WorldWideScience

Sample records for bacterial transcriptional regulatory

  1. Elongation factor P mediates a novel post-transcriptional regulatory pathway critical for bacterial virulence

    DEFF Research Database (Denmark)

    Zou, S Betty; Roy, Hervé; Ibba, Michael

    2012-01-01

    of the pathogen to respond to external cues are typically attenuating. Here we discuss our recent discovery of a novel post-transcriptional regulatory pathway critical for Salmonella virulence and stress resistance. The enzymes PoxA and YjeK coordinately attach a unique beta-amino acid onto a highly conserved......Bacterial pathogens detect and integrate multiple environmental signals to coordinate appropriate changes in gene expression including the selective expression of virulence factors, changes to metabolism and the activation of stress response systems. Mutations that abolish the ability...... changes in the translation machinery during stress adaptation, indicating that the role of these factors in physiology may be broadly conserved....

  2. Elongation factor P mediates a novel post-transcriptional regulatory pathway critical for bacterial virulence

    DEFF Research Database (Denmark)

    Zou, S Betty; Roy, Hervé; Ibba, Michael

    2012-01-01

    Bacterial pathogens detect and integrate multiple environmental signals to coordinate appropriate changes in gene expression including the selective expression of virulence factors, changes to metabolism and the activation of stress response systems. Mutations that abolish the ability...... of the pathogen to respond to external cues are typically attenuating. Here we discuss our recent discovery of a novel post-transcriptional regulatory pathway critical for Salmonella virulence and stress resistance. The enzymes PoxA and YjeK coordinately attach a unique beta-amino acid onto a highly conserved...

  3. Structural studies of bacterial transcriptional regulatory proteins by multidimensional heteronuclear NMR

    Energy Technology Data Exchange (ETDEWEB)

    Volkman, Brian Finley [Univ. of California, Berkeley, CA (United States)

    1995-02-01

    Nuclear magnetic resonance spectroscopy was used to elucidate detailed structural information for peptide and protein molecules. A small peptide was designed and synthesized, and its three-dimensional structure was calculated using distance information derived from two-dimensional NMR measurements. The peptide was used to induce antibodies in mice, and the cross-reactivity of the antibodies with a related protein was analyzed with enzyme-linked immunosorbent assays. Two proteins which are involved in regulation of transcription in bacteria were also studied. The ferric uptake regulation (Fur) protein is a metal-dependent repressor which controls iron uptake in bacteria. Two- and three-dimensional NMR techniques, coupled with uniform and selective isotope labeling allowed the nearly complete assignment of the resonances of the metal-binding domain of the Fur protein. NTRC is a transcriptional enhancer binding protein whose N-terminal domain is a "receiver domain" in the family of "two-component" regulatory systems. Phosphorylation of the N-terminal domain of NTRC activates the initiation of transcription of aeries encoding proteins involved in nitrogen regulation. Three- and four-dimensional NMR spectroscopy methods have been used to complete the resonance assignments and determine the solution structure of the N-terminal receiver domain of the NTRC protein. Comparison of the solution structure of the NTRC receiver domain with the crystal structures of the homologous protein CheY reveals a very similar fold, with the only significant difference being the position of helix 4 relative to the rest of the protein. The determination of the structure of the NTRC receiver domain is the first step toward understanding a mechanism of signal transduction which is common to many bacterial regulatory systems.

  4. A study of bacterial gene regulatory mechanisms

    DEFF Research Database (Denmark)

    Hansen, Sabine

    the different regulatory mechanisms affect system dynamics. We have designed a synthetic gene regulatory network (GRN) in bacterial cells that enables us to study the dynamics of GRNs. The results presented in this PhD thesis show that model equations based on the established mechanisms of action of each...... of a particular type of regulatory mechanism. The synthetic system presented in this thesis is, to our knowledge, the first of its kind to allow a direct comparison of the dynamic behaviors of gene regulatory networks that employ different mechanisms of regulation. In addition to studying the dynamic behavior...... switch off the expression of unfavorable proteins. This dynamic regulation requires a coordinated effort by a network of regulatory factors. The regulatory mechanisms employed by bacterial cell to regulate their protein expression have been extensively studied. However, little is known about how...

  5. Transcription regulatory networks analysis using CAGE

    KAUST Repository

    Tegnér, Jesper N.

    2009-10-01

    Mapping out cellular networks in general and transcriptional networks in particular has proved to be a bottle-neck hampering our understanding of biological processes. Integrative approaches fusing computational and experimental technologies for decoding transcriptional networks at a high level of resolution is therefore of uttermost importance. Yet, this is challenging since the control of gene expression in eukaryotes is a complex multi-level process influenced by several epigenetic factors and the fine interplay between regulatory proteins and the promoter structure governing the combinatorial regulation of gene expression. In this chapter we review how the CAGE data can be integrated with other measurements such as expression, physical interactions and computational prediction of regulatory motifs, which together can provide a genome-wide picture of eukaryotic transcriptional regulatory networks at a new level of resolution. © 2010 by Pan Stanford Publishing Pte. Ltd. All rights reserved.

  6. Transcriptional features of genomic regulatory blocks.

    Science.gov (United States)

    Akalin, Altuna; Fredman, David; Arner, Erik; Dong, Xianjun; Bryne, Jan Christian; Suzuki, Harukazu; Daub, Carsten O; Hayashizaki, Yoshihide; Lenhard, Boris

    2009-01-01

    Genomic regulatory blocks (GRBs) are chromosomal regions spanned by highly conserved non-coding elements (HCNEs), most of which serve as regulatory inputs of one target gene in the region. The target genes are most often transcription factors involved in embryonic development and differentiation. GRBs often contain extensive gene deserts, as well as additional 'bystander' genes intertwined with HCNEs but whose expression and function are unrelated to those of the target gene. The tight regulation of target genes, complex arrangement of regulatory inputs, and the differential responsiveness of genes in the region call for the examination of fundamental rules governing transcriptional activity in GRBs. Here we use extensive CAGE tag mapping of transcription start sites across different human tissues and differentiation stages combined with expression data and a number of sequence and epigenetic features to discover these rules and patterns. We show evidence that GRB target genes have properties that set them apart from their bystanders as well as other genes in the genome: longer CpG islands, a higher number and wider spacing of alternative transcription start sites, and a distinct composition of transcription factor binding sites in their core/proximal promoters. Target gene expression correlates with the acetylation state of HCNEs in the region. Additionally, target gene promoters have a distinct combination of activating and repressing histone modifications in mouse embryonic stem cell lines. GRB targets are genes with a number of unique features that are the likely cause of their ability to respond to regulatory inputs from very long distances.

  7. DETECTION OF BACTERIAL SMALL TRANSCRIPTS FROM RNA-SEQ DATA: A COMPARATIVE ASSESSMENT.

    Science.gov (United States)

    Peña-Castillo, Lourdes; Grüell, Marc; Mulligan, Martin E; Lang, Andrew S

    2016-01-01

    Small non-coding RNAs (sRNAs) are regulatory RNA molecules that have been identified in a multitude of bacterial species and shown to control numerous cellular processes through various regulatory mechanisms. In the last decade, next generation RNA sequencing (RNA-seq) has been used for the genome-wide detection of bacterial sRNAs. Here we describe sRNA-Detect, a novel approach to identify expressed small transcripts from prokaryotic RNA-seq data. Using RNA-seq data from three bacterial species and two sequencing platforms, we performed a comparative assessment of five computational approaches for the detection of small transcripts. We demonstrate that sRNA-Detect improves upon current standalone computational approaches for identifying novel small transcripts in bacteria.

  8. Global analysis of photosynthesis transcriptional regulatory networks.

    Directory of Open Access Journals (Sweden)

    Saheed Imam

    2014-12-01

    Full Text Available Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888, which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ∼34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ΔFnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis.

  9. Global Analysis of Photosynthesis Transcriptional Regulatory Networks

    Science.gov (United States)

    Imam, Saheed; Noguera, Daniel R.; Donohue, Timothy J.

    2014-01-01

    Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ∼34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ΔFnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406

  10. Transcription factor trapping by RNA in gene regulatory elements.

    Science.gov (United States)

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  11. Transcription profile of Escherichia coli: genomic SELEX search for regulatory targets of transcription factors

    Science.gov (United States)

    Ishihama, Akira; Shimada, Tomohiro; Yamazaki, Yukiko

    2016-01-01

    Bacterial genomes are transcribed by DNA-dependent RNA polymerase (RNAP), which achieves gene selectivity through interaction with sigma factors that recognize promoters, and transcription factors (TFs) that control the activity and specificity of RNAP holoenzyme. To understand the molecular mechanisms of transcriptional regulation, the identification of regulatory targets is needed for all these factors. We then performed genomic SELEX screenings of targets under the control of each sigma factor and each TF. Here we describe the assembly of 156 SELEX patterns of a total of 116 TFs performed in the presence and absence of effector ligands. The results reveal several novel concepts: (i) each TF regulates more targets than hitherto recognized; (ii) each promoter is regulated by more TFs than hitherto recognized; and (iii) the binding sites of some TFs are located within operons and even inside open reading frames. The binding sites of a set of global regulators, including cAMP receptor protein, LeuO and Lrp, overlap with those of the silencer H-NS, suggesting that certain global regulators play an anti-silencing role. To facilitate sharing of these accumulated SELEX datasets with the research community, we compiled a database, ‘Transcription Profile of Escherichia coli’ (www.shigen.nig.ac.jp/ecoli/tec/). PMID:26843427

  12. Transcription profile of Escherichia coli: genomic SELEX search for regulatory targets of transcription factors.

    Science.gov (United States)

    Ishihama, Akira; Shimada, Tomohiro; Yamazaki, Yukiko

    2016-03-18

    Bacterial genomes are transcribed by DNA-dependent RNA polymerase (RNAP), which achieves gene selectivity through interaction with sigma factors that recognize promoters, and transcription factors (TFs) that control the activity and specificity of RNAP holoenzyme. To understand the molecular mechanisms of transcriptional regulation, the identification of regulatory targets is needed for all these factors. We then performed genomic SELEX screenings of targets under the control of each sigma factor and each TF. Here we describe the assembly of 156 SELEX patterns of a total of 116 TFs performed in the presence and absence of effector ligands. The results reveal several novel concepts: (i) each TF regulates more targets than hitherto recognized; (ii) each promoter is regulated by more TFs than hitherto recognized; and (iii) the binding sites of some TFs are located within operons and even inside open reading frames. The binding sites of a set of global regulators, including cAMP receptor protein, LeuO and Lrp, overlap with those of the silencer H-NS, suggesting that certain global regulators play an anti-silencing role. To facilitate sharing of these accumulated SELEX datasets with the research community, we compiled a database, 'Transcription Profile of Escherichia coli' (www.shigen.nig.ac.jp/ecoli/tec/). © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Matrix formalism to describe functional states of transcriptional regulatory systems.

    Directory of Open Access Journals (Sweden)

    Erwin P Gianchandani

    2006-08-01

    Full Text Available Complex regulatory networks control the transcription state of a genome. These transcriptional regulatory networks (TRNs have been mathematically described using a Boolean formalism, in which the state of a gene is represented as either transcribed or not transcribed in response to regulatory signals. The Boolean formalism results in a series of regulatory rules for the individual genes of a TRN that in turn can be used to link environmental cues to the transcription state of a genome, thereby forming a complete transcriptional regulatory system (TRS. Herein, we develop a formalism that represents such a set of regulatory rules in a matrix form. Matrix formalism allows for the systemic characterization of the properties of a TRS and facilitates the computation of the transcriptional state of the genome under any given set of environmental conditions. Additionally, it provides a means to incorporate mechanistic detail of a TRS as it becomes available. In this study, the regulatory network matrix, R, for a prototypic TRS is characterized and the fundamental subspaces of this matrix are described. We illustrate how the matrix representation of a TRS coupled with its environment (R* allows for a sampling of all possible expression states of a given network, and furthermore, how the fundamental subspaces of the matrix provide a way to study key TRS features and may assist in experimental design.

  14. Inferring a transcription regulatory network by directed perturbation

    NARCIS (Netherlands)

    Sameith, K.

    2013-01-01

    Transcription plays a key role in cellular processes and its regulation is of paramount importance. The aim of the work described in this thesis is to study the transcription regulatory network of Saccharomyces cerevisiae, employing genome-wide approaches. All the three presented research studies

  15. A unified architecture of transcriptional regulatory elements

    DEFF Research Database (Denmark)

    Andersson, Robin; Sandelin, Albin Gustav; Danko, Charles G.

    2015-01-01

    Gene expression is precisely controlled in time and space through the integration of signals that act at gene promoters and gene-distal enhancers. Classically, promoters and enhancers are considered separate classes of regulatory elements, often distinguished by histone modifications. However, re...

  16. DNA residence time is a regulatory factor of transcription repression.

    Science.gov (United States)

    Clauß, Karen; Popp, Achim P; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N Henriette; Gebhardt, J Christof M

    2017-11-02

    Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Controllability analysis of transcriptional regulatory networks reveals circular control patterns among transcription factors

    DEFF Research Database (Denmark)

    Österlund, Tobias; Bordel, Sergio; Nielsen, Jens

    2015-01-01

    we analyze the topology and organization of nine transcriptional regulatory networks for E. coli, yeast, mouse and human, and we evaluate how the structure of these networks influences two of their key properties, namely controllability and stability. We calculate the controllability for each network......Transcriptional regulation is the most committed type of regulation in living cells where transcription factors (TFs) control the expression of their target genes and TF expression is controlled by other TFs forming complex transcriptional regulatory networks that can be highly interconnected. Here...... as a measure of the organization and interconnectivity of the network. We find that the number of driver nodes n(D) needed to control the whole network is 64% of the TFs in the E. coli transcriptional regulatory network in contrast to only 17% for the yeast network, 4% for the mouse network and 8...

  18. Unraveling condition specific gene transcriptional regulatory networks in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Kluger Yuval

    2006-03-01

    Full Text Available Abstract Background Gene expression and transcription factor (TF binding data have been used to reveal gene transcriptional regulatory networks. Existing knowledge of gene regulation can be presented using gene connectivity networks. However, these composite connectivity networks do not specify the range of biological conditions of the activity of each link in the network. Results We present a novel method that utilizes the expression and binding patterns of the neighboring nodes of each link in existing experimentally-based, literature-derived gene transcriptional regulatory networks and extend them in silico using TF-gene binding motifs and a compendium of large expression data from Saccharomyces cerevisiae. Using this method, we predict several hundreds of new transcriptional regulatory TF-gene links, along with experimental conditions in which known and predicted links become active. This approach unravels new links in the yeast gene transcriptional regulatory network by utilizing the known transcriptional regulatory interactions, and is particularly useful for breaking down the composite transcriptional regulatory network to condition specific networks. Conclusion Our methods can facilitate future binding experiments, as they can considerably help focus on the TFs that must be surveyed to understand gene regulation. (Supplemental material and the latest version of the MATLAB implementation of the United Signature Algorithm is available online at 1 or [see Additional files 1, 2, 3, 4, 5, 6, 7, 8, 9, 10] Additional File 1 overview of supplemental data Click here for file Additional File 2 experimental conditions for each link in figure 5. These are the experimental conditions in which the links are likely to be active. Click here for file Additional File 3 experimental conditions for each link in figure 7. These are the experimental conditions in which the links are likely to be active. Click here for file Additional File 4 Alon

  19. Characterization of transcriptional regulatory domains of ankyrin repeat cofactor-1

    International Nuclear Information System (INIS)

    Zhang, Aihua; Li, Chia-Wei; Chen, J. Don

    2007-01-01

    The ankyrin repeats cofactor-1 (ANCO-1) was recently identified as a p160 coactivator-interacting protein that may inhibit transcriptional activity of nuclear receptors. Here, we have characterized the transcriptional regulatory domains of ANCO-1. Two intrinsic repression domains (RD) were identified: an N-terminal RD1 at residues 318-611 and a C-terminal RD2 at 2369-2663. ANCO-1 also contains an activation domain (AD) capable of stimulating transcription in both mammalian and yeast cells. The minimal AD was delimited to a 70-amino acid region at residues 2076-2145. Overall, full-length ANCO-1 exhibited transcriptional repressor activity, suggesting that RD domains may suppress the AD activity. We further demonstrated that ANCO-1 silencing by siRNA enhanced progesterone receptor-mediated transcription. Together, these results indicate that the transcriptional potential of ANCO-1 may be modulated by a combination of repression and activation signals

  20. Identification of active transcriptional regulatory elements with GRO-seq

    OpenAIRE

    Danko, Charles G.; Hyland, Stephanie L.; Core, Leighton J.; Martins, Andre L.; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G.; Kraus, W. Lee; Lis, John T.; Siepel, Adam

    2015-01-01

    Transcriptional regulatory elements (TREs), including enhancers and promoters, determine the transcription levels of associated genes. We have recently shown that global run-on and sequencing (GRO-seq) with enrichment for 5'-capped RNAs reveals active TREs with high accuracy. Here, we demonstrate that active TREs can be identified by applying sensitive machine-learning methods to standard GRO-seq data. This approach allows TREs to be assayed together with gene expression levels and other tran...

  1. Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion.

    Science.gov (United States)

    Hovingh, Elise S; van den Broek, Bryan; Jongerius, Ilse

    2016-01-01

    The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed.

  2. A stochastic differential equation model for transcriptional regulatory networks

    Directory of Open Access Journals (Sweden)

    Quirk Michelle D

    2007-05-01

    Full Text Available Abstract Background This work explores the quantitative characteristics of the local transcriptional regulatory network based on the availability of time dependent gene expression data sets. The dynamics of the gene expression level are fitted via a stochastic differential equation model, yielding a set of specific regulators and their contribution. Results We show that a beta sigmoid function that keeps track of temporal parameters is a novel prototype of a regulatory function, with the effect of improving the performance of the profile prediction. The stochastic differential equation model follows well the dynamic of the gene expression levels. Conclusion When adapted to biological hypotheses and combined with a promoter analysis, the method proposed here leads to improved models of the transcriptional regulatory networks.

  3. In silico discovery of transcription regulatory elements in Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Le Roch Karine G

    2008-02-01

    Full Text Available Abstract Background With the sequence of the Plasmodium falciparum genome and several global mRNA and protein life cycle expression profiling projects now completed, elucidating the underlying networks of transcriptional control important for the progression of the parasite life cycle is highly pertinent to the development of new anti-malarials. To date, relatively little is known regarding the specific mechanisms the parasite employs to regulate gene expression at the mRNA level, with studies of the P. falciparum genome sequence having revealed few cis-regulatory elements and associated transcription factors. Although it is possible the parasite may evoke mechanisms of transcriptional control drastically different from those used by other eukaryotic organisms, the extreme AT-rich nature of P. falciparum intergenic regions (~90% AT presents significant challenges to in silico cis-regulatory element discovery. Results We have developed an algorithm called Gene Enrichment Motif Searching (GEMS that uses a hypergeometric-based scoring function and a position-weight matrix optimization routine to identify with high-confidence regulatory elements in the nucleotide-biased and repeat sequence-rich P. falciparum genome. When applied to promoter regions of genes contained within 21 co-expression gene clusters generated from P. falciparum life cycle microarray data using the semi-supervised clustering algorithm Ontology-based Pattern Identification, GEMS identified 34 putative cis-regulatory elements associated with a variety of parasite processes including sexual development, cell invasion, antigenic variation and protein biosynthesis. Among these candidates were novel motifs, as well as many of the elements for which biological experimental evidence already exists in the Plasmodium literature. To provide evidence for the biological relevance of a cell invasion-related element predicted by GEMS, reporter gene and electrophoretic mobility shift assays

  4. Iterative reconstruction of transcriptional regulatory networks: an algorithmic approach.

    Directory of Open Access Journals (Sweden)

    Christian L Barrett

    2006-05-01

    Full Text Available The number of complete, publicly available genome sequences is now greater than 200, and this number is expected to rapidly grow in the near future as metagenomic and environmental sequencing efforts escalate and the cost of sequencing drops. In order to make use of this data for understanding particular organisms and for discerning general principles about how organisms function, it will be necessary to reconstruct their various biochemical reaction networks. Principal among these will be transcriptional regulatory networks. Given the physical and logical complexity of these networks, the various sources of (often noisy data that can be utilized for their elucidation, the monetary costs involved, and the huge number of potential experiments approximately 10(12 that can be performed, experiment design algorithms will be necessary for synthesizing the various computational and experimental data to maximize the efficiency of regulatory network reconstruction. This paper presents an algorithm for experimental design to systematically and efficiently reconstruct transcriptional regulatory networks. It is meant to be applied iteratively in conjunction with an experimental laboratory component. The algorithm is presented here in the context of reconstructing transcriptional regulation for metabolism in Escherichia coli, and, through a retrospective analysis with previously performed experiments, we show that the produced experiment designs conform to how a human would design experiments. The algorithm is able to utilize probability estimates based on a wide range of computational and experimental sources to suggest experiments with the highest potential of discovering the greatest amount of new regulatory knowledge.

  5. Identification of active transcriptional regulatory elements with GRO-seq

    Science.gov (United States)

    Danko, Charles G.; Hyland, Stephanie L.; Core, Leighton J.; Martins, Andre L.; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G.; Kraus, W. Lee; Lis, John T.; Siepel, Adam

    2015-01-01

    Transcriptional regulatory elements (TREs), including enhancers and promoters, determine the transcription levels of associated genes. We have recently shown that global run-on and sequencing (GRO-seq) with enrichment for 5'-capped RNAs reveals active TREs with high accuracy. Here, we demonstrate that active TREs can be identified by applying sensitive machine-learning methods to standard GRO-seq data. This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Our prediction method, called discriminative Regulatory Element detection from GRO-seq (dREG), summarizes GRO-seq read counts at multiple scales and uses support vector regression to identify active TREs. The predicted TREs are more strongly enriched for several marks of transcriptional activation, including eQTL, GWAS-associated SNPs, H3K27ac, and transcription factor binding than those identified by alternative functional assays. Using dREG, we survey TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  6. Interrogating transcriptional regulatory sequences in Tol2-mediated Xenopus transgenics.

    Directory of Open Access Journals (Sweden)

    Gabriela G Loots

    Full Text Available Identifying gene regulatory elements and their target genes in vertebrates remains a significant challenge. It is now recognized that transcriptional regulatory sequences are critical in orchestrating dynamic controls of tissue-specific gene expression during vertebrate development and in adult tissues, and that these elements can be positioned at great distances in relation to the promoters of the genes they control. While significant progress has been made in mapping DNA binding regions by combining chromatin immunoprecipitation and next generation sequencing, functional validation remains a limiting step in improving our ability to correlate in silico predictions with biological function. We recently developed a computational method that synergistically combines genome-wide gene-expression profiling, vertebrate genome comparisons, and transcription factor binding-site analysis to predict tissue-specific enhancers in the human genome. We applied this method to 270 genes highly expressed in skeletal muscle and predicted 190 putative cis-regulatory modules. Furthermore, we optimized Tol2 transgenic constructs in Xenopus laevis to interrogate 20 of these elements for their ability to function as skeletal muscle-specific transcriptional enhancers during embryonic development. We found 45% of these elements expressed only in the fast muscle fibers that are oriented in highly organized chevrons in the Xenopus laevis tadpole. Transcription factor binding site analysis identified >2 Mef2/MyoD sites within ~200 bp regions in 6 of the validated enhancers, and systematic mutagenesis of these sites revealed that they are critical for the enhancer function. The data described herein introduces a new reporter system suitable for interrogating tissue-specific cis-regulatory elements which allows monitoring of enhancer activity in real time, throughout early stages of embryonic development, in Xenopus.

  7. Learning transcriptional regulatory relationships using sparse graphical models.

    Directory of Open Access Journals (Sweden)

    Xiang Zhang

    Full Text Available Understanding the organization and function of transcriptional regulatory networks by analyzing high-throughput gene expression profiles is a key problem in computational biology. The challenges in this work are 1 the lack of complete knowledge of the regulatory relationship between the regulators and the associated genes, 2 the potential for spurious associations due to confounding factors, and 3 the number of parameters to learn is usually larger than the number of available microarray experiments. We present a sparse (L1 regularized graphical model to address these challenges. Our model incorporates known transcription factors and introduces hidden variables to represent possible unknown transcription and confounding factors. The expression level of a gene is modeled as a linear combination of the expression levels of known transcription factors and hidden factors. Using gene expression data covering 39,296 oligonucleotide probes from 1109 human liver samples, we demonstrate that our model better predicts out-of-sample data than a model with no hidden variables. We also show that some of the gene sets associated with hidden variables are strongly correlated with Gene Ontology categories. The software including source code is available at http://grnl1.codeplex.com.

  8. The global regulatory architecture of transcription during the Caulobacter cell cycle.

    Directory of Open Access Journals (Sweden)

    Bo Zhou

    2015-01-01

    Full Text Available Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.

  9. Transcriptional control by two leucine-responsive regulatory proteins in Halobacterium salinarum R1

    Directory of Open Access Journals (Sweden)

    Tarasov Valery

    2010-05-01

    Full Text Available Abstract Background Archaea combine bacterial-as well as eukaryotic-like features to regulate cellular processes. Halobacterium salinarum R1 encodes eight leucine-responsive regulatory protein (Lrp-homologues. The function of two of them, Irp (OE3923F and lrpA1 (OE2621R, were analyzed by gene deletion and overexpression, including genome scale impacts using microarrays. Results It was shown that Lrp affects the transcription of multiple target genes, including those encoding enzymes involved in amino acid synthesis, central metabolism, transport processes and other regulators of transcription. In contrast, LrpA1 regulates transcription in a more specific manner. The aspB3 gene, coding for an aspartate transaminase, was repressed by LrpA1 in the presence of L-aspartate. Analytical DNA-affinity chromatography was adapted to high salt, and demonstrated binding of LrpA1 to its own promoter, as well as L-aspartate dependent binding to the aspB3 promoter. Conclusion The gene expression profiles of two archaeal Lrp-homologues report in detail their role in H. salinarum R1. LrpA1 and Lrp show similar functions to those already described in bacteria, but in addition they play a key role in regulatory networks, such as controlling the transcription of other regulators. In a more detailed analysis ligand dependent binding of LrpA1 was demonstrated to its target gene aspB3.

  10. Transcriptional regulatory programs underlying barley germination and regulatory functions of Gibberellin and abscisic acid

    Science.gov (United States)

    2011-01-01

    Background Seed germination is a complex multi-stage developmental process, and mainly accomplished through concerted activities of many gene products and biological pathways that are often subjected to strict developmental regulation. Gibberellins (GA) and abscisic acid (ABA) are two key phytohormones regulating seed germination and seedling growth. However, transcriptional regulatory networks underlying seed germination and its associated biological pathways are largely unknown. Results The studies examined transcriptomes of barley representing six distinct and well characterized germination stages and revealed that the transcriptional regulatory program underlying barley germination was composed of early, late, and post-germination phases. Each phase was accompanied with transcriptional up-regulation of distinct biological pathways. Cell wall synthesis and regulatory components including transcription factors, signaling and post-translational modification components were specifically and transiently up-regulated in early germination phase while histone families and many metabolic pathways were up-regulated in late germination phase. Photosynthesis and seed reserve mobilization pathways were up-regulated in post-germination phase. However, stress related pathways and seed storage proteins were suppressed through the entire course of germination. A set of genes were transiently up-regulated within three hours of imbibition, and might play roles in initiating biological pathways involved in seed germination. However, highly abundant transcripts in dry barley and Arabidopsis seeds were significantly conserved. Comparison with transcriptomes of barley aleurone in response to GA and ABA identified three sets of germination responsive genes that were regulated coordinately by GA, antagonistically by ABA, and coordinately by GA but antagonistically by ABA. Major CHO metabolism, cell wall degradation and protein degradation pathways were up-regulated by both GA and seed

  11. Identification of germline transcriptional regulatory elements in Aedes aegypti

    Science.gov (United States)

    Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

    2014-02-01

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  12. Architectural Epigenetics: Mitotic Retention of Mammalian Transcriptional Regulatory Information ▿

    Science.gov (United States)

    Zaidi, Sayyed K.; Young, Daniel W.; Montecino, Martin; Lian, Jane B.; Stein, Janet L.; van Wijnen, Andre J.; Stein, Gary S.

    2010-01-01

    Epigenetic regulatory information must be retained during mammalian cell division to sustain phenotype-specific and physiologically responsive gene expression in the progeny cells. Histone modifications, DNA methylation, and RNA-mediated silencing are well-defined epigenetic mechanisms that control the cellular phenotype by regulating gene expression. Recent results suggest that the mitotic retention of nuclease hypersensitivity, selective histone marks, as well as the lineage-specific transcription factor occupancy of promoter elements contribute to the epigenetic control of sustained cellular identity in progeny cells. We propose that these mitotic epigenetic signatures collectively constitute architectural epigenetics, a novel and essential mechanism that conveys regulatory information to sustain the control of phenotype and proliferation in progeny cells by bookmarking genes for activation or suppression. PMID:20696837

  13. Architectural epigenetics: mitotic retention of mammalian transcriptional regulatory information.

    Science.gov (United States)

    Zaidi, Sayyed K; Young, Daniel W; Montecino, Martin; Lian, Jane B; Stein, Janet L; van Wijnen, Andre J; Stein, Gary S

    2010-10-01

    Epigenetic regulatory information must be retained during mammalian cell division to sustain phenotype-specific and physiologically responsive gene expression in the progeny cells. Histone modifications, DNA methylation, and RNA-mediated silencing are well-defined epigenetic mechanisms that control the cellular phenotype by regulating gene expression. Recent results suggest that the mitotic retention of nuclease hypersensitivity, selective histone marks, as well as the lineage-specific transcription factor occupancy of promoter elements contribute to the epigenetic control of sustained cellular identity in progeny cells. We propose that these mitotic epigenetic signatures collectively constitute architectural epigenetics, a novel and essential mechanism that conveys regulatory information to sustain the control of phenotype and proliferation in progeny cells by bookmarking genes for activation or suppression.

  14. Global transcriptional regulatory network for Escherichia coli robustly connects gene expression to transcription factor activities

    DEFF Research Database (Denmark)

    Fang, Xin; Sastry, Anand; Mih, Nathan

    2017-01-01

    gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions...... algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose...... definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems...

  15. Oncogenes Activate an Autonomous Transcriptional Regulatory Circuit That Drives Glioblastoma

    Directory of Open Access Journals (Sweden)

    Dinesh K. Singh

    2017-01-01

    Full Text Available Efforts to identify and target glioblastoma (GBM drivers have primarily focused on receptor tyrosine kinases (RTKs. Clinical benefits, however, have been elusive. Here, we identify an SRY-related box 2 (SOX2 transcriptional regulatory network that is independent of upstream RTKs and capable of driving glioma-initiating cells. We identified oligodendrocyte lineage transcription factor 2 (OLIG2 and zinc-finger E-box binding homeobox 1 (ZEB1, which are frequently co-expressed irrespective of driver mutations, as potential SOX2 targets. In murine glioma models, we show that different combinations of tumor suppressor and oncogene mutations can activate Sox2, Olig2, and Zeb1 expression. We demonstrate that ectopic co-expression of the three transcription factors can transform tumor-suppressor-deficient astrocytes into glioma-initiating cells in the absence of an upstream RTK oncogene. Finally, we demonstrate that the transcriptional inhibitor mithramycin downregulates SOX2 and its target genes, resulting in markedly reduced proliferation of GBM cells in vivo.

  16. Oncogenes Activate an Autonomous Transcriptional Regulatory Circuit That Drives Glioblastoma.

    Science.gov (United States)

    Singh, Dinesh K; Kollipara, Rahul K; Vemireddy, Vamsidara; Yang, Xiao-Li; Sun, Yuxiao; Regmi, Nanda; Klingler, Stefan; Hatanpaa, Kimmo J; Raisanen, Jack; Cho, Steve K; Sirasanagandla, Shyam; Nannepaga, Suraj; Piccirillo, Sara; Mashimo, Tomoyuki; Wang, Shan; Humphries, Caroline G; Mickey, Bruce; Maher, Elizabeth A; Zheng, Hongwu; Kim, Ryung S; Kittler, Ralf; Bachoo, Robert M

    2017-01-24

    Efforts to identify and target glioblastoma (GBM) drivers have primarily focused on receptor tyrosine kinases (RTKs). Clinical benefits, however, have been elusive. Here, we identify an SRY-related box 2 (SOX2) transcriptional regulatory network that is independent of upstream RTKs and capable of driving glioma-initiating cells. We identified oligodendrocyte lineage transcription factor 2 (OLIG2) and zinc-finger E-box binding homeobox 1 (ZEB1), which are frequently co-expressed irrespective of driver mutations, as potential SOX2 targets. In murine glioma models, we show that different combinations of tumor suppressor and oncogene mutations can activate Sox2, Olig2, and Zeb1 expression. We demonstrate that ectopic co-expression of the three transcription factors can transform tumor-suppressor-deficient astrocytes into glioma-initiating cells in the absence of an upstream RTK oncogene. Finally, we demonstrate that the transcriptional inhibitor mithramycin downregulates SOX2 and its target genes, resulting in markedly reduced proliferation of GBM cells in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Transcriptional regulatory networks underlying gene expression changes in Huntington's disease.

    Science.gov (United States)

    Ament, Seth A; Pearl, Jocelynn R; Cantle, Jeffrey P; Bragg, Robert M; Skene, Peter J; Coffey, Sydney R; Bergey, Dani E; Wheeler, Vanessa C; MacDonald, Marcy E; Baliga, Nitin S; Rosinski, Jim; Hood, Leroy E; Carroll, Jeffrey B; Price, Nathan D

    2018-03-26

    Transcriptional changes occur presymptomatically and throughout Huntington's disease (HD), motivating the study of transcriptional regulatory networks (TRNs) in HD We reconstructed a genome-scale model for the target genes of 718 transcription factors (TFs) in the mouse striatum by integrating a model of genomic binding sites with transcriptome profiling of striatal tissue from HD mouse models. We identified 48 differentially expressed TF-target gene modules associated with age- and CAG repeat length-dependent gene expression changes in Htt CAG knock-in mouse striatum and replicated many of these associations in independent transcriptomic and proteomic datasets. Thirteen of 48 of these predicted TF-target gene modules were also differentially expressed in striatal tissue from human disease. We experimentally validated a specific model prediction that SMAD3 regulates HD-related gene expression changes using chromatin immunoprecipitation and deep sequencing (ChIP-seq) of mouse striatum. We found CAG repeat length-dependent changes in the genomic occupancy of SMAD3 and confirmed our model's prediction that many SMAD3 target genes are downregulated early in HD. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  18. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice.

    Science.gov (United States)

    Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M; Bansal, Kailash C

    2015-01-01

    MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by "top-down" and "guide-gene" approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via "top-down" approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by "guide-gene" approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice

  19. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    Directory of Open Access Journals (Sweden)

    Shuchi eSmita

    2015-12-01

    Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  20. Transcription-factor-dependent enhancer transcription defines a gene regulatory network for cardiac rhythm.

    Science.gov (United States)

    Yang, Xinan H; Nadadur, Rangarajan D; Hilvering, Catharina Re; Bianchi, Valerio; Werner, Michael; Mazurek, Stefan R; Gadek, Margaret; Shen, Kaitlyn M; Goldman, Joseph Aaron; Tyan, Leonid; Bekeny, Jenna; Hall, Johnathon M; Lee, Nutishia; Perez-Cervantes, Carlos; Burnicka-Turek, Ozanna; Poss, Kenneth D; Weber, Christopher R; de Laat, Wouter; Ruthenburg, Alexander J; Moskowitz, Ivan P

    2017-12-27

    The noncoding genome is pervasively transcribed. Noncoding RNAs (ncRNAs) generated from enhancers have been proposed as a general facet of enhancer function and some have been shown to be required for enhancer activity. Here we examine the transcription-factor-(TF)-dependence of ncRNA expression to define enhancers and enhancer-associated ncRNAs that are involved in a TF-dependent regulatory network. TBX5, a cardiac TF, regulates a network of cardiac channel genes to maintain cardiac rhythm. We deep sequenced wildtype and Tbx5 -mutant mouse atria, identifying ~2600 novel Tbx5 -dependent ncRNAs. Tbx5-dependent ncRNAs were enriched for tissue-specific marks of active enhancers genome-wide. Tbx5-dependent ncRNAs emanated from regions that are enriched for TBX5-binding and that demonstrated Tbx5-dependent enhancer activity. Tbx5 -dependent ncRNA transcription provided a quantitative metric of Tbx5 -dependent enhancer activity, correlating with target gene expression. We identified RACER , a novel Tbx5 -dependent long noncoding RNA (lncRNA) required for the expression of the calcium-handling gene Ryr2 . We illustrate that TF-dependent enhancer transcription can illuminate components of TF-dependent gene regulatory networks.

  1. Multiple post-transcriptional regulatory mechanisms in ferritin gene expression

    International Nuclear Information System (INIS)

    Mattia, E.; Den Blaauwen, J.; Van Renswoude, J.; Ashwell, G.

    1989-01-01

    The authors have investigated the mechanisms involved in the regulation of ferritin biosynthesis in K562 human erythroleukemia cells during prolonged exposure to iron. They show that, upon addition of hemin (an efficient iron donor) to the cell culture, the rate of ferritin biosynthesis reaches a maximum after a few hours and then decreases. During a 24-hr incubation with the iron donor the concentrations of total ferritin heavy (H) and light (L) subunit mRNAs rise 2- to 5-fold and 2- to 3-fold, respectively, over the control values, while the amount of the protein increases 10- to 30-fold. The hemin-induced increment in ferritin subunit mRNA is not prevented by deferoxamine, suggesting that it is not directly mediated by chelatable iron. In vitro nuclear transcription analyses performed on nuclei isolated from control cells and cells grown in the presence of hemin indicate that the rates of synthesis of H- and L-subunit mRNAs remain constant. They conclude that iron-induced ferritin biosynthesis is governed by multiple post-transcriptional regulatory mechanisms. They propose that exposure of cells to iron leads to stabilization of ferritin mRNAs, in addition to activation and translation of stored H-and L-subunit mRNAs

  2. Conserved Transcriptional Regulatory Programs Underlying Rice and Barley Germination

    Science.gov (United States)

    Lin, Li; Tian, Shulan; Kaeppler, Shawn; Liu, Zongrang; An, Yong-Qiang (Charles)

    2014-01-01

    Germination is a biological process important to plant development and agricultural production. Barley and rice diverged 50 million years ago, but share a similar germination process. To gain insight into the conservation of their underlying gene regulatory programs, we compared transcriptomes of barley and rice at start, middle and end points of germination, and revealed that germination regulated barley and rice genes (BRs) diverged significantly in expression patterns and/or protein sequences. However, BRs with higher protein sequence similarity tended to have more conserved expression patterns. We identified and characterized 316 sets of conserved barley and rice genes (cBRs) with high similarity in both protein sequences and expression patterns, and provided a comprehensive depiction of the transcriptional regulatory program conserved in barley and rice germination at gene, pathway and systems levels. The cBRs encoded proteins involved in a variety of biological pathways and had a wide range of expression patterns. The cBRs encoding key regulatory components in signaling pathways often had diverse expression patterns. Early germination up-regulation of cell wall metabolic pathway and peroxidases, and late germination up-regulation of chromatin structure and remodeling pathways were conserved in both barley and rice. Protein sequence and expression pattern of a gene change quickly if it is not subjected to a functional constraint. Preserving germination-regulated expression patterns and protein sequences of those cBRs for 50 million years strongly suggests that the cBRs are functionally significant and equivalent in germination, and contribute to the ancient characteristics of germination preserved in barley and rice. The functional significance and equivalence of the cBR genes predicted here can serve as a foundation to further characterize their biological functions and facilitate bridging rice and barley germination research with greater confidence. PMID

  3. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Tzyy-Choou.

    1989-01-01

    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  4. FOXA and master transcription factors recruit Mediator and Cohesin to the core transcriptional regulatory circuitry of cancer cells

    Science.gov (United States)

    Fournier, Michèle; Bourriquen, Gaëlle; Lamaze, Fabien C.; Côté, Maxime C.; Fournier, Éric; Joly-Beauparlant, Charles; Caron, Vicky; Gobeil, Stéphane; Droit, Arnaud; Bilodeau, Steve

    2016-10-01

    Controlling the transcriptional program is essential to maintain the identity and the biological functions of a cell. The Mediator and Cohesin complexes have been established as central cofactors controlling the transcriptional program in normal cells. However, the distribution, recruitment and importance of these complexes in cancer cells have not been fully investigated. Here we show that FOXA and master transcription factors are part of the core transcriptional regulatory circuitry of cancer cells and are essential to recruit M ediator and Cohesin. Indeed, Mediator and Cohesin occupied the enhancer and promoter regions of actively transcribed genes and maintained the proliferation and colony forming potential. Through integration of publically available ChIP-Seq datasets, we predicted the core transcriptional regulatory circuitry of each cancer cell. Unexpectedly, for all cells investigated, the pioneer transcription factors FOXA1 and/or FOXA2 were identified in addition to cell-specific master transcription factors. Loss of both types of transcription factors phenocopied the loss of Mediator and Cohesin. Lastly, the master and pioneer transcription factors were essential to recruit Mediator and Cohesin to regulatory regions of actively transcribed genes. Our study proposes that maintenance of the cancer cell state is dependent on recruitment of Mediator and Cohesin through FOXA and master transcription factors.

  5. Deciphering Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli

    DEFF Research Database (Denmark)

    Seo, Sang Woo; Kim, Donghyuk; Latif, Haythem

    2014-01-01

    The ferric uptake regulator (Fur) plays a critical role in the transcriptional regulation of iron metabolism. However, the full regulatory potential of Fur remains undefined. Here we comprehensively reconstruct the Fur transcriptional regulatory network in Escherichia coli K-12 MG1655 in response...

  6. Comparative study between transcriptionally- and translationally-acting adenine riboswitches reveals key differences in riboswitch regulatory mechanisms.

    Directory of Open Access Journals (Sweden)

    Jean-François Lemay

    2011-01-01

    Full Text Available Many bacterial mRNAs are regulated at the transcriptional or translational level by ligand-binding elements called riboswitches. Although they both bind adenine, the adenine riboswitches of Bacillus subtilis and Vibrio vulnificus differ by controlling transcription and translation, respectively. Here, we demonstrate that, beyond the obvious difference in transcriptional and translational modulation, both adenine riboswitches exhibit different ligand binding properties and appear to operate under different regulation regimes (kinetic versus thermodynamic. While the B. subtilis pbuE riboswitch fully depends on co-transcriptional binding of adenine to function, the V. vulnificus add riboswitch can bind to adenine after transcription is completed and still perform translation regulation. Further investigation demonstrates that the rate of transcription is critical for the B. subtilis pbuE riboswitch to perform efficiently, which is in agreement with a co-transcriptional regulation. Our results suggest that the nature of gene regulation control, that is transcription or translation, may have a high importance in riboswitch regulatory mechanisms.

  7. A new regulatory mechanism for bacterial lipoic acid synthesis.

    Science.gov (United States)

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  8. DNA supercoiling is a fundamental regulatory principle in the control of bacterial gene expression.

    Science.gov (United States)

    Dorman, Charles J; Dorman, Matthew J

    2016-11-01

    Although it has become routine to consider DNA in terms of its role as a carrier of genetic information, it is also an important contributor to the control of gene expression. This regulatory principle arises from its structural properties. DNA is maintained in an underwound state in most bacterial cells and this has important implications both for DNA storage in the nucleoid and for the expression of genetic information. Underwinding of the DNA through reduction in its linking number potentially imparts energy to the duplex that is available to drive DNA transactions, such as transcription, replication and recombination. The topological state of DNA also influences its affinity for some DNA binding proteins, especially in DNA sequences that have a high A + T base content. The underwinding of DNA by the ATP-dependent topoisomerase DNA gyrase creates a continuum between metabolic flux, DNA topology and gene expression that underpins the global response of the genome to changes in the intracellular and external environments. These connections describe a fundamental and generalised mechanism affecting global gene expression that underlies the specific control of transcription operating through conventional transcription factors. This mechanism also provides a basal level of control for genes acquired by horizontal DNA transfer, assisting microbial evolution, including the evolution of pathogenic bacteria.

  9. ChIP-Seq Data Analysis to Define Transcriptional Regulatory Networks.

    Science.gov (United States)

    Pavesi, Giulio

    The first step in the definition of transcriptional regulatory networks is to establish correct relationships between transcription factors (TFs) and their target genes, together with the effect of their regulatory activity (activator or repressor). Fundamental advances in this direction have been made possible by the introduction of experimental techniques such as Chromatin Immunoprecipitation, which, coupled with next-generation sequencing technologies (ChIP-Seq), permit the genome-wide identification of TF binding sites. This chapter provides a survey on how data of this kind are to be processed and integrated with expression and other types of data to infer transcriptional regulatory rules and codes.

  10. Pleiotropy constrains the evolution of protein but not regulatory sequences in a transcription regulatory network influencing complex social behaviours

    Directory of Open Access Journals (Sweden)

    Daria eMolodtsova

    2014-12-01

    Full Text Available It is increasingly apparent that genes and networks that influence complex behaviour are evolutionary conserved, which is paradoxical considering that behaviour is labile over evolutionary timescales. How does adaptive change in behaviour arise if behaviour is controlled by conserved, pleiotropic, and likely evolutionary constrained genes? Pleiotropy and connectedness are known to constrain the general rate of protein evolution, prompting some to suggest that the evolution of complex traits, including behaviour, is fuelled by regulatory sequence evolution. However, we seldom have data on the strength of selection on mutations in coding and regulatory sequences, and this hinders our ability to study how pleiotropy influences coding and regulatory sequence evolution. Here we use population genomics to estimate the strength of selection on coding and regulatory mutations for a transcriptional regulatory network that influences complex behaviour of honey bees. We found that replacement mutations in highly connected transcription factors and target genes experience significantly stronger negative selection relative to weakly connected transcription factors and targets. Adaptively evolving proteins were significantly more likely to reside at the periphery of the regulatory network, while proteins with signs of negative selection were near the core of the network. Interestingly, connectedness and network structure had minimal influence on the strength of selection on putative regulatory sequences for both transcription factors and their targets. Our study indicates that adaptive evolution of complex behaviour can arise because of positive selection on protein-coding mutations in peripheral genes, and on regulatory sequence mutations in both transcription factors and their targets throughout the network.

  11. A deeper look into transcription regulatory code by preferred pair distance templates for transcription factor binding sites

    KAUST Repository

    Kulakovskiy, Ivan V.

    2011-08-18

    Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding of the transcription regulatory code. Results: We constructed binding motifs for TFs forming a complex with HIF-1α at the erythropoietin 3\\'-enhancer. Corresponding TFBSs were predicted in the segments around transcription start sites (TSSs) of all human genes. Using the genome-wide set of regulatory regions, we observed several strongly preferred distances between hypoxia-responsive element (HRE) and binding sites of a particular cofactor protein. The set of preferred distances was called as a preferred pair distance template (PPDT). PPDT dramatically depended on the TF and orientation of its binding sites relative to HRE. PPDT evaluated from the genome-wide set of regulatory sequences was used to detect significant PPDT-consistent binding site pairs in regulatory regions of hypoxia-responsive genes. We believe PPDT can help to reveal the layout of eukaryotic regulatory segments. © The Author 2011. Published by Oxford University Press. All rights reserved.

  12. Metabolic Network Topology Reveals Transcriptional Regulatory Signatures of Type 2 Diabetes

    DEFF Research Database (Denmark)

    Zelezniak, Aleksej; Pers, Tune Hannes; Pinho Soares, Simao Pedro

    2010-01-01

    mechanisms underlying these transcriptional changes and their impact on the cellular metabolic phenotype is a challenging task due to the complexity of transcriptional regulation and the highly interconnected nature of the metabolic network. In this study we integrate skeletal muscle gene expression datasets...... with human metabolic network reconstructions to identify key metabolic regulatory features of T2DM. These features include reporter metabolites—metabolites with significant collective transcriptional response in the associated enzyme-coding genes, and transcription factors with significant enrichment...... factor regulatory network connecting several parts of metabolism. The identified transcription factors include members of the CREB, NRF1 and PPAR family, among others, and represent regulatory targets for further experimental analysis. Overall, our results provide a holistic picture of key metabolic...

  13. A guide to integrating transcriptional regulatory and metabolic networks using PROM (probabilistic regulation of metabolism).

    Science.gov (United States)

    Simeonidis, Evangelos; Chandrasekaran, Sriram; Price, Nathan D

    2013-01-01

    The integration of transcriptional regulatory and metabolic networks is a crucial step in the process of predicting metabolic behaviors that emerge from either genetic or environmental changes. Here, we present a guide to PROM (probabilistic regulation of metabolism), an automated method for the construction and simulation of integrated metabolic and transcriptional regulatory networks that enables large-scale phenotypic predictions for a wide range of model organisms.

  14. Cooperative transcription factor associations discovered using regulatory variation.

    Science.gov (United States)

    Karczewski, Konrad J; Tatonetti, Nicholas P; Landt, Stephen G; Yang, Xinqiong; Slifer, Teri; Altman, Russ B; Snyder, Michael

    2011-08-09

    Regulation of gene expression at the transcriptional level is achieved by complex interactions of transcription factors operating at their target genes. Dissecting the specific combination of factors that bind each target is a significant challenge. Here, we describe in detail the Allele Binding Cooperativity test, which uses variation in transcription factor binding among individuals to discover combinations of factors and their targets. We developed the ALPHABIT (a large-scale process to hunt for allele binding interacting transcription factors) pipeline, which includes statistical analysis of binding sites followed by experimental validation, and demonstrate that this method predicts transcription factors that associate with NFκB. Our method successfully identifies factors that have been known to work with NFκB (E2A, STAT1, IRF2), but whose global coassociation and sites of cooperative action were not known. In addition, we identify a unique coassociation (EBF1) that had not been reported previously. We present a general approach for discovering combinatorial models of regulation and advance our understanding of the genetic basis of variation in transcription factor binding.

  15. Uncovering transcription factor and microRNA risk regulatory pathways associated with osteoarthritis by network analysis.

    Science.gov (United States)

    Song, Zhenhua; Zhang, Chi; He, Lingxiao; Sui, Yanfang; Lin, Xiafei; Pan, Jingjing

    2018-04-27

    Osteoarthritis (OA) is the most common form of joint disease. The development of inflammation have been considered to play a key role during the progression of OA. Regulatory pathways are known to play crucial roles in many pathogenic processes. Thus, deciphering these risk regulatory pathways is critical for elucidating the mechanisms underlying OA. We constructed an OA-specific regulatory network by integrating comprehensive curated transcription and post-transcriptional resource involving transcription factor (TF) and microRNA (miRNA). To deepen our understanding of underlying molecular mechanisms of OA, we developed an integrated systems approach to identify OA-specific risk regulatory pathways. In this study, we identified 89 significantly differentially expressed genes between normal and inflamed areas of OA patients. We found the OA-specific regulatory network was a standard scale-free network with small-world properties. It significant enriched many immune response-related functions including leukocyte differentiation, myeloid differentiation and T cell activation. Finally, 141 risk regulatory pathways were identified based on OA-specific regulatory network, which contains some known regulator of OA. The risk regulatory pathways may provide clues for the etiology of OA and be a potential resource for the discovery of novel OA-associated disease genes. Copyright © 2018. Published by Elsevier Inc.

  16. Computational methods to dissect cis-regulatory transcriptional ...

    Indian Academy of Sciences (India)

    The formation of diverse cell types from an invariant set of genes is governed by biochemical and molecular processes that regulate gene activity. A complete understanding of the regulatory mechanisms of gene expression is the major function of genomics. Computational genomics is a rapidly emerging area for ...

