tunneling: From bulk to quantum-confined semiconductor devices

    International Nuclear Information System (INIS)

    Carrillo-Nuñez, H.; Ziegler, A.; Luisier, M.; Schenk, A.

    2015-01-01

    A rigorous framework to study direct band-to-band tunneling (BTBT) in homo- and hetero-junction semiconductor nanodevices is introduced. An interaction Hamiltonian coupling conduction and valence bands (CVBs) is derived using a multiband envelope method. A general form of the BTBT probability is then obtained from the linear response to the “CVBs interaction” that drives the system out of equilibrium. Simple expressions in terms of the one-electron spectral function are developed to compute the BTBT current in two- and three-dimensional semiconductor structures. Additionally, a two-band envelope equation based on the Flietner model of imaginary dispersion is proposed for the same purpose. In order to characterize their accuracy and differences, both approaches are compared with full-band, atomistic quantum transport simulations of Ge, InAs, and InAs-Si Esaki diodes. As another numerical application, the BTBT current in InAs-Si nanowire tunnel field-effect transistors is computed. It is found that both approaches agree with high accuracy. The first one is considerably easier to conceive and could be implemented straightforwardly in existing quantum transport tools based on the effective mass approximation to account for BTBT in nanodevices

  10. Modeling direct band-to-band tunneling: From bulk to quantum-confined semiconductor devices

    Energy Technology Data Exchange (ETDEWEB)

    Carrillo-Nuñez, H.; Ziegler, A.; Luisier, M.; Schenk, A. [Integrated Systems Laboratory ETH Zürich, Gloriastrasse 35, 8092 Zürich (Switzerland)

    2015-06-21

    A rigorous framework to study direct band-to-band tunneling (BTBT) in homo- and hetero-junction semiconductor nanodevices is introduced. An interaction Hamiltonian coupling conduction and valence bands (CVBs) is derived using a multiband envelope method. A general form of the BTBT probability is then obtained from the linear response to the “CVBs interaction” that drives the system out of equilibrium. Simple expressions in terms of the one-electron spectral function are developed to compute the BTBT current in two- and three-dimensional semiconductor structures. Additionally, a two-band envelope equation based on the Flietner model of imaginary dispersion is proposed for the same purpose. In order to characterize their accuracy and differences, both approaches are compared with full-band, atomistic quantum transport simulations of Ge, InAs, and InAs-Si Esaki diodes. As another numerical application, the BTBT current in InAs-Si nanowire tunnel field-effect transistors is computed. It is found that both approaches agree with high accuracy. The first one is considerably easier to conceive and could be implemented straightforwardly in existing quantum transport tools based on the effective mass approximation to account for BTBT in nanodevices.

  11. Precipitation Estimation Using L-Band and C-Band Soil Moisture Retrievals

    Science.gov (United States)

    Koster, Randal D.; Brocca, Luca; Crow, Wade T.; Burgin, Mariko S.; De Lannoy, Gabrielle J. M.

    2016-01-01

    An established methodology for estimating precipitation amounts from satellite-based soil moisture retrievals is applied to L-band products from the Soil Moisture Active Passive (SMAP) and Soil Moisture and Ocean Salinity (SMOS) satellite missions and to a C-band product from the Advanced Scatterometer (ASCAT) mission. The precipitation estimates so obtained are evaluated against in situ (gauge-based) precipitation observations from across the globe. The precipitation estimation skill achieved using the L-band SMAP and SMOS data sets is higher than that obtained with the C-band product, as might be expected given that L-band is sensitive to a thicker layer of soil and thereby provides more information on the response of soil moisture to precipitation. The square of the correlation coefficient between the SMAP-based precipitation estimates and the observations (for aggregations to approximately100 km and 5 days) is on average about 0.6 in areas of high rain gauge density. Satellite missions specifically designed to monitor soil moisture thus do provide significant information on precipitation variability, information that could contribute to efforts in global precipitation estimation.

  12. Simultaneous confidence bands for the integrated hazard function

    OpenAIRE

    Dudek, Anna; Gocwin, Maciej; Leskow, Jacek

    2006-01-01

    The construction of the simultaneous confidence bands for the integrated hazard function is considered. The Nelson--Aalen estimator is used. The simultaneous confidence bands based on bootstrap methods are presented. Two methods of construction of such confidence bands are proposed. The weird bootstrap method is used for resampling. Simulations are made to compare the actual coverage probability of the bootstrap and the asymptotic simultaneous confidence bands. It is shown that the equal--tai...

  13. Microscopic description of the three major bands in transitional nuclei

    International Nuclear Information System (INIS)

    Pineda S, R.L.

    1986-01-01

    The author has extended the Coherent Phonon Model to the description of the three major bands in medium heavy transitional nuclei. The model assumes an axially symmetric deformed ground intrinsic state for the description of the low lying yrast levels of the ground band, while the excited bands are generated by intrinsic excitations of the ground band. Good angular momentum states are generated by the Peierls-Yoccoz angular momentum projection method

  14. Identical bands in Ba-Dy, N < 104 space

    International Nuclear Information System (INIS)

    Mittal, H.M.; Vidya Devi; Gupta, J.B.

    2008-01-01

    The recognition of the existence of identical bands, in even-even, odd-even and odd-odd nuclei, in normal deformed bands and superdeformed bands has become the subject of great interest in recent years. Here the search have been taken for such bands for the normal deformed, even-Z, even-N nuclei of Ba and Dy for 82< N<104 major shell space

  15. Vortex excitations and identical superdeformed bands

    Energy Technology Data Exchange (ETDEWEB)

    Waddington, J C; Bhaduri, R K [McMaster Univ., Hamilton, ON (Canada). Dept. of Physics

    1992-08-01

    Striking relationships exist amongst the transition energies of the identical superdeformed bands (SDB). In this paper, the authors suggest that all of these bands in both the mass 150 and mass 190 regions can be explained as excitations of the specially stable doubly closed shell {sup 152}Dy. Typical of these bands is the case of {sup 153}Dy. Two excited SDB`s were observe which not only have a moment of inertia identical to that of {sup 152}Dy, but the transition energies are shifted by exactly {+-}1/4 of a rotational spacing. It is as though the spin 1/2 of the last neutron had been added directly to the angular momentum of the core, but the mass of this last particle had not contributed to the moment of inertia. The possibility is being investigated that the identical SDBs arise from an equivalent picture under the strong rotation of the specially stable {sup 152}Dy. The rotation renders the 3-dimensional space topologically nontrivial. The moment of inertia of {sup 192}Hg extrapolated to zero spin is identical to that of {sup 152}Dy at high spin. This suggests that a superfluid is formed as particles are added to {sup 152}Dy to make {sup 192}Hg. It is proposed that as the rotational frequency of {sup 192}Hg is increased, quantized vortices are formed, like vortices in superfluid {sup 4}He. These vortices lead to an additional alignment in{sup 192}Hg relative to the {sup 152} core, increasing as I{sup 2}, reaching a value of 4{Dirac_h} at I = 48. 3 refs., 3 figs.

  16. Thermodynamics of many-band superconductors

    International Nuclear Information System (INIS)

    Waelte, A.

    2006-01-01

    In the present thesis the microscopical properties of the superconducting state of MgCNi 3 , MgB 2 , and some rare earth-transition metal borocarbides are studied by means of measurements of the specific heat. Furthermore the frequency spectrum of the lattice vibrations is estimated. The energy gap of the superconducting state can be determined from the specific heat of the superconducting state, which yields as like as the upper critical mafnetic field H c2 (0) hints on the electron-phonon coupling. From the analysis of these results and the comparison with results from transport measurements as well as the tunnel and point-contact spectroscopy can be concluded, how far the BCS model of superconductivity must be modified in order to be able to describe the superconducting state of the studied compounds. Studies on MgCNi 3 , which lies near a magnetic instability, show that occurring magnetic fluctuations have a bisection of the superconducting transition temperature T C as consequence. The under this aspect relatively high value of T C =7 K is a consequence of strong electron-phonon coupling, which is essentailly carried by nickel vibrations stabilized by carbon. A for the first time observed distinct anomaly in the specific heat of the classical many-band superconductor MgB 2 (here with pure 10 B) at about T c /4=10 K can be understood by means of a two-band model for the case of especially weak coupling between both bands. The analysis of the specific heat of the superconducting phase of the non-magnetic rare earth-nickel borocarbide YNi 2 B 2 C and LuNi 2 B 2 C leads to the conclusion thet visible effects of the many-band electron system are dependent on the mass on the position both of the rare earth and the transition metal. The signal of the superconducting phase transformation visible in the specific heat of the antiferromagnetic HoNi 2 B 2 C is smaller than expected

  17. Clear-air lidar dark band

    Science.gov (United States)

    Girolamo, Paolo Di; Scoccione, Andrea; Cacciani, Marco; Summa, Donato; Schween, Jan H.

    2018-04-01

    This paper illustrates measurements carried out by the Raman lidar BASIL in the frame of HOPE, revealing the presence of a clear-air dark band phenomenon (i.e. the appearance of a minimum in lidar backscatter echoes) in the upper portion of the convective boundary layer. The phenomenon is clearly distinguishable in the lidar backscatter echoes at 1064 nm. This phenomenon is attributed to the presence of lignite aerosol particles advected from the surrounding open pit mines in the vicinity of the measuring site.

  18. Fermion dynamical symmetry and identical bands

    International Nuclear Information System (INIS)

    Guidry, M.

    1995-01-01

    Recent general attention has been directed to the phenomenon of identical bands in both normally deformed and superdeformed nuclei. This paper discusses the possibility that such behavior results from a dynamical symmetry of the nuclear many-body system. Phenomenology and the basis principles of Lie algebras are used to place conditions on the acceptable properties of a candidate symmetry. We find that quite general arguments require that such a symmetry have a minimum of 21 generators with a microscopic fermion interpretation. (author). 9 refs., 11 figs., 1 tab

  19. f-band narrowing in uranium intermetallics

    International Nuclear Information System (INIS)

    Dunlap, B.D.; Litterst, F.J.; Malik, S.K.; Kierstead, H.A.; Crabtree, G.W.; Kwok, W.; Lam, D.J.; Mitchell, A.W.

    1987-01-01

    Although the discovery of heavy fermion behavior in uranium compounds has attracted a great deal of attention, relatively little work has been done which is sufficiently systematic to allow an assessment of the relationship of such behavior to more common phenomena, such as mixed valence, narrow-band effects, etc. In this paper we report bulk property measurements for a number of alloys which form a part of such a systematic study. The approach has been to take relatively simple and well-understood materials and alter their behavior by alloying to produce heavy fermion or Kondo behavior in a controlled way

  20. Peristalticity-driven banded chemical garden

    Science.gov (United States)

    Pópity-Tóth, É.; Schuszter, G.; Horváth, D.; Tóth, Á.

    2018-05-01

    Complex structures in nature are often formed by self-assembly. In order to mimic the formation, to enhance the production, or to modify the structures, easy-to-use methods are sought to couple engineering and self-assembly. Chemical-garden-like precipitation reactions are frequently used to study such couplings because of the intrinsic chemical and hydrodynamic interplays. In this work, we present a simple method of applying periodic pressure fluctuations given by a peristaltic pump which can be used to achieve regularly banded precipitate membranes in the copper-phosphate system.

  1. W-Band Sheet Beam Klystron Design

    International Nuclear Information System (INIS)

    Scheitrum, G.; Caryotakis, G.; Burke, A.; Jensen, A.; Jongewaard, E.; Krasnykh, A.; Neubauer, M.; Phillips, R.; Rauenbuehler, K.

    2011-01-01

    Sheet beam devices provide important advantages for very high power, narrow bandwidth RF sources like accelerator klystrons (1). Reduced current density and increased surface area result in increased power capabi1ity, reduced magnetic fields for focusing and reduced cathode loading. These advantages are offset by increased complexity, beam formation and transport issues and potential for mode competition in the ovennoded cavities and drift tube. This paper will describe the design issues encountered in developing a 100 kW peak and 2 kW average power sheet beam k1ystron at W-band including beam formation, beam transport, circuit design, circuit fabrication and mode competition.

  2. Raman band intensities of tellurite glasses.

    Science.gov (United States)

    Plotnichenko, V G; Sokolov, V O; Koltashev, V V; Dianov, E M; Grishin, I A; Churbanov, M F

    2005-05-15

    Raman spectra of TeO2-based glasses doped with WO3, ZnO, GeO2, TiO2, MoO3, and Sb2O3 are measured. The intensity of bands in the Raman spectra of MoO3-TeO2 and MoO3-WO3-TeO2 glasses is shown to be 80-95 times higher than that for silica glass. It is shown that these glasses can be considered as one of the most promising materials for Raman fiber amplifiers.

  3. 77 FR 33098 - Unlicensed Operation in the TV Broadcast Band

    Science.gov (United States)

    2012-06-05

    ...] Unlicensed Operation in the TV Broadcast Band AGENCY: Federal Communications Commission. ACTION: Correcting... matter of ``Unlicensed Operation in the TV Broadcast Band Approval.'' This document contains corrections... of this correction relate to ``Unlicensed Operation in the TV Broadcast Band Approval'' under Sec. 15...

  4. Plasmon band gap generated by intense ion acoustic waves

    International Nuclear Information System (INIS)

    Son, S.; Ku, S.

    2010-01-01

    In the presence of an intense ion acoustic wave, the energy-momentum dispersion relation of plasmons is strongly modified to exhibit a band gap structure. The intensity of an ion acoustic wave might be measured from the band gap width. The plasmon band gap can be used to block the nonlinear cascading channel of the Langmuir wave decay.

  5. Microbial control of Asian longhorned beetles - what are fungal bands?

    Science.gov (United States)

    Ann E. Hajek; Thomas Dubois; Jennifer Lund; Ryan Shanley; Leah Bauer; Michael Smith; Peng Fan; Huang Bo; Hu Jiafu; Zengzhi Li

    2007-01-01

    In Japan, the entomopathogenic fungus Beauveria brongniartii is grown in nonwoven fiber bands that are placed around trunks of orchard trees for control of numerous cerambycid pests, including Anoplophora chinensis (= A. malasiaca). The Japanese company producing bands, Nitto Denko in Osaka, markets bands...

  6. Transistorized wide band pulse amplifier; Amplificateur d'impulsions a large bande et a transistors

    Energy Technology Data Exchange (ETDEWEB)

    Girard, J; Savinelli, H [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires; Hazoni, Y [Atomic Energy Commission (Israel)

    1960-07-01

    A simple wide band amplifier is described below, having a stability better than 1{sup 0}/00 deg{sup -1} centigrade, a current gain of 10{sup 3}, bandwidth of 30 MHz, and a signal to noise current ratio of about 100. This amplifier has been studied to answer the necessity of a fast transistor head amplifier for nuclear detectors, having in mind pile up and overloading problems. (author) [French] Un amplificateur simple, a large bande, est decrit ci-apres, il a une stabilite meilleure que le 0/00 par degre centigrade, un gain en courant de 10{sup 3} une largeur de bande de 30 MHz, et un rapport signal sur bruit en courant d'environ 100. Cet amplificateur a ete etudie pour repondre a la necessite de l'amplification des impulsions provenant de detecteurs nucleaires, ayant a l'esprit les problemes d'empilement et de saturation. (auteur)

  7. Band head spin assignment of superdeformed bands in Hg isotopes through power index formula

    Science.gov (United States)

    Sharma, Honey; Mittal, H. M.

    2018-05-01

    The power index formula has been used to obtain the band head spin (I 0) of all the superdeformed (SD) bands in Hg isotopes. A least squares fitting approach is used. The root mean square deviations between the determined and the observed transition energies are calculated by extracting the model parameters using the power index formula. Whenever definite spins are available, the determined and the observed transition energies are in accordance with each other. The computed values of dynamic moment of inertia J (2) obtained by using the power index formula and its deviation with the rotational frequency is also studied. Excellent agreement is shown between the calculated and the experimental results for J (2) versus the rotational frequency. Hence, the power index formula works very well for all the SD bands in Hg isotopes expect for 195Hg(2, 3, 4).

  8. Systematic study of β-band and correlation with g- band using power law and soft rotor formula

    International Nuclear Information System (INIS)

    Katoch, Vikas; Kaushik, Reetu; Sharma, S.; Gupta, J.B.

    2014-01-01

    The nuclear structure of even Z even N medium mass transitional nuclei consist of ground state band, K π =0 1 β-band, K π =2 1 γ- band and other higher bands. As we move away from closed shell, energy levels are low lying from spherical to deformed nuclei and energy deviated from ideal rotor behavior. The energy of these transitional nuclei in ground band can also be studied using Bohr Mottelson energy expression, Soft Rotor Formula (SRF), Power Law (PL) etc. Recently, Gupta et al. (2013) modified SRF for non zero band head K π =2 1 γ-band and reproduced the level energies. Here same formula applied for K π =0 1 β-band and the level energies are reproduced and compared with experimental energies. The power law is also used for recalculation of level energies and for useful comparison

  9. Ka Band Phase Locked Loop Oscillator Dielectric Resonator Oscillator for Satellite EHF Band Receiver

    Directory of Open Access Journals (Sweden)

    S. Coco

    2008-01-01

    Full Text Available This paper describes the design and fabrication of a Ka Band PLL DRO having a fundamental oscillation frequency of 19.250 GHz, used as local oscillator in the low-noise block of a down converter (LNB for an EHF band receiver. Apposite circuital models have been created to describe the behaviour of the dielectric resonator and of the active component used in the oscillator core. The DRO characterization and measurements have shown very good agreement with simulation results. A good phase noise performance is obtained by using a very high Q dielectric resonator.

  10. Higher superdeformed band members in {sup 190}Hg. Evidence for a band interaction

    Energy Technology Data Exchange (ETDEWEB)

    Bearden, I G; Daly, P J [Purdue Univ., Lafayette, IN (United States); Janssens, V F; Carpenter, M P; Ahmad, I; Khoo, T L; Lauritsen, T; Liang, Y [Argonne National Lab., IL (United States); Drigert, M W [Idaho National Engineering Lab., Idaho Falls, ID (United States); Garg, U; Reviol, W [Notre Dame Univ., IN (United States); Wyss, R [Joint Inst. for Heavy Ion Research, Oak Ridge, TN (United States)

    1992-08-01

    The superdeformed band of {sup 190}Hg has been traced up to a frequency {Dirac_h}{omega} {>=} 0.4 MeV by combining data from several experiments. A distinct change in the slope of the dynamic moment of inertia J{sup (2)} vs {Dirac_h}{omega} is observed at {Dirac_h}{omega} 0.32 MeV. This result is interpreted as evidence for a band interaction at the highest frequencies. Possible interpretations are reviewed. (author) 14 refs., 3 figs.

  11. Strongly coupled band in {sup 140}Gd

    Energy Technology Data Exchange (ETDEWEB)

    Falla-Sotelo, F.; Oliveira, J.R.B.; Rao, M.N. [Instituto de Fisica, Universidade de Sao Paulo, Sao Paulo (Brazil)] (and others)

    2005-07-01

    Several high-K states are known to exist in the mass 130-140 region. For the N=74 even-even isotopes, K{pi} = 8{sup -} isomers, with lifetimes ranging from ns to ms, are known in {sup 128}Xe, {sup 130}Ba, {sup 132}Ce, {sup 134}Nd, {sup 136}Sm, and {sup 138}Gd[. In {sup 140}Gd, we have observed for the first time a band also based on an I{pi} = 8{sup -} state. This could be the first case of a K{pi} = 8{sup -} state observed in an N=76 even-even isotope. The systematics of the K{pi} = 8{sup -} isomeric states in N=74 isotopes has been studied by A.M. Bruce et al. These states decay towards the K = 0 ground state band, and the transitions are K-forbidden. The {sup 140}Gd case presents strong similarities but also some significant differences with relation to the N=74 isotopes. We propose the same configuration but with larger deformation in {sup 140}Gd.

  12. Symmetries and band gaps in nanoribbons

    Science.gov (United States)

    Zhang, Zhiwei; Tian, Yiteng; Fernando, Gayanath; Kocharian, Armen

    In ideal graphene-like systems, time reversal and sublattice symmetries preserve the degeneracies at the Dirac point(s). We have examined such degeneracies in the band structure as well as the transport properties in various arm-twisted (graphene-related) nanoribbons. A twist angle is defined such that at 0 degrees the ribbon is a rectangular ribbon and at 60 degrees the ribbon is cut from a honeycomb lattice. Using model Hamiltonians and first principles calculations in these nanoribbons with Z2 topology, we have monitored the band structure as a function of the twist angle θ. In twisted ribbons, it turns out that the introduction of an extra hopping term leads to a gap opening. We have also calculated the size and temperature broadening effects in similar ribbons in addition to Rashba-induced transport properties. The authors acknowledge the computing facilities provided by the Center for Functional Nanomaterials, Brookhaven National Laboratory supported by the U.S. Department of Energy, Office of Basic Energy Sciences, under Contract No.DE-AC02- 98CH10886.

  13. Changing optical band structure with single photons

    Science.gov (United States)

    Albrecht, Andreas; Caneva, Tommaso; Chang, Darrick E.

    2017-11-01

    Achieving strong interactions between individual photons enables a wide variety of exciting possibilities in quantum information science and many-body physics. Cold atoms interfaced with nanophotonic structures have emerged as a platform to realize novel forms of nonlinear interactions. In particular, when atoms are coupled to a photonic crystal waveguide, long-range atomic interactions can arise that are mediated by localized atom-photon bound states. We theoretically show that in such a system, the absorption of a single photon can change the band structure for a subsequent photon. This occurs because the first photon affects the atoms in the chain in an alternating fashion, thus leading to an effective period doubling of the system and a new optical band structure for the composite atom-nanophotonic system. We demonstrate how this mechanism can be engineered to realize a single-photon switch, where the first incoming photon switches the system from being highly transmissive to highly reflective, and analyze how signatures can be observed via non-classical correlations of the outgoing photon field.

  14. f-electron systems: pushing band theory

    International Nuclear Information System (INIS)

    Koelling, D.D.

    1991-01-01

    The f-electron orbitrals have always been the ''incomplete atomic shells acting as local moments, and weakly interacting with the remaining electronic structure'' in the minds of most people. So examining them using a band theory where one views them as itinerant was once - and to some extent even today still is - considered with some skepticism. Nonetheless, a very significant community has successfully utilized band theory as a probe of the electronic structure of the appropriate actinides and rare earths. Those people actually using the approach would be the first to declare that it is not the whole solution. Instead, one is pushing and even exceeding its limit of applicability. However, the apropriate procedure is to push the model consistently to its limits, patch where possible, and then look to see where discrepancies remain. I propose to offer a selected review of past developments (emphasizing the career to data of A.J. Freeman in this area), offer a list of interesting puzzles for the future, and then make some guesses as to the techniques one might want to use. (orig.)

  15. Optical band gaps of organic semiconductor materials

    Science.gov (United States)

    Costa, José C. S.; Taveira, Ricardo J. S.; Lima, Carlos F. R. A. C.; Mendes, Adélio; Santos, Luís M. N. B. F.

    2016-08-01

    UV-Vis can be used as an easy and forthright technique to accurately estimate the band gap energy of organic π-conjugated materials, widely used as thin films/composites in organic and hybrid electronic devices such as OLEDs, OPVs and OFETs. The electronic and optical properties, including HOMO-LUMO energy gaps of π-conjugated systems were evaluated by UV-Vis spectroscopy in CHCl3 solution for a large number of relevant π-conjugated systems: tris-8-hydroxyquinolinatos (Alq3, Gaq3, Inq3, Al(qNO2)3, Al(qCl)3, Al(qBr)3, In(qNO2)3, In(qCl)3 and In(qBr)3); triphenylamine derivatives (DDP, p-TTP, TPB, TPD, TDAB, m-MTDAB, NPB, α-NPD); oligoacenes (naphthalene, anthracene, tetracene and rubrene); oligothiophenes (α-2T, β-2T, α-3T, β-3T, α-4T and α-5T). Additionally, some electronic properties were also explored by quantum chemical calculations. The experimental UV-Vis data are in accordance with the DFT predictions and indicate that the band gap energies of the OSCs dissolved in CHCl3 solution are consistent with the values presented for thin films.

  16. Spectra of γ rays feeding superdeformed bands

    International Nuclear Information System (INIS)

    Lauritsen, T.; Khoo, T.L.; Henry, R.G.

    1995-01-01

    The spectrum of γrays coincident with SD transitions contains the transitions which populate the SD band. This spectrum can provide information on the feeding mechanism and on the properties (moment of inertia, collectivity) of excited SD states. We used a model we developed to explain the feeding of SD bands, to calculate the spectrum of feeding γrays. The Monte Carlo simulations take into account the trigger conditions present in our Eurogam experiment. Both experimental and theoretical spectra contain a statistical component and a broad E2 peak (from transitions occurring between excited states in the SD well). There is good resemblance between the measured and calculated spectra although the calculated multiplicity of an E2 bump is low by ∼30%. Work is continuing to improve the quality of the fits, which will result in a better understanding of excited SD states. In addition, a model for the last steps, which cool the γ cascade into the SD yrast line, needs to be developed. A strong M1/E2 low-energy component, which we believe is responsible for this cooling, was observed

  17. Study of intruder band in 112Sn

    International Nuclear Information System (INIS)

    Ganguly, S.; Banerjee, P.; Ray, I.; Kshetri, R.; Raut, R.; Bhattacharya, S.; Saha-Sarkar, M.; Goswami, A.; Mukhopadhyay, S.; Mukherjee, A.; Mukherjee, G.; Basu, S.K.

    2007-01-01

    Excited states of the positive-parity intruder band in 112 Sn, populated in the 100 Mo( 20 Ne,α4n) reaction at a beam energy of 136 MeV, have been studied. The band has been observed up to 11570.0 keV with spin (24 + ). Mean lifetimes have been measured for six states up to the 22 + , 10335.1 keV level and an upper limit of the lifetime has been estimated for the 11570.0 keV (24 + ) state. The B(E2) values, derived from the present lifetime results, correspond to a moderate quadrupole deformation of β 2 ∼0.18 for states with spin J π >=12 + , and the decrease in B(E2) for the 14 + ->12 + transition is consistent with a ν(h 11/2 ) 2 alignment at ω∼0.35 MeV, predicted by a cranked shell-model calculation. Total Routhian surface calculations predict a triaxial shape following the alignment

  18. Valence band photoemission studies of clean metals

    International Nuclear Information System (INIS)

    Wehner, P.S.