  17. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  18. Inferring a transcriptional regulatory network of the cytokinesis-related genes by network component analysis

    Directory of Open Access Journals (Sweden)

    Kao Cheng-Yan

    2009-11-01

    Full Text Available Abstract Background Network Component Analysis (NCA is a network structure-driven framework for deducing regulatory signal dynamics. In contrast to principal component analysis, which can be employed to select the high-variance genes, NCA makes use of the connectivity structure from transcriptional regulatory networks to infer dynamics of transcription factor activities. Using the budding yeast Saccharomyces cerevisiae as a model system, we aim to deduce regulatory actions of cytokinesis-related genes, using precise spatial proximity (midbody and/or temporal synchronicity (cytokinesis to avoid full-scale computation from genome-wide databases. Results NCA was applied to infer regulatory actions of transcription factor activity from microarray data and partial transcription factor-gene connectivity information for cytokinesis-related genes, which were a subset of genome-wide datasets. No literature has so far discussed the inferred results through NCA are independent of the scale of the gene expression dataset. To avoid full-scale computation from genome-wide databases, four cytokinesis-related gene cases were selected for NCA by running computational analysis over the transcription factor database to confirm the approach being scale-free. The inferred dynamics of transcription factor activity through NCA were independent of the scale of the data matrix selected from the four cytokinesis-related gene sets. Moreover, the inferred regulatory actions were nearly identical to published observations for the selected cytokinesis-related genes in the budding yeast; namely, Mcm1, Ndd1, and Fkh2, which form a transcription factor complex to control expression of the CLB2 cluster (i.e. BUD4, CHS2, IQG1, and CDC5. Conclusion In this study, using S. cerevisiae as a model system, NCA was successfully applied to infer similar regulatory actions of transcription factor activities from two various microarray databases and several partial transcription factor

  19. Inferring a transcriptional regulatory network of the cytokinesis-related genes by network component analysis.

    Science.gov (United States)

    Chen, Shun-Fu; Juang, Yue-Li; Chou, Wei-Kang; Lai, Jin-Mei; Huang, Chi-Ying F; Kao, Cheng-Yan; Wang, Feng-Sheng

    2009-11-27

    Network Component Analysis (NCA) is a network structure-driven framework for deducing regulatory signal dynamics. In contrast to principal component analysis, which can be employed to select the high-variance genes, NCA makes use of the connectivity structure from transcriptional regulatory networks to infer dynamics of transcription factor activities. Using the budding yeast Saccharomyces cerevisiae as a model system, we aim to deduce regulatory actions of cytokinesis-related genes, using precise spatial proximity (midbody) and/or temporal synchronicity (cytokinesis) to avoid full-scale computation from genome-wide databases. NCA was applied to infer regulatory actions of transcription factor activity from microarray data and partial transcription factor-gene connectivity information for cytokinesis-related genes, which were a subset of genome-wide datasets. No literature has so far discussed the inferred results through NCA are independent of the scale of the gene expression dataset. To avoid full-scale computation from genome-wide databases, four cytokinesis-related gene cases were selected for NCA by running computational analysis over the transcription factor database to confirm the approach being scale-free. The inferred dynamics of transcription factor activity through NCA were independent of the scale of the data matrix selected from the four cytokinesis-related gene sets. Moreover, the inferred regulatory actions were nearly identical to published observations for the selected cytokinesis-related genes in the budding yeast; namely, Mcm1, Ndd1, and Fkh2, which form a transcription factor complex to control expression of the CLB2 cluster (i.e. BUD4, CHS2, IQG1, and CDC5). In this study, using S. cerevisiae as a model system, NCA was successfully applied to infer similar regulatory actions of transcription factor activities from two various microarray databases and several partial transcription factor-gene connectivity datasets for selected cytokinesis

  20. Predicting combinatorial binding of transcription factors to regulatory elements in the human genome by association rule mining

    OpenAIRE

    Morgan, Xochitl C; Ni, Shulin; Miranker, Daniel P; Iyer, Vishwanath R

    2007-01-01

    Abstract Background Cis-acting transcriptional regulatory elements in mammalian genomes typically contain specific combinations of binding sites for various transcription factors. Although some cis-regulatory elements have been well studied, the combinations of transcription factors that regulate normal expression levels for the vast majority of the 20,000 genes in the human genome are unknown. We hypothesized that it should be possible to discover transcription factor combinations that regul...

  1. Transcriptional response of Musca domestica larvae to bacterial infection.

    Directory of Open Access Journals (Sweden)

    Ting Tang

    Full Text Available The house fly Musca domestica, a cosmopolitan dipteran insect, is a significant vector for human and animal bacterial pathogens, but little is known about its immune response to these pathogens. To address this issue, we inoculated the larvae with a mixture of Escherichia coli and Staphylococcus aureus and profiled the transcriptome 6, 24, and 48 h thereafter. Many genes known to controlling innate immunity in insects were induced following infection, including genes encoding pattern recognition proteins (PGRPs, various components of the Toll and IMD signaling pathways and of the proPO-activating and redox systems, and multiple antimicrobial peptides. Interestingly, we also uncovered a large set of novel immune response genes including two broad-spectrum antimicrobial peptides (muscin and domesticin, which might have evolved to adapt to house-fly's unique ecological environments. Finally, genes mediating oxidative phosphorylation were repressed at 48 h post-infection, suggesting disruption of energy homeostasis and mitochondrial function at the late stages of infection. Collectively, our data reveal dynamic changes in gene expression following bacterial infection in the house fly, paving the way for future in-depth analysis of M. domestica's immune system.

  2. Sucrose-induced anthocyanin accumulation in vegetative tissue of Petunia plants requires anthocyanin regulatory transcription factors.

    Science.gov (United States)

    Ai, Trinh Ngoc; Naing, Aung Htay; Arun, Muthukrishnan; Lim, Sun-Hyung; Kim, Chang Kil

    2016-11-01

    The effects of three different sucrose concentrations on plant growth and anthocyanin accumulation were examined in non-transgenic (NT) and transgenic (T 2 ) specimens of the Petunia hybrida cultivar 'Mirage rose' that carried the anthocyanin regulatory transcription factors B-Peru+mPAP1 or RsMYB1. Anthocyanin accumulation was not observed in NT plants in any treatments, whereas a range of anthocyanin accumulation was observed in transgenic plants. The anthocyanin content detected in transgenic plants expressing the anthocyanin regulatory transcription factors (B-Peru+mPAP1 or RsMYB1) was higher than that in NT plants. In addition, increasing sucrose concentration strongly enhanced anthocyanin content as shown by quantitative real-time polymerase chain reaction (qRT-PCR) analysis, wherein increased concentrations of sucrose enhanced transcript levels of the transcription factors that are responsible for the induction of biosynthetic genes involved in anthocyanin synthesis; this pattern was not observed in NT plants. In addition, sucrose affected plant growth, although the effects were different between NT and transgenic plants. Taken together, the application of sucrose could enhance anthocyanin production in vegetative tissue of transgenic Petunia carrying anthocyanin regulatory transcription factors, and this study provides insights about interactive effects of sucrose and transcription factors in anthocyanin biosynthesis in the transgenic plant. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  3. Role of the σ54 Activator Interacting Domain in Bacterial Transcription Initiation

    Energy Technology Data Exchange (ETDEWEB)

    Siegel, Alexander R. [Univ. of California, Berkeley, CA (United States); Wemmer, David E. [Univ. of California, Berkeley, CA (United States)

    2016-10-11

    Bacterial sigma factors are subunits of RNA polymerase that direct the holoenzyme to specific sets of promoters in the genome and are a central element of regulating transcription. Most polymerase holoenzymes open the promoter and initiate transcription rapidly after binding. However, polymerase containing the members of the σ54 family must be acted on by a transcriptional activator before DNA opening and initiation occur. A key domain in these transcriptional activators forms a hexameric AAA + ATPase that acts through conformational changes brought on by ATP hydrolysis. Contacts between the transcriptional activator and σ54 are primarily made through an N-terminal σ54 activator interacting domain (AID). To better understand this mechanism of bacterial transcription initiation, we characterized the σ54 AID by NMR spectroscopy and other biophysical methods and show that it is an intrinsically disordered domain in σ54 alone. In this paper, we identified a minimal construct of the Aquifex aeolicus σ54 AID that consists of two predicted helices and retains native-like binding affinity for the transcriptional activator NtrC1. Using the NtrC1 ATPase domain, bound with the non-hydrolyzable ATP analog ADP-beryllium fluoride, we studied the NtrC1–σ54 AID complex using NMR spectroscopy. We show that the σ54 AID becomes structured after associating with the core loops of the transcriptional activators in their ATP state and that the primary site of the interaction is the first predicted helix. Finally, understanding this complex, formed as the first step toward initiation, will help unravel the mechanism of σ54 bacterial transcription initiation.

  4. Quantification of yeast and bacterial gene transcripts in retail cheeses by reverse transcription-quantitative PCR.

    Science.gov (United States)

    Monnet, Christophe; Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

    2013-01-01

    The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed.

  5. Data from computational analysis of the peptide linkers in the MocR bacterial transcriptional regulators

    Directory of Open Access Journals (Sweden)

    Sebastiana Angelaccio

    2016-12-01

    Interpretation and discussion of reported data refer to the article “Structural properties of the linkers connecting the N- and C- terminal domains in the MocR bacterial transcriptional regulators” (T. Milano, S. Angelaccio, A. Tramonti, M. L. Di Salvo, R. Contestabile, S. Pascarella, 2016 [1].

  6. TIGER: Toolbox for integrating genome-scale metabolic models, expression data, and transcriptional regulatory networks

    Directory of Open Access Journals (Sweden)

    Jensen Paul A

    2011-09-01

    Full Text Available Abstract Background Several methods have been developed for analyzing genome-scale models of metabolism and transcriptional regulation. Many of these methods, such as Flux Balance Analysis, use constrained optimization to predict relationships between metabolic flux and the genes that encode and regulate enzyme activity. Recently, mixed integer programming has been used to encode these gene-protein-reaction (GPR relationships into a single optimization problem, but these techniques are often of limited generality and lack a tool for automating the conversion of rules to a coupled regulatory/metabolic model. Results We present TIGER, a Toolbox for Integrating Genome-scale Metabolism, Expression, and Regulation. TIGER converts a series of generalized, Boolean or multilevel rules into a set of mixed integer inequalities. The package also includes implementations of existing algorithms to integrate high-throughput expression data with genome-scale models of metabolism and transcriptional regulation. We demonstrate how TIGER automates the coupling of a genome-scale metabolic model with GPR logic and models of transcriptional regulation, thereby serving as a platform for algorithm development and large-scale metabolic analysis. Additionally, we demonstrate how TIGER's algorithms can be used to identify inconsistencies and improve existing models of transcriptional regulation with examples from the reconstructed transcriptional regulatory network of Saccharomyces cerevisiae. Conclusion The TIGER package provides a consistent platform for algorithm development and extending existing genome-scale metabolic models with regulatory networks and high-throughput data.

  7. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    Directory of Open Access Journals (Sweden)

    Paola Miyazato

    2016-06-01

    Full Text Available Human T-cell leukemia virus type 1 (HTLV-1 is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP. As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic.

  8. Transcription-factor-dependent enhancer transcription defines a gene regulatory network for cardiac rhythm

    NARCIS (Netherlands)

    Yang, Xinan H; Nadadur, Rangarajan D; Hilvering, Catharina Re; Bianchi, Valerio; Werner, Michael; Mazurek, Stefan R; Gadek, Margaret; Shen, Kaitlyn M; Goldman, Joseph Aaron; Tyan, Leonid; Bekeny, Jenna; Hall, Johnathan M; Lee, Nutishia; Perez-Cervantes, Carlos; Burnicka-Turek, Ozanna; Poss, Kenneth D; Weber, Christopher R; de Laat, Wouter; Ruthenburg, Alexander J; Moskowitz, Ivan P

    2017-01-01

    The noncoding genome is pervasively transcribed. Noncoding RNAs (ncRNAs) generated from enhancers have been proposed as a general facet of enhancer function and some have been shown to be required for enhancer activity. Here we examine the transcription-factor-(TF)-dependence of ncRNA expression to

  9. Transcriptional responses of Treponema denticola to other oral bacterial species.

    Directory of Open Access Journals (Sweden)

    Juni Sarkar

    presented here provide an in-depth understanding of the transcriptional responses triggered by contact-dependent interactions between microorganisms inhabiting the periodontal pocket.

  10. Metabolic network topology reveals transcriptional regulatory signatures of type 2 diabetes.

    Science.gov (United States)

    Zelezniak, Aleksej; Pers, Tune H; Soares, Simão; Patti, Mary Elizabeth; Patil, Kiran Raosaheb

    2010-04-01

    Type 2 diabetes mellitus (T2DM) is a disorder characterized by both insulin resistance and impaired insulin secretion. Recent transcriptomics studies related to T2DM have revealed changes in expression of a large number of metabolic genes in a variety of tissues. Identification of the molecular mechanisms underlying these transcriptional changes and their impact on the cellular metabolic phenotype is a challenging task due to the complexity of transcriptional regulation and the highly interconnected nature of the metabolic network. In this study we integrate skeletal muscle gene expression datasets with human metabolic network reconstructions to identify key metabolic regulatory features of T2DM. These features include reporter metabolites--metabolites with significant collective transcriptional response in the associated enzyme-coding genes, and transcription factors with significant enrichment of binding sites in the promoter regions of these genes. In addition to metabolites from TCA cycle, oxidative phosphorylation, and lipid metabolism (known to be associated with T2DM), we identified several reporter metabolites representing novel biomarker candidates. For example, the highly connected metabolites NAD+/NADH and ATP/ADP were also identified as reporter metabolites that are potentially contributing to the widespread gene expression changes observed in T2DM. An algorithm based on the analysis of the promoter regions of the genes associated with reporter metabolites revealed a transcription factor regulatory network connecting several parts of metabolism. The identified transcription factors include members of the CREB, NRF1 and PPAR family, among others, and represent regulatory targets for further experimental analysis. Overall, our results provide a holistic picture of key metabolic and regulatory nodes potentially involved in the pathogenesis of T2DM.

  11. A new regulatory mechanism for bacterial lipoic acid synthesis

    OpenAIRE

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60?years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physi...

  12. Nature of bacterial colonization influences transcription of mucin genes in mice during the first week of life

    Directory of Open Access Journals (Sweden)

    Bergström Anders

    2012-08-01

    Full Text Available Abstract Background Postnatal regulation of the small intestinal mucus layer is potentially important in the development of adult gut functionality. We hypothesized that the nature of bacterial colonization affects mucus gene regulation in early life. We thus analyzed the influence of the presence of a conventional microbiota as well as two selected monocolonizing bacterial strains on the transcription of murine genes involved in mucus layer development during the first week of life. Mouse pups (N = 8/group from differently colonized dams: Germ-free (GF, conventional specific pathogen free (SPF, monocolonized with either Lactobacillus acidophilus NCFM (Lb or Escherichia coli Nissle (Ec were analyzed by qPCR on isolated ileal tissue sections from postnatal days 1 and 6 (PND1, PND6 after birth with respect to: (i transcription of specific genes involved in mucus production (Muc1-4, Tff3 and (ii amounts of 16S rRNA of Lactobacillus and E. coli. Quantification of 16S rRNA genes was performed to obtain a measure for amounts of colonized bacteria. Results We found a microbiota-independent transcriptional increase of all five mucus genes from PND1 to PND6. Furthermore, the relative level of transcription of certain mucus genes on PND1 was increased by the presence of bacteria. This was observed for Tff3 in the SPF, Ec, and Lb groups; for Muc2 in SPF; and for Muc3 and Muc4 in Ec and Lb, respectively. Detection of bacterial 16S rRNA genes levels above the qPCR detection level occurred only on PND6 and only for some of the colonized animals. On PND6, we found significantly lower levels of Muc1, Muc2 and Muc4 gene transcription for Lb animals with detectable Lactobacillus levels as compared to animals with Lactobacillus levels below the detection limit. Conclusions In summary, our data show that development of the expression of genes encoding secreted (Muc2/Tff3 and membrane-bound (Muc1/Muc3/Muc4 mucus regulatory proteins, respectively, is distinct and

  13. Using network component analysis to dissect regulatory networks mediated by transcription factors in yeast.

    Directory of Open Access Journals (Sweden)

    Chun Ye

    2009-03-01

    Full Text Available Understanding the relationship between genetic variation and gene expression is a central question in genetics. With the availability of data from high-throughput technologies such as ChIP-Chip, expression, and genotyping arrays, we can begin to not only identify associations but to understand how genetic variations perturb the underlying transcription regulatory networks to induce differential gene expression. In this study, we describe a simple model of transcription regulation where the expression of a gene is completely characterized by two properties: the concentrations and promoter affinities of active transcription factors. We devise a method that extends Network Component Analysis (NCA to determine how genetic variations in the form of single nucleotide polymorphisms (SNPs perturb these two properties. Applying our method to a segregating population of Saccharomyces cerevisiae, we found statistically significant examples of trans-acting SNPs located in regulatory hotspots that perturb transcription factor concentrations and affinities for target promoters to cause global differential expression and cis-acting genetic variations that perturb the promoter affinities of transcription factors on a single gene to cause local differential expression. Although many genetic variations linked to gene expressions have been identified, it is not clear how they perturb the underlying regulatory networks that govern gene expression. Our work begins to fill this void by showing that many genetic variations affect the concentrations of active transcription factors in a cell and their affinities for target promoters. Understanding the effects of these perturbations can help us to paint a more complete picture of the complex landscape of transcription regulation. The software package implementing the algorithms discussed in this work is available as a MATLAB package upon request.

  14. The dynamic nature and territory of transcriptional machinery in the bacterial chromosome

    Directory of Open Access Journals (Sweden)

    Ding Jun Jin

    2015-05-01

    Full Text Available Our knowledge of the regulation of genes involved in bacterial growth and stress responses is extensive; however, we have only recently begun to understand how environmental cues influence the dynamic, three-dimensional distribution of RNA polymerase (RNAP in Escherichia coli on the level of single cell, using wide-field fluorescence microscopy and state-of-the-art imaging techniques. Live-cell imaging using either an agarose-embedding procedure or a microfluidic system further underscores the dynamic nature of the distribution of RNAP in response to changes in the environment. A general agreement between live-cell and fixed-cell images has validated the formaldehyde-fixing procedure, which is a technical breakthrough in the study of the cell biology of RNAP. In this review we use a systems biology perspective to summarize the advances in the cell biology of RNAP in E. coli, including the discoveries of the bacterial nucleolus, the spatial compartmentalization of the transcription machinery at the periphery of the nucleoid, and the segregation of the chromosome territories for the two major cellular functions of transcription and replication in fast-growing cells. Our understanding of the coupling of transcription and bacterial chromosome (or nucleoid structure is also summarized. Using E. coli as a simple model system, co-imaging of RNAP with DNA and other factors during growth and stress responses will continue to be a useful tool for studying bacterial growth and adaptation in changing environment.

  15. DMPD: Type I interferon [corrected] gene induction by the interferon regulatory factorfamily of transcription factors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16979567 Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...ng) (.svg) (.html) (.csml) Show Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...orrected] gene induction by the interferon regulatory factorfamily of transcription factors. Authors Honda K

  16. Aggregation of topological motifs in the Escherichia coli transcriptional regulatory network

    Directory of Open Access Journals (Sweden)

    Barabási Albert-László

    2004-01-01

    Full Text Available Abstract Background Transcriptional regulation of cellular functions is carried out through a complex network of interactions among transcription factors and the promoter regions of genes and operons regulated by them.To better understand the system-level function of such networks simplification of their architecture was previously achieved by identifying the motifs present in the network, which are small, overrepresented, topologically distinct regulatory interaction patterns (subgraphs. However, the interaction of such motifs with each other, and their form of integration into the full network has not been previously examined. Results By studying the transcriptional regulatory network of the bacterium, Escherichia coli, we demonstrate that the two previously identified motif types in the network (i.e., feed-forward loops and bi-fan motifs do not exist in isolation, but rather aggregate into homologous motif clusters that largely overlap with known biological functions. Moreover, these clusters further coalesce into a supercluster, thus establishing distinct topological hierarchies that show global statistical properties similar to the whole network. Targeted removal of motif links disintegrates the network into small, isolated clusters, while random disruptions of equal number of links do not cause such an effect. Conclusion Individual motifs aggregate into homologous motif clusters and a supercluster forming the backbone of the E. coli transcriptional regulatory network and play a central role in defining its global topological organization.

  17. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  18. Regulatory elements and transcriptional control of chickenvasahomologue (CVH) promoter in chicken primordial germ cells.

    Science.gov (United States)

    Jin, So Dam; Lee, Bo Ram; Hwang, Young Sun; Lee, Hong Jo; Rim, Jong Seop; Han, Jae Yong

    2017-01-01

    Primordial germ cells (PGCs), the precursors of functional gametes, have distinct characteristics and exhibit several unique molecular mechanisms to maintain pluripotency and germness in comparison to somatic cells. They express germ cell-specific RNA binding proteins (RBPs) by modulating tissue-specific cis - and trans -regulatory elements. Studies on gene structures of chicken vasa homologue ( CVH ), a chicken RNA binding protein, involved in temporal and spatial regulation are thus important not only for understanding the molecular mechanisms that regulate germ cell fate, but also for practical applications of primordial germ cells. However, very limited studies are available on regulatory elements that control germ cell-specific expression in chicken. Therefore, we investigated the intricate regulatory mechanism(s) that governs transcriptional control of CVH . We constructed green fluorescence protein (GFP) or luciferase reporter vectors containing the various 5' flanking regions of CVH gene. From the 5' deletion and fragmented assays in chicken PGCs, we have identified a CVH promoter that locates at -316 to +275 base pair fragment with the highest luciferase activity. Additionally, we confirmed for the first time that the 5' untranslated region (UTR) containing intron 1 is required for promoter activity of the CVH gene in chicken PGCs. Furthermore, using a transcription factor binding prediction, transcriptome analysis and siRNA-mediated knockdown, we have identified that a set of transcription factors play a role in the PGC-specific CVH gene expression. These results demonstrate that cis -elements and transcription factors localizing in the 5' flanking region including the 5' UTR and an intron are important for transcriptional regulation of the CVH gene in chicken PGCs. Finally, this information will contribute to research studies in areas of reproductive biology, constructing of germ cell-specific synthetic promoter for tracing primordial germ cells as well

  19. Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors.

    Science.gov (United States)

    Motohashi, Hozumi; O'Connor, Tania; Katsuoka, Fumiki; Engel, James Douglas; Yamamoto, Masayuki

    2002-07-10

    Recent progress in the analysis of transcriptional regulation has revealed the presence of an exquisite functional network comprising the Maf and Cap 'n' collar (CNC) families of regulatory proteins, many of which have been isolated. Among Maf factors, large Maf proteins are important in the regulation of embryonic development and cell differentiation, whereas small Maf proteins serve as obligatory heterodimeric partner molecules for members of the CNC family. Both Maf homodimers and CNC-small Maf heterodimers bind to the Maf recognition element (MARE). Since the MARE contains a consensus TRE sequence recognized by AP-1, Jun and Fos family members may act to compete or interfere with the function of CNC-small Maf heterodimers. Overall then, the quantitative balance of transcription factors interacting with the MARE determines its transcriptional activity. Many putative MARE-dependent target genes such as those induced by antioxidants and oxidative stress are under concerted regulation by the CNC family member Nrf2, as clearly proven by mouse germline mutagenesis. Since these genes represent a vital aspect of the cellular defense mechanism against oxidative stress, Nrf2-null mutant mice are highly sensitive to xenobiotic and oxidative insults. Deciphering the molecular basis of the regulatory network composed of Maf and CNC families of transcription factors will undoubtedly lead to a new paradigm for the cooperative function of transcription factors.

  20. Allelic polymorphisms in the transcriptional regulatory region of apolipoprotein E gene.

    Science.gov (United States)

    Artiga, M J; Bullido, M J; Sastre, I; Recuero, M; García, M A; Aldudo, J; Vázquez, J; Valdivieso, F

    1998-01-09

    In this work, we explored the existence of genetic variants within the apolipoprotein E gene transcriptional regulatory region, using a denaturing gradient gel electrophoresis screening of a region comprising nucleotides -1017 to +406. Upon a population study, three new polymorphic sites (-491, -427 and -219) and two mutations were found. Functional effects of the polymorphisms, assayed by transient transfection and electrophoretic mobility shift assays in a human hepatoma cell line, showed that polymorphisms at sites -491 and -219 of the APOE promoter produce variations in the transcriptional activity of the gene, most probably through differential binding of nuclear proteins.

  1. Prediction of transcriptional regulatory sites in the complete genome sequence of Escherichia coli K-12.

    Science.gov (United States)

    Thieffry, D; Salgado, H; Huerta, A M; Collado-Vides, J

    1998-06-01

    As one of the best-characterized free-living organisms, Escherichia coli and its recently completed genomic sequence offer a special opportunity to exploit systematically the variety of regulatory data available in the literature in order to make a comprehensive set of regulatory predictions in the whole genome. The complete genome sequence of E.coli was analyzed for the binding of transcriptional regulators upstream of coding sequences. The biological information contained in RegulonDB (Huerta, A.M. et al., Nucleic Acids Res.,26,55-60, 1998) for 56 different transcriptional proteins was the support to implement a stringent strategy combining string search and weight matrices. We estimate that our search included representatives of 15-25% of the total number of regulatory binding proteins in E.coli. This search was performed on the set of 4288 putative regulatory regions, each 450 bp long. Within the regions with predicted sites, 89% are regulated by one protein and 81% involve only one site. These numbers are reasonably consistent with the distribution of experimental regulatory sites. Regulatory sites are found in 603 regions corresponding to 16% of operon regions and 10% of intra-operonic regions. Additional evidence gives stronger support to some of these predictions, including the position of the site, biological consistency with the function of the downstream gene, as well as genetic evidence for the regulatory interaction. The predictions described here were incorporated into the map presented in the paper describing the complete E.coli genome (Blattner,F.R. et al., Science, 277, 1453-1461, 1997). The complete set of predictions in GenBank format is available at the url: http://www. cifn.unam.mx/Computational_Biology/E.coli-predictions ecoli-reg@cifn.unam.mx, collado@cifn.unam.mx

  2. Effector Regulatory T Cell Differentiation and Immune Homeostasis Depend on the Transcription Factor Myb.

    Science.gov (United States)

    Dias, Sheila; D'Amico, Angela; Cretney, Erika; Liao, Yang; Tellier, Julie; Bruggeman, Christine; Almeida, Francisca F; Leahy, Jamie; Belz, Gabrielle T; Smyth, Gordon K; Shi, Wei; Nutt, Stephen L

    2017-01-17

    FoxP3-expressing regulatory T (Treg) cells are essential for maintaining immune homeostasis. Activated Treg cells undergo further differentiation into an effector state that highly expresses genes critical for Treg cell function, although how this process is coordinated on a transcriptional level is poorly understood. Here, we demonstrate that mice lacking the transcription factor Myb in Treg cells succumbed to a multi-organ inflammatory disease. Myb was specifically expressed in, and required for the differentiation of, thymus-derived effector Treg cells. The combination of transcriptome and genomic footprint analyses revealed that Myb directly regulated a large proportion of the gene expression specific to effector Treg cells, identifying Myb as a critical component of the gene regulatory network controlling effector Treg cell differentiation and function. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Architecture of transcriptional regulatory circuits is knitted over the topology of bio-molecular interaction networks

    DEFF Research Database (Denmark)

    Soberano de Oliveira, Ana Paula; Patil, Kiran Raosaheb; Nielsen, Jens

    2008-01-01

    is to use the topology of bio-molecular interaction networks in order to constrain the solution space. Such approaches systematically integrate the existing biological knowledge with the 'omics' data. Results: Here we introduce a hypothesis-driven method that integrates bio-molecular network topology...... with transcriptome data, thereby allowing the identification of key biological features (Reporter Features) around which transcriptional changes are significantly concentrated. We have combined transcriptome data with different biological networks in order to identify Reporter Gene Ontologies, Reporter Transcription...... Factors, Reporter Proteins and Reporter Complexes, and use this to decipher the logic of regulatory circuits playing a key role in yeast glucose repression and human diabetes. Conclusion: Reporter Features offer the opportunity to identify regulatory hot-spots in bio-molecular interaction networks...

  4. Methods of MicroRNA Promoter Prediction and Transcription Factor Mediated Regulatory Network.

    Science.gov (United States)

    Zhao, Yuming; Wang, Fang; Chen, Su; Wan, Jun; Wang, Guohua

    2017-01-01

    MicroRNAs (miRNAs) are short (~22 nucleotides) noncoding RNAs and disseminated throughout the genome, either in the intergenic regions or in the intronic sequences of protein-coding genes. MiRNAs have been proved to play important roles in regulating gene expression. Hence, understanding the transcriptional mechanism of miRNA genes is a very critical step to uncover the whole regulatory network. A number of miRNA promoter prediction models have been proposed in the past decade. This review summarized several most popular miRNA promoter prediction models which used genome sequence features, or other features, for example, histone markers, RNA Pol II binding sites, and nucleosome-free regions, achieved by high-throughput sequencing data. Some databases were described as resources for miRNA promoter information. We then performed comprehensive discussion on prediction and identification of transcription factor mediated microRNA regulatory networks.

  5. Riboswitches: discovery of drugs that target bacterial gene-regulatory RNAs

    Science.gov (United States)

    Deigan, Katherine E.; Ferré-D’Amaré, Adrian R.

    2011-01-01

    Conspectus Riboswitches, which were discovered in the first years of the XXI century, are gene-regulatory mRNA domains that respond to the intracellular concentration of a variety of metabolites and second messengers. They control essential genes in many pathogenic bacteria, and represent a new class of biomolecular target for the development of antibiotics and chemical-biological tools. Five mechanisms of gene regulation are known for riboswitches. Most bacterial riboswitches modulate transcription termination or translation initiation in response to ligand binding. All known examples of eukaryotic riboswitches and some bacterial riboswitches control gene expression by alternative splicing. The glmS riboswitch, widespread in Gram-positive bacteria, is a catalytic RNA activated by ligand binding. Its self-cleavage destabilizes the mRNA of which it is part. Finally, one example of trans-acting riboswitch is known. Three-dimensional (3D) structures have been determined of representatives of thirteen structurally distinct riboswitch classes, providing atomic-level insight into their mechanisms of ligand recognition. While cellular and viral RNAs in general have attracted interest as potential drug targets, riboswitches show special promise due to the diversity and sophistication of small molecule recognition strategies on display in their ligand binding pockets. Moreover, uniquely among known structured RNA domains, riboswitches evolved to recognize small molecule ligands. Structural and biochemical advances in the study of riboswitches provide an impetus for the development of methods for the discovery of novel riboswitch activators and inhibitors. Recent rational drug design efforts focused on select riboswitch classes have yielded a small number of candidate antibiotic compounds, including one active in a mouse model of Staphylococcus aureus infection. The development of high-throughput methods suitable for riboswitch-specific drug discovery is ongoing. A fragment

  6. Mapping and Dynamics of Regulatory DNA and Transcription Factor Networks in A. thaliana

    Directory of Open Access Journals (Sweden)

    Alessandra M. Sullivan

    2014-09-01

    Full Text Available Our understanding of gene regulation in plants is constrained by our limited knowledge of plant cis-regulatory DNA and its dynamics. We mapped DNase I hypersensitive sites (DHSs in A. thaliana seedlings and used genomic footprinting to delineate ∼700,000 sites of in vivo transcription factor (TF occupancy at nucleotide resolution. We show that variation associated with 72 diverse quantitative phenotypes localizes within DHSs. TF footprints encode an extensive cis-regulatory lexicon subject to recent evolutionary pressures, and widespread TF binding within exons may have shaped codon usage patterns. The architecture of A. thaliana TF regulatory networks is strikingly similar to that of animals in spite of diverged regulatory repertoires. We analyzed regulatory landscape dynamics during heat shock and photomorphogenesis, disclosing thousands of environmentally sensitive elements and enabling mapping of key TF regulatory circuits underlying these fundamental responses. Our results provide an extensive resource for the study of A. thaliana gene regulation and functional biology.

  7. Inference of Transcription Regulatory Network in Low Phytic Acid Soybean Seeds

    Directory of Open Access Journals (Sweden)

    Neelam Redekar

    2017-11-01

    Full Text Available A dominant loss of function mutation in myo-inositol phosphate synthase (MIPS gene and recessive loss of function mutations in two multidrug resistant protein type-ABC transporter genes not only reduce the seed phytic acid levels in soybean, but also affect the pathways associated with seed development, ultimately resulting in low emergence. To understand the regulatory mechanisms and identify key genes that intervene in the seed development process in low phytic acid crops, we performed computational inference of gene regulatory networks in low and normal phytic acid soybeans using a time course transcriptomic data and multiple network inference algorithms. We identified a set of putative candidate transcription factors and their regulatory interactions with genes that have functions in myo-inositol biosynthesis, auxin-ABA signaling, and seed dormancy. We evaluated the performance of our unsupervised network inference method by comparing the predicted regulatory network with published regulatory interactions in Arabidopsis. Some contrasting regulatory interactions were observed in low phytic acid mutants compared to non-mutant lines. These findings provide important hypotheses on expression regulation of myo-inositol metabolism and phytohormone signaling in developing low phytic acid soybeans. The computational pipeline used for unsupervised network learning in this study is provided as open source software and is freely available at https://lilabatvt.github.io/LPANetwork/.

  8. Information processing in the transcriptional regulatory network of yeast: Functional robustness

    Directory of Open Access Journals (Sweden)

    Dehmer Matthias

    2009-03-01

    Full Text Available Abstract Background Gene networks are considered to represent various aspects of molecular biological systems meaningfully because they naturally provide a systems perspective of molecular interactions. In this respect, the functional understanding of the transcriptional regulatory network is considered as key to elucidate the functional organization of an organism. Results In this paper we study the functional robustness of the transcriptional regulatory network of S. cerevisiae. We model the information processing in the network as a first order Markov chain and study the influence of single gene perturbations on the global, asymptotic communication among genes. Modification in the communication is measured by an information theoretic measure allowing to predict genes that are 'fragile' with respect to single gene knockouts. Our results demonstrate that the predicted set of fragile genes contains a statistically significant enrichment of so called essential genes that are experimentally found to be necessary to ensure vital yeast. Further, a structural analysis of the transcriptional regulatory network reveals that there are significant differences between fragile genes, hub genes and genes with a high betweenness centrality value. Conclusion Our study does not only demonstrate that a combination of graph theoretical, information theoretical and statistical methods leads to meaningful biological results but also that such methods allow to study information processing in gene networks instead of just their structural properties.

  9. SAGA: a hybrid search algorithm for Bayesian Network structure learning of transcriptional regulatory networks.

    Science.gov (United States)

    Adabor, Emmanuel S; Acquaah-Mensah, George K; Oduro, Francis T

    2015-02-01

    Bayesian Networks have been used for the inference of transcriptional regulatory relationships among genes, and are valuable for obtaining biological insights. However, finding optimal Bayesian Network (BN) is NP-hard. Thus, heuristic approaches have sought to effectively solve this problem. In this work, we develop a hybrid search method combining Simulated Annealing with a Greedy Algorithm (SAGA). SAGA explores most of the search space by undergoing a two-phase search: first with a Simulated Annealing search and then with a Greedy search. Three sets of background-corrected and normalized microarray datasets were used to test the algorithm. BN structure learning was also conducted using the datasets, and other established search methods as implemented in BANJO (Bayesian Network Inference with Java Objects). The Bayesian Dirichlet Equivalence (BDe) metric was used to score the networks produced with SAGA. SAGA predicted transcriptional regulatory relationships among genes in networks that evaluated to higher BDe scores with high sensitivities and specificities. Thus, the proposed method competes well with existing search algorithms for Bayesian Network structure learning of transcriptional regulatory networks. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Identification of active transcriptional regulatory elements from GRO-seq data.

    Science.gov (United States)

    Danko, Charles G; Hyland, Stephanie L; Core, Leighton J; Martins, Andre L; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G; Kraus, W Lee; Lis, John T; Siepel, Adam

    2015-05-01

    Modifications to the global run-on and sequencing (GRO-seq) protocol that enrich for 5'-capped RNAs can be used to reveal active transcriptional regulatory elements (TREs) with high accuracy. Here, we introduce discriminative regulatory-element detection from GRO-seq (dREG), a sensitive machine learning method that uses support vector regression to identify active TREs from GRO-seq data without requiring cap-based enrichment (https://github.com/Danko-Lab/dREG/). This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Predicted TREs are more enriched for several marks of transcriptional activation—including expression quantitative trait loci, disease-associated polymorphisms, acetylated histone 3 lysine 27 (H3K27ac) and transcription factor binding—than those identified by alternative functional assays. Using dREG, we surveyed TREs in eight human cell types and provide new insights into global patterns of TRE function.

  11. Functional organization of an Mbp enhancer exposes striking transcriptional regulatory diversity within myelinating glia

    DEFF Research Database (Denmark)

    Dionne, Nancy; Dib, Samar; Finsen, Bente

    2016-01-01

    In mammals, large caliber axons are ensheathed by myelin, a glial specialization supporting axon integrity and conferring accelerated and energy-efficient action potential conduction. Myelin basic protein (MBP) is required for normal myelin elaboration with maximal mbp transcription...... regulatory element combinations were found to drive expression in oligodendrocytes and Schwann cells with a minimal 129 bp sequence conferring expression in oligodendrocytes throughout myelin elaboration, maintenance and repair. Unexpectedly, M3 derivatives conferred markedly different spatial and temporal...... expression programs thus illuminating striking transcriptional heterogeneity within post-mitotic oligodendrocytes. Finally, one M3 derivative engaged only during primary myelination, not during adult remyelination, demonstrating that transcriptional regulation in the two states is not equivalent. GLIA 2015....

  12. Predictive regulatory models in Drosophila melanogaster by integrative inference of transcriptional networks.

    Science.gov (United States)

    Marbach, Daniel; Roy, Sushmita; Ay, Ferhat; Meyer, Patrick E; Candeias, Rogerio; Kahveci, Tamer; Bristow, Christopher A; Kellis, Manolis

    2012-07-01

    Gaining insights on gene regulation from large-scale functional data sets is a grand challenge in systems biology. In this article, we develop and apply methods for transcriptional regulatory network inference from diverse functional genomics data sets and demonstrate their value for gene function and gene expression prediction. We formulate the network inference problem in a machine-learning framework and use both supervised and unsupervised methods to predict regulatory edges by integrating transcription factor (TF) binding, evolutionarily conserved sequence motifs, gene expression, and chromatin modification data sets as input features. Applying these methods to Drosophila melanogaster, we predict ∼300,000 regulatory edges in a network of ∼600 TFs and 12,000 target genes. We validate our predictions using known regulatory interactions, gene functional annotations, tissue-specific expression, protein-protein interactions, and three-dimensional maps of chromosome conformation. We use the inferred network to identify putative functions for hundreds of previously uncharacterized genes, including many in nervous system development, which are independently confirmed based on their tissue-specific expression patterns. Last, we use the regulatory network to predict target gene expression levels as a function of TF expression, and find significantly higher predictive power for integrative networks than for motif or ChIP-based networks. Our work reveals the complementarity between physical evidence of regulatory interactions (TF binding, motif conservation) and functional evidence (coordinated expression or chromatin patterns) and demonstrates the power of data integration for network inference and studies of gene regulation at the systems level.

  13. Predictive regulatory models in Drosophila melanogaster by integrative inference of transcriptional networks

    Science.gov (United States)

    Marbach, Daniel; Roy, Sushmita; Ay, Ferhat; Meyer, Patrick E.; Candeias, Rogerio; Kahveci, Tamer; Bristow, Christopher A.; Kellis, Manolis

    2012-01-01

    Gaining insights on gene regulation from large-scale functional data sets is a grand challenge in systems biology. In this article, we develop and apply methods for transcriptional regulatory network inference from diverse functional genomics data sets and demonstrate their value for gene function and gene expression prediction. We formulate the network inference problem in a machine-learning framework and use both supervised and unsupervised methods to predict regulatory edges by integrating transcription factor (TF) binding, evolutionarily conserved sequence motifs, gene expression, and chromatin modification data sets as input features. Applying these methods to Drosophila melanogaster, we predict ∼300,000 regulatory edges in a network of ∼600 TFs and 12,000 target genes. We validate our predictions using known regulatory interactions, gene functional annotations, tissue-specific expression, protein–protein interactions, and three-dimensional maps of chromosome conformation. We use the inferred network to identify putative functions for hundreds of previously uncharacterized genes, including many in nervous system development, which are independently confirmed based on their tissue-specific expression patterns. Last, we use the regulatory network to predict target gene expression levels as a function of TF expression, and find significantly higher predictive power for integrative networks than for motif or ChIP-based networks. Our work reveals the complementarity between physical evidence of regulatory interactions (TF binding, motif conservation) and functional evidence (coordinated expression or chromatin patterns) and demonstrates the power of data integration for network inference and studies of gene regulation at the systems level. PMID:22456606

  14. SINCERITIES: Inferring gene regulatory networks from time-stamped single cell transcriptional expression profiles.

    Science.gov (United States)

    Papili Gao, Nan; Ud-Dean, S M Minhaz; Gandrillon, Olivier; Gunawan, Rudiyanto

    2017-09-14

    Single cell transcriptional profiling opens up a new avenue in studying the functional role of cell-to-cell variability in physiological processes. The analysis of single cell expression profiles creates new challenges due to the distributive nature of the data and the stochastic dynamics of gene transcription process. The reconstruction of gene regulatory networks (GRNs) using single cell transcriptional profiles is particularly challenging, especially when directed gene-gene relationships are desired. We developed SINCERITIES (SINgle CEll Regularized Inference using TIme-stamped Expression profileS) for the inference of GRNs from single cell transcriptional profiles. We focused on time-stamped cross-sectional expression data, commonly generated from transcriptional profiling of single cells collected at multiple time points after cell stimulation. SINCERITIES recovers directed regulatory relationships among genes by employing regularized linear regression (ridge regression), using temporal changes in the distributions of gene expressions. Meanwhile, the modes of the gene regulations (activation and repression) come from partial correlation analyses between pairs of genes. We demonstrated the efficacy of SINCERITIES in inferring GRNs using in silico time-stamped single cell expression data and single cell transcriptional profiles of THP-1 monocytic human leukemia cells. The case studies showed that SINCERITIES could provide accurate GRN predictions, significantly better than other GRN inference algorithms such as TSNI, GENIE3 and JUMP3. Moreover, SINCERITIES has a low computational complexity and is amenable to problems of extremely large dimensionality. Finally, an application of SINCERITIES to single cell expression data of T2EC chicken erythrocytes pointed to BATF as a candidate novel regulator of erythroid development. The MATLAB and R version of SINCERITIES is freely available from the following websites: http://www.cabsel.ethz.ch/tools/sincerities.html and

  15. Genome-wide prediction of transcriptional regulatory elements of human promoters using gene expression and promoter analysis data

    Directory of Open Access Journals (Sweden)

    Kim Seon-Young

    2006-07-01

    Full Text Available Abstract Background A complete understanding of the regulatory mechanisms of gene expression is the next important issue of genomics. Many bioinformaticians have developed methods and algorithms for predicting transcriptional regulatory mechanisms from sequence, gene expression, and binding data. However, most of these studies involved the use of yeast which has much simpler regulatory networks than human and has many genome wide binding data and gene expression data under diverse conditions. Studies of genome wide transcriptional networks of human genomes currently lag behind those of yeast. Results We report herein a new method that combines gene expression data analysis with promoter analysis to infer transcriptional regulatory elements of human genes. The Z scores from the application of gene set analysis with gene sets of transcription factor binding sites (TFBSs were successfully used to represent the activity of TFBSs in a given microarray data set. A significant correlation between the Z scores of gene sets of TFBSs and individual genes across multiple conditions permitted successful identification of many known human transcriptional regulatory elements of genes as well as the prediction of numerous putative TFBSs of many genes which will constitute a good starting point for further experiments. Using Z scores of gene sets of TFBSs produced better predictions than the use of mRNA levels of a transcription factor itself, suggesting that the Z scores of gene sets of TFBSs better represent diverse mechanisms for changing the activity of transcription factors in the cell. In addition, cis-regulatory modules, combinations of co-acting TFBSs, were readily identified by our analysis. Conclusion By a strategic combination of gene set level analysis of gene expression data sets and promoter analysis, we were able to identify and predict many transcriptional regulatory elements of human genes. We conclude that this approach will aid in decoding

  16. Comparative analysis of module-based versus direct methods for reverse-engineering transcriptional regulatory networks

    Directory of Open Access Journals (Sweden)

    Joshi Anagha

    2009-05-01

    Full Text Available Abstract Background A myriad of methods to reverse-engineer transcriptional regulatory networks have been developed in recent years. Direct methods directly reconstruct a network of pairwise regulatory interactions while module-based methods predict a set of regulators for modules of coexpressed genes treated as a single unit. To date, there has been no systematic comparison of the relative strengths and weaknesses of both types of methods. Results We have compared a recently developed module-based algorithm, LeMoNe (Learning Module Networks, to a mutual information based direct algorithm, CLR (Context Likelihood of Relatedness, using benchmark expression data and databases of known transcriptional regulatory interactions for Escherichia coli and Saccharomyces cerevisiae. A global comparison using recall versus precision curves hides the topologically distinct nature of the inferred networks and is not informative about the specific subtasks for which each method is most suited. Analysis of the degree distributions and a regulator specific comparison show that CLR is 'regulator-centric', making true predictions for a higher number of regulators, while LeMoNe is 'target-centric', recovering a higher number of known targets for fewer regulators, with limited overlap in the predicted interactions between both methods. Detailed biological examples in E. coli and S. cerevisiae are used to illustrate these differences and to prove that each method is able to infer parts of the network where the other fails. Biological validation of the inferred networks cautions against over-interpreting recall and precision values computed using incomplete reference networks. Conclusion Our results indicate that module-based and direct methods retrieve largely distinct parts of the underlying transcriptional regulatory networks. The choice of algorithm should therefore be based on the particular biological problem of interest and not on global metrics which cannot be

  17. Overview Article: Identifying transcriptional cis-regulatory modules in animal genomes

    Science.gov (United States)

    Suryamohan, Kushal; Halfon, Marc S.

    2014-01-01

    Gene expression is regulated through the activity of transcription factors and chromatin modifying proteins acting on specific DNA sequences, referred to as cis-regulatory elements. These include promoters, located at the transcription initiation sites of genes, and a variety of distal cis-regulatory modules (CRMs), the most common of which are transcriptional enhancers. Because regulated gene expression is fundamental to cell differentiation and acquisition of new cell fates, identifying, characterizing, and understanding the mechanisms of action of CRMs is critical for understanding development. CRM discovery has historically been challenging, as CRMs can be located far from the genes they regulate, have few readily-identifiable sequence characteristics, and for many years were not amenable to high-throughput discovery methods. However, the recent availability of complete genome sequences and the development of next-generation sequencing methods has led to an explosion of both computational and empirical methods for CRM discovery in model and non-model organisms alike. Experimentally, CRMs can be identified through chromatin immunoprecipitation directed against transcription factors or histone post-translational modifications, identification of nucleosome-depleted “open” chromatin regions, or sequencing-based high-throughput functional screening. Computational methods include comparative genomics, clustering of known or predicted transcription factor binding sites, and supervised machine-learning approaches trained on known CRMs. All of these methods have proven effective for CRM discovery, but each has its own considerations and limitations, and each is subject to a greater or lesser number of false-positive identifications. Experimental confirmation of predictions is essential, although shortcomings in current methods suggest that additional means of validation need to be developed. PMID:25704908

  18. Evolution of UCP1 Transcriptional Regulatory Elements Across the Mammalian Phylogeny

    Directory of Open Access Journals (Sweden)

    Michael J. Gaudry

    2017-09-01

    Full Text Available Uncoupling protein 1 (UCP1 permits non-shivering thermogenesis (NST when highly expressed in brown adipose tissue (BAT mitochondria. Exclusive to placental mammals, BAT has commonly been regarded to be advantageous for thermoregulation in hibernators, small-bodied species, and the neonates of larger species. While numerous regulatory control motifs associated with UCP1 transcription have been proposed for murid rodents, it remains unclear whether these are conserved across the eutherian mammal phylogeny and hence essential for UCP1 expression. To address this shortcoming, we conducted a broad comparative survey of putative UCP1 transcriptional regulatory elements in 139 mammals (135 eutherians. We find no evidence for presence of a UCP1 enhancer in monotremes and marsupials, supporting the hypothesis that this control region evolved in a stem eutherian ancestor. We additionally reveal that several putative promoter elements (e.g., CRE-4, CCAAT identified in murid rodents are not conserved among BAT-expressing eutherians, and together with the putative regulatory region (PRR and CpG island do not appear to be crucial for UCP1 expression. The specificity and importance of the upTRE, dnTRE, URE1, CRE-2, RARE-2, NBRE, BRE-1, and BRE-2 enhancer elements first described from rats and mice are moreover uncertain as these motifs differ substantially—but generally remain highly conserved—in other BAT-expressing eutherians. Other UCP1 enhancer motifs (CRE-3, PPRE, and RARE-3 as well as the TATA box are also highly conserved in nearly all eutherian lineages with an intact UCP1. While these transcriptional regulatory motifs are generally also maintained in species where this gene is pseudogenized, the loss or degeneration of key basal promoter (e.g., TATA box and enhancer elements in other UCP1-lacking lineages make it unlikely that the enhancer region is pleiotropic (i.e., co-regulates additional genes. Importantly, differential losses of (or mutations

  19. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms.

    Science.gov (United States)

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M

    2014-05-27

    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms.DOI: http://dx.doi.org/10.7554/eLife.02200.001. Copyright © 2014, Allen et al.

  20. Localizing potentially active post-transcriptional regulations in the Ewing's sarcoma gene regulatory network

    Directory of Open Access Journals (Sweden)

    Delyon Bernard

    2010-11-01

    Full Text Available Abstract Background A wide range of techniques is now available for analyzing regulatory networks. Nonetheless, most of these techniques fail to interpret large-scale transcriptional data at the post-translational level. Results We address the question of using large-scale transcriptomic observation of a system perturbation to analyze a regulatory network which contained several types of interactions - transcriptional and post-translational. Our method consisted of post-processing the outputs of an open-source tool named BioQuali - an automatic constraint-based analysis mimicking biologist's local reasoning on a large scale. The post-processing relied on differences in the behavior of the transcriptional and post-translational levels in the network. As a case study, we analyzed a network representation of the genes and proteins controlled by an oncogene in the context of Ewing's sarcoma. The analysis allowed us to pinpoint active interactions specific to this cancer. We also identified the parts of the network which were incomplete and should be submitted for further investigation. Conclusions The proposed approach is effective for the qualitative analysis of cancer networks. It allows the integrative use of experimental data of various types in order to identify the specific information that should be considered a priority in the initial - and possibly very large - experimental dataset. Iteratively, new dataset can be introduced into the analysis to improve the network representation and make it more specific.

  1. Differential roles of epigenetic changes and Foxp3 expression in regulatory T cell-specific transcriptional regulation

    NARCIS (Netherlands)

    Morikawa, Hiromasa; Ohkura, Naganari; Vandenbon, Alexis; Itoh, Masayoshi; Nagao-Sato, Sayaka; Kawaji, Hideya; Lassmann, Timo; Carninci, Piero; Hayashizaki, Yoshihide; Forrest, Alistair R. R.; Standley, Daron M.; Date, Hiroshi; Sakaguchi, Shimon; Rehli, Michael; Baillie, J. Kenneth; de Hoon, Michiel J. L.; Haberle, Vanja; Kulakovskiy, Ivan V.; Lizio, Marina; Andersson, Robin; Mungall, Christopher J.; Meehan, Terrence F.; Schmeier, Sebastian; Bertin, Nicolas; Jørgensen, Mette; Dimont, Emmanuel; Arner, Erik; Schmidl, Christian; Schaefer, Ulf; Medvedeva, Yulia A.; Plessy, Charles; Vitezic, Morana; Severin, Jessica; Semple, Colin A.; Ishizu, Yuri; Francescatto, Margherita; Alam, Intikhab; Albanese, Davide; Altschuler, Gabriel M.; Archer, John A. C.; Arner, Peter; Babina, Magda; Baker, Sarah; Balwierz, Piotr J.; Beckhouse, Anthony G.; Pradhan-Bhatt, Swati; Blake, Judith A.; Blumenthal, Antje; Bodega, Beatrice; Bonetti, Alessandro; Briggs, James; Brombacher, Frank; Burroughs, A. Maxwell; Califano, Andrea; Cannistraci, Carlo V.; Carbajo, Daniel; Chen, Yun; Chierici, Marco; Ciani, Yari; Clevers, Hans C.; Dalla, Emiliano; Davis, Carrie A.; Deplancke, Bart; Detmar, Michael; Diehl, Alexander D.; Dohi, Taeko; Drabløs, Finn; Edge, Albert S. B.; Edinger, Matthias; Ekwall, Karl; Endoh, Mitsuhiro; Enomoto, Hideki; Fagiolini, Michela; Fairbairn, Lynsey; Fang, Hai; Farach-Carson, Mary C.; Faulkner, Geoffrey J.; Favorov, Alexander V.; Fisher, Malcolm E.; Frith, Martin C.; Fujita, Rie; Fukuda, Shiro; Furlanello, Cesare; Furuno, Masaaki; Furusawa, Jun-ichi; Geijtenbeek, Teunis B.; Gibson, Andrew; Gingeras, Thomas; Goldowitz, Daniel; Gough, Julian; Guhl, Sven; Guler, Reto; Gustincich, Stefano; Ha, Thomas J.; Hamaguchi, Masahide; Hara, Mitsuko; Harbers, Matthias; Harshbarger, Jayson; Hasegawa, Akira; Hasegawa, Yuki; Hashimoto, Takehiro; Herlyn, Meenhard; Hitchens, Kelly J.; Ho Sui, Shannan J.; Hofmann, Oliver M.; Hoof, Ilka; Hori, Fumi; Huminiecki, Lukasz; Iida, Kei; Ikawa, Tomokatsu; Jankovic, Boris R.; Jia, Hui; Joshi, Anagha; Jurman, Giuseppe; Kaczkowski, Bogumil; Kai, Chieko; Kaida, Kaoru; Kaiho, Ai; Kajiyama, Kazuhiro; Kanamori-Katayama, Mutsumi; Kasianov, Artem S.; Kasukawa, Takeya; Katayama, Shintaro; Kato, Sachi; Kawaguchi, Shuji; Kawamoto, Hiroshi; Kawamura, Yuki I.; Kawashima, Tsugumi; Kempfle, Judith S.; Kenna, Tony J.; Kere, Juha; Khachigian, Levon M.; Kitamura, Toshio; Klinken, S. Peter; Knox, Alan J.; Kojima, Miki; Kojima, Soichi; Kondo, Naoto; Koseki, Haruhiko; Koyasu, Shigeo; Krampitz, Sarah; Kubosaki, Atsutaka; Kwon, Andrew T.; Laros, Jeroen F. J.; Lee, Weonju; Lennartsson, Andreas; Li, Kang; Lilje, Berit; Lipovich, Leonard; Mackay-sim, Alan; Manabe, Ri-ichiroh; Mar, Jessica C.; Marchand, Benoit; Mathelier, Anthony; Mejhert, Niklas; Meynert, Alison; Mizuno, Yosuke; Morais, David A. de Lima; Morimoto, Mitsuru; Moro, Kazuyo; Motakis, Efthymios; Motohashi, Hozumi; Mummery, Christine L.; Murata, Mitsuyoshi; Nakachi, Yutaka; Nakahara, Fumio; Nakamura, Toshiyuki; Nakamura, Yukio; Nakazato, Kenichi; van Nimwegen, Erik; Ninomiya, Noriko; Nishiyori, Hiromi; Noma, Shohei; Nozaki, Tadasuke; Ogishima, Soichi; Ohmiya, Hiroko; Ohno, Hiroshi; Ohshima, Mitsuhiro; Okada-Hatakeyama, Mariko; Okazaki, Yasushi; Orlando, Valerio; Ovchinnikov, Dmitry A.; Pain, Arnab; Passier, Robert; Patrikakis, Margaret; Persson, Helena; Piazza, Silvano; Prendergast, James G. D.; Rackham, Owen J. L.; Ramilowski, Jordan A.; Rashid, Mamoon; Ravasi, Timothy; Rizzu, Patrizia; Roncador, Marco; Roy, Sugata; Rye, Morten B.; Saijyo, Eri; Sajantila, Antti; Saka, Akiko; Sakai, Mizuho; Sato, Hiroki; Satoh, Hironori; Savvi, Suzana; Saxena, Alka; Schneider, Claudio; Schultes, Erik A.; Schulze-Tanzil, Gundula G.; Schwegmann, Anita; Sengstag, Thierry; Sheng, Guojun; Shimoji, Hisashi; Shimoni, Yishai; Shin, Jay W.; Simon, Christophe; Sugiyama, Daisuke; Sugiyama, Takaaki; Suzuki, Masanori; Swoboda, Rolf K.; 't Hoen, Peter A. C.; Tagami, Michihira; Takahashi, Naoko; Takai, Jun; Tanaka, Hiroshi; Tatsukawa, Hideki; Tatum, Zuotian; Thompson, Mark; Toyoda, Hiroo; Toyoda, Tetsuro; Valen, Eivind; van de Wetering, Marc; van den Berg, Linda M.; Verardo, Roberto; Vijayan, Dipti; Vorontsov, Ilya E.; Wasserman, Wyeth W.; Watanabe, Shoko; Wells, Christine A.; Winteringham, Louise N.; Wolvetang, Ernst; Wood, Emily J.; Yamaguchi, Yoko; Yamamoto, Masayuki; Yoneda, Misako; Yonekura, Yohei; Yoshida, Shigehiro; Zabierowski, Suzan E.; Zhang, Peter G.; Zhao, Xiaobei; Zucchelli, Silvia; Summers, Kim M.; Suzuki, Harukazu; Daub, Carsten O.; Kawai, Jun; Heutink, Peter; Hide, Winston; Freeman, Tom C.; Lenhard, Boris; Bajic, Vladimir B.; Taylor, Martin S.; Makeev, Vsevolod J.; Sandelin, Albin; Hume, David A.

    2014-01-01

    Naturally occurring regulatory T (Treg) cells, which specifically express the transcription factor forkhead box P3 (Foxp3), are engaged in the maintenance of immunological self-tolerance and homeostasis. By transcriptional start site cluster analysis, we assessed here how genome-wide patterns of DNA

  2. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  3. Methods of MicroRNA Promoter Prediction and Transcription Factor Mediated Regulatory Network

    OpenAIRE

    Zhao, Yuming; Wang, Fang; Chen, Su; Wan, Jun; Wang, Guohua

    2017-01-01

    MicroRNAs (miRNAs) are short (~22 nucleotides) noncoding RNAs and disseminated throughout the genome, either in the intergenic regions or in the intronic sequences of protein-coding genes. MiRNAs have been proved to play important roles in regulating gene expression. Hence, understanding the transcriptional mechanism of miRNA genes is a very critical step to uncover the whole regulatory network. A number of miRNA promoter prediction models have been proposed in the past decade. This review su...

  4. Core Transcriptional Regulatory Circuit Controlled by the TAL1 Complex in Human T Cell Acute Lymphoblastic Leukemia

    OpenAIRE

    Sanda, Takaomi; Lawton, Lee N.; Barrasa, M. Inmaculada; Fan, Zi Peng; Kohlhammer, Holger; Gutierrez, Alejandro; Ma, Wenxue; Tatarek, Jessica; Ahn, Yebin; Kelliher, Michelle A.; Jamieson, Catriona H.M.; Staudt, Louis M.; Young, Richard A.; Look, A. Thomas

    2012-01-01

    The oncogenic transcription factor TAL1/SCL is aberrantly expressed in over 40% of cases of human T-cell acute lymphoblastic leukemia (T-ALL), emphasizing its importance in the molecular pathogenesis of T-ALL. Here we identify the core transcriptional regulatory circuit controlled by TAL1 and its regulatory partners HEB, E2A, LMO1/2, GATA3 and RUNX1. We show that TAL1 forms a positive interconnected auto-regulatory loop with GATA3 and RUNX1, and that the TAL1 complex directly activates the MY...

  5. Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification

    Directory of Open Access Journals (Sweden)

    David H. Keating

    2014-08-01

    Full Text Available Efficient microbial conversion of lignocellulosic hydrolysates to biofuels is a key barrier to the economically viable deployment of lignocellulosic biofuels. A chief contributor to this barrier is the impact on microbial processes and energy metabolism of lignocellulose-derived inhibitors, including phenolic carboxylates, phenolic amides (for ammonia-pretreated biomass, phenolic aldehydes, and furfurals. To understand the bacterial pathways induced by inhibitors present in ammonia-pretreated biomass hydrolysates, which are less well studied than acid-pretreated biomass hydrolysates, we developed and exploited synthetic mimics of ammonia-pretreated corn stover hydrolysate (ACSH. To determine regulatory responses to the inhibitors normally present in ACSH, we measured transcript and protein levels in an Escherichia coli ethanologen using RNA-seq and quantitative proteomics during fermentation to ethanol of synthetic hydrolysates containing or lacking the inhibitors. Our study identified four major regulators mediating these responses, the MarA/SoxS/Rob network, AaeR, FrmR, and YqhC. Induction of these regulons was correlated with a reduced rate of ethanol production, buildup of pyruvate, depletion of ATP and NAD(PH, and an inhibition of xylose conversion. The aromatic aldehyde inhibitor 5-hydroxymethylfurfural appeared to be reduced to its alcohol form by the ethanologen during fermentation, whereas phenolic acid and amide inhibitors were not metabolized. Together, our findings establish that the major regulatory responses to lignocellulose-derived inhibitors are mediated by transcriptional rather than translational regulators, suggest that energy consumed for inhibitor efflux and detoxification may limit biofuel production, and identify a network of regulators for future synthetic biology efforts.

  6. Redefining the transcriptional regulatory dynamics of classically and alternatively activated macrophages by deepCAGE transcriptomics

    KAUST Repository

    Roy, S.

    2015-06-27

    Classically or alternatively activated macrophages (M1 and M2, respectively) play distinct and important roles for microbiocidal activity, regulation of inflammation and tissue homeostasis. Despite this, their transcriptional regulatory dynamics are poorly understood. Using promoter-level expression profiling by non-biased deepCAGE we have studied the transcriptional dynamics of classically and alternatively activated macrophages. Transcription factor (TF) binding motif activity analysis revealed four motifs, NFKB1_REL_RELA, IRF1,2, IRF7 and TBP that are commonly activated but have distinct activity dynamics in M1 and M2 activation. We observe matching changes in the expression profiles of the corresponding TFs and show that only a restricted set of TFs change expression. There is an overall drastic and transient up-regulation in M1 and a weaker and more sustainable up-regulation in M2. Novel TFs, such as Thap6, Maff, (M1) and Hivep1, Nfil3, Prdm1, (M2) among others, were suggested to be involved in the activation processes. Additionally, 52 (M1) and 67 (M2) novel differentially expressed genes and, for the first time, several differentially expressed long non-coding RNA (lncRNA) transcriptome markers were identified. In conclusion, the finding of novel motifs, TFs and protein-coding and lncRNA genes is an important step forward to fully understand the transcriptional machinery of macrophage activation.

  7. Transcriptional Regulatory Circuitries in the Human Pathogen Candida albicans Involving Sense–Antisense Interactions

    Science.gov (United States)

    Ahmad, Ausaf; Kravets, Anatoliy; Rustchenko, Elena

    2012-01-01

    Candida albicans, a major human fungal pathogen, usually contains a diploid genome, but controls adaptation to a toxic alternative carbon source L-sorbose, by the reversible loss of one chromosome 5 (Ch5). We have previously identified multiple unique regions on Ch5 that repress the growth on sorbose. In one of the regions, the CSU51 gene determining the repressive property of the region was identified. We report here the identification of the CSU53 gene from a different region on Ch5. Most importantly, we find that CSU51 and CSU53 are associated with novel regulatory elements, ASUs, which are embedded within CSUs in an antisense configuration. ASUs act opposite to CSUs by enhancing the growth on sorbose. In respect to the CSU transcripts, the ASU long antisense transcripts are in lesser amounts, are completely overlapped, and are inversely related. ASUs interact with CSUs in natural CSU/ASU cis configurations, as well as when extra copies of ASUs are placed in trans to the CSU/ASU configurations. We suggest that ASU long embedded antisense transcripts modulate CSU sense transcripts. PMID:22135347

  8. Transcriptional regulatory circuitries in the human pathogen Candida albicans involving sense--antisense interactions.

    Science.gov (United States)

    Ahmad, Ausaf; Kravets, Anatoliy; Rustchenko, Elena

    2012-02-01

    Candida albicans, a major human fungal pathogen, usually contains a diploid genome, but controls adaptation to a toxic alternative carbon source L-sorbose, by the reversible loss of one chromosome 5 (Ch5). We have previously identified multiple unique regions on Ch5 that repress the growth on sorbose. In one of the regions, the CSU51 gene determining the repressive property of the region was identified. We report here the identification of the CSU53 gene from a different region on Ch5. Most importantly, we find that CSU51 and CSU53 are associated with novel regulatory elements, ASUs, which are embedded within CSUs in an antisense configuration. ASUs act opposite to CSUs by enhancing the growth on sorbose. In respect to the CSU transcripts, the ASU long antisense transcripts are in lesser amounts, are completely overlapped, and are inversely related. ASUs interact with CSUs in natural CSU/ASU cis configurations, as well as when extra copies of ASUs are placed in trans to the CSU/ASU configurations. We suggest that ASU long embedded antisense transcripts modulate CSU sense transcripts.

  9. Nsite, NsiteH and NsiteM Computer Tools for Studying Tran-scription Regulatory Elements

    KAUST Repository

    Shahmuradov, Ilham

    2015-07-02

    Summary: Gene transcription is mostly conducted through interactions of various transcription factors and their binding sites on DNA (regulatory elements, REs). Today, we are still far from understanding the real regulatory content of promoter regions. Computer methods for identification of REs remain a widely used tool for studying and understanding transcriptional regulation mechanisms. The Nsite, NsiteH and NsiteM programs perform searches for statistically significant (non-random) motifs of known human, animal and plant one-box and composite REs in a single genomic sequence, in a pair of aligned homologous sequences and in a set of functionally related sequences, respectively.

  10. The cis-regulatory logic of the mammalian photoreceptor transcriptional network.

    Science.gov (United States)

    Hsiau, Timothy H-C; Diaconu, Claudiu; Myers, Connie A; Lee, Jongwoo; Cepko, Constance L; Corbo, Joseph C

    2007-07-25

    The photoreceptor cells of the retina are subject to a greater number of genetic diseases than any other cell type in the human body. The majority of more than 120 cloned human blindness genes are highly expressed in photoreceptors. In order to establish an integrative framework in which to understand these diseases, we have undertaken an experimental and computational analysis of the network controlled by the mammalian photoreceptor transcription factors, Crx, Nrl, and Nr2e3. Using microarray and in situ hybridization datasets we have produced a model of this network which contains over 600 genes, including numerous retinal disease loci as well as previously uncharacterized photoreceptor transcription factors. To elucidate the connectivity of this network, we devised a computational algorithm to identify the photoreceptor-specific cis-regulatory elements (CREs) mediating the interactions between these transcription factors and their target genes. In vivo validation of our computational predictions resulted in the discovery of 19 novel photoreceptor-specific CREs near retinal disease genes. Examination of these CREs permitted the definition of a simple cis-regulatory grammar rule associated with high-level expression. To test the generality of this rule, we used an expanded form of it as a selection filter to evolve photoreceptor CREs from random DNA sequences in silico. When fused to fluorescent reporters, these evolved CREs drove strong, photoreceptor-specific expression in vivo. This study represents the first systematic identification and in vivo validation of CREs in a mammalian neuronal cell type and lays the groundwork for a systems biology of photoreceptor transcriptional regulation.

  11. The cis-regulatory logic of the mammalian photoreceptor transcriptional network.

    Directory of Open Access Journals (Sweden)

    Timothy H-C Hsiau

    2007-07-01

    Full Text Available The photoreceptor cells of the retina are subject to a greater number of genetic diseases than any other cell type in the human body. The majority of more than 120 cloned human blindness genes are highly expressed in photoreceptors. In order to establish an integrative framework in which to understand these diseases, we have undertaken an experimental and computational analysis of the network controlled by the mammalian photoreceptor transcription factors, Crx, Nrl, and Nr2e3. Using microarray and in situ hybridization datasets we have produced a model of this network which contains over 600 genes, including numerous retinal disease loci as well as previously uncharacterized photoreceptor transcription factors. To elucidate the connectivity of this network, we devised a computational algorithm to identify the photoreceptor-specific cis-regulatory elements (CREs mediating the interactions between these transcription factors and their target genes. In vivo validation of our computational predictions resulted in the discovery of 19 novel photoreceptor-specific CREs near retinal disease genes. Examination of these CREs permitted the definition of a simple cis-regulatory grammar rule associated with high-level expression. To test the generality of this rule, we used an expanded form of it as a selection filter to evolve photoreceptor CREs from random DNA sequences in silico. When fused to fluorescent reporters, these evolved CREs drove strong, photoreceptor-specific expression in vivo. This study represents the first systematic identification and in vivo validation of CREs in a mammalian neuronal cell type and lays the groundwork for a systems biology of photoreceptor transcriptional regulation.

  12. Regulation of the CDP-choline pathway by sterol regulatory element binding proteins involves transcriptional and post-transcriptional mechanisms.

    Science.gov (United States)

    Ridgway, Neale D; Lagace, Thomas A

    2003-06-15

    The synthesis of phosphatidylcholine (PtdCho) by the CDP-choline pathway is under the control of the rate-limiting enzyme CTP:phosphocholine cytidylyltransferase (CCT). Sterol regulatory element binding proteins (SREBPs) have been proposed to regulate CCT at the transcriptional level, or via the synthesis of lipid activators or substrates of the CDP-choline pathway. To assess the contributions of these two mechanisms, we examined CCTalpha expression and PtdCho synthesis by the CDP-choline pathway in cholesterol and fatty acid auxotrophic CHO M19 cells inducibly expressing constitutively active nuclear forms of SREBP1a or SREBP2. Induction of either SREBP resulted in increased expression of mRNAs for sterol-regulated genes, elevated fatty acid and cholesterol synthesis (>10-50-fold) and increased PtdCho synthesis (2-fold). CCTalpha mRNA was increased 2-fold by enforced expression of SREBP1a or SREBP2. The resultant increase in CCTalpha protein and activity (2-fold) was restricted primarily to the soluble fraction of cells, and increased CCTalpha activity in vivo was not detected. Inhibition of the synthesis of fatty acids or their CoA esters by cerulenin or triacsin C respectively following SREBP induction effectively blocked the accompanying elevation in PtdCho synthesis. Thus PtdCho synthesis was driven by increased synthesis of fatty acids or a product thereof. These data show that transcriptional activation of CCTalpha is modest relative to that of other SREBP-regulated genes, and that stimulation of PtdCho synthesis by SREBPs in CHO cells is due primarily to increased fatty acid synthesis.

  13. Total Binding Affinity Profiles of Regulatory Regions Predict Transcription Factor Binding and Gene Expression in Human Cells.

    Directory of Open Access Journals (Sweden)

    Elena Grassi

    Full Text Available Transcription factors regulate gene expression by binding regulatory DNA. Understanding the rules governing such binding is an essential step in describing the network of regulatory interactions, and its pathological alterations. We show that describing regulatory regions in terms of their profile of total binding affinities for transcription factors leads to increased predictive power compared to methods based on the identification of discrete binding sites. This applies both to the prediction of transcription factor binding as revealed by ChIP-seq experiments and to the prediction of gene expression through RNA-seq. Further significant improvements in predictive power are obtained when regulatory regions are defined based on chromatin states inferred from histone modification data.

  14. Transcription Factor and lncRNA Regulatory Networks Identify Key Elements in Lung Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Dan Li

    2018-01-01

    Full Text Available Lung cancer is the second most commonly diagnosed carcinoma and is the leading cause of cancer death. Although significant progress has been made towards its understanding and treatment, unraveling the complexities of lung cancer is still hampered by a lack of comprehensive knowledge on the mechanisms underlying the disease. High-throughput and multidimensional genomic data have shed new light on cancer biology. In this study, we developed a network-based approach integrating somatic mutations, the transcriptome, DNA methylation, and protein-DNA interactions to reveal the key regulators in lung adenocarcinoma (LUAD. By combining Bayesian network analysis with tissue-specific transcription factor (TF and targeted gene interactions, we inferred 15 disease-related core regulatory networks in co-expression gene modules associated with LUAD. Through target gene set enrichment analysis, we identified a set of key TFs, including known cancer genes that potentially regulate the disease networks. These TFs were significantly enriched in multiple cancer-related pathways. Specifically, our results suggest that hepatitis viruses may contribute to lung carcinogenesis, highlighting the need for further investigations into the roles that viruses play in treating lung cancer. Additionally, 13 putative regulatory long non-coding RNAs (lncRNAs, including three that are known to be associated with lung cancer, and nine novel lncRNAs were revealed by our study. These lncRNAs and their target genes exhibited high interaction potentials and demonstrated significant expression correlations between normal lung and LUAD tissues. We further extended our study to include 16 solid-tissue tumor types and determined that the majority of these lncRNAs have putative regulatory roles in multiple cancers, with a few showing lung-cancer specific regulations. Our study provides a comprehensive investigation of transcription factor and lncRNA regulation in the context of LUAD

  15. Medusa structure of the gene regulatory network: dominance of transcription factors in cancer subtype classification.

    Science.gov (United States)

    Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui

    2011-05-01

    Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.

  16. A long noncoding RNA transcriptional regulatory circuit drives thermogenic adipocyte differentiation.

    Science.gov (United States)

    Zhao, Xu-Yun; Li, Siming; Wang, Guo-Xiao; Yu, Qi; Lin, Jiandie D

    2014-08-07

    Brown and beige/brite fats generate heat via uncoupled respiration to defend against cold. The total mass and activity of thermogenic adipose tissues are also tightly linked to systemic energy and nutrient homeostasis. Despite originating from distinct progenitors, brown and beige adipocytes acquire remarkably similar molecular and metabolic characteristics during differentiation through the action of a network of transcription factors and cofactors. How this regulatory network interfaces with long noncoding RNAs (lncRNAs), an emerging class of developmental regulators, remains largely unexplored. Here, we globally profiled lncRNA gene expression during thermogenic adipocyte formation and identified Brown fat lncRNA 1 (Blnc1) as a nuclear lncRNA that promotes brown and beige adipocyte differentiation and function. Blnc1 forms a ribonucleoprotein complex with transcription factor EBF2 to stimulate the thermogenic gene program. Further, Blnc1 itself is a target of EBF2, thereby forming a feedforward regulatory loop to drive adipogenesis toward thermogenic phenotype. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Data-based model and parameter evaluation in dynamic transcriptional regulatory networks.

    Science.gov (United States)

    Cavelier, German; Anastassiou, Dimitris

    2004-05-01

    Finding the causality and strength of connectivity in transcriptional regulatory networks from time-series data will provide a powerful tool for the analysis of cellular states. Presented here is the design of tools for the evaluation of the network's model structure and parameters. The most effective tools are found to be based on evolution strategies. We evaluate models of increasing complexity, from lumped, algebraic phenomenological models to Hill functions and thermodynamically derived functions. These last functions provide the free energies of binding of transcription factors to their operators, as well as cooperativity energies. Optimization results based on published experimental data from a synthetic network in Escherichia coli are presented. The free energies of binding and cooperativity found by our tools are in the same physiological ranges as those experimentally derived in the bacteriophage lambda system. We also use time-series data from high-density oligonucleotide microarrays of yeast meiotic expression patterns. The algorithm appropriately finds the parameters of pairs of regulated regulatory yeast genes, showing that for related genes an overall reasonable computation effort is sufficient to find the strength and causality of the connectivity of large numbers of them. Copyright 2004 Wiley-Liss, Inc.

  18. Elucidating the role of transcription in shaping the 3D structure of the bacterial genome

    Science.gov (United States)

    Brandao, Hugo B.; Wang, Xindan; Rudner, David Z.; Mirny, Leonid

    Active transcription has been linked to several genome conformation changes in bacteria, including the recruitment of chromosomal DNA to the cell membrane and formation of nucleoid clusters. Using genomic and imaging data as input into mathematical models and polymer simulations, we sought to explore the extent to which bacterial 3D genome structure could be explained by 1D transcription tracks. Using B. subtilis as a model organism, we investigated via polymer simulations the role of loop extrusion and DNA super-coiling on the formation of interaction domains and other fine-scale features that are visible in chromosome conformation capture (Hi-C) data. We then explored the role of the condensin structural maintenance of chromosome complex on the alignment of chromosomal arms. A parameter-free transcription traffic model demonstrated that mean chromosomal arm alignment can be quantitatively explained, and the effects on arm alignment in genomically rearranged strains of B. subtilis were accurately predicted. H.B. acknowledges support from the Natural Sciences and Engineering Research Council of Canada for a PGS-D fellowship.

  19. A reporter system coupled with high-throughput sequencing unveils key bacterial transcription and translation determinants.

    Science.gov (United States)

    Yus, Eva; Yang, Jae-Seong; Sogues, Adrià; Serrano, Luis

    2017-08-28

    Quantitative analysis of the sequence determinants of transcription and translation regulation is relevant for systems and synthetic biology. To identify these determinants, researchers have developed different methods of screening random libraries using fluorescent reporters or antibiotic resistance genes. Here, we have implemented a generic approach called ELM-seq (expression level monitoring by DNA methylation) that overcomes the technical limitations of such classic reporters. ELM-seq uses DamID (Escherichia coli DNA adenine methylase as a reporter coupled with methylation-sensitive restriction enzyme digestion and high-throughput sequencing) to enable in vivo quantitative analyses of upstream regulatory sequences. Using the genome-reduced bacterium Mycoplasma pneumoniae, we show that ELM-seq has a large dynamic range and causes minimal toxicity. We use ELM-seq to determine key sequences (known and putatively novel) of promoter and untranslated regions that influence transcription and translation efficiency. Applying ELM-seq to other organisms will help us to further understand gene expression and guide synthetic biology.Quantitative analysis of how DNA sequence determines transcription and translation regulation is of interest to systems and synthetic biologists. Here the authors present ELM-seq, which uses Dam activity as reporter for high-throughput analysis of promoter and 5'-UTR regions.

  20. Evolutionary remodeling of global regulatory networks during long-term bacterial adaptation to human hosts

    DEFF Research Database (Denmark)

    Pedersen, Søren Damkiær; Yang, Lei; Molin, Søren

    2013-01-01

    The genetic basis of bacterial adaptation to a natural environment has been investigated in a highly successful Pseudomonas aeruginosa lineage (DK2) that evolved within the airways of patients with cystic fibrosis (CF) for more than 35 y. During evolution in the CF airways, the DK2 lineage...... phenotypes. Our results suggest that adaptation to a highly selective environment, such as the CF airways, is a highly dynamic and complex process, which involves continuous optimization of existing regulatory networks to match the fluctuations in the environment....

  1. Identification of High-Impact cis-Regulatory Mutations Using Transcription Factor Specific Random Forest Models.

    Directory of Open Access Journals (Sweden)

    Dmitry Svetlichnyy

    2015-11-01

    Full Text Available Cancer genomes contain vast amounts of somatic mutations, many of which are passenger mutations not involved in oncogenesis. Whereas driver mutations in protein-coding genes can be distinguished from passenger mutations based on their recurrence, non-coding mutations are usually not recurrent at the same position. Therefore, it is still unclear how to identify cis-regulatory driver mutations, particularly when chromatin data from the same patient is not available, thus relying only on sequence and expression information. Here we use machine-learning methods to predict functional regulatory regions using sequence information alone, and compare the predicted activity of the mutated region with the reference sequence. This way we define the Predicted Regulatory Impact of a Mutation in an Enhancer (PRIME. We find that the recently identified driver mutation in the TAL1 enhancer has a high PRIME score, representing a "gain-of-target" for MYB, whereas the highly recurrent TERT promoter mutation has a surprisingly low PRIME score. We trained Random Forest models for 45 cancer-related transcription factors, and used these to score variations in the HeLa genome and somatic mutations across more than five hundred cancer genomes. Each model predicts only a small fraction of non-coding mutations with a potential impact on the function of the encompassing regulatory region. Nevertheless, as these few candidate driver mutations are often linked to gains in chromatin activity and gene expression, they may contribute to the oncogenic program by altering the expression levels of specific oncogenes and tumor suppressor genes.

  2. Identification of direct regulatory targets of the transcription factor Sox10 based on function and conservation

    Directory of Open Access Journals (Sweden)

    Lee Sanghyuk

    2008-09-01

    Full Text Available Abstract Background Sox10, a member of the Sry-related HMG-Box gene family, is a critical transcription factor for several important cell lineages, most notably the neural crest stem cells and the derivative peripheral glial cells and melanocytes. Thus far, only a handful of direct target genes are known for this transcription factor limiting our understanding of the biological network it governs. Results We describe identification of multiple direct regulatory target genes of Sox10 through a procedure based on function and conservation. By combining RNA interference technique and DNA microarray technology, we have identified a set of genes that show significant down-regulation upon introduction of Sox10 specific siRNA into Schwannoma cells. Subsequent comparative genomics analyses led to potential binding sites for Sox10 protein conserved across several mammalian species within the genomic region proximal to these genes. Multiple sites belonging to 4 different genes (proteolipid protein, Sox10, extracellular superoxide dismutase, and pleiotrophin were shown to directly interact with Sox10 by chromatin immunoprecipitation assay. We further confirmed the direct regulation through the identified cis-element for one of the genes, extracellular superoxide dismutase, using electrophoretic mobility shift assay and reporter assay. Conclusion In sum, the process of combining differential expression profiling and comparative genomics successfully led to further defining the role of Sox10, a critical transcription factor for the development of peripheral glia. Our strategy utilizing relatively accessible techniques and tools should be applicable to studying the function of other transcription factors.

  3. Stability and function of regulatory T cells expressing the transcription factor T-bet.

    Science.gov (United States)

    Levine, Andrew G; Mendoza, Alejandra; Hemmers, Saskia; Moltedo, Bruno; Niec, Rachel E; Schizas, Michail; Hoyos, Beatrice E; Putintseva, Ekaterina V; Chaudhry, Ashutosh; Dikiy, Stanislav; Fujisawa, Sho; Chudakov, Dmitriy M; Treuting, Piper M; Rudensky, Alexander Y

    2017-06-15

    Adaptive immune responses are tailored to different types of pathogens through differentiation of naive CD4 T cells into functionally distinct subsets of effector T cells (T helper 1 (T H 1), T H 2, and T H 17) defined by expression of the key transcription factors T-bet, GATA3, and RORγt, respectively. Regulatory T (T reg ) cells comprise a distinct anti-inflammatory lineage specified by the X-linked transcription factor Foxp3 (refs 2, 3). Paradoxically, some activated T reg cells express the aforementioned effector CD4 T cell transcription factors, which have been suggested to provide T reg cells with enhanced suppressive capacity. Whether expression of these factors in T reg cells-as in effector T cells-is indicative of heterogeneity of functionally discrete and stable differentiation states, or conversely may be readily reversible, is unknown. Here we demonstrate that expression of the T H 1-associated transcription factor T-bet in mouse T reg cells, induced at steady state and following infection, gradually becomes highly stable even under non-permissive conditions. Loss of function or elimination of T-bet-expressing T reg cells-but not of T-bet expression in T reg cells-resulted in severe T H 1 autoimmunity. Conversely, following depletion of T-bet - T reg cells, the remaining T-bet + cells specifically inhibited T H 1 and CD8 T cell activation consistent with their co-localization with T-bet + effector T cells. These results suggest that T-bet + T reg cells have an essential immunosuppressive function and indicate that T reg cell functional heterogeneity is a critical feature of immunological tolerance.

  4. Human and mouse switch-like genes share common transcriptional regulatory mechanisms for bimodality

    Directory of Open Access Journals (Sweden)

    Tozeren Aydin

    2008-12-01

    Full Text Available Abstract Background Gene expression is controlled over a wide range at the transcript level through complex interplay between DNA and regulatory proteins, resulting in profiles of gene expression that can be represented as normal, graded, and bimodal (switch-like distributions. We have previously performed genome-scale identification and annotation of genes with switch-like expression at the transcript level in mouse, using large microarray datasets for healthy tissue, in order to study the cellular pathways and regulatory mechanisms involving this class of genes. We showed that a large population of bimodal mouse genes encoding for cell membrane and extracellular matrix proteins is involved in communication pathways. This study expands on previous results by annotating human bimodal genes, investigating their correspondence to bimodality in mouse orthologs and exploring possible regulatory mechanisms that contribute to bimodality in gene expression in human and mouse. Results Fourteen percent of the human genes on the HGU133A array (1847 out of 13076 were identified as bimodal or switch-like. More than 40% were found to have bimodal mouse orthologs. KEGG pathways enriched for bimodal genes included ECM-receptor interaction, focal adhesion, and tight junction, showing strong similarity to the results obtained in mouse. Tissue-specific modes of expression of bimodal genes among brain, heart, and skeletal muscle were common between human and mouse. Promoter analysis revealed a higher than average number of transcription start sites per gene within the set of bimodal genes. Moreover, the bimodal gene set had differentially methylated histones compared to the set of the remaining genes in the genome. Conclusion The fact that bimodal genes were enriched within the cell membrane and extracellular environment make these genes as candidates for biomarkers for tissue specificity. The commonality of the important roles bimodal genes play in tissue

  5. Genome-wide identification of the regulatory targets of a transcription factor using biochemical characterization and computational genomic analysis

    Directory of Open Access Journals (Sweden)

    Jolly Emmitt R

    2005-11-01

    Full Text Available Abstract Background A major challenge in computational genomics is the development of methodologies that allow accurate genome-wide prediction of the regulatory targets of a transcription factor. We present a method for target identification that combines experimental characterization of binding requirements with computational genomic analysis. Results Our method identified potential target genes of the transcription factor Ndt80, a key transcriptional regulator involved in yeast sporulation, using the combined information of binding affinity, positional distribution, and conservation of the binding sites across multiple species. We have also developed a mathematical approach to compute the false positive rate and the total number of targets in the genome based on the multiple selection criteria. Conclusion We have shown that combining biochemical characterization and computational genomic analysis leads to accurate identification of the genome-wide targets of a transcription factor. The method can be extended to other transcription factors and can complement other genomic approaches to transcriptional regulation.

  6. A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants.

    Directory of Open Access Journals (Sweden)

    Dong Wang

    2006-11-01

    Full Text Available Many biological processes are controlled by intricate networks of transcriptional regulators. With the development of microarray technology, transcriptional changes can be examined at the whole-genome level. However, such analysis often lacks information on the hierarchical relationship between components of a given system. Systemic acquired resistance (SAR is an inducible plant defense response involving a cascade of transcriptional events induced by salicylic acid through the transcription cofactor NPR1. To identify additional regulatory nodes in the SAR network, we performed microarray analysis on Arabidopsis plants expressing the NPR1-GR (glucocorticoid receptor fusion protein. Since nuclear translocation of NPR1-GR requires dexamethasone, we were able to control NPR1-dependent transcription and identify direct transcriptional targets of NPR1. We show that NPR1 directly upregulates the expression of eight WRKY transcription factor genes. This large family of 74 transcription factors has been implicated in various defense responses, but no specific WRKY factor has been placed in the SAR network. Identification of NPR1-regulated WRKY factors allowed us to perform in-depth genetic analysis on a small number of WRKY factors and test well-defined phenotypes of single and double mutants associated with NPR1. Among these WRKY factors we found both positive and negative regulators of SAR. This genomics-directed approach unambiguously positioned five WRKY factors in the complex transcriptional regulatory network of SAR. Our work not only discovered new transcription regulatory components in the signaling network of SAR but also demonstrated that functional studies of large gene families have to take into consideration sequence similarity as well as the expression patterns of the candidates.

  7. Differential roles of epigenetic changes and Foxp3 expression in regulatory T cell-specific transcriptional regulation

    OpenAIRE

    Morikawa, Hiromasa; Ohkura, Naganari; Vandenbon, Alexis; Itoh, Masayoshi; Nagao-Sato, Sayaka; Kawaji, Hideya; Lassmann, Timo; Carninci, Piero; Hayashizaki, Yoshihide; Forrest, Alistair R. R.; Standley, Daron M.; Date, Hiroshi; Sakaguchi, Shimon; Forrest, Alistair R.R.; Kawaji, Hideya

    2014-01-01

    Naturally occurring regulatory T (Treg) cells, which specifically express the transcription factor forkhead box P3 (Foxp3), are engaged in the maintenance of immunological self-tolerance and homeostasis. By transcriptional start site cluster analysis, we assessed here how genome-wide patterns of DNA methylation or Foxp3 binding sites were associated with Treg-specific gene expression. We found that Treg-specific DNA hypomethylated regions were closely associated with Treg up-regulated transcr...

  8. Transcriptional responses of resistant and susceptible fish clones to the bacterial pathogen Flavobacterium psychrophilum.

    Directory of Open Access Journals (Sweden)

    Christelle Langevin

    Full Text Available Flavobacterium psychrophilum is a bacterial species that represents one of the most important pathogens for aquaculture worldwide, especially for salmonids. To gain insights into the genetic basis of the natural resistance to F. psychrophilum, we selected homozygous clones of rainbow trout with contrasted susceptibility to the infection. We compared the transcriptional response to the bacteria in the pronephros of a susceptible and a resistant line by micro-array analysis five days after infection. While the basal transcriptome of healthy fish was significantly different in the resistant and susceptible lines, the transcriptome modifications induced by the bacteria involved essentially the same genes and pathways. The response to F. psychrophilum involved antimicrobial peptides, complement, and a number of enzymes and chemokines. The matrix metalloproteases mmp9 and mmp13 were among the most highly induced genes in both genetic backgrounds. Key genes of both pro- and anti-inflammatory response such as IL1 and IL10, were up-regulated with a greater magnitude in susceptible animals where the bacterial load was also much higher. While higher resistance to F. psychrophilum does not seem to be based on extensive differences in the orientation of the immune response, several genes including complement C3 showed stronger induction in the resistant fish. They may be important for the variation of susceptibility to the infection.

  9. Lineage-specific transcription factors and the evolution of gene regulatory networks.

    Science.gov (United States)

    Nowick, Katja; Stubbs, Lisa

    2010-01-01

    Nature is replete with examples of diverse cell types, tissues and body plans, forming very different creatures from genomes with similar gene complements. However, while the genes and the structures of proteins they encode can be highly conserved, the production of those proteins in specific cell types and at specific developmental time points might differ considerably between species. A full understanding of the factors that orchestrate gene expression will be essential to fully understand evolutionary variety. Transcription factor (TF) proteins, which form gene regulatory networks (GRNs) to act in cooperative or competitive partnerships to regulate gene expression, are key components of these unique regulatory programs. Although many TFs are conserved in structure and function, certain classes of TFs display extensive levels of species diversity. In this review, we highlight families of TFs that have expanded through gene duplication events to create species-unique repertoires in different evolutionary lineages. We discuss how the hierarchical structures of GRNs allow for flexible small to large-scale phenotypic changes. We survey evidence that explains how newly evolved TFs may be integrated into an existing GRN and how molecular changes in TFs might impact the GRNs. Finally, we review examples of traits that evolved due to lineage-specific TFs and species differences in GRNs.

  10. Transcription factor IRF8 controls Th1-like regulatory T-cell function.

    Science.gov (United States)

    Lee, Wonyong; Kim, Hyeong Su; Baek, Song Yi; Lee, Gap Ryol

    2016-11-01

    Recent studies have suggested that regulatory T (Treg) cells comprise a heterogeneous population that regulates various aspects of the immune response, and that Treg cells use the factors that are expressed in their target cells to regulate them. We searched for factors that regulate Th1 response in Treg cells using a meta-analysis. In the process, we discovered that transcription factor interferon regulatory factor 8 (IRF8) was selectively expressed in Treg and Th1 cells. IRF8-deficient Treg cells showed defective expression of CXCR3 and aberrant expression of the Il4 and Il17 genes. Upon treatment with alpha galactosyl-C18-ceramide (αGal-C18-Cer), IRF8-deficient mice showed defective Treg cell recruitment in the liver. Eliciting Th1 immune response by anti-CD40 antibody injection in mice induced IRF8 expression in Treg cells. The expression of IRF8 was induced by Foxp3 in Treg cells. IRF8 had no effect on T-bet expression in Treg and vice versa. Thus, our results strongly suggest that IRF8 controls Th1 immune response in Treg cells independent of T-bet.

  11. Prediction of bipartite transcriptional regulatory elements using transcriptome data of Arabidopsis.

    Science.gov (United States)

    Yamamoto, Yoshiharu Y; Ichida, Hiroyuki; Hieno, Ayaka; Obata, Daichi; Tokizawa, Mutsutomo; Nomoto, Mika; Tada, Yasuomi; Kusunoki, Kazutaka; Koyama, Hiroyuki; Hayami, Natsuki

    2017-06-01

    In our previous study, a methodology was established to predict transcriptional regulatory elements in promoter sequences using transcriptome data based on a frequency comparison of octamers. Some transcription factors, including the NAC family, cannot be covered by this method because their binding sequences have non-specific spacers in the middle of the two binding sites. In order to remove this blind spot in promoter prediction, we have extended our analysis by including bipartite octamers that are composed of '4 bases-a spacer with a flexible length-4 bases'. 8,044 pre-selected bipartite octamers, which had an overrepresentation of specific spacer lengths in promoter sequences and sequences related to core elements removed, were subjected to frequency comparison analysis. Prediction of ER stress-responsive elements in the BiP/BiPL promoter and an ANAC017 target sequence resulted in precise detection of true positives, judged by functional analyses of a reported article and our own in vitro protein-DNA binding assays. These results demonstrate that incorporation of bipartite octamers with continuous ones improves promoter prediction significantly. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  12. Bacterial rRNA-Targeted Reverse Transcription-PCR Used To Identify Pathogens Responsible for Fever with Neutropenia▿

    OpenAIRE

    Sakaguchi, Sachi; Saito, Masahiro; Tsuji, Hirokazu; Asahara, Takashi; Takata, Oto; Fujimura, Junya; Nagata, Satoru; Nomoto, Koji; Shimizu, Toshiaki

    2010-01-01

    The purpose of this study was to evaluate the clinical utility of bacterial rRNA-targeted reverse transcription-quantitative PCR (BrRNA RT-qPCR) assays for identifying the bacterial pathogens that cause fever with neutropenia in pediatric cancer patients, by comparing the bacterial detection rate of this technique with that of blood culture. One milliliter of blood was collected from pediatric patients who developed fever with neutropenia following cancer chemotherapy. BrRNA RT-qPCR was perfo...

  13. Predicting combinatorial binding of transcription factors to regulatory elements in the human genome by association rule mining

    Directory of Open Access Journals (Sweden)

    Iyer Vishwanath R

    2007-11-01

    Full Text Available Abstract Background Cis-acting transcriptional regulatory elements in mammalian genomes typically contain specific combinations of binding sites for various transcription factors. Although some cis-regulatory elements have been well studied, the combinations of transcription factors that regulate normal expression levels for the vast majority of the 20,000 genes in the human genome are unknown. We hypothesized that it should be possible to discover transcription factor combinations that regulate gene expression in concert by identifying over-represented combinations of sequence motifs that occur together in the genome. In order to detect combinations of transcription factor binding motifs, we developed a data mining approach based on the use of association rules, which are typically used in market basket analysis. We scored each segment of the genome for the presence or absence of each of 83 transcription factor binding motifs, then used association rule mining algorithms to mine this dataset, thus identifying frequently occurring pairs of distinct motifs within a segment. Results Support for most pairs of transcription factor binding motifs was highly correlated across different chromosomes although pair significance varied. Known true positive motif pairs showed higher association rule support, confidence, and significance than background. Our subsets of high-confidence, high-significance mined pairs of transcription factors showed enrichment for co-citation in PubMed abstracts relative to all pairs, and the predicted associations were often readily verifiable in the literature. Conclusion Functional elements in the genome where transcription factors bind to regulate expression in a combinatorial manner are more likely to be predicted by identifying statistically and biologically significant combinations of transcription factor binding motifs than by simply scanning the genome for the occurrence of binding sites for a single transcription

  14. Transcriptional regulatory networks underlying the reprogramming of spermatogonial stem cells to multipotent stem cells.

    Science.gov (United States)

    Jeong, Hoe-Su; Bhin, Jinhyuk; Joon Kim, Hyung; Hwang, Daehee; Ryul Lee, Dong; Kim, Kye-Seong

    2017-04-14

    Spermatogonial stem cells (SSCs) are germline stem cells located along the basement membrane of seminiferous tubules in testes. Recently, SSCs were shown to be reprogrammed into multipotent SSCs (mSSCs). However, both the key factors and biological networks underlying this reprogramming remain elusive. Here, we present transcriptional regulatory networks (TRNs) that control cellular processes related to the SSC-to-mSSC reprogramming. Previously, we established intermediate SSCs (iSSCs) undergoing the transition to mSSCs and generated gene expression profiles of SSCs, iSSCs and mSSCs. By comparing these profiles, we identified 2643 genes that were up-regulated during the reprogramming process and 15 key transcription factors (TFs) that regulate these genes. Using the TF-target relationships, we developed TRNs describing how these TFs regulate three pluripotency-related processes (cell proliferation, stem cell maintenance and epigenetic regulation) during the reprogramming. The TRNs showed that 4 of the 15 TFs (Oct4/Pou5f1, Cux1, Zfp143 and E2f4) regulated cell proliferation during the early stages of reprogramming, whereas 11 TFs (Oct4/Pou5f1, Foxm1, Cux1, Zfp143, Trp53, E2f4, Esrrb, Nfyb, Nanog, Sox2 and Klf4) regulated the three pluripotency-related processes during the late stages of reprogramming. Our TRNs provide a model for the temporally coordinated transcriptional regulation of pluripotency-related processes during the SSC-to-mSSC reprogramming, which can be further tested in detailed functional studies.

  15. A Bacteriophage Capsid Protein Is an Inhibitor of a Conserved Transcription Terminator of Various Bacterial Pathogens.

    Science.gov (United States)

    Ghosh, Gairika; Reddy, Jayavardhana; Sambhare, Susmit; Sen, Ranjan

    2018-01-01

    Rho is a hexameric molecular motor that functions as a conserved transcription terminator in the majority of bacterial species and is a potential drug target. Psu is a bacteriophage P4 capsid protein that inhibits Escherichia coli Rho by obstructing its ATPase and translocase activities. In this study, we explored the anti-Rho activity of Psu for Rho proteins from different pathogens. Sequence alignment and homology modeling of Rho proteins from pathogenic bacteria revealed the conserved nature of the Psu-interacting regions in all these proteins. We chose Rho proteins from various pathogens, including Mycobacterium smegmatis , Mycobacterium bovis , Mycobacterium tuberculosis , Xanthomonas campestris , Xanthomonas oryzae , Corynebacterium glutamicum , Vibrio cholerae , Salmonella enterica , and Pseudomonas syringae The purified recombinant Rho proteins of these organisms showed variable rates of ATP hydrolysis on poly(rC) as the substrate and were capable of releasing RNA from the E. coli transcription elongation complexes. Psu was capable of inhibiting these two functions of all these Rho proteins. In vivo pulldown assays revealed direct binding of Psu with many of these Rho proteins. In vivo expression of psu induced killing of M. smegmatis , M. bovis , X. campestris , and E. coli expressing S. enterica Rho indicating Psu-induced inhibition of Rho proteins of these strains under physiological conditions. We propose that the "universal" inhibitory function of the Psu protein against the Rho proteins from both Gram-negative and Gram-positive bacteria could be useful for designing peptides with antimicrobial functions and that these peptides could contribute to synergistic antibiotic treatment of the pathogens by compromising the Rho functions. IMPORTANCE Bacteriophage-derived protein factors modulating different bacterial processes could be converted into unique antimicrobial agents. Bacteriophage P4 capsid protein Psu is an inhibitor of the E. coli transcription

  16. Diagnostic Test Accuracy of a 2-Transcript Host RNA Signature for Discriminating Bacterial vs Viral Infection in Febrile Children.

    Science.gov (United States)

    Herberg, Jethro A; Kaforou, Myrsini; Wright, Victoria J; Shailes, Hannah; Eleftherohorinou, Hariklia; Hoggart, Clive J; Cebey-López, Miriam; Carter, Michael J; Janes, Victoria A; Gormley, Stuart; Shimizu, Chisato; Tremoulet, Adriana H; Barendregt, Anouk M; Salas, Antonio; Kanegaye, John; Pollard, Andrew J; Faust, Saul N; Patel, Sanjay; Kuijpers, Taco; Martinón-Torres, Federico; Burns, Jane C; Coin, Lachlan J M; Levin, Michael

    Because clinical features do not reliably distinguish bacterial from viral infection, many children worldwide receive unnecessary antibiotic treatment, while bacterial infection is missed in others. To identify a blood RNA expression signature that distinguishes bacterial from viral infection in febrile children. Febrile children presenting to participating hospitals in the United Kingdom, Spain, the Netherlands, and the United States between 2009-2013 were prospectively recruited, comprising a discovery group and validation group. Each group was classified after microbiological investigation as having definite bacterial infection, definite viral infection, or indeterminate infection. RNA expression signatures distinguishing definite bacterial from viral infection were identified in the discovery group and diagnostic performance assessed in the validation group. Additional validation was undertaken in separate studies of children with meningococcal disease (n = 24) and inflammatory diseases (n = 48) and on published gene expression datasets. A 2-transcript RNA expression signature distinguishing bacterial infection from viral infection was evaluated against clinical and microbiological diagnosis. Definite bacterial and viral infection was confirmed by culture or molecular detection of the pathogens. Performance of the RNA signature was evaluated in the definite bacterial and viral group and in the indeterminate infection group. The discovery group of 240 children (median age, 19 months; 62% male) included 52 with definite bacterial infection, of whom 36 (69%) required intensive care, and 92 with definite viral infection, of whom 32 (35%) required intensive care. Ninety-six children had indeterminate infection. Analysis of RNA expression data identified a 38-transcript signature distinguishing bacterial from viral infection. A smaller (2-transcript) signature (FAM89A and IFI44L) was identified by removing highly correlated transcripts. When this 2-transcript

  17. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    Science.gov (United States)

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  18. Core transcriptional regulatory circuit controlled by the TAL1 complex in human T cell acute lymphoblastic leukemia.

    Science.gov (United States)

    Sanda, Takaomi; Lawton, Lee N; Barrasa, M Inmaculada; Fan, Zi Peng; Kohlhammer, Holger; Gutierrez, Alejandro; Ma, Wenxue; Tatarek, Jessica; Ahn, Yebin; Kelliher, Michelle A; Jamieson, Catriona H M; Staudt, Louis M; Young, Richard A; Look, A Thomas

    2012-08-14

    The oncogenic transcription factor TAL1/SCL is aberrantly expressed in over 40% of cases of human T cell acute lymphoblastic leukemia (T-ALL), emphasizing its importance in the molecular pathogenesis of T-ALL. Here we identify the core transcriptional regulatory circuit controlled by TAL1 and its regulatory partners HEB, E2A, LMO1/2, GATA3, and RUNX1. We show that TAL1 forms a positive interconnected autoregulatory loop with GATA3 and RUNX1 and that the TAL1 complex directly activates the MYB oncogene, forming a positive feed-forward regulatory loop that reinforces and stabilizes the TAL1-regulated oncogenic program. One of the critical downstream targets in this circuitry is the TRIB2 gene, which is oppositely regulated by TAL1 and E2A/HEB and is essential for the survival of T-ALL cells. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Molecular approaches for viable bacterial population and transcriptional analyses in a rodent model of dental caries

    Science.gov (United States)

    Klein, Marlise I.; Scott-Anne, Kathleen M.; Gregoire, Stacy; Rosalen, Pedro L.; Koo, Hyun

    2012-01-01

    SUMMARY Culturing methods are the primary approach for microbiological analysis of plaque-biofilms in rodent models of dental caries. In this study, we developed strategies for isolation of DNA and RNA from in vivo formed plaque-biofilms to analyze the viable bacterial population and gene expression. Plaque-biofilm samples from rats were treated with propidium monoazide to isolate DNA from viable cells, and the purified DNA was used to quantify total bacteria and S. mutans population via qPCR and specific primers; the same samples were also analyzed by colony forming unit (CFU) counting. In parallel, RNA was isolated from plaque-biofilm samples (from same animals) and used for transcriptional analyses via RT-qPCR. The viable population of both S. mutans and total bacteria assessed by qPCR were positively correlated with the CFU data (P0.8). However, the qPCR data showed higher bacterial cell counts, particularly for total bacteria (vs. CFU). Moreover, S. mutans proportion in the plaque-biofilm determined by qPCR analysis showed strong correlation with incidence of smooth-surface caries (P=0.0022, r=0.71). The purified RNAs presented high RNA integrity numbers (>7), which allowed measurement of the expression of genes that are critical for S. mutans virulence (e.g. gtfB and gtfC). Our data show that the viable microbial population and the gene expression can be analyzed simultaneously, providing a global assessment of the infectious aspect of the disease dental caries. Our approach could enhance the value of the current rodent model in further understanding the pathophysiology of this disease and facilitating the exploration of novel anti-caries therapies. PMID:22958384

  20. A trans-acting Variant within the Transcription Factor RIM101 Interacts with Genetic Background to Determine its Regulatory Capacity.