    1978-04-01

    The application of Angle-Resolved Photoelectron Spectroscopy (ARPES) to crystalline solids and the utilization of such studies to illuminate several questions concerning the detailed electronic structure of such materials, are discussed. Specifically, by construction of a Direct Transition (DT) model and the utilization of energy-dependent angle-resolved normal photoemission in the photon energy range 32 eV < or = hν < or = 200 eV, the bulk band structure of copper is experimentally mapped out along three different directions in the Brillouin Zone; GAMMA to K, GAMMA to L, and GAMMA to X. In addition, various effects which influence the obtainable resolution in vector k-space, namely, thermal disorder, momentum broadening, and band mixing, are discussed and are shown to place severe limitations on the applicability of the DT model. Finally, a model for Angle-Resolved X-ray Photoelectron Spectroscopy (ARXPS) based on the symmetry of the initial-state wavefunctions is presented and compared to experimental results obtained from copper single crystals

  19. Spectra of {gamma} rays feeding superdeformed bands

    Energy Technology Data Exchange (ETDEWEB)

    Lauritsen, T.; Khoo, T.L.; Henry, R.G. [and others

    1995-08-01

    The spectrum of {gamma}rays coincident with SD transitions contains the transitions which populate the SD band. This spectrum can provide information on the feeding mechanism and on the properties (moment of inertia, collectivity) of excited SD states. We used a model we developed to explain the feeding of SD bands, to calculate the spectrum of feeding {gamma}rays. The Monte Carlo simulations take into account the trigger conditions present in our Eurogam experiment. Both experimental and theoretical spectra contain a statistical component and a broad E2 peak (from transitions occurring between excited states in the SD well). There is good resemblance between the measured and calculated spectra although the calculated multiplicity of an E2 bump is low by {approximately}30%. Work is continuing to improve the quality of the fits, which will result in a better understanding of excited SD states. In addition, a model for the last steps, which cool the {gamma} cascade into the SD yrast line, needs to be developed. A strong M1/E2 low-energy component, which we believe is responsible for this cooling, was observed.

  20. Portable, x-band, linear accelerator systems

    International Nuclear Information System (INIS)

    Schonberg, R.G.; Deruyter, H.; Fowkes, W.R.; Johnson, W.A.; Miller, R.H.; Potter, J.M.; Weaver, J.N.

    1985-01-01

    Three light-weight, x-band, electron accelerators have been developed to provide a series of highly portable sources of x-rays and neutrons for non-destructive testing. The 1.5 MeV x-ray unit has a 200 kW magnetron for an RF source and an air-cooled, traveling wave accelerating structure to minimize its weight. The 4 and 6 MeV units share the same drive system which contains a 1.2 MW magnetron. The 4 MeV unit uses a traveling-wave guide to produce x-rays and the 6MeV unit uses a standing-wave guide to produce x-rays or neutrons. The choice of 9.3 GHz was dictated by the availability of a high power coaxial magnetron and by the obvious dimensional and weight advantages of a higher frequency over the more common S-band frequencies around 3 GHz

  1. Warm-Up Activities of Middle and High School Band Directors Participating in State-Level Concert Band Assessments

    Science.gov (United States)

    Ward, Justin P.; Hancock, Carl B.

    2016-01-01

    The purpose of this study was to examine the warm-ups chosen by concert band directors participating in state-level performance assessments. We observed 29 middle and high school bands and coded the frequency and duration of warm-up activities and behaviors. Results indicated that most bands rehearsed music and played scales, long tones, and…

  2. Treatment of Patellar Lower Pole Fracture with Modified Titanium Cable Tension Band Plus Patellar Tibial Tunnel Steel "8" Reduction Band.

    Science.gov (United States)

    Li, Jiaming; Wang, Decheng; He, Zhiliang; Shi, Hao

    2018-01-08

    To determine the efficacy of modified titanium tension band plus patellar tendon tunnel steel 8 "reduction band" versus titanium cable tension band fixation for the treatment of patellar lower pole fracture. 58 patients with lower patella fracture were enrolled in this study, including 30 patients treated with modified titanium cable tension band plus patellar tibial tunnel wire "8" tension band internal fixation (modified group), and 28 patients with titanium cable tension band fixation. All patients were followed up for 9∼15 months with an average of 11.6 months. Knee flexion was significantly improved in the modified group than in the titanium cable tension band group (111.33 ± 13 degrees versus 98.21 ± 21.70 degrees, P = 0.004). The fracture healing time showed no significant difference. At the end of the follow-up, the improvement excellent rate was 93.33% in the modified group, and 82.14% in the titanium cable tension band group. Titanium cable tension band internal fixation loosening was found in 2 cases, including 1 case of treatment by two surgeries without loose internal fixation. The modified titanium cable tension band with "8" tension band fixation showed better efficacy for lower patella fractures than titanium cable tension band fixation.

  3. InfiniBand-Experiences at the Forschungszentrum Karlsruhe

    International Nuclear Information System (INIS)

    Schwickerath, Ulrich; Heiss, Andreas

    2006-01-01

    The Institute for Scientific Computing (IWR) at the Forschungszentrum Karlsruhe has been evaluating the InfiniBand [InfiniBand Trade Association, InfiniBand Architecture Specification, Release 1.0, October 24, 2000] technology since end of the year 2002. The performance of the interconnect has been tested on different platforms and architectures using MPI. Sequential file transfer performance was measured with the RFIO protocol running on native InfiniBand [Ulrich Schwickerath, Andreas Heiss, Nucl. Instr. and Meth. A 534 (2004) 130, http://www.fzk.de/infiniband], and a newly developed InfiniBand-enabled version of the XROOTD

  4. Band structures in fractal grading porous phononic crystals

    Science.gov (United States)

    Wang, Kai; Liu, Ying; Liang, Tianshu; Wang, Bin

    2018-05-01

    In this paper, a new grading porous structure is introduced based on a Sierpinski triangle routine, and wave propagation in this fractal grading porous phononic crystal is investigated. The influences of fractal hierarchy and porosity on the band structures in fractal graidng porous phononic crystals are clarified. Vibration modes of unit cell at absolute band gap edges are given to manifest formation mechanism of absolute band gaps. The results show that absolute band gaps are easy to form in fractal structures comparatively to the normal ones with the same porosity. Structures with higher fractal hierarchies benefit multiple wider absolute band gaps. This work provides useful guidance in design of fractal porous phononic crystals.

  5. The Keenan and Wing bands in S stars

    International Nuclear Information System (INIS)

    Lambert, D.L.; Clegg, R.E.S.

    1980-01-01

    New observations of the near infrared spectra of S stars are presented as part of a survey of the unidentified Keenan and Wing bands. Bandhead wavelengths accurate to 0.5 A are presented. A new band is found at 9014 A. The bands are not present in normal M giants and dwarfs. Laboratory spectroscopy of heavy element oxides is reported. Several new identifications are proposed. The 10 300 A Wing band is identified with the Δv = - 1 sequence of the ZrO 9300 A Δv = 0 bands. The ZrO B 1 PI-A 1 Δ (Δv = 0) system may be responsible for either the 9736 A or the 10 515 A Wing bands. Two new bands in the near infrared at 8219 and 8235 A are provided by CeO. A new band with heads at 7503 and 7509 A in a spectrum of R And is tentatively attributed to YS. A band at 8268 A in M stars is the TiO delta(2-1) head. The 8610 A Keenan band is not due to CrH. Potential carriers of the Keenan and Wing bands are reviewed. It is suggested that the heavy element sulphides and, perhaps, chlorides are leading candidates. Identification of YS in R And may provide the first evidence for these sulphides. ZrS is a leading candidate for which laboratory spectroscopy is needed. (author)

  6. Reduction in pediatric identification band errors: a quality collaborative.

    Science.gov (United States)

    Phillips, Shannon Connor; Saysana, Michele; Worley, Sarah; Hain, Paul D

    2012-06-01

    Accurate and consistent placement of a patient identification (ID) band is used in health care to reduce errors associated with patient misidentification. Multiple safety organizations have devoted time and energy to improving patient ID, but no multicenter improvement collaboratives have shown scalability of previously successful interventions. We hoped to reduce by half the pediatric patient ID band error rate, defined as absent, illegible, or inaccurate ID band, across a quality improvement learning collaborative of hospitals in 1 year. On the basis of a previously successful single-site intervention, we conducted a self-selected 6-site collaborative to reduce ID band errors in heterogeneous pediatric hospital settings. The collaborative had 3 phases: preparatory work and employee survey of current practice and barriers, data collection (ID band failure rate), and intervention driven by data and collaborative learning to accelerate change. The collaborative audited 11377 patients for ID band errors between September 2009 and September 2010. The ID band failure rate decreased from 17% to 4.1% (77% relative reduction). Interventions including education of frontline staff regarding correct ID bands as a safety strategy; a change to softer ID bands, including "luggage tag" type ID bands for some patients; and partnering with families and patients through education were applied at all institutions. Over 13 months, a collaborative of pediatric institutions significantly reduced the ID band failure rate. This quality improvement learning collaborative demonstrates that safety improvements tested in a single institution can be disseminated to improve quality of care across large populations of children.

  7. Thermoelectric band engineering: The role of carrier scattering

    Science.gov (United States)

    Witkoske, Evan; Wang, Xufeng; Lundstrom, Mark; Askarpour, Vahid; Maassen, Jesse

    2017-11-01

    Complex electronic band structures, with multiple valleys or bands at the same or similar energies, can be beneficial for thermoelectric performance, but the advantages can be offset by inter-valley and inter-band scattering. In this paper, we demonstrate how first-principles band structures coupled with recently developed techniques for rigorous simulation of electron-phonon scattering provide the capabilities to realistically assess the benefits and trade-offs associated with these materials. We illustrate the approach using n-type silicon as a model material and show that intervalley scattering is strong. This example shows that the convergence of valleys and bands can improve thermoelectric performance, but the magnitude of the improvement depends sensitively on the relative strengths of intra- and inter-valley electron scattering. Because anisotropy of the band structure also plays an important role, a measure of the benefit of band anisotropy in the presence of strong intervalley scattering is presented.

  8. Formation of Degenerate Band Gaps in Layered Systems

    Directory of Open Access Journals (Sweden)

    Alexey P. Vinogradov

    2012-06-01

    Full Text Available In the review, peculiarities of spectra of one-dimensional photonic crystals made of anisotropic and/or magnetooptic materials are considered. The attention is focused on band gaps of a special type—the so called degenerate band gaps which are degenerate with respect to polarization. Mechanisms of formation and properties of these band gaps are analyzed. Peculiarities of spectra of photonic crystals that arise due to the linkage between band gaps are discussed. Particularly, it is shown that formation of a frozen mode is caused by linkage between Brillouin and degenerate band gaps. Also, existence of the optical Borrmann effect at the boundaries of degenerate band gaps and optical Tamm states at the frequencies of degenerate band gaps are analyzed.

  9. Emission bands of phosphorus and calculation of band structure of rare earth phosphides

    International Nuclear Information System (INIS)

    Al'perovich, G.I.; Gusatinskij, A.N.; Geguzin, I.I.; Blokhin, M.A.; Torbov, V.I.; Chukalin, V.I.; AN SSSR, Moscow. Inst. Novykh Khimicheskikh Problem)

    1977-01-01

    The method of x-ray emission spectroscopy has been used to investigate the electronic structure of monophosphides of rare-earth metals (REM). The fluorescence K bands of phosphorus have been obtained in LaP, PrP, SmP, GdP, TbP, DyP, HoP, ErP, TmP, YbP, and LuP and also the Lsub(2,3) bands of phosphorus in ErP, TmP, YbP, and LuP. Using the Green function technique involving the muffin-tin potential, the energy spectrum for ErP has been calculated in the single-electron approximation. The hystogram of electronic state distribution N(E) is compared with the experimental K and Lsub(2,3) bands of phosphorus in ErP. The agreement between the main details of N(E) and that of x-ray spectra allows to state that the model used provides a good description of the electron density distribution in crystals of REM monophosphides. In accordance with the character of the N(E) distribution the compounds under study are classified as semimetals or semiconductors with a very narrow forbidden band

  10. New results on the superdeformed {sup 196}Pb nucleus: The decay of the excited bands to the yrast band

    Energy Technology Data Exchange (ETDEWEB)

    Bouneau, S.; Azaiez, F.; Duprat, J. [IPN, Orsay (France)] [and others

    1996-12-31

    The study of the superdeformed (SD) {sup 196}Pb nucleus has been revisited using the EUROGAM phase 2 spectrometer. In addition to the known yrast and two lowest excited SD bands, a third excited SD band has been seen. All of the three excited bands were found to decay to the yrast SD band through, presumably, E1 transitions, allowing relative spin and excitation energy assignments. Comparisons with calculations using the random-phase approximation suggest that all three excited bands can be interpreted as octupole vibrational structures.

  11. Collapse and revival in inter-band oscillations of a two-band Bose-Hubbard model

    Energy Technology Data Exchange (ETDEWEB)

    Ploetz, Patrick; Wimberger, Sandro [Institut fuer Theoretische Physik, Universitaet Heidelberg, Philosophenweg 19, 69120 Heidelberg (Germany); Madronero, Javier, E-mail: ploetz@thphys.uni-heidelberg.d [Physik Department, Technische Universitaet Muenchen, James-Franck-Str. 1, 85748 Garching (Germany)

    2010-04-28

    We study the effect of a many-body interaction on inter-band oscillations in a two-band Bose-Hubbard model with an external Stark force. Weak and strong inter-band oscillations are observed, where the latter arise from a resonant coupling of the bands. These oscillations collapse and revive due to a weak two-body interaction between the atoms. Effective models for oscillations in and out of resonance are introduced that provide predictions for the system's behaviour, particularly for the time scales for the collapse and revival of the resonant inter-band oscillations. (fast track communication)

  12. Band structure dynamics in indium wires

    Science.gov (United States)

    Chávez-Cervantes, M.; Krause, R.; Aeschlimann, S.; Gierz, I.

    2018-05-01

    One-dimensional indium wires grown on Si(111) substrates, which are metallic at high temperatures, become insulating below ˜100 K due to the formation of a charge density wave (CDW). The physics of this transition is not conventional and involves a multiband Peierls instability with strong interband coupling. This CDW ground state is readily destroyed with femtosecond laser pulses resulting in a light-induced insulator-to-metal phase transition. The current understanding of this transition remains incomplete, requiring measurements of the transient electronic structure to complement previous investigations of the lattice dynamics. Time- and angle-resolved photoemission spectroscopy with extreme ultraviolet radiation is applied to this end. We find that the transition from the insulating to the metallic band structure occurs within ˜660 fs, which is a fraction of the amplitude mode period. The long lifetime of the transient state (>100 ps) is attributed to trapping in a metastable state in accordance with previous work.

  13. Satellitenbewegung, band III: Natiirliche und gesteuerte bewegung.

    Science.gov (United States)

    Jochim, E. F.

    2014-12-01

    Im dritten Band der Satellitenbewegung werden in fortlaufender Nummerierung einige für Untersuchungen der Bewegung der künstlichen Satelliten wichtige Grundlagen der Astrodynamik mit ausführlichen mathematischen Formelsystemen behandelt. Dazu zählen die unterschiedlichen Aspekte der Bewegung der natürlichen Himmelskörper, die Steuerung und Kontrolle von künstlichen Objekten, und insbesondere die für eine Satellitenbahnanalyse wichtigen physikalischen Beeinflussungen einer Satellitenbewegung. Mathematisch entscheidend ist die Wahl geeigneter Bahnparameter, die ein bestimmtes Bewegungsproblem widerspruchsfrei und singularitätenfrei zu behandeln gestatten. Für die Behandlung routinemäßiger Aufgabenstellungen der Satellitenbewegung, in erster Linie einer präzisen Bahnbestimmung und Bahnverbesserung, kann auf eine Fülle von lehrbuchartigen Monographien verwiesen werden, so dass diese Problematik in der vorliegenden Arbeit nur angedeutet werden soll.

  14. Majorana flat bands in anisotropic systems

    Energy Technology Data Exchange (ETDEWEB)

    Mendler, Daniel; Kotetes, Panagiotis; Schoen, Gerd [Institut fuer theoretische Festkoerperphysik, Karlsruher Institut fuer Technologie (Germany)

    2015-07-01

    It has been recently proposed that topologically protected Majorana flat bands (MFBs) emerge in superconductors with nodal energy spectrum. In this work we introduce a new class of gapful superconductors, in which MFBs can occur due to strong anisotropy. The prototype system exhibiting this kind of behavior is the nematic p{sub x}+p{sub y} spinless superconductor, which supports an edge MFB with controllable bandwidth. Our proposal can be for instance experimentally implemented in topological superconductors engineered from i. semiconductors with tunable spin-orbit coupling or ii. topological insulator surfaces with intrinsic magnetic order in proximity to a conventional SC. By investigating the topological properties of both setups, we show that their unique features render them feasible platforms for manipulating the Majorana fermion bandstructure and realizing MFBs.

  15. Laparoscopic Adjustable Gastric Banding and Hypoglycemia

    Directory of Open Access Journals (Sweden)

    Sigrid Bairdain

    2013-01-01

    Full Text Available Obesity is commonplace, and surgical treatment usually includes Roux-en-Y gastric bypasses (RYGBs. RYGBs have the most documented side effects including vitamin deficiencies, rebound weight gain, and symptomatic hypoglycemia; fewer series exist describing hypoglycemia following other bariatric operations. We reviewed all patients undergoing laparoscopic adjustable gastric banding (LAGB at our institution between 2008 and 2012. Three patients were identified to have symptomatic hypoglycemia following LAGB. Mean time from surgery was 33 months (range 14–45 months, and mean weight loss was 32.7 kg (range 15.9–43.1 kg. None of the patients had preexisting diabetes. Therefore, symptomatic hypoglycemia should be investigated irrespective of bariatric operation.

  16. Two band model for the cuprates

    Science.gov (United States)

    Liu, Shiu; White, Steven

    2009-03-01

    We use a numerical canonical transformation approach to derive an effective two-band model for the hole-doped cuprates, which keeps both oxygen and copper orbitals but removes double occupancy from each. A similar model was considered previously by Frenkel, Gooding, Shraiman, and Siggia (PRB 41, number 1, page 350). We compare the numerically derived model with previously obtained analytical results. In addition to the usual hopping terms between oxygens tpp and Cu-Cu exchange terms Jdd, the model also includes a strong copper-oxygen exchange interaction Jpd and a Kondo-like spin-flip oxygen-oxygen hopping term Kpdp. We use the density matrix renormalization group to study the charge, spin, and pairing properties of the derived model on ladder systems.

  17. High Efficiency Ka-Band Spatial Combiner

    Directory of Open Access Journals (Sweden)

    D. Passi

    2014-12-01

    Full Text Available A Ka-Band, High Efficiency, Small Size Spatial Combiner (SPC is proposed in this paper, which uses an innovatively matched quadruple Fin Lines to microstrip (FLuS transitions. At the date of this paper and at the Author's best knowledge no such FLuS innovative transitions have been reported in literature before. These transitions are inserted into a WR28 waveguide T-junction, in order to allow the integration of 16 Monolithic Microwave Integrated Circuit (MMIC Solid State Power Amplifiers (SSPA's. A computational electromagnetic model using the finite elements method has been implemented. A mean insertion loss of 2 dB is achieved with a return loss better the 10 dB in the 31-37 GHz bandwidth.

  18. Band magnetism due to f-electrons

    International Nuclear Information System (INIS)

    Brodsky, M.B.; Trainor, R.J.

    1976-01-01

    Specific heat data illustrate several types of itinerant or band magnetism in actinide intermetallic compounds. The results show ferromagnetic spin fluctuations in UAl 2 with T/sub sf/ equals 25K, itinerant antiferromagnetism in NpSn 3 with T/sub N/ equals 9.5K and itinerant ferromagnetism in NpOs 2 with T/sub C/ equals 7.9K. Specific heat studies of dilute U/sub 1-x/Th/sub x/Al 2 show the theoretically predicted modifications due to impurity scattering in a spin fluctuation system. For NpSn 3 it is possible to show the BCS nature of the transition due to the gap formation

  19. Theory of Fermi Liquid with Flat Bands

    Science.gov (United States)

    Khodel, V. A.

    2018-04-01

    A self-consistent theory of Fermi systems hosting flat bands is developed. Compared with an original model of fermion condensation, its key point consists in proper accounting for mixing between condensate and non-condensate degrees of freedom that leads to formation of a non-BCS gap Υ (p) in the single-particle spectrum. The results obtained explain: (1) the two-gap structure of spectra of single-particle excitations of electron systems of copper oxides, revealed in ARPES studies, (2) the role of violation of the topological stability of the Landau state in the arrangement of the T-x phase diagram of this family of high-T_c superconductors, (3) the topological nature of a metal-insulator transition, discovered in homogeneous two-dimensional low-density electron liquid of MOSFETs more than 20 years ago.

  20. Design of W-Band photoinjector

    International Nuclear Information System (INIS)

    Zhu, Xiongwei; Nakajima, Kazuhisa

    2000-01-01

    We present a design study on W-Band photocathode RF gun which is capable of generating and accelerating 300 pC electron bunch. The design system is made up of 91.392 GHz photocathode RF gun and 91.392 GHz travelling wave linac cells. Based on the numerical simulation using SUPERFISH and PARMELA and the conventional RF linac scaling law, the design will produce 300 pC at 1.74 MeV with bunch length 0.72 ps and normalized tranverse emittance 0.5 mm mrad. We study the beam dynamics in high frequency and high gradient; due to the high gradient, the pondermotive effect plays an important role in beam dynamics; we found the pondermotive effect still exist with only the fundamental space harmonics (synchrotron mode) due to the coupling of the transverse and longitudinal motion. (author)

  1. The cyanogen band of Comet Halley

    Science.gov (United States)

    Tatum, J. B.; Campbell, E. C.

    The results of improved whole disk solar irradiance spectrum calculations performed for projected Halley's Comet heliocentric radial velocity and distance are provided. The computations were carried out to account for Doppler effects in the Fraunhofer lines of rotational excitation bands of violet CN emissions from the comet in its encounters with solar radiation. The calculations spanned every half-day for 200 days before and after perihelion. The 801 computer images of the expected intensities were photographed in sequence to form an animated film paced by background music from Liszt's Second Hungarian Rhapsody. The results are intended for accounting for spectral changes observed due to Doppler effects induced by changing velocity and distance, rather than physical mechanisms of the emitting processes.

  2. Photonic band gaps of porous solids

    International Nuclear Information System (INIS)

    Biswas, R.; Sigalas, M. M.; Subramania, G.; Soukoulis, C. M.; Ho, K.-M.

    2000-01-01

    Colloidal inverse photonic crystals composed of ordered lattices of air spheres in a high dielectric background are found to have three-dimensional photonic gaps for face-centered cubic, hexgaonal close-packed, and double hexagonal close-packed stacking sequences. Conditions for the occurrence of the complete gap are a sufficient dielectric contrast and a geometry near close packed. Although the lower pseudogaps of these stacking sequences differ, the lowest stop band in the stacking direction is insensitive to the stacking sequence; hence their experimental reflection should be similar. Transmission calculations with structural disorder show the lower pseudogap is relatively unaffected but the higher gap is very difficult to observe with moderate disorder. (c) 2000 The American Physical Society

  3. On the red giant titanium oxide bands

    Science.gov (United States)

    Hanni, L.; Sitska, J.

    1985-12-01

    The dependence of TiO absorption in cool oxygen-sequence giant stars on the Teff and log g of their atmospheres is investigated theoretically on the basis of spectra simulated using the computer program described by Hanni (1983) and the giant model atmospheres of Johnson et al. (1980). The temperature dependence of the intensity jumps at the head of the alpha(1.0) band is determined from simulated spectra, and the jumps are related to spectral types using the calibration of Ridgway et al. (1980). The results are presented in tables and graphs and shown to be in good agreement with the empirical Teff/intensity-jump correlation of Boyarchuk (1969).

  4. Molding of L band niobium superconductor cavity

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, Hitoshi; Funahashi, Yoshisato; Saito, Kenji; Noguchi, Shuichi; Koizumi, Susumu [National Lab. for High Energy Physics, Tsukuba, Ibaraki (Japan)

    1995-07-01

    A cavity to produce high accelerating electron field was developed. The L-band (1.3 GHz) niobium superconductor unit cell cavity was ellipsoid with {phi}217.3 mm outer diameter and 2.5 mm thickness and consisted of two pieces of half cell, two beam pipes and flange. A deep drawing process was adapted. In spite of the first trial manufacture, each good cavity was obtained. Characteristic properties of niobium materials, molding method of cavity, extension of sheet after molding, production of beam pipe, accuracy and the cost were explained. Niobium materials. showed tensile strength 15.6 kg/mm{sup 2}, load-carrying capacity 4.1 kg/mm{sup 2}, density 8.57, extension 42.5% and RRR (resistance residual ratio){>=}200. (S.Y.)