    Directory of Open Access Journals (Sweden)

    Timothy Read

    2016-01-01

    Full Text Available Most genetic variants associated with disease occur within regulatory regions of the genome, underscoring the importance of defining the mechanisms underlying differences in regulation of gene expression between individuals. We discovered a pair of co-regulated, divergently oriented transcripts, AQY2 and ncFRE6, that are expressed in one strain of Saccharomyces cerevisiae, ∑1278b, but not in another, S288c. By combining classical genetics techniques with high-throughput sequencing, we identified a trans-acting single nucleotide polymorphism within the transcription factor RIM101 that causes the background-dependent expression of both transcripts. Subsequent RNA-seq experiments revealed that RIM101 regulates many more targets in S288c than in ∑1278b and that deletion of RIM101 in both backgrounds abrogates the majority of differential expression between the strains. Strikingly, only three transcripts undergo a significant change in expression after swapping RIM101 alleles between backgrounds, implying that the differences in the RIM101 allele lead to a remarkably focused transcriptional response. However, hundreds of RIM101-dependent targets undergo a subtle but consistent shift in expression in the S288c RIM101-swapped strain, but not its ∑1278b counterpart. We conclude that ∑1278b may harbor a variant(s that buffers against widespread transcriptional dysregulation upon introduction of a non-native RIM101 allele, emphasizing the importance of accounting for genetic background when assessing the impact of a regulatory variant.

  1. Statistical tests for natural selection on regulatory regions based on the strength of transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Moses Alan M

    2009-12-01

    Full Text Available Abstract Background Although cis-regulatory changes play an important role in evolution, it remains difficult to establish the contribution of natural selection to regulatory differences between species. For protein coding regions, powerful tests of natural selection have been developed based on comparisons of synonymous and non-synonymous substitutions, and analogous tests for regulatory regions would be of great utility. Results Here, tests for natural selection on regulatory regions are proposed based on nucleotide substitutions that occur in characterized transcription factor binding sites (an important type functional element within regulatory regions. In the absence of selection, these substitutions will tend to reduce the strength of existing binding sites. On the other hand, purifying selection will act to preserve the binding sites in regulatory regions, while positive selection can act to create or destroy binding sites, as well as change their strength. Using standard models of binding site strength and molecular evolution in the absence of selection, this intuition can be used to develop statistical tests for natural selection. Application of these tests to two well-characterized regulatory regions in Drosophila provides evidence for purifying selection. Conclusion This demonstrates that it is possible to develop tests for selection on regulatory regions based on the specific functional constrains on these sequences.

  2. Short term memory of Caenorhabditis elegans against bacterial pathogens involves CREB transcription factor.

    Science.gov (United States)

    Prithika, Udayakumar; Vikneswari, Ramaraj; Balamurugan, Krishnaswamy

    2017-04-01

    One of the key issues pertaining to the control of memory is to respond to a consistently changing environment or microbial niche present in it. Human cyclic AMP response element binding protein (CREB) transcription factor which plays a crucial role in memory has a homolog in C. elegans, crh-1. crh-1 appears to influence memory processes to certain extent by habituation of the host to a particular environment. The discrimination between the pathogen and a non-pathogen is essential for C. elegans in a microbial niche which determines its survival. Training the nematodes in the presence of a virulent pathogen (S. aureus) and an opportunistic pathogen (P. mirabilis) separately exhibits a different behavioural paradigm. This appears to be dependent on the CREB transcription factor. Here we show that C. elegans homolog crh-1 helps in memory response for a short term against the interacting pathogens. Following conditioning of the nematodes to S. aureus and P. mirabilis, the wild type nematodes exhibited a positive response towards the respective pathogens which diminished slowly after 2h. By contrast, the crh-1 deficient nematodes had a defective memory post conditioning. The molecular data reinforces the importance of crh-1 gene in retaining the memory of nematode. Our results also suggest that involvement of neurotransmitters play a crucial role in modulating the memory of the nematode with the assistance of CREB. Therefore, we elucidate that CREB is responsible for the short term memory response in C. elegans against bacterial pathogens. Copyright © 2016 Elsevier GmbH. All rights reserved.

  3. Unraveling the regulatory network of the MADS box transcription factor RIN in fruit ripening.

    Science.gov (United States)

    Qin, Guozheng; Wang, Yuying; Cao, Baohua; Wang, Weihao; Tian, Shiping

    2012-04-01

    The MADS box transcription factor RIN is a global regulator of fruit ripening. However, the direct targets modulated by RIN and the mechanisms underlying the transcriptional regulation remain largely unknown. Here we identified 41 protein spots representing 35 individual genes as potential targets of RIN by comparative proteomic analysis of a rin mutant in tomato fruits. Gene expression analysis showed that the mRNA level of 26 genes correlated well with the protein level. After examining the promoter regions of the candidate genes, a variable number of RIN binding sites were found. Five genes (E8, TomloxC, PNAE, PGK and ADH2) were identified as novel direct targets of RIN by chromatin immunoprecipitation. The results of a gel mobility shift assay confirmed the direct binding of RIN to the promoters of these genes. Of the direct target genes, TomloxC and ADH2, which encode lipoxygenase (LOX) and alcohol dehydrogenase, respectively, are critical for the production of characteristic tomato aromas derived from LOX pathway. Further study indicated that RIN also directly regulates the expression of HPL, which encodes hydroperoxide lyase, another rate-limiting enzyme in the LOX pathway. Loss of function of RIN causes de-regulation of the LOX pathway, leading to a specific defect in the generation of aroma compounds derived from this pathway. These results indicate that RIN modulates aroma formation by direct and rigorous regulation of expression of genes in the LOX pathway. Taken together, our findings suggest that the regulatory effect of RIN on fruit ripening is achieved by targeting specific molecular pathways. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  4. A New Mechanism for Mendelian Dominance in Regulatory Genetic Pathways: Competitive Binding by Transcription Factors.

    Science.gov (United States)

    Porter, Adam H; Johnson, Norman A; Tulchinsky, Alexander Y

    2017-01-01

    We report a new mechanism for allelic dominance in regulatory genetic interactions that we call binding dominance. We investigated a biophysical model of gene regulation, where the fractional occupancy of a transcription factor (TF) on the cis-regulated promoter site it binds to is determined by binding energy (-ΔG) and TF dosage. Transcription and gene expression proceed when the TF is bound to the promoter. In diploids, individuals may be heterozygous at the cis-site, at the TF's coding region, or at the TF's own promoter, which determines allele-specific dosage. We find that when the TF's coding region is heterozygous, TF alleles compete for occupancy at the cis-sites and the tighter-binding TF is dominant in proportion to the difference in binding strength. When the TF's own promoter is heterozygous, the TF produced at the higher dosage is also dominant. Cis-site heterozygotes have additive expression and therefore codominant phenotypes. Binding dominance propagates to affect the expression of downstream loci and it is sensitive in both magnitude and direction to genetic background, but its detectability often attenuates. While binding dominance is inevitable at the molecular level, it is difficult to detect in the phenotype under some biophysical conditions, more so when TF dosage is high and allele-specific binding affinities are similar. A body of empirical research on the biophysics of TF binding demonstrates the plausibility of this mechanism of dominance, but studies of gene expression under competitive binding in heterozygotes in a diversity of genetic backgrounds are needed. Copyright © 2017 by the Genetics Society of America.

  5. Cross-phosphorylation of bacterial serine/threonine and tyrosine protein kinases on key regulatory residues

    Directory of Open Access Journals (Sweden)

    Lei eShi

    2014-09-01

    Full Text Available Bacteria possess protein serine/threonine and tyrosine kinases which resemble eukaryal kinases in their capacity to phosphorylate multiple substrates. We hypothesized that the analogy might extend further, and bacterial kinases may also undergo mutual phosphorylation and activation, which is currently considered as a hallmark of eukaryal kinase networks. In order to test this hypothesis, we explored the capacity of all members of four different classes of serine/threonine and tyrosine kinases present in the firmicute model organism Bacillus subtilis to phosphorylate each other in vitro and interact with each other in vivo. The interactomics data suggested a high degree of connectivity among all types of kinases, while phosphorylation assays revealed equally wide-spread cross-phosphorylation events. Our findings suggest that the Hanks-type kinases PrkC, PrkD and YabT exhibit the highest capacity to phosphorylate other B. subtilis kinases, while the BY-kinase PtkA and the two-component-like kinases RsbW and SpoIIAB show the highest propensity to be phosphorylated by other kinases. Analysis of phosphorylated residues on several selected recipient kinases suggests that most cross-phosphorylation events concern key regulatory residues. Therefore, cross-phosphorylation events are very likely to influence the capacity of recipient kinases to phosphorylate substrates downstream in the signal transduction cascade. We therefore conclude that bacterial serine/threonine and tyrosine kinases probably engage in a network-type behavior previously described only in eukaryal cells.

  6. RNA Transcriptional Biosignature Analysis for Identifying Febrile Infants With Serious Bacterial Infections in the Emergency Department

    Science.gov (United States)

    Mahajan, Prashant; Kuppermann, Nathan; Suarez, Nicolas; Mejias, Asuncion; Casper, Charlie; Dean, J. Michael; Ramilo, Octavio

    2015-01-01

    Objectives To develop the infrastructure and demonstrate the feasibility of conducting microarray-based RNA transcriptional profile analyses for the diagnosis of serious bacterial infections in febrile infants 60 days and younger in a multicenter pediatric emergency research network. Methods We designed a prospective multicenter cohort study with the aim of enrolling more than 4000 febrile infants 60 days and younger. To ensure success of conducting complex genomic studies in emergency department (ED) settings, we established an infrastructure within the Pediatric Emergency Care Applied Research Network, including 21 sites, to evaluate RNA transcriptional profiles in young febrile infants. We developed a comprehensive manual of operations and trained site investigators to obtain and process blood samples for RNA extraction and genomic analyses. We created standard operating procedures for blood sample collection, processing, storage, shipping, and analyses. We planned to prospectively identify, enroll, and collect 1 mL blood samples for genomic analyses from eligible patients to identify logistical issues with study procedures. Finally, we planned to batch blood samples and determined RNA quantity and quality at the central microarray laboratory and organized data analysis with the Pediatric Emergency Care Applied Research Network data coordinating center. Below we report on establishment of the infrastructure and the feasibility success in the first year based on the enrollment of a limited number of patients. Results We successfully established the infrastructure at 21 EDs. Over the first 5 months we enrolled 79% (74 of 94) of eligible febrile infants. We were able to obtain and ship 1 mL of blood from 74% (55 of 74) of enrolled participants, with at least 1 sample per participating ED. The 55 samples were shipped and evaluated at the microarray laboratory, and 95% (52 of 55) of blood samples were of adequate quality and contained sufficient RNA for expression

  7. Transcriptional regulatory network refinement and quantification through kinetic modeling, gene expression microarray data and information theory

    Science.gov (United States)

    Sayyed-Ahmad, Abdallah; Tuncay, Kagan; Ortoleva, Peter J

    2007-01-01

    Background Gene expression microarray and other multiplex data hold promise for addressing the challenges of cellular complexity, refined diagnoses and the discovery of well-targeted treatments. A new approach to the construction and quantification of transcriptional regulatory networks (TRNs) is presented that integrates gene expression microarray data and cell modeling through information theory. Given a partial TRN and time series data, a probability density is constructed that is a functional of the time course of transcription factor (TF) thermodynamic activities at the site of gene control, and is a function of mRNA degradation and transcription rate coefficients, and equilibrium constants for TF/gene binding. Results Our approach yields more physicochemical information that compliments the results of network structure delineation methods, and thereby can serve as an element of a comprehensive TRN discovery/quantification system. The most probable TF time courses and values of the aforementioned parameters are obtained by maximizing the probability obtained through entropy maximization. Observed time delays between mRNA expression and activity are accounted for implicitly since the time course of the activity of a TF is coupled by probability functional maximization, and is not assumed to be proportional to expression level of the mRNA type that translates into the TF. This allows one to investigate post-translational and TF activation mechanisms of gene regulation. Accuracy and robustness of the method are evaluated. A kinetic formulation is used to facilitate the analysis of phenomena with a strongly dynamical character while a physically-motivated regularization of the TF time course is found to overcome difficulties due to omnipresent noise and data sparsity that plague other methods of gene expression data analysis. An application to Escherichia coli is presented. Conclusion Multiplex time series data can be used for the construction of the network of

  8. Crystal structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn2+-binding FCD domains

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Meiying; Cooper, David; Grossoehmerb, Nickolas; Yu, Minmin; Hung, Li-Wei; Cieslik, Murcin; Derewendaro, Urszula; Lesley, Scott; Wilson, Ian; Giedrocb, David; Derewenda, Zygmunt

    2009-06-06

    The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged helix (WH) DNA-binding domains and diverse C-terminal, regulatory domains, which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all a-helical regulatory domains classified into two related Pfam families: FadR{_}C and FCD. Only two crystal structures of the FadR family members, i.e. the E. coli FadR protein and the LldR from C. glutamicum, have been described to date in literature. Here we describe the crystal structure of TM0439, a GntR regulator with an FCD domain, found in the Thermotoga maritima genome. The FCD domain is similar to that of the LldR regulator, and contains a buried metal binding site. Using atomic absorption spectroscopy and Trp fluorescence, we show that the recombinant protein contains bound Ni{sup 2+} ions, but it is able to bind Zn{sup 2+} with K{sub D} < 70 nM . We conclude that Zn{sup 2+} is the likely physiological metal, where it may perform either or both structural and regulatory roles. Finally, we compare the TM0439 structure to two other FadR family structures recently deposited by Structural Genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors.

  9. Structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn2+-binding FCD domains

    International Nuclear Information System (INIS)

    Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.; Yu, Minmin; Hung, Li-Wei; Cieslik, Marcin; Derewenda, Urszula; Lesley, Scott A.; Wilson, Ian A.; Giedroc, David P.; Derewenda, Zygmunt S.

    2009-01-01

    Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR-C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacterium glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni 2+ ions but that it is able to bind Zn 2+ with K d < 70 nM. It is concluded that Zn 2+ is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors

  10. Regulatory elements involved in the post-transcriptional control of stage-specific gene expression in Trypanosoma cruzi: a review

    Directory of Open Access Journals (Sweden)

    Patricia R Araújo

    2011-05-01

    Full Text Available Trypanosoma cruzi, a protozoan parasite that causes Chagas disease, exhibits unique mechanisms for gene expression such as constitutive polycistronic transcription of protein-coding genes, RNA editing and trans-splicing. In the absence of mechanism controlling transcription initiation, organized subsets of T. cruzi genes must be post-transcriptionally co-regulated in response to extracellular signals. The mechanisms that regulate stage-specific gene expression in this parasite have become much clearer through sequencing its whole genome as well as performing various proteomic and microarray analyses, which have demonstrated that at least half of the T. cruzi genes are differentially regulated during its life cycle. In this review, we attempt to highlight the recent advances in characterising cis and trans-acting elements in the T. cruzi genome that are involved in its post-transcriptional regulatory machinery.

  11. Association of sterol regulatory element-binding transcription factor gene polymorphisms with ischaemic stroke.

    Science.gov (United States)

    Jin, X; Zeng, F; Zhang, N; Huang, T; Meng, Q; Liu, Y

    2012-01-01

    To explore the association between polymorphisms of the sterol regulatory element-binding transcription factor (SREBF) gene and ischaemic stroke. The SREBF1c 54G>C and SREBPF2 1784G>C genotypes were assessed using restriction fragment length polymorphism analysis in 446 Han Chinese ischaemic stroke patients and 355 Han Chinese control subjects without cerebrovascular disease. The frequencies of the SREBF2 1784G>C CC genotype and the C allele were significantly higher in the ischaemic stroke group than in controls. Patients with ischaemic stroke who had the SREBF2 1784G>C CC genotype had significantly lower high-density lipoprotein (HDL) levels, compared with ischaemic stroke patients and control subjects with the GC or GG genotypes. Multivariate logistic regression analysis revealed a significant positive association between SREBF2 1784G>C and ischaemic stroke; an inverse association was observed between HDL level and risk of ischaemic stroke. The CC genotype of the SREBF2 1784G>C polymorphism was associated with an increased risk of ischaemic stroke, possibly through decreasing the HDL level, which was inversely associated with the risk of ischaemic stroke.

  12. Structure of a bacterial quorum-sensing transcription factor complexed with pheromone and DNA.

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, R.; Pappas, T.; Brace, J.; Miller, P.; Oulmassov, T.; Molyneaux, J.; Anderson, J.; Bashkin, J.; Winans, S.; Joachimiak, A.; Biosciences Division; Cornell Univ.; Monsanto Co.

    2002-06-27

    Many proteobacteria are able to monitor their population densities through the release of pheromones known as N-acylhomoserine lactones. At high population densities, these pheromones elicit diverse responses that include bioluminescence, biofilm formation, production of antimicrobials, DNA exchange, pathogenesis and symbiosis1. Many of these regulatory systems require a pheromone-dependent transcription factor similar to the LuxR protein of Vibrio fischeri. Here we present the structure of a LuxR-type protein. TraR of Agrobacterium tumefaciens was solved at 1.66 A as a complex with the pheromone N-3-oxooctanoyl-l-homoserine lactone (OOHL) and its TraR DNA-binding site. The amino-terminal domain of TraR is an {alpha}/{beta}/{alpha} sandwich that binds OOHL, whereas the carboxy-terminal domain contains a helix-turn-helix DNA-binding motif. The TraR dimer displays a two-fold symmetry axis in each domain; however, these two axes of symmetry are at an approximately 90 degree angle, resulting in a pronounced overall asymmetry of the complex. The pheromone lies fully embedded within the protein with virtually no solvent contact, and makes numerous hydrophobic contacts with the protein as well as four hydrogen bonds: three direct and one water-mediated.

  13. Boolean modelling reveals new regulatory connections between transcription factors orchestrating the development of the ventral spinal cord.

    KAUST Repository

    Lovrics, Anna

    2014-11-14

    We have assembled a network of cell-fate determining transcription factors that play a key role in the specification of the ventral neuronal subtypes of the spinal cord on the basis of published transcriptional interactions. Asynchronous Boolean modelling of the network was used to compare simulation results with reported experimental observations. Such comparison highlighted the need to include additional regulatory connections in order to obtain the fixed point attractors of the model associated with the five known progenitor cell types located in the ventral spinal cord. The revised gene regulatory network reproduced previously observed cell state switches between progenitor cells observed in knock-out animal models or in experiments where the transcription factors were overexpressed. Furthermore the network predicted the inhibition of Irx3 by Nkx2.2 and this prediction was tested experimentally. Our results provide evidence for the existence of an as yet undescribed inhibitory connection which could potentially have significance beyond the ventral spinal cord. The work presented in this paper demonstrates the strength of Boolean modelling for identifying gene regulatory networks.

  14. Functional role of pyruvate kinase from Lactobacillus bulgaricus in acid tolerance and identification of its transcription factor by bacterial one-hybrid.

    Science.gov (United States)

    Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling

    2015-11-19

    Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5'-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5'-TGTAAGCCCTAACA-3') upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network.

  15. The Campylobacter jejuni MarR-like transcriptional regulators RrpA and RrpB both influence bacterial responses to oxidative and aerobic stresses

    Directory of Open Access Journals (Sweden)

    Ozan eGundogdu

    2015-07-01

    Full Text Available The ability of the human intestinal pathogen Campylobacter jejuni to respond to oxidative stress is central to bacterial survival both in vivo during infection and in the environment. Re-annotation of the C. jejuni NCTC11168 genome revealed the presence of two MarR-type transcriptional regulators Cj1546 and Cj1556, originally annotated as hypothetical proteins, which we have designated RrpA and RrpB (regulator of response to peroxide respectively. Previously we demonstrated a role for RrpB in both oxidative and aerobic (O2 stress and that RrpB was a DNA binding protein with auto-regulatory activity, typical of MarR-type transcriptional regulators. In this study, we show that RrpA is also a DNA binding protein and that a rrpA mutant in strain 11168H exhibits increased sensitivity to hydrogen peroxide oxidative stress. Mutation of either rrpA or rrpB reduces catalase (KatA expression. However a rrpAB double mutant exhibits higher levels of resistance to hydrogen peroxide oxidative stress, with levels of KatA expression similar to the wild-type strain. Neither the rrpA nor rrpB mutant exhibits any significant difference in sensitivity to either cumene hydroperoxide or menadione oxidative stresses, but both mutants exhibit a reduced ability to survive aerobic (O2 stress, enhanced biofilm formation and reduced virulence in the Galleria mellonella infection model. The rrpAB double mutant exhibits wild-type levels of biofilm formation and wild-type levels of virulence in the Galleria mellonella infection model. Together these data indicate a role for both RrpA and RrpB in the C. jejuni peroxide oxidative and aerobic (O2 stress responses, enhancing bacterial survival in vivo and in the environment.

  16. Genome-wide targeting of the epigenetic regulatory protein CTCF to gene promoters by the transcription factor TFII-I.

    Science.gov (United States)

    Peña-Hernández, Rodrigo; Marques, Maud; Hilmi, Khalid; Zhao, Teijun; Saad, Amine; Alaoui-Jamali, Moulay A; del Rincon, Sonia V; Ashworth, Todd; Roy, Ananda L; Emerson, Beverly M; Witcher, Michael

    2015-02-17

    CCCTC-binding factor (CTCF) is a key regulator of nuclear chromatin structure and gene regulation. The impact of CTCF on transcriptional output is highly varied, ranging from repression to transcriptional pausing and transactivation. The multifunctional nature of CTCF may be directed solely through remodeling chromatin architecture. However, another hypothesis is that the multifunctional nature of CTCF is mediated, in part, through differential association with protein partners having unique functions. Consistent with this hypothesis, our mass spectrometry analyses of CTCF interacting partners reveal a previously undefined association with the transcription factor general transcription factor II-I (TFII-I). Biochemical fractionation of CTCF indicates that a distinct CTCF complex incorporating TFII-I is assembled on DNA. Unexpectedly, we found that the interaction between CTCF and TFII-I is essential for directing CTCF to the promoter proximal regulatory regions of target genes across the genome, particularly at genes involved in metabolism. At genes coregulated by CTCF and TFII-I, we find knockdown of TFII-I results in diminished CTCF binding, lack of cyclin-dependent kinase 8 (CDK8) recruitment, and an attenuation of RNA polymerase II phosphorylation at serine 5. Phenotypically, knockdown of TFII-I alters the cellular response to metabolic stress. Our data indicate that TFII-I directs CTCF binding to target genes, and in turn the two proteins cooperate to recruit CDK8 and enhance transcription initiation.

  17. Transcriptional regulatory networks downstream of TAL1/SCL in T-cell acute lymphoblastic leukemia

    OpenAIRE

    Palomero, Teresa; Odom, Duncan T.; O'Neil, Jennifer; Ferrando, Adolfo A.; Margolin, Adam; Neuberg, Donna S.; Winter, Stuart S.; Larson, Richard S.; Li, Wei; Liu, X. Shirley; Young, Richard A.; Look, A. Thomas

    2006-01-01

    Aberrant expression of 1 or more transcription factor oncogenes is a critical component of the molecular pathogenesis of human T-cell acute lymphoblastic leukemia (T-ALL); however, oncogenic transcriptional programs downstream of T-ALL oncogenes are mostly unknown. TAL1/SCL is a basic helix-loop-helix (bHLH) transcription factor oncogene aberrantly expressed in 60% of human T-ALLs. We used chromatin immunoprecipitation (ChIP) on chip to identify 71 direct transcriptional targets of TAL1/SCL. ...

  18. Global transcription profiling reveals differential responses to chronic nitrogen stress and putative nitrogen regulatory components in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Zhu Tong

    2007-08-01

    Full Text Available Abstract Background A large quantity of nitrogen (N fertilizer is used for crop production to achieve high yields at a significant economic and environmental cost. Efforts have been directed to understanding the molecular basis of plant responses to N and identifying N-responsive genes in order to manipulate their expression, thus enabling plants to use N more efficiently. No studies have yet delineated these responses at the transcriptional level when plants are grown under chronic N stress and the understanding of regulatory elements involved in N response is very limited. Results To further our understanding of the response of plants to varying N levels, a growth system was developed where N was the growth-limiting factor. An Arabidopsis whole genome microarray was used to evaluate global gene expression under different N conditions. Differentially expressed genes under mild or severe chronic N stress were identified. Mild N stress triggered only a small set of genes significantly different at the transcriptional level, which are largely involved in various stress responses. Plant responses were much more pronounced under severe N stress, involving a large number of genes in many different biological processes. Differentially expressed genes were also identified in response to short- and long-term N availability increases. Putative N regulatory elements were determined along with several previously known motifs involved in the responses to N and carbon availability as well as plant stress. Conclusion Differentially expressed genes identified provide additional insights into the coordination of the complex N responses of plants and the components of the N response mechanism. Putative N regulatory elements were identified to reveal possible new components of the regulatory network for plant N responses. A better understanding of the complex regulatory network for plant N responses will help lead to strategies to improve N use efficiency.

  19. Identification of regulatory network topological units coordinating the genome-wide transcriptional response to glucose in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Gosset Guillermo

    2007-06-01

    Full Text Available Abstract Background Glucose is the preferred carbon and energy source for Escherichia coli. A complex regulatory network coordinates gene expression, transport and enzyme activities in response to the presence of this sugar. To determine the extent of the cellular response to glucose, we applied an approach combining global transcriptome and regulatory network analyses. Results Transcriptome data from isogenic wild type and crp- strains grown in Luria-Bertani medium (LB or LB + 4 g/L glucose (LB+G were analyzed to identify differentially transcribed genes. We detected 180 and 200 genes displaying increased and reduced relative transcript levels in the presence of glucose, respectively. The observed expression pattern in LB was consistent with a gluconeogenic metabolic state including active transport and interconversion of small molecules and macromolecules, induction of protease-encoding genes and a partial heat shock response. In LB+G, catabolic repression was detected for transport and metabolic interconversion activities. We also detected an increased capacity for de novo synthesis of nucleotides, amino acids and proteins. Cluster analysis of a subset of genes revealed that CRP mediates catabolite repression for most of the genes displaying reduced transcript levels in LB+G, whereas Fis participates in the upregulation of genes under this condition. An analysis of the regulatory network, in terms of topological functional units, revealed 8 interconnected modules which again exposed the importance of Fis and CRP as directly responsible for the coordinated response of the cell. This effect was also seen with other not extensively connected transcription factors such as FruR and PdhR, which showed a consistent response considering media composition. Conclusion This work allowed the identification of eight interconnected regulatory network modules that includes CRP, Fis and other transcriptional factors that respond directly or indirectly to the

  20. Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism

    Science.gov (United States)

    Xu, Jie; Zhang, Huimin; Srinivas, Swaminath

    2013-01-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  1. Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks.

    Directory of Open Access Journals (Sweden)

    Mathilde de Taffin

    Full Text Available Collier, the single Drosophila COE (Collier/EBF/Olf-1 transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles.

  2. Chromatin reader L(3)mbt requires the Myb-MuvB/DREAM transcriptional regulatory complex for chromosomal recruitment.

    Science.gov (United States)

    Blanchard, Daniel P; Georlette, Daphne; Antoszewski, Lisa; Botchan, Michael R

    2014-10-07

    Lethal malignant brain tumors (lmbt) result from the loss of the conserved transcriptional repressor l(3)mbt, in Drosophila melanogaster. Similar mutations in the human homolog L3MBTL1 correlate with some cancers. The protein's C-terminal MBT repeats bind mono and dimethylated histones in vitro, which could influence recruitment of L3MBTL1 to its target sites. The L(3)mbt chromatin targeting mechanism, however, is controversial and several studies suggest insufficiency or a minor role for histone methylation in determining the site specificity for recruitment. We report that L(3)mbt colocalizes with core members of the Myb-MuvB/DREAM (MMB/DREAM) transcriptional regulatory complex genome-wide, and that L(3)mbt-mediated repression requires this complex in salivary glands and larval brains. Loss of l(3)mbt or of MMB components through mutation cause similar spurious expression of genes, including the transposon regulatory gene piwi, in terminally differentiated cells. The DNA-binding MMB core component Mip120 (Lin54) is required for L(3)mbt recruitment to chromosomes, whereas Mip130 (Lin9) (an MMB core protein) and E2f2 (an MMB transcriptional repressor) are not, but are essential for repression. Cytolocalization experiments suggest the presence of site-specific differential composition of MMB in polytene chromosomes where some loci were bound by a Myb-containing or alternatively, an E2f2 and L(3)mbt form of the complex.

  3. Making Sense of Multifunctional Proteins: Human Immunodeficiency Virus Type 1 Accessory and Regulatory Proteins and Connections to Transcription.

    Science.gov (United States)

    Faust, Tyler B; Binning, Jennifer M; Gross, John D; Frankel, Alan D

    2017-09-29

    Viruses are completely dependent upon cellular machinery to support replication and have therefore developed strategies to co-opt cellular processes to optimize infection and counter host immune defenses. Many viruses, including human immunodeficiency virus type 1 (HIV-1), encode a relatively small number of genes. Viruses with limited genetic content often encode multifunctional proteins that function at multiple stages of the viral replication cycle. In this review, we discuss the functions of HIV-1 regulatory (Tat and Rev) and accessory (Vif, Vpr, Vpu, and Nef) proteins. Each of these proteins has a highly conserved primary activity; however, numerous additional activities have been attributed to these viral proteins. We explore the possibility that HIV-1 proteins leverage their multifunctional nature to alter host transcriptional networks to elicit a diverse set of cellular responses. Although these transcriptional effects appear to benefit the virus, it is not yet clear whether they are strongly selected for during viral evolution or are a ripple effect from the primary function. As our detailed knowledge of these viral proteins improves, we will undoubtedly uncover how the multifunctional nature of these HIV-1 regulatory and accessory proteins, and in particular their transcriptional functions, work to drive viral pathogenesis.

  4. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression

    Science.gov (United States)

    Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.

    2016-01-01

    SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798

  5. RAV transcription factors are essential for disease resistance against cassava bacterial blight via activation of melatonin biosynthesis genes.

    Science.gov (United States)

    Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao

    2018-01-01

    With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Transcription factor retention on mitotic chromosomes: regulatory mechanisms and impact on cell fate decisions.

    Science.gov (United States)

    Raccaud, Mahé; Suter, David M

    2017-09-01

    During mitosis, gene transcription stops, and the bulk of DNA-binding proteins are excluded from condensed chromosomes. While most gene-specific transcription factors are largely evicted from mitotic chromosomes, a subset remains bound to specific and non-specific DNA sites. Here, we review the current knowledge on the mechanisms leading to the retention of a subset of transcription factors on mitotic chromosomes and discuss the implications in gene expression regulation and their potential as an epigenetic mechanism controlling stem cell self-renewal and differentiation. © 2017 Federation of European Biochemical Societies.

  7. The colitis-associated transcriptional profile of commensal Bacteroides thetaiotaomicron enhances adaptive immune responses to a bacterial antigen.

    Directory of Open Access Journals (Sweden)

    Jonathan J Hansen

    Full Text Available Inflammatory bowel diseases (IBD may be caused in part by aberrant immune responses to commensal intestinal microbes including the well-characterized anaerobic gut commensal Bacteroides thetaiotaomicron (B. theta. Healthy, germ-free HLA-B27 transgenic (Tg rats develop chronic colitis when colonized with complex gut commensal bacteria whereas non-transgenic (nTg rats remain disease-free. However, the role of B. theta in causing disease in Tg rats is unknown nor is much known about how gut microbes respond to host inflammation.Tg and nTg rats were monoassociated with a human isolate of B. theta. Colonic inflammation was assessed by histologic scoring and tissue pro-inflammatory cytokine measurement. Whole genome transcriptional profiling of B. theta recovered from ceca was performed using custom GeneChips and data analyzed using dChip, Significance Analysis of Microarrays, and Gene Set Enrichment Analysis (GSEA software. Western Blots were used to determine adaptive immune responses to a differentially expressed B. theta gene.B. theta monoassociated Tg rats, but not nTg or germ-free controls, developed chronic colitis. Transcriptional profiles of cecal B. theta were significantly different in Tg vs. nTg rats. GSEA revealed that genes in KEGG canonical pathways involved in bacterial growth and metabolism were downregulated in B. theta from Tg rats with colitis though luminal bacterial concentrations were unaffected. Bacterial genes in the Gene Ontology molecular function "receptor activity", most of which encode nutrient binding proteins, were significantly upregulated in B. theta from Tg rats and include a SusC homolog that induces adaptive immune responses in Tg rats.B. theta induces colitis in HLA-B27 Tg rats, which is associated with regulation of bacterial genes in metabolic and nutrient binding pathways that may affect host immune responses. These studies of the host-microbial dialogue may lead to the identification of novel microbial targets

  8. Developmentally Regulated Recruitment of Transcription Factors and Chromatin Modification Activities to Chicken Lysozyme cis-Regulatory Elements In Vivo

    Science.gov (United States)

    Lefevre, Pascal; Melnik, Svitlana; Wilson, Nicola; Riggs, Arthur D.; Bonifer, Constanze

    2003-01-01

    Expression of the chicken lysozyme gene is upregulated during macrophage differentiation and reaches its highest level in bacterial lipopolysaccharide (LPS)-stimulated macrophages. This is accompanied by complex alterations in chromatin structure. We have previously shown that chromatin fine-structure alterations precede the onset of gene expression in macrophage precursor cells and mark the lysozyme chromatin domain for expression later in development. To further examine this phenomenon and to investigate the basis for the differentiation-dependent alterations of lysozyme chromatin, we studied the recruitment of transcription factors to the lysozyme locus in vivo at different stages of myeloid differentiation. Factor recruitment occurred in several steps. First, early-acting transcription factors such as NF1 and Fli-1 bound to a subset of enhancer elements and recruited CREB-binding protein. LPS stimulation led to an additional recruitment of C/EBPβ and a significant change in enhancer and promoter structure. Transcription factor recruitment was accompanied by specific changes in histone modification within the lysozyme chromatin domain. Interestingly, we present evidence for a transient interaction of transcription factors with lysozyme chromatin in lysozyme-nonexpressing macrophage precursors, which was accompanied by a partial demethylation of CpG sites. This indicates that a partially accessible chromatin structure of lineage-specific genes is a hallmark of hematopoietic progenitor cells. PMID:12773578

  9. A Direct Regulatory Interaction between Chaperonin TRiC and Stress-Responsive Transcription Factor HSF1

    Directory of Open Access Journals (Sweden)

    Daniel W. Neef

    2014-11-01

    Full Text Available Heat shock transcription factor 1 (HSF1 is an evolutionarily conserved transcription factor that protects cells from protein-misfolding-induced stress and apoptosis. The mechanisms by which cytosolic protein misfolding leads to HSF1 activation have not been elucidated. Here, we demonstrate that HSF1 is directly regulated by TRiC/CCT, a central ATP-dependent chaperonin complex that folds cytosolic proteins. A small-molecule activator of HSF1, HSF1A, protects cells from stress-induced apoptosis, binds TRiC subunits in vivo and in vitro, and inhibits TRiC activity without perturbation of ATP hydrolysis. Genetic inactivation or depletion of the TRiC complex results in human HSF1 activation, and HSF1A inhibits the direct interaction between purified TRiC and HSF1 in vitro. These results demonstrate a direct regulatory interaction between the cytosolic chaperone machine and a critical transcription factor that protects cells from proteotoxicity, providing a mechanistic basis for signaling perturbations in protein folding to a stress-protective transcription factor.

  10. The TEAD/TEF family protein Scalloped mediates transcriptional output of the Hippo growth-regulatory pathway.

    Science.gov (United States)

    Wu, Shian; Liu, Yi; Zheng, Yonggang; Dong, Jixin; Pan, Duojia

    2008-03-01

    The Hippo (Hpo) kinase cascade restricts tissue growth by inactivating the transcriptional coactivator Yorkie (Yki), which regulates the expression of target genes such as the cell death inhibitor diap1 by unknown mechanisms. Here we identify the TEAD/TEF family protein Scalloped (Sd) as a DNA-binding transcription factor that partners with Yki to mediate the transcriptional output of the Hpo growth-regulatory pathway. The diap1 (th) locus harbors a minimal Sd-binding Hpo Responsive Element (HRE) that mediates transcriptional regulation by the Hpo pathway. Sd binds directly to Yki, and a Yki missense mutation that abrogates Sd-Yki binding also inactivates Yki function in vivo. We further demonstrate that sd is required for yki-induced tissue overgrowth and target gene expression, and that sd activity is conserved in its mammalian homolog. Our results uncover a heretofore missing link in the Hpo signaling pathway and provide a glimpse of the molecular events on a Hpo-responsive enhancer element.

  11. Identifying significant genetic regulatory networks in the prostate cancer from microarray data based on transcription factor analysis and conditional independency

    Directory of Open Access Journals (Sweden)

    Yeh Cheng-Yu

    2009-12-01

    Full Text Available Abstract Background Prostate cancer is a world wide leading cancer and it is characterized by its aggressive metastasis. According to the clinical heterogeneity, prostate cancer displays different stages and grades related to the aggressive metastasis disease. Although numerous studies used microarray analysis and traditional clustering method to identify the individual genes during the disease processes, the important gene regulations remain unclear. We present a computational method for inferring genetic regulatory networks from micorarray data automatically with transcription factor analysis and conditional independence testing to explore the potential significant gene regulatory networks that are correlated with cancer, tumor grade and stage in the prostate cancer. Results To deal with missing values in microarray data, we used a K-nearest-neighbors (KNN algorithm to determine the precise expression values. We applied web services technology to wrap the bioinformatics toolkits and databases to automatically extract the promoter regions of DNA sequences and predicted the transcription factors that regulate the gene expressions. We adopt the microarray datasets consists of 62 primary tumors, 41 normal prostate tissues from Stanford Microarray Database (SMD as a target dataset to evaluate our method. The predicted results showed that the possible biomarker genes related to cancer and denoted the androgen functions and processes may be in the development of the prostate cancer and promote the cell death in cell cycle. Our predicted results showed that sub-networks of genes SREBF1, STAT6 and PBX1 are strongly related to a high extent while ETS transcription factors ELK1, JUN and EGR2 are related to a low extent. Gene SLC22A3 may explain clinically the differentiation associated with the high grade cancer compared with low grade cancer. Enhancer of Zeste Homolg 2 (EZH2 regulated by RUNX1 and STAT3 is correlated to the pathological stage

  12. [P53-mediated Regulatory Mechanism of Ran Transcription in Multiple Myeloma Cells].

    Science.gov (United States)

    Yuan, Lei; Gu, Zhen-Yang; Gao, Chun-Ji

    2016-06-01

    To investigate the role of p53 on ran transcription in myeloma cells. Using real-time fluorescence quantitative PCR, the ran transcription level was measured in 8 human myeloma cell lines such as OPM-2, RPMI-8226, U-266, KAS6/1, ANML-6, H-929, MM1.S and MOLP-8. The ran transcription level and P53 expression were detected by Q-PCR in MM1.S treated with Nutlin-3a for 24, 48 and 72 hours, respectively. The Western blot was used to detect the expression levels of ran and P53 proteins, and ran expression level after transfection of MM1.S cells using different concentration of plasmids which express the P53 luciferase reporter. H-929 and MM1.S cells showed the highest ran transcription level among the above-mentioned 8 cell lines (P<0.05). After treatment with Nutlin-3a, ran transcription level in MM1.S cells decreased (P<0.05), (r=-1.00, P=0.04) and P53 expression increased (r=1.00, P=0.06) in time-dependence manner. The detection by p53 luciferase reporter showed that the ran transcription decreased and the plasmid increased to 25 ng (P<0.05). This study demonstrated that ran is a target gene regulated by P53 in myeloma cells for the first time.

  13. Identification of cis-regulatory sequences that activate transcription in the suspensor of plant embryos.

    Science.gov (United States)

    Kawashima, Tomokazu; Wang, Xingjun; Henry, Kelli F; Bi, Yuping; Weterings, Koen; Goldberg, Robert B

    2009-03-03

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the scarlet runner bean (Phaseolus coccineus) G564 gene to understand how genes are activated specifically within the suspensor during early embryo development. Previously, we showed that the G564 upstream region has a block of tandem repeats, which contain a conserved 10-bp motif (GAAAAG(C)/(T)GAA), and that deletion of these repeats results in a loss of suspensor transcription. Here, we use gain-of-function (GOF) experiments with transgenic globular-stage tobacco embryos to show that only 1 of the 5 tandem repeats is required to drive suspensor-specific transcription. Fine-scale deletion and scanning mutagenesis experiments with 1 tandem repeat uncovered a 54-bp region that contains all of the sequences required to activate transcription in the suspensor, including the 10-bp motif (GAAAAGCGAA) and a similar 10-bp-like motif (GAAAAACGAA). Site-directed mutagenesis and GOF experiments indicated that both the 10-bp and 10-bp-like motifs are necessary, but not sufficient to activate transcription in the suspensor, and that a sequence (TTGGT) between the 10-bp and the 10-bp-like motifs is also necessary for suspensor transcription. Together, these data identify sequences that are required to activate transcription in the suspensor of a plant embryo after fertilization.

  14. An NF-κB Transcription-Factor-Dependent Lineage-Specific Transcriptional Program Promotes Regulatory T Cell Identity and Function.

    Science.gov (United States)

    Oh, Hyunju; Grinberg-Bleyer, Yenkel; Liao, Will; Maloney, Dillon; Wang, Pingzhang; Wu, Zikai; Wang, Jiguang; Bhatt, Dev M; Heise, Nicole; Schmid, Roland M; Hayden, Matthew S; Klein, Ulf; Rabadan, Raul; Ghosh, Sankar

    2017-09-19

    Both conventional T (Tconv) cells and regulatory T (Treg) cells are activated through ligation of the T cell receptor (TCR) complex, leading to the induction of the transcription factor NF-κB. In Tconv cells, NF-κB regulates expression of genes essential for T cell activation, proliferation, and function. However the role of NF-κB in Treg function remains unclear. We conditionally deleted canonical NF-κB members p65 and c-Rel in developing and mature Treg cells and found they have unique but partially redundant roles. c-Rel was critical for thymic Treg development while p65 was essential for mature Treg identity and maintenance of immune tolerance. Transcriptome and NF-κB p65 binding analyses demonstrated a lineage specific, NF-κB-dependent transcriptional program, enabled by enhanced chromatin accessibility. These dual roles of canonical NF-κB in Tconv and Treg cells highlight the functional plasticity of the NF-κB signaling pathway and underscores the need for more selective strategies to therapeutically target NF-κB. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. A Regulatory Circuit Composed of a Transcription Factor, IscR, and a Regulatory RNA, RyhB, Controls Fe-S Cluster Delivery

    Directory of Open Access Journals (Sweden)

    Pierre Mandin

    2016-09-01

    Full Text Available Fe-S clusters are cofactors conserved through all domains of life. Once assembled by dedicated ISC and/or SUF scaffolds, Fe-S clusters are conveyed to their apo-targets via A-type carrier proteins (ATCs. Escherichia coli possesses four such ATCs. ErpA is the only ATC essential under aerobiosis. Recent studies reported a possible regulation of the erpA mRNA by the small RNA (sRNA RyhB, which controls the expression of many genes under iron starvation. Surprisingly, erpA has not been identified in recent transcriptomic analysis of the iron starvation response, thus bringing into question the actual physiological significance of the putative regulation of erpA by RyhB. Using an sRNA library, we show that among 26 sRNAs, only RyhB represses the expression of an erpA-lacZ translational fusion. We further demonstrate that this repression occurs during iron starvation. Using mutational analysis, we show that RyhB base pairs to the erpA mRNA, inducing its disappearance. In addition, IscR, the master regulator of Fe-S homeostasis, represses expression of erpA at the transcriptional level when iron is abundant, but depleting iron from the medium alleviates this repression. The conjunction of transcriptional derepression by IscR and posttranscriptional repression by RyhB under Fe-limiting conditions is best described as an incoherent regulatory circuit. This double regulation allows full expression of erpA at iron concentrations for which Fe-S biogenesis switches from the ISC to the SUF system. We further provide evidence that this regulatory circuit coordinates ATC usage to iron availability.

  16. Comparative study of discretization methods of microarray data for inferring transcriptional regulatory networks

    Directory of Open Access Journals (Sweden)

    Ji Wei

    2010-10-01

    Full Text Available Abstract Background Microarray data discretization is a basic preprocess for many algorithms of gene regulatory network inference. Some common discretization methods in informatics are used to discretize microarray data. Selection of the discretization method is often arbitrary and no systematic comparison of different discretization has been conducted, in the context of gene regulatory network inference from time series gene expression data. Results In this study, we propose a new discretization method "bikmeans", and compare its performance with four other widely-used discretization methods using different datasets, modeling algorithms and number of intervals. Sensitivities, specificities and total accuracies were calculated and statistical analysis was carried out. Bikmeans method always gave high total accuracies. Conclusions Our results indicate that proper discretization methods can consistently improve gene regulatory network inference independent of network modeling algorithms and datasets. Our new method, bikmeans, resulted in significant better total accuracies than other methods.

  17. Patterns of Transcriptional Response to 1,25-Dihydroxyvitamin D3 and Bacterial Lipopolysaccharide in Primary Human Monocytes

    Directory of Open Access Journals (Sweden)

    Silvia N. Kariuki

    2016-05-01

    Full Text Available The active form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25D, plays an important immunomodulatory role, regulating transcription of genes in the innate and adaptive immune system. The present study examines patterns of transcriptome-wide response to 1,25D, and the bacterial lipopolysaccharide (LPS in primary human monocytes, to elucidate pathways underlying the effects of 1,25D on the immune system. Monocytes obtained from healthy individuals of African-American and European-American ancestry were treated with 1,25D, LPS, or both, simultaneously. The addition of 1,25D during stimulation with LPS induced significant upregulation of genes in the antimicrobial and autophagy pathways, and downregulation of proinflammatory response genes compared to LPS treatment alone. A joint Bayesian analysis enabled clustering of genes into patterns of shared transcriptional response across treatments. The biological pathways enriched within these expression patterns highlighted several mechanisms through which 1,25D could exert its immunomodulatory role. Pathways such as mTOR signaling, EIF2 signaling, IL-8 signaling, and Tec Kinase signaling were enriched among genes with opposite transcriptional responses to 1,25D and LPS, respectively, highlighting the important roles of these pathways in mediating the immunomodulatory activity of 1,25D. Furthermore, a subset of genes with evidence of interethnic differences in transcriptional response was also identified, suggesting that in addition to the well-established interethnic variation in circulating levels of vitamin D, the intensity of transcriptional response to 1,25D and LPS also varies between ethnic groups. We propose that dysregulation of the pathways identified in this study could contribute to immune-mediated disease risk.

  18. Overlapping Podospora anserina transcriptional responses to bacterial and fungal non self indicate a multilayered innate immune response

    Directory of Open Access Journals (Sweden)

    Marina eLamacchia

    2016-04-01

    Full Text Available Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI, a genetically controlled process initiating a programmed cell death (PCD leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the

  19. Overlapping Podospora anserina Transcriptional Responses to Bacterial and Fungal Non Self Indicate a Multilayered Innate Immune Response.

    Science.gov (United States)

    Lamacchia, Marina; Dyrka, Witold; Breton, Annick; Saupe, Sven J; Paoletti, Mathieu

    2016-01-01

    Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI), a genetically controlled process initiating a programmed cell death (PCD) leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR) immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the fungus while most

  20. Likelihood for transcriptions in a genetic regulatory system under asymmetric stable Lévy noise

    Science.gov (United States)

    Wang, Hui; Cheng, Xiujun; Duan, Jinqiao; Kurths, Jürgen; Li, Xiaofan

    2018-01-01

    This work is devoted to investigating the evolution of concentration in a genetic regulation system, when the synthesis reaction rate is under additive and multiplicative asymmetric stable Lévy fluctuations. By focusing on the impact of skewness (i.e., non-symmetry) in the probability distributions of noise, we find that via examining the mean first exit time (MFET) and the first escape probability (FEP), the asymmetric fluctuations, interacting with nonlinearity in the system, lead to peculiar likelihood for transcription. This includes, in the additive noise case, realizing higher likelihood of transcription for larger positive skewness (i.e., asymmetry) index β, causing a stochastic bifurcation at the non-Gaussianity index value α = 1 (i.e., it is a separating point or line for the likelihood for transcription), and achieving a turning point at the threshold value β≈-0.5 (i.e., beyond which the likelihood for transcription suddenly reversed for α values). The stochastic bifurcation and turning point phenomena do not occur in the symmetric noise case (β = 0). While in the multiplicative noise case, non-Gaussianity index value α = 1 is a separating point or line for both the MFET and the FEP. We also investigate the noise enhanced stability phenomenon. Additionally, we are able to specify the regions in the whole parameter space for the asymmetric noise, in which we attain desired likelihood for transcription. We have conducted a series of numerical experiments in "regulating" the likelihood of gene transcription by tuning asymmetric stable Lévy noise indexes. This work offers insights for possible ways of achieving gene regulation in experimental research.

  1. Take it of leave it : Mechanisms underlying bacterial bistable regulatory networks

    NARCIS (Netherlands)

    Siebring, Jeroen; Sorg, Robin; Herber, Martijn; Kuipers, Oscar; Filloux, Alain A.M.

    2012-01-01

    Bistable switches occur in regulatory networks that can exist in two distinct stable states. Such networks allow distinct switching of individual cells. In bacteria these switches coexist with regulatory networks that respond gradually to environmental input. Bistable switches play key roles in high

  2. Iron Starvation Conditions Upregulate Ehrlichia ruminantium Type IV Secretion System, tr1 Transcription Factor and map1 Genes Family through the Master Regulatory Protein ErxR

    Directory of Open Access Journals (Sweden)

    Amal Moumène

    2018-01-01

    Full Text Available Ehrlichia ruminantium is an obligatory intracellular bacterium that causes heartwater, a fatal disease in ruminants. Due to its intracellular nature, E. ruminantium requires a set of specific virulence factors, such as the type IV secretion system (T4SS, and outer membrane proteins (Map proteins in order to avoid and subvert the host's immune response. Several studies have been conducted to understand the regulation of the T4SS or outer membrane proteins, in Ehrlichia, but no integrated approach has been used to understand the regulation of Ehrlichia pathogenicity determinants in response to environmental cues. Iron is known to be a key nutrient for bacterial growth both in the environment and within hosts. In this study, we experimentally demonstrated the regulation of virB, map1, and tr1 genes by the newly identified master regulator ErxR (for Ehrlichia ruminantium expression regulator. We also analyzed the effect of iron depletion on the expression of erxR gene, tr1 transcription factor, T4SS and map1 genes clusters in E. ruminantium. We show that exposure of E. ruminantium to iron starvation induces erxR and subsequently tr1, virB, and map1 genes. Our results reveal tight co-regulation of T4SS and map1 genes via the ErxR regulatory protein at the transcriptional level, and, for the first time link map genes to the virulence function sensu stricto, thereby advancing our understanding of Ehrlichia's infection process. These results suggest that Ehrlichia is able to sense changes in iron concentrations in the environment and to regulate the expression of virulence factors accordingly.

  3. Restriction of IL-22-producing T cell responses and differential regulation of regulatory T cell compartments by zinc finger transcription factor Ikaros.

    Science.gov (United States)

    Heller, Jennifer J; Schjerven, Hilde; Li, Shiyang; Lee, Aileen; Qiu, Ju; Chen, Zong-Ming E; Smale, Stephen T; Zhou, Liang

    2014-10-15

    Proper immune responses are needed to control pathogen infection at mucosal surfaces. IL-22-producing CD4(+) T cells play an important role in controlling bacterial infection in the gut; however, transcriptional regulation of these cells remains elusive. In this study, we show that mice with targeted deletion of the fourth DNA-binding zinc finger of the transcription factor Ikaros had increased IL-22-producing, but not IL-17-producing, CD4(+) T cells in the gut. Adoptive transfer of CD4(+) T cells from these Ikaros-mutant mice conferred enhanced mucosal immunity against Citrobacter rodentium infection. Despite an intact in vivo thymic-derived regulatory T cell (Treg) compartment in these Ikaros-mutant mice, TGF-β, a cytokine well known for induction of Tregs, failed to induce Foxp3 expression in Ikaros-mutant CD4(+) T cells in vitro and, instead, promoted IL-22. Aberrant upregulation of IL-21 in CD4(+) T cells expressing mutant Ikaros was responsible, at least in part, for the enhanced IL-22 expression in a Stat3-dependent manner. Genetic analysis using compound mutations further demonstrated that the aryl hydrocarbon receptor, but not RORγt, was required for aberrant IL-22 expression by Ikaros-mutant CD4(+) T cells, whereas forced expression of Foxp3 was sufficient to inhibit this aberrant cytokine production. Together, our data identified new functions for Ikaros in maintaining mucosal immune homeostasis by restricting IL-22 production by CD4(+) T cells. Copyright © 2014 by The American Association of Immunologists, Inc.

  4. Comparative analysis of regulatory elements between Escherichia coli and Klebsiella pneumoniae by genome-wide transcription start site profiling.