  5. Hetero-gate-dielectric double gate junctionless transistor (HGJLT) with reduced band-to-band tunnelling effects in subthreshold regime

    International Nuclear Information System (INIS)

    Ghosh, Bahniman; Mondal, Partha; Akram, M. W.; Bal, Punyasloka; Salimath, Akshay Kumar

    2014-01-01

    We propose a hetero-gate-dielectric double gate junctionless transistor (HGJLT), taking high-k gate insulator at source side and low-k gate insulator at drain side, which reduces the effects of band-to-band tunnelling (BTBT) in the sub-threshold region. A junctionless transistor (JLT) is turned off by the depletion of carriers in the highly doped thin channel (device layer) which results in a significant band overlap between the valence band of the channel region and the conduction band of the drain region, due to off-state drain bias, that triggers electrons to tunnel from the valence band of the channel region to the conduction band of the drain region leaving behind holes in the channel. These effects of band-to-band tunnelling increase the sub-threshold leakage current, and the accumulation of holes in the channel forms a parasitic bipolar junction transistor (n–p–n BJT for channel JLT) in the lateral direction by the source (emitter), channel (base) and drain (collector) regions in JLT structure in off-state. The proposed HGJLT reduces the subthreshold leakage current and suppresses the parasitic BJT action in off-state by reducing the band-to-band tunnelling probability. (semiconductor devices)

  6. Hazard banding in compliance with the new Globally Harmonised System (GHS) for use in control banding tools.

    Science.gov (United States)

    Arnone, Mario; Koppisch, Dorothea; Smola, Thomas; Gabriel, Stefan; Verbist, Koen; Visser, Remco

    2015-10-01

    Many control banding tools use hazard banding in risk assessments for the occupational handling of hazardous substances. The outcome of these assessments can be combined with advice for the required risk management measures (RMMs). The Globally Harmonised System of Classification and Labelling of Chemicals (GHS) has resulted in a change in the hazard communication elements, i.e. Hazard (H) statements instead of Risk-phrases. Hazard banding schemes that depend on the old form of safety information have to be adapted to the new rules. The purpose of this publication is to outline the rationales for the assignment of hazard bands to H statements under the GHS. Based on this, this publication proposes a hazard banding scheme that uses the information from the safety data sheets as the basis for assignment. The assignment of hazard bands tiered according to the severity of the underlying hazards supports the important principle of substitution. Additionally, the set of assignment rules permits an exposure-route-specific assignment of hazard bands, which is necessary for the proposed route-specific RMMs. Ideally, all control banding tools should apply the same assignment rules. This GHS-compliant hazard banding scheme can hopefully help to establish a unified hazard banding strategy in the various control banding tools. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Electronic band structures of binary skutterudites

    International Nuclear Information System (INIS)

    Khan, Banaras; Aliabad, H.A. Rahnamaye; Saifullah; Jalali-Asadabadi, S.; Khan, Imad; Ahmad, Iftikhar

    2015-01-01

    The electronic properties of complex binary skutterudites, MX 3 (M = Co, Rh, Ir; X = P, As, Sb) are explored, using various density functional theory (DFT) based theoretical approaches including Green's Function (GW) as well as regular and non-regular Tran Blaha modified Becke Jhonson (TB-mBJ) methods. The wide range of calculated bandgap values for each compound of this skutterudites family confirm that they are theoretically as challenging as their experimental studies. The computationally expensive GW method, which is generally assume to be efficient in the reproduction of the experimental bandgaps, is also not very successful in the calculation of bandgaps. In this article, the issue of the theoretical bandgaps of these compounds is resolved by reproducing the accurate experimental bandgaps, using the recently developed non-regular TB-mBJ approach, based on DFT. The effectiveness of this technique is due to the fact that a large volume of the binary skutterudite crystal is empty and hence quite large proportion of electrons lie outside of the atomic spheres, where unlike LDA and GGA which are poor in the treatment of these electrons, this technique properly treats these electrons and hence reproduces the clear electronic picture of these compounds. - Highlights: • Theoretical and experimental electronic band structures of binary skutterudites are reviewed. • The literature reveals that none of the existing theoretical results are consistent with the experiments. • GW, regular and non-regular TB-mBJ methods are used to reproduce the correct results. • The GW and regular TB-mBJ results are better than the available results in literature. • However, non-regular TB-mBJ reproduces the correct experimental band structures

  8. Outcome of band ligation in oesophageal varices

    International Nuclear Information System (INIS)

    Abbasi, A.; Bhutto, A.R.; Bhatti, K.I.; Mahmood, K.; Lal, K.

    2013-01-01

    Objective: To find out the outcome og band ligation of oesophageal varices in decompensated chronic liver disease patients. Methods: The quasi experimental study was conducted at the Jinnah Postgraduate Medical Centre, Karachi, and Civil Hospital, Karachi, unit from September 2007 to August 2011. Subjects were eligible if they had a diagnosis of cirrhosis based on history, physical examination, biochemical parameters and liver biopsy in some cases. Patients with advanced cirrhosis (Child-Pugh class C), antibodies against human immunodeficiency virus, hepatocellular carcinoma, portal vein thrombosis evident on ultrasonography, parenteral drug addiction, current alcohol abuse, previous or current treatment with β-blockers were excluded from the study. All patients were asked about alcohol intake and tested to determine the cause of liver cirrhosis. Tests for other causes of cirrhosis were carried out only if there was a suggestive clue. All patients under-went upper gastrointestinal endoscopy after consent. SPSS 15 was used for statistical analysis. Results: The age of the 173 patients who met the inclusion criteria ranged from 15 to 85 years, with a mean of 48.39+-13.38 years. There were 112 (64.7%) males. High-grade varices were seen in 130 (75.1%) patients, while low-grade varices were observed in 43 (24.9%) on first endoscopy. At initial endoscopy, 111 (64.2%) patients had portal hypertensive gastropathy. The patients were followed up for a mean period of 5.20+-2.67 months. Variceal obliteration was achieved in 138 (79.8%), while 33 (19.1%) cases developed re-bleeding. Mean number of endoscopy sessions for these patients were 2.28+-.918 with a maximum of 4. Conclusion: Band ligation eradicated oesophageal varices with less complications and a lower re-bleeding rate, but at the same time eradication was associated with more frequent development of portal hypertensive gastropathy. (author)

  9. Electronic band structures of binary skutterudites

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Banaras [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan); Aliabad, H.A. Rahnamaye [Department of Physics, Hakim Sabzevari University, Sabzevar (Iran, Islamic Republic of); Saifullah [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan); Jalali-Asadabadi, S. [Department of Physics, Faculty of Science, University of Isfahan (UI), 81744 Isfahan (Iran, Islamic Republic of); Khan, Imad [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan); Ahmad, Iftikhar, E-mail: ahma5532@gmail.com [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan)

    2015-10-25

    The electronic properties of complex binary skutterudites, MX{sub 3} (M = Co, Rh, Ir; X = P, As, Sb) are explored, using various density functional theory (DFT) based theoretical approaches including Green's Function (GW) as well as regular and non-regular Tran Blaha modified Becke Jhonson (TB-mBJ) methods. The wide range of calculated bandgap values for each compound of this skutterudites family confirm that they are theoretically as challenging as their experimental studies. The computationally expensive GW method, which is generally assume to be efficient in the reproduction of the experimental bandgaps, is also not very successful in the calculation of bandgaps. In this article, the issue of the theoretical bandgaps of these compounds is resolved by reproducing the accurate experimental bandgaps, using the recently developed non-regular TB-mBJ approach, based on DFT. The effectiveness of this technique is due to the fact that a large volume of the binary skutterudite crystal is empty and hence quite large proportion of electrons lie outside of the atomic spheres, where unlike LDA and GGA which are poor in the treatment of these electrons, this technique properly treats these electrons and hence reproduces the clear electronic picture of these compounds. - Highlights: • Theoretical and experimental electronic band structures of binary skutterudites are reviewed. • The literature reveals that none of the existing theoretical results are consistent with the experiments. • GW, regular and non-regular TB-mBJ methods are used to reproduce the correct results. • The GW and regular TB-mBJ results are better than the available results in literature. • However, non-regular TB-mBJ reproduces the correct experimental band structures.

  10. Change in optimum genetic algorithm solution with changing band discontinuities and band widths of electrically conducting copolymers

    Science.gov (United States)

    Kaur, Avneet; Bakhshi, A. K.

    2010-04-01

    The interest in copolymers stems from the fact that they present interesting electronic and optical properties leading to a variety of technological applications. In order to get a suitable copolymer for a specific application, genetic algorithm (GA) along with negative factor counting (NFC) method has recently been used. In this paper, we study the effect of change in the ratio of conduction band discontinuity to valence band discontinuity (Δ Ec/Δ Ev) on the optimum solution obtained from GA for model binary copolymers. The effect of varying bandwidths on the optimum GA solution is also investigated. The obtained results show that the optimum solution changes with varying parameters like band discontinuity and band width of constituent homopolymers. As the ratio Δ Ec/Δ Ev increases, band gap of optimum solution decreases. With increasing band widths of constituent homopolymers, the optimum solution tends to be dependent on the component with higher band gap.

  11. New Kronig-Penney equation emphasizing the band edge conditions

    International Nuclear Information System (INIS)

    Szmulowicz, Frank

    2008-01-01

    The Kronig-Penney problem is a textbook example for discussing band dispersions and band gap formation in periodic layered media. For example, in photonic crystals, the behaviour of bands next to the band edges is important for further discussions of such effects as inhibited light emission, slow light and negative index of refraction. However, the standard Kronig-Penney equation does not explicitly state the band edge conditions. This paper derives a new solution for the Kronig-Penney problem that explicitly displays the band edge conditions as well as contains all other essential physics of band formation. Therefore, the present exposition should show the student that the band edge conditions are not simply special cases of the familiar Kronig-Penney equation but, instead, are an integral part of the band theory. For the computationally minded student, the new equation is particularly convenient for calculating the positions of closely spaced band edges. The present results can be taught alongside the Kronig-Penney equation in advanced undergraduate or beginning graduate quantum mechanics, solid state theory and photonics courses dealing with wave propagation through periodic layered media

  12. Deformation potentials for band-to-band tunneling in silicon and germanium from first principles

    Science.gov (United States)

    Vandenberghe, William G.; Fischetti, Massimo V.

    2015-01-01

    The deformation potentials for phonon-assisted band-to-band tunneling (BTBT) in silicon and germanium are calculated using a plane-wave density functional theory code. Using hybrid functionals, we obtain: DTA = 4.1 × 108 eV/cm, DTO = 1.2 × 109 eV/cm, and DLO = 2.2 × 109 eV/cm for BTBT in silicon and DTA = 7.8 × 108 eV/cm and DLO = 1.3 × 109 eV/cm for BTBT in germanium. These values agree with experimentally measured values and we explain why in diodes, the TA/TO phonon-assisted BTBT dominates over LO phonon-assisted BTBT despite the larger deformation potential for the latter. We also explain why LO phonon-assisted BTBT can nevertheless dominate in many practical applications.

  13. Notes on basis band-pass circuits; Notes sur les circuits de base passe-bande

    Energy Technology Data Exchange (ETDEWEB)

    Ailloud, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1959-07-01

    Resistor load amplifier stages, basic band-pass RC networks, conventional single-tuned circuits, have the same transfer function. Common properties and differences because diverse magnitude of parameters with proposed problems are exposed. Next the case of several cascaded stages (or networks) is examined when there is no reaction ones to another. (author) [French] Les etages amplificateurs a resistances, les circuits passe-bande RC elementaires, le circuit resonnant classique possedent la meme fonction de transfert. On fait ressortir les proprietes communes et les differences de comportement dues aux ordres de grandeur qu'il est possible de donner aux parametres en fonction des problemes a resoudre. On examine ensuite le cas de plusieurs etages (ou de plusieurs circuits) en cascade lorsqu'ils ne reagissent pas les uns sur les autres. (auteur)

  14. Review of wide band-gap semiconductors technology

    Directory of Open Access Journals (Sweden)

    Jin Haiwei

    2016-01-01

    Full Text Available Silicon carbide (SiC and gallium nitride (GaN are typical representative of the wide band-gap semiconductor material, which is also known as third-generation semiconductor materials. Compared with the conventional semiconductor silicon (Si or gallium arsenide (GaAs, wide band-gap semiconductor has the wide band gap, high saturated drift velocity, high critical breakdown field and other advantages; it is a highly desirable semiconductor material applied under the case of high-power, high-temperature, high-frequency, anti-radiation environment. These advantages of wide band-gap devices make them a hot spot of semiconductor technology research in various countries. This article describes the research agenda of United States and European in this area, focusing on the recent developments of the wide band-gap technology in the US and Europe, summed up the facing challenge of the wide band-gap technology.

  15. Search for positive parity bands in 117Xe

    International Nuclear Information System (INIS)

    Liu, Z.; Sun, X.; Zhou, X.; Lei, X.; Zhang, Y.; Jin, H.; Pan, Q.; Guo, Y.; Chen, X.; Luo, Y.; Wen, S.; Yuan, G.; Yang, C.; Luo, W.; Chen, Y.S.; Xing, Z.; Chen, X.Q.

    1995-01-01

    Excited states of 117 Xe were populated via the reaction 28 Si+ 92 Mo at 100-120MeV. More than 40 new γ-transitions and three new positive parity bands have been observed by means of in-beam γ-ray spectroscopy. The previously known νh 11/2 bands were confirmed, and the νg 7/2 favored band was extended up to 47/2 + in which two bandcrossings have been observed at hω=0.33 and 0.44MeV, respectively. The band structures have been discussed by means of TRS and CSM calculations. A newly observed rotational band consisting of five γ-transitions has been considered as the πh 11/2 band of 117 Cs. ((orig.))

  16. Band Structure Characteristics of Nacreous Composite Materials with Various Defects

    Science.gov (United States)

    Yin, J.; Zhang, S.; Zhang, H. W.; Chen, B. S.

    2016-06-01

    Nacreous composite materials have excellent mechanical properties, such as high strength, high toughness, and wide phononic band gap. In order to research band structure characteristics of nacreous composite materials with various defects, supercell models with the Brick-and-Mortar microstructure are considered. An efficient multi-level substructure algorithm is employed to discuss the band structure. Furthermore, two common systems with point and line defects and varied material parameters are discussed. In addition, band structures concerning straight and deflected crack defects are calculated by changing the shear modulus of the mortar. Finally, the sensitivity of band structures to the random material distribution is presented by considering different volume ratios of the brick. The results reveal that the first band gap of a nacreous composite material is insensitive to defects under certain conditions. It will be of great value to the design and synthesis of new nacreous composite materials for better dynamic properties.

  17. Lifetimes of an excited superdeformed band in {sup 192}Hg

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, I.; Blumenthal, D.; Carpenter, M.P. [and others

    1995-08-01

    An excited superdeformed band was identified in {sup 192}Hg and the lifetimes of its levels measured with the Doppler-shift attenuation method from data taken with the Eurogam spectrometer. The band is proposed to be based on the two-quasineutron (v[642]3/2 [512]5/2) configuration, which after a band crossing, becomes the (v[642]3/2 [752]5/2) configuration. The transition quadrupole moment Q{sub t} of the excited band is the same as that of the yrast SD band, within experimental errors. This suggests that the deformation of the SD minimum is robust with respect to quasiparticle excitation, despite the occupation of the deformation-driving v[752]5/2 level (from the j{sub 15/2} shell) after the band crossing.

  18. Enhancement of phononic band gaps in ternary/binary structure

    International Nuclear Information System (INIS)

    Aly, Arafa H.; Mehaney, Ahmed

    2012-01-01

    Based on the transfer matrix method (TMM) and Bloch theory, the interaction of elastic waves (normal incidence) with 1D phononic crystal had been studied. The transfer matrix method was obtained for both longitudinal and transverse waves by applying the continuity conditions between the consecutive unit cells. Dispersion relations are calculated and plotted for both binary and ternary structures. Also we have investigated the corresponding effects on the band gaps values for the two types of phononic crystals. Furthermore, it can be observed that the complete band gaps are located in the common frequency stop-band regions. Numerical simulations are performed to investigate the effect of different thickness ratios inside each unit cell on the band gap values, as well as unit cells thickness on the central band gap frequency. These phononic band gap materials can be used as a filter for elastic waves at different frequencies values.

  19. A Compact Printed Quadruple Band-Notched UWB Antenna

    Directory of Open Access Journals (Sweden)

    Xiaoyin Li

    2013-01-01

    Full Text Available A novel compact coplanar waveguide- (CPW- fed ultrawideband (UWB printed planar volcano-smoke antenna (PVSA with four band-notches for various wireless applications is proposed and demonstrated. The low-profile antenna consists of a C-shaped parasitic strip to generate a notched band at 8.01~8.55 GHz for the ITU band, two C-shaped slots, and an inverted U-shaped slot etched in the radiator patch to create three notched bands at 5.15~5.35 GHz, 5.75~5.85 GHz, and 7.25~7.75 GHz for filtering the WLAN and X-band satellite signals. Simulated and measured results both confirm that the proposed antenna has a broad bandwidth of 3.1~12 GHz with VSWR < 2 and good omnidirectional radiation patterns with four notched-bands.

  20. Banding the World Together; The Global Growth of Control Banding and Qualitative Occupational Risk Management

    OpenAIRE

    Zalk, David M; Heussen, Ga Henri

    2011-01-01

    Control Banding (CB) strategies to prevent work-related illness and injury for 2.5 billion workers without access to health and safety professionals has grown exponentially this last decade. CB originates from the pharmaceutical industry to control active pharmaceutical ingredients without a complete toxicological basis and therefore no occupational exposure limits. CB applications have broadened into chemicals in general - including new emerging risks like nanomaterials and recently into erg...

  1. Panchromatic cooperative hyperspectral adaptive wide band deletion repair method

    Science.gov (United States)

    Jiang, Bitao; Shi, Chunyu

    2018-02-01

    In the hyperspectral data, the phenomenon of stripe deletion often occurs, which seriously affects the efficiency and accuracy of data analysis and application. Narrow band deletion can be directly repaired by interpolation, and this method is not ideal for wide band deletion repair. In this paper, an adaptive spectral wide band missing restoration method based on panchromatic information is proposed, and the effectiveness of the algorithm is verified by experiments.

  2. Observations of banding in first-year Arctic sea ice

    Science.gov (United States)

    Cole, David M.; Eicken, Hajo; Frey, Karoline; Shapiro, Lewis H.

    2004-08-01

    Horizontal banding features, alternating dark and bright horizontal bands apparent in ice cores and stratigraphic cross sections have long been observed in first-year sea ice and are frequently associated with bands of high and low brine or gas porosity. Observations on the land-fast ice near Barrow, Alaska, in recent years have revealed particularly striking banding patterns and prompted a study of their macroscopic and microscopic characteristics. The banding patterns are quantified from photographs of full-depth sections of the ice, and examples are presented from the Chukchi Sea and Elson Lagoon. Statistics on band spacing are presented, and the growth records for three seasons are employed to estimate their time of formation. These data provide insight into the periodicity of the underlying phenomena. Micrographs are used to examine the microstructural variations associated with various banding features and to quantify the geometry of the constituent brine inclusions associated with high- and low-porosity bands. The micrography revealed that the area fraction of brine inclusions varied by a factor of nearly 3 through the more pronounced high- and low-porosity bands. Vertical micrographs obtained shortly after the materials' removal from the ice sheet showed that significantly larger inclusions form abruptly at the start of the high-porosity bands and frequently terminate abruptly at the end of the band. Crystallographic observations indicated that the high-porosity bands supported the nucleation and growth of crystals having substantially different orientations from the very well aligned columnar structure that characterized the bulk of the sheet.

  3. Surface Resonance Bands on (001)W: Experimental Dispersion Relations

    DEFF Research Database (Denmark)

    Willis, R. F.; Feuerbacher, B.; Christensen, N. Egede

    1977-01-01

    A band of unbound surface states (resonances), located in an energy region above the vacuum threshold corresponding to an energy band gap in the electron states of the bulk crystal, has been observed by angle-resolved secondary-electron-emission spectroscopy. The experimental dispersion behavior...... is in agreement with the two-dimensional band structure of a clean (001)W surface recently proposed by Smith and Mittheiss....

  4. Identical gamma-vibrational bands in {sup 165}Ho

    Energy Technology Data Exchange (ETDEWEB)

    Radford, D.C.; Galindo-Uribarri, A.; Janzen, V.P. [Chalk River Labs., Ontario (Canada)] [and others

    1996-12-31

    The structure of {sup 165}Ho at moderate spins has been investigated by means of Coulomb excitation. Two {gamma}-vibrational bands (K{sup {pi}} = 11/2{sup {minus}} and K{sup {pi}} = 3/2{sup {minus}}) are observed, with very nearly identical in-band {gamma}-ray energies. Gamma-ray branching ratios are analyzed to extract information on Coriolis mixing, and the role of the K quantum number in identical bands is discussed.

  5. Micromachined millimeter-wave photonic band-gap crystals

    International Nuclear Information System (INIS)

    Oezbay, E.; Michel, E.; Tuttle, G.; Biswas, R.; Sigalas, M.; Ho, K.

    1994-01-01

    We have developed a new technique for fabricating three-dimensional photonic band-gap crystals. Our method utilizes an orderly stacking of micromachined (110) silicon wafers to build the periodic structure. A structure with a full three-dimensional photonic band gap centered near 100 GHz was measured, with experimental results in good agreement with theoretical predictions. This basic approach described should be extendable to build structures with photonic band-gap frequencies ranging from 30 GHz to 3 THz

  6. X-band RF power sources for accelerator applications

    International Nuclear Information System (INIS)

    Kirshner, Mark F.; Kowalczyk, Richard D.; Wilsen, Craig B.; True, Richard B.; Simpson, Ian T.; Wray, John T.

    2011-01-01

    The majority of medical and industrial linear accelerators (LINACs) in use today operate at S-band. To reduce size and weight, these systems are gradually migrating toward X-band. The new LINACs will require suitable RF components to power them. In anticipation of this market, L-3 Communications Electron Devices Division (EDD) has recently developed a suite of RF sources operating at 9.3 GHz to complement our existing S-band product line. (author)

  7. Gastropericardial Fistula as a Late Complication of Laparoscopic Gastric Banding

    Directory of Open Access Journals (Sweden)

    Adam A Rudd

    2017-01-01

    Full Text Available Laparoscopic adjustable gastric banding (LAGB is a bariatric procedure that is being performed with increasing frequency as an alternative management option for morbid obesity. Several common complications have been reported including gastric band slippage and associated pouch dilatation, intragastric erosion of the band, gastric wall perforation, and abscess formation. We present a case of gastropericardial fistula occurring nine years after an LAGB. There have been no previous documented cases of the complication after this procedure.

  8. Left regular bands of groups of left quotients

    International Nuclear Information System (INIS)

    El-Qallali, A.

    1988-10-01

    A semigroup S which has a left regular band of groups as a semigroup of left quotients is shown to be the semigroup which is a left regular band of right reversible cancellative semigroups. An alternative characterization is provided by using spinned products. These results are applied to the case where S is a superabundant whose set of idempotents forms a left normal band. (author). 13 refs

  9. Deep-Space Ka-Band Flight Experience

    Science.gov (United States)

    Morabito, D. D.

    2017-11-01

    Lower frequency bands have become more congested in allocated bandwidth as there is increased competition between flight projects and other entities. Going to higher frequency bands offers significantly more bandwidth, allowing for the use of much higher data rates. However, Ka-band is more susceptible to weather effects than lower frequency bands currently used for most standard downlink telemetry operations. Future or prospective flight projects considering deep-space Ka-band (32-GHz) telemetry data links have expressed an interest in understanding past flight experience with received Ka-band downlink performance. Especially important to these flight projects is gaining a better understanding of weather effects from the experience of current or past missions that operated Ka-band radio systems. We will discuss the historical flight experience of several Ka-band missions starting from Mars Observer in 1993 up to present-day deep-space missions such as Kepler. The study of historical Ka-band flight experience allows one to recommend margin policy for future missions. Of particular interest, we will review previously reported-on flight experience with the Cassini spacecraft Ka-band radio system that has been used for radio science investigations as well as engineering studies from 2004 to 2015, when Cassini was in orbit around the planet Saturn. In this article, we will focus primarily on the Kepler spacecraft Ka-band link, which has been used for operational telemetry downlink from an Earth trailing orbit where the spacecraft resides. We analyzed the received Ka-band signal level data in order to characterize link performance over a wide range of weather conditions and as a function of elevation angle. Based on this analysis of Kepler and Cassini flight data, we found that a 4-dB margin with respect to adverse conditions ensures that we achieve at least a 95 percent data return.

  10. Analytically derived conversion of spectral band radiance to brightness temperature

    Energy Technology Data Exchange (ETDEWEB)

    Berk, Alexander [Spectral Sciences, Inc., 44th Avenue, Burlington, MA 01803 (United States)], E-mail: lex@spectral.com

    2008-05-15

    Simple analytic expressions for brightness temperature have been derived in terms of band response function spectral moments. Accuracy measures are also derived. Application of these formulas to GOES-12 Sounder thermal infrared bands produces brightness temperature residuals between -5.0 and 2.5 mK for a 150-400 K temperature range. The magnitude of residuals for the five ASTER Radiometer thermal infrared bands over the same temperature range is less than 0.22 mK.

  11. Gastric band tubing-related complication during pregnancy.

    Science.gov (United States)

    Ongso, Yuni F; Beh, Han N

    2017-11-01

    In the past few decades, laparoscopic adjustable gastric banding is one of the most common bariatric procedures performed to treat morbid obesity. Device-related complication such as connection-tubing problem is rare. Here we present a case of gastric band tubing complication during pregnancy. This case illustrates the need to maintain high index of suspicion of gastric band device-related complication during pregnancy and early referral for bariatric surgical assessment is recommended.

  12. Development of a Control Banding Tool for Nanomaterials

    OpenAIRE

    Riediker, M.; Ostiguy, C.; Triolet, J.; Troisfontaine, P.; Vernez, D.; Bourdel, G.; Thieriet, N.; Cadène, A.

    2012-01-01

    Control banding (CB) can be a useful tool for managing the potential risks of nanomaterials. The here proposed CB, which should be part of an overall risk control strategy, groups materials by hazard and emission potential. The resulting decision matrix proposes control bands adapted to the risk potential levels and helps define an action plan. If this plan is not practical and financially feasible, a full risk assessment is launched. The hazard banding combines key concepts of nanomaterial t...

  13. The Marvels of Electromagnetic Band Gap (EBG) Structures

    Science.gov (United States)

    2003-11-01

    terminology of "Electromagnetic conference papers and journal articles dealing with Band- gaps (EBG)". Recently, many researchers the characterizations...Band Gap (EBG) Structures 9 utilized to reduce the mutual coupling between Structures: An FDTD/Prony Technique elements of antenna arrays. based on the...Band- Gap of several patents. He has had pioneering research contributions in diverse areas of electromagnetics,Snteructure", Dymposiget o l 21 IE 48

  14. Design of an S band narrow-band bandpass BAW filter

    Science.gov (United States)

    Gao, Yang; Zhao, Kun-li; Han, Chao

    2017-11-01

    An S band narrowband bandpass filter BAW with center frequency 2.460 GHz, bandwidth 41MHz, band insertion loss - 1.154 dB, the passband ripple 0.9 dB, the out of band rejection about -42.5dB@2.385 GHz; -45.5dB@2.506 GHz was designed for potential UAV measurement and control applications. According to the design specifications, the design is as follows: each FBAR's stack was designed in BAW filter by using Mason model. Each FBAR's shape was designed with the method of apodization electrode. The layout of BAW filter was designed. The acoustic-electromagnetic cosimulation model was built to validate the performance of the designed BAW filter. The presented design procedure is a common one, and there are two characteristics: 1) an A and EM co-simulation method is used for the final BAW filter performance validation in the design stage, thus ensures over-optimistic designs by the bare 1D Mason model are found and rejected in time; 2) An in-house developed auto-layout method is used to get compact BAW filter layout, which simplifies iterative error-and-try work here and output necessary in-plane geometry information to the A and EM cosimulation model.

  15. S-band and X-band integrated PWT photoelectron linacs

    International Nuclear Information System (INIS)

    Yu, D.; Newsham, D.; Zeng, J.; Rosenzweig, J.