    Directory of Open Access Journals (Sweden)

    Donghyuk Kim

    Full Text Available Genome-wide transcription start site (TSS profiles of the enterobacteria Escherichia coli and Klebsiella pneumoniae were experimentally determined through modified 5' RACE followed by deep sequencing of intact primary mRNA. This identified 3,746 and 3,143 TSSs for E. coli and K. pneumoniae, respectively. Experimentally determined TSSs were then used to define promoter regions and 5' UTRs upstream of coding genes. Comparative analysis of these regulatory elements revealed the use of multiple TSSs, identical sequence motifs of promoter and Shine-Dalgarno sequence, reflecting conserved gene expression apparatuses between the two species. In both species, over 70% of primary transcripts were expressed from operons having orthologous genes during exponential growth. However, expressed orthologous genes in E. coli and K. pneumoniae showed a strikingly different organization of upstream regulatory regions with only 20% identical promoters with TSSs in both species. Over 40% of promoters had TSSs identified in only one species, despite conserved promoter sequences existing in the other species. 662 conserved promoters having TSSs in both species resulted in the same number of comparable 5' UTR pairs, and that regulatory element was found to be the most variant region in sequence among promoter, 5' UTR, and ORF. In K. pneumoniae, 48 sRNAs were predicted and 36 of them were expressed during exponential growth. Among them, 34 orthologous sRNAs between two species were analyzed in depth, and the analysis showed that many sRNAs of K. pneumoniae, including pleiotropic sRNAs such as rprA, arcZ, and sgrS, may work in the same way as in E. coli. These results reveal a new dimension of comparative genomics such that a comparison of two genomes needs to be comprehensive over all levels of genome organization.

  5. Bacterial gene expression detected in human faeces by reverse transcription-PCR

    NARCIS (Netherlands)

    Fitzsimons, N.A.; Akkermans, A.D.L.; Vos, de W.M.; Vaughan, E.E.

    2003-01-01

    A method to isolate and specifically detect bacterial messenger RNA (mRNA) in human faeces is presented. The surface layer protein gene slpA of Lactobacillus acidophilus ATCC 4356(T) was chosen as a model system because it is transcribed at a high level to a relatively stable mRNA (Boot et al.,

  6. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  7. Bovine proteins containing poly-glutamine repeats are often polymorphic and enriched for components of transcriptional regulatory complexes

    LENUS (Irish Health Repository)

    Whan, Vicki

    2010-11-23

    Abstract Background About forty human diseases are caused by repeat instability mutations. A distinct subset of these diseases is the result of extreme expansions of polymorphic trinucleotide repeats; typically CAG repeats encoding poly-glutamine (poly-Q) tracts in proteins. Polymorphic repeat length variation is also apparent in human poly-Q encoding genes from normal individuals. As these coding sequence repeats are subject to selection in mammals, it has been suggested that normal variations in some of these typically highly conserved genes are implicated in morphological differences between species and phenotypic variations within species. At present, poly-Q encoding genes in non-human mammalian species are poorly documented, as are their functions and propensities for polymorphic variation. Results The current investigation identified 178 bovine poly-Q encoding genes (Q ≥ 5) and within this group, 26 genes with orthologs in both human and mouse that did not contain poly-Q repeats. The bovine poly-Q encoding genes typically had ubiquitous expression patterns although there was bias towards expression in epithelia, brain and testes. They were also characterised by unusually large sizes. Analysis of gene ontology terms revealed that the encoded proteins were strongly enriched for functions associated with transcriptional regulation and many contributed to physical interaction networks in the nucleus where they presumably act cooperatively in transcriptional regulatory complexes. In addition, the coding sequence CAG repeats in some bovine genes impacted mRNA splicing thereby generating unusual transcriptional diversity, which in at least one instance was tissue-specific. The poly-Q encoding genes were prioritised using multiple criteria for their likelihood of being polymorphic and then the highest ranking group was experimentally tested for polymorphic variation within a cattle diversity panel. Extensive and meiotically stable variation was identified

  8. Live Staphylococcus aureus and bacterial soluble factors induce different transcriptional responses in human airway cells.

    Science.gov (United States)

    Moreilhon, Chimène; Gras, Delphine; Hologne, Coralie; Bajolet, Odile; Cottrez, Françoise; Magnone, Virginie; Merten, Marc; Groux, Hervé; Puchelle, Edith; Barbry, Pascal

    2005-02-10

    To characterize the response of respiratory epithelium to infection by Staphylococcus aureus (S. aureus), human airway cells were incubated for 1 to 24 h with a supernatant of a S. aureus culture (bacterial supernatant), then profiled with a pangenomic DNA microarray. Because an upregulation of many genes was noticed around 3 h, three independent approaches were then used to characterize the host response to a 3-h contact either with bacterial supernatant or with live bacteria: 1) a DNA microarray containing 4,200 sequence-verified probes, 2) a semiquantitative RT-PCR with a set of 537 pairs of validated primers, or 3) ELISA assay of IL-8, IL-6, TNFalpha, and PGE(2). Among others, Fos, Jun, and EGR-1 were upregulated by the bacterial supernatant and by live bacteria. Increased expression of bhlhb2 and Mig-6, promoter regions which harbor HIF responding elements, was explained by an increased expression of the HIF-1alpha protein. Activation of the inducible form of cyclooxygenase, COX-2, and of the interleukins IL-1, IL-6, and IL-8, as well as of the NF-kappaB pathway, was observed preferentially in cells in contact with bacterial supernatant. Early infection was characterized by an upregulation of anti-apoptotic genes and a downregulation of pro-apoptotic genes. This correlated with a necrotic, rather than apoptotic cell death. Overall, this first global description of an airway epithelial infection by S. aureus demonstrates a larger global response to bacterial supernatant (in term of altered genes and variation factors) than to exponentially growing live bacteria.

  9. The post-transcriptional regulatory system CSR controls the balance of metabolic pools in upper glycolysis of Escherichia coli.

    Science.gov (United States)

    Morin, Manon; Ropers, Delphine; Letisse, Fabien; Laguerre, Sandrine; Portais, Jean-Charles; Cocaign-Bousquet, Muriel; Enjalbert, Brice

    2016-05-01

    Metabolic control in Escherichia coli is a complex process involving multilevel regulatory systems but the involvement of post-transcriptional regulation is uncertain. The post-transcriptional factor CsrA is stated as being the only regulator essential for the use of glycolytic substrates. A dozen enzymes in the central carbon metabolism (CCM) have been reported as potentially controlled by CsrA, but its impact on the CCM functioning has not been demonstrated. Here, a multiscale analysis was performed in a wild-type strain and its isogenic mutant attenuated for CsrA (including growth parameters, gene expression levels, metabolite pools, abundance of enzymes and fluxes). Data integration and regulation analysis showed a coordinated control of the expression of glycolytic enzymes. This also revealed the imbalance of metabolite pools in the csrA mutant upper glycolysis, before the phosphofructokinase PfkA step. This imbalance is associated with a glucose-phosphate stress. Restoring PfkA activity in the csrA mutant strain suppressed this stress and increased the mutant growth rate on glucose. Thus, the carbon storage regulator system is essential for the effective functioning of the upper glycolysis mainly through its control of PfkA. This work demonstrates the pivotal role of post-transcriptional regulation to shape the carbon metabolism. © 2016 John Wiley & Sons Ltd.

  10. Transcriptional and Translational Regulatory Responses to Iron Limitation in the Globally Distributed Marine Bacterium Candidatus Pelagibacter ubique

    Science.gov (United States)

    Smith, Daniel P.; Kitner, Joshua B.; Norbeck, Angela D.; Clauss, Therese R.; Lipton, Mary S.; Schwalbach, Michael S.; Steindler, Laura; Nicora, Carrie D.; Smith, Richard D.; Giovannoni, Stephen J.

    2010-01-01

    Iron is recognized as an important micronutrient that limits microbial plankton productivity over vast regions of the oceans. We investigated the gene expression responses of Candidatus Pelagibacter ubique cultures to iron limitation in natural seawater media supplemented with a siderophore to chelate iron. Microarray data indicated transcription of the periplasmic iron binding protein sfuC increased by 16-fold, and iron transporter subunits, iron-sulfur center assembly genes, and the putative ferroxidase rubrerythrin transcripts increased to a lesser extent. Quantitative peptide mass spectrometry revealed that sfuC protein abundance increased 27-fold, despite an average decrease of 59% across the global proteome. Thus, we propose sfuC as a marker gene for indicating iron limitation in marine metatranscriptomic and metaproteomic ecological surveys. The marked proteome reduction was not directly correlated to changes in the transcriptome, implicating post-transcriptional regulatory mechanisms as modulators of protein expression. Two RNA-binding proteins, CspE and CspL, correlated well with iron availability, suggesting that they may contribute to the observed differences between the transcriptome and proteome. We propose a model in which the RNA-binding activity of CspE and CspL selectively enables protein synthesis of the iron acquisition protein SfuC during transient growth-limiting episodes of iron scarcity. PMID:20463970

  11. Differential roles of epigenetic changes and Foxp3 expression in regulatory T cell-specific transcriptional regulation

    Science.gov (United States)

    Morikawa, Hiromasa; Ohkura, Naganari; Vandenbon, Alexis; Itoh, Masayoshi; Nagao-Sato, Sayaka; Kawaji, Hideya; Lassmann, Timo; Carninci, Piero; Hayashizaki, Yoshihide; Forrest, Alistair R. R.; Standley, Daron M.; Date, Hiroshi; Sakaguchi, Shimon; Forrest, Alistair R.R.; Kawaji, Hideya; Rehli, Michael; Baillie, J. Kenneth; de Hoon, Michiel J.L.; Haberle, Vanja; Lassmann, Timo; Kulakovskiy, Ivan V.; Lizio, Marina; Itoh, Masayoshi; Andersson, Robin; Mungall, Christopher J.; Meehan, Terrence F.; Schmeier, Sebastian; Bertin, Nicolas; Jørgensen, Mette; Dimont, Emmanuel; Arner, Erik; Schmidl, Christian; Schaefer, Ulf; Medvedeva, Yulia A.; Plessy, Charles; Vitezic, Morana; Severin, Jessica; Semple, Colin A.; Ishizu, Yuri; Francescatto, Margherita; Alam, Intikhab; Albanese, Davide; Altschuler, Gabriel M.; Archer, John A.C.; Arner, Peter; Babina, Magda; Baker, Sarah; Balwierz, Piotr J.; Beckhouse, Anthony G.; Pradhan-Bhatt, Swati; Blake, Judith A.; Blumenthal, Antje; Bodega, Beatrice; Bonetti, Alessandro; Briggs, James; Brombacher, Frank; Burroughs, A. Maxwell; Califano, Andrea; Cannistraci, Carlo V.; Carbajo, Daniel; Chen, Yun; Chierici, Marco; Ciani, Yari; Clevers, Hans C.; Dalla, Emiliano; Davis, Carrie A.; Deplancke, Bart; Detmar, Michael; Diehl, Alexander D.; Dohi, Taeko; Drabløs, Finn; Edge, Albert S.B.; Edinger, Matthias; Ekwall, Karl; Endoh, Mitsuhiro; Enomoto, Hideki; Fagiolini, Michela; Fairbairn, Lynsey; Fang, Hai; Farach-Carson, Mary C.; Faulkner, Geoffrey J.; Favorov, Alexander V.; Fisher, Malcolm E.; Frith, Martin C.; Fujita, Rie; Fukuda, Shiro; Furlanello, Cesare; Furuno, Masaaki; Furusawa, Jun-ichi; Geijtenbeek, Teunis B.; Gibson, Andrew; Gingeras, Thomas; Goldowitz, Daniel; Gough, Julian; Guhl, Sven; Guler, Reto; Gustincich, Stefano; Ha, Thomas J.; Hamaguchi, Masahide; Hara, Mitsuko; Harbers, Matthias; Harshbarger, Jayson; Hasegawa, Akira; Hasegawa, Yuki; Hashimoto, Takehiro; Herlyn, Meenhard; Hitchens, Kelly J.; Sui, Shannan J. Ho; Hofmann, Oliver M.; Hoof, Ilka; Hori, Fumi; Huminiecki, Lukasz; Iida, Kei; Ikawa, Tomokatsu; Jankovic, Boris R.; Jia, Hui; Joshi, Anagha; Jurman, Giuseppe; Kaczkowski, Bogumil; Kai, Chieko; Kaida, Kaoru; Kaiho, Ai; Kajiyama, Kazuhiro; Kanamori-Katayama, Mutsumi; Kasianov, Artem S.; Kasukawa, Takeya; Katayama, Shintaro; Kato, Sachi; Kawaguchi, Shuji; Kawamoto, Hiroshi; Kawamura, Yuki I.; Kawashima, Tsugumi; Kempfle, Judith S.; Kenna, Tony J.; Kere, Juha; Khachigian, Levon M.; Kitamura, Toshio; Klinken, S. Peter; Knox, Alan J.; Kojima, Miki; Kojima, Soichi; Kondo, Naoto; Koseki, Haruhiko; Koyasu, Shigeo; Krampitz, Sarah; Kubosaki, Atsutaka; Kwon, Andrew T.; Laros, Jeroen F.J.; Lee, Weonju; Lennartsson, Andreas; Li, Kang; Lilje, Berit; Lipovich, Leonard; Mackay-sim, Alan; Manabe, Ri-ichiroh; Mar, Jessica C.; Marchand, Benoit; Mathelier, Anthony; Mejhert, Niklas; Meynert, Alison; Mizuno, Yosuke; Morais, David A. de Lima; Morikawa, Hiromasa; Morimoto, Mitsuru; Moro, Kazuyo; Motakis, Efthymios; Motohashi, Hozumi; Mummery, Christine L.; Murata, Mitsuyoshi; Nagao-Sato, Sayaka; Nakachi, Yutaka; Nakahara, Fumio; Nakamura, Toshiyuki; Nakamura, Yukio; Nakazato, Kenichi; van Nimwegen, Erik; Ninomiya, Noriko; Nishiyori, Hiromi; Noma, Shohei; Nozaki, Tadasuke; Ogishima, Soichi; Ohkura, Naganari; Ohmiya, Hiroko; Ohno, Hiroshi; Ohshima, Mitsuhiro; Okada-Hatakeyama, Mariko; Okazaki, Yasushi; Orlando, Valerio; Ovchinnikov, Dmitry A.; Pain, Arnab; Passier, Robert; Patrikakis, Margaret; Persson, Helena; Piazza, Silvano; Prendergast, James G.D.; Rackham, Owen J.L.; Ramilowski, Jordan A.; Rashid, Mamoon; Ravasi, Timothy; Rizzu, Patrizia; Roncador, Marco; Roy, Sugata; Rye, Morten B.; Saijyo, Eri; Sajantila, Antti; Saka, Akiko; Sakaguchi, Shimon; Sakai, Mizuho; Sato, Hiroki; Satoh, Hironori; Savvi, Suzana; Saxena, Alka; Schneider, Claudio; Schultes, Erik A.; Schulze-Tanzil, Gundula G.; Schwegmann, Anita; Sengstag, Thierry; Sheng, Guojun; Shimoji, Hisashi; Shimoni, Yishai; Shin, Jay W.; Simon, Christophe; Sugiyama, Daisuke; Sugiyama, Takaaki; Suzuki, Masanori; Swoboda, Rolf K.; 't Hoen, Peter A.C.; Tagami, Michihira; Takahashi, Naoko; Takai, Jun; Tanaka, Hiroshi; Tatsukawa, Hideki; Tatum, Zuotian; Thompson, Mark; Toyoda, Hiroo; Toyoda, Tetsuro; Valen, Eivind; van de Wetering, Marc; van den Berg, Linda M.; Verardo, Roberto; Vijayan, Dipti; Vorontsov, Ilya E.; Wasserman, Wyeth W.; Watanabe, Shoko; Wells, Christine A.; Winteringham, Louise N.; Wolvetang, Ernst; Wood, Emily J.; Yamaguchi, Yoko; Yamamoto, Masayuki; Yoneda, Misako; Yonekura, Yohei; Yoshida, Shigehiro; Zabierowski, Suzan E.; Zhang, Peter G.

    2014-01-01

    Naturally occurring regulatory T (Treg) cells, which specifically express the transcription factor forkhead box P3 (Foxp3), are engaged in the maintenance of immunological self-tolerance and homeostasis. By transcriptional start site cluster analysis, we assessed here how genome-wide patterns of DNA methylation or Foxp3 binding sites were associated with Treg-specific gene expression. We found that Treg-specific DNA hypomethylated regions were closely associated with Treg up-regulated transcriptional start site clusters, whereas Foxp3 binding regions had no significant correlation with either up- or down-regulated clusters in nonactivated Treg cells. However, in activated Treg cells, Foxp3 binding regions showed a strong correlation with down-regulated clusters. In accordance with these findings, the above two features of activation-dependent gene regulation in Treg cells tend to occur at different locations in the genome. The results collectively indicate that Treg-specific DNA hypomethylation is instrumental in gene up-regulation in steady state Treg cells, whereas Foxp3 down-regulates the expression of its target genes in activated Treg cells. Thus, the two events seem to play distinct but complementary roles in Treg-specific gene expression. PMID:24706905

  12. The BAF complex interacts with Pax6 in adult neural progenitors to establish a neurogenic cross-regulatory transcriptional network.

    Science.gov (United States)

    Ninkovic, Jovica; Steiner-Mezzadri, Andrea; Jawerka, Melanie; Akinci, Umut; Masserdotti, Giacomo; Petricca, Stefania; Fischer, Judith; von Holst, Alexander; Beckers, Johanes; Lie, Chichung D; Petrik, David; Miller, Erik; Tang, Jiong; Wu, Jiang; Lefebvre, Veronique; Demmers, Jeroen; Eisch, Amelia; Metzger, Daniel; Crabtree, Gerald; Irmler, Martin; Poot, Raymond; Götz, Magdalena

    2013-10-03

    Numerous transcriptional regulators of neurogenesis have been identified in the developing and adult brain, but how neurogenic fate is programmed at the epigenetic level remains poorly defined. Here, we report that the transcription factor Pax6 directly interacts with the Brg1-containing BAF complex in adult neural progenitors. Deletion of either Brg1 or Pax6 in the subependymal zone (SEZ) causes the progeny of adult neural stem cells to convert to the ependymal lineage within the SEZ while migrating neuroblasts convert to different glial lineages en route to or in the olfactory bulb (OB). Genome-wide analyses reveal that the majority of genes downregulated in the Brg1 null SEZ and OB contain Pax6 binding sites and are also downregulated in Pax6 null SEZ and OB. Downstream of the Pax6-BAF complex, we find that Sox11, Nfib, and Pou3f4 form a transcriptional cross-regulatory network that drives neurogenesis and can convert postnatal glia into neurons. Taken together, elements of our work identify a tripartite effector network activated by Pax6-BAF that programs neuronal fate. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Autophagy and the hematopoietic niche: a regulatory role for the Forkhead-box transcription factors

    NARCIS (Netherlands)

    Gomez Puerto, MC

    2016-01-01

    Two main components of the hematopoietic niche are hematopoietic stem cells (HSCs) and mesenchymal stem cells (MSCs). FOXO transcription factors play a fundamental role in the maintenance of these cells through the regulation of cell cycle and oxidative stress. Other gene expression programs

  14. Mitochondrial biogenesis in brown adipose tissue is associated with differential expression of transcription regulatory factors

    Czech Academy of Sciences Publication Activity Database

    Villena, J. A.; Carmona, M. C.; Rodriguez de la Concepción, M.; Rossmeisl, Martin; Vinas, O.; Mampel, T.; Iglesias, R.; Giralt, M.; Villarroya, F.

    2002-01-01

    Roč. 59, č. 11 (2002), s. 1934-1944 ISSN 1420-682X Grant - others:Ministerio de Ciencia y Tecnología (ES) PM98.0188 Institutional research plan: CEZ:AV0Z5011922 Keywords : brown adipose tissue * mitochondria * transcription factors Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.259, year: 2002

  15. GATA Transcription Factor Required for Immunity to Bacterial and Fungal Pathogens

    Science.gov (United States)

    Gaddis, Nathan C.; Aballay, Alejandro

    2006-01-01

    In the past decade, Caenorhabditis elegans has been used to dissect several genetic pathways involved in immunity; however, little is known about transcription factors that regulate the expression of immune effectors. C. elegans does not appear to have a functional homolog of the key immune transcription factor NF-κB. Here we show that that the intestinal GATA transcription factor ELT-2 is required for both immunity to Salmonella enterica and expression of a C-type lectin gene, clec-67, which is expressed in the intestinal cells and is a good marker of S. enterica infection. We also found that ELT-2 is required for immunity to Pseudomonas aeruginosa, Enterococcus faecalis, and Cryptococcus neoformans. Lack of immune inhibition by DAF-2, which negatively regulates the FOXO transcription factor DAF-16, rescues the hypersusceptibility to pathogens phenotype of elt-2(RNAi) animals. Our results indicate that ELT-2 is part of a multi-pathogen defense pathway that regulates innate immunity independently of the DAF-2/DAF-16 signaling pathway. PMID:17183709

  16. Bacterial Genome Editing Strategy for Control of Transcription and Protein Stability

    DEFF Research Database (Denmark)

    Lauritsen, Ida; Martinez, Virginia; Ronda, Carlotta

    2018-01-01

    In molecular biology and cell factory engineering, tools that enable control of protein production and stability are highly important. Here, we describe protocols for tagging genes in Escherichia coli allowing for inducible degradation and transcriptional control of any soluble protein of interes...

  17. A central regulatory system largely controls transcriptional activation and repression responses to phosphate starvation in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Regla Bustos

    2010-09-01

    Full Text Available Plants respond to different stresses by inducing or repressing transcription of partially overlapping sets of genes. In Arabidopsis, the PHR1 transcription factor (TF has an important role in the control of phosphate (Pi starvation stress responses. Using transcriptomic analysis of Pi starvation in phr1, and phr1 phr1-like (phl1 mutants and in wild type plants, we show that PHR1 in conjunction with PHL1 controls most transcriptional activation and repression responses to phosphate starvation, regardless of the Pi starvation specificity of these responses. Induced genes are enriched in PHR1 binding sequences (P1BS in their promoters, whereas repressed genes do not show such enrichment, suggesting that PHR1(-like control of transcriptional repression responses is indirect. In agreement with this, transcriptomic analysis of a transgenic plant expressing PHR1 fused to the hormone ligand domain of the glucocorticoid receptor showed that PHR1 direct targets (i.e., displaying altered expression after GR:PHR1 activation by dexamethasone in the presence of cycloheximide corresponded largely to Pi starvation-induced genes that are highly enriched in P1BS. A minimal promoter containing a multimerised P1BS recapitulates Pi starvation-specific responsiveness. Likewise, mutation of P1BS in the promoter of two Pi starvation-responsive genes impaired their responsiveness to Pi starvation, but not to other stress types. Phylogenetic footprinting confirmed the importance of P1BS and PHR1 in Pi starvation responsiveness and indicated that P1BS acts in concert with other cis motifs. All together, our data show that PHR1 and PHL1 are partially redundant TF acting as central integrators of Pi starvation responses, both specific and generic. In addition, they indicate that transcriptional repression responses are an integral part of adaptive responses to stress.

  18. A lncRNA-H19 transcript from secondary hair follicle of Liaoning cashmere goat: Identification, regulatory network and expression regulated potentially by its promoter methylation.

    Science.gov (United States)

    Zhu, Yu B; Wang, Ze Y; Yin, Rong H; Jiao, Qian; Zhao, Su J; Cong, Yu Y; Xue, Hui L; Guo, Dan; Wang, Shi Q; Zhu, Yan X; Bai, Wen L

    2018-01-30

    The H19 transcript (imprinted maternally expressed transcript) is well-known as long noncoding RNA (lncRNA), and it is thought to be associated with the inductive capacity of dermal papilla cells for hair-follicle reconstruction. In this study, we isolated and characterized a lncRNA-H19 transcript from the secondary hair follicle of Liaoning cashmere goat. Also, we investigated its transcriptional pattern and methylation status of H19 gene in secondary hair follicle of this breed during different stages of hair follicle cycle. Nucleotide composition analysis indicated that guanine (G) and cytosine (C) are the dominant nucleotides in the lncRNA-H19 transcript of Liaoning cashmere goat with the highest frequency distribution (11.25%) of GG nucleotide pair. The regulatory network showed that lncRNA-H19 transcript appears to have remarkably diverse regulatory relationships with its related miRNAs and the potential target genes. In secondary hair follicle, the relative expression of lncRNA-H19 transcript at the anagen phase is significantly higher than that at both telogen and catagen phases suggesting that lncRNA-H19 transcript might play essential roles in the formation and growth of cashmere fiber of goat. Methylation analysis indicated that the methylation of the promoter region of H19 gene most likely participates in its transcriptional suppression in secondary hair follicle of Liaoning cashmere goat. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Evolution of Transcriptional Regulatory Networks in Pseudomonas aeruginosa During Long Time Growth in Human Hosts

    DEFF Research Database (Denmark)

    Andresen, Eva Kammer

    are subjected to forces that allow the bacteria to break genomic constraints, remodel existing regulatory networks, and colonise new environments. While experimental evolution studies have documented that global regulators of gene expression are indeed targets for adaptive mutations, it is less clear to which...... extent these observations relate to natural microbial populations. The focus of this thesis has been to study how regulatory networks evolve in natural systems. By using a particular infectious disease scenario (human associated persistent airway infections caused by the bacterium Pseudomonas aeruginosa...... in global regulator genes facilitate the generation of novel phenotypes which again facilitate the shift in life-style of the bacterium from an environmental opportunistic pathogen to a human airway specific pathogen. These findings are not only applicable to P. aeruginosa specific studies, but suggest that...

  20. A cysteine protease (cathepsin Z) from disk abalone, Haliotis discus discus: Genomic characterization and transcriptional profiling during bacterial infections.

    Science.gov (United States)

    Godahewa, G I; Perera, N C N; Lee, Sukkyoung; Kim, Myoung-Jin; Lee, Jehee

    2017-09-05

    Cathepsin Z (CTSZ) is lysosomal cysteine protease of the papain superfamily. It participates in the host immune defense via phagocytosis, signal transduction, cell-cell communication, proliferation, and migration of immune cells such as monocytes, macrophages, and dendritic cells. Hence, CTSZ is also acknowledged as an acute-phase protein in host immunity. In this study, we sought to identify the CTSZ homolog from disk abalone (AbCTSZ) and characterize it at the molecular, genomic, and transcriptional levels. AbCTSZ encodes a protein with 318 amino acids and a molecular mass of 36kDa. The structure of AbCTSZ reveals amino acid sequences that are characteristic of the signal sequence, pro-peptide, peptidase-C1 papain family cysteine protease domain, mini-loop, HIP motif, N-linked glycosylation sites, active sites, and conserved Cys residues. A pairwise comparison revealed that AbCTSZ shared the highest amino acid homology with its molluscan counterpart from Crassostrea gigas. A multiple alignment analysis revealed the conservation of functionally crucial elements of AbCTSZ, and a phylogenetic study further confirmed a proximal evolutionary relationship with its invertebrate counterparts. Further, an analysis of AbCTSZ genomic structure revealed seven exons separated by six introns, which differs from that of its vertebrate counterparts. Quantitative real time PCR (qPCR) detected the transcripts of AbCTSZ in early developmental stages and in eight different tissues. Higher levels of AbCTSZ transcripts were found in trochophore, gill, and hemocytes, highlighting its importance in the early development and immunity of disk abalone. In addition, we found that viable bacteria (Vibrio parahaemolyticus and Listeria monocytogenes) and bacterial lipopolysaccharides significantly modulated AbCTSZ transcription. Collectively, these lines of evidences suggest that AbCTSZ plays an indispensable role in the innate immunity of disk abalone. Copyright © 2017. Published by Elsevier

  1. Transcriptional profiling at different sites in lungs of pigs during acute bacterial respiratory infection

    DEFF Research Database (Denmark)

    Mortensen, Shila; Skovgaard, Kerstin; Hedegaard, Jakob

    2011-01-01

    The local transcriptional response was studied in different locations of lungs from pigs experimentally infected with the respiratory pathogen Actinobacillus pleuropneumoniae serotype 5B, using porcine cDNA microarrays. This infection gives rise to well-demarcated infection loci in the lung, char...... of induced genes as, in unaffected areas a large part of differently expressed genes were involved in systemic reactions to infections, while differently expressed genes in necrotic areas were mainly concerned with homeostasis regulation....

  2. Transcriptional signatures of regulatory and toxic responses to benzo-[a]-pyrene exposure

    Directory of Open Access Journals (Sweden)

    Schirmer Kristin

    2011-10-01

    Full Text Available Abstract Background Small molecule ligands often have multiple effects on the transcriptional program of a cell: they trigger a receptor specific response and additional, indirect responses ("side effects". Distinguishing those responses is important for understanding side effects of drugs and for elucidating molecular mechanisms of toxic chemicals. Results We explored this problem by exposing cells to the environmental contaminant benzo-[a]-pyrene (B[a]P. B[a]P exposure activates the aryl hydrocarbon receptor (Ahr and causes toxic stress resulting in transcriptional changes that are not regulated through Ahr. We sought to distinguish these two types of responses based on a time course of expression changes measured after B[a]P exposure. Using Random Forest machine learning we classified 81 primary Ahr responders and 1,308 genes regulated as side effects. Subsequent weighted clustering gave further insight into the connection between expression pattern, mode of regulation, and biological function. Finally, the accuracy of the predictions was supported through extensive experimental validation. Conclusion Using a combination of machine learning followed by extensive experimental validation, we have further expanded the known catalog of genes regulated by the environmentally sensitive transcription factor Ahr. More broadly, this study presents a strategy for distinguishing receptor-dependent responses and side effects based on expression time courses.

  3. Role of transcription regulatory sequence in regulation of gene expression and replication of porcine reproductive and respiratory syndrome virus.

    Science.gov (United States)

    Wang, Chengbao; Meng, Han; Gao, Yujin; Gao, Hui; Guo, Kangkang; Almazan, Fernando; Sola, Isabel; Enjuanes, Luis; Zhang, Yanming; Abrahamyan, Levon

    2017-08-10

    In order to gain insight into the role of the transcription regulatory sequences (TRSs) in the regulation of gene expression and replication of porcine reproductive and respiratory syndrome virus (PRRSV), the enhanced green fluorescent protein (EGFP) gene, under the control of the different structural gene TRSs, was inserted between the N gene and 3'-UTR of the PRRSV genome and EGFP expression was analyzed for each TRS. TRSs of all the studied structural genes of PRRSV positively modulated EGFP expression at different levels. Among the TRSs analyzed, those of GP2, GP5, M, and N genes highly enhanced EGFP expression without altering replication of PRRSV. These data indicated that structural gene TRSs could be an extremely useful tool for foreign gene expression using PRRSV as a vector.

  4. Post-Transcriptional Regulation by the Csr Global Regulatory System in Escherichia coli

    OpenAIRE

    Suzuki, Kazushi; 鈴木, 一史

    2007-01-01

    In many species of bacteria, the Csr (carbon storage regulator) global regulatory system coordinates the expression of various genes. In Escherichia coli, the central component of this system, CsrA, is a RNA-binding protein. The CsrA is a homodimer and binds to leader segments of target mRNAs, affecting their translation and stability. CsrA activity is regulated by two small non-coding RNAs, CsrB and CsrC. These RNAs contain multiple CsrA-binding sequences and act by sequestering CsrA. In thi...

  5. Increasing the efficiency of bacterial transcription simulations: When to exclude the genome without loss of accuracy

    Directory of Open Access Journals (Sweden)

    McMillen David R

    2008-09-01

    Full Text Available Abstract Background Simulating the major molecular events inside an Escherichia coli cell can lead to a very large number of reactions that compose its overall behaviour. Not only should the model be accurate, but it is imperative for the experimenter to create an efficient model to obtain the results in a timely fashion. Here, we show that for many parameter regimes, the effect of the host cell genome on the transcription of a gene from a plasmid-borne promoter is negligible, allowing one to simulate the system more efficiently by removing the computational load associated with representing the presence of the rest of the genome. The key parameter is the on-rate of RNAP binding to the promoter (k_on, and we compare the total number of transcripts produced from a plasmid vector generated as a function of this rate constant, for two versions of our gene expression model, one incorporating the host cell genome and one excluding it. By sweeping parameters, we identify the k_on range for which the difference between the genome and no-genome models drops below 5%, over a wide range of doubling times, mRNA degradation rates, plasmid copy numbers, and gene lengths. Results We assess the effect of the simulating the presence of the genome over a four-dimensional parameter space, considering: 24 min Conclusion Exclusion of the genome is shown to yield less than 5% difference in transcript numbers over wide ranges of values, and computational speed is improved by two to 24 times by excluding explicit representation of the genome.

  6. TRFBA: an algorithm to integrate genome-scale metabolic and transcriptional regulatory networks with incorporation of expression data.

    Science.gov (United States)

    Motamedian, Ehsan; Mohammadi, Maryam; Shojaosadati, Seyed Abbas; Heydari, Mona

    2017-04-01

    Integration of different biological networks and data-types has been a major challenge in systems biology. The present study introduces the transcriptional regulated flux balance analysis (TRFBA) algorithm that integrates transcriptional regulatory and metabolic models using a set of expression data for various perturbations. TRFBA considers the expression levels of genes as a new continuous variable and introduces two new linear constraints. The first constraint limits the rate of reaction(s) supported by a metabolic gene using a constant parameter (C) that converts the expression levels to the upper bounds of the reactions. Considering the concept of constraint-based modeling, the second set of constraints correlates the expression level of each target gene with that of its regulating genes. A set of constraints and binary variables was also added to prevent the second set of constraints from overlapping. TRFBA was implemented on Escherichia coli and Saccharomyces cerevisiae models to estimate growth rates under various environmental and genetic perturbations. The error sensitivity to the algorithm parameter was evaluated to find the best value of C. The results indicate a significant improvement in the quantitative prediction of growth in comparison with previously presented algorithms. The robustness of the algorithm to change in the expression data and the regulatory network was tested to evaluate the effect of noisy and incomplete data. Furthermore, the use of added constraints for perturbations without their gene expression profile demonstrates that these constraints can be applied to improve the growth prediction of FBA. TRFBA is implemented in Matlab software and requires COBRA toolbox. Source code is freely available at http://sbme.modares.ac.ir . : motamedian@modares.ac.ir. Supplementary data are available at Bioinformatics online.

  7. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Directory of Open Access Journals (Sweden)

    Aaron E Walworth

    Full Text Available In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L., a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora', which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT. Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5 gene was down-regulated and associated with five other differentially expressed (DE genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2, a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5, and a VERNALIZATION1-like gene (VcVRN1, may function as integrators in place of FLOWERING LOCUS C (FLC in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1, LEAFY-like (VcLFY, APETALA1-like (VcAP1, CAULIFLOWER 1-like (VcCAL1, and FRUITFULL-like (VcFUL genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of

  8. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Science.gov (United States)

    Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

  9. A model for genetic and epigenetic regulatory networks identifies rare pathways for transcription factor induced pluripotency

    Science.gov (United States)

    Artyomov, Maxim; Meissner, Alex; Chakraborty, Arup

    2010-03-01

    Most cells in an organism have the same DNA. Yet, different cell types express different proteins and carry out different functions. This is because of epigenetic differences; i.e., DNA in different cell types is packaged distinctly, making it hard to express certain genes while facilitating the expression of others. During development, upon receipt of appropriate cues, pluripotent embryonic stem cells differentiate into diverse cell types that make up the organism (e.g., a human). There has long been an effort to make this process go backward -- i.e., reprogram a differentiated cell (e.g., a skin cell) to pluripotent status. Recently, this has been achieved by transfecting certain transcription factors into differentiated cells. This method does not use embryonic material and promises the development of patient-specific regenerative medicine, but it is inefficient. The mechanisms that make reprogramming rare, or even possible, are poorly understood. We have developed the first computational model of transcription factor-induced reprogramming. Results obtained from the model are consistent with diverse observations, and identify the rare pathways that allow reprogramming to occur. If validated, our model could be further developed to design optimal strategies for reprogramming and shed light on basic questions in biology.

  10. Differential 3’ processing of specific transcripts expands regulatory and protein diversity across neuronal cell types

    Science.gov (United States)

    Jereb, Saša; Hwang, Hun-Way; Van Otterloo, Eric; Govek, Eve-Ellen; Fak, John J; Yuan, Yuan; Hatten, Mary E

    2018-01-01

    Alternative polyadenylation (APA) regulates mRNA translation, stability, and protein localization. However, it is unclear to what extent APA regulates these processes uniquely in specific cell types. Using a new technique, cTag-PAPERCLIP, we discovered significant differences in APA between the principal types of mouse cerebellar neurons, the Purkinje and granule cells, as well as between proliferating and differentiated granule cells. Transcripts that differed in APA in these comparisons were enriched in key neuronal functions and many differed in coding sequence in addition to 3’UTR length. We characterize Memo1, a transcript that shifted from expressing a short 3’UTR isoform to a longer one during granule cell differentiation. We show that Memo1 regulates granule cell precursor proliferation and that its long 3’UTR isoform is targeted by miR-124, contributing to its downregulation during development. Our findings provide insight into roles for APA in specific cell types and establish a platform for further functional studies. PMID:29578408

  11. Genetic Code Expansion as a Tool to Study Regulatory Processes of Transcription

    Science.gov (United States)

    Schmidt, Moritz; Summerer, Daniel

    2014-02-01

    The expansion of the genetic code with noncanonical amino acids (ncAA) enables the chemical and biophysical properties of proteins to be tailored, inside cells, with a previously unattainable level of precision. A wide range of ncAA with functions not found in canonical amino acids have been genetically encoded in recent years and have delivered insights into biological processes that would be difficult to access with traditional approaches of molecular biology. A major field for the development and application of novel ncAA-functions has been transcription and its regulation. This is particularly attractive, since advanced DNA sequencing- and proteomics-techniques continue to deliver vast information on these processes on a global level, but complementing methodologies to study them on a detailed, molecular level and in living cells have been comparably scarce. In a growing number of studies, genetic code expansion has now been applied to precisely control the chemical properties of transcription factors, RNA polymerases and histones, and this has enabled new insights into their interactions, conformational changes, cellular localizations and the functional roles of posttranslational modifications.

  12. Thermosensing coordinates a cis-regulatory module for transcriptional activation of the intracellular virulence system in Salmonella enterica serovar Typhimurium.

    Science.gov (United States)

    Duong, Nancy; Osborne, Suzanne; Bustamante, Víctor H; Tomljenovic, Ana M; Puente, José L; Coombes, Brian K

    2007-11-23

    The expression of bacterial virulence genes is tightly controlled by the convergence of multiple extracellular signals. As a zoonotic pathogen, virulence gene regulation in Salmonella enterica serovar Typhimurium must be responsive to multiple cues from the general environment as well as from multiple niches within animal and human hosts. Previous work has identified combined magnesium and phosphate limitation as an environmental cue that activates genes required for intracellular virulence. One unanswered question is how virulence genes that are expressed within the host are inhibited in non-host environments that satisfy the phosphate and magnesium limitation cues. We report here that thermosensing is the major mechanism controlling incongruous activation of the intracellular virulence phenotype. Bacteria grown at 30 degrees C or lower were unable to activate the intracellular type III secretion system even under strong inducing signals such as synthetic medium, contact with macrophages, and exposure to the murine gut. Thermoregulation was fully recapitulated in a Salmonella bongori strain engineered to contain the intracellular virulence genes of S. enterica sv. Typhimurium, suggesting that orthologous thermoregulators were available. Accordingly, virulence gene repression at the nonpermissive temperature required Hha and H-NS, two nucleoid-like proteins involved in virulence gene control. The use of combined environmental cues to control transcriptional "logic gates" allows for transcriptional selectivity of virulence genes that would otherwise be superfluous if activated in the non-host environment. Thus, thermosensing by Salmonella provides integrated control of host niche-specific virulence factors.

  13. Expression Pattern of Myogenic Regulatory Transcription Factor mRNAs in the Embryo and Adult Labeo rohita (Hamilton, 1822

    Directory of Open Access Journals (Sweden)

    Archya Sengupta

    2014-01-01

    Full Text Available Understanding the regulation of skeletal muscle development is important to meet the increasing demand of Indian major carp Labeo rohita. Myogenic regulatory factors (MRFs along with myocyte specific enhancer factor 2 (MEF2 play the pivotal role in the determination and differentiation of skeletal muscle. The majority of skeletal muscle genes require both MRFs and MEF2 family members to activate their transcription. In this study, the expression pattern of MyoD, myf-5, myogenin, and MEF2A was observed from 6 h after fertilization to 12 months of age using semiquantitative RT-PCR as well as real-time PCR method. MyoD and myf-5 mRNAs were expressed at high level at the early embryonic stages. Myogenin and MEF2A were expressed after MyoD and myf-5 and remained active up to adult stage. Expression of MyoD was lower than that of Myf-5 after the 5th month. Partial sequencing of MyoD, myf-5, and MEF2A was done to draw phylogeny. In phylogenetic study, Labeo MyoD, MEF2A and myf-5 were found to be closely related to those of common carp. The present investigation suggests that the four transcription factors play pivotal role in the regulation of muscle growth of Labeo rohita in an overlapping and interconnected way.

  14. Different papillomaviruses have different repertoires of transcription factor binding sites: convergence and divergence in the upstream regulatory region

    Directory of Open Access Journals (Sweden)

    Alonso Ángel

    2006-03-01

    Full Text Available Abstract Background Papillomaviruses (PVs infect stratified squamous epithelia in warm-blooded vertebrates and have undergone a complex evolutionary process. The control of the expression of the early ORFs in PVs depends on the binding of cellular and viral transcription factors to the upstream regulatory region (URR of the virus. It is believed that there is a core of transcription factor binding sites (TFBS common to all PVs, with additional individual differences, although most of the available information focuses only on a handful of viruses. Results We have studied the URR of sixty-one PVs, covering twenty different hosts. We have predicted the TFBS present in the URR and analysed these results by principal component analysis and genetic algorithms. The number and nature of TFBS in the URR might be much broader than thus far described, and different PVs have different repertoires of TFBS. Conclusion There are common fingerprints in the URR in PVs that infect primates, although the ancestors of these viruses diverged a long time ago. Additionally, there are obvious differences between the URR of alpha and beta PVs, despite these PVs infect similar histological cell types in the same host, i.e. human. A thorough analysis of the TFBS in the URR might provide crucial information about the differential biology of cancer-associated PVs.

  15. A novel test for selection on cis-regulatory elements reveals positive and negative selection acting on mammalian transcriptional enhancers.

    Science.gov (United States)

    Smith, Justin D; McManus, Kimberly F; Fraser, Hunter B

    2013-11-01

    Measuring natural selection on genomic elements involved in the cis-regulation of gene expression--such as transcriptional enhancers and promoters--is critical for understanding the evolution of genomes, yet it remains a major challenge. Many studies have attempted to detect positive or negative selection in these noncoding elements by searching for those with the fastest or slowest rates of evolution, but this can be problematic. Here, we introduce a new approach to this issue, and demonstrate its utility on three mammalian transcriptional enhancers. Using results from saturation mutagenesis studies of these enhancers, we classified all possible point mutations as upregulating, downregulating, or silent, and determined which of these mutations have occurred on each branch of a phylogeny. Applying a framework analogous to Ka/Ks in protein-coding genes, we measured the strength of selection on upregulating and downregulating mutations, in specific branches as well as entire phylogenies. We discovered distinct modes of selection acting on different enhancers: although all three have experienced negative selection against downregulating mutations, the selection pressures on upregulating mutations vary. In one case, we detected positive selection for upregulation, whereas the other two had no detectable selection on upregulating mutations. Our methodology is applicable to the growing number of saturation mutagenesis data sets, and provides a detailed picture of the mode and strength of natural selection acting on cis-regulatory elements.

  16. Transcriptional regulatory network triggered by oxidative signals configures the early response mechanisms of japonica rice to chilling stress

    KAUST Repository

    Yun, Kil-Young

    2010-01-25

    Background: The transcriptional regulatory network involved in low temperature response leading to acclimation has been established in Arabidopsis. In japonica rice, which can only withstand transient exposure to milder cold stress (10C), an oxidative-mediated network has been proposed to play a key role in configuring early responses and short-term defenses. The components, hierarchical organization and physiological consequences of this network were further dissected by a systems-level approach.Results: Regulatory clusters responding directly to oxidative signals were prominent during the initial 6 to 12 hours at 10C. Early events mirrored a typical oxidative response based on striking similarities of the transcriptome to disease, elicitor and wounding induced processes. Targets of oxidative-mediated mechanisms are likely regulated by several classes of bZIP factors acting on as1/ocs/TGA-like element enriched clusters, ERF factors acting on GCC-box/JAre-like element enriched clusters and R2R3-MYB factors acting on MYB2-like element enriched clusters.Temporal induction of several H2O2-induced bZIP, ERF and MYB genes coincided with the transient H2O2spikes within the initial 6 to 12 hours. Oxidative-independent responses involve DREB/CBF, RAP2 and RAV1 factors acting on DRE/CRT/rav1-like enriched clusters and bZIP factors acting on ABRE-like enriched clusters. Oxidative-mediated clusters were activated earlier than ABA-mediated clusters.Conclusion: Genome-wide, physiological and whole-plant level analyses established a holistic view of chilling stress response mechanism of japonica rice. Early response regulatory network triggered by oxidative signals is critical for prolonged survival under sub-optimal temperature. Integration of stress and developmental responses leads to modulated growth and vigor maintenance contributing to a delay of plastic injuries. 2010 Yun et al; licensee BioMed Central Ltd.

  17. The p53 regulatory gene MDM2 is a direct transcriptional target of MYCN in neuroblastoma.

    Science.gov (United States)

    Slack, Andrew; Chen, Zaowen; Tonelli, Roberto; Pule, Martin; Hunt, Lisa; Pession, Andrea; Shohet, Jason M

    2005-01-18

    The MYCN oncogene is the major negative prognostic marker in neuroblastoma with important roles in both the pathogenesis and clinical behavior of this aggressive malignancy. MYC oncogenes activate both proliferative and apoptotic cellular pathways and, accordingly, inhibition of p53-mediated apoptosis is a prerequisite for MYC-driven tumorigenesis. To identify novel transcriptional targets mediating the MYCN-dependent phenotype, we screened a MYCN-amplified neuroblastoma cell line by using chromatin immunoprecipitation (ChIP) cloning. We identified the essential p53 inhibitor and protooncogene MDM2 as a putative target. MDM2 has multiple p53-independent functions modulating cell cycle and transcriptional events. Standard ChIP with MYCN antibodies established the binding of MYCN to a consensus E-box within the human MDM2 promoter. Oligonucleotide pull-down assays further established the capacity of MYCN to bind to this promoter region, confirming the ChIP results. Luciferase reporter assays confirmed the E-box-specific, MYCN-dependent regulation of the MDM2 promoter in MYCN-inducible neuroblastoma cell lines. Real-time quantitative PCR and Western blot analysis demonstrated a rapid increase in endogenous MDM2 mRNA and MDM2 protein upon induction of MYCN. Targeted inhibition of MYCN in a MYCN-amplified neuroblastoma cell line resulted in decreased MDM2 expression levels with concomitant stabilization of p53 and induction of apoptosis. Our finding that MYCN directly modulates baseline MDM2 levels suggests a mechanism contributing to the pathogenesis of neuroblastoma and other MYC-driven malignancies through inhibition of MYC-stimulated apoptosis.

  18. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Science.gov (United States)

    Saban, Ricardo; Simpson, Cindy; Vadigepalli, Rajanikanth; Memet, Sylvie; Dozmorov, Igor; Saban, Marcia R

    2007-01-01

    Background Tachykinins (TK), such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs). Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT) and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF) and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2). In the absence of NK1R, the matrix Nkx2

  19. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  20. Evolutionary dynamics of DNA-binding sites and direct target genes of a floral master regulatory transcription factor [ChIP-Seq

    NARCIS (Netherlands)

    Muiño, J.M.; Bruijn, de S.A.; Vingron, Martin; Angenent, G.C.; Kaufmann, K.

    2015-01-01

    Plant development is controlled by transcription factors (TFs) which form complex gene-regulatory networks. Genome-wide TF DNA-binding studies revealed that these TFs have several thousands of binding sites in the Arabidopsis genome, and may regulate the expression of many genes directly. Given the

  1. Decoding genome-wide GadEWX-transcriptional regulatory networks reveals multifaceted cellular responses to acid stress in Escherichia coli

    DEFF Research Database (Denmark)

    Seo, Sang Woo; Kim, Donghyuk; O'Brien, Edward J.

    2015-01-01

    The regulators GadE, GadW and GadX (which we refer to as GadEWX) play a critical role in the transcriptional regulation of the glutamate-dependent acid resistance (GDAR) system in Escherichia coli K-12 MG1655. However, the genome-wide regulatory role of GadEWX is still unknown. Here we comprehens...

  2. Impact of the Staphylococcus epidermidis LytSR two-component regulatory system on murein hydrolase activity, pyruvate utilization and global transcriptional profile

    Directory of Open Access Journals (Sweden)

    Yu Fangyou

    2010-11-01

    Full Text Available Abstract Background Staphylococcus epidermidis has emerged as one of the most important nosocomial pathogens, mainly because of its ability to colonize implanted biomaterials by forming a biofilm. Extensive studies are focused on the molecular mechanisms involved in biofilm formation. The LytSR two-component regulatory system regulates autolysis and biofilm formation in Staphylococcus aureus. However, the role of LytSR played in S. epidermidis remained unknown. Results In the present study, we demonstrated that lytSR knock-out in S. epidermidis did not alter susceptibility to Triton X-100 induced autolysis. Quantitative murein hydrolase assay indicated that disruption of lytSR in S. epidermidis resulted in decreased activities of extracellular murein hydrolases, although zymogram showed no apparent differences in murein hydrolase patterns between S. epidermidis strain 1457 and its lytSR mutant. Compared to the wild-type counterpart, 1457ΔlytSR produced slightly more biofilm, with significantly decreased dead cells inside. Microarray analysis showed that lytSR mutation affected the transcription of 164 genes (123 genes were upregulated and 41 genes were downregulated. Specifically, genes encoding proteins responsible for protein synthesis, energy metabolism were downregulated, while genes involved in amino acid and nucleotide biosynthesis, amino acid transporters were upregulated. Impaired ability to utilize pyruvate and reduced activity of arginine deiminase was observed in 1457ΔlytSR, which is consistent with the microarray data. Conclusions The preliminary results suggest that in S. epidermidis LytSR two-component system regulates extracellular murein hydrolase activity, bacterial cell death and pyruvate utilization. Based on the microarray data, it appears that lytSR inactivation induces a stringent response. In addition, LytSR may indirectly enhance biofilm formation by altering the metabolic status of the bacteria.

  3. The life cycle of the steroidogenic acute regulatory (StAR) protein: from transcription through proteolysis.

    Science.gov (United States)

    Granot, Zvi; Silverman, Eran; Friedlander, Ruth; Melamed-Book, Naomi; Eimerl, Sarah; Timberg, Rina; Hales, Karen H; Hales, Dale B; Stocco, Douglas M; Orly, Joseph

    2002-11-01

    The Steroidogenic Acute Regulatory (StAR) protein is a mitochondrial protein required for the transport of cholesterol substrate to the P450scc enzyme located in the inner mitochondrial membranes of steroid producing cells. This study suggests that the acute regulation of the rodent StAR gene in the ovary is mediated by two factors, C/EBPbeta and GATA-4. Once translated, the StAR precursor protein is either imported into the mitochondria, or it is rapidly degraded in the cytosol. We predicted that in order to perpetuate StAR activity cycles, imported StAR should turn over rapidly to avoid a potentially harmful accumulation of the protein in sub-mitochondrial compartments. Pulse-chase experiments in metabolically labeled cells showed that: (a) the turnover rate of mature mitochondrial StAR protein (30 kDa) is much faster (t(1/2) = 4-5 h) than that of other mitochondrial proteins; (b) dissipation of the inner membrane potential (-delta psi) by carbonyl cyanide m-chlorophenylhydrazone (mCCCP) accelerates the mitochondrial degradation of StAR; (c) unexpectedly, the mitochondrial degradation of StAR is inhibited by MG132 and lactacystin, but not by epoxomicin. Furthermore, StAR degradation becomes inhibitor-resistant two hours after import. Therefore, these studies suggest a bi-phasic route of StAR turnover in the mitochondria. Shortly after import, StAR is degraded by inhibitor-sensitive protease(s) (phase I), whereas at later times, StAR turnover proceeds to completion through an MG132-resistant proteolytic activity (phase II). Collectively, this study defines StAR as a unique protein that can authentically be used to probe multiple proteolytic activities in mammalian mitochondria.