    2001-01-01

    A compact high-energy injector, which has been developed by DULY Research Inc., will have wide scientific, industrial, and medical applications. The new photoelectron injector integrates the photocathode directly into a multicell linear accelerator. By focusing the beam with solenoids or permanent magnets, and producing high current with low emittance, high brightness and low energy spread are achieved. In addition to providing a small footprint and improved beam quality in an integrated structure, the compact system considerably simplifies external subsystems required to operate the photoelectron linac, including rf power transport, beam focusing, vacuum and cooling. The photoelectron linac employs an innovative Plane-Wave-Transformer (PWT) design, which provides strong cell-to-cell coupling, relaxes manufacturing tolerances and facilitates the attachment of external ports to the compact structure with minimal field interference. DULY Research Inc. under the support of the DOE Small Business Innovation Research (SBIR) program, has developed, constructed and installed a 20-MeV, S-band compact electron source at UCLA. Cold test results for this device are presented. DULY Research is also actively engaged in the development of an X-band photoelectron linear accelerator in a SBIR project. When completed, the higher frequency structure will be approximately three times smaller. Design considerations for this device are discussed following the S-band cold test results

  16. Surface correlation effects in two-band strongly correlated slabs.

    Science.gov (United States)

    Esfahani, D Nasr; Covaci, L; Peeters, F M

    2014-02-19

    Using an extension of the Gutzwiller approximation for an inhomogeneous system, we study the two-band Hubbard model with unequal band widths for a slab geometry. The aim is to investigate the mutual effect of individual bands on the spatial distribution of quasi-particle weight and charge density, especially near the surface of the slab. The main effect of the difference in band width is the presence of two different length scales corresponding to the quasi-particle profile of each band. This is enhanced in the vicinity of the critical interaction of the narrow band where an orbitally selective Mott transition occurs and a surface dead layer forms for the narrow band. For the doped case, two different regimes of charge transfer between the surface and the bulk of the slab are revealed. The charge transfer from surface/center to center/surface depends on both the doping level and the average relative charge accumulated in each band. Such effects could also be of importance when describing the accumulation of charges at the interface between structures made of multi-band strongly correlated materials.

  17. Workshop: Western hemisphere network of bird banding programs

    Science.gov (United States)

    Celis-Murillo, A.

    2007-01-01

    Purpose: To promote collaboration among banding programs in the Americas. Introduction: Bird banding and marking provide indispensable tools for ornithological research, management, and conservation of migratory birds on migratory routes, breeding and non-breeding grounds. Many countries and organizations in Latin America and the Caribbean are in the process of developing or have expressed interest in developing national banding schemes and databases to support their research and management programs. Coordination of developing and existing banding programs is essential for effective data management, reporting, archiving and security, and most importantly, for gaining a fuller understanding of migratory bird conservation issues and how the banding data can help. Currently, there is a well established bird-banding program in the U.S.A. and Canada, and programs in other countries are being developed as well. Ornithologists in many Latin American countries and the Caribbean are interested in using banding and marking in their research programs. Many in the ornithological community are interested in establishing banding schemes and some countries have recently initiated independent banding programs. With the number of long term collaborative and international initiatives increasing, the time is ripe to discuss and explore opportunities for international collaboration, coordination, and administration of bird banding programs in the Western Hemisphere. We propose the second ?Western Hemisphere Network of Bird Banding Programs? workshop, in association with the SCSCB, to be an essential step in the progress to strengthen international partnerships and support migratory bird conservation in the Americas and beyond. This will be the second multi-national meeting to promote collaboration among banding programs in the Americas (the first meeting was held in October 8-9, 2006 in La Mancha, Veracruz, Mexico). The Second ?Western Hemisphere Network of Bird Banding Programs

  18. A programmable ultra-low noise X-band exciter.

    Science.gov (United States)

    MacMullen, A; Hoover, L R; Justice, R D; Callahan, B S

    2001-07-01

    A programmable ultra-low noise X-band exciter has been developed using commercial off-the-shelf components. Its phase noise is more than 10 dB below the best available microwave synthesizers. It covers a 7% frequency band with 0.1-Hz resolution. The X-band output at +23 dBm is a combination of signals from an X-band sapphire-loaded cavity oscillator (SLCO), a low noise UHF frequency synthesizer, and special-purpose frequency translation and up-conversion circuitry.

  19. Block 3 X-band receiver-exciter

    Science.gov (United States)

    Johns, C. E.

    1987-01-01

    The development of an X-band exciter, for use in the X-Band Uplink Subsystem, was completed. The exciter generates the drive signal for the X-band transmitter and also generates coherent test signals for the S- and X-band Block 3 translator and a Doppler reference signal for the Doppler extractor system. In addition to the above, the exciter generates other reference signals that are described. Also presented is an overview of the exciter design and some test data taken on the prototype. A brief discussion of the Block 3 Doppler extractor is presented.

  20. Deflation of gastric band balloon in pregnancy for improving outcomes.

    Science.gov (United States)

    Jefferys, Amanda E; Siassakos, Dimitrios; Draycott, Tim; Akande, Valentine A; Fox, Robert

    2013-04-30

    In line with the rise in the prevalence of obesity, an increasing number of women of childbearing age are undergoing laparoscopic adjustable gastric banding (LAGB), resulting in an increasing number of pregnancies with a band in place. Currently, there is no consensus on optimal band management in pregnancy. Some clinicians advocate leaving the band balloon inflated to reduce gestational weight gain and associated adverse perinatal outcomes. However, there are concerns that maintaining balloon inflation during pregnancy might increase the risk of band complications and adversely affect fetal development and/or growth as a result of reduced nutritional intake. To compare maternal and perinatal outcomes for elective gastric band balloon deflation versus intention to maintain balloon inflation during pregnancy. We searched the Cochrane Pregnancy and Childbirth Group's Trials Register (30 September 2012) and the Web of Science database (1940 to September 2012). Randomised-controlled trials comparing elective deflation of the gastric band balloon with intention to maintain balloon inflation in pregnant women who have undergone LAGB. Two review authors independently assessed studies for inclusion. No studies met the criteria for inclusion in the review. To date no randomised controlled trials exist that compare elective deflation of the gastric band balloon in pregnancy versus intention to maintain balloon inflation. Further research is needed to define the optimum management of the gastric band balloon in pregnancy.

  1. Injuries and Injury Prevention in the US Army Band

    National Research Council Canada - National Science Library

    Knapik, Joseph J; Jones, Sarah B; Ohlin, Doug W; Canham-Chervak, Michelle; Darakjy, Salima S; Goddard, Donald E; Hauret, Keith G; Hadley, Jeffrey A; Twombly, Gregory; Harkins, Deanna K

    2006-01-01

    ...) medical data from the Defense Medical Surveillance System, 3) audiograms of Band member from the Defense Occupational and Environmental Health Readiness System-Hearing Conservation database, 4...

  2. Conservation of topological quantum numbers in energy bands

    International Nuclear Information System (INIS)

    Chang, L.N.; Liang, Y.

    1988-01-01

    Quantum systems described by parametrized Hamiltinians are studied in a general context. Within this context, the classification scheme of Avron-Seiler-Simon for non-degenerate energy bands is extended to cover general parameter spaces, whole their sum rule is generalized to cover cases with degenerate bands as well. Additive topological quantum numbers are defined, and these are shown to be conserved in energy band ''collisions''. The conservation laws dictate that when some invariants are non-vanishing, no energy gap can develop in a set of degenerate bands. This gives rise to a series of splitting rules

  3. The amniotic band syndrome: antenatal sonographic diagnosis and potential pitfalls.

    Science.gov (United States)

    Mahony, B S; Filly, R A; Callen, P W; Golbus, M S

    1985-05-01

    Amniotic band syndrome causes a variety of fetal malformations involving the limbs, craniofacial region, and trunk. Six prenatally diagnosed cases of amniotic band syndrome are discussed. The diagnosis was based on sonographic visualization of either amniotic sheets or bands associated with fetal deformation or deformities in nonembryologic distributions known to characterize the amniotic band syndrome. Seven additional cases are considered in which an aberrant sheet of tissue with a free edge was visualized within the amniotic cavity but no restriction of fetal motion or subsequent deformity was demonstrated.

  4. Band structures in the nematic elastomers phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Shuai [Department of Mechanics, School of Civil Engineering, Beijing Jiaotong University, Beijing 100044 (China); School of Civil Engineering and Architecture, Anyang Normal University, Anyang 455000 (China); Liu, Ying, E-mail: yliu5@bjtu.edu.cn [Department of Mechanics, School of Civil Engineering, Beijing Jiaotong University, Beijing 100044 (China); Liang, Tianshu [Department of Mechanics, School of Civil Engineering, Beijing Jiaotong University, Beijing 100044 (China)

    2017-02-01

    As one kind of new intelligent materials, nematic elastomers (NEs) represent an exciting physical system that combines the local orientational symmetry breaking and the entropic rubber elasticity, producing a number of unique physical phenomena. In this paper, the potential application of NEs in the band tuning is explored. The band structures in two kinds of NE phononic crystals (PCs) are investigated. Through changing NE intrinsic parameters, the influence of the porosity, director rotation and relaxation on the band structures in NE PCs are analyzed. This work is a meaningful try for application of NEs in acoustic field and proposes a new intelligent strategy in band turning.

  5. Band structures in the nematic elastomers phononic crystals

    International Nuclear Information System (INIS)

    Yang, Shuai; Liu, Ying; Liang, Tianshu

    2017-01-01

    As one kind of new intelligent materials, nematic elastomers (NEs) represent an exciting physical system that combines the local orientational symmetry breaking and the entropic rubber elasticity, producing a number of unique physical phenomena. In this paper, the potential application of NEs in the band tuning is explored. The band structures in two kinds of NE phononic crystals (PCs) are investigated. Through changing NE intrinsic parameters, the influence of the porosity, director rotation and relaxation on the band structures in NE PCs are analyzed. This work is a meaningful try for application of NEs in acoustic field and proposes a new intelligent strategy in band turning.

  6. Electronic band structure of lithium, sodium and potassium fluorides

    International Nuclear Information System (INIS)

    Jouanin, C.; Albert, J.P.; Gout, C.

    1975-01-01

    A mixed tight-binding, pseudopotential method is proposed to calculate the energy band structure of large-gap crystals and is tested here on LiF, NaF and KF. Three-centre terms are included in the determination of the valence bands by the tight-binding method and for the conduction bands we use a pseudopotential model proposed by Bassani and Giuliano, modified for the positive ions. By taking into account the polarization corrections, transitions calculated from the energy band structures are compared with experimental data and the agreement is generally good

  7. Multiple superdeformed bands in Sr, Y, and Zr nuclei

    International Nuclear Information System (INIS)

    Reviol, W.; Sarantites, D.G.; Lerma, F.; Devlin, M.; LaFosse, D.R.; Chiara, C.J.; Wyss, R.; Baktash, C.; Jin, H.-Q.; Tabor, S.L.; Soltysik, D.; Clark, R.M.; Lee, I.Y.; Macchiavelli, A.O.; MacLeod, R.W.

    2003-01-01

    Multiple superdeformed bands in the nuclei 80-83Sr, 82-84Y, and 83,84Zr have been studied in a backed-target experiment using the Gammasphere and Microball detector arrays. For 15 bands in these nuclei, average transition quadrupole moments (Qt) have been measured accurately. Among those are two pairs of 'isospectral' bands and the Qt values obtained in each case are nearly identical. The measured Qt values and dynamical moments of inertia place stringent conditions on configuration assignments for the bands obtained from mean field calculations

  8. The complex band structure for armchair graphene nanoribbons

    International Nuclear Information System (INIS)

    Zhang Liu-Jun; Xia Tong-Sheng

    2010-01-01

    Using a tight binding transfer matrix method, we calculate the complex band structure of armchair graphene nanoribbons. The real part of the complex band structure calculated by the transfer matrix method fits well with the bulk band structure calculated by a Hermitian matrix. The complex band structure gives extra information on carrier's decay behaviour. The imaginary loop connects the conduction and valence band, and can profoundly affect the characteristics of nanoscale electronic device made with graphene nanoribbons. In this work, the complex band structure calculation includes not only the first nearest neighbour interaction, but also the effects of edge bond relaxation and the third nearest neighbour interaction. The band gap is classified into three classes. Due to the edge bond relaxation and the third nearest neighbour interaction term, it opens a band gap for N = 3M − 1. The band gap is almost unchanged for N = 3M + 1, but decreased for N = 3M. The maximum imaginary wave vector length provides additional information about the electrical characteristics of graphene nanoribbons, and is also classified into three classes

  9. Photodensitometric tracing of Mach bands and its significance

    International Nuclear Information System (INIS)

    Yoo, Shi Joon; Cho, Kyung Sik; Kang, Heung Sik; Cho, Byung Jae

    1984-01-01

    Mach bands, a visual phenomenon resulting from lateral inhibitory impulses in the retina, are recognized as lucent or dense lines at the borders of different radiographic densities. A number of clinical situations have been described in which Mach bands may cause difficulty in radiographic diagnosis. Photodensitometric measurement of the film can differentiate the true change in film density from the Mach band which is an optical illusion. Authors present several examples of photodensitometric tracings of Mach bands, with the brief review of the mechanism of their production

  10. Picosecond thermometer in the amide I band of myoglobin

    DEFF Research Database (Denmark)

    Austin, R.H.; Xie, A.; Meer, L. van der

    2005-01-01

    The amide I and II bands in myoglobin show a heterogeneous temperature dependence, with bands at 6.17 and 6.43 mu m which are more intense at low temperatures. The amide I band temperature dependence is on the long wavelength edge of the band, while the short wavelength side has almost...... can be used to determine the time it takes vibrational energy to flow into the hydration shell. We determine that vibrational energy flow to the hydration shell from the amide I takes approximately 20 ps to occur....

  11. Macroscopic optical response and photonic bands

    International Nuclear Information System (INIS)

    Pérez-Huerta, J S; Luis Mochán, W; Ortiz, Guillermo P; Mendoza, Bernardo S

    2013-01-01

    We develop a formalism for the calculation of the macroscopic dielectric response of composite systems made of particles of one material embedded periodically within a matrix of another material, each of which is characterized by a well-defined dielectric function. The nature of these dielectric functions is arbitrary, and could correspond to dielectric or conducting, transparent or opaque, absorptive and dispersive materials. The geometry of the particles and the Bravais lattice of the composite are also arbitrary. Our formalism goes beyond the long-wavelength approximation as it fully incorporates retardation effects. We test our formalism through the study of the propagation of electromagnetic waves in two-dimensional photonic crystals made of periodic arrays of cylindrical holes in a dispersionless dielectric host. Our macroscopic theory yields a spatially dispersive macroscopic response which allows the calculation of the full photonic band structure of the system, as well as the characterization of its normal modes, upon substitution into the macroscopic field equations. We can also account approximately for the spatial dispersion through a local magnetic permeability and analyze the resulting dispersion relation, obtaining a region of left handedness. (paper)

  12. Metallic photonic band-gap materials

    International Nuclear Information System (INIS)

    Sigalas, M.M.; Chan, C.T.; Ho, K.M.; Soukoulis, C.M.

    1995-01-01

    We calculate the transmission and absorption of electromagnetic waves propagating in two-dimensional (2D) and 3D periodic metallic photonic band-gap (PBG) structures. For 2D systems, there is substantial difference between the s- and p-polarized waves. The p-polarized waves exhibit behavior similar to the dielectric PBG's. But, the s-polarized waves have a cutoff frequency below which there are no propagating modes. For 3D systems, the results are qualitatively the same for both polarizations but there are important differences related to the topology of the structure. For 3D structures with isolated metallic scatterers (cermet topology), the behavior is similar to that of the dielectric PBG's, while for 3D structures with the metal forming a continuous network (network topology), there is a cutoff frequency below which there are no propagating modes. The systems with the network topology may have some interesting applications for frequencies less than about 1 THz where the absorption can be neglected. We also study the role of the defects in the metallic structures

  13. Severe neurological complication following adjustable gastric banding.

    Science.gov (United States)

    Martines, G; Musa, N; Aquilino, F; Capuano, P

    2018-01-01

    In the last years with the increase of bariatric surgery, first of all as a result of new indications, a rise in the incidence of nutrient-related complications has been observed. Currently little is known about the impact of post-bariatric malnutrition and neurological complications. Wernicke's encephalopathy is a severe neurological syndrome which occurs as a result of thiamine deficiency. Wernicke-Korsakoff syndrome must be considered a serious neurological complication of bariatric surgery with significant morbidity and mortality, with rapidly progressing neurological symptoms, and must be treated immediately. We report the case of a 35 years-old male patient, affected by morbid obesity, anxious-depressive syndrome and alcohol use disorder, who after adjustable gastric banding implanted in another hospital developed a severe malnutrition and neurological syndrome. The patient showed poor adherence to the follow-up and to the dietary indications and after all, we needed to place a PEG for enteral nutrition in order to resolve the malnutrition condition and the neurological syndrome. Our experience emphasizes that preoperative selection and assessment of a patient's nutritional status according to guidelines, is required to identify potential problems, and that bariatric surgeons or physicians caring for patient who have undergone bariatric surgery should be familiar with the constellation of nutritional and neurological disorder that may occur after surgery. We want to remark the importance of preoperative selection of the patients, the follow-up and the cooperation between patient and physician in order to obtain the best result and avoid severe complications.

  14. MR findings in iliotibial band syndrome

    International Nuclear Information System (INIS)

    Nishimura, G.; Yamato, M.; Tamai, K.; Takahashi, J.; Uetani, M.

    1997-01-01

    Objective. To elucidate the MR findings in iliotibial band (ITB) syndrome. Design and patients. The subjects comprised four patients (five knees) with lateral knee pain: two athletes and two non-athletes. One non-athlete was engaged in work requiring repetitive knee movement, and the other suffered from Cushing syndrome and had bilateral abnormalities. All patients were suspected of having a lateral meniscal tear prior to MR examination, but physical examination following provisional MR diagnosis warranted the final diagnosis. MR studies included fast spin echo sagittal imaging, fat-saturated fast spin echo proton density coronal imaging, and T2* radial imaging. Twelve normal volunteers were examined. Results and conclusion. Fat-saturated coronal imaging demonstrated an ill-defined, high-intensity area deep to the ITB. T2* radial imaging showed an identical, but less conspicuous, abnormality. The MR finding suggested soft tissue inflammation and/or edema rather than focal fluid collection in the bursae. The signal alteration predominated in the region beneath the posterior fibers of the ITB, thus supporting the current opinion that the posterior fibers of the ITB are tighter against the lateral femoral epicondyle than the anterior fibers. The ITB itself did not show any signal alteration or increased thickness. (orig.). With 4 figs., 1 tab

  15. Topological nanophononic states by band inversion

    Science.gov (United States)

    Esmann, Martin; Lamberti, Fabrice Roland; Senellart, Pascale; Favero, Ivan; Krebs, Olivier; Lanco, Loïc; Gomez Carbonell, Carmen; Lemaître, Aristide; Lanzillotti-Kimura, Norberto Daniel

    2018-04-01

    Nanophononics is essential for the engineering of thermal transport in nanostructured electronic devices, it greatly facilitates the manipulation of mechanical resonators in the quantum regime, and it could unveil a new route in quantum communications using phonons as carriers of information. Acoustic phonons also constitute a versatile platform for the study of fundamental wave dynamics, including Bloch oscillations, Wannier-Stark ladders, and other localization phenomena. Many of the phenomena studied in nanophononics were inspired by their counterparts in optics and electronics. In these fields, the consideration of topological invariants to control wave dynamics has already had a great impact for the generation of robust confined states. Interestingly, the use of topological phases to engineer nanophononic devices remains an unexplored and promising field. Conversely, the use of acoustic phonons could constitute a rich platform to study topological states. Here, we introduce the concept of topological invariants to nanophononics and experimentally implement a nanophononic system supporting a robust topological interface state at 350 GHz. The state is constructed through band inversion, i.e., by concatenating two semiconductor superlattices with inverted spatial mode symmetries. The existence of this state is purely determined by the Zak phases of the constituent superlattices, i.e., the one-dimensional Berry phase. We experimentally evidenced the mode through Raman spectroscopy. The reported robust topological interface states could become part of nanophononic devices requiring resonant structures such as sensors or phonon lasers.

  16. Annual Growth Bands in Hymenaea courbaril

    Energy Technology Data Exchange (ETDEWEB)

    Westbrook, J A; Guilderson, T P; Colinvaux, P A

    2004-02-09

    One significant source of annual temperature and precipitation data arises from the regular annual secondary growth rings of trees. Several tropical tree species are observed to form regular growth bands that may or may not form annually. Such growth was observed in one stem disk of the tropical legume Hymenaea courbaril near the area of David, Panama. In comparison to annual reference {Delta}{sup 14}C values from wood and air, the {Delta}{sup 14}C values from the secondary growth rings formed by H. courbaril were determined to be annual in nature in this one stem disk specimen. During this study, H. courbaril was also observed to translocate recently produced photosynthate into older growth rings as sapwood is converted to heartwood. This process alters the overall {Delta}{sup 14}C values of these transitional growth rings as cellulose with a higher {Delta}{sup 14}C content is translocated into growth rings with a relatively lower {Delta}{sup 14}C content. Once the annual nature of these growth rings is established, further stable isotope analyses on H. courbaril material in other studies may help to complete gaps in the understanding of short and of long term global climate patterns.

  17. Electronic Band Structure of Helical Polyisocyanides.

    Science.gov (United States)

    Champagne, Benoît; Liégeois, Vincent; Fripiat, Joseph G; Harris, Frank E

    2017-10-19

    Restricted Hartree-Fock computations are reported for a methyl isocyanide polymer (repeating unit -C═N-CH 3 ), whose most stable conformation is expected to be a helical chain. The computations used a standard contracted Gaussian orbital set at the computational levels STO-3G, 3-21G, 6-31G, and 6-31G**, and studies were made for two line-group configurations motivated by earlier work and by studies of space-filling molecular models: (1) A structure of line-group symmetry L9 5 , containing a 9-fold screw axis with atoms displaced in the axial direction by 5/9 times the lattice constant, and (2) a structure of symmetry L4 1 that had been proposed, containing a 4-fold screw axis with translation by 1/4 of the lattice constant. Full use of the line-group symmetry was employed to cause most of the computational complexity to depend only on the size of the asymmetric repeating unit. Data reported include computed bond properties, atomic charge distribution, longitudinal polarizability, band structure, and the convoluted density of states. Most features of the description were found to be insensitive to the level of computational approximation. The work also illustrates the importance of exploiting line-group symmetry to extend the range of polymer structural problems that can be treated computationally.

  18. Rotational band structure in 132La

    International Nuclear Information System (INIS)

    Oliveira, J.R.B.; Emediato, L.G.R.; Rizzutto, M.A.; Ribas, R.V.; Seale, W.A.; Rao, M.N.; Medina, N.H.; Botelho, S.; Cybulska, E.W.

    1989-01-01

    '3'2La was studied using on-line gamma-spectroscopy through the reactions '1 24,126 Te( 11,10 B, 3, 4n) 132 La. The excitation function was obtained with 10 B(E lab =41.4; 45.4 and 48 MeV) in order to identify 132 La gamma-transitions. Gamma-gamma coincidences and angular distributions were performed for the 126 Te( 10 B, 4n) 132 La reaction. From the experimental results a rotational band with strongest M1 transitions and less intense 'cross-overs' E2 transitions was constructed. Using the methods of Bengtsson and Frauendorf the alignment (ix) and the Routhian (e') as a function of the angular velocity (ω) were also obtained from the experimental data. It was observed a constant alignment up to ω≅0.4 MeV, and a signature-splitting Δe'=25keV. Preliminary triaxial Cranking-Shell Model calculations indicate that a γ=-8deg deformation is consistent with the signature-splitting value of 25 keV experimentally observed. (Author) [es

  19. Band structure studies of actinide systems

    International Nuclear Information System (INIS)

    Koelling, D.D.

    1976-01-01

    The nature of the f-orbitals in an actinide system plays a crucial role in determining the electronic properties. It has long been realized that when the actinide separation is small enough for the f-orbitals to interact directly, the system will exhibit itinerant electron properties: an absence of local moment due to the f-orbitals and sometimes even superconductivity. However, a number of systems with the larger actinide separation that should imply local moment behavior also exhibit intinerant properties. Such systems (URh 3 , UIr 3 , UGe 3 , UC) were examined to learn something about the other f-interactions. A preliminary observation made is that there is apparently a very large and ansiotropic mass enhancement in these systems. There is very good reason to believe that this is not solely due to large electron--electron correlations but to a large electron--phonon interaction as well. These features of the ''non-magnetic'', large actinide separation systems are discussed in light of our results to date. Finally, the results of some recent molecular calculations on actinide hexafluorides are used to illustrate the shielding effects on the intra-atomic Coulomb term U/sub f-f/ which would appear in any attempt to study the formation of local moments. As one becomes interested in materials for which a band structure is no longer an adequate model, this screened U/sub ff/ is the significant parameter and efforts must be made to evaluate it in solid state systems

  20. Band structure, band offsets, substitutional doping, and Schottky barriers of bulk and monolayer InSe

    Science.gov (United States)

    Guo, Yuzheng; Robertson, John

    2017-09-01

    We present a detailed study of the electronic structure of the layered semiconductor InSe. We calculate the band structure of the monolayer and bulk material using density functional theory, hybrid functionals, and G W . The band gap of the monolayer InSe is calculated to be 2.4 eV in screened exchange hybrid functional, close to the experimental photoluminescence gap. The electron affinities and band offsets are calculated for vertical stacked-layer heterostructures, and are found to be suitable for tunnel field effect transistors (TFETs) in combination with WS e2 or similar. The valence-band edge of InSe is calculated to lie 5.2 eV below the vacuum level, similar to that for the closed shell systems HfS e2 or SnS e2 . Hence InSe would be suitable to act as a p -type drain in the TFET. The intrinsic defects are calculated. For Se-rich layers, the Se adatom (interstitial) is found to be the most stable defect, whereas for In-rich layers, the Se vacancy is the most stable for the neutral state. Antisites tend to have energies just above those of vacancies. The Se antisite distorts towards a bond-breaking distortion as in the EL2 center of GaAs. Both substitutional donors and acceptors are calculated to be shallow, and effective dopants. They do not reconstruct to form nondoping configurations as occurs in black phosphorus. Finally, the Schottky barriers of metals on InSe are found to be strongly pinned by metal induced gap states (MIGS) at ˜0.5 eV above the valence-band edge. Any interfacial defects would lead to a stronger pinning at a similar energy. Overall, InSe is an effective semiconductor combining the good features of 2D (lack of dangling bonds, etc.) with the good features of 3D (effective doping), which few others achieve.