  4. Brain in situ hybridization maps as a source for reverse-engineering transcriptional regulatory networks: Alzheimer's disease insights

    Energy Technology Data Exchange (ETDEWEB)

    Acquaah-Mensah, George K.; Taylor, Ronald C.

    2016-07-01

    Microarray data have been a valuable resource for identifying transcriptional regulatory relationships among genes. As an example, brain region-specific transcriptional regulatory events have the potential of providing etiological insights into Alzheimer Disease (AD). However, there is often a paucity of suitable brain-region specific expression data obtained via microarrays or other high throughput means. The Allen Brain Atlas in situ hybridization (ISH) data sets (Jones et al., 2009) represent a potentially valuable alternative source of high-throughput brain region-specific gene expression data for such purposes. In this study, Allen BrainAtlasmouse ISH data in the hippocampal fields were extracted, focusing on 508 genes relevant to neurodegeneration. Transcriptional regulatory networkswere learned using three high-performing network inference algorithms. Only 17% of regulatory edges from a network reverse-engineered based on brain region-specific ISH data were also found in a network constructed upon gene expression correlations inmousewhole brain microarrays, thus showing the specificity of gene expression within brain sub-regions. Furthermore, the ISH data-based networks were used to identify instructive transcriptional regulatory relationships. Ncor2, Sp3 and Usf2 form a unique three-party regulatory motif, potentially affecting memory formation pathways. Nfe2l1, Egr1 and Usf2 emerge among regulators of genes involved in AD (e.g. Dhcr24, Aplp2, Tia1, Pdrx1, Vdac1, andSyn2). Further, Nfe2l1, Egr1 and Usf2 are sensitive to dietary factors and could be among links between dietary influences and genes in the AD etiology. Thus, this approach of harnessing brain region-specific ISH data represents a rare opportunity for gleaning unique etiological insights for diseases such as AD.

  5. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

    Science.gov (United States)

    Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

    The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  6. Possible roles of σ-dependent RNA polymerase pausing in transcription regulation.

    Science.gov (United States)

    Petushkov, Ivan; Esyunina, Daria; Kulbachinskiy, Andrey

    2017-12-02

    The σ subunit of bacterial RNA polymerase is required for promoter recognition during transcription initiation but may also regulate transcription elongation. The principal σ 70 subunit of Escherichia coli was shown to travel with RNA polymerase and induce transcriptional pausing at promoter-like motifs, with potential regulatory output. We recently demonstrated that an alternative σ 38 subunit can also induce RNA polymerase pausing. Here, we outline proposed regulatory roles of σ-dependent pausing in bacteria and discuss possible interplay between alternative σ variants and regulatory factors during transcription elongation.

  7. Revealing genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles under osmotic stress in Escherichia coli K-12 MG1655

    DEFF Research Database (Denmark)

    Seo, Sang Woo; Gao, Ye; Kim, Donghyuk

    2017-01-01

    A transcription factor (TF), OmpR, plays a critical role in transcriptional regulation of the osmotic stress response in bacteria. Here, we reveal a genome-scale OmpR regulon in Escherichia coli K-12 MG1655. Integrative data analysis reveals that a total of 37 genes in 24 transcription units (TUs...

  8. Transcriptional analysis of the jamaicamide gene cluster from the marine cyanobacterium Lyngbya majuscula and identification of possible regulatory proteins

    Directory of Open Access Journals (Sweden)

    Dorrestein Pieter C

    2009-12-01

    Full Text Available Abstract Background The marine cyanobacterium Lyngbya majuscula is a prolific producer of bioactive secondary metabolites. Although biosynthetic gene clusters encoding several of these compounds have been identified, little is known about how these clusters of genes are transcribed or regulated, and techniques targeting genetic manipulation in Lyngbya strains have not yet been developed. We conducted transcriptional analyses of the jamaicamide gene cluster from a Jamaican strain of Lyngbya majuscula, and isolated proteins that could be involved in jamaicamide regulation. Results An unusually long untranslated leader region of approximately 840 bp is located between the jamaicamide transcription start site (TSS and gene cluster start codon. All of the intergenic regions between the pathway ORFs were transcribed into RNA in RT-PCR experiments; however, a promoter prediction program indicated the possible presence of promoters in multiple intergenic regions. Because the functionality of these promoters could not be verified in vivo, we used a reporter gene assay in E. coli to show that several of these intergenic regions, as well as the primary promoter preceding the TSS, are capable of driving β-galactosidase production. A protein pulldown assay was also used to isolate proteins that may regulate the jamaicamide pathway. Pulldown experiments using the intergenic region upstream of jamA as a DNA probe isolated two proteins that were identified by LC-MS/MS. By BLAST analysis, one of these had close sequence identity to a regulatory protein in another cyanobacterial species. Protein comparisons suggest a possible correlation between secondary metabolism regulation and light dependent complementary chromatic adaptation. Electromobility shift assays were used to evaluate binding of the recombinant proteins to the jamaicamide promoter region. Conclusion Insights into natural product regulation in cyanobacteria are of significant value to drug discovery

  9. Muscle and neural isoforms of agrin increase utrophin expression in cultured myotubes via a transcriptional regulatory mechanism.

    Science.gov (United States)

    Gramolini, A O; Burton, E A; Tinsley, J M; Ferns, M J; Cartaud, A; Cartaud, J; Davies, K E; Lunde, J A; Jasmin, B J

    1998-01-09

    . Furthermore, this increase in transcriptional activity in response to agrin resulted from a greater number of myonuclei expressing the 1.3-kilobase pair utrophin promoter-nlsLacZ construct. Deletion of 800 base pairs 5' from this fragment decreased the basal levels of nlsLacZ expression and abolished the sensitivity of the utrophin promoter to exogenously applied agrin. In addition, site-directed mutagenesis of an N-box motif contained within this 800-base pair fragment demonstrated its essential contribution in this regulatory mechanism. Finally, direct gene transfer studies performed in vivo further revealed the importance of this DNA element for the synapse-specific expression of the utrophin gene along multinucleated muscle fibers. These data show that both muscle and neural isoforms of agrin can regulate expression of the utrophin gene and further indicate that agrin is not only involved in the mechanisms leading to the formation of clusters containing presynthesized synaptic molecules but that it can also participate in the local regulation of genes encoding synaptic proteins. Together, these observations are therefore relevant for our basic understanding of the events involved in the assembly and maintenance of the postsynaptic membrane domain of the neuromuscular junction and for the potential use of utrophin as a therapeutic strategy to counteract the effects of Duchenne muscular dystrophy.

  10. Uncovering packaging features of co-regulated modules based on human protein interaction and transcriptional regulatory networks

    Directory of Open Access Journals (Sweden)

    He Weiming

    2010-07-01

    Full Text Available Abstract Background Network co-regulated modules are believed to have the functionality of packaging multiple biological entities, and can thus be assumed to coordinate many biological functions in their network neighbouring regions. Results Here, we weighted edges of a human protein interaction network and a transcriptional regulatory network to construct an integrated network, and introduce a probabilistic model and a bipartite graph framework to exploit human co-regulated modules and uncover their specific features in packaging different biological entities (genes, protein complexes or metabolic pathways. Finally, we identified 96 human co-regulated modules based on this method, and evaluate its effectiveness by comparing it with four other methods. Conclusions Dysfunctions in co-regulated interactions often occur in the development of cancer. Therefore, we focussed on an example co-regulated module and found that it could integrate a number of cancer-related genes. This was extended to causal dysfunctions of some complexes maintained by several physically interacting proteins, thus coordinating several metabolic pathways that directly underlie cancer.

  11. Signal transducer and activator of transcription 5 (STAT5) paralog dose governs T cell effector and regulatory functions

    Science.gov (United States)

    Villarino, Alejandro; Laurence, Arian; Robinson, Gertraud W; Bonelli, Michael; Dema, Barbara; Afzali, Behdad; Shih, Han-Yu; Sun, Hong-Wei; Brooks, Stephen R; Hennighausen, Lothar; Kanno, Yuka; O'Shea, John J

    2016-01-01

    The transcription factor STAT5 is fundamental to the mammalian immune system. However, the relationship between its two paralogs, STAT5A and STAT5B, and the extent to which they are functionally distinct, remain uncertain. Using mouse models of paralog deficiency, we demonstrate that they are not equivalent for CD4+ 'helper' T cells, the principal orchestrators of adaptive immunity. Instead, we find that STAT5B is dominant for both effector and regulatory (Treg) responses and, therefore, uniquely necessary for immunological tolerance. Comparative analysis of genomic distribution and transcriptomic output confirm that STAT5B has fargreater impact but, surprisingly, the data point towards asymmetric expression (i.e. paralog dose), rather than distinct functional properties, as the key distinguishing feature. Thus, we propose a quantitative model of STAT5 paralog activity whereby relative abundance imposes functional specificity (or dominance) in the face of widespread structural homology. DOI: http://dx.doi.org/10.7554/eLife.08384.001 PMID:26999798

  12. TALE-induced bHLH transcription factors that activate a pectate lyase contribute to water soaking in bacterial spot of tomato.

    Science.gov (United States)

    Schwartz, Allison R; Morbitzer, Robert; Lahaye, Thomas; Staskawicz, Brian J

    2017-01-31

    AvrHah1 [avirulence (avr) gene homologous to avrBs3 and hax2, no. 1] is a transcription activator-like (TAL) effector (TALE) in Xanthomonas gardneri that induces water-soaked disease lesions on fruits and leaves during bacterial spot of tomato. We observe that water from outside the leaf is drawn into the apoplast in X. gardneri-infected, but not X. gardneriΔavrHah1 (XgΔavrHah1)-infected, plants, conferring a dark, water-soaked appearance. The pull of water can facilitate entry of additional bacterial cells into the apoplast. Comparing the transcriptomes of tomato infected with X. gardneri vs. XgΔavrHah1 revealed the differential up-regulation of two basic helix-loop-helix (bHLH) transcription factors with predicted effector binding elements (EBEs) for AvrHah1. We mined our RNA-sequencing data for differentially up-regulated genes that could be direct targets of the bHLH transcription factors and therefore indirect targets of AvrHah1. We show that two pectin modification genes, a pectate lyase and pectinesterase, are targets of both bHLH transcription factors. Designer TALEs (dTALEs) for the bHLH transcription factors and the pectate lyase, but not for the pectinesterase, complement water soaking when delivered by XgΔavrHah1 By perturbing transcriptional networks and/or modifying the plant cell wall, AvrHah1 may promote water uptake to enhance tissue damage and eventual bacterial egression from the apoplast to the leaf surface. Understanding how disease symptoms develop may be a useful tool for improving the tolerance of crops from damaging disease lesions.

  13. SREBP-2, a second basic-helix-loop-helix-leucine zipper protein that stimulates transcription by binding to a sterol regulatory element.

    OpenAIRE

    Hua, X; Yokoyama, C; Wu, J; Briggs, M R; Brown, M S; Goldstein, J L; Wang, X

    1993-01-01

    We report the cDNA cloning of SREBP-2, the second member of a family of basic-helix-loop-helix-leucine zipper (bHLH-Zip) transcription factors that recognize sterol regulatory element 1 (SRE-1). SRE-1, a conditional enhancer in the promoters for the low density lipoprotein receptor and 3-hydroxy-3-methylglutaryl-coenzyme A synthase genes, increases transcription in the absence of sterols and is inactivated when sterols accumulate. Human SREBP-2 contains 1141 amino acids and is 47% identical t...

  14. Phytohormone priming elevates the accumulation of defense-related gene transcripts and enhances bacterial blight disease resistance in cassava.

    Science.gov (United States)

    Yoodee, Sunisa; Kobayashi, Yohko; Songnuan, Wisuwat; Boonchird, Chuenchit; Thitamadee, Siripong; Kobayashi, Issei; Narangajavana, Jarunya

    2018-01-01

    Cassava bacterial blight (CBB) disease caused by Xanthomonas axonopodis pv. manihotis (Xam) is a severe disease in cassava worldwide. In addition to causing significant cassava yield loss, CBB disease has not been extensively studied, especially in terms of CBB resistance genes. The present research demonstrated the molecular mechanisms underlining the defense response during Xam infection in two cassava cultivars exhibiting different degrees of disease resistance, Huay Bong60 (HB60) and Hanatee (HN). Based on gene expression analysis, ten of twelve putative defense-related genes including, leucine-rich repeat receptor-like kinases (LRR-RLKs), resistance (R), WRKY and pathogenesis-related (PR) genes, were differentially expressed between these two cassava cultivars during Xam infection. The up-regulation of defense-related genes observed in HB60 may be the mechanism required for the reduction of disease severity in the resistant cultivar. Interestingly, priming with salicylic acid (SA) or methyl jasmonate (MeJA) for 24 h before Xam inoculation could enhance the defense response in both cassava cultivars. The disease severity was decreased 10% in the resistant cultivar (HB60) and was remarkably reduced 21% in the susceptible cultivar (HN) by SA/MeJA priming. Priming with Xam inoculation modulated cassava4.1_013417, cassava4.1_030866 and cassava4.1_020555 (highest similarity to MeWRKY59, MePR1 and AtPDF2.2, respectively) expression and led to enhanced resistance of the susceptible cultivar in the second infection. The putative cis-regulatory elements were predicted in an upstream region of these three defense-related genes. The different gene expression levels in these genes between the two cultivars were due to the differences in cis-regulatory elements in their promoter regions. Taken together, our study strongly suggested that the induction of defense-related genes correlated with defense resistance against Xam infection, and exogenous application of SA or Me

  15. Discovery of transcription factors and regulatory regions driving in vivo tumor development by ATAC-seq and FAIRE-seq open chromatin profiling.

    Directory of Open Access Journals (Sweden)

    Kristofer Davie

    2015-02-01

    Full Text Available Genomic enhancers regulate spatio-temporal gene expression by recruiting specific combinations of transcription factors (TFs. When TFs are bound to active regulatory regions, they displace canonical nucleosomes, making these regions biochemically detectable as nucleosome-depleted regions or accessible/open chromatin. Here we ask whether open chromatin profiling can be used to identify the entire repertoire of active promoters and enhancers underlying tissue-specific gene expression during normal development and oncogenesis in vivo. To this end, we first compare two different approaches to detect open chromatin in vivo using the Drosophila eye primordium as a model system: FAIRE-seq, based on physical separation of open versus closed chromatin; and ATAC-seq, based on preferential integration of a transposon into open chromatin. We find that both methods reproducibly capture the tissue-specific chromatin activity of regulatory regions, including promoters, enhancers, and insulators. Using both techniques, we screened for regulatory regions that become ectopically active during Ras-dependent oncogenesis, and identified 3778 regions that become (over-activated during tumor development. Next, we applied motif discovery to search for candidate transcription factors that could bind these regions and identified AP-1 and Stat92E as key regulators. We validated the importance of Stat92E in the development of the tumors by introducing a loss of function Stat92E mutant, which was sufficient to rescue the tumor phenotype. Additionally we tested if the predicted Stat92E responsive regulatory regions are genuine, using ectopic induction of JAK/STAT signaling in developing eye discs, and observed that similar chromatin changes indeed occurred. Finally, we determine that these are functionally significant regulatory changes, as nearby target genes are up- or down-regulated. In conclusion, we show that FAIRE-seq and ATAC-seq based open chromatin profiling

  16. Evaluation of T Regulatory Lymphocytes Transcription Factors in HTLV-1-Associated Myelopathy/Tropical Spastic Paraparesis (HAM/TSP) Patients.

    Science.gov (United States)

    Ghezeldasht, Sanaz Ahmadi; Sadeghian, Hamed; Azarpazhooh, Mahmoud Reza; Shamsian, Seyyed Ali Akbar; Rafatpanah, Houshang; Mahmoodi, Mahmood; Rezaee, Seyyed Abdolrahim

    2017-08-01

    HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) is an aggressive neurological disease. The CD4 + CD25 + T cell population plays pivotal roles in the maintenance of immunological tolerance and prevention of such autoimmune diseases. In the current study, proviral load (PVL), factor forkhead box p3 (Foxp3), and glucocorticoid-induced tumor necrosis factor receptor-related protein (GITR) gene expression and regulatory T cells (Tregs) counts of 21 HAM/TSP patients and 16 HTLV-1 healthy carriers (ACs) were measured using real-time PCR, TaqMan method, and flow cytometry. The demographic, history of disease, and severity of myelopathy were assessed by a checklist and the Osame motor disability score (OMDS). The mean OMDS for HAM/TSP was 4.82 ± 2.37 which had no significant correlation with Treg count or the expression of Foxp3, GITR, and PVL. The CD4 + CD25 + cell counts had no significant differences between HAM/TSP and ACs. Findings revealed a higher PVL in HAM/TSPs (313.36 copies/10 4 ) compared to ACs (144.93 copies/10 4 , p = 0.035). The Foxp3 and GITR mRNA levels were lower in HAM/TSP patients (11.78 and 13.80, respectively) than those in healthy carriers (18.44 and 21.00, p = 0.041 and 0.03, respectively). There was a significant correlation between Treg frequency and Foxp3 gene expression (R = 0.67, p = 0.006) and GITR and Foxp3 (R = 0.84, p = 0.042) in HAM/TSP patients. Furthermore, the transcription factors have strong correlations with CD4 + CD25 + T cell frequencies. These findings suggest that HTLV-1 infection can modify the expression of main functional transcription factors, FOXP3 and GITR, which may lead to immune response deterioration of Tregs and consequently HAM/TSP manifestation.

  17. Genetic variation in metallothionein and metal-regulatory transcription factor 1 in relation to urinary cadmium, copper, and zinc

    International Nuclear Information System (INIS)

    Adams, Scott V.; Barrick, Brian; Christopher, Emily P.; Shafer, Martin M.; Makar, Karen W.; Song, Xiaoling; Lampe, Johanna W.; Vilchis, Hugo; Ulery, April; Newcomb, Polly A.

    2015-01-01

    Background: Metallothionein (MT) proteins play critical roles in the physiological handling of both essential (Cu and Zn) and toxic (Cd) metals. MT expression is regulated by metal-regulatory transcription factor 1 (MTF1). Hence, genetic variation in the MT gene family and MTF1 might influence excretion of these metals. Methods: 321 women were recruited in Seattle, WA and Las Cruces, NM and provided demographic information, urine samples for measurement of metal concentrations by mass spectrometry and creatinine, and blood or saliva for extraction of DNA. Forty-one single nucleotide polymorphisms (SNPs) within the MTF1 gene region and the region of chromosome 16 encoding the MT gene family were selected for genotyping in addition to an ancestry informative marker panel. Linear regression was used to estimate the association of SNPs with urinary Cd, Cu, and Zn, adjusted for age, urinary creatinine, smoking history, study site, and ancestry. Results: Minor alleles of rs28366003 and rs10636 near the MT2A gene were associated with lower urinary Cd, Cu, and Zn. Minor alleles of rs8044719 and rs1599823, near MT1A and MT1B, were associated with lower urinary Cd and Zn, respectively. Minor alleles of rs4653329 in MTF1 were associated with lower urinary Cd. Conclusions: These results suggest that genetic variation in the MT gene region and MTF1 influences urinary Cd, Cu, and Zn excretion. - Highlights: • Genetic variation in metallothionein (MT) genes was assessed in two diverse populations. • Single nucleotide polymorphisms (SNPs) in MT genes were associated with mean urinary Cd, Cu and Zn. • Genetic variation may influence biomarkers of exposure, and associations of exposure with health.

  18. Comparative transcriptional profiling of 3 murine models of SLE nephritis reveals both unique and shared regulatory networks.

    Directory of Open Access Journals (Sweden)

    Ramalingam Bethunaickan

    Full Text Available To define shared and unique features of SLE nephritis in mouse models of proliferative and glomerulosclerotic renal disease.Perfused kidneys from NZB/W F1, NZW/BXSB and NZM2410 mice were harvested before and after nephritis onset. Affymetrix based gene expression profiles of kidney RNA were analyzed using Genomatix Pathway Systems and Ingenuity Pathway Analysis software. Gene expression patterns were confirmed using real-time PCR.955, 1168 and 755 genes were regulated in the kidneys of nephritic NZB/W F1, NZM2410 and NZW/BXSB mice respectively. 263 genes were regulated concordantly in all three strains reflecting immune cell infiltration, endothelial cell activation, complement activation, cytokine signaling, tissue remodeling and hypoxia. STAT3 was the top associated transcription factor, having a binding site in the gene promoter of 60/263 regulated genes. The two strains with proliferative nephritis shared a macrophage/DC infiltration and activation signature. NZB/W and NZM2410 mice shared a mitochondrial dysfunction signature. Dominant T cell and plasma cell signatures in NZB/W mice reflected lymphoid aggregates; this was the only strain with regulatory T cell infiltrates. NZW/BXSB mice manifested tubular regeneration and NZM2410 mice had the most metabolic stress and manifested loss of nephrin, indicating podocyte loss.These findings identify shared inflammatory mechanisms of SLE nephritis that can be therapeutically targeted. Nevertheless, the heterogeneity of effector mechanisms suggests that individualized therapy might need to be based on biopsy findings. Some common mechanisms are shared with non-immune-mediated renal diseases, suggesting that strategies to prevent tissue hypoxia and remodeling may be useful in SLE nephritis.

  19. The Rts1 regulatory subunit of protein phosphatase 2A is required for control of G1 cyclin transcription and nutrient modulation of cell size.

    Directory of Open Access Journals (Sweden)

    Karen Artiles

    2009-11-01

    Full Text Available The key molecular event that marks entry into the cell cycle is transcription of G1 cyclins, which bind and activate cyclin-dependent kinases. In yeast cells, initiation of G1 cyclin transcription is linked to achievement of a critical cell size, which contributes to cell-size homeostasis. The critical cell size is modulated by nutrients, such that cells growing in poor nutrients are smaller than cells growing in rich nutrients. Nutrient modulation of cell size does not work through known critical regulators of G1 cyclin transcription and is therefore thought to work through a distinct pathway. Here, we report that Rts1, a highly conserved regulatory subunit of protein phosphatase 2A (PP2A, is required for normal control of G1 cyclin transcription. Loss of Rts1 caused delayed initiation of bud growth and delayed and reduced accumulation of G1 cyclins. Expression of the G1 cyclin CLN2 from an inducible promoter rescued the delayed bud growth in rts1Delta cells, indicating that Rts1 acts at the level of transcription. Moreover, loss of Rts1 caused altered regulation of Swi6, a key component of the SBF transcription factor that controls G1 cyclin transcription. Epistasis analysis revealed that Rts1 does not work solely through several known critical upstream regulators of G1 cyclin transcription. Cells lacking Rts1 failed to undergo nutrient modulation of cell size. Together, these observations demonstrate that Rts1 is a key player in pathways that link nutrient availability, cell size, and G1 cyclin transcription. Since Rts1 is highly conserved, it may function in similar pathways in vertebrates.

  20. Construction and analysis of the transcription factor-microRNA co-regulatory network response to Mycobacterium tuberculosis: a view from the blood.

    Science.gov (United States)

    Lin, Yan; Duan, Zipeng; Xu, Feng; Zhang, Jiayuan; Shulgina, Marina V; Li, Fan

    2017-01-01

    Mycobacterium tuberculosis ( Mtb ) infection has been regional outbreak, recently. The traditional focus on the patterns of "reductionism" which was associated with single molecular changes has been unable to meet the demand of early diagnosis and clinical application when current tuberculosis infection happened. In this study, we employed a systems biology approach to collect large microarray data sets including mRNAs and microRNAs (miRNAs) to identify the differentially expressed mRNAs and miRNAs in the whole blood of TB patients. The aim was to identify key genes associated with the immune response in the pathogenic process of tuberculosis by analyzing the co-regulatory network that was consisted of transcription factors and miRNAs as well as their target genes. The network along with their co-regulatory genes was analyzed utilizing Transcriptional Regulatory Element Database (TRED) and Database for Annotation, Visualization and Integrated Discovery (DAVID). We got 21 (19 up-regulated and 2 down-regulated) differentially expressed genes that were co-regulated by transcription factors and miRNAs. KEGG pathway enrichment analysis showed that the 21 differentially expressed genes were predominantly involved in Tuberculosis signaling pathway, which may play a major role in tuberculosis biological process. Quantitative real-time PCR was performed to verify the over expression of co-regulatory genes ( FCGR1A and CEBPB ). The genetic expression was correlated with clinicopathological characteristics in TB patients and inferences drawn. Our results suggest the TF-miRNA gene co-regulatory network may help us further understand the molecular mechanism of immune response to tuberculosis and provide us a new angle of future biomarker and therapeutic targets.

  1. ChIPBase v2.0: decoding transcriptional regulatory networks of non-coding RNAs and protein-coding genes from ChIP-seq data.

    Science.gov (United States)

    Zhou, Ke-Ren; Liu, Shun; Sun, Wen-Ju; Zheng, Ling-Ling; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu

    2017-01-04

    The abnormal transcriptional regulation of non-coding RNAs (ncRNAs) and protein-coding genes (PCGs) is contributed to various biological processes and linked with human diseases, but the underlying mechanisms remain elusive. In this study, we developed ChIPBase v2.0 (http://rna.sysu.edu.cn/chipbase/) to explore the transcriptional regulatory networks of ncRNAs and PCGs. ChIPBase v2.0 has been expanded with ∼10 200 curated ChIP-seq datasets, which represent about 20 times expansion when comparing to the previous released version. We identified thousands of binding motif matrices and their binding sites from ChIP-seq data of DNA-binding proteins and predicted millions of transcriptional regulatory relationships between transcription factors (TFs) and genes. We constructed 'Regulator' module to predict hundreds of TFs and histone modifications that were involved in or affected transcription of ncRNAs and PCGs. Moreover, we built a web-based tool, Co-Expression, to explore the co-expression patterns between DNA-binding proteins and various types of genes by integrating the gene expression profiles of ∼10 000 tumor samples and ∼9100 normal tissues and cell lines. ChIPBase also provides a ChIP-Function tool and a genome browser to predict functions of diverse genes and visualize various ChIP-seq data. This study will greatly expand our understanding of the transcriptional regulations of ncRNAs and PCGs. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Menin and RNF20 recruitment is associated with dynamic histone modifications that regulate signal transducer and activator of transcription 1 (STAT1-activated transcription of the interferon regulatory factor 1 gene (IRF1

    Directory of Open Access Journals (Sweden)

    Buro Lauren J

    2010-09-01

    Full Text Available Abstract Background Signal transducer and activator of transcription (STAT activation of gene expression is both rapid and transient, and when properly executed it affects growth, differentiation, homeostasis and the immune response, but when dysregulated it contributes to human disease. Transcriptional activation is regulated by alterations to the chromatin template. However, the role of histone modification at gene loci that are activated for transcription in response to STAT signaling is poorly defined. Results Using chromatin immunoprecipitation, we profiled several histone modifications during STAT1 activation of the interferon regulatory factor 1 gene (IRF1. Methylated lysine histone proteins H3K4me2, H3K4me3, H3K79me3, H3K36me3 and monoubiquitinated histone ubH2B are dynamic and correlate with interferon (IFNγ induction of STAT1 activity. Chemical inhibition of H3K4 methylation downregulates IRF1 transcription and decreases RNA polymerase II (Pol II occupancy at the IRF1 promoter. MEN1, a component of a complex proteins associated with Set1 (COMPASS-like complex and the hBRE1 component, RNF20, are localized to IRF1 in the uninduced state and are further recruited when IRF1 is activated. RNAi-mediated depletion of RNF20 lowers both ubH2B and H3K4me3, but surprisingly, upregulates IFNγ induced IRF1 transcription. The dynamics of phosphorylation in the C-terminal domain (CTD of Pol II are disrupted during gene activation as well. Conclusions H2B monoubiquitination promotes H3K4 methylation, but the E3 ubiquitin ligase, RNF20, is repressive of inducible transcription at the IRF1 gene locus, suggesting that ubH2B can, directly or indirectly, affect Pol II CTD phosphorylation cycling to exert control on ongoing transcription.

  3. The Arabidopsis Transcription Factor NAC016 Promotes Drought Stress Responses by Repressing AREB1 Transcription through a Trifurcate Feed-Forward Regulatory Loop Involving NAP[OPEN

    Science.gov (United States)

    Sakuraba, Yasuhito; Kim, Ye-Sol; Han, Su-Hyun; Lee, Byoung-Doo; Paek, Nam-Chon

    2015-01-01

    Drought and other abiotic stresses negatively affect plant growth and development and thus reduce productivity. The plant-specific NAM/ATAF1/2/CUC2 (NAC) transcription factors have important roles in abiotic stress-responsive signaling. Here, we show that Arabidopsis thaliana NAC016 is involved in drought stress responses; nac016 mutants have high drought tolerance, and NAC016-overexpressing (NAC016-OX) plants have low drought tolerance. Using genome-wide gene expression microarray analysis and MEME motif searches, we identified the NAC016-specific binding motif (NAC16BM), GATTGGAT[AT]CA, in the promoters of genes downregulated in nac016-1 mutants. The NAC16BM sequence does not contain the core NAC binding motif CACG (or its reverse complement CGTG). NAC016 directly binds to the NAC16BM in the promoter of ABSCISIC ACID-RESPONSIVE ELEMENT BINDING PROTEIN1 (AREB1), which encodes a central transcription factor in the stress-responsive abscisic acid signaling pathway and represses AREB1 transcription. We found that knockout mutants of the NAC016 target gene NAC-LIKE, ACTIVATED BY AP3/PI (NAP) also exhibited strong drought tolerance; moreover, NAP binds to the AREB1 promoter and suppresses AREB1 transcription. Taking these results together, we propose that a trifurcate feed-forward pathway involving NAC016, NAP, and AREB1 functions in the drought stress response, in addition to affecting leaf senescence in Arabidopsis. PMID:26059204

  4. Mutant p53 is a transcriptional co-factor that binds to G-rich regulatory regions of active genes and generates transcriptional plasticity

    Czech Academy of Sciences Publication Activity Database

    Quante, T.; Otto, B.; Brázdová, Marie; Kejnovská, Iva; Deppert, W.; Tolstonog, G.V.

    2012-01-01

    Roč. 11, č. 17 (2012), s. 3290-3303 ISSN 1538-4101 R&D Projects: GA ČR(CZ) GAP301/10/2370 Institutional research plan: CEZ:AV0Z50040702 Keywords : mutant p53 * transcription * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 5.243, year: 2012

  5. Role of the DmpR-mediated regulatory circuit in bacterial biodegradation properties in methylphenol-amended soils.

    Science.gov (United States)

    Sarand, I; Skärfstad, E; Forsman, M; Romantschuk, M; Shingler, V

    2001-01-01

    Pathway substrates and some structural analogues directly activate the regulatory protein DmpR to promote transcription of the dmp operon genes encoding the (methyl)phenol degradative pathway of Pseudomonas sp. strain CF600. While a wide range of phenols can activate DmpR, the location and nature of substituents on the basic phenolic ring can limit the level of activation and thus utilization of some compounds as assessed by growth on plates. Here we address the role of the aromatic effector response of DmpR in determining degradative properties in two soil matrices that provide different nutritional conditions. Using the wild-type system and an isogenic counterpart containing a DmpR mutant with enhanced ability to respond to para-substituted phenols, we demonstrate (i) that the enhanced in vitro biodegradative capacity of the regulator mutant strain is manifested in the two different soil types and (ii) that exposure of the wild-type strain to 4-methylphenol-contaminated soil led to rapid selection of a subpopulation exhibiting enhanced capacities to degrade the compound. Genetic and functional analyses of 10 of these derivatives demonstrated that all harbored a single mutation in the sensory domain of DmpR that mediated the phenotype in each case. These findings establish a dominating role for the aromatic effector response of DmpR in determining degradation properties. Moreover, the results indicate that the ability to rapidly adapt regulator properties to different profiles of polluting compounds may underlie the evolutionary success of DmpR-like regulators in controlling aromatic catabolic pathways.

  6. Identification of Lineage-Specific Cis-Regulatory Modules Associated with Variation in Transcription Factor Binding and Chromatin Activity Using Ornstein–Uhlenbeck Models

    Science.gov (United States)

    Naval-Sánchez, Marina; Potier, Delphine; Hulselmans, Gert; Christiaens, Valerie; Aerts, Stein

    2015-01-01

    Scoring the impact of noncoding variation on the function of cis-regulatory regions, on their chromatin state, and on the qualitative and quantitative expression levels of target genes is a fundamental problem in evolutionary genomics. A particular challenge is how to model the divergence of quantitative traits and to identify relationships between the changes across the different levels of the genome, the chromatin activity landscape, and the transcriptome. Here, we examine the use of the Ornstein–Uhlenbeck (OU) model to infer selection at the level of predicted cis-regulatory modules (CRMs), and link these with changes in transcription factor binding and chromatin activity. Using publicly available cross-species ChIP-Seq and STARR-Seq data we show how OU can be applied genome-wide to identify candidate transcription factors for which binding site and CRM turnover is correlated with changes in regulatory activity. Next, we profile open chromatin in the developing eye across three Drosophila species. We identify the recognition motifs of the chromatin remodelers, Trithorax-like and Grainyhead as mostly correlating with species-specific changes in open chromatin. In conclusion, we show in this study that CRM scores can be used as quantitative traits and that motif discovery approaches can be extended towards more complex models of divergence. PMID:25944915

  7. The upstream regulatory sequence of the light harvesting complex Lhcf2 gene of the marine diatom Phaeodactylum tricornutum enhances transcription in an orientation- and distance-independent fashion.

    Science.gov (United States)

    Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela

    2015-12-01

    Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Regulatory mechanisms for 3'-end alternative splicing and polyadenylation of the Glial Fibrillary Acidic Protein, GFAP, transcript

    DEFF Research Database (Denmark)

    Blechingberg, Jenny; Lykke-Andersen, Søren; Jensen, Torben Heick

    2007-01-01

    The glial fibrillary acidic protein, GFAP, forms the intermediate cytoskeleton in cells of the glial lineage. Besides the common GFAP alpha transcript, the GFAP epsilon and GFAP kappa transcripts are generated by alternative mRNA 3'-end processing. Here we use a GFAP minigene to characterize...

  9. Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655

    DEFF Research Database (Denmark)

    Seo, Sang Woo; Kim, Donghyuk; Szubin, Richard

    2015-01-01

    Three transcription factors (TFs), OxyR, SoxR, and SoxS, play a critical role in transcriptional regulation of the defense system for oxidative stress in bacteria. However, their full genome-wide regulatory potential is unknown. Here, we perform a genome-scale reconstruction of the OxyR, SoxR, an...

  10. Gene and transcript abundances of bacterial type III secretion systems from the rumen microbiome are correlated with methane yield in sheep.

    Science.gov (United States)

    Kamke, Janine; Soni, Priya; Li, Yang; Ganesh, Siva; Kelly, William J; Leahy, Sinead C; Shi, Weibing; Froula, Jeff; Rubin, Edward M; Attwood, Graeme T

    2017-08-08

    Ruminants are important contributors to global methane emissions via microbial fermentation in their reticulo-rumens. This study is part of a larger program, characterising the rumen microbiomes of sheep which vary naturally in methane yield (g CH 4 /kg DM/day) and aims to define differences in microbial communities, and in gene and transcript abundances that can explain the animal methane phenotype. Rumen microbiome metagenomic and metatranscriptomic data were analysed by Gene Set Enrichment, sparse partial least squares regression and the Wilcoxon Rank Sum test to estimate correlations between specific KEGG bacterial pathways/genes and high methane yield in sheep. KEGG genes enriched in high methane yield sheep were reassembled from raw reads and existing contigs and analysed by MEGAN to predict their phylogenetic origin. Protein coding sequences from Succinivibrio dextrinosolvens strains were analysed using Effective DB to predict bacterial type III secreted proteins. The effect of S. dextrinosolvens strain H5 growth on methane formation by rumen methanogens was explored using co-cultures. Detailed analysis of the rumen microbiomes of high methane yield sheep shows that gene and transcript abundances of bacterial type III secretion system genes are positively correlated with methane yield in sheep. Most of the bacterial type III secretion system genes could not be assigned to a particular bacterial group, but several genes were affiliated with the genus Succinivibrio, and searches of bacterial genome sequences found that strains of S. dextrinosolvens were part of a small group of rumen bacteria that encode this type of secretion system. In co-culture experiments, S. dextrinosolvens strain H5 showed a growth-enhancing effect on a methanogen belonging to the order Methanomassiliicoccales, and inhibition of a representative of the Methanobrevibacter gottschalkii clade. This is the first report of bacterial type III secretion system genes being associated with high

  11. Comparative Bioinformatics Analysis of Transcription Factor Genes Indicates Conservation of Key Regulatory Domains among Babesia bovis, Babesia microti, and Theileria equi.

    Directory of Open Access Journals (Sweden)

    Heba F Alzan

    2016-11-01

    Full Text Available Apicomplexa tick-borne hemoparasites, including Babesia bovis, Babesia microti, and Theileria equi are responsible for bovine and human babesiosis and equine theileriosis, respectively. These parasites of vast medical, epidemiological, and economic impact have complex life cycles in their vertebrate and tick hosts. Large gaps in knowledge concerning the mechanisms used by these parasites for gene regulation remain. Regulatory genes coding for DNA binding proteins such as members of the Api-AP2, HMG, and Myb families are known to play crucial roles as transcription factors. Although the repertoire of Api-AP2 has been defined and a HMG gene was previously identified in the B. bovis genome, these regulatory genes have not been described in detail in B. microti and T. equi. In this study, comparative bioinformatics was used to: (i identify and map genes encoding for these transcription factors among three parasites' genomes; (ii identify a previously unreported HMG gene in B. microti; (iii define a repertoire of eight conserved Myb genes; and (iv identify AP2 correlates among B. bovis and the better-studied Plasmodium parasites. Searching the available transcriptome of B. bovis defined patterns of transcription of these three gene families in B. bovis erythrocyte stage parasites. Sequence comparisons show conservation of functional domains and general architecture in the AP2, Myb, and HMG proteins, which may be significant for the regulation of common critical parasite life cycle transitions in B. bovis, B. microti, and T. equi. A detailed understanding of the role of gene families encoding DNA binding proteins will provide new tools for unraveling regulatory mechanisms involved in B. bovis, B. microti, and T. equi life cycles and environmental adaptive responses and potentially contributes to the development of novel convergent strategies for improved control of babesiosis and equine piroplasmosis.

  12. Amplification of pico-scale DNA mediated by bacterial carrier DNA for small-cell-number transcription factor ChIP-seq

    DEFF Research Database (Denmark)

    Jakobsen, Janus S; Bagger, Frederik O; Hasemann, Marie S

    2015-01-01

    BACKGROUND: Chromatin-Immunoprecipitation coupled with deep sequencing (ChIP-seq) is used to map transcription factor occupancy and generate epigenetic profiles genome-wide. The requirement of nano-scale ChIP DNA for generation of sequencing libraries has impeded ChIP-seq on in vivo tissues of low...... cell numbers. RESULTS: We describe a robust, simple and scalable methodology for ChIP-seq of low-abundant cell populations, verified down to 10,000 cells. By employing non-mammalian genome mapping bacterial carrier DNA during amplification, we reliably amplify down to 50 pg of ChIP DNA from...... transcription factor (CEBPA) and histone mark (H3K4me3) ChIP. We further demonstrate that genomic profiles are highly resilient to changes in carrier DNA to ChIP DNA ratios. CONCLUSIONS: This represents a significant advance compared to existing technologies, which involve either complex steps of pre...

  13. The NF-κB transcription factor RelA is required for the tolerogenic function of Foxp3(+) regulatory T cells.

    Science.gov (United States)

    Messina, Nicole; Fulford, Thomas; O'Reilly, Lorraine; Loh, Wen Xian; Motyer, Jessica M; Ellis, Darcy; McLean, Catriona; Naeem, Haroon; Lin, Ann; Gugasyan, Raffi; Slattery, Robyn M; Grumont, Raelene J; Gerondakis, Steve

    2016-06-01

    The properties of CD4(+) regulatory T cell (Treg) subsets are dictated by distinct patterns of gene expression determined by FOXP3 and different combinations of various transcription factors. Here we show the NF-κB transcription factor RelA is constitutively active in naïve and effector Tregs. The conditional inactivation of Rela in murine FOXP3(+) cells induces a rapid onset, multi-focal autoimmune disease that depends on RelA being expressed in conventional T cells. In addition to promoting Treg lineage stability, RelA determines the size of the effector Treg population, a function influenced by the presence or absence of RelA in conventional T cells. These findings showing that RelA controls Treg stability and promotes the competitive fitness of effector Tregs highlight the importance of RelA activity in peripheral Treg induced tolerance. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Mathematical model of a telomerase transcriptional regulatory network developed by cell-based screening: analysis of inhibitor effects and telomerase expression mechanisms.

    Directory of Open Access Journals (Sweden)

    Alan E Bilsland

    2014-02-01

    Full Text Available Cancer cells depend on transcription of telomerase reverse transcriptase (TERT. Many transcription factors affect TERT, though regulation occurs in context of a broader network. Network effects on telomerase regulation have not been investigated, though deeper understanding of TERT transcription requires a systems view. However, control over individual interactions in complex networks is not easily achievable. Mathematical modelling provides an attractive approach for analysis of complex systems and some models may prove useful in systems pharmacology approaches to drug discovery. In this report, we used transfection screening to test interactions among 14 TERT regulatory transcription factors and their respective promoters in ovarian cancer cells. The results were used to generate a network model of TERT transcription and to implement a dynamic Boolean model whose steady states were analysed. Modelled effects of signal transduction inhibitors successfully predicted TERT repression by Src-family inhibitor SU6656 and lack of repression by ERK inhibitor FR180204, results confirmed by RT-QPCR analysis of endogenous TERT expression in treated cells. Modelled effects of GSK3 inhibitor 6-bromoindirubin-3'-oxime (BIO predicted unstable TERT repression dependent on noise and expression of JUN, corresponding with observations from a previous study. MYC expression is critical in TERT activation in the model, consistent with its well known function in endogenous TERT regulation. Loss of MYC caused complete TERT suppression in our model, substantially rescued only by co-suppression of AR. Interestingly expression was easily rescued under modelled Ets-factor gain of function, as occurs in TERT promoter mutation. RNAi targeting AR, JUN, MXD1, SP3, or TP53, showed that AR suppression does rescue endogenous TERT expression following MYC knockdown in these cells and SP3 or TP53 siRNA also cause partial recovery. The model therefore successfully predicted several

  15. Expanded roles of leucine-responsive regulatory protein in transcription regulation of the Escherichia coli genome: Genomic SELEX screening of the regulation targets

    OpenAIRE

    Shimada, Tomohiro; Saito, Natsumi; Maeda, Michihisa; Tanaka, Kan; Ishihama, Akira

    2015-01-01

    Leucine-responsive regulatory protein (Lrp) is a transcriptional regulator for the genes involved in transport, biosynthesis and catabolism of amino acids in Escherichia coli. In order to identify the whole set of genes under the direct control of Lrp, we performed Genomic SELEX screening and identified a total of 314 Lrp-binding sites on the E. coli genome. As a result, the regulation target of Lrp was predicted to expand from the hitherto identified genes for amino acid metabolism to a set ...

  16. Real-Time Reverse Transcription PCR as a Tool to Study Virulence Gene Regulation in Bacterial Pathogens.

    Science.gov (United States)

    Aviv, Gili; Gal-Mor, Ohad

    2018-01-01

    Quantitative real-time PCR (qRT-PCR) is a highly sensitive and reliable method for detection and quantification of DNA. When combined with a prior stage of RNA reverse transcription to generate complementary DNA (cDNA), this is a powerful approach to determine and analyze gene transcriptional expression. Real-time quantitative reverse transcription PCR has become the gold standard method in studying genes expression and virulence regulation under various genetic backgrounds (e.g., in the absence of regulators) or environmental conditions. Here we demonstrate the utilization of this approach to study the transcriptional regulation of the conjugation pilus of the Salmonella enterica serovar Infantis virulence plasmid (pESI).

  17. Validating regulatory predictions from diverse bacteria with mutant fitness data.

    Directory of Open Access Journals (Sweden)

    Shiori Sagawa

    Full Text Available Although transcriptional regulation is fundamental to understanding bacterial physiology, the targets of most bacterial transcription factors are not known. Comparative genomics has been used to identify likely targets of some of these transcription factors, but these predictions typically lack experimental support. Here, we used mutant fitness data, which measures the importance of each gene for a bacterium's growth across many conditions, to test regulatory predictions from RegPrecise, a curated collection of comparative genomics predictions. Because characterized transcription factors often have correlated fitness with one of their targets (either positively or negatively, correlated fitness patterns provide support for the comparative genomics predictions. At a false discovery rate of 3%, we identified significant cofitness for at least one target of 158 TFs in 107 ortholog groups and from 24 bacteria. Thus, high-throughput genetics can be used to identify a high-confidence subset of the sequence-based regulatory predictions.

  18. Two Cassava Basic Leucine Zipper (bZIP Transcription Factors (MebZIP3 and MebZIP5 Confer Disease Resistance against Cassava Bacterial Blight

    Directory of Open Access Journals (Sweden)

    Xiaolin Li

    2017-12-01

    Full Text Available Basic domain-leucine zipper (bZIP transcription factor, one type of conserved gene family, plays an important role in plant development and stress responses. Although 77 MebZIPs have been genome-wide identified in cassava, their in vivo roles remain unknown. In this study, we analyzed the expression pattern and the function of two MebZIPs (MebZIP3 and MebZIP5 in response to pathogen infection. Gene expression analysis indicated that MebZIP3 and MebZIP5 were commonly regulated by flg22, Xanthomonas axonopodis pv. manihotis (Xam, salicylic acid (SA, and hydrogen peroxide (H2O2. Subcellular localization analysis showed that MebZIP3 and MebZIP5 are specifically located in cell nucleus. Through overexpression in tobacco, we found that MebZIP3 and MebZIP5 conferred improved disease resistance against cassava bacterial blight, with more callose depositions. On the contrary, MebZIP3- and MebZIP5-silenced plants by virus-induced gene silencing (VIGS showed disease sensitive phenotype, lower transcript levels of defense-related genes and less callose depositions. Taken together, this study highlights the positive role of MebZIP3 and MebZIP5 in disease resistance against cassava bacterial blight for further utilization in genetic improvement of cassava disease resistance.

  19. Temporal and Spatial Coexistence of Archaeal and Bacterial amoA Genes and Gene Transcripts in Lake Lucerne

    Directory of Open Access Journals (Sweden)

    Elisabeth W. Vissers

    2013-01-01

    Full Text Available Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO. This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA and bacteria (AOB over a period of 16 months, shedding more light on the role of both AO in a deep, alpine lake environment. At the surface, at 42 m water depth, and in the water layer immediately above the sediment, AOA generally outnumbered AOB. However, in the surface water during summer stratification, when both AO were low in abundance, AOB were more numerous than AOA. Temporal distribution patterns of AOA and AOB were comparable. Higher abundances of amoA gene transcripts were observed at the onset and end of summer stratification. In summer, archaeal amoA genes and transcripts correlated negatively with temperature and conductivity. Concentrations of ammonium and oxygen did not vary enough to explain the amoA gene and transcript dynamics. The observed herbivorous zooplankton may have caused a hidden flux of mineralized ammonium and a change in abundance of genes and transcripts. At the surface, AO might have been repressed during summer stratification due to nutrient limitation caused by active phytoplankton.

  20. Comprehensive meta-analysis of Signal Transducers and Activators of Transcription (STAT genomic binding patterns discerns cell-specific cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Kang Keunsoo

    2013-01-01

    Full Text Available Abstract Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM, which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors.

  1. ThDof1.4 and ThZFP1 constitute a transcriptional regulatory cascade involved in salt or osmotic stress in Tamarix hispida.

    Science.gov (United States)

    Zang, Dandan; Wang, Lina; Zhang, Yiming; Zhao, Huimin; Wang, Yucheng

    2017-07-01

    Identification of the upstream regulators of a gene is important to characterize the transcriptional pathway and the function of the gene. Previously, we found that a zinc finger protein (ThZFP1) is involved in abiotic stress tolerance of Tamarix hispida. In the present study, we further investigated the transcriptional pathway of ThZFP1. Dof motifs are abundant in the ThZFP1 promoter; therefore, we used them to screen for transcriptional regulators of ThZFP1. A Dof protein, ThDof1.4, binds to the Dof motif specifically, and was hypothesized as the upstream regulator of ThZFP1. Further study showed that overexpression of ThDof1.4 in T. hispida activated the expression of GUS controlled by the ThZFP1 promoter. In T. hispida, transient overexpression of ThDof1.4 increased the transcripts of ThZFP1; conversely, transient RNAi-silencing of ThDof1.4 reduced the expression of ThZFP1. Chromatin immunoprecipitation indicated that ThDof1.4 binds to the ThZFP1 promoter. Additionally, ThDof1.4 and ThZFP1 share similar expression patterns in response to salt or drought stress. Furthermore, like ThZFP1, ThDof1.4 could increase the proline level and enhance ROS scavenging capability to improve salt and osmotic stress tolerance. Together, these results suggested that ThDof1.4 and ThZFP1 form a transcriptional regulatory cascade involved in abiotic stress resistance in T. hispida.

  2. UVB induces a genome-wide acting negative regulatory mechanism that operates at the level of transcription initiation in human cells.

    Science.gov (United States)

    Gyenis, Akos; Umlauf, David; Ujfaludi, Zsuzsanna; Boros, Imre; Ye, Tao; Tora, Làszlò

    2014-07-01

    Faithful transcription of DNA is constantly threatened by different endogenous and environmental genotoxic effects. Transcription coupled repair (TCR) has been described to stop transcription and quickly remove DNA lesions from the transcribed strand of active genes, permitting rapid resumption of blocked transcription. This repair mechanism has been well characterized in the past using individual target genes. Moreover, numerous efforts investigated the fate of blocked RNA polymerase II (Pol II) during DNA repair mechanisms and suggested that stopped Pol II complexes can either backtrack, be removed and degraded or bypass the lesions to allow TCR. We investigated the effect of a non-lethal dose of UVB on global DNA-bound Pol II distribution in human cells. We found that the used UVB dose did not induce Pol II degradation however surprisingly at about 93% of the promoters of all expressed genes Pol II occupancy was seriously reduced 2-4 hours following UVB irradiation. The presence of Pol II at these cleared promoters was restored 5-6 hours after irradiation, indicating that the negative regulation is very dynamic. We also identified a small set of genes (including several p53 regulated genes), where the UVB-induced Pol II clearing did not operate. Interestingly, at promoters, where Pol II promoter clearance occurs, TFIIH, but not TBP, follows the behavior of Pol II, suggesting that at these genes upon UVB treatment TFIIH is sequestered for DNA repair by the TCR machinery. In agreement, in cells where the TCR factor, the Cockayne Syndrome B protein, was depleted UVB did not induce Pol II and TFIIH clearance at promoters. Thus, our study reveals a UVB induced negative regulatory mechanism that targets Pol II transcription initiation on the large majority of transcribed gene promoters, and a small subset of genes, where Pol II escapes this negative regulation.

  3. UVB induces a genome-wide acting negative regulatory mechanism that operates at the level of transcription initiation in human cells.

    Directory of Open Access Journals (Sweden)

    Akos Gyenis

    2014-07-01

    Full Text Available Faithful transcription of DNA is constantly threatened by different endogenous and environmental genotoxic effects. Transcription coupled repair (TCR has been described to stop transcription and quickly remove DNA lesions from the transcribed strand of active genes, permitting rapid resumption of blocked transcription. This repair mechanism has been well characterized in the past using individual target genes. Moreover, numerous efforts investigated the fate of blocked RNA polymerase II (Pol II during DNA repair mechanisms and suggested that stopped Pol II complexes can either backtrack, be removed and degraded or bypass the lesions to allow TCR. We investigated the effect of a non-lethal dose of UVB on global DNA-bound Pol II distribution in human cells. We found that the used UVB dose did not induce Pol II degradation however surprisingly at about 93% of the promoters of all expressed genes Pol II occupancy was seriously reduced 2-4 hours following UVB irradiation. The presence of Pol II at these cleared promoters was restored 5-6 hours after irradiation, indicating that the negative regulation is very dynamic. We also identified a small set of genes (including several p53 regulated genes, where the UVB-induced Pol II clearing did not operate. Interestingly, at promoters, where Pol II promoter clearance occurs, TFIIH, but not TBP, follows the behavior of Pol II, suggesting that at these genes upon UVB treatment TFIIH is sequestered for DNA repair by the TCR machinery. In agreement, in cells where the TCR factor, the Cockayne Syndrome B protein, was depleted UVB did not induce Pol II and TFIIH clearance at promoters. Thus, our study reveals a UVB induced negative regulatory mechanism that targets Pol II transcription initiation on the large majority of transcribed gene promoters, and a small subset of genes, where Pol II escapes this negative regulation.