  1. A UWB Band-Pass Antenna with Triple-Notched Band Using Common Direction Rectangular Complementary Split-Ring Resonators

    Directory of Open Access Journals (Sweden)

    Bo Yan

    2013-01-01

    Full Text Available A novel ultrawideband (UWB antenna which has a triple-band notch function is presented. The proposed antenna can block interfering signals from C-band satellite communication systems, IEEE802.11a, and HIPERLAN/2 WLAN systems for example. The antenna is excited by using novel common direction rectangular complementary split-ring resonators (CSRR fabricated on radiating patch of the dielectric substrate with coplanar waveguide (CPW feed strip line. The voltage standing wave ratio (VSWR of the proposed antenna is less than 2.0 in the frequency band from 2.8 to 12 GHz, while showing a very sharp band-rejection performance at 3.9 GHz, 5.2 GHz, and 5.9 GHz. The measurement results show that the proposed antenna provides good omnidirectional field pattern over its whole frequency band excluding the rejected band, which is suitable for UWB applications.

  2. A comparison of L-band and C-band rf guns as sources for inline-injection systems

    International Nuclear Information System (INIS)

    Gallardo, J.C.; Kirk, H.G.; Meyerer, T.

    1994-12-01

    We consider the beam dynamics associated with installing a BNL type 1 1/2 cell L-band or C-band rf gun before two TESLA L-band cryomodules. This system will deliver a 25 MeV electron beam with peak currents on the order of 100 A suitable for further magnetic compression. evaluate the injection systems utilizing the electron beam dynamic code PARMELA from the point of view of minimizing the transverse invariant emittance

  3. Terra MODIS Band 27 Electronic Crosstalk Effect and Its Removal

    Science.gov (United States)

    Sun, Junqiang; Xiong, Xiaoxiong; Madhavan, Sriharsha; Wenny, Brian

    2012-01-01

    The MODerate-resolution Imaging Spectroradiometer (MODIS) is one of the primary instruments in the NASA Earth Observing System (EOS). The first MODIS instrument was launched in December, 1999 on-board the Terra spacecraft. MODIS has 36 bands, covering a wavelength range from 0.4 micron to 14.4 micron. MODIS band 27 (6.72 micron) is a water vapor band, which is designed to be insensitive to Earth surface features. In recent Earth View (EV) images of Terra band 27, surface feature contamination is clearly seen and striping has become very pronounced. In this paper, it is shown that band 27 is impacted by electronic crosstalk from bands 28-30. An algorithm using a linear approximation is developed to correct the crosstalk effect. The crosstalk coefficients are derived from Terra MODIS lunar observations. They show that the crosstalk is strongly detector dependent and the crosstalk pattern has changed dramatically since launch. The crosstalk contributions are positive to the instrument response of band 27 early in the mission but became negative and much larger in magnitude at later stages of the mission for most detectors of the band. The algorithm is applied to both Black Body (BB) calibration and MODIS L1B products. With the crosstalk effect removed, the calibration coefficients of Terra MODIS band 27 derived from the BB show that the detector differences become smaller. With the algorithm applied to MODIS L1B products, the Earth surface features are significantly removed and the striping is substantially reduced in the images of the band. The approach developed in this report for removal of the electronic crosstalk effect can be applied to other MODIS bands if similar crosstalk behaviors occur.

  4. Observation of band gaps in the gigahertz range and deaf bands in a hypersonic aluminum nitride phononic crystal slab

    Science.gov (United States)

    Gorisse, M.; Benchabane, S.; Teissier, G.; Billard, C.; Reinhardt, A.; Laude, V.; Defaÿ, E.; Aïd, M.

    2011-06-01

    We report on the observation of elastic waves propagating in a two-dimensional phononic crystal composed of air holes drilled in an aluminum nitride membrane. The theoretical band structure indicates the existence of an acoustic band gap centered around 800 MHz with a relative bandwidth of 6.5% that is confirmed by gigahertz optical images of the surface displacement. Further electrical measurements and computation of the transmission reveal a much wider attenuation band that is explained by the deaf character of certain bands resulting from the orthogonality of their polarization with that of the source.

  5. Band-to-band transitions, selection rules, effective mass, and excitonic contributions in monoclinic β -Ga2O3

    Science.gov (United States)

    Mock, Alyssa; Korlacki, Rafał; Briley, Chad; Darakchieva, Vanya; Monemar, Bo; Kumagai, Yoshinao; Goto, Ken; Higashiwaki, Masataka; Schubert, Mathias

    2017-12-01

    We employ an eigenpolarization model including the description of direction dependent excitonic effects for rendering critical point structures within the dielectric function tensor of monoclinic β -Ga2O3 yielding a comprehensive analysis of generalized ellipsometry data obtained from 0.75-9 eV. The eigenpolarization model permits complete description of the dielectric response. We obtain, for single-electron and excitonic band-to-band transitions, anisotropic critical point model parameters including their polarization vectors within the monoclinic lattice. We compare our experimental analysis with results from density functional theory calculations performed using the Gaussian-attenuation-Perdew-Burke-Ernzerhof hybrid density functional. We present and discuss the order of the fundamental direct band-to-band transitions and their polarization selection rules, the electron and hole effective mass parameters for the three lowest band-to-band transitions, and their excitonic contributions. We find that the effective masses for holes are highly anisotropic and correlate with the selection rules for the fundamental band-to-band transitions. The observed transitions are polarized close to the direction of the lowest hole effective mass for the valence band participating in the transition.

  6. A conversation with Susan Band Horwitz.

    Science.gov (United States)

    Horwitz, Susan Band; Goldman, I David

    2015-01-01

    Susan Band Horwitz is a Distinguished Professor and holds the Falkenstein Chair in Cancer Research at Albert Einstein College of Medicine in New York. She is co-chair of the Department of Molecular Pharmacology and associate director for therapeutics at the Albert Einstein Cancer Center. After graduating from Bryn Mawr College, Dr. Horwitz received her PhD in biochemistry from Brandeis University. She has had a continuing interest in natural products as a source of new drugs for the treatment of cancer. Her most seminal research contribution has been in the development of Taxol(®). Dr. Horwitz and her colleagues made the discovery that Taxol had a unique mechanism of action and suggested that it was a prototype for a new class of antitumor drugs. Although Taxol was an antimitotic agent blocking cells in the metaphase stage of the cell cycle, Dr. Horwitz recognized that Taxol was blocking mitosis in a way different from that of other known agents. Her group demonstrated that the binding site for Taxol was on the β-tubulin subunit. The interaction of Taxol with the β-tubulin subunit resulted in stabilized microtubules, essentially paralyzing the cytoskeleton, thereby preventing cell division. Dr. Horwitz served as president (2002-2003) of the American Association for Cancer Research (AACR). She is a member of the National Academy of Sciences, the Institute of Medicine, the American Academy of Arts and Sciences, and the American Philosophical Society. She has received numerous honors and awards, including the C. Chester Stock Award from Memorial Sloan Kettering Cancer Center, the Warren Alpert Foundation Prize from Harvard Medical School, the Bristol-Myers Squibb Award for Distinguished Achievement in Cancer Research, the American Cancer Society's Medal of Honor, and the AACR Award for Lifetime Achievement in Cancer Research. The following interview was conducted on January 23, 2014.

  7. Polarimetric and Structural Properties of a Boreal Forest at P-Band and L-Band

    Science.gov (United States)

    Tebaldini, S.; Rocca, F.

    2010-12-01

    With this paper we investigate the structural and polarimetric of the boreal forest within the Krycklan river catchment, Northern Sweden, basing on multi-polarimetric and multi-baseline SAR surveys at P-Band and L-Band collected in the framework of the ESA campaign BioSAR 2008. The analysis has been carried out by applying the Algebraic Synthesis (AS) technique, recently introduced in literature, which provides a theoretical framework for the decomposition of the backscattered signal into ground-only and volume-only contributions, basing on both baseline and polarization diversity. The availability of multiple baselines allows the formation of a synthetic aperture not only along the azimuth direction but also in elevation. Accordingly, the backscattered echoes can be focused not only in the slant range, azimuth plane, but in the whole 3D space. This is the rationale of the SAR Tomography (T-SAR) concept, which has been widely considered in the literature of the last years. It follows that, as long as the penetration in the scattering volume is guaranteed, the vertical profile of the vegetation layer is retrieved by separating backscatter contributions along the vertical direction, which is the main reason for the exploitation of Tomographic techniques at longer wavelengths. Still, the capabilities of T-SAR are limited to imaging the global vertical structure of the electromagnetic scattering in a certain polarization. It then becomes important to develop methodologies for the investigation of the vertical structure of different Scattering Mechanisms (SMs), such as ground and volume scattering, in such a way as to derive information that can be delivered also outside the field of Radar processing. This is an issue that may become relevant at longer wavelengths, such as P-Band, where the presence of multiple scattering arising from the interaction with terrain could hinder the correct reconstruction of the forest structure. The availability of multiple polarizations

  8. Amniotic band-like structures | Govender | Obstetrics and ...

    African Journals Online (AJOL)

    Intra-amniotic band-like structures are seen fairly commonly on routine obstetric scans, especially during the first and second trimesters of pregnancy. It is important to establish the cause for such findings in order to determine their clinical significance and to assess prognosis. The vast majority of band-like structures are ...

  9. Band excitation method applicable to scanning probe microscopy

    Science.gov (United States)

    Jesse, Stephen [Knoxville, TN; Kalinin, Sergei V [Knoxville, TN

    2010-08-17

    Methods and apparatus are described for scanning probe microscopy. A method includes generating a band excitation (BE) signal having finite and predefined amplitude and phase spectrum in at least a first predefined frequency band; exciting a probe using the band excitation signal; obtaining data by measuring a response of the probe in at least a second predefined frequency band; and extracting at least one relevant dynamic parameter of the response of the probe in a predefined range including analyzing the obtained data. The BE signal can be synthesized prior to imaging (static band excitation), or adjusted at each pixel or spectroscopy step to accommodate changes in sample properties (adaptive band excitation). An apparatus includes a band excitation signal generator; a probe coupled to the band excitation signal generator; a detector coupled to the probe; and a relevant dynamic parameter extractor component coupled to the detector, the relevant dynamic parameter extractor including a processor that performs a mathematical transform selected from the group consisting of an integral transform and a discrete transform.

  10. Study of positive-parity yrast band in 83Rb

    International Nuclear Information System (INIS)

    Ganguly, S.; Banerjee, P.; Ray, I.; Kshetri, R.; Bhattacharya, S.; Saha Sarkar, M.; Goswami, A.; Muralithar, S.; Singh, R.P.; Kumar, R.; Bhowmik, R.K.

    2005-01-01

    The properties of the positive-parity yrast band in the odd-A 81,83,85 Rb (Z=37) isotopes show remarkable changes as N increases. The objective of the present work is to study the structure of the lowest positive-parity band in 83 Rb from lifetime studies

  11. Large area modules based on low band gap polymers

    DEFF Research Database (Denmark)

    Bundgaard, Eva; Krebs, Frederik C

    2010-01-01

    The use of three low band gap polymers in large area roll-to-roll coated modules is demonstrated. The polymers were prepared by a Stille cross coupling polymerization and all had a band gap around 1.6 eV. The polymers were first tested in small area organic photovoltaic devices which showed...

  12. 76 FR 56657 - Unlicensed Operation in the TV Broadcast Bands

    Science.gov (United States)

    2011-09-14

    ...-174] Unlicensed Operation in the TV Broadcast Bands AGENCY: Federal Communications Commission. ACTION... collection requirements contained in the regulations for issues relating to the unlicensed use of the TV bands (TV White Space). The information collection requirements were approved on September 7, 2011 by...

  13. Band-Structure of Thallium by the LMTO Method

    DEFF Research Database (Denmark)

    Holtham, P. M.; Jan, J. P.; Skriver, Hans Lomholt

    1977-01-01

    by an energy gap. The 6d and 7s bands were found to be far above the Fermi level and the 5d states were found to be far below it. Fermi surface properties and the electronic specific heat are computed and compared with experiment. The joint density of states has also been computed and is in reasonable...... and p bands for the HCP structure. Energy bands have been evaluated both with and without spin-orbit coupling which is particularly large in thallium. Energy bands close to the Fermi level were found to be mainly 6p like in character. The 6s states lay below the 6p bands and were separated from them......The relativistic band structure of thallium has been calculated using the linear muffin-tin orbital (LMTO) method. The positions and extents of the bands were found to follow the Wigner-Seitz rule approximately, and the origin of the dispersion of the bands was established from the canonical s...

  14. Determination of conduction and valence band electronic structure ...

    Indian Academy of Sciences (India)

    shifts in the rutile Ti d-band to lower energy with respect to anatase, i.e., ... requires excitation with UV light due to its wide band ... RIXS maps were compared to the theoretical results .... optical methods are insufficient, such as dark samples.

  15. 76 FR 51978 - Unlicensed Operation in the TV Broadcast Bands

    Science.gov (United States)

    2011-08-19

    ... this document the Office of Engineering and Technology conditionally designates Microsoft Corporation....gov . Summary of Order 1. In this Order, the Office of Engineering and Technology designates Microsoft... the TV bands, TV bands devices must include a geo-location capability and the capability to access a...

  16. Present status of intermediate band solar cell research

    International Nuclear Information System (INIS)

    Cuadra, L.; Marti, A.; Luque, A.

    2004-01-01

    The intermediate band solar cell is a theoretical concept with the potential for exceeding the performance of conventional single-gap solar cells. This novel photovoltaic converter bases its superior theoretical efficiency over single-gap solar cells by enhancing its photogenerated current, via the two-step absorption of sub-band gap photons, without reducing its output voltage. This is achieved through a material with an electrically isolated and partially filled intermediate band located within a higher forbidden gap. This material is commonly named intermediate band material. This paper centres on summarising the present status of intermediate band solar cell research. A number of attempts, which aim to implement the intermediate band concept, are being followed: the direct engineering of the intermediate band material, its implementation by means of quantum dots and the highly porous material approach. Among other sub-band gap absorbing proposals, there is a renewed interest on the impurity photovoltaic effect, the quantum well solar cells and the particularly promising proposal for the use of up- and down-converters

  17. 47 CFR 18.303 - Prohibited frequency bands.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Prohibited frequency bands. 18.303 Section 18.303 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL INDUSTRIAL, SCIENTIFIC, AND MEDICAL EQUIPMENT Technical Standards § 18.303 Prohibited frequency bands. Operation of ISM equipment within the...

  18. Gastroscopic treatment of gastric band penetrating the gastric wall

    DEFF Research Database (Denmark)

    Jess, Per; Fonnest, G

    1999-01-01

    Gastric wall penetration of a gastric band after operation for morbid obesity is a well known late complication. The treatment is usually reoperation. In this case report we show that a band penetrating the gastric wall can be successfully treated by gastroscopic operation. This technique is more...

  19. Health Risks Faced by Public School Band Directors

    Science.gov (United States)

    Woolery, Danielle N.; Woolery, Jesse A.

    2013-01-01

    Public school band directors face many work-related hazards in their grueling, yet rewarding job. As a school year progresses, directors are expected to work long hours, while trying to balance professional and personal responsibilities. A band director whose career spans multiple decades can potentially face a number of serious medical problems.…

  20. Wurtzite gallium phosphide has a direct-band gap

    NARCIS (Netherlands)

    Assali, S.; Zardo, I.; Plissard, S.; Verheijen, M.A.; Haverkort, J.E.M.; Bakkers, E.P.A.M.

    2013-01-01

    Gallium Phosphide (GaP) with the normal cubic crystal structure has an indirect band gap, which severely limits the emission efficiency. We report the fabrication of GaP nanowires with pure hexagonal crystal structure and demonstrate the direct nature of the band gap. We observe strong

  1. Popular Music Pedagogy: Band Rehearsals at British Universities

    Science.gov (United States)

    Pulman, Mark

    2014-01-01

    There has been little published pedagogical research on popular music group rehearsing. This study explores the perceptions of tutors and student pop/rock bands about the rehearsals in which they were involved as a part of their university music course. The participants were 10 tutors and 16 bands from eight British tertiary institutions. Analysis…

  2. Amniotiese Bande by 'n Baba na Abdominale Swangerskap | du P ...

    African Journals Online (AJOL)

    A baby, delivered by Caesarean section after a 36-week extra-uterine pregnancy, with deformities due to amniotic bands, is described. The mechanism of amniotic band deformities and the paediatric risks of extra-uterine pregnancy are briefly discussed. S. Afr. Med. J., 48, 1106 (1974) ...

  3. Deformation bands in porous carbonate grainstones: Field and laboratory observations

    NARCIS (Netherlands)

    Cilona, A.; Baud, P.; Tondi, E.; Agosta, F.; Vinciguerra, S.; Rustichelli, A.; Spiers, C.J.

    2012-01-01

    Recent field-based studies documented deformation bands in porous carbonates; these structures accommodate volumetric and/or shear strain by means of pore collapse, grain rotation and/or sliding. Microstructural observations of natural deformation bands in carbonates showed that, at advanced stages

  4. Steel Band Repertoire: The Case for Original Music

    Science.gov (United States)

    Tanner, Chris

    2010-01-01

    In the past few decades, the steel band art form has experienced consistent growth and development in several key respects. For example, in the United States, the sheer number of steel band programs has steadily increased, and it appears that this trend will continue in the future. Additionally, pan builders and tuners have made great strides in…

  5. Non-equilibrium and band tailing in organic conductors

    Indian Academy of Sciences (India)

    . Non-equilibrium ... Introduction. Study of organic conductors and semiconductors continues to generate interest with the ... Band tailing reduces band gap or the acti- ..... (9), we can identify Eg(0) with the focal point and is proportional to P2. 1 .

  6. Deexcitation of superdeformed bands in the nucleus Tb-151

    NARCIS (Netherlands)

    Finck, C; Appelbe, D; Beck, FA; Byrski, T; Cullen, D; Curien, D; deFrance, G; Duchene, G; Erturk, S; Haas, B; Khadiri, N; Kharraja, B; Prevost, D; Rigollet, C; Stezowski, O; Twin, P; Vivien, JP; Zuber, K

    1997-01-01

    The aim of this work is to get more informations about the decay-out of superdeformed bands. One of the best candidates in the mass A similar or equal to 150 region for that kind of research is the nucleus Tb-151. From previous works, it has been established that the first excited band goes lower in

  7. Evaluation of a color fused dual-band NVG

    NARCIS (Netherlands)

    Hogervorst, M.A.; Toet, A.

    2009-01-01

    We designed and evaluated a dual-band Night Vision Goggles sensor system. The sensor system consists of two optically aligned NVGs fitted with filters splitting the sensitive range into a visual and a near-infrared band. The Color-the-night technique (Hogervorst & Toet, FUSION2008) was used to fuse

  8. Evaluation of a color fused dual-band NVG

    NARCIS (Netherlands)

    Hogervorst, M.A.; Toet, A.

    2009-01-01

    We have tested a prototype dual-band NVG system consisting of two NVGs fitted with filters that split the NVG sensitive range into a short (visual) and a long wavelength (NIR) band. The Color-the-night technique (see Hogervorst & Toet, SPIE D&S ‘08) was used to fuse the images of the two sensors. We

  9. Exposure measuring techniques for wide band mobile radio-communications

    International Nuclear Information System (INIS)

    Trinchero, S.; Benedetto, A.; Anglesio, L.; D'Amore, G.; Trinchero, D.

    2004-01-01

    The paper illustrates the limits and performances of different experimental monitoring techniques, which are applied to digitally modulated radiofrequency electromagnetic fields used for mobile telecommunications. Different experimental set-ups have been developed, verified and applied for the analysis and characterisation of wide band probes and narrow band measuring procedures. (authors)

  10. Constriction of the Stomach by an Unusual Peritoneal Band.

    Science.gov (United States)

    Kassem, Mohammad W; Patel, Mayank; Iwanaga, Joe; Loukas, Marios; Tubbs, R Shane

    2018-02-03

    Compression of intraabdominal contents can occur due to anomalous congenital bands. Herein, we describe, to our knowledge, the first case of compression of the stomach by an anomalous band extending from the lesser omentum to the greater omentum. Relevant literature is reviewed and the clinical implications of such a case are described.

  11. K-Band Traveling-Wave Tube Amplifier

    Science.gov (United States)

    Force, Dale A.; Simons, Rainee N.; Peterson, Todd T.; Spitsen, Paul C.

    2010-01-01

    A new space-qualified, high-power, high-efficiency, K-band traveling-wave tube amplifier (TWTA) will provide high-rate, high-capacity, direct-to-Earth communications for science data and video gathered by the Lunar Reconnaissance Orbiter (LRO) during its mission. Several technological advances were responsible for the successful demonstration of the K-band TWTA.

  12. L-Band Polarimetric Correlation Radiometer with Subharmonic Sampling

    DEFF Research Database (Denmark)

    Rotbøll, Jesper; Søbjærg, Sten Schmidl; Skou, Niels

    2001-01-01

    A novel L-band radiometer trading analog complexity for digital ditto has been designed and built. It is a fully polarimetric radiometer of the correlation type and it is based on the sub-harmonic sampling principle in which the L-band signal is directly sampled by a fast A to D converter...

  13. A novel L-band polarimetric radiometer featuring subharmonic sampling

    DEFF Research Database (Denmark)

    Rotbøll, J.; Søbjærg, Sten Schmidl; Skou, Niels

    2003-01-01

    A novel L-band radiometer trading analog components for digital circuits has been designed, built and operated. It is a fully polarimetric radiometer of the correlation type, and it is based on the subharmonic sampling principle in which the L-band signal is directly sampled by a fast A to D...

  14. Shell model description of band structure in 48Cr

    International Nuclear Information System (INIS)

    Vargas, Carlos E.; Velazquez, Victor M.

    2007-01-01

    The band structure for normal and abnormal parity bands in 48Cr are described using the m-scheme shell model. In addition to full fp-shell, two particles in the 1d3/2 orbital are allowed in order to describe intruder states. The interaction includes fp-, sd- and mixed matrix elements

  15. Excited bands in even-even rare-earth nuclei

    International Nuclear Information System (INIS)

    Vargas, Carlos E.; Hirsch, Jorge G.

    2004-01-01

    The energetics of states belonging to normal parity bands in even-even dysprosium isotopes, and their B(E2) transition strengths, are studied using an extended pseudo-SU(3) shell model. States with pseudospin 1 are added to the standard pseudospin 0 space, allowing for a proper description of known excited normal parity bands

  16. Band Gap Engineering of Titania Systems Purposed for Photocatalytic Activity

    Science.gov (United States)

    Thurston, Cameron

    Ab initio computer aided design drastically increases candidate population for highly specified material discovery and selection. These simulations, carried out through a first-principles computational approach, accurately extrapolate material properties and behavior. Titanium Dioxide (TiO2 ) is one such material that stands to gain a great deal from the use of these simulations. In its anatase form, titania (TiO2 ) has been found to exhibit a band gap nearing 3.2 eV. If titania is to become a viable alternative to other contemporary photoactive materials exhibiting band gaps better suited for the solar spectrum, then the band gap must be subsequently reduced. To lower the energy needed for electronic excitation, both transition metals and non-metals have been extensively researched and are currently viable candidates for the continued reduction of titania's band gap. The introduction of multicomponent atomic doping introduces new energy bands which tend to both reduce the band gap and recombination loss. Ta-N, Nb-N, V-N, Cr-N, Mo-N, and W-N substitutions were studied in titania and subsequent energy and band gap calculations show a favorable band gap reduction in the case of passivated systems.

  17. Macroeconomic stabilization and intervention policy under an exchange rate band

    NARCIS (Netherlands)

    Beetsma, R.M.W.J.; van der Ploeg, F.

    1998-01-01

    Macroeconomic stabilization and foreign exchange market interventions are investigated for a small open economy with a nominal exchange rate band. In a first-best situation, a band is not advisable from a stabilization perspective, even though with money demand shocks no welfare losses are incurred.

  18. The influence of laparoscopic adjustable gastric banding on gastroesophageal reflux

    NARCIS (Netherlands)

    de Jong, [No Value; van Ramshorst, B; Timmer, R; Gooszen, HG; Smout, AJPM

    Background: Laparoscopic adjustable gastric banding (LAGB) influences gastroesophageal reflux. Methods: 26 patients undergoing gastric banding were assessed by a questionnaire for symptom analysis, 24-hour pH monitoring, endoscopy and barium swallows, preoperatively, at 6 weeks and at 6 months after

  19. The influence of laparoscopic adjustable gastric banding on gastroesophageal reflux

    NARCIS (Netherlands)

    de Jong, Justin R.; van Ramshorst, Bert; Timmer, Robin; Gooszen, Hein G.; Smout, André J. P. M.

    2004-01-01

    BACKGROUND: Laparoscopic adjustable gastric banding (LAGB) influences gastroesophageal reflux. METHODS: 26 patients undergoing gastric banding were assessed by a questionnaire for symptom analysis, 24-hour pH monitoring, endoscopy and barium swallows, preoperatively, at 6 weeks and at 6 months after

  20. Strain gradient drives shear banding in metallic glasses

    Science.gov (United States)

    Tian, Zhi-Li; Wang, Yun-Jiang; Chen, Yan; Dai, Lan-Hong

    2017-09-01

    Shear banding is a nucleation-controlled process in metallic glasses (MGs) involving multiple temporal-spatial scales, which hinders a concrete understanding of its structural origin down to the atomic scale. Here, inspired by the morphology of composite materials, we propose a different perspective of MGs as a hard particle-reinforced material based on atomic-scale structural heterogeneity. The local stable structures indicated by a high level of local fivefold symmetry (L5FS) act as hard "particles" which are embedded in the relatively soft matrix. We demonstrate this concept by performing atomistic simulations of shear banding in CuZr MG. A shear band is prone to form in a sample with a high degree of L5FS which is slowly quenched from the liquid. An atomic-scale analysis on strain and the structural evolution reveals that it is the strain gradient effect that has originated from structural heterogeneity that facilitates shear transformation zones (STZs) to mature shear bands. An artificial composite model with a high degree of strain gradient, generated by inserting hard MG strips into a soft MG matrix, demonstrates a great propensity for shear banding. It therefore confirms the critical role strain gradient plays in shear banding. The strain gradient effect on shear banding is further quantified with a continuum model and a mechanical instability analysis. These physical insights might highlight the strain gradient as the hidden driving force in transforming STZs into shear bands in MGs.

  1. Band structure of superlattice with δ-like potential

    International Nuclear Information System (INIS)

    Gashimzade, N.F.; Gashimzade, F.M.; Hajiev, A.T.

    1993-08-01

    Band structure of superlattice with δ-like potential has been calculated taking into account interaction of carriers of different kinds. Superlattices of semiconductors with degenerated valence band and zero-gap semiconductors have been considered. For the latter semimetal-semiconductor transition has been obtained. (author). 8 refs, 1 fig

  2. Breeding biology and diet of Banded Kestrels Falco zoniventris on ...

    African Journals Online (AJOL)

    All Banded Kestrel nests were placed inside clusters of epiphytic arboreal plants composed of Asplenium nidus, Phymatodes scolopendria and Medinilla sp. and averaged 18m above the ground. Banded Kestrel diet, derived from 188 prey items, comprised 47% chameleons, 18% other lizards, 31% insects, 3% birds, a frog ...

  3. A simultaneous confidence band for sparse longitudinal regression

    KAUST Repository

    Ma, Shujie; Yang, Lijian; Carroll, Raymond J.

    2012-01-01

    Functional data analysis has received considerable recent attention and a number of successful applications have been reported. In this paper, asymptotically simultaneous confidence bands are obtained for the mean function of the functional regression model, using piecewise constant spline estimation. Simulation experiments corroborate the asymptotic theory. The confidence band procedure is illustrated by analyzing CD4 cell counts of HIV infected patients.

  4. Decay out of the yrast superdeformed band in 191Hg

    International Nuclear Information System (INIS)

    Sien, S.; Reiter, P.; Khoo, T.; Lauritsen, T.; Carpenter, M. P.; Ahmad, I.; Amro, H.; Calderin, I.; Dossing, T.; Fischer, S. M.; Garg, U.; Gassmann, D.; Hackman, G.; Hannachi, F.; Janssens, R. V. F.; Kharraja, B.; Korichi, A.; Lopez-Martens, A.; Moore, E. F.; Nisius, D.; Schuck, C.

    1999-01-01

    The excitation energies and spins of the yrast superdeformed band in 191 Hg have been determined by analyzing the quasicontinuum spectrum connecting the superdeformed and normal-deformed states. The results from this analysis, combined with that given by one-step decay lines, give confident assignments of the spins and energies of the yrast superdeformed band in 191 Hg

  5. Conduction bands and invariant energy gaps in alkali bromides

    NARCIS (Netherlands)

    Boer, P.K. de; Groot, R.A. de

    1998-01-01

    Electronic structure calculations of the alkali bromides LiBr, NaBr, KBr, RbBr and CsBr are reported. It is shown that the conduction band has primarily bromine character. The size of the band gaps of bromides and alkali halides in general is reinterpreted.

  6. Sub-band-gap laser micromachining of lithium niobate

    DEFF Research Database (Denmark)

    Christensen, F. K.; Müllenborn, Matthias

    1995-01-01

    method is reported which enables us to do laser processing of lithium niobate using sub-band-gap photons. Using high scan speeds, moderate power densities, and sub-band-gap photon energies results in volume removal rates in excess of 106µm3/s. This enables fast micromachining of small piezoelectric...

  7. Model Development for MODIS Thermal Band Electronic Crosstalk

    Science.gov (United States)

    Chang, Tiejun; Wu, Aisheng; Geng, Xu; Li, Yonghonh; Brinkman, Jake; Keller, Graziela; Xiong, Xiaoxiong

    2016-01-01

    MODerate-resolution Imaging Spectroradiometer (MODIS) has 36 bands. Among them, 16 thermal emissive bands covering a wavelength range from 3.8 to 14.4 m. After 16 years on-orbit operation, the electronic crosstalk of a few Terra MODIS thermal emissive bands developed substantial issues that cause biases in the EV brightness temperature measurements and surface feature contamination. The crosstalk effects on band 27 with center wavelength at 6.7 m and band 29 at 8.5 m increased significantly in recent years, affecting downstream products such as water vapor and cloud mask. The crosstalk effect is evident in the near-monthly scheduled lunar measurements, from which the crosstalk coefficients can be derived. The development of an alternative approach is very helpful for independent verification.In this work, a physical model was developed to assess the crosstalk impact on calibration as well as in Earth view brightness temperature retrieval. This model was applied to Terra MODIS band 29 empirically to correct the Earth brightness temperature measurements. In the model development, the detectors nonlinear response is considered. The impact of the electronic crosstalk is assessed in two steps. The first step consists of determining the impact on calibration using the on-board blackbody (BB). Due to the detectors nonlinear response and large background signal, both linear and nonlinear coefficients are affected by the crosstalk from sending bands. The second step is to calculate the effects on the Earth view brightness temperature retrieval. The effects include those from affected calibration coefficients and the contamination of Earth view measurements. This model links the measurement bias with crosstalk coefficients, detector non-linearity, and the ratio of Earth measurements between the sending and receiving bands. The correction of the electronic cross talk can be implemented empirically from the processed bias at different brightness temperature. The implementation

  8. Construct and Concurrent Validation of a New Resistance Intensity Scale for Exercise with Thera-Band® Elastic Bands

    Directory of Open Access Journals (Sweden)

    Juan C. Colado, Xavier Garcia-Masso, N. Travis Triplett, Joaquin Calatayud, Jorge Flandez, David Behm, Michael E. Rogers

    2014-12-01

    Full Text Available The construct and concurrent validity of the Thera-Band Perceived Exertion Scale for Resistance Exercise with elastic bands (EB was examined. Twenty subjects performed two separate sets of 15 repetitions of both frontal and lateral raise exercise over two sessions. The criterion variables were myoelectric activity and heart rate. One set was performed with an elastic band grip width that permitted 15 maximum repetitions in the selected exercise, and another set was performed with a grip width 50% more than the 15RM grip. Following the final repetition of each set, active muscle (AM and overall body (O ratings of perceived exertion (RPE were collected from the Thera-Band® resistance exercise scale and the OMNI-Resistance Exercise Scale of perceived exertion with Thera-Band® resistance bands (OMNI-RES EB. Construct validity was established by correlating the RPE from the OMNI-RES EB with the Thera-Band RPE scale using regression analysis. The results showed significant differences (p ≤ 0.05 in myoelectric activity, heart rate, and RPE scores between the low- and high-intensity sets. The intraclass correlation coefficient for active muscles and overall RPE scale scores was 0.67 and 0.58, respectively. There was a positive linear relationship between the RPE from the OMNI-RES EB and the Thera-Band scale. Validity coefficients for the RPE AM were r2 = 0.87 and ranged from r2 = 0.76 to 0.85 for the RPE O. Therefore, the Thera-Band Perceived Exertion Scale for Resistance Exercise can be used for monitoring elastic band exercise intensity. This would allow the training dosage to be better controlled within and between sessions. Moreover, the construct and concurrent validity indicates that the OMNI-RES EB measures similar properties of exertion as the Thera-Band RPE scale during elastic resistance exercise.

  9. Designing broad phononic band gaps for in-plane modes

    Science.gov (United States)

    Li, Yang Fan; Meng, Fei; Li, Shuo; Jia, Baohua; Zhou, Shiwei; Huang, Xiaodong

    2018-03-01

    Phononic crystals are known as artificial materials that can manipulate the propagation of elastic waves, and one essential feature of phononic crystals is the existence of forbidden frequency range of traveling waves called band gaps. In this paper, we have proposed an easy way to design phononic crystals with large in-plane band gaps. We demonstrated that the gap between two arbitrarily appointed bands of in-plane mode can be formed by employing a certain number of solid or hollow circular rods embedded in a matrix material. Topology optimization has been applied to find the best material distributions within the primitive unit cell with maximal band gap width. Our results reveal that the centroids of optimized rods coincide with the point positions generated by Lloyd's algorithm, which deepens our understandings on the formation mechanism of phononic in-plane band gaps.

  10. Band-selective filter in a zigzag graphene nanoribbon.

    Science.gov (United States)

    Nakabayashi, Jun; Yamamoto, Daisuke; Kurihara, Susumu

    2009-02-13

    Electric transport of a zigzag graphene nanoribbon through a steplike potential and a barrier potential is investigated by using the recursive Green's function method. In the case of the steplike potential, we demonstrate numerically that scattering processes obey a selection rule for the band indices when the number of zigzag chains is even; the electrons belonging to the "even" ("odd") bands are scattered only into the even (odd) bands so that the parity of the wave functions is preserved. In the case of the barrier potential, by tuning the barrier height to be an appropriate value, we show that it can work as the "band-selective filter", which transmits electrons selectively with respect to the indices of the bands to which the incident electrons belong. Finally, we suggest that this selection rule can be observed in the conductance by applying two barrier potentials.

  11. Hole energy and momentum distributions in valence bands

    International Nuclear Information System (INIS)

    Laan, G. van der.

    1982-01-01

    In order to understand the electrical and magnetic properties of solids, the knowledge of the density of states and the dispersion relation of the valence bands is indispensable. This thesis offers some alternative methods to obtain information about the nature of the valence band. Part A deals with the energy distribution of the photoelectrons. A simple model, which explains the core hole satellite structure in compounds with large correlation effects between the valence band holes and the created photo-hole, is outlined. CuCl, CuX 2 (X = F Cl and Br) are studied, by photoemission and Auger electron spectroscopies in determining the valence band properties. Part B deals with the simultaneous measurement of the energy and the wave vector of the emitted electrons. A practical example is given for the determination of the dispersion relation in copper. The measurements of a surface resonance band and the distribution of the secondary electrons are also reported. (Auth.)

  12. Band structures in Sierpinski triangle fractal porous phononic crystals

    International Nuclear Information System (INIS)

    Wang, Kai; Liu, Ying; Liang, Tianshu

    2016-01-01

    In this paper, the band structures in Sierpinski triangle fractal porous phononic crystals (FPPCs) are studied with the aim to clarify the effect of fractal hierarchy on the band structures. Firstly, one kind of FPPCs based on Sierpinski triangle routine is proposed. Then the influence of the porosity on the elastic wave dispersion in Sierpinski triangle FPPCs is investigated. The sensitivity of the band structures to the fractal hierarchy is discussed in detail. The results show that the increase of the hierarchy increases the sensitivity of ABG (Absolute band gap) central frequency to the porosity. But further increase of the fractal hierarchy weakens this sensitivity. On the same hierarchy, wider ABGs could be opened in Sierpinski equilateral triangle FPPC; whilst, a lower ABG could be opened at lower porosity in Sierpinski right-angled isosceles FPPCs. These results will provide a meaningful guidance in tuning band structures in porous phononic crystals by fractal design.

  13. SPECTRUM AGGREGATION WITH OPTIMAL MULTI-BAND SCHEDULING

    DEFF Research Database (Denmark)

    Mihovska, Albena D.

    2010-01-01

    This paper seeks to explore the integration of spectrum and network resource management functionalities to the benefit of achieving higher performance and capacity gains in an International Mobile Telecommunications-Advanced (IMT-A) scenario. In particular, we investigate the allocation of users...... over two frequency bands (i.e., 2 GHz and 5 GHz) for a single operator scenario. The same type of Radio Access Technology (RAT) is considered for both frequency bands. It is assumed that the operator has gained access to a non-shared 2 GHz band and to part (or all) of the frequency pool band at 5 GHz....... The performance gain is analyzed in terms of higher data throughput. The performance is heavily dependent on the channel quality for each user in the considered bands which, in turn, is a function of the path loss and the distance from the Base Station (BS). The operator will have relevant improvements when...

  14. Chiral topological excitons in a Chern band insulator

    Science.gov (United States)

    Chen, Ke; Shindou, Ryuichi

    2017-10-01

    A family of semiconductors called Chern band insulators are shown to host exciton bands with nonzero topological Chern integers and chiral exciton edge modes. Using a prototypical two-band Chern insulator model, we calculate a cross-correlation function to obtain the exciton bands and their Chern integers. The lowest exciton band acquires Chern integers such as ±1 and ±2 in the electronic Chern insulator phase. The nontrivial topology can be experimentally observed both by a nonlocal optoelectronic response of exciton edge modes and by a phase shift in the cross-correlation response due to the bulk mode. Our result suggests that magnetically doped HgTe, InAs/GaSb quantum wells, and (Bi,Sb)2Te3 thin films are promising candidates for a platform of topological excitonics.

  15. Deep space propagation experiments at Ka-band

    Science.gov (United States)

    Butman, Stanley A.

    1990-01-01

    Propagation experiments as essential components of the general plan to develop an operational deep space telecommunications and navigation capability at Ka-band (32 to 35 GHz) by the end of the 20th century are discussed. Significant benefits of Ka-band over the current deep space standard X-band (8.4 GHz) are an improvement of 4 to 10 dB in telemetry capacity and a similar increase in radio navigation accuracy. Propagation experiments are planned on the Mars Observer Mission in 1992 in preparation for the Cassini Mission to Saturn in 1996, which will use Ka-band in the search for gravity waves as well as to enhance telemetry and navigation at Saturn in 2002. Subsequent uses of Ka-band are planned for the Solar Probe Mission and the Mars Program.

  16. Band structures in Sierpinski triangle fractal porous phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Kai; Liu, Ying, E-mail: yliu5@bjtu.edu.cn; Liang, Tianshu

    2016-10-01

    In this paper, the band structures in Sierpinski triangle fractal porous phononic crystals (FPPCs) are studied with the aim to clarify the effect of fractal hierarchy on the band structures. Firstly, one kind of FPPCs based on Sierpinski triangle routine is proposed. Then the influence of the porosity on the elastic wave dispersion in Sierpinski triangle FPPCs is investigated. The sensitivity of the band structures to the fractal hierarchy is discussed in detail. The results show that the increase of the hierarchy increases the sensitivity of ABG (Absolute band gap) central frequency to the porosity. But further increase of the fractal hierarchy weakens this sensitivity. On the same hierarchy, wider ABGs could be opened in Sierpinski equilateral triangle FPPC; whilst, a lower ABG could be opened at lower porosity in Sierpinski right-angled isosceles FPPCs. These results will provide a meaningful guidance in tuning band structures in porous phononic crystals by fractal design.

  17. Tunable band structures in digital oxides with layered crystal habits

    Science.gov (United States)

    Shin, Yongjin; Rondinelli, James M.

    2017-11-01

    We use density functional calculations to show that heterovalent cation-order sequences enable control over band-gap variations up to several eV and band-gap closure in the bulk band insulator LaSrAlO4. The band-gap control originates from the internal electric fields induced by the digital chemical order, which induces picoscale band bending; the electric-field magnitude is mainly governed by the inequivalent charged monoxide layers afforded by the layered crystal habit. Charge transfer and ionic relaxations across these layers play secondary roles. This understanding is used to construct and validate a descriptor that captures the layer-charge variation and to predict changes in the electronic gap in layered oxides exhibiting antisite defects and in other chemistries.

  18. Development of shear bands in amorphous-crystalline metallic alloys

    International Nuclear Information System (INIS)

    Pozdnyakov, V.A.

    2004-01-01

    A theoretical study is made into conditions of shear band evolution in amorphous-crystalline alloys with various morphological types of structural constituents. The condition of shear band evolution in thin amorphous alloys in the interior of the crystalline matrix is obtained. It is shown that a scale effect exists which manifests itself in suppression of the process of localized plastic flow with amorphous alloy thickness decreasing down to the limit. The analysis of the condition for shear band evolution in an amorphous alloy with nanocrystalline inclusions is accomplished. The relationship of a critical stress of shear band evolution to a volume fraction of disperse crystal inclusions is obtained. A consideration is also given to the evolution of shear bands in the material containing amorphous and crystalline areas of micro meter size. For the alloy with the structure of this type conditions for propagation of localized flows by a relay race type mechanism are determined [ru

  19. The Noisiness of Low Frequency Bands of Noise

    Science.gov (United States)

    Lawton, B. W.

    1975-01-01

    The relative noisiness of low frequency 1/3-octave bands of noise was examined. The frequency range investigated was bounded by the bands centered at 25 and 200 Hz, with intensities ranging from 50 to 95 db (SPL). Thirty-two subjects used a method of adjustment technique, producing comparison band intensities as noisy as 100 and 200 Hz standard bands at 60 and 72 db. The work resulted in contours of equal noisiness for 1/3-octave bands, ranging in intensity from approximately 58 to 86 db (SPL). These contours were compared with the standard equal noisiness contours; in the region of overlap, between 50 and 200 Hz, the agreement was good.

  20. Optimal wavelength band clustering for multispectral iris recognition.

    Science.gov (United States)

    Gong, Yazhuo; Zhang, David; Shi, Pengfei; Yan, Jingqi

    2012-07-01

    This work explores the possibility of clustering spectral wavelengths based on the maximum dissimilarity of iris textures. The eventual goal is to determine how many bands of spectral wavelengths will be enough for iris multispectral fusion and to find these bands that will provide higher performance of iris multispectral recognition. A multispectral acquisition system was first designed for imaging the iris at narrow spectral bands in the range of 420 to 940 nm. Next, a set of 60 human iris images that correspond to the right and left eyes of 30 different subjects were acquired for an analysis. Finally, we determined that 3 clusters were enough to represent the 10 feature bands of spectral wavelengths using the agglomerative clustering based on two-dimensional principal component analysis. The experimental results suggest (1) the number, center, and composition of clusters of spectral wavelengths and (2) the higher performance of iris multispectral recognition based on a three wavelengths-bands fusion.

  1. Electronic transport properties of Ti-impurity band in Si

    Energy Technology Data Exchange (ETDEWEB)

    Olea, J; Gonzalez-Diaz, G; Pastor, D; Martil, I [Departamento de Fisica Aplicada III (Electricidad y Electronica), Facultad de Ciencias, Fisicas, Universidad Complutense, E-28040 Madrid (Spain)

    2009-04-21

    In this paper we show that pulsed laser melted high dose implantation of Ti in Si, above the Mott transition, produces an impurity band (IB) in this semiconductor. Using the van der Pauw method and Hall effect measurements we find strong laminated conductivity at the implanted layer and a temperature dependent decoupling between the Ti implanted layer (TIL) and the substrate. The conduction mechanism from the TIL to the substrate shows blocking characteristics that could be well explained through IB theory. Using the ATLAS code we can estimate the energetic position of the IB at 0.36 eV from the conduction band, the density of holes in this band which is closely related to the Ti atomic density and the hole mobility in this band. Band diagrams of the structure at low and high temperatures are also simulated in the ATLAS framework. The simulation obtained is fully coherent with experimental results.

  2. Electronic transport properties of Ti-impurity band in Si

    International Nuclear Information System (INIS)

    Olea, J; Gonzalez-Diaz, G; Pastor, D; Martil, I

    2009-01-01

    In this paper we show that pulsed laser melted high dose implantation of Ti in Si, above the Mott transition, produces an impurity band (IB) in this semiconductor. Using the van der Pauw method and Hall effect measurements we find strong laminated conductivity at the implanted layer and a temperature dependent decoupling between the Ti implanted layer (TIL) and the substrate. The conduction mechanism from the TIL to the substrate shows blocking characteristics that could be well explained through IB theory. Using the ATLAS code we can estimate the energetic position of the IB at 0.36 eV from the conduction band, the density of holes in this band which is closely related to the Ti atomic density and the hole mobility in this band. Band diagrams of the structure at low and high temperatures are also simulated in the ATLAS framework. The simulation obtained is fully coherent with experimental results.

  3. Drosophila polytene chromosome bands formed by gene introns.

    Science.gov (United States)

    Zhimulev, I F; Boldyreva, L V; Demakova, O V; Poholkova, G V; Khoroshko, V A; Zykova, T Yu; Lavrov, S A; Belyaeva, E S

    2016-01-01

    Genetic organization of bands and interbands in polytene chromosomes has long remained a puzzle for geneticists. It has been recently demonstrated that interbands typically correspond to the 5'-ends of house-keeping genes, whereas adjacent loose bands tend to be composed of coding sequences of the genes. In the present work, we made one important step further and mapped two large introns of ubiquitously active genes on the polytene chromosome map. We show that alternative promoter regions of these genes map to interbands, whereas introns and coding sequences found between those promoters correspond to loose grey bands. Thus, a gene having its long intron "sandwiched" between to alternative promoters and a common coding sequence may occupy two interbands and one band in the context of polytene chromosomes. Loose, partially decompacted bands appear to host large introns.

  4. Building blocks of topological quantum chemistry: Elementary band representations

    Science.gov (United States)

    Cano, Jennifer; Bradlyn, Barry; Wang, Zhijun; Elcoro, L.; Vergniory, M. G.; Felser, C.; Aroyo, M. I.; Bernevig, B. Andrei

    2018-01-01

    The link between chemical orbitals described by local degrees of freedom and band theory, which is defined in momentum space, was proposed by Zak several decades ago for spinless systems with and without time reversal in his theory of "elementary" band representations. In a recent paper [Bradlyn et al., Nature (London) 547, 298 (2017), 10.1038/nature23268] we introduced the generalization of this theory to the experimentally relevant situation of spin-orbit coupled systems with time-reversal symmetry and proved that all bands that do not transform as band representations are topological. Here we give the full details of this construction. We prove that elementary band representations are either connected as bands in the Brillouin zone and are described by localized Wannier orbitals respecting the symmetries of the lattice (including time reversal when applicable), or, if disconnected, describe topological insulators. We then show how to generate a band representation from a particular Wyckoff position and determine which Wyckoff positions generate elementary band representations for all space groups. This theory applies to spinful and spinless systems, in all dimensions, with and without time reversal. We introduce a homotopic notion of equivalence and show that it results in a finer classification of topological phases than approaches based only on the symmetry of wave functions at special points in the Brillouin zone. Utilizing a mapping of the band connectivity into a graph theory problem, we show in companion papers which Wyckoff positions can generate disconnected elementary band representations, furnishing a natural avenue for a systematic materials search.

  5. Mars Global Surveyor Ka-Band Frequency Data Analysis

    Science.gov (United States)

    Morabito, D.; Butman, S.; Shambayati, S.

    2000-01-01

    The Mars Global Surveyor (MGS) spacecraft, launched on November 7, 1996, carries an experimental space-to-ground telecommunications link at Ka-band (32 GHz) along with the primary X-band (8.4 GHz) downlink. The signals are simultaneously transmitted from a 1.5-in diameter parabolic high gain antenna (HGA) on MGS and received by a beam-waveguide (BWG) R&D 34-meter antenna located in NASA's Goldstone Deep Space Network (DSN) complex near Barstow, California. The projected 5-dB link advantage of Ka-band relative to X-band was confirmed in previous reports using measurements of MGS signal strength data acquired during the first two years of the link experiment from December 1996 to December 1998. Analysis of X-band and Ka-band frequency data and difference frequency (fx-fka)/3.8 data will be presented here. On board the spacecraft, a low-power sample of the X-band downlink from the transponder is upconverted to 32 GHz, the Ka-band frequency, amplified to I-W using a Solid State Power Amplifier, and radiated from the dual X/Ka HGA. The X-band signal is amplified by one of two 25 W TWTAs. An upconverter first downconverts the 8.42 GHz X-band signal to 8 GHz and then multiplies using a X4 multiplier producing the 32 GHz Ka-band frequency. The frequency source selection is performed by an RF switch which can be commanded to select a VCO (Voltage Controlled Oscillator) or USO (Ultra-Stable Oscillator) reference. The Ka-band frequency can be either coherent with the X-band downlink reference or a hybrid combination of the USO and VCO derived frequencies. The data in this study were chosen such that the Ka-band signal is purely coherent with the X-band signal, that is the downconverter is driven by the same frequency source as the X-band downlink). The ground station used to acquire the data is DSS-13, a 34-meter BWG antenna which incorporates a series of mirrors inside beam waveguide tubes which guide the energy to a subterranean pedestal room, providing a stable environment

  6. Advances in X-Band and S-Band Linear Accelerators for Security, NDT, and Other Applications

    CERN Document Server

    Mishin, Andrey V

    2005-01-01

    At AS&E High Energy Systems Division, we designed several new advanced high energy electron beam and X-ray sources. Our primary focus has always been in building the world's most portable commercial X-band accelerators. Today, our X-band systems frequently exceed performance of the similar S-band machines, while they are more portable compared to the latter. The new designs of the X-band accelerators in the most practical energy range from 1 MeV to 6 MeV have been tested delivering outstanding results. Seventy 6 MeV X-band linacs systems have been produced. The most compact linac for security is used by AS&E in a self-shielded, Shaped Energy™ cargo screening system. We pioneered using the X-band linear accelerators for CT, producing high quality images of oil pipes and wood logs. An X-band linear accelerator head on a robotic arm has been used for electron beam radiation curing of an odd-shaped graphite composite part. We developed the broad-range 4 MeV to over 10 MeV energy-regulated X-band ...

  7. Head and hand detuning effect study of narrow-band against wide-band mobile phone antennas

    DEFF Research Database (Denmark)

    Bahramzy, Pevand; Pedersen, Gert Frølund

    2014-01-01

    Wide-band (WB) and narrow-band (NB) antennas in terms of performance are compared, when interacting with the user’s right head and hand (RHH). The investigations are done through experimental measurements, using standardised head phantom and hand. It is shown that WB antennas detune more than NB ...

  8. Manta A New BroadBand OBS

    Science.gov (United States)

    Hello, Y.; Yegikyan, M.; Charvis, P.; Philippe, O.

    2017-12-01

    Manta is a new BroadBand OBS developed at Geoazur and commercialized by Osean. The design is inspired by 3-years autonomy MUG-OBS a Multiparameter Ocean Bottom System which carry a lot of sort of sensor types. As Mug-OBS, Manta-OBS rated 6000m is designed to resist a trawling. All the components are non corrosive such polyethylene, titanium and buoyancy is ensured by syntactic foam. Equipped in standard version with a Trillium compact OBS Manta has an autonomy of 18 months, but can accept on its 4 input channels any kind of signal as low as from an hydrophone or larger from other type of a seismometer or accelerometer. Tri-axial geophones unit (2 Hz or 4.5 Hz ) can replace the seismometer and will expend the lifespan for the instrument. The seismometer is encapsulated in a central well established by four panels of the main structure to protect it from sea current convection and is decoupled from main chassis. An health bulletin is recoverable by acoustic any time to facilitate the installation and during a visit when instrument is deployed. Main parameters for acquisition can be changed by acoustics command from surface at any time. Once at the bottom, release for the main sensor installation is programmed on a timer but controlled by the tilt of the OBS. If the tilt is too important based on programmed limits, sensor will not released automatically, but this can be forced by acoustic command after returning the tilt informations to the boat operator. Manta is equipped with flash light and AIS system for easy location at recovery, and can also send it's position by Iridium satellite in case of an unexpected ascent such caused by a possible trawling if deployed in shallow water. Clock drift calculation is automatically made against GPS time signal once the OBS return at the surface. The recovery of the OBS is initiated by an acoustic command. These new features made Manta a very versatile instrument for monitoring earthquakes.