  4. Seed maturation associated transcriptional programs and regulatory networks underlying genotypic difference in seed dormancy and size/weight in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Yamasaki, Yuji; Gao, Feng; Jordan, Mark C; Ayele, Belay T

    2017-09-16

    Maturation forms one of the critical seed developmental phases and it is characterized mainly by programmed cell death, dormancy and desiccation, however, the transcriptional programs and regulatory networks underlying acquisition of dormancy and deposition of storage reserves during the maturation phase of seed development are poorly understood in wheat. The present study performed comparative spatiotemporal transcriptomic analysis of seed maturation in two wheat genotypes with contrasting seed weight/size and dormancy phenotype. The embryo and endosperm tissues of maturing seeds appeared to exhibit genotype-specific temporal shifts in gene expression profile that might contribute to the seed phenotypic variations. Functional annotations of gene clusters suggest that the two tissues exhibit distinct but genotypically overlapping molecular functions. Motif enrichment predicts genotypically distinct abscisic acid (ABA) and gibberellin (GA) regulated transcriptional networks contribute to the contrasting seed weight/size and dormancy phenotypes between the two genotypes. While other ABA responsive element (ABRE) motifs are enriched in both genotypes, the prevalence of G-box-like motif specifically in tissues of the dormant genotype suggests distinct ABA mediated transcriptional mechanisms control the establishment of dormancy during seed maturation. In agreement with this, the bZIP transcription factors that co-express with ABRE enriched embryonic genes differ with genotype. The enrichment of SITEIIATCYTC motif specifically in embryo clusters of maturing seeds irrespective of genotype predicts a tissue specific role for the respective TCP transcription factors with no or minimal contribution to the variations in seed dormancy. The results of this study advance our understanding of the seed maturation associated molecular mechanisms underlying variation in dormancy and weight/size in wheat seeds, which is a critical step towards the designing of molecular strategies

  5. A DNA-binding-site landscape and regulatory network analysis for NAC transcription factors in Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Lindemose, Søren; Jensen, Michael Krogh; de Velde, Jan Van

    2014-01-01

    Target gene identification for transcription factors is a prerequisite for the systems wide understanding of organismal behaviour. NAM-ATAF1/2-CUC2 (NAC) transcription factors are amongst the largest transcription factor families in plants, yet limited data exist from unbiased approaches to resolve...... the DNA-binding preferences of individual members. Here, we present a TF-target gene identification workflow based on the integration of novel protein binding microarray data with gene expression and multi-species promoter sequence conservation to identify the DNA-binding specificities and the gene...... of complementary functional genomics filters, makes it possible to translate, for each TF, protein binding microarray data into a set of high-quality target genes. With this approach, we confirm NAC target genes reported from independent in vivo analyses. We emphasize that candidate target gene sets together...

  6. Transcriptional regulatory program in wild-type and retinoblastoma gene-deficient mouse embryonic fibroblasts during adipocyte differentiation

    DEFF Research Database (Denmark)

    Hakim-Weber, Robab; Krogsdam, Anne-M; Jørgensen, Claus

    2011-01-01

    Although many molecular regulators of adipogenesis have been identified a comprehensive catalogue of components is still missing. Recent studies showed that the retinoblastoma protein (pRb) was expressed in the cell cycle and late cellular differentiation phase during adipogenesis. To investigate...... this dual role of pRb in the early and late stages of adipogenesis we used microarrays to perform a comprehensive systems-level analysis of the common transcriptional program of the classic 3T3-L1 preadipocyte cell line, wild-type mouse embryonic fibroblasts (MEFs), and retinoblastoma gene-deficient MEFs...... of experimental data and computational analyses pinpointed a feedback-loop between Pparg and Foxo1.To analyze the effects of the retinoblastoma protein at the transcriptional level we chose a perturbated system (Rb-/- MEFs) for comparison to the transcriptional program of wild-type MEFs. Gene ontology analysis...

  7. Sex Chromosome-wide Transcriptional Suppression and Compensatory Cis-Regulatory Evolution Mediate Gene Expression in the Drosophila Male Germline.

    Directory of Open Access Journals (Sweden)

    Emily L Landeen

    2016-07-01

    Full Text Available The evolution of heteromorphic sex chromosomes has repeatedly resulted in the evolution of sex chromosome-specific forms of regulation, including sex chromosome dosage compensation in the soma and meiotic sex chromosome inactivation in the germline. In the male germline of Drosophila melanogaster, a novel but poorly understood form of sex chromosome-specific transcriptional regulation occurs that is distinct from canonical sex chromosome dosage compensation or meiotic inactivation. Previous work shows that expression of reporter genes driven by testis-specific promoters is considerably lower-approximately 3-fold or more-for transgenes inserted into X chromosome versus autosome locations. Here we characterize this transcriptional suppression of X-linked genes in the male germline and its evolutionary consequences. Using transgenes and transpositions, we show that most endogenous X-linked genes, not just testis-specific ones, are transcriptionally suppressed several-fold specifically in the Drosophila male germline. In wild-type testes, this sex chromosome-wide transcriptional suppression is generally undetectable, being effectively compensated by the gene-by-gene evolutionary recruitment of strong promoters on the X chromosome. We identify and experimentally validate a promoter element sequence motif that is enriched upstream of the transcription start sites of hundreds of testis-expressed genes; evolutionarily conserved across species; associated with strong gene expression levels in testes; and overrepresented on the X chromosome. These findings show that the expression of X-linked genes in the Drosophila testes reflects a balance between chromosome-wide epigenetic transcriptional suppression and long-term compensatory adaptation by sex-linked genes. Our results have broad implications for the evolution of gene expression in the Drosophila male germline and for genome evolution.

  8. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    International Nuclear Information System (INIS)

    Ghazal, P.; Lubon, H.; Hennighausen, L.

    1988-01-01

    Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

  9. Ciliary dyslexia candidate genes DYX1C1 and DCDC2 are regulated by Regulatory Factor X (RFX) transcription factors through X-box promoter motifs.

    Science.gov (United States)

    Tammimies, Kristiina; Bieder, Andrea; Lauter, Gilbert; Sugiaman-Trapman, Debora; Torchet, Rachel; Hokkanen, Marie-Estelle; Burghoorn, Jan; Castrén, Eero; Kere, Juha; Tapia-Páez, Isabel; Swoboda, Peter

    2016-10-01

    DYX1C1, DCDC2, and KIAA0319 are three of the most replicated dyslexia candidate genes (DCGs). Recently, these DCGs were implicated in functions at the cilium. Here, we investigate the regulation of these DCGs by Regulatory Factor X transcription factors (RFX TFs), a gene family known for transcriptionally regulating ciliary genes. We identify conserved X-box motifs in the promoter regions of DYX1C1, DCDC2, and KIAA0319 and demonstrate their functionality, as well as the ability to recruit RFX TFs using reporter gene and electrophoretic mobility shift assays. Furthermore, we uncover a complex regulation pattern between RFX1, RFX2, and RFX3 and their significant effect on modifying the endogenous expression of DYX1C1 and DCDC2 in a human retinal pigmented epithelial cell line immortalized with hTERT (hTERT-RPE1). In addition, induction of ciliogenesis increases the expression of RFX TFs and DCGs. At the protein level, we show that endogenous DYX1C1 localizes to the base of the cilium, whereas DCDC2 localizes along the entire axoneme of the cilium, thereby validating earlier localization studies using overexpression models. Our results corroborate the emerging role of DCGs in ciliary function and characterize functional noncoding elements, X-box promoter motifs, in DCG promoter regions, which thus can be targeted for mutation screening in dyslexia and ciliopathies associated with these genes.-Tammimies, K., Bieder, A., Lauter, G., Sugiaman-Trapman, D., Torchet, R., Hokkanen, M.-E., Burghoorn, J., Castrén, E., Kere, J., Tapia-Páez, I., Swoboda, P. Ciliary dyslexia candidate genes DYX1C1 and DCDC2 are regulated by Regulatory Factor (RF) X transcription factors through X-box promoter motifs. © The Author(s).

  10. Selection Effects on the Positioning of Genes and Gene Structures from the Interplay of Replication and Transcription in Bacterial Genomes

    Directory of Open Access Journals (Sweden)

    Kazuharu Arakawa

    2007-01-01

    Full Text Available Bacterial chromosomes are partly shaped by the functional requirements for efficient replication, which lead to strand bias as commonly characterized by the excess of guanines over cytosines in the leading strand. Gene structures are also highly organized within bacterial genomes as a result of such functional constraints, displaying characteristic positioning and structuring along the genome. Here we analyze the gene structures in completely sequenced bacterial chromosomes to observe the positional constraints on gene orientation, length, and codon usage with regard to the positions of replication origin and terminus. Selection on these gene features is different in regions surrounding the terminus of replication from the rest of the genome, but the selection could be either positive or negative depending on the species, and these positional effects are partly attributed to the A-T enrichment near the terminus. Characteristic gene structuring relative to the position of replication origin and terminus is commonly observed among most bacterial species with circular chromosomes, and therefore we argue that the highly organized gene positioning as well as the strand bias should be considered for genomics studies of bacteria.

  11. Nature of bacterial colonization influences transcription of mucin genes in mice during the first week of life

    DEFF Research Database (Denmark)

    Bergström, Anders; Kristensen, Matilde Bylov; Bahl, Martin Iain

    2012-01-01

    In summary, our data show that development of the expression of genes encoding secreted (Muc2/Tff3) and membrane-bound (Muc1/Muc3/Muc4) mucus regulatory proteins, respectively, is distinct and that the onset of this development may be accelerated by specific groups of bacteria present or absent a...

  12. Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655

    Directory of Open Access Journals (Sweden)

    Sang Woo Seo

    2015-08-01

    Full Text Available Three transcription factors (TFs, OxyR, SoxR, and SoxS, play a critical role in transcriptional regulation of the defense system for oxidative stress in bacteria. However, their full genome-wide regulatory potential is unknown. Here, we perform a genome-scale reconstruction of the OxyR, SoxR, and SoxS regulons in Escherichia coli K-12 MG1655. Integrative data analysis reveals that a total of 68 genes in 51 transcription units (TUs belong to these regulons. Among them, 48 genes showed more than 2-fold changes in expression level under single-TF-knockout conditions. This reconstruction expands the genome-wide roles of these factors to include direct activation of genes related to amino acid biosynthesis (methionine and aromatic amino acids, cell wall synthesis (lipid A biosynthesis and peptidoglycan growth, and divalent metal ion transport (Mn2+, Zn2+, and Mg2+. Investigating the co-regulation of these genes with other stress-response TFs reveals that they are independently regulated by stress-specific TFs.

  13. Mapping Mammalian Cell-type-specific Transcriptional Regulatory Networks Using KD-CAGE and ChIP-seq Data in the TC-YIK Cell Line.

    Science.gov (United States)

    Lizio, Marina; Ishizu, Yuri; Itoh, Masayoshi; Lassmann, Timo; Hasegawa, Akira; Kubosaki, Atsutaka; Severin, Jessica; Kawaji, Hideya; Nakamura, Yukio; Suzuki, Harukazu; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R R

    2015-01-01

    Mammals are composed of hundreds of different cell types with specialized functions. Each of these cellular phenotypes are controlled by different combinations of transcription factors. Using a human non islet cell insulinoma cell line (TC-YIK) which expresses insulin and the majority of known pancreatic beta cell specific genes as an example, we describe a general approach to identify key cell-type-specific transcription factors (TFs) and their direct and indirect targets. By ranking all human TFs by their level of enriched expression in TC-YIK relative to a broad collection of samples (FANTOM5), we confirmed known key regulators of pancreatic function and development. Systematic siRNA mediated perturbation of these TFs followed by qRT-PCR revealed their interconnections with NEUROD1 at the top of the regulation hierarchy and its depletion drastically reducing insulin levels. For 15 of the TF knock-downs (KD), we then used Cap Analysis of Gene Expression (CAGE) to identify thousands of their targets genome-wide (KD-CAGE). The data confirm NEUROD1 as a key positive regulator in the transcriptional regulatory network (TRN), and ISL1, and PROX1 as antagonists. As a complimentary approach we used ChIP-seq on four of these factors to identify NEUROD1, LMX1A, PAX6, and RFX6 binding sites in the human genome. Examining the overlap between genes perturbed in the KD-CAGE experiments and genes with a ChIP-seq peak within 50 kb of their promoter, we identified direct transcriptional targets of these TFs. Integration of KD-CAGE and ChIP-seq data shows that both NEUROD1 and LMX1A work as the main transcriptional activators. In the core TRN (i.e., TF-TF only), NEUROD1 directly transcriptionally activates the pancreatic TFs HSF4, INSM1, MLXIPL, MYT1, NKX6-3, ONECUT2, PAX4, PROX1, RFX6, ST18, DACH1, and SHOX2, while LMX1A directly transcriptionally activates DACH1, SHOX2, PAX6, and PDX1. Analysis of these complementary datasets suggests the need for caution in interpreting Ch

  14. Single nucleotide polymorphisms with cis-regulatory effects on long non-coding transcripts in human primary monocytes.

    Directory of Open Access Journals (Sweden)

    Jonas Carlsson Almlöf

    Full Text Available We applied genome-wide allele-specific expression analysis of monocytes from 188 samples. Monocytes were purified from white blood cells of healthy blood donors to detect cis-acting genetic variation that regulates the expression of long non-coding RNAs. We analysed 8929 regions harboring genes for potential long non-coding RNA that were retrieved from data from the ENCODE project. Of these regions, 60% were annotated as intergenic, which implies that they do not overlap with protein-coding genes. Focusing on the intergenic regions, and using stringent analysis of the allele-specific expression data, we detected robust cis-regulatory SNPs in 258 out of 489 informative intergenic regions included in the analysis. The cis-regulatory SNPs that were significantly associated with allele-specific expression of long non-coding RNAs were enriched to enhancer regions marked for active or bivalent, poised chromatin by histone modifications. Out of the lncRNA regions regulated by cis-acting regulatory SNPs, 20% (n = 52 were co-regulated with the closest protein coding gene. We compared the identified cis-regulatory SNPs with those in the catalog of SNPs identified by genome-wide association studies of human diseases and traits. This comparison identified 32 SNPs in loci from genome-wide association studies that displayed a strong association signal with allele-specific expression of non-coding RNAs in monocytes, with p-values ranging from 6.7×10(-7 to 9.5×10(-89. The identified cis-regulatory SNPs are associated with diseases of the immune system, like multiple sclerosis and rheumatoid arthritis.

  15. CONREAL: conserved regulatory elements anchored alignment algorithm for identification of transcription factor binding sites by phylogenetic footprinting

    NARCIS (Netherlands)

    Berezikov, E.; Guryev, V.; Plasterk, R.; Cuppen, E.

    2004-01-01

    Prediction of transcription-factor target sites in promoters remains difficult due to the short length and degeneracy of the target sequences. Although the use of orthologous sequences and phylogenetic footprinting approaches may help in the recognition of conserved and potentially functional

  16. Heterogeneous nuclear ribonucleoprotein A1 in health and neurodegenerative disease: from structural insights to post-transcriptional regulatory roles.

    Science.gov (United States)

    Bekenstein, Uriya; Soreq, Hermona

    2013-09-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) are a family of conserved nuclear proteins that associate with nascent RNA polymerase II transcripts to yield hnRNP particles, playing key roles in mRNA metabolism, DNA-related functions and microRNA biogenesis. HnRNPs accompany transcripts from stages of transcriptional regulation through splicing and post-transcriptional regulation, and are believed to affect the majority of expressed genes in mammals. Most hnRNP mRNA transcripts undergo alternative splicing and post-translational modifications, to yield a remarkable diversity of proteins with numerous functional elements that work in concert in their multiple functions. Therefore, mis-regulation of hnRNPs leads to different maladies. Here, we focus on the role of one of the best-known members of this protein family, hnRNP A1 in RNA metabolism, and address recent works that note its multileveled involvement in several neurodegenerative disorders. Initially discovered as a DNA binding protein, hnRNP A1 includes two RNA recognition motifs, and post-translational modifications of these and other regions in this multifunctional protein alter both its nuclear pore shuttling properties and its RNA interactions and affect transcription, mRNA splicing and microRNA biogenesis. HnRNP A1 plays several key roles in neuronal functioning and its depletion, either due to debilitated cholinergic neurotransmission or under autoimmune reactions causes drastic changes in RNA metabolism. Consequently, hnRNP A1 decline contributes to the severity of symptoms in several neurodegenerative diseases, including Alzheimer's disease (AD), spinal muscular atrophy (SMA), fronto-temporal lobar degeneration (FTLD), amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), hereditary spastic paraparesis (HSP) and HTLV-I associated myelopathy/tropical spastic paraparesis (HAM/TSP). At the translational level, these properties of hnRNP A1 led to massive research efforts aimed at developing RNA

  17. Transcriptional responses of Italian ryegrass during interaction with Xanthomonas translucens pv. graminis reveal novel candidate genes for bacterial wilt resistance

    DEFF Research Database (Denmark)

    Wichmann, Fabienne; Asp, Torben; Widmer, Franko

    2011-01-01

    Xanthomonas translucens pv. graminis (Xtg) causes bacterial wilt, a severe disease of forage grasses such as Italian ryegrass (Lolium multiflorum Lam.). In order to gain a more detailed understanding of the genetic control of resistance mechanisms and to provide prerequisites for marker assisted...... selection, the partial transcriptomes of two Italian ryegrass genotypes, one resistant and one susceptible to bacterial wilt were compared at four time points after Xtg infection. A cDNA microarray developed from a perennial ryegrass (Lolium perenne) expressed sequence tag set consisting of 9,990 unique...... genes was used for transcriptome analysis in Italian ryegrass. An average of 4,487 (45%) of the perennial ryegrass sequences spotted on the cDNA microarray were detected by cross-hybridisation to Italian ryegrass. Transcriptome analyses of the resistant versus the susceptible genotype revealed...

  18. Foot-and-mouth disease virus leader proteinase inhibits dsRNA-induced type I interferon transcription by decreasing interferon regulatory factor 3/7 in protein levels

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dang; Fang, Liurong; Luo, Rui; Ye, Rui; Fang, Ying; Xie, Lilan; Chen, Huanchun [Division of Animal Infectious Diseases, State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); Xiao, Shaobo, E-mail: shaoboxiao@yahoo.com [Division of Animal Infectious Diseases, State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China)

    2010-08-13

    Research highlights: {yields} FMDV L{sup pro} inhibits poly(I:C)-induced IFN-{alpha}1/{beta} mRNA expression. {yields} L{sup pro} inhibits MDA5-mediated activation of the IFN-{alpha}1/{beta} promoter. {yields} L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes. {yields} L{sup pro} inhibits IFN-{alpha}1/{beta} promoter activation by decreasing IRF-3/7 in protein levels. {yields} The ability to process eIF-4G of L{sup pro} is not necessary to inhibit IFN-{alpha}1/{beta} activation. -- Abstract: The leader proteinase (L{sup pro}) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-{beta} (IFN-{beta}) antagonist that disrupts the integrity of transcription factor nuclear factor {kappa}B (NF-{kappa}B). In this study, we showed that the reduction of double stranded RNA (dsRNA)-induced IFN-{alpha}1/{beta} expression caused by L{sup pro} was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-{alpha}/{beta}. Furthermore, overexpression of L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L{sup pro} mutants indicated that the ability to process eIF-4G of L{sup pro} is not required for suppressing dsRNA-induced activation of the IFN-{alpha}1/{beta} promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-{kappa}B, L{sup pro} also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.

  19. Temporal clustering of gene expression links the metabolic transcription factor HNF4α to the ER stress-dependent gene regulatory network

    Directory of Open Access Journals (Sweden)

    Angela M Arensdorf

    2013-09-01

    Full Text Available The unfolded protein response (UPR responds to disruption of endoplasmic reticulum (ER function by initiating signaling cascades that ultimately culminate in extensive transcriptional regulation. Classically, this regulation includes genes encoding ER chaperones, ER-associated degradation factors, and others involved in secretory protein folding and processing, and is carried out by the transcriptional activators that are produced as a consequence of UPR activation. However, up to half of the mRNAs regulated by ER stress are downregulated rather than upregulated, and the mechanisms linking ER stress and UPR activation to mRNA suppression are poorly understood. To begin to address this issue, we used a bottom-up approach to study the metabolic gene regulatory network controlled by the UPR in the liver, because ER in the liver stress leads to lipid accumulation, and fatty liver disease is the most common liver disease in the western world. qRT-PCR profiling of mouse liver mRNAs during ER stress revealed that suppression of the transcriptional regulators C/EBPα, PPARα, and PGC-1α preceded lipid accumulation, and was then followed by suppression of mRNAs encoding key enzymes involved in fatty acid oxidation and lipoprotein biogenesis and transport. Mice lacking the ER stress sensor ATF6α, which experience persistent ER stress and profound lipid accumulation during challenge, were then used as the basis for a functional genomics approach that allowed genes to be grouped into distinct expression profiles. This clustering predicted that ER stress would suppress the activity of the metabolic transcriptional regulator HNF4α--a finding subsequently confirmed by chromatin immunopreciptation at the Cebpa and Pgc1a promoters. Our results establish a framework for hepatic gene regulation during ER stress and suggest that HNF4α occupies the apex of that framework. They also provide a unique resource for the community to further explore the temporal

  20. The muscle regulatory transcription factor MyoD participates with p53 to directly increase the expression of the pro-apoptotic Bcl2 family member PUMA.

    Science.gov (United States)

    Harford, Terri J; Kliment, Greg; Shukla, Girish C; Weyman, Crystal M

    2017-12-01

    The muscle regulatory transcription factor MyoD is a master regulator of skeletal myoblast differentiation. We have previously reported that MyoD is also necessary for the elevated expression of the pro-apoptotic Bcl2 family member PUMA, and the ensuing apoptosis, that occurs in a subset of myoblasts induced to differentiate. Herein, we report the identification of a functional MyoD binding site within the extended PUMA promoter. In silico analysis of the murine PUMA extended promoter revealed three potential MyoD binding sites within 2 kb of the transcription start site. Expression from a luciferase reporter construct containing this 2 kb fragment was enhanced by activation of MyoD in both myoblasts and fibroblasts and diminished by silencing of MyoD in myoblasts. Experiments utilizing truncated versions of this promoter region revealed that the potential binding site at position - 857 was necessary for expression. Chromatin immunoprecipitation (ChIP) analysis confirmed binding of MyoD to the DNA region encompassing position - 857. The increase in MyoD binding to the PUMA promoter as a consequence of culture in differentiation media (DM) was comparable to the increase in MyoD binding at the myogenin promoter and was diminished in myoblasts silenced for MyoD expression. Finally, ChIP analysis using an antibody specific for the transcription factor p53 demonstrated that, in myoblasts silenced for MyoD expression, p53 binding to the PUMA promoter was diminished in response to culture in DM. These data indicate that MyoD plays a direct role in regulating PUMA expression and reveal functional consequences of MyoD expression on p53 mediated transcription of PUMA.

  1. Foot-and-mouth disease virus leader proteinase inhibits dsRNA-induced type I interferon transcription by decreasing interferon regulatory factor 3/7 in protein levels

    International Nuclear Information System (INIS)

    Wang, Dang; Fang, Liurong; Luo, Rui; Ye, Rui; Fang, Ying; Xie, Lilan; Chen, Huanchun; Xiao, Shaobo

    2010-01-01

    Research highlights: → FMDV L pro inhibits poly(I:C)-induced IFN-α1/β mRNA expression. → L pro inhibits MDA5-mediated activation of the IFN-α1/β promoter. → L pro significantly reduced the transcription of multiple IRF-responsive genes. → L pro inhibits IFN-α1/β promoter activation by decreasing IRF-3/7 in protein levels. → The ability to process eIF-4G of L pro is not necessary to inhibit IFN-α1/β activation. -- Abstract: The leader proteinase (L pro ) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-β (IFN-β) antagonist that disrupts the integrity of transcription factor nuclear factor κB (NF-κB). In this study, we showed that the reduction of double stranded RNA (dsRNA)-induced IFN-α1/β expression caused by L pro was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-α/β. Furthermore, overexpression of L pro significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L pro mutants indicated that the ability to process eIF-4G of L pro is not required for suppressing dsRNA-induced activation of the IFN-α1/β promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-κB, L pro also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.

  2. The stress-regulatory transcription factors Msn2 and Msn4 regulate fatty acid oxidation in budding yeast.

    Science.gov (United States)

    Rajvanshi, Praveen Kumar; Arya, Madhuri; Rajasekharan, Ram

    2017-11-10

    The transcription factors Msn2 and Msn4 (multicopy suppressor of SNF1 mutation proteins 2 and 4) bind the stress-response element in gene promoters in the yeast Saccharomyces cerevisiae However, the roles of Msn2/4 in primary metabolic pathways such as fatty acid β-oxidation are unclear. Here, in silico analysis revealed that the promoters of most genes involved in the biogenesis, function, and regulation of the peroxisome contain Msn2/4-binding sites. We also found that transcript levels of MSN2/MSN4 are increased in glucose-depletion conditions and that during growth in nonpreferred carbon sources, Msn2 is constantly localized to the nucleus in wild-type cells. Of note, the double mutant msn2 Δ msn4 Δ exhibited a severe growth defect when grown with oleic acid as the sole carbon source and had reduced transcript levels of major β-oxidation genes. ChIP indicated that Msn2 has increased occupancy on the promoters of β-oxidation genes in glucose-depleted conditions, and in vivo reporter gene analysis indicated reduced expression of these genes in msn2 Δ msn4 Δ cells. Moreover, mobility shift assays revealed that Msn4 binds β-oxidation gene promoters. Immunofluorescence microscopy with anti-peroxisome membrane protein antibodies disclosed that the msn2 Δ msn4 Δ strain had fewer peroxisomes than the wild type, and lipid analysis indicated that the msn2 Δ msn4 Δ strain had increased triacylglycerol and steryl ester levels. Collectively, our data suggest that Msn2/Msn4 transcription factors activate expression of the genes involved in fatty acid oxidation. Because glucose sensing, signaling, and fatty acid β-oxidation pathways are evolutionarily conserved throughout eukaryotes, the msn2 Δ msn4 Δ strain could therefore be a good model system for further study of these critical processes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Divergence of regulatory networks governed by the orthologous transcription factors FLC and PEP1 in Brassicaceae species.

    Science.gov (United States)

    Mateos, Julieta L; Tilmes, Vicky; Madrigal, Pedro; Severing, Edouard; Richter, René; Rijkenberg, Colin W M; Krajewski, Paweł; Coupland, George

    2017-12-19

    Genome-wide landscapes of transcription factor (TF) binding sites (BSs) diverge during evolution, conferring species-specific transcriptional patterns. The rate of divergence varies in different metazoan lineages but has not been widely studied in plants. We identified the BSs and assessed the effects on transcription of FLOWERING LOCUS C (FLC) and PERPETUAL FLOWERING 1 (PEP1), two orthologous MADS-box TFs that repress flowering and confer vernalization requirement in the Brassicaceae species Arabidopsis thaliana and Arabis alpina , respectively. We found that only 14% of their BSs were conserved in both species and that these contained a CArG-box that is recognized by MADS-box TFs. The CArG-box consensus at conserved BSs was extended compared with the core motif. By contrast, species-specific BSs usually lacked the CArG-box in the other species. Flowering-time genes were highly overrepresented among conserved targets, and their CArG-boxes were widely conserved among Brassicaceae species. Cold-regulated (COR) genes were also overrepresented among targets, but the cognate BSs and the identity of the regulated genes were usually different in each species. In cold, COR gene transcript levels were increased in flc and pep1-1 mutants compared with WT, and this correlated with reduced growth in pep1-1 Therefore, FLC orthologs regulate a set of conserved target genes mainly involved in reproductive development and were later independently recruited to modulate stress responses in different Brassicaceae lineages. Analysis of TF BSs in these lineages thus distinguishes widely conserved targets representing the core function of the TF from those that were recruited later in evolution. Copyright © 2017 the Author(s). Published by PNAS.

  4. Regulatory and Functional Connection of Microphthalmia-Associated Transcription Factor and Anti-Metastatic Pigment Epithelium Derived Factor in Melanoma

    Directory of Open Access Journals (Sweden)

    Asunción Fernández-Barral

    2014-06-01

    Full Text Available Pigment epithelium-derived factor (PEDF, a member of the serine protease inhibitor superfamily, has potent anti-metastatic effects in cutaneous melanoma through its direct actions on endothelial and melanoma cells. Here we show that PEDF expression positively correlates with microphthalmia-associated transcription factor (MITF in melanoma cell lines and human samples. High PEDF and MITF expression is characteristic of low aggressive melanomas classified according to molecular and pathological criteria, whereas both factors are decreased in senescent melanocytes and naevi. Importantly, MITF silencing down-regulates PEDF expression in melanoma cell lines and primary melanocytes, suggesting that the correlation in the expression reflects a causal relationship. In agreement, analysis of Chromatin immunoprecipitation coupled to high throughput sequencing (ChIP-seq data sets revealed three MITF binding regions within the first intron of SERPINF1, and reporter assays demonstrated that the binding of MITF to these regions is sufficient to drive transcription. Finally, we demonstrate that exogenous PEDF expression efficiently halts in vitro migration and invasion, as well as in vivo dissemination of melanoma cells induced by MITF silencing. In summary, these results identify PEDF as a novel transcriptional target of MITF and support a relevant functional role for the MITF-PEDF axis in the biology of melanoma.

  5. The Bacterial Effector HopX1 Targets JAZ Transcriptional Repressors to Activate Jasmonate Signaling and Promote Infection in Arabidopsis

    Science.gov (United States)

    Gimenez-Ibanez, Selena; Boter, Marta; Fernández-Barbero, Gemma; Chini, Andrea; Rathjen, John P.; Solano, Roberto

    2014-01-01

    Pathogenicity of Pseudomonas syringae is dependent on a type III secretion system, which secretes a suite of virulence effector proteins into the host cytoplasm, and the production of a number of toxins such as coronatine (COR), which is a mimic of the plant hormone jasmonate-isoleuce (JA-Ile). Inside the plant cell, effectors target host molecules to subvert the host cell physiology and disrupt defenses. However, despite the fact that elucidating effector action is essential to understanding bacterial pathogenesis, the molecular function and host targets of the vast majority of effectors remain largely unknown. Here, we found that effector HopX1 from Pseudomonas syringae pv. tabaci (Pta) 11528, a strain that does not produce COR, interacts with and promotes the degradation of JAZ proteins, a key family of JA-repressors. We show that hopX1 encodes a cysteine protease, activity that is required for degradation of JAZs by HopX1. HopX1 associates with JAZ proteins through its central ZIM domain and degradation occurs in a COI1-independent manner. Moreover, ectopic expression of HopX1 in Arabidopsis induces the expression of JA-dependent genes, represses salicylic acid (SA)-induced markers, and complements the growth of a COR-deficient P. syringae pv. tomato (Pto) DC3000 strain during natural bacterial infections. Furthermore, HopX1 promoted susceptibility when delivered by the natural type III secretion system, to a similar extent as the addition of COR, and this effect was dependent on its catalytic activity. Altogether, our results indicate that JAZ proteins are direct targets of bacterial effectors to promote activation of JA-induced defenses and susceptibility in Arabidopsis. HopX1 illustrates a paradigm of an alternative evolutionary solution to COR with similar physiological outcome. PMID:24558350

  6. Modification of the FoxP3 transcription factor principally affects inducible T regulatory cells in a model of experimental autoimmune encephalomyelitis.

    Directory of Open Access Journals (Sweden)

    Johan Verhagen

    Full Text Available T regulatory (Treg cells expressing the transcription factor FoxP3 play a key role in protection against autoimmune disease. GFP-FoxP3 reporter mice have been used widely to study the induction, function and stability of both thymically- and peripherally-induced Treg cells. The N-terminal modification of FoxP3, however, affects its interaction with transcriptional co-factors; this can alter Treg cell development and function in certain self-antigen specific animal models. Interestingly, Treg cell function can be negatively or positively affected, depending on the nature of the model. In this study, we focused on the effect of the GFP-FoxP3 reporter on Treg cell development and function in the Tg4 mouse model. In this model, T cells express a transgenic T cell receptor (TCR specific for the Myelin Basic Protein (MBP peptide Ac1-9, making the animals susceptible to experimental autoimmune encephalomyelitis (EAE, a disease akin to multiple sclerosis in humans. Unlike diabetes-susceptible mice, Tg4 FoxP3(gfp mice did not develop spontaneous autoimmune disease and did not demonstrate augmented susceptibility to induced disease. Concurrently, thymic generation of natural Treg cells was not negatively affected. The induction of FoxP3 expression in naive peripheral T cells was, however, significantly impaired as a result of the transgene. This study shows that the requirements for the interaction of FoxP3 with co-factors, which governs its regulatory ability, differ not only between natural and inducible Treg cells but also between animal models of diseases such as diabetes and EAE.

  7. Reference genes for quantitative, reverse-transcription PCR in Bacillus cereus group strains throughout the bacterial life cycle.

    Science.gov (United States)

    Reiter, Lillian; Kolstø, Anne-Brit; Piehler, Armin P

    2011-08-01

    Quantitative reverse-transcription PCR (RT-qPCR) has become a major tool to better understand the biology and pathogenesis of bacteria. One prerequisite of valid RT-qPCR data is their proper normalization to stably expressed reference genes. To identify and evaluate reference genes suitable for normalization of gene expression data in Bacillus cereus group strains, mRNA levels of eleven candidate reference genes (rpsU, nifU, udp (UDP-N-acetylglucosamine 2-epimerase), BT9727_5154/BC_5475, BT9727_4034/BC_4293, BT9727_4549/BC_4813, pspA, gatB_Yqey (gatB_Yqey domain containing protein), helicase (SWF/SNF family protein), adk and pta) and a target gene (BT9727_3305/BC3547+BC3546) were quantified by RT-qPCR at different time points throughout the entire life cycle of the wild-type B. cereus ATCC 14579 and Bacillus thuringiensis subsp. konkukian 97-27, a phylogenetically closely related strain to Bacillus anthracis. The programs geNorm and Normfinder were used to calculate expression stabilities and identified the genes gatB_Yqey, rpsU and udp as the most stably expressed reference genes. Compared to this combination or the sets of reference genes as recommended by geNorm or Normfinder, normalization using a traditional housekeeping gene (adk) alone resulted in significantly different gene expression results and in a significant overestimation of the target gene transcription. Normalization of the data to the reference gene gatB_Yqey alone showed no or only small differences to the reference gene combinations indicating that gatB_Yqey may be used as a single reference gene when investigating rather large changes in mRNA transcription. Otherwise, a combination of the stably expressed reference genes is recommended. In conclusion, the present study underlines the importance of normalization to stably expressed reference genes and presents valid endogenous controls suitable for normalization of transcriptional data throughout the life cycle of B. cereus group strains

  8. A Two-Tube Multiplex Reverse Transcription PCR Assay for Simultaneous Detection of Viral and Bacterial Pathogens of Infectious Diarrhea

    Directory of Open Access Journals (Sweden)

    Ji Wang

    2014-01-01

    Full Text Available Diarrhea caused by viral and bacterial infections is a major health problem in developing countries. The purpose of this study is to develop a two-tube multiplex PCR assay using automatic electrophoresis for simultaneous detection of 13 diarrhea-causative viruses or bacteria, with an intended application in provincial Centers for Diseases Control and Prevention, China. The assay was designed to detect rotavirus A, norovirus genogroups GI and GII, human astrovirus, enteric adenoviruses, and human bocavirus (tube 1, and Salmonella, Vibrio parahaemolyticus, diarrheagenic Escherichia coli, Campylobacter jejuni, Shigella, Yersinia, and Vibrio cholera (tube 2. The analytical specificity was examined with positive controls for each pathogen. The analytical sensitivity was evaluated by performing the assay on serial tenfold dilutions of in vitro transcribed RNA, recombinant plasmids, or bacterial culture. A total of 122 stool samples were tested by this two-tube assay and the results were compared with those obtained from reference methods. The two-tube assay achieved a sensitivity of 20–200 copies for a single virus and 102-103 CFU/mL for bacteria. The clinical performance demonstrated that the two-tube assay had comparable sensitivity and specificity to those of reference methods. In conclusion, the two-tube assay is a rapid, cost-effective, sensitive, specific, and high throughput method for the simultaneous detection of enteric bacteria and virus.

  9. Positive- and negative-acting regulatory elements contribute to the tissue-specific expression of INNER NO OUTER, a YABBY-type transcription factor gene in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Simon Marissa K

    2012-11-01

    Full Text Available Abstract Background The INNER NO OUTER (INO gene, which encodes a YABBY-type transcription factor, specifies and promotes the growth of the outer integument of the ovule in Arabidopsis. INO expression is limited to the abaxial cell layer of the developing outer integument of the ovule and is regulated by multiple regions of the INO promoter, including POS9, a positive element that when present in quadruplicate can produce low-level expression in the normal INO pattern. Results Significant redundancy in activity between different regions of the INO promoter is demonstrated. For specific regulatory elements, multimerization or the addition of the cauliflower mosaic virus 35S general enhancer was able to activate expression of reporter gene constructs that were otherwise incapable of expression on their own. A new promoter element, POS6, is defined and is shown to include sufficient positive regulatory information to reproduce the endogenous pattern of expression in ovules, but other promoter regions are necessary to fully suppress expression outside of ovules. The full-length INO promoter, but not any of the INO promoter deletions tested, is able to act as an enhancer-blocking insulator to prevent the ectopic activation of expression by the 35S enhancer. Sequence conservation between the promoter regions of Arabidopsis thaliana, Brassica oleracea and Brassica rapa aligns closely with the functional definition of the POS6 and POS9 regions, and with a defined INO minimal promoter. The B. oleracea INO promoter is sufficient to promote a similar pattern and level of reporter gene expression in Arabidopsis to that observed for the Arabidopsis promoter. Conclusions At least two independent regions of the INO promoter contain sufficient regulatory information to direct the specific pattern but not the level of INO gene expression. These regulatory regions act in a partially redundant manner to promote the expression in a specific pattern in the ovule and

  10. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold and heat

    Directory of Open Access Journals (Sweden)

    Kazuo eNakashima

    2014-05-01

    Full Text Available Drought negatively impacts plant growth and the productivity of crops around the world. Understanding the molecular mechanisms in the drought response is important for improvement of drought tolerance using molecular techniques. In plants, abscisic acid (ABA is accumulated under osmotic stress conditions caused by drought, and has a key role in stress responses and tolerance. Comprehensive molecular analyses have shown that ABA regulates the expression of many genes under osmotic stress conditions, and the ABA-responsive element (ABRE is the major cis-element for ABA-responsive gene expression. Transcription factors (TFs are master regulators of gene expression. ABRE-binding protein (AREB and ABRE-binding factor (ABF TFs control gene expression in an ABA-dependent manner. SNF1-related protein kinases 2, group A 2C-type protein phosphatases, and ABA receptors were shown to control the ABA signaling pathway. ABA-independent signaling pathways such as dehydration-responsive element-binding protein (DREB TFs and NAC TFs are also involved in stress responses including drought, heat and cold. Recent studies have suggested that there are interactions between the major ABA signaling pathway and other signaling factors in stress responses. The important roles of these transcription factors in crosstalk among abiotic stress responses will be discussed. Control of ABA or stress signaling factor expression can improve tolerance to environmental stresses. Recent studies using crops have shown that stress-specific overexpression of TFs improves drought tolerance and grain yield compared with controls in the field.

  11. Latency of transcription factor Stp1 depends on a modular regulatory motif that functions as cytoplasmic retention determinant and nuclear degron

    Science.gov (United States)

    Omnus, Deike J.; Ljungdahl, Per O.

    2014-01-01

    The Ssy1-Ptr3-Ssy5 (SPS)–sensing pathway enables yeast to respond to extracellular amino acids. Stp1, the effector transcription factor, is synthesized as a latent cytoplasmic precursor with an N-terminal regulatory domain that restricts its nuclear accumulation. The negative regulatory mechanisms impinging on the N-terminal domain are poorly understood. However, Stp1 latency depends on three inner nuclear membrane proteins, Asi1, Asi2, and Asi3. We report that the N-terminal domain of Stp1 contains a small motif, designated RI, that fully accounts for latency. RI is modular, mediates interactions with the plasma membrane, and can retain histone Htb2 in the cytoplasm. A novel class of STP1 mutations affecting RI were isolated that are less efficiently retained in the cytoplasm but remain under tight negative control by the Asi proteins. Intriguingly, these mutant proteins exhibit enhanced stability in strains lacking ASI1. Our results indicate that RI mediates latency by two distinct activities: it functions as a cytoplasmic retention determinant and an Asi-dependent degron. These findings provide novel insights into the SPS-sensing pathway and demonstrate for the first time that the inner nuclear membrane Asi proteins function in a degradation pathway in the nucleus. PMID:25253722

  12. A Bioinformatics Analysis Reveals a Group of MocR Bacterial Transcriptional Regulators Linked to a Family of Genes Coding for Membrane Proteins

    Directory of Open Access Journals (Sweden)

    Teresa Milano

    2016-01-01

    Full Text Available The MocR bacterial transcriptional regulators are characterized by an N-terminal domain, 60 residues long on average, possessing the winged-helix-turn-helix (wHTH architecture responsible for DNA recognition and binding, linked to a large C-terminal domain (350 residues on average that is homologous to fold type-I pyridoxal 5′-phosphate (PLP dependent enzymes like aspartate aminotransferase (AAT. These regulators are involved in the expression of genes taking part in several metabolic pathways directly or indirectly connected to PLP chemistry, many of which are still uncharacterized. A bioinformatics analysis is here reported that studied the features of a distinct group of MocR regulators predicted to be functionally linked to a family of homologous genes coding for integral membrane proteins of unknown function. This group occurs mainly in the Actinobacteria and Gammaproteobacteria phyla. An analysis of the multiple sequence alignments of their wHTH and AAT domains suggested the presence of specificity-determining positions (SDPs. Mapping of SDPs onto a homology model of the AAT domain hinted at possible structural/functional roles in effector recognition. Likewise, SDPs in wHTH domain suggested the basis of specificity of Transcription Factor Binding Site recognition. The results reported represent a framework for rational design of experiments and for bioinformatics analysis of other MocR subgroups.

  13. Expanded roles of leucine-responsive regulatory protein in transcription regulation of the Escherichia coli genome: Genomic SELEX screening of the regulation targets.

    Science.gov (United States)

    Shimada, Tomohiro; Saito, Natsumi; Maeda, Michihisa; Tanaka, Kan; Ishihama, Akira

    2015-07-01

    Leucine-responsive regulatory protein (Lrp) is a transcriptional regulator for the genes involved in transport, biosynthesis and catabolism of amino acids in Escherichia coli . In order to identify the whole set of genes under the direct control of Lrp, we performed Genomic SELEX screening and identified a total of 314 Lrp-binding sites on the E. coli genome. As a result, the regulation target of Lrp was predicted to expand from the hitherto identified genes for amino acid metabolism to a set of novel target genes for utilization of amino acids for protein synthesis, including tRNAs, aminoacyl-tRNA synthases and rRNAs. Northern blot analysis indicated alteration of mRNA levels for at least some novel targets, including the aminoacyl-tRNA synthetase genes. Phenotype MicroArray of the lrp mutant indicated significant alteration in utilization of amino acids and peptides, whilst metabolome analysis showed variations in the concentration of amino acids in the lrp mutant. From these two datasets we realized a reverse correlation between amino acid levels and cell growth rate: fast-growing cells contain low-level amino acids, whilst a high level of amino acids exists in slow-growing cells. Taken together, we propose that Lrp is a global regulator of transcription of a large number of the genes involved in not only amino acid transport and metabolism, but also amino acid utilization.

  14. Screening of the transcriptional regulatory regions of vascular endothelial growth factor receptor 2 (VEGFR2 in amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    Hartley Judith

    2007-04-01

    Full Text Available Abstract Background Vascular endothelial growth factor (VEGF has neurotrophic activity which is mediated by its main agonist receptor, VEGFR2. Dysregulation of VEGF causes motor neurone degeneration in a mouse model of amyotrophic lateral sclerosis (ALS, and expression of VEGFR2 is reduced in motor neurones and spinal cord of patients with ALS. Methods We have screened the promoter region and 4 exonic regions of functional significance of the VEGFR2 gene in a UK population of patients with ALS, for mutations and polymorphisms that may affect expression or function of this VEGF receptor. Results No mutations were identified in the VEGFR2 gene. We found no association between polymorphisms in the regulatory regions of the VEGFR2 gene and ALS. Conclusion Mechanisms other than genetic variation may downregulate expression or function of the VEGFR2 receptor in patients with ALS.

  15. Multiple regulatory roles of the mouse transmembrane adaptor protein NTAL in gene transcription and mast cell physiology.

    Directory of Open Access Journals (Sweden)

    Iva Polakovicova

    Full Text Available Non-T cell activation linker (NTAL; also called LAB or LAT2 is a transmembrane adaptor protein that is expressed in a subset of hematopoietic cells, including mast cells. There are conflicting reports on the role of NTAL in the high affinity immunoglobulin E receptor (FcεRI signaling. Studies carried out on mast cells derived from mice with NTAL knock out (KO and wild type mice suggested that NTAL is a negative regulator of FcεRI signaling, while experiments with RNAi-mediated NTAL knockdown (KD in human mast cells and rat basophilic leukemia cells suggested its positive regulatory role. To determine whether different methodologies of NTAL ablation (KO vs KD have different physiological consequences, we compared under well defined conditions FcεRI-mediated signaling events in mouse bone marrow-derived mast cells (BMMCs with NTAL KO or KD. BMMCs with both NTAL KO and KD exhibited enhanced degranulation, calcium mobilization, chemotaxis, tyrosine phosphorylation of LAT and ERK, and depolymerization of filamentous actin. These data provide clear evidence that NTAL is a negative regulator of FcεRI activation events in murine BMMCs, independently of possible compensatory developmental alterations. To gain further insight into the role of NTAL in mast cells, we examined the transcriptome profiles of resting and antigen-activated NTAL KO, NTAL KD, and corresponding control BMMCs. Through this analysis we identified several genes that were differentially regulated in nonactivated and antigen-activated NTAL-deficient cells, when compared to the corresponding control cells. Some of the genes seem to be involved in regulation of cholesterol-dependent events in antigen-mediated chemotaxis. The combined data indicate multiple regulatory roles of NTAL in gene expression and mast cell physiology.

  16. Characterization of the regulatory domains of the human skn-1a/Epoc-1/Oct-11 POU transcription factor.

    Science.gov (United States)

    Hildesheim, J; Foster, R A; Chamberlin, M E; Vogel, J C

    1999-09-10

    The Skn-1a POU transcription factor is primarily expressed in keratinocytes of murine embryonic and adult epidermis. Although some POU factors expressed in a tissue-specific manner are important for normal differentiation, the biological function of Skn-1a remains unknown. Previous in vitro studies indicate that Skn-1a has the ability to transactivate markers of keratinocyte differentiation. In this study, we have characterized Skn-1a's transactivation domain(s) and engineered a dominant negative protein that lacked this transactivation domain. Deletional analysis of the human homologue of Skn-1a with three target promoters revealed the presence of two functional domains: a primary C-terminal transactivation domain and a combined N-terminal inhibitory domain and transactivation domain. Skn-1a lacking the C-terminal region completely lost transactivation ability, irrespective of the promoter tested, and was able to block transactivation by normal Skn-1a in competition assays. Compared with full-length, Skn-1a lacking the N-terminal region demonstrated either increased transactivation (bovine cytokeratin 6 promoter), comparable transactivation (human papillomavirus type 1a long control region), or loss of transactivation (human papillomavirus type 18 long control region). The identification of a primary C-terminal transactivation domain enabled us to generate a dominant negative Skn-1a factor, which will be useful in the quest for a better understanding of this keratinocyte-specific gene regulator.

  17. Synthesis and biological activity of novel mono-indole and mono-benzofuran inhibitors of bacterial transcription initiation complex formation.

    Science.gov (United States)

    Mielczarek, Marcin; Thomas, Ruth V; Ma, Cong; Kandemir, Hakan; Yang, Xiao; Bhadbhade, Mohan; Black, David StC; Griffith, Renate; Lewis, Peter J; Kumar, Naresh

    2015-04-15

    Our ongoing research focused on targeting transcription initiation in bacteria has resulted in synthesis of several classes of mono-indole and mono-benzofuran inhibitors that targeted the essential protein-protein interaction between RNA polymerase core and σ(70)/σ(A) factors in bacteria. In this study, the reaction of indole-2-, indole-3-, indole-7- and benzofuran-2-glyoxyloyl chlorides with amines and hydrazines afforded a variety of glyoxyloylamides and glyoxyloylhydrazides. Similarly, condensation of 2- and 7-trichloroacetylindoles with amines and hydrazines delivered amides and hydrazides. The novel molecules were found to inhibit the RNA polymerase-σ(70)/σ(A) interaction as measured by ELISA, and also inhibited the growth of both Gram-positive and Gram-negative bacteria in culture. Structure-activity relationship (SAR) studies of the mono-indole and mono-benzofuran inhibitors suggested that the hydrophilic-hydrophobic balance is an important determinant of biological activity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Crystallization and preliminary X-ray analysis of Psu, an inhibitor of the bacterial transcription terminator Rho

    International Nuclear Information System (INIS)

    Khamrui, Susmita; Ranjan, Amitabh; Pani, Bibhusita; Sen, Ranjan; Sen, Udayaditya

    2010-01-01

    Psu, a unique 21 kDa protein from bacteriophage P4, is a non-essential capsid-decoration protein that inhibits Rho-dependent termination specifically and efficiently both in vivo and in vitro. Psu has been crystallized using PEG as precipitant and the crystals diffracted to 2.3 Å resolution. Psu, a coat protein from bacteriophage P4, inhibits Rho-dependent transcription termination both in vivo and in vitro. The Psu protein is α-helical in nature and appeared to be a dimer in solution. It interacts with Rho and affects the ATP binding and RNA-dependent ATPase activity of Rho, which in turn reduces the rate of RNA release from the elongation complex. Crystals of Psu were grown in space group I422 in the presence of PEG, with unit-cell parameters a = b = 148.76, c = 63.38 Å and a calculated Matthews coefficient of 2.1 Å 3 Da −1 (41.5% solvent content), assuming the presence of two molecules in the asymmetric unit. A native data set was collected to 2.3 Å resolution

  19. Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency.

    Science.gov (United States)

    Zhou, Wenli; Sadeghieh, Sanaz; Abruzzese, Ronald; Uppada, Subhadra; Meredith, Justin; Ohlrichs, Charletta; Broek, Diane; Polejaeva, Irina

    2009-09-01

    Among many factors that potentially affect somatic cell nuclear transfer (SCNT) embryo development is the donor cell itself. Cloning potentials of somatic donor cells vary greatly, possibly because the cells have different capacities to be reprogrammed by ooplasma. It is therefore intriguing to identify factors that regulate the reprogrammability of somatic donor cells. Gene expression analysis is a widely used tool to investigate underlying mechanisms of various phenotypes. In this study, we conducted a retrospective analysis investigating whether donor cell lines with distinct cloning efficiencies express different levels of genes involved in epigenetic reprogramming including histone deacetylase-1 (HDAC1), -2 (HDAC2); DNA methyltransferase-1 (DNMT1), -3a (DNMT3a),-3b (DNMT3b), and the bovine homolog of yeast sucrose nonfermenting-2 (SNF2L), a SWI/SNF family of ATPases. Cell samples from 12 bovine donor cell lines were collected at the time of nuclear transfer experiments and expression levels of the genes were measured using quantitative polymerase chain reaction (PCR). Our results show that there are no significant differences in expression levels of these genes between donor cell lines of high and low cloning efficiency defined as live calving rates, although inverse correlations are observed between in vitro embryo developmental rates and expression levels of HDAC2 and SNF2L. We also show that selection of stable reference genes is important for relative quantification, and different batches of cells can have different gene expression patterns. In summary, we demonstrate that expression levels of these epigenome regulatory genes in bovine donor cells are not correlated with cloning potential. The experimental design and data analysis method reported here can be applied to study any genes expressed in donor cells.

  20. Three novel C1q domain containing proteins from the disk abalone Haliotis discus discus: Genomic organization and analysis of the transcriptional changes in response to bacterial pathogens.

    Science.gov (United States)

    Bathige, S D N K; Umasuthan, Navaneethaiyer; Jayasinghe, J D H E; Godahewa, G I; Park, Hae-Chul; Lee, Jehee

    2016-09-01

    The globular C1q (gC1q) domain containing proteins, commonly referred as C1q domain containing (C1qDC) proteins, are an essential family of proteins involved in various innate immune responses. In this study, three novel C1qDC proteins were identified from the disk abalone (Haliotis discus discus) transcriptome database and designated as AbC1qDC1, AbC1qDC2, and AbC1qDC3. The cDNA sequences of AbC1qDC1, AbC1qDC2, and AbC1qDC3 consisted of 807, 1305, and 660 bp open reading frames (ORFs) encoding 269, 435, and 220 amino acids (aa), respectively. Putative signal peptides and the N-terminal gC1q domain were identified in all three AbC1qDC proteins. An additional predicted motif region, known as the coiled coil region (CCR), was identified next to the signal sequence of AbC1qDC2. The genomic organization of the AbC1qDCs was determined using a bacterial artificial chromosome (BAC) library. It was found that the CDS of AbC1qDC1 was distributed among three exons, while the CDSs of AbC1qDC2 and AbC1qDC3 were distributed between two exons. Sequence analysis indicated that the AbC1qDC proteins shared <40% identity with other counterparts from different species. According to the neighbor-joining phylogenetic tree, the proteins were grouped within an invertebrate group with high evolutionary distances, which suggests that they are new members of the C1qDC family. Higher expression of AbC1qDC1 and AbC1qDC2 was detected in hepatopancreas, muscle, and mantle tissues compare to the other tissues analyzed, using reverse transcription, followed by quantitative real-time PCR (qPCR) using SYBR Green, whereas AbC1qDC3 was predominantly expressed in gill tissues, followed by muscles and the hepatopancreas. The temporal expression of AbC1qDC transcripts in gills after bacterial (Vibrio parahaemolyticus and Listeria monocytogenes) and lipopolysaccharide stimulation indicated that AbC1qDCs can be strongly induced by both Gram-negative and Gram-positive bacterial species with different

  1. Chronic exposure of HIT cells to high glucose concentrations paradoxically decreases insulin gene transcription and alters binding of insulin gene regulatory protein.

    Science.gov (United States)

    Olson, L K; Redmon, J B; Towle, H C; Robertson, R P

    1993-07-01

    Chronically culturing HIT-T15 cells in media containing high glucose concentrations leads to decreased insulin mRNA levels, insulin content, and insulin secretion. These changes can be prevented by culturing the cells in media containing lower glucose levels (Robertson, R. P., H.-J. Zhang, K. L. Pyzdrowski, and T. F. Walseth. 1992. J. Clin. Invest. 90:320-325). The mechanism of this seemingly paradoxical phenomenon was examined by transiently transfecting HIT cells with a chloramphenicol acetyl transferase (CAT) reporter gene controlled by the 5'-regulatory domain of the human insulin gene (INSCAT). Early passages of HIT cells readily expressed INSCAT, whereas late passages of cells chronically cultured in 11.1 mM glucose expressed only 28.7 +/- 2.3% (mean +/- SEM) of the CAT activity expressed in early passages. In contrast, late passages of HIT cells chronically cultured in 0.8 mM glucose retained the ability to express the INSCAT reporter gene to 69.6 +/- 10.0% of the CAT activity observed in early passages. The decrease in INSCAT expression in late passages of cells serially cultured in 11.1 mM glucose was associated with the inability to form a specific nuclear protein-DNA complex with the CT motifs of the human insulin promoter. Formation of this specific protein-DNA complex was preserved in late passages of HIT cells when serially cultured in 0.8 mM glucose. Mutations of the CT motifs caused markedly diminished CAT activity in all passages examined. These data indicate that chronic exposure of the beta cell to high glucose concentrations can paradoxically decrease insulin gene transcription, in part, by altering the ability of a regulatory protein (GSTF) to interact with the insulin gene promoter. This provides a potential mechanism for glucotoxic effects on the beta cell at the level of the insulin gene.

  2. A Novel Sucrose-Regulatory MADS-Box Transcription Factor GmNMHC5 Promotes Root Development and Nodulation in Soybean (Glycine max [L.] Merr.).

    Science.gov (United States)

    Liu, Wei; Han, Xiangdong; Zhan, Ge; Zhao, Zhenfang; Feng, Yongjun; Wu, Cunxiang

    2015-08-31

    The MADS-box protein family includes many transcription factors that have a conserved DNA-binding MADS-box domain. The proteins in this family were originally recognized to play prominent roles in floral development. Recent findings, especially with regard to the regulatory roles of the AGL17 subfamily in root development, have greatly broadened their known functions. In this study, a gene from soybean (Glycine max [L.] Merr.), GmNMHC5, was cloned from the Zigongdongdou cultivar and identified as a member of the AGL17 subfamily. Real-time fluorescence quantitative PCR analysis showed that GmNMHC5 was expressed at much higher levels in roots and nodules than in other organs. The activation of expression was first examined in leaves and roots, followed by shoot apexes. GmNMHC5 expression levels rose sharply when the plants were treated under short-day conditions (SD) and started to pod, whereas low levels were maintained in non-podding plants under long-day conditions (LD). Furthermore, overexpression of GmNMHC5 in transgenic soybean significantly promoted lateral root development and nodule building. Moreover, GmNMHC5 is upregulated by exogenous sucrose. These results indicate that GmNMHC5 can sense the sucrose signal and plays significant roles in lateral root development and nodule building.

  3. A Novel Sucrose-Regulatory MADS-Box Transcription Factor GmNMHC5 Promotes Root Development and Nodulation in Soybean (Glycine max [L.] Merr.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    2015-08-01

    Full Text Available The MADS-box protein family includes many transcription factors that have a conserved DNA-binding MADS-box domain. The proteins in this family were originally recognized to play prominent roles in floral development. Recent findings, especially with regard to the regulatory roles of the AGL17 subfamily in root development, have greatly broadened their known functions. In this study, a gene from soybean (Glycine max [L.] Merr., GmNMHC5, was cloned from the Zigongdongdou cultivar and identified as a member of the AGL17 subfamily. Real-time fluorescence quantitative PCR analysis showed that GmNMHC5 was expressed at much higher levels in roots and nodules than in other organs. The activation of expression was first examined in leaves and roots, followed by shoot apexes. GmNMHC5 expression levels rose sharply when the plants were treated under short-day conditions (SD and started to pod, whereas low levels were maintained in non-podding plants under long-day conditions (LD. Furthermore, overexpression of GmNMHC5 in transgenic soybean significantly promoted lateral root development and nodule building. Moreover, GmNMHC5 is upregulated by exogenous sucrose. These results indicate that GmNMHC5 can sense the sucrose signal and plays significant roles in lateral root development and nodule building.

  4. Transcription control engineering and applications in synthetic biology

    Directory of Open Access Journals (Sweden)

    Michael D. Engstrom

    2017-09-01

    Full Text Available In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein, a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators (cis-factors were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators (trans-factors, giving examples of how cis- and trans-acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli, we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  5. Transcription control engineering and applications in synthetic biology.

    Science.gov (United States)

    Engstrom, Michael D; Pfleger, Brian F

    2017-09-01

    In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein), a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity) levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators ( cis -factors) were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators ( trans- factors), giving examples of how cis- and trans -acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli , we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  6. Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS

    DEFF Research Database (Denmark)

    Farooq, Muhammad; Troelsen, Jesper T; Boyd, Mette

    2010-01-01

    A cis-regulatory sequence also known as zone of polarizing activity (ZPA) regulatory sequence (ZRS) located in intron 5 of LMBR1 is essential for expression of sonic hedgehog (SHH) in the developing posterior limb bud mesenchyme. Even though many point mutations causing preaxial duplication defects...... demonstrated a marked difference between wild-type and the mutant probe, which uniquely bound one or several transcription factors extracted from Caco-2 cells. This finding supports a model in which ectopic anterior SHH expression in the developing limb results from abnormal binding of one or more...

  7. The Arabidopsis ATAF1, a NAC transcription factor, is a negative regulator of defense responses against necrotrophic fungal and bacterial pathogens.

    Science.gov (United States)

    Wang, Xiao'e; Basnayake, B M Vindhya S; Zhang, Huijuan; Li, Guojun; Li, Wei; Virk, Nasar; Mengiste, Tesfaye; Song, Fengming

    2009-10-01

    Transcription factors of the NAC family are known to be involved in various growth or developmental processes and in regulation of response to environmental stresses. In the present study, we report that Arabidopsis ATAF1 is a negative regulator of defense responses against both necrotrophic fungal and bacterial pathogens. Expression of ATAF1 was downregulated after infection with Botrytis cinerea or Pseudomonas syringae pv. tomato or after treatment with salicylic acid (SA), jasmonic acid, and 1-amino cyclopropane-1-carboxylic acid (the precursor of ethylene biosynthesis). Transgenic plants that overexpress the ATAF1 gene (ATAF1-OE) showed increased susceptibility while expression of an ATAF1 chimeric repressor construct (ATAF1-SRDX) exhibited enhanced resistance to P. syringae pv. tomato DC3000, B. cinerea, and Alternaria brassicicola. The ataf1 mutant plants showed no significant resistance against the pathogens tested. After inoculation with B. cinerea or P. syringae pv. tomato DC3000, expressions of defense-related genes PR-1, PR-5. and PDF1.2 were upregulated in the ATAF1-SRDX plants but attenuated or unchanged in the ATAF1-OE plants. In ATAF1-OE plants, SA-induced expression of pathogenesis-related genes and disease resistance against P. syringae pv. tomato DC3000 was partially suppressed. Increased levels of reactive oxygen species (i.e., H(2)O(2) and superoxide anion) accumulated only in the ATAF1-OE but not in the ATAF1-SRDX plants after Botrytis spp. infection. Our studies provide direct genetic evidence for the role of ATAF1 as a negative regulator of defense response against different type of pathogens.

  8. Transcriptional and metabolic signatures of Arabidopsis responses to chewing damage by an insect herbivore and bacterial infection and the consequences of their interaction

    Science.gov (United States)

    Appel, Heidi M.; Maqbool, Shahina B.; Raina, Surabhi; Jagadeeswaran, Guru; Acharya, Biswa R.; Hanley, John C.; Miller, Kathryn P.; Hearnes, Leonard; Jones, A. Daniel; Raina, Ramesh; Schultz, Jack C.

    2014-01-01

    Plants use multiple interacting signaling systems to identify and respond to biotic stresses. Although it is often assumed that there is specificity in signaling responses to specific pests, this is rarely examined outside of the gene-for-gene relationships of plant-pathogen interactions. In this study, we first compared early events in gene expression and later events in metabolite profiles of Arabidopsis thaliana following attack by either the caterpillar Spodoptera exigua or avirulent (DC3000 avrRpm1) Pseudomonas syringae pv. tomato at three time points. Transcriptional responses of the plant to caterpillar feeding were rapid, occurring within 1 h of feeding, and then decreased at 6 and 24 h. In contrast, plant response to the pathogen was undetectable at 1 h but grew larger and more significant at 6 and 24 h. There was a surprisingly large amount of overlap in jasmonate and salicylate signaling in responses to the insect and pathogen, including levels of gene expression and individual hormones. The caterpillar and pathogen treatments induced different patterns of expression of glucosinolate biosynthesis genes and levels of glucosinolates. This suggests that when specific responses develop, their regulation is complex and best understood by characterizing expression of many genes and metabolites. We then examined the effect of feeding by the caterpillar Spodoptera exigua on Arabidopsis susceptibility to virulent (DC3000) and avirulent (DC3000 avrRpm1) P. syringae pv. tomato, and found that caterpillar feeding enhanced Arabidopsis resistance to the avirulent pathogen and lowered resistance to the virulent strain. We conclude that efforts to improve plant resistance to bacterial pathogens are likely to influence resistance to insects and vice versa. Studies explicitly comparing plant responses to multiple stresses, including the role of elicitors at early time points, are critical to understanding how plants organize responses in natural settings. PMID:25278943

  9. Transcriptional and metabolic signatures of Arabidopsis responses to chewing damage by an insect herbivore and bacterial infection and the consequences of their interaction

    Directory of Open Access Journals (Sweden)

    Heidi M Appel

    2014-09-01

    Full Text Available Plants use multiple interacting signaling systems to identify and respond to biotic stresses. Although it is often assumed that there is specificity in signaling responses to specific pests, this is rarely examined outside of the gene-for-gene relationships of plant-pathogen interactions. In this study, we first compared early events in gene expression and later events in metabolite profiles of Arabidopsis thaliana following attack by either the caterpillar Spodoptera exigua or avirulent (DC3000 avrRpm1 Pseudomonas syringae pv. tomato at three time points. Transcriptional responses of the plant to caterpillar feeding were rapid, occurring within 1 h of feeding, and then decreased at 6 h and 24 h. In contrast, plant response to the pathogen was undetectable at 1 h but grew larger and more significant at 6 h and 24 h. There was a surprisingly large amount of overlap in jasmonate and salicylate signaling in responses to the insect and pathogen, including levels of gene expression and individual hormones. The caterpillar and pathogen treatments induced different patterns of expression of glucosinolate biosynthesis genes and levels of glucosinolates. This suggests that when specific responses develop, their regulation is complex and best understood by characterizing expression of many genes and metabolites. We then examined the effect of feeding by the caterpillar Spodoptera exigua on Arabidopsis susceptibility to virulent (DC3000 and avirulent (DC3000 avrRpm1 P. syringae pv. tomato, and found that caterpillar feeding enhanced Arabidopsis resistance to the avirulent pathogen and lowered resistance to the virulent strain. We conclude that efforts to improve plant resistance to bacterial pathogens are likely to influence resistance to insects and vice versa. Studies explicitly comparing plant responses to multiple stresses, including the role of elicitors at early time points, are critical to understanding how plants organize responses in natural

  10. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo

    2005-10-01

    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  11. Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus

    Directory of Open Access Journals (Sweden)

    Kovaleva Galina

    2011-06-01

    Full Text Available Abstract Background Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. Results To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. Multiple variations in regulatory strategies between the Shewanella spp. and E. coli include regulon contraction and expansion (as in the case of PdhR, HexR, FadR, numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. PsrA for fatty acid degradation and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp. Conclusions We tentatively defined the first reference collection of ~100 transcriptional regulons in 16 Shewanella genomes. The resulting regulatory network contains ~600 regulated genes per genome that are mostly involved in metabolism of carbohydrates, amino acids, fatty acids, vitamins, metals, and stress responses. Several reconstructed regulons including NagR for N-acetylglucosamine catabolism were experimentally validated in S

  12. Polymorphism in the regulatory region located more than 1.1 kilobases 5' to the start site of transcription, the promoter region, and exon 1 of the HLA-G gene

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Sørensen, Steen; Morling, Niels

    1999-01-01

    The non-classic Human Leucocyte Antigen class Ib molecule, HLA-G, is expressed on the invasive, extra-villous cytotrophoblast in human placenta. HLA-G protects against natural killer (NK)-cell-mediated lysis and may modulate the secretion of cytokines. Aberrant expression of HLA-G has been reported...... in certain disorders of pregnancy. We have studied the DNA sequences of the putative regulatory region located more than 1.1 kilobases 5' from the start site of transcription (a 244 bp HindIII/EcoRI fragment) of the HLA-G gene and of the promoter region to detect any possible polymorphism. We detected one...... into two groups based on the detected polymorphism. The nucleotide substitutions may have implications for the binding of nuclear factors to the regulatory regions. To our knowledge this is the first study of any polymorphism in the 5'-flanking sequences to the HLA-G gene. Further studies are needed...

  13. Method to determine transcriptional regulation pathways in organisms

    Science.gov (United States)

    Gardner, Timothy S.; Collins, James J.; Hayete, Boris; Faith, Jeremiah

    2012-11-06

    The invention relates to computer-implemented methods and systems for identifying regulatory relationships between expressed regulating polypeptides and targets of the regulatory activities of such regulating polypeptides. More specifically, the invention provides a new method for identifying regulatory dependencies between biochemical species in a cell. In particular embodiments, provided are computer-implemented methods for identifying a regulatory interaction between a transcription factor and a gene target of the transcription factor, or between a transcription factor and a set of gene targets of the transcription factor. Further provided are genome-scale methods for predicting regulatory interactions between a set of transcription factors and a corresponding set of transcriptional target substrates thereof.

  14. Mutant Forms of the Azotobacter vinelandii Transcriptional Activator NifA Resistant to Inhibition by the NifL Regulatory Protein

    OpenAIRE

    Reyes-Ramirez, Francisca; Little, Richard; Dixon, Ray

    2002-01-01

    The Azotobacter vinelandii σ54-dependent transcriptional activator protein NifA is regulated by the NifL protein in response to redox, carbon, and nitrogen status. Under conditions inappropriate for nitrogen fixation, NifL inhibits transcription activation by NifA through the formation of the NifL-NifA protein complex. NifL inhibits the ATPase activity of the central AAA+ domain of NifA required to drive open complex formation by σ54-RNA polymerase and may also inhibit the activator-polymeras...

  15. Senescence-associated barley NAC (NAM, ATAF1,2, CUC) transcription factor interacts with radical-induced cell death 1 through a disordered regulatory domain

    DEFF Research Database (Denmark)

    Kjaersgaard, Trine; Jensen, Michael K; Christiansen, Michael W

    2011-01-01

    Senescence in plants involves massive nutrient relocation and age-related cell death. Characterization of the molecular components, such as transcription factors (TFs), involved in these processes is required to understand senescence. We found that HvNAC005 and HvNAC013 of the plant-specific NAC...... as a transcriptional activator suggesting that an involvement of HvNAC013 and HvNAC005 in senescence will be different. HvNAC013 interacted with barley radical-induced cell death 1 (RCD1) via the very C-terminal part of its TRD, outside of the region containing the LP motif. No significant secondary structure...

  16. ChIP-seq analysis of genomic binding regions of five major transcription factors highlights a central role for ZIC2 in the mouse epiblast stem cell gene regulatory network

    Science.gov (United States)

    Matsuda, Kazunari; Oki, Shinya; Iida, Hideaki; Andrabi, Munazah; Yamaguchi, Katsushi

    2017-01-01

    To obtain insight into the transcription factor (TF)-dependent regulation of epiblast stem cells (EpiSCs), we performed ChIP-seq analysis of the genomic binding regions of five major TFs. Analysis of in vivo biotinylated ZIC2, OTX2, SOX2, POU5F1 and POU3F1 binding in EpiSCs identified several new features. (1) Megabase-scale genomic domains rich in ZIC2 peaks and genes alternate with those rich in POU3F1 but sparse in genes, reflecting the clustering of regulatory regions that act at short and long-range, which involve binding of ZIC2 and POU3F1, respectively. (2) The enhancers bound by ZIC2 and OTX2 prominently regulate TF genes in EpiSCs. (3) The binding sites for SOX2 and POU5F1 in mouse embryonic stem cells (ESCs) and EpiSCs are divergent, reflecting the shift in the major acting TFs from SOX2/POU5F1 in ESCs to OTX2/ZIC2 in EpiSCs. (4) This shift in the major acting TFs appears to be primed by binding of ZIC2 in ESCs at relevant genomic positions that later function as enhancers following the disengagement of SOX2/POU5F1 from major regulatory functions and subsequent binding by OTX2. These new insights into EpiSC gene regulatory networks gained from this study are highly relevant to early stage embryogenesis. PMID:28455373

  17. RNA-guided transcriptional regulation in planta via synthetic dCas9-based transcription factors

    KAUST Repository

    Piatek, Agnieszka Anna

    2014-11-14

    Targeted genomic regulation is a powerful approach to accelerate trait discovery and development in agricultural biotechnology. Bacteria and archaea use clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) regulatory systems for adaptive molecular immunity against foreign nucleic acids introduced by invading phages and conjugative plasmids. The type II CRISPR/Cas system has been adapted for genome editing in many cell types and organisms. A recent study used the catalytically inactive Cas9 (dCas9) protein combined with guide-RNAs (gRNAs) as a DNA-targeting platform to modulate gene expression in bacterial, yeast, and human cells. Here, we modified this DNA-targeting platform for targeted transcriptional regulation in planta by developing chimeric dCas9-based transcriptional activators and repressors. To generate transcriptional activators, we fused the dCas9 C-terminus with the activation domains of EDLL and TAL effectors. To generate a transcriptional repressor, we fused the dCas9 C-terminus with the SRDX repression domain. Our data demonstrate that dCas9 fusion with the EDLL activation domain (dCas9:EDLL) and the TAL activation domain (dCas9:TAD), guided by gRNAs complementary to selected promoter elements, induce strong transcriptional activation on Bs3

  18. Hippo, TGF-β, and Src-MAPK pathways regulate transcription of the upd3 cytokine in Drosophila enterocytes upon bacterial infection.

    Science.gov (United States)

    Houtz, Philip; Bonfini, Alessandro; Liu, Xi; Revah, Jonathan; Guillou, Aurélien; Poidevin, Mickael; Hens, Korneel; Huang, Hsin-Yi; Deplancke, Bart; Tsai, Yu-Chen; Buchon, Nicolas

    2017-11-01

    Cytokine signaling is responsible for coordinating conserved epithelial regeneration and immune responses in the digestive tract. In the Drosophila midgut, Upd3 is a major cytokine, which is induced in enterocytes (EC) and enteroblasts (EB) upon oral infection, and initiates intestinal stem cell (ISC) dependent tissue repair. To date, the genetic network directing upd3 transcription remains largely uncharacterized. Here, we have identified the key infection-responsive enhancers of the upd3 gene and show that distinct enhancers respond to various stresses. Furthermore, through functional genetic screening, bioinformatic analyses and yeast one-hybrid screening, we determined that the transcription factors Scalloped (Sd), Mothers against dpp (Mad), and D-Fos are principal regulators of upd3 expression. Our study demonstrates that upd3 transcription in the gut is regulated by the activation of multiple pathways, including the Hippo, TGF-β/Dpp, and Src, as well as p38-dependent MAPK pathways. Thus, these essential pathways, which are known to control ISC proliferation cell-autonomously, are also activated in ECs to promote tissue turnover the regulation of upd3 transcription.

  19. A Novel WRKY transcription factor is required for induction of PR-1a gene expression by salicylic acid and bacterial elicitors

    NARCIS (Netherlands)

    van Verk, Marcel C|info:eu-repo/dai/nl/327618671; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M

    PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of

  20. A bacterial community analysis using reverse transcription (RT) PCR which detects the bacteria with high activity in a wastewater treatment reactor

    Science.gov (United States)

    This research used reverse transcription polymerase chain reaction (RT-PCR) method to help detect active bacteria in a single-tank deammonification reactor combining partial nitritation and anammox. The single-tank aerobic deammonification reactor effectively removed the ammonia in anaerobically di...

  1. Transcriptional control of t lymphocyte differentiation

    NARCIS (Netherlands)

    F.J.T. Staal (Frank); F. Weerkamp (Floor); A.W. Langerak (Anton); R.W. Hendriks (Rudi); H.C. Clevers (Hans)

    2001-01-01

    textabstractInitiation of gene transcription by transcription factors (TFs) is an important regulatory step in many developmental processes. The differentiation of T cell progenitors in the thymus is tightly controlled by signaling molecules, ultimately activating

  2. Bacterial lipoprotein delays apoptosis in human neutrophils through inhibition of caspase-3 activity: regulatory roles for CD14 and TLR-2.

    LENUS (Irish Health Repository)

    Power, Colm P

    2012-02-03

    The human sepsis syndrome resulting from bacterial infection continues to account for a significant proportion of hospital mortality. Neutralizing strategies aimed at individual bacterial wall products (such as LPS) have enjoyed limited success in this arena. Bacterial lipoprotein (BLP) is a major constituent of the wall of diverse bacterial forms and profoundly influences cellular function in vivo and in vitro, and has been implicated in the etiology of human sepsis. Delayed polymorphonuclear cell (PMN) apoptosis is a characteristic feature of human sepsis arising from Gram-negative or Gram-positive bacterial infection. Bacterial wall product ligation and subsequent receptor-mediated events upstream of caspase inhibition in neutrophils remain incompletely understood. BLP has been shown to exert its cellular effects primarily through TLR-2, and it is now widely accepted that lateral associations with the TLRs represent the means by which CD14 communicates intracellular messages. In this study, we demonstrate that BLP inhibits neutrophil mitochondrial membrane depolarization with a subsequent reduction in caspase-3 processing, ultimately leading to a significant delay in PMN apoptosis. Pretreatment of PMNs with an anti-TLR-2 mAb or anti-CD14 mAb prevented BLP from delaying PMN apoptosis to such a marked degree. Combination blockade using both mAbs completely prevented the effects of BLP (in 1 and 10 ng\\/ml concentrations) on PMN apoptosis. At higher concentrations of BLP, the antiapoptotic effects were observed, but were not as pronounced. Our findings therefore provide the first evidence of a crucial role for both CD14 and TLR-2 in delayed PMN apoptosis arising from bacterial infection.

  3. [Effects of transcription factor T-bet, GATA-3, FoxP3 and CD4(+)CD25(+)regulatory T cells in pathogenesis of child Hench-Schonlein purpura].

    Science.gov (United States)

    Wang, Qiang; Ren, Shu-Hong; Dong, Wei; Fang, Jun

    2012-02-01

    The aim of this study was to investigate the effects of transcription factors T-bet, GATA-3 in the pathogenesis of Hench-Schonlein purpura (HSP) in children, the relationship between CD4(+)CD25(+)regulatory T cells, transcription factor FoxP3 and the development of child HSP, and the molecular mechanisms of Th1/Th2 imbalance of child HSP at acute phase, so as to may provide a new approach and strategy for the treatment of HSP at the molecular levels. The expression of T-bet, GATA-3 and FoxP3 mRNA were detected by real time PCR using SYBR Green I in 46 patients with HSP at acute phase and 30 healthy children as controls. The expression of T lymphocyte subsets CD4(+)CD25(+) in peripheral blood mononuclear cells was detected by flow cytometry. The results showed that the relative level of GATA-3 mRNA in peripheral blood mononuclear cells of patients with HSP was significantly higher than those of the control group (964.30 ± 655.18 vs 78.09 ± 57.20, P child HSP, especially predominant activation of Th2, which correlates with the abnormal expression of transcription factor T-bet and GATA-3 mRNA. At acute phase of child HSP, the expression of CD4(+)CD25(+)Treg and its special transcription factor FoxP3 mRNA are down-regulated. Treg cells decreases, which indicates that insufficient immunosuppressive effects resulting from the reduction of Treg cells may be one of the important reason in the immune imbalance of HSP acute phase. This study provides experimental evidence for illustrating the pathogenesis of HSP from the molecular mechanism of Treg cells and its regulation, and also provides a new thinking and new strategies for the treatment of HSP at molecular levels.

  4. Evolution of transcriptional regulation in closely related bacteria

    Directory of Open Access Journals (Sweden)

    Tsoy Olga V

    2012-10-01

    Full Text Available Abstract Background The exponential growth of the number of fully sequenced genomes at varying taxonomic closeness allows one to characterize transcriptional regulation using comparative-genomics analysis instead of time-consuming experimental methods. A transcriptional regulatory unit consists of a transcription factor, its binding site and a regulated gene. These units constitute a graph which contains so-called “network motifs”, subgraphs of a given structure. Here we consider genomes of closely related Enterobacteriales and estimate the fraction of conserved network motifs and sites as well as positions under selection in various types of non-coding regions. Results Using a newly developed technique, we found that the highest fraction of positions under selection, approximately 50%, was observed in synvergon spacers (between consecutive genes from the same strand, followed by ~45% in divergon spacers (common 5’-regions, and ~10% in convergon spacers (common 3’-regions. The fraction of selected positions in functional regions was higher, 60% in transcription factor-binding sites and ~45% in terminators and promoters. Small, but significant differences were observed between Escherichia coli and Salmonella enterica. This fraction is similar to the one observed in eukaryotes. The conservation of binding sites demonstrated some differences between types of regulatory units. In E. coli, strains the interactions of the type “local transcriptional factor gene” turned out to be more conserved in feed-forward loops (FFLs compared to non-motif interactions. The coherent FFLs tend to be less conserved than the incoherent FFLs. A natural explanation is that the former imply functional redundancy. Conclusions A naïve hypothesis that FFL would be highly conserved turned out to be not entirely true: its conservation depends on its status in the transcriptional network and also from its usage. The fraction of positions under selection in

  5. The transcription factor Ste12 mediates the regulatory role of the Tmk1 MAP kinase in mycoparasitism and vegetative hyphal fusion in the filamentous fungus Trichoderma atroviride.

    Directory of Open Access Journals (Sweden)

    Sabine Gruber

    Full Text Available Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12.

  6. Gene and transcript abundances of bacterial type III secretion systems from the rumen microbiome are correlated with methane yield in sheep

    OpenAIRE

    Kamke, Janine; Soni, Priya; Li, Yang; Ganesh, Siva; Kelly, William J.; Leahy, Sinead C.; Shi, Weibing; Froula, Jeff; Rubin, Edward M.; Attwood, Graeme T.

    2017-01-01

    Background Ruminants are important contributors to global methane emissions via microbial fermentation in their reticulo-rumens. This study is part of a larger program, characterising the rumen microbiomes of sheep which vary naturally in methane yield (g CH4/kg DM/day) and aims to define differences in microbial communities, and in gene and transcript abundances that can explain the animal methane phenotype. Methods Rumen microbiome metagenomic and metatranscriptomic data were analysed by Ge...

  7. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1.

    Science.gov (United States)

    Lu, Fang; Chen, Horng-Shen; Kossenkov, Andrew V; DeWispeleare, Karen; Won, Kyoung-Jae; Lieberman, Paul M

    2016-01-01

    Epstein-Barr Virus (EBV) transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival.

  8. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1.

    Directory of Open Access Journals (Sweden)

    Fang Lu

    2016-01-01

    Full Text Available Epstein-Barr Virus (EBV transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival.

  9. Functional footprinting of regulatory DNA.

    Science.gov (United States)

    Vierstra, Jeff; Reik, Andreas; Chang, Kai-Hsin; Stehling-Sun, Sandra; Zhou, Yuanyue; Hinkley, Sarah J; Paschon, David E; Zhang, Lei; Psatha, Nikoletta; Bendana, Yuri R; O'Neil, Colleen M; Song, Alexander H; Mich, Andrea K; Liu, Pei-Qi; Lee, Gary; Bauer, Daniel E; Holmes, Michael C; Orkin, Stuart H; Papayannopoulou, Thalia; Stamatoyannopoulos, George; Rebar, Edward J; Gregory, Philip D; Urnov, Fyodor D; Stamatoyannopoulos, John A

    2015-10-01

    Regulatory regions harbor multiple transcription factor (TF) recognition sites; however, the contribution of individual sites to regulatory function remains challenging to define. We describe an approach that exploits the error-prone nature of genome editing-induced double-strand break repair to map functional elements within regulatory DNA at nucleotide resolution. We demonstrate the approach on a human erythroid enhancer, revealing single TF recognition sites that gate the majority of downstream regulatory function.

  10. Post-transcriptional regulation of gene expression in Yersinia species

    Directory of Open Access Journals (Sweden)

    Chelsea A Schiano

    2012-11-01

    Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

  11. Antisense transcription regulates the expression of the enterohemorrhagic Escherichia coli virulence regulatory gene ler in response to the intracellular iron concentration.

    Directory of Open Access Journals (Sweden)

    Toru Tobe

    Full Text Available Enteric pathogens, such as enterohemorrhagic E. coli (EHEC O157:H7, encounter varying concentrations of iron during their life cycle. In the gastrointestinal tract, the amount of available free iron is limited because of absorption by host factors. EHEC and other enteric pathogens have developed sophisticated iron-responsive systems to utilize limited iron resources, and these systems are primarily regulated by the Fur repressor protein. The iron concentration could be a signal that controls gene expression in the intestines. In this study, we explored the role of iron in LEE (locus for enterocyte effacement virulence gene expression in EHEC. In contrast to the expression of Fur-regulated genes, the expression of LEE genes was greatly reduced in fur mutants irrespective of the iron concentration. The expression of the ler gene, the LEE-encoded master regulator, was affected at a post-transcription step by fur mutation. Further analysis showed that the loss of Fur affected the translation of the ler gene by increasing the intracellular concentration of free iron, and the transcription of the antisense strand was necessary for regulation. The results indicate that LEE gene expression is closely linked to the control of intracellular free iron homeostasis.

  12. Molecular characterization of collagen IV evidences early transcription expression related to the immune response against bacterial infection in the red abalone (Haliotis rufescens).

    Science.gov (United States)

    Chovar-Vera, Ornella; Valenzuela-Muñoz, Valentina; Gallardo-Escárate, Cristian

    2015-02-01

    Collagen IV has been described as a structural protein of the basement membrane, which as a whole forms a specialized extracellular matrix. Recent studies have indicated a possible relationship between collagen IV and the innate immune response of invertebrate organisms. The present study characterized the alpha-1 chain of collagen IV in the red abalone Haliotis rufescens (Hr-ColIV) and evaluated its association with the innate immune response against Vibrio anguillarum. To further evidence the immune response, the matrix metalloproteinase-1 (Hr-MMP-1) and C-type lectin (Hr-CLEC) genes were also assessed. The complete sequence of Hr-ColIV was composed of 6658 bp, with a 5'UTR of 154 bp, a 3'UTR of 1177 bp, and an ORF of 5327 bp that coded for 1776 amino acids. The innate immune response generated against V. anguillarum resulted in a significant increase in the transcript levels of Hr-ColIV between 3 and 6 hpi, whereas Hr-MMP-1 and Hr-CLEC had the highest transcript activity 6 and 12 hpi, respectively. The results obtained in this study propose a putative biological function for collagen IV involved in the early innate immune response of the red abalone H. rufescens. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. The SWI/SNF Chromatin Regulator BRG1 Modulates the Transcriptional Regulatory Activity of the Epstein-Barr Virus DNA Polymerase Processivity Factor BMRF1.

    Science.gov (United States)

    Su, Mei-Tzu; Wang, Ya-Ting; Chen, Yen-Ju; Lin, Su-Fang; Tsai, Ching-Hwa; Chen, Mei-Ru

    2017-05-01

    During the lytic phase of Epstein-Barr virus (EBV), binding of the transactivator Zta to the origin of lytic replication (oriLyt) and the BHLF1 transcript, forming a stable RNA-DNA hybrid, is required to initiate viral DNA replication. EBV-encoded viral DNA replication proteins form complexes to amplify viral DNA. BMRF1, the viral DNA polymerase accessory factor, is essential for lytic DNA replication and also known as a transcriptional regulator of the expression of BHLF1 and BALF2 (single-stranded DNA [ssDNA]-binding protein). In order to determine systematically how BMRF1 regulates viral transcription, a BMRF1 knockout bacmid was generated to analyze viral gene expression using a viral DNA microarray. We found that a subset of Rta-responsive late genes, including BcLF1, BLLF1, BLLF2, and BDLF3, were downregulated in cells harboring a BMRF1 knockout EBV bacmid (p2089ΔBMRF1). In reporter assays, BMRF1 appears to transactivate a subset of viral late promoters through distinct pathways. BMRF1 activates the BDLF3 promoter in an SP1-dependent manner. Notably, BMRF1 associates with the transcriptional regulator BRG1 in EBV-reactivated cells. BMRF1-mediated transactivation activities on the BcLF1 and BLLF1 promoters were attenuated by knockdown of BRG1. In BRG1-depleted EBV-reactivated cells, BcLF1 and BLLF1 transcripts were reduced in number, resulting in reduced virion secretion. BMRF1 and BRG1 bound to the adjacent upstream regions of the BcLF1 and BLLF1 promoters, and depletion of BRG1 attenuated the recruitment of BMRF1 onto both promoters, suggesting that BRG1 is involved in BMRF1-mediated regulation of these two genes. Overall, we reveal a novel pathway by which BMRF1 can regulate viral promoters through interaction with BRG1. IMPORTANCE The cascade of viral gene expression during Epstein-Barr virus (EBV) replication is exquisitely regulated by the coordination of the viral DNA replication machinery and cellular factors. Upon lytic replication, the EBV immediate

  14. RegPrecise 3.0--a resource for genome-scale exploration of transcriptional regulation in bacteria.

    Science.gov (United States)

    Novichkov, Pavel S; Kazakov, Alexey E; Ravcheev, Dmitry A; Leyn, Semen A; Kovaleva, Galina Y; Sutormin, Roman A; Kazanov, Marat D; Riehl, William; Arkin, Adam P; Dubchak, Inna; Rodionov, Dmitry A

    2013-11-01

    Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in prokaryotes is one of the critical tasks of modern genomics. Bacteria from different taxonomic groups, whose lifestyles and natural environments are substantially different, possess highly diverged transcriptional regulatory networks. The comparative genomics approaches are useful for in silico reconstruction of bacterial regulons and networks operated by both transcription factors (TFs) and RNA regulatory elements (riboswitches). RegPrecise (http://regprecise.lbl.gov) is a web resource for collection, visualization and analysis of transcriptional regulons reconstructed by comparative genomics. We significantly expanded a reference collection of manually curated regulons we introduced earlier. RegPrecise 3.0 provides access to inferred regulatory interactions organized by phylogenetic, structural and functional properties. Taxonomy-specific collections include 781 TF regulogs inferred in more than 160 genomes representing 14 taxonomic groups of Bacteria. TF-specific collections include regulogs for a selected subset of 40 TFs reconstructed across more than 30 taxonomic lineages. Novel collections of regulons operated by RNA regulatory elements (riboswitches) include near 400 regulogs inferred in 24 bacterial lineages. RegPrecise 3.0 provides four classifications of the reference regulons implemented as controlled vocabularies: 55 TF protein families; 43 RNA motif families; ~150 biological processes or metabolic pathways; and ~200 effectors or environmental signals. Genome-wide visualization of regulatory networks and metabolic pathways covered by the reference regulons are available for all studied genomes. A separate section of RegPrecise 3.0 contains draft regulatory networks in 640 genomes obtained by an conservative propagation of the reference regulons to closely related genomes. RegPrecise 3.0 gives access to the transcriptional regulons reconstructed in

  15. Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

    Science.gov (United States)

    2018-01-01

    Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

  16. Fast and Efficient Cloning of Cis-Regulatory Sequences for High-Throughput Yeast One-Hybrid Analyses of Transcription Factors.

    Science.gov (United States)

    Kelemen, Zsolt; Przybyla-Toscano, Jonathan; Tissot, Nicolas; Lepiniec, Loïc; Dubos, Christian

    2016-01-01

    Yeast one-hybrid (Y1H) assay has been proven to be a powerful technique to characterize in vivo the interaction between a given transcription factor (TF), or its DNA-binding domain (DBD), and target DNA sequences. Comprehensive characterization of TF/DBD and DNA interactions should allow designing synthetic promoters that would undoubtedly be valuable for biotechnological approaches. Here, we use the ligation-independent cloning system (LIC) in order to enhance the cloning efficiency of DNA motifs into the pHISi Y1H vector. LIC overcomes important limitations of traditional cloning technologies, since any DNA fragment can be cloned into LIC compatible vectors without using restriction endonucleases, ligation, or in vitro recombination.

  17. Systematic Profiling of Poly(A)+ Transcripts Modulated by Core 3’ End Processing and Splicing Factors Reveals Regulatory Rules of Alternative Cleavage and Polyadenylation

    Science.gov (United States)

    Li, Wencheng; You, Bei; Hoque, Mainul; Zheng, Dinghai; Luo, Wenting; Ji, Zhe; Park, Ji Yeon; Gunderson, Samuel I.; Kalsotra, Auinash; Manley, James L.; Tian, Bin

    2015-01-01

    Alternative cleavage and polyadenylation (APA) results in mRNA isoforms containing different 3’ untranslated regions (3’UTRs) and/or coding sequences. How core cleavage/polyadenylation (C/P) factors regulate APA is not well understood. Using siRNA knockdown coupled with deep sequencing, we found that several C/P factors can play significant roles in 3’UTR-APA. Whereas Pcf11 and Fip1 enhance usage of proximal poly(A) sites (pAs), CFI-25/68, PABPN1 and PABPC1 promote usage of distal pAs. Strong cis element biases were found for pAs regulated by CFI-25/68 or Fip1, and the distance between pAs plays an important role in APA regulation. In addition, intronic pAs are substantially regulated by splicing factors, with U1 mostly inhibiting C/P events in introns near the 5’ end of gene and U2 suppressing those in introns with features for efficient splicing. Furthermore, PABPN1 inhibits expression of transcripts with pAs near the transcription start site (TSS), a property possibly related to its role in RNA degradation. Finally, we found that groups of APA events regulated by C/P factors are also modulated in cell differentiation and development with distinct trends. Together, our results support an APA code where an APA event in a given cellular context is regulated by a number of parameters, including relative location to the TSS, splicing context, distance between competing pAs, surrounding cis elements and concentrations of core C/P factors. PMID:25906188

  18. Systematic profiling of poly(A+ transcripts modulated by core 3' end processing and splicing factors reveals regulatory rules of alternative cleavage and polyadenylation.

    Directory of Open Access Journals (Sweden)

    Wencheng Li

    2015-04-01

    Full Text Available Alternative cleavage and polyadenylation (APA results in mRNA isoforms containing different 3' untranslated regions (3'UTRs and/or coding sequences. How core cleavage/polyadenylation (C/P factors regulate APA is not well understood. Using siRNA knockdown coupled with deep sequencing, we found that several C/P factors can play significant roles in 3'UTR-APA. Whereas Pcf11 and Fip1 enhance usage of proximal poly(A sites (pAs, CFI-25/68, PABPN1 and PABPC1 promote usage of distal pAs. Strong cis element biases were found for pAs regulated by CFI-25/68 or Fip1, and the distance between pAs plays an important role in APA regulation. In addition, intronic pAs are substantially regulated by splicing factors, with U1 mostly inhibiting C/P events in introns near the 5' end of gene and U2 suppressing those in introns with features for efficient splicing. Furthermore, PABPN1 inhibits expression of transcripts with pAs near the transcription start site (TSS, a property possibly related to its role in RNA degradation. Finally, we found that groups of APA events regulated by C/P factors are also modulated in cell differentiation and development with distinct trends. Together, our results support an APA code where an APA event in a given cellular context is regulated by a number of parameters, including relative location to the TSS, splicing context, distance between competing pAs, surrounding cis elements and concentrations of core C/P factors.

  19. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

    2005-01-05

    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  20. Novel positive regulatory role for the SPL6 transcription factor in the N TIR-NB-LRR receptor-mediated plant innate immunity.

    Directory of Open Access Journals (Sweden)

    Meenu S Padmanabhan

    2013-03-01

    Full Text Available Following the recognition of pathogen-encoded effectors, plant TIR-NB-LRR immune receptors induce defense signaling by a largely unknown mechanism. We identify a novel and conserved role for the SQUAMOSA PROMOTER BINDING PROTEIN (SBP-domain transcription factor SPL6 in enabling the activation of the defense transcriptome following its association with a nuclear-localized immune receptor. During an active immune response, the Nicotiana TIR-NB-LRR N immune receptor associates with NbSPL6 within distinct nuclear compartments. NbSPL6 is essential for the N-mediated resistance to Tobacco mosaic virus. Similarly, the presumed Arabidopsis ortholog AtSPL6 is required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that AtSPL6 positively regulates a subset of defense genes. A pathogen-activated nuclear-localized TIR-NB-LRR like N can therefore regulate defense genes through SPL6 in a mechanism analogous to the induction of MHC genes by mammalian immune receptors like CIITA and NLRC5.

  1. Analysis of transcriptional and upstream regulatory sequence activity of two environmental stress-inducible genes, NBS-Str1 and BLEC-Str8, of rice.

    Science.gov (United States)

    Ray, Swatismita; Kapoor, Sanjay; Tyagi, Akhilesh K

    2012-04-01

    Two abiotic stress-inducible upstream regulatory sequences (URSs) from rice have been identified and functionally characterized in rice. NBS-Str1 and BLEC-Str8 genes have been identified, by analysing the transcriptome data of cold, salt and desiccation stress-treated 7-day-old rice (Oryza sativa L. var. IR64) seedling, to be preferentially responsive to desiccation and salt stress, respectively. NBS-Str1 and BLEC-Str8 genes code for putative NBS (nucleotide binding site)-LRR (leucine rich repeat) and β-lectin domain protein, respectively. NBS-Str1 URS is induced in root tissue, preferentially in vascular bundle, during 3 and 24 h of desiccation stress condition in transgenic 7-day-old rice seedling. In mature transgenic plants, this URS shows induction in root and shoot tissue under desiccation stress as well as under prolonged (1 and 2 day) salt stress. BLEC-Str8 URS shows basal activity under un-stressed condition, however, it is inducible under salt stress condition in both root and leaf tissues in young seedling and mature plants. Activity of BLEC-Str8 URS has been found to be vascular tissue preferential, however, under salt stress condition its activity is also found in the mesophyll tissue. NBS-Str1 and BLEC-Str8 URSs are inducible by heavy metal, copper and manganese. Interestingly, both the URSs have been found to be non responsive to ABA treatment, implying them to be part of ABA-independent abiotic stress response pathway. These URSs could prove useful for expressing a transgene in a stress responsive manner for development of stress tolerant transgenic systems.

  2. Application of a fuzzy neural network model in predicting polycyclic aromatic hydrocarbon-mediated perturbations of the Cyp1b1 transcriptional regulatory network in mouse skin.

    Science.gov (United States)

    Larkin, Andrew; Siddens, Lisbeth K; Krueger, Sharon K; Tilton, Susan C; Waters, Katrina M; Williams, David E; Baird, William M

    2013-03-01

    Polycyclic aromatic hydrocarbons (PAHs) are present in the environment as complex mixtures with components that have diverse carcinogenic potencies and mostly unknown interactive effects. Non-additive PAH interactions have been observed in regulation of cytochrome P450 (CYP) gene expression in the CYP1 family. To better understand and predict biological effects of complex mixtures, such as environmental PAHs, an 11 gene input-1 gene output fuzzy neural network (FNN) was developed for predicting PAH-mediated perturbations of dermal Cyp1b1 transcription in mice. Input values were generalized using fuzzy logic into low, medium, and high fuzzy subsets, and sorted using k-means clustering to create Mamdani logic functions for predicting Cyp1b1 mRNA expression. Model testing was performed with data from microarray analysis of skin samples from FVB/N mice treated with toluene (vehicle control), dibenzo[def,p]chrysene (DBC), benzo[a]pyrene (BaP), or 1 of 3 combinations of diesel particulate extract (DPE), coal tar extract (CTE) and cigarette smoke condensate (CSC) using leave-one-out cross-validation. Predictions were within 1 log(2) fold change unit of microarray data, with the exception of the DBC treatment group, where the unexpected down-regulation of Cyp1b1 expression was predicted but did not reach statistical significance on the microarrays. Adding CTE to DPE was predicted to increase Cyp1b1 expression, whereas adding CSC to CTE and DPE was predicted to have no effect, in agreement with microarray results. The aryl hydrocarbon receptor repressor (Ahrr) was determined to be the most significant input variable for model predictions using back-propagation and normalization of FNN weights. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. N-termini of fungal CSL transcription factors are disordered, enriched in regulatory motifs and inhibit DNA binding in fission yeast.

    Directory of Open Access Journals (Sweden)

    Martin Převorovský

    Full Text Available CSL (CBF1/RBP-Jκ/Suppressor of Hairless/LAG-1 transcription factors are the effector components of the Notch receptor signalling pathway, which is critical for metazoan development. The metazoan CSL proteins (class M can also function in a Notch-independent manner. Recently, two novel classes of CSL proteins, designated F1 and F2, have been identified in fungi. The role of the fungal CSL proteins is unclear, because the Notch pathway is not present in fungi. In fission yeast, the Cbf11 and Cbf12 CSL paralogs play antagonistic roles in cell adhesion and the coordination of cell and nuclear division. Unusually long N-terminal extensions are typical for fungal and invertebrate CSL family members. In this study, we investigate the functional significance of these extended N-termini of CSL proteins.We identify 15 novel CSL family members from 7 fungal species and conduct bioinformatic analyses of a combined dataset containing 34 fungal and 11 metazoan CSL protein sequences. We show that the long, non-conserved N-terminal tails of fungal CSL proteins are likely disordered and enriched in phosphorylation sites and PEST motifs. In a case study of Cbf12 (class F2, we provide experimental evidence that the protein is proteolytically processed and that the N-terminus inhibits the Cbf12-dependent DNA binding activity in an electrophoretic mobility shift assay.This study provides insight into the characteristics of the long N-terminal tails of fungal CSL proteins that may be crucial for controlling DNA-binding and CSL function. We propose that the regulation of DNA binding by Cbf12 via its N-terminal region represents an important means by which fission yeast strikes a balance between the class F1 and class F2 paralog activities. This mode of regulation might be shared with other CSL-positive fungi, some of which are relevant to human disease and biotechnology.

  4. The Journey of a Transcription Factor

    DEFF Research Database (Denmark)

    Pireyre, Marie

    in their regulation at multiple steps of their activation. Plant signaling in connection with transcription factor regulation is an exciting field, allowing research on multiple regulatory mechanisms. This thesis shed light on the importance of integrating all steps of transcription factor activation in a regulatory......Plants have developed astonishing networks regulating their metabolism to adapt to their environment. The complexity of these networks is illustrated by the expansion of families of regulators such as transcription factors in the plant kingdom. Transcription factors specifically impact...... MYBs to activate transcription of GLS biosynthetic genes. A lot is known about transcriptional regulation of these nine GLS regulators. This thesis aimed at identifying regulatory mechanisms at the protein level, allowing rapid and specific regulation of transcription factors using GLS as a model...

  5. Application of a fuzzy neural network model in predicting polycyclic aromatic hydrocarbon-mediated perturbations of the Cyp1b1 transcriptional regulatory network in mouse skin

    Energy Technology Data Exchange (ETDEWEB)

    Larkin, Andrew [Department of Environmental and Molecular Toxicology, Oregon State University (United States); Department of Statistics, Oregon State University (United States); Superfund Research Center, Oregon State University (United States); Siddens, Lisbeth K. [Department of Environmental and Molecular Toxicology, Oregon State University (United States); Superfund Research Center, Oregon State University (United States); Krueger, Sharon K. [Superfund Research Center, Oregon State University (United States); Linus Pauling Institute, Oregon State University (United States); Tilton, Susan C.; Waters, Katrina M. [Superfund Research Center, Oregon State University (United States); Computational Biology and Bioinformatics Group, Pacific Northwest National Laboratory, Richland, WA 99352 (United States); Williams, David E., E-mail: david.williams@oregonstate.edu [Department of Environmental and Molecular Toxicology, Oregon State University (United States); Superfund Research Center, Oregon State University (United States); Linus Pauling Institute, Oregon State University (United States); Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); Baird, William M. [Department of Environmental and Molecular Toxicology, Oregon State University (United States); Superfund Research Center, Oregon State University (United States); Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States)

    2013-03-01

    Polycyclic aromatic hydrocarbons (PAHs) are present in the environment as complex mixtures with components that have diverse carcinogenic potencies and mostly unknown interactive effects. Non-additive PAH interactions have been observed in regulation of cytochrome P450 (CYP) gene expression in the CYP1 family. To better understand and predict biological effects of complex mixtures, such as environmental PAHs, an 11 gene input-1 gene output fuzzy neural network (FNN) was developed for predicting PAH-mediated perturbations of dermal Cyp1b1 transcription in mice. Input values were generalized using fuzzy logic into low, medium, and high fuzzy subsets, and sorted using k-means clustering to create Mamdani logic functions for predicting Cyp1b1 mRNA expression. Model testing was performed with data from microarray analysis of skin samples from FVB/N mice treated with toluene (vehicle control), dibenzo[def,p]chrysene (DBC), benzo[a]pyrene (BaP), or 1 of 3 combinations of diesel particulate extract (DPE), coal tar extract (CTE) and cigarette smoke condensate (CSC) using leave-one-out cross-validation. Predictions were within 1 log{sub 2} fold change unit of microarray data, with the exception of the DBC treatment group, where the unexpected down-regulation of Cyp1b1 expression was predicted but did not reach statistical significance on the microarrays. Adding CTE to DPE was predicted to increase Cyp1b1 expression, whereas adding CSC to CTE and DPE was predicted to have no effect, in agreement with microarray results. The aryl hydrocarbon receptor repressor (Ahrr) was determined to be the most significant input variable for model predictions using back-propagation and normalization of FNN weights. - Highlights: ► Tested a model to predict PAH mixture-mediated changes in Cyp1b1 expression ► Quantitative predictions in agreement with microarrays for Cyp1b1 induction ► Unexpected difference in expression between DBC and other treatments predicted ► Model predictions