  9. Design studies of the Ku-band, wide-band Gyro-TWT amplifier

    Science.gov (United States)

    Jung, Sang Wook; Lee, Han Seul; Jang, Kwong Ho; Choi, Jin Joo; Hong, Yong Jun; Shin, Jin Woo; So, Jun Ho; Won, Jong Hyo

    2014-02-01

    This paper reports a Ku-band, wide band Gyrotron-Traveling-wave-tube(Gyro-TWT) that is currently being developed at Kwangwoon University. The Gyro-TWT has a two stage linear tapered interaction circuit to obtain a wide operating bandwidth. The linearly-tapered interaction circuit and nonlinearly-tapered magnetic field gives the Gyro-TWT a wide operating bandwidth. The Gyro-TWT bandwidth is 23%. The 2d-Particle-in-cell(PIC) and MAGIC2d code simulation results are 17.3 dB and 24.34 kW, respectively for the maximum saturated output power. A double anode MIG was simulated with E-Gun code. The results were 0.7 for the transvers to the axial beam velocity ratio (=alpha) and a 2.3% axial velocity spread at 50 kV and 4 A. A magnetic field profile simulation was performed by using the Poisson code to obtain the grazing magnetic field of the entire interaction circuit with Poisson code.

  10. Physical properties and analytical models of band-to-band tunneling in low-bandgap semiconductors

    International Nuclear Information System (INIS)

    Shih, Chun-Hsing; Dang Chien, Nguyen

    2014-01-01

    Low-bandgap semiconductors, such as InAs and InSb, are widely considered to be ideal for use in tunnel field-effect transistors to ensure sufficient on-current boosting at low voltages. This work elucidates the physical and mathematical considerations of applying conventional band-to-band tunneling models in low-bandgap semiconductors, and presents a new analytical alternative for practical use. The high-bandgap tunneling generates most at maximum field region with shortest tunnel path, whereas the low-bandgap generations occur dispersedly because of narrow tunnel barrier. The local electrical field associated with tunneling-electron numbers dominates in low-bandgap materials. This work proposes decoupled electric-field terms in the pre-exponential factor and exponential function of generation-rate expressions. Without fitting, the analytical results and approximated forms exhibit great agreements with the sophisticated forms both in high- and low-bandgap semiconductors. Neither nonlocal nor local field is appropriate to be used in numerical simulations for predicting the tunneling generations in a variety of low- and high-bandgap semiconductors

  11. X-Band CubeSat Communication System Demonstration

    Science.gov (United States)

    Altunc, Serhat; Kegege, Obadiah; Bundick, Steve; Shaw, Harry; Schaire, Scott; Bussey, George; Crum, Gary; Burke, Jacob C.; Palo, Scott; O'Conor, Darren

    2015-01-01

    Today's CubeSats mostly operate their communications at UHF- and S-band frequencies. UHF band is presently crowded, thus downlink communications are at lower data rates due to bandwidth limitations and are unreliable due to interference. This research presents an end-to-end robust, innovative, compact, efficient and low cost S-band uplink and X-band downlink CubeSat communication system demonstration between a balloon and a Near Earth Network (NEN) ground system. Since communication systems serve as umbilical cords for space missions, demonstration of this X-band communication system is critical for successfully supporting current and future CubeSat communication needs. This research has three main objectives. The first objective is to design, simulate, and test a CubeSat S- and X-band communication system. Satellite Tool Kit (STK) dynamic link budget calculations and HFSS Simulations and modeling results have been used to trade the merit of various designs for small satellite applications. S- and X-band antennas have been tested in the compact antenna test range at Goddard Space Flight Center (GSFC) to gather radiation pattern data. The second objective is simulate and test a CubeSat compatible X-band communication system at 12.5Mbps including S-band antennas, X-band antennas, Laboratory for Atmospheric and Space Physics (LASP) /GSFC transmitter and an S-band receiver from TRL-5 to TRL-8 by the end of this effort. Different X-band communication system components (antennas, diplexers, etc.) from GSFC, other NASA centers, universities, and private companies have been investigated and traded, and a complete component list for the communication system baseline has been developed by performing analytical and numerical analysis. This objective also includes running simulations and performing trades between different X-band antenna systems to optimize communication system performance. The final objective is to perform an end-to-end X-band CubeSat communication system

  12. Band gap effects of hexagonal boron nitride using oxygen plasma

    Energy Technology Data Exchange (ETDEWEB)

    Sevak Singh, Ram; Leong Chow, Wai [School of Electrical and Electronic Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); Yingjie Tay, Roland [School of Electrical and Electronic Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); Temasek Laboratories-NTU, 50 Nanyang Avenue, Singapore 639798 (Singapore); Hon Tsang, Siu [Temasek Laboratories-NTU, 50 Nanyang Avenue, Singapore 639798 (Singapore); Mallick, Govind [Temasek Laboratories-NTU, 50 Nanyang Avenue, Singapore 639798 (Singapore); Weapons and Materials Research Directorate, U.S. Army Research Laboratory, Aberdeen Proving Ground, Maryland 21005 (United States); Tong Teo, Edwin Hang, E-mail: htteo@ntu.edu.sg [School of Electrical and Electronic Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore)

    2014-04-21

    Tuning of band gap of hexagonal boron nitride (h-BN) has been a challenging problem due to its inherent chemical stability and inertness. In this work, we report the changes in band gaps in a few layers of chemical vapor deposition processed as-grown h-BN using a simple oxygen plasma treatment. Optical absorption spectra show a trend of band gap narrowing monotonically from 6 eV of pristine h-BN to 4.31 eV when exposed to oxygen plasma for 12 s. The narrowing of band gap causes the reduction in electrical resistance by ∼100 fold. The x-ray photoelectron spectroscopy results of plasma treated hexagonal boron nitride surface show the predominant doping of oxygen for the nitrogen vacancy. Energy sub-band formations inside the band gap of h-BN, due to the incorporation of oxygen dopants, cause a red shift in absorption edge corresponding to the band gap narrowing.

  13. Band gap effects of hexagonal boron nitride using oxygen plasma

    International Nuclear Information System (INIS)

    Sevak Singh, Ram; Leong Chow, Wai; Yingjie Tay, Roland; Hon Tsang, Siu; Mallick, Govind; Tong Teo, Edwin Hang

    2014-01-01

    Tuning of band gap of hexagonal boron nitride (h-BN) has been a challenging problem due to its inherent chemical stability and inertness. In this work, we report the changes in band gaps in a few layers of chemical vapor deposition processed as-grown h-BN using a simple oxygen plasma treatment. Optical absorption spectra show a trend of band gap narrowing monotonically from 6 eV of pristine h-BN to 4.31 eV when exposed to oxygen plasma for 12 s. The narrowing of band gap causes the reduction in electrical resistance by ∼100 fold. The x-ray photoelectron spectroscopy results of plasma treated hexagonal boron nitride surface show the predominant doping of oxygen for the nitrogen vacancy. Energy sub-band formations inside the band gap of h-BN, due to the incorporation of oxygen dopants, cause a red shift in absorption edge corresponding to the band gap narrowing

  14. Decay from the superdeformed bands in 194Hg

    International Nuclear Information System (INIS)

    Henry, R.G.; Khoo, T.L.; Carpenter, M.P.

    1995-01-01

    Superdeformed bands in 194 H g were studied using the early implementation of Gammasphere. The response functions for the Ge detectors were measured for the first time as part of this experiment. Experiments were performed with both a backed target (where the residue stopped in the Au backing) and a thin target (where the residue recoiled into vacuum). This will permit measurements of the decay times of the quasicontinuum γrays. The spectrum in coincidence with the yrast SD band in 194 Hg reveals the same features as found in the quasicontinuum structure in 192 Hg. These features include: statistical γrays feeding the SD band, a pronounced E2 peak from transitions feeding the SD band, a Ml/E2 bump at low energies that is associated with the last stages of feeding of the superdeformed band, and a quasicontinuous distribution from γrays linking SD and normal states, including a sizable clustering of strength around 1.7 MeV. The remarkable similarity of the spectra coincident with SD bands in 192,194 Hg provides additional support for a statistical process for decay out of the SD states. This similarity contrasts with differences observed in the spectrum coincident with the SD band in the odd-even 191 Hg, confirming the predictions about the role of pairing (in normal states) in influencing the shape of the decay-out spectrum

  15. Ultrawide band gap amorphous oxide semiconductor, Ga–Zn–O

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Junghwan, E-mail: JH.KIM@lucid.msl.titech.ac.jp [Materials and Structures Laboratory, Tokyo Institute of Technology, Mailbox R3-4, 4259 Nagatsuta, Midori-ku, Yokohama (Japan); Miyokawa, Norihiko; Sekiya, Takumi; Ide, Keisuke [Materials and Structures Laboratory, Tokyo Institute of Technology, Mailbox R3-4, 4259 Nagatsuta, Midori-ku, Yokohama (Japan); Toda, Yoshitake [Materials Research Center for Element Strategy, Tokyo Institute of Technology, Mailbox SE-6, 4259 Nagatsuta, Midori-ku, Yokohama (Japan); Hiramatsu, Hidenori; Hosono, Hideo; Kamiya, Toshio [Materials and Structures Laboratory, Tokyo Institute of Technology, Mailbox R3-4, 4259 Nagatsuta, Midori-ku, Yokohama (Japan); Materials Research Center for Element Strategy, Tokyo Institute of Technology, Mailbox SE-6, 4259 Nagatsuta, Midori-ku, Yokohama (Japan)

    2016-09-01

    We fabricated amorphous oxide semiconductor films, a-(Ga{sub 1–x}Zn{sub x})O{sub y}, at room temperature on glass, which have widely tunable band gaps (E{sub g}) ranging from 3.47–4.12 eV. The highest electron Hall mobility ~ 7 cm{sup 2} V{sup −1} s{sup −1} was obtained for E{sub g} = ~ 3.8 eV. Ultraviolet photoemission spectroscopy revealed that the increase in E{sub g} with increasing the Ga content comes mostly from the deepening of the valence band maximum level while the conduction band minimum level remains almost unchanged. These characteristics are explained by their electronic structures. As these films can be fabricated at room temperature on plastic, this achievement extends the applications of flexible electronics to opto-electronic integrated circuits associated with deep ultraviolet region. - Highlights: • Incorporation of H/H{sub 2}O stabilizes the amorphous phase. • Ultrawide band gap (~ 3.8 eV) amorphous oxide semiconductor was fabricated. • The increase in band gap comes mostly from the deepening of the valence band maximum level. • Donor level is more likely aligned to the valence band maximum level.

  16. Anomalous electromagnetically induced transparency in photonic-band-gap materials

    International Nuclear Information System (INIS)

    Singh, Mahi R.

    2004-01-01

    The phenomenon of electromagnetically induced transparency has been studied when a four-level atom is located in a photonic band gap material. Quantum interference is introduced by driving the two upper levels of the atom with a strong pump laser field. The top level and one of the ground levels are coupled by a weak probe laser field and absorption takes place between these two states. The susceptibility due to the absorption for this transition has been calculated by using the master equation method in linear response theory. Numerical simulations are performed for the real and imaginary parts of the susceptibility for a photonic band gap material whose gap-midgap ratio is 21%. It is found that when resonance frequencies lie within the band, the medium becomes transparent under the action of the strong pump laser field. More interesting results are found when one of the resonance frequencies lies at the band edge and within the band gap. When the resonance frequency lies at the band edge, the medium becomes nontransparent even under a strong pump laser field. On the other hand, when the resonance frequency lies within the band gap, the medium becomes transparent even under a weak pump laser field. In summary, we found that the medium can be transformed from the transparent state to the nontransparent state just by changing the location of the resonance frequency. We call these two effects anomalous electromagnetically induced transparency

  17. Decay from the superdeformed bands in {sup 194}Hg

    Energy Technology Data Exchange (ETDEWEB)

    Henry, R.G.; Khoo, T.L.; Carpenter, M.P. [and others

    1995-08-01

    Superdeformed bands in {sup 194}H g were studied using the early implementation of Gammasphere. The response functions for the Ge detectors were measured for the first time as part of this experiment. Experiments were performed with both a backed target (where the residue stopped in the Au backing) and a thin target (where the residue recoiled into vacuum). This will permit measurements of the decay times of the quasicontinuum {gamma}rays. The spectrum in coincidence with the yrast SD band in {sup 194}Hg reveals the same features as found in the quasicontinuum structure in {sup 192}Hg. These features include: statistical {gamma}rays feeding the SD band, a pronounced E2 peak from transitions feeding the SD band, a Ml/E2 bump at low energies that is associated with the last stages of feeding of the superdeformed band, and a quasicontinuous distribution from {gamma}rays linking SD and normal states, including a sizable clustering of strength around 1.7 MeV. The remarkable similarity of the spectra coincident with SD bands in {sup 192,194}Hg provides additional support for a statistical process for decay out of the SD states. This similarity contrasts with differences observed in the spectrum coincident with the SD band in the odd-even {sup 191}Hg, confirming the predictions about the role of pairing (in normal states) in influencing the shape of the decay-out spectrum.

  18. Super rigid nature of super-deformed bands

    International Nuclear Information System (INIS)

    Sharma, Neha; Mittal, H.M.; Jain, A.K.

    2012-01-01

    The phenomenon of high-spin super-deformation represents one of the most remarkable discoveries in nuclear physics. A large number of SD bands have been observed in A = 60, 80, 130, 150, 190 mass regions. The cascades of SD bands are known to be connected by electric quadruple E2 transitions. Because of absence of linking transitions between superdeformed (SD) and normal deformed (ND) levels, the spin assignments of most of these bands carry a minimum uncertainty ≈ 1-2ħ. It was found in an analysis of SD bands in the context of semi classical approach that moment of inertia comes close to the rigid body value in most of the cases. Lack of knowledge of spins has led to an emphasis on the study of dynamical moment of inertia of SD bands and systematic of kinematic moment of inertia has not been examined so far. In this paper, we extract the band moment of inertia J 0 and softness parameter (σ) of all the SD bands corresponding to axes ratio (x) = 1.5 and present their systematic

  19. Secular trends in Cherokee cranial morphology: Eastern vs Western bands.

    Science.gov (United States)

    Sutphin, Rebecca; Ross, Ann H; Jantz, Richard L

    2014-01-01

    The research objective was to examine if secular trends can be identified for cranial data commissioned by Boas in 1892, specifically for cranial breadth and cranial length of the Eastern and Western band Cherokee who experienced environmental hardships. Multiple regression analysis was used to test the degree of relationship between each of the cranial measures: cranial length, cranial breadth and cephalic index, along with predictor variables (year-of-birth, location, sex, admixture); the model revealed a significant difference for all craniometric variables. Additional regression analysis was performed with smoothing Loess plots to observe cranial length and cranial breadth change over time (year-of-birth) separately for Eastern and Western Cherokee band females and males born between 1783-1874. This revealed the Western and Eastern bands show a decrease in cranial length over time. Eastern band individuals maintain a relatively constant head breadth, while Western Band individuals show a sharp decline beginning around 1860. These findings support negative secular trend occurring for both Cherokee bands where the environment made a detrimental impact; this is especially marked with the Western Cherokee band.

  20. Introduction to the viewpoint set on shear bands

    International Nuclear Information System (INIS)

    Hutchinson, J.W.

    1984-01-01

    Recent work aimed at improving our understanding of shear banding and flow localization as modes of deformation and failure is summarized in the six viewpoint articles which follow. For the most part, the emphasis here is on the observation and analysis of shear banding in metals, but active efforts are also underway to understand the role of shear bands in the deformation and failure of soils and rocks. There is a tendency to regard shear bands as a failure mode, as indeed they often are. But extensive straining under highly constrained conditions such as rolling can give rise to profuse flow localization into shear bands which can be regarded as microscopic in the sense that their extent is on the scale of the grains rather than the overall dimensions of the block of material being deformed. Hatherly and Malin describe in detail the observation of such bands and emphasize that they should be considered as a mode of deformation under these circumstances. They relate the formation of the bands to microstructural aspects and discuss their role in the development of recrystallization textures. It will be clear from reading the articles in this viewpoint set that the beginnings of a quantitative theory of shear banding is in place. Continued progress will require parallel developments in constitutive theory and experimental observation. Moreover, basic questions remain to be explored related to the spatial development of the shear bands, their mutual interaction, their development into a failure mode, and how these are influenced by factors such as overall deformational constraint, rate of straining, and temperature

  1. First experience with the InfiniBand interconnect

    International Nuclear Information System (INIS)

    Schwickerath, Ulrich; Heiss, Andreas

    2004-01-01

    A test cluster of dual Intel-Xeon processor server nodes has been equipped with 10 GBit/s InfiniBand interconnect. Capabilities of this new technique were tested and compared to Gigabit-Ethernet (GE) with respect to both High-Performance Computing (MPI-based parallel computing applications) and High-Throughput Computing (HTC). RFIO, a protocol for fast and efficient file transfers, has been ported to make immediate use of InfiniBand, utilizing the remote direct memory access (RDMA) capabilities of the InfiniBand hardware. The performance is compared to Gigabit-Ethernet

  2. Accurate calculation of superdeformed bands in Hg and Pb

    International Nuclear Information System (INIS)

    Lei Yian; Zeng Jinyan

    1993-01-01

    The superdeformed (SD) rotational bands in Hg and Pb are analyzed by means of the abc expression for rotational bands, which was derived from the Bohr Hamiltonian. The agreement between calculated and observed transition energies is incredibly well. The deviation of the calculated E' γ s from the observed results turns out to be absolute value δ ≤0.5 keV (except for a few cases, 0.5 kev ≤ absolute value δ ≤ 0.7 keV). Some transitions which have not been observed yet in these SD bands are also predicted, which may be useful for experimental investigation

  3. Integrated wide-band low-background amplifiers

    International Nuclear Information System (INIS)

    Il'yushchenko, I.I.

    1980-01-01

    Ways of increasing stability and reproduction of characteristics of wide-band integral amplifiers that would to the least extent increase their background noises, are discussed. Considered are some certain flowsheets of integral wide-band amplifiers with low background noise of foreign production which differ from one another by construction of inlet cascades as well as by the applied feedback type. The principal flowsheets of the amplifiers and their main performances are presented. The analysis of the data obtained has revealed that microcircuits made of cascades with a common emitter and local combined feedback are most wide-band among all the considered microcircuits [ru

  4. Oral Rehabilitation for Amniotic Band Syndrome: An Unusual Presentation.

    Science.gov (United States)

    Hotwani, Kavita; Sharma, Krishna

    2015-01-01

    Amniotic band syndrome (ABS) is a congenital disorder caused by entrapment of fetal parts in fibrous amniotic bands while in utero. The syndrome is underdiagnosed and its presentation is variable. The syndrome has been well described in the pediatric, orthopedic and obstetric literature; however, despite the discernable craniomaxillofacial involvement, ABS has not been reported in the dental literature very often. The present report describes a case of a patient with ABS and concomitant dental findings. How to cite this article: Hotwani K, Sharma K. Oral Rehabilitation for Amniotic Band Syndrome: An Unusual Presentation. Int J Clin Pediatr Dent 2015;8(1):55-57.

  5. Multi-band Image Registration Method Based on Fourier Transform

    Institute of Scientific and Technical Information of China (English)

    庹红娅; 刘允才

    2004-01-01

    This paper presented a registration method based on Fourier transform for multi-band images which is involved in translation and small rotation. Although different band images differ a lot in the intensity and features,they contain certain common information which we can exploit. A model was given that the multi-band images have linear correlations under the least-square sense. It is proved that the coefficients have no effect on the registration progress if two images have linear correlations. Finally, the steps of the registration method were proposed. The experiments show that the model is reasonable and the results are satisfying.

  6. Gamma bands in doubly odd rhenium and iridium nuclei

    Directory of Open Access Journals (Sweden)

    Balodis M.

    2015-01-01

    Full Text Available Structure of the |K ± 2| bands in doubly-odd nuclei belonging to the transitional deformation region at A∼190 is discussed. Relation of these quasi gamma-bands with the non-axial deformation of the parent two-quasiparticle configurations is studied. Using available experimental information, new tentative |K ± 2| bands are proposed in 188Re, and 192,194Ir nuclei. Coexistence of two-quasiparticle states with different deformation modes is considered in the case of 188Re and 194Ir.

  7. Microscopic mechanism of identical multi-quasiparticle bands

    International Nuclear Information System (INIS)

    Lei Yian; Zhao Enguang; Zeng Jinyan

    1997-01-01

    Identical one-quasiparticle and two-quasiparticle bands in neighboring odd-and even-mass nuclei are recognized; The intrinsic structure of identical bands is demonstrated by using the particle-number-conserving (PNC) treatment. The occurrence of almost identical moments of inertia is the result of competition among the shell effect (including shape variation), pairing (anti-alignment) effect and blocking (anti-pairing) effect. The observed moments of inertia of identical multi-quasiparticle bands are reproduced quite well by the PNC calculation

  8. Detection Range Estimation of UV Spectral Band Laser Radar

    Directory of Open Access Journals (Sweden)

    V. A. Gorodnichev

    2014-01-01

    Full Text Available Recently, has come into existence an interest in the systems operating in the ultra-violet (UF band of wavelengths, which use other spectral information (coefficients of reflection or radiation in UF range about location objects, than laser systems in the visible, near or average infrared bands. Thus, a point is not only to receive additional (in another spectral range information on location objects. Laser radiation in the UF spectral band of 0.315 – 0.4 microns is safer than laser radiation with the wavelengths of 0.38 – 1.4 microns.The work presents a comparative estimation of the detection systems range of laser radars in the UV and visible spectral bands for the following wavelengths of radiation:- UF band: 0.266 microns (the fourth harmonic of YAG-laser activated by neodymium ions, 0.308 microns (the XeCl-excimer laser, 0.355 microns (the third harmonic of YAG-laser activated by neodymium ions;- visible band: 0.532 microns (the second harmonic of YAG-laser activated by neodymium ions.Results of calculations show that for the horizontal pathway in the terrestrial atmosphere at the selected radiation wavelengths a detection range is in the range of 2510m – 5690 m.The maximum range of detection corresponds to the visible spectral band. A sweep range decreases with transition to the UF band. This is caused by the fact that with transition to the UF band there is a rise of atmosphere attenuation (generally, because of absorption by ozone, this effect being smoothed by reducing background radiation.In the UF band a wavelength of 0.355 microns is the most acceptable. For this wavelength a detection range is about 1,5 times less (in comparison with the visible band of 0.532 microns. However, this is the much more eye-safe wavelength. With transition to the UV band a detection range decreases not that much and can be compensated by changing parameters of transmitting or receiving channels of laser radar.

  9. Thin-film intermediate band chalcopyrite solar cells

    International Nuclear Information System (INIS)

    Fuertes Marron, D.; Marti, A.; Luque, A.

    2009-01-01

    Chalcopyrite-based solar cells currently lead the efficiency tables of thin-film photovoltaic technologies. Further improvements are foreseen upon implementation of an intermediate band in the absorber layers. We present a theoretical analysis of the efficiency limit for this type of device as a function of factors such as the gap of the host, the relative position of the intermediate band with respect to the band edge and the level of light concentration used as illumination. We have also considered the impact of non-idealities on the performance of the device, particularly the effect of electronic losses related to non-radiative recombination

  10. Spins of superdeformed rotational bands in Tl isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Dadwal, Anshul; Mittal, H.M. [Dr. B.R. Ambedkar National Institute of Technology, Jalandhar (India)

    2017-01-15

    The two-parameter model defined for even-even nuclei viz. soft-rotor formula is used to assign the band-head spin of the 17 rotational bands in Tl isotopes. The least-squares fitting method is employed to obtain the spins of these bands in the A ∝ 190 mass region. The calculated transition energies are found to depend sensitively on the proposed spin. Whenever a correct spin assignment is made, the calculated and experimental transition energies coincide very well. The dynamic moment of inertia is also calculated and its variation with rotational frequency is explored. (orig.)

  11. Experimental studies of narrow band effects in the actinides

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, M.B.

    1976-01-01

    In many actinide metallic systems the f-electrons exhibit band behavior. This is a consequence of direct f-f wave function overlap or hybridization of f-electrons with s-, p-, and d-electrons. The f-bands can be responsible for large electronic densities of states at the Fermi level which may lead to band magnetism of various types. Although the concept of valence instabilities must be approached cautiously especially in the light actinides, it would not be surprising to observe them in the future, especially in Am compounds.

  12. Experimental studies of narrow band effects in the actinides

    International Nuclear Information System (INIS)

    Brodsky, M.B.

    1976-01-01

    In many actinide metallic systems the f-electrons exhibit band behavior. This is a consequence of direct f-f wave function overlap or hybridization of f-electrons with s-, p-, and d-electrons. The f-bands can be responsible for large electronic densities of states at the Fermi level which may lead to band magnetism of various types. Although the concept of valence instabilities must be approached cautiously especially in the light actinides, it would not be surprising to observe them in the future, especially in Am compounds

  13. Synthesis and design of waveguide band-stop filters without out-of-band spurious responses for plasma diagnosis

    International Nuclear Information System (INIS)

    Montejo-Garai, José R.; Leal-Sevillano, Carlos A.; Ruiz-Cruz, Jorge A.; Rebollar, Jesús M.; Estrada, Teresa

    2012-01-01

    Highlights: ► A rigorous systematic design process based on circuit synthesis is proposed for band-stop filters. ► The new compact E-plane waveguide structure reduces drastically the unwanted resonances in a very large pass band. ► The manufacturing process together with the computation effort is significantly reduced. ► Experimental results validate the state-of-art electrical responses. - Abstract: Band-stop or notch filters play a crucial role in plasma diagnosis systems to protect receivers from the stray radiation. In this work, a rigorous design process based on circuit synthesis in addition to an extremely compact E-plane waveguide structure is proposed for this kind of filters. On the one hand, the transfer function verifying the rejection specification is analytically obtained, fixing the minimum number of required cavities. On the other hand, a coupling structure that reduces drastically the unwanted resonances in filters with a very large pass band requirement, is presented. This coupling between the rejection cavities and the main rectangular waveguide has additional advantages; (a) unlike typical inductive irises, large coupling coefficients can be implemented (b) a pure E-plane configuration is achieved, which simplifies the manufacturing and also reduces significantly the computational effort. Experimental validation is demonstrated by two pseudo-elliptic fifth-order band-stop filters fabricated and measured in Ka and V bands. In both cases, the filters are free of spurious resonances in their total operation bands.

  14. Band-to-Band Misregistration of the Images of MODIS Onboard Calibrators and Its Impact on Calibration

    Science.gov (United States)

    Wang, Zhipeng; Xiong, Xiaoxiong

    2017-01-01

    The Moderate Resolution Imaging Spectroradiometer (MODIS) instruments aboard Terra and Aqua satellites are radiometrically calibrated on-orbit with a set of onboard calibrators (OBCs), including a solar diffuser, a blackbody, and a space view port through which the detectors can view the dark space. As a whisk-broom scanning spectroradiometer, thirty-six MODIS spectral bands are assembled in the along-scan direction on four focal plane assemblies (FPAs). These bands capture images of the same target sequentially with the motion of a scan mirror. Then the images are coregistered onboard by delaying the appropriate band-dependent amount of time, depending on the band locations on the FPA. While this coregistration mechanismis functioning well for the far-field remote targets such as earth view scenes or the moon, noticeable band-to-band misregistration in the along-scan direction has been observed for near field targets, particularly in OBCs. In this paper, the misregistration phenomenon is presented and analyzed. It is concluded that the root cause of the misregistration is that the rotating element of the instrument, the scan mirror, is displaced from the focus of the telescope primary mirror. The amount of the misregistrationis proportional to the band location on the FPA and is inversely proportional to the distance between the target and the scan mirror. The impact of this misregistration on the calibration of MODIS bands is discussed. In particular, the calculation of the detector gain coefficient m1of bands 8-16 (412 nm 870 nm) is improved by up to 1.5% for Aqua MODIS.

  15. Band-to-Band Misregistration of the Images of MODIS On-Board Calibrators and Its Impact to Calibration

    Science.gov (United States)

    Wang, Zhipeng; Xiong, Xiaoxiong

    2017-01-01

    The MODIS instruments aboard Terra and Aqua satellites are radiometrically calibrated on-orbit with a set of onboard calibrators (OBC) including a solar diffuser (SD), a blackbody (BB) and a space view (SV) port through which the detectors can view the dark space. As a whisk-broom scanning spectroradiometer, thirty-six MODIS spectral bands are assembled in the along-scan direction on four focal plane assemblies (FPA). These bands capture images of the same target sequentially with the motion of a scan mirror. Then the images are co-registered on board by delaying appropriate band dependent amount of time depending on the band locations on the FPA. While this co-registration mechanism is functioning well for the "far field" remote targets such as Earth view (EV) scenes or the Moon, noticeable band-to-band misregistration in the along-scan direction has been observed for near field targets, in particular the OBCs. In this paper, the misregistration phenomenon is presented and analyzed. It is concluded that the root cause of the misregistration is that the rotating element of the instrument, the scan mirror, is displaced from the focus of the telescope primary mirror. The amount of the misregistration is proportional to the band location on the FPA and is inversely proportional to the distance between the target and the scan mirror. The impact of this misregistration to the calibration of MODIS bands is discussed. In particular, the calculation of the detector gain coefficient m1 of bands 8-16 (412 nm 870 nm) is improved by up to 1.5% for Aqua MODIS.

  16. Temperature dependence of the fundamental band gap parameters ...

    Indian Academy of Sciences (India)

    the energy and broadening of the fundamental band gap have been evaluated using various models including the ... other crucial parameters including the operating temperatures of these devices. ... refrigeration system (Air Product Displex).

  17. 2008 - Color & Infrared (4 band) - Statewide NAIP (1m)

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The NAIP_1M_CLRIR_2008 dataset is a 1:40000 scale (1 meter) truecolor and infrared (4 band) NAIP imagery product acquired during the summer of...

  18. Long-term effects of flipper bands on penguins

    Science.gov (United States)

    Gauthier-Clerc, M.; Gendner, J.-P.; Ribic, C.A.; Fraser, William R.; Woehler, Eric J.; Descamps, S.; Gilly, C.; Le, Bohec C.; Le, Maho Y.

    2004-01-01

    Changes in seabird populations, and particularly of penguins, offer a unique opportunity for investigating the impact of fisheries and climatic variations on marine resources. Such investigations often require large-scale banding to identify individual birds, but the significance of the data relies on the assumption that no bias is introduced in this type of long-term monitoring. After 5 years of using an automated system of identification of king penguins implanted with electronic tags (100 adult king penguins were implanted with a transponder tag, 50 of which were also flipper banded), we can report that banding results in later arrival at the colony for courtship in some years, lower breeding probability and lower chick production. We also found that the survival rate of unbanded, electronically tagged king penguin chicks after 2-3 years is approximately twice as large as that reported in the literature for banded chicks. ?? 2004 The Royal Society.

  19. Antenna Gain Enhancement Using a Photonic Band Gap Reflector

    National Research Council Canada - National Science Library

    Schloer, Karl

    1999-01-01

    Scientists have long known that periodic structures can filter electromagnetic (EM) waves. In the last decade, extension of one- and two-dimensionally periodic structures into a third periodic dimension has produced photonic band gap...

  20. Operational Bright-Band Snow Level Detection Using Doppler Radar

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A method to detect the bright-band snow level from radar reflectivity and Doppler vertical velocity data collection with an atmospheric profiling Doppler radar. The...

  1. Gravitational Analysis of the In-Band Wormhole Phenomenon

    National Research Council Canada - National Science Library

    Gopaul, Richard; Kruus, Peter; Sterne, Dan; Rivera, Brian

    2006-01-01

    ...], for evaluating the effects of in-band wormhole attacks on OLSR routing. The gravitational analysis technique examines individual network topologies and results in the creation of a gravitational chart for each topology...

  2. Exciter For X-Band Transmitter And Receiver

    Science.gov (United States)

    Johns, Carl E.

    1989-01-01

    Report describes developmental X-band exciter for X-band uplink subsystem of Deep Space Network. X-band transmitter-exciting signal expected to have fractional frequency stability of 5.2 X 10 to negative 15th power during 1,000-second integration period. Generates coherent test signals for S- and X-band Block III translator of Deep Space Network, Doppler-reference signal for associated Doppler-extractor system, first-local-oscillator signal for associated receiver, and reference signal for associated ranging subsystem. Tests of prototype exciter show controlling and monitoring and internal phase-correcting loops perform according to applicable design criteria. Measurements of stability of frequency and of single-sideband noise spectral density of transmitter-exciting signal made subsequently.

  3. 2014 - Color & Infrared (4 band) - Statewide NAIP (1m)

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The NAIP_1M_CLRIR_2014 dataset is a (1 meter) truecolor and infrared (4 band) NAIP imagery product acquired during the summer of 2014 by the...

  4. Elastic band ligation of hemorrhoids using flexible gastroscope

    Directory of Open Access Journals (Sweden)

    Hadi Abd Zaid Al-Khattabi

    2017-03-01

    Conclusion High success rate, cost effectiveness and the simplicity of rubber band ligation as an outpatient procedure promote its use as the frst line of treatment for frst, second and early third degree hemorrhoids.

  5. Mineralogy and geochemistry of banded iron formation and iron ...

    Indian Academy of Sciences (India)

    The geological complexities of banded iron formation (BIF) and associated iron ores of Jilling–. Langalata iron ore ...... sure to sea water. Uranium in these samples varies ..... Ce oxidation and removal (Elderfield and Greaves. 1982; De Baar et ...

  6. Modelling and design of complete photonic band gaps in two ...

    Indian Academy of Sciences (India)

    Photonic crystal; complete photonic band gap; plane-wave expansion method. ... lies in the possibility of the substantial control of the radiation field by means of ... research. To prevent the propagation of the waves, whatever its direction is, the.

  7. Self-consistent, relativistic, ferromagnetic band structure of gadolinium

    International Nuclear Information System (INIS)

    Harmon, B.N.; Schirber, J.; Koelling, D.D.

    1977-01-01

    An initial self-consistent calculation of the ground state magnetic band structure of gadolinium is described. A linearized APW method was used which included all single particle relativistic effects except spin-orbit coupling. The spin polarized potential was obtained in the muffin-tin form using the local spin density approximation for exchange and correlation. The most striking and unorthodox aspect of the results is the position of the 4f spin-down ''bands'' which are required to float just on top of the Fermi level in order to obtain convergence. If the 4f states (l = 3 resonance) are removed from the occupied region of the conduction bands the magnetic moment is approximately .75 μ/sub B//atom; however, as the 4f spin-down states are allowed to find their own position they hybridize with the conduction bands at the Fermi level and the moment becomes smaller. Means of improving the calculation are discussed

  8. Identical high- K three-quasiparticle rotational bands

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Harjeet; Singh, Pardeep [Guru Nanak Dev University, Department of Physics, Amritsar (India)

    2016-12-15

    A comprehensive study of high-K three-quasiparticle rotational bands in odd-A nuclei indicates the similarity in γ-ray energies and dynamic moment of inertia I{sup (2)}. The extent of the identicality between the rotational bands is evaluated by using the energy factor method. For nuclei pairs exhibiting identical bands, the average relative change in the dynamic moment of inertia I{sup (2)} is also determined. The identical behaviour shown by these bands is attributed to the interplay of nuclear structure parameters: deformation and the pairing correlations. Also, experimental trend of the I(ℎ) vs. ℎω (MeV) plot for these nuclei pairs is shown to be in agreement with Tilted-Axis Cranking (TAC) model calculations. (orig.)

  9. Extragalactic active objects in the radio and infrared bands

    Energy Technology Data Exchange (ETDEWEB)

    Sikora, M [Polska Akademia Nauk, Warsaw. Centrum Astronomiczne

    1981-01-01

    This paper is the second in a series of papers concerning extragalactic active objects. We discuss the properties of Seyfert's galaxies, radiogalaxies, quasars and BL Lacertae objects in the radio and infrared bands.

  10. Experimental study of shear bands formation in a granular material

    Directory of Open Access Journals (Sweden)

    Nguyen Thai Binh

    2017-01-01

    Full Text Available We present an experimental investigation of the formation of shear bands in a granular sample submitted to a biaxial test. Our principal result is the direct observation of the bifurcation at the origin of the localization process in the material. At the bifurcation, the shear band is spatially extended: we observe a breaking of symmetry without any sudden localization of the deformation in a narrow band. Our work thus allows to clearly distinguish different phenomena: bifurcation which is a ponctual event which occurs before the peak, localization which is a process that covers a range of deformation of several percents during which the peak occurs and finally stationary shear bands which are well-defined permanent structures that can be observed at the end of the localization process, after the peak.

  11. A rare combination of amniotic constriction band with osteogenesis imperfecta.

    Science.gov (United States)

    Shah, Krupa Hitesh; Shah, Hitesh

    2015-11-11

    Amniotic constriction bands and osteogenesis imperfecta are disorders arising from a collagen defect. We report a rare association of amniotic bands with osteogenesis imperfecta in a child. The child was born with multiple amniotic bands involving the right leg, both hands and both feet. Multiple fractures of long bones of lower limbs occurred in childhood due to trivial trauma. Deformities of the femur and tibia due to malunion with osteopenia and blue sclerae were present. The patient was treated with z plasty of constriction band of the right tibia and bisphosphonate for osteogenesis imperfecta. This rare association of both collagen diseases may provide further insight for the pathogenesis of these diseases. 2015 BMJ Publishing Group Ltd.

  12. Two-dimensional microwave band-gap structures of different ...

    Indian Academy of Sciences (India)

    - stant and/or magnetic permeability (or in particular impedance) are periodic and the propagation of electromagnetic waves is forbidden at certain frequencies when allowed to pass through these structures. This is similar to the electronic band.

  13. Study of positive parity bands in 137Pr

    International Nuclear Information System (INIS)

    Agarwal, Priyanka; Kumar, Suresh; Jain, A.K.; Singh, Sukhjeet; Malik, S.S.; Sinha, Rishi Kumar; Dhal, Anukul; Chaturvedi, L.; Muralithar, S.; Singh, R.P.; Madhavan, N.; Kumar, Rakesh; Bhowmik, R.K.; Pancholi, S.C.; Jain, H.C.

    2006-01-01

    In this paper the analysis and interpretation of the positive parity states in 137 Pr have been reported. The detailed interpretation with configuration assignments and the calculations for the bands will be reported

  14. Digital Conically Scanned L-Band Radar, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — The proposed effort seeks to develop a digitally steered polarimetric phased array L-Band radar utilizing a novel, high performance architecture leveraging recent...

  15. High Data Rate Optical Wireless Communications Based on Ultraviolet Band

    KAUST Repository

    Sun, Xiaobin

    2017-01-01

    Optical wireless communication systems based on ultraviolet (UV)-band has a lot inherent advantages, such as low background solar radiation, low device dark noise. Besides, it also has small restrictive requirements for PAT (pointing, acquisition

  16. Multiple triaxial bands and abnormal signature inversion in 7433As

    International Nuclear Information System (INIS)

    Hu, Shi-Peng; Ma, Hai-Liang; Cao, Xue-Peng; Wu, Xiao-Guang; Zhang, Huan-Qiao; Hua, Hui; Sun, Jun-Jie; Sun, Hui-Bin; He, Chuang-Ye; Zheng, Yun; Li, Guang-Sheng; Li, Cong-Bo; Yao, Shun-He; Yu, Bei-Bei; Wang, Jin-Long; Li, Hong-We; Wu, Yi-Heng; Liu, Jia-Jian; Luo, Peng-Wei; Xu, Chuan

    2014-01-01

    Excited states of the odd–odd nucleus 74 As have been investigated via heavy ion fusion evaporation reaction 70 Zn( 7 Li,3n) 74 As at beam energy of 30 MeV. The properties of the positive- and the negative- parity bands can be interpreted in terms of the Cranked Nilsson–Strutinsky (CNS) model calculations which show that the observed bands are built on the triaxial deformed shape. The inversion of the favored and unfavored signature branches observed in the positive-parity bands presents at high spins rather than normal signature inversion occurs at low spins. This phenomenon may be explained as the origin of unpaired band crossing in a highly rotating triaxial nucleus.

  17. Multi-band phase shifter design using modified slotline configuration

    Science.gov (United States)

    Kulandhaisamy, Indhumathi; Rajendran, Dinesh Babu; Kanagasabai, Malathi; Gurusamy, Gunasekaran; Moorthy, Balaji; George, Jithila V.; Lawrance, Livya

    2017-01-01

    In this paper, an analog multiband phase shifter using slotline configuration is proposed. To implement the design, a pair of modified Split Ring Resonator (SRR) is employed. The periodic property of SRR provides multiband characteristics, whether the coupling slot gives the phase variations over the bands. The operation is well explained with an equivalent circuit model and its characteristics have been studied both in simulation and measurement. The prototype operates in 1.77-2.16, 3.5-3.97, 5.08-5.33, 6.43-6.93, and 8.01-8.59 GHz frequency bands which can be utilized for GSM, GPS, WLAN, C-band, and X-band applications, respectively.

  18. Quantitative analysis on electric dipole energy in Rashba band splitting.

    Science.gov (United States)

    Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

    2015-09-01

    We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

  19. Photonic band gap engineering in 2D photonic crystals

    Indian Academy of Sciences (India)

    Department of Applied Physics, Delhi College of Engineering, Faculty of Technology. (University of ... Photonic crystal; photonic band gap; plane-wave expansion method. PACS Nos 71.20 .... Numerical analysis and results. To obtain the ...

  20. High Efficiency S-Band 20 Watt Amplifier

    Data.gov (United States)

    National Aeronautics and Space Administration — This project includes the design and build of a prototype 20 W, high efficiency, S-Band amplifier.   The design will incorporate the latest semiconductor technology,...

  1. Band gap engineering strategy via polarization rotation in perovskite ferroelectrics

    International Nuclear Information System (INIS)

    Wang, Fenggong; Grinberg, Ilya; Rappe, Andrew M.

    2014-01-01

    We propose a strategy to engineer the band gaps of perovskite oxide ferroelectrics, supported by first principles calculations. We find that the band gaps of perovskites can be substantially reduced by as much as 1.2 eV through local rhombohedral-to-tetragonal structural transition. Furthermore, the strong polarization of the rhombohedral perovskite is largely preserved by its tetragonal counterpart. The B-cation off-center displacements and the resulting enhancement of the antibonding character in the conduction band give rise to the wider band gaps of the rhombohedral perovskites. The correlation between the structure, polarization orientation, and electronic structure lays a good foundation for understanding the physics of more complex perovskite solid solutions and provides a route for the design of photovoltaic perovskite ferroelectrics

  2. Narrow band interference cancelation in OFDM: Astructured maximum likelihood approach

    KAUST Repository

    Sohail, Muhammad Sadiq; Al-Naffouri, Tareq Y.; Al-Ghadhban, Samir N.

    2012-01-01

    This paper presents a maximum likelihood (ML) approach to mitigate the effect of narrow band interference (NBI) in a zero padded orthogonal frequency division multiplexing (ZP-OFDM) system. The NBI is assumed to be time variant and asynchronous

  3. A Compact UWB Band-Pass Filter Using Embedded Circular Slot Structures for Improved Upper Stop-band Performance

    DEFF Research Database (Denmark)

    Shen, Ming; Ren, Jian; Mikkelsen, Jan Hvolgaard

    2016-01-01

    structures into the ring resonator. This is different from conventional designs using cascaded bandstop/low-pass filters for stop-band response suppression, which usually leads to big circuit sizes. And hence the proposed approach can reduce the circuit size significantly. A prototype filter with a compact...... size (13.6 mm×6.75 mm) has been implemented for experimental validation. The measured results show a −3 dB frequency band from 3.4 GHz to 11.7 GHz and > 20 dB upper stop-band suppression from 12.5 GHz to 20GHz....

  4. Resonant enhancement of band-to-band tunneling in in-plane MoS2/WS2 heterojunctions

    Science.gov (United States)

    Kuroda, Tatsuya; Mori, Nobuya

    2018-04-01

    The band-to-band (BTB) tunneling current J through in-plane MoS2/WS2 heterojunctions is calculated by the nonequilibrium Green function method combined with tight-binding approximation. Types A and B of band configurations are considered. For type-A (type-B) heterojunctions, a potential notch exists (or is absent) at the heterointerface. Both type-A and type-B MoS2/WS2 heterojunctions can support a higher BTB current than MoS2 and WS2 homojunctions. For type-A heterojunctions, the resonant enhancement of J occurs resulting in a significantly higher BTB tunneling current.

  5. O2 atmospheric band measurements with WINDII: Performance of a narrow band filter/wide angle Michelson combination in space

    International Nuclear Information System (INIS)

    Ward, W.E.; Hersom, C.H.; Tai, C.C.; Gault, W.A.; Shepherd, G.G.; Solheim, B.H.

    1994-01-01

    Among the emissions viewed by the Wind Imaging Interferometer (WINDII) on the Upper Atmosphere Research Satellite (UARS) are selected lines in the (0-0) transition of the O2 atmospheric band. These lines are viewed simultaneously using a narrow band filter/wide-angle Michelson interferometer combination. The narrow band filter is used to separate the lines on the CCD (spectral-spatial scanning) and the Michelson used to modulate the emissions so that winds and rotational temperatures may be measured from the Doppler shifts and relative intensities of the lines. In this report this technique will be outlined and the on-orbit behavior since launch summarized

  6. Polarization catastrophe in nanostructures doped in photonic band gap materials

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Mahi R. [Department of Physics and Astronomy, University of Western Ontario, London N6A 3K7 (Canada)], E-mail: msingh@uwo.ca

    2008-11-30

    In the presence of the dipole-dipole interaction, we have studied a possible dielectric catastrophe in photonic band gap materials doped with an ensemble of four-level nanoparticles. It is found that the dielectric constant of the system has a singularity when the resonance energy lies within the bands. This phenomenon is known as the dielectric catastrophe. It is also found that this phenomenon depends on the strength of the dipole-dipole interaction.

  7. Magnetron based high energy S-band linac system

    International Nuclear Information System (INIS)

    Tiwari, T.; Krishnan, R.; Phatangare, Manoj

    2012-01-01

    This paper deals with the study of magnetron based high energy S-band linear accelerator (linac) system operating at spot frequency 2.998 GHz. The energy and dose are two important parameters of linac system which depend on input power of microwave source and length of linac tube. Here the author has studied how these parameters can be improved for side coupled standing wave S-band linac system

  8. Systematic description of superdeformed bands in the mass-190 region

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Yang; Guidry, M. [Oak Ridge National Lab., TN (United States)]|[Univ. of Tennessee, Knoxville, TN (United States); Zhang, Jing-ye [Univ. of Tennessee, Knoxville, TN (United States)

    1996-12-31

    Superdeformed bands for the mass-190 region are described by the Projected Shell Model. Even-even, odd mass and odd-odd nuclei are equally well described. Good agreement with available data for all isotopes studied is obtained. The authors calculation of electromagnetic properties and pairing correlations provides an understanding of the observed gradual increase of dynamical moments of inertia with angular momentum observed in many bands in this mass region.

  9. Band structure and optical properties of opal photonic crystals

    OpenAIRE

    Pavarini, E.; Andreani, L. C.; Soci, C.; Galli, M.; Marabelli, F.; Comoretto, D.

    2005-01-01

    A theoretical approach for the interpretation of reflectance spectra of opal photonic crystals with fcc structure and (111) surface orientation is presented. It is based on the calculation of photonic bands and density of states corresponding to a specified angle of incidence in air. The results yield a clear distinction between diffraction in the direction of light propagation by (111) family planes (leading to the formation of a stop band) and diffraction in other directions by higher-order...

  10. Overview of ISM bands and Software-defined Radio Experimentation

    OpenAIRE

    Kumbhar, Abhaykumar

    2016-01-01

    Wireless systems using low-power wireless communication protocol are rapidly gain popularity in the license-free industrial scientific, and medical (ISM) frequency bands. One such emerging trend in ISM frequency bands is home automation. Historically, all the home devices were once unconnected, today are now being connected either by a wired or wireless connection. The low-power wireless communication protocols enable integration of all the digital home devices into a single system and enhanc...

  11. Evaluation of coronary band temperatures in healthy horses

    DEFF Research Database (Denmark)

    Rosenmeier, Jesper G.; Strathe, Anders Bjerring; Andersen, Pia Haubro

    2012-01-01

    To measure coronary band temperature (CBT) in healthy horses fed high-fructan or low-carbohydrate diets and to analyze the association of CBT with diet, time of day, and ambient temperature.......To measure coronary band temperature (CBT) in healthy horses fed high-fructan or low-carbohydrate diets and to analyze the association of CBT with diet, time of day, and ambient temperature....

  12. Teletraffic performance Analysis of Multi-band Overlaid WCDMA Systems

    DEFF Research Database (Denmark)

    Wang, Hua; Iversen, Villy Bæk

    2007-01-01

    Wide-band Code Division Multiple Access (WCDMA) systems are considered to be among the best alternatives for Universal Mobile Telecommunication System (UMTS). In future deployment of WCDMA systems, spectrum overlay among sub-bands with different bandwidth is necessary to support various kinds of ...... of virtual channel so that classical teletraffic theory can be applied. A service class is modelled as a BPP (Binomial-Poisson-Pascal) multi-rate traffic stream....

  13. Cranking model interpretation of weakly coupled bands in Hg isotopes

    International Nuclear Information System (INIS)

    Guttormsen, M.; Huebel, H.

    1982-01-01

    The positive-parity yrast states of the transitional sup(189-198)Hg isotopes are interpreted within the Bengtsson and Frauendorf version of the cranking model. The very sharp backbendings can be explained by small interaction matrix elements between the ground and s-bands. The experimentally observed large aligned angular momenta and the low band-crossing frequencies are well reproduced in the calculations. (orig.)

  14. Nature of the identical bands in atomic nuclei

    International Nuclear Information System (INIS)

    Szymanski, Z.

    1995-01-01

    Single-nucleon spectra in the fast rotating nuclei are shown to exhibit some special orbits that appear to be insensitive to nuclear rotation. It is suggested that the special orbits play an essential role in explaining the appearance and structure of the identical bands discovered in the superdeformed region. It is suggested that identical bands appear whenever the nucleonic orbit approaches the separatrix, i.e., a line dividing regions of different coupling schemes in a rotating mean field

  15. Maximizing the Optical Band Gap in 2D Photonic Crystals

    DEFF Research Database (Denmark)

    Hougaard, Kristian G.; Sigmund, Ole

    Topology optimization is used to find the 2D photonic crystal designs with the largest relative photonic band gaps. Starting points for the topology optimization are found with an exhaustive binary search on a low resolution grid.......Topology optimization is used to find the 2D photonic crystal designs with the largest relative photonic band gaps. Starting points for the topology optimization are found with an exhaustive binary search on a low resolution grid....

  16. Analysis on X-band structure breakdown at GLCTA

    International Nuclear Information System (INIS)

    Suehara, T.; Sanuki, T.; Komamiya, S.; Higo, T.; Hayano, H.; Terunuma, N.; Saeki, T.; Watanabe, K.; Hayakawa, A.; Tsukada, Y.

    2004-01-01

    We have built a new monitoring system for accelerator structure breakdown in the X-band high-gradient test facility at KEK (GLCTA: Global Linear Collider Test Accelerator). An X-band test structure KX01 (made by KEK) has been processed at GLCTA and we have been collecting data for about 3 months using this breakdown monitoring system. We describe overview of the monitoring system and preliminary result of breakdown analysis of the structure. (author)

  17. α+12C rotational bands in 16O

    Directory of Open Access Journals (Sweden)

    Katsuma M.

    2014-03-01

    Full Text Available The total quantum number N of the α+12C rotational bands in 16O is determined by a study of α+12C elastic scattering. The 8+ and 9− states are found around the excitation energy Ex = 30 MeV and they are the member of the known rotational bands. At the same time, the 02+ state (Ex = 6.05 MeV is found to be dominated by N = 8.

  18. Odd - even staggering, a result of γ - band split

    International Nuclear Information System (INIS)

    Singh, M.; Gupta, D.K.; Singh, Yuvraj; Gupta, K.K.; Bihari, Chhail; Sharma, Aparna; Varshney, A.K.; Varshney, Mani

    2011-01-01

    The structure of low - lying K = 2+ gamma band in even - even nuclei represents quadrupole vibration breaking axial symmetry in unified collective model of Bohr-Mottelson. In the group theoretical approach of the Interacting boson model (IBM) the band structure can belong to one of the three limiting symmetries of U (6) algebra viz. U (5), SU (3) and O (6), corresponding to the anharmonic vibrator, deformed rotor and γ - unstable respectively

  19. Intermediate bands versus levels in non-radiative recombination

    International Nuclear Information System (INIS)

    Luque, Antonio; Marti, Antonio; Antolin, Elisa; Tablero, Cesar

    2006-01-01

    There is a practical interest in developing semiconductors with levels situated within their band gap while preventing the non-radiative recombination that these levels promote. In this paper, the physical causes of this non-radiative recombination are analyzed and the increase in the density of the impurities responsible for the mid-gap levels to the point of forming bands is suggested as the means of suppressing the recombination. Simple models supporting this recommendation and helping in its quantification are presented

  20. Cecal volvulus as a complication of gastric banding.

    Science.gov (United States)

    Fakhro, Abdulla; O'Riordan, James M; Lawler, Leo P; O'Connell, P Ronan

    2009-12-01

    Surgery is an increasingly important management option for patients with obesity. Laparoscopic adjustable gastric banding is a procedure employed to treat morbid obesity refractory to medical therapy. It works by reducing the capacity of the stomach and promoting early satiety. We report the unusual case of a 33-year-old female who presented acutely 2 years following laparoscopic adjustable gastric banding with cecal volvulus and closed loop obstruction caused by displacement of the connecting tube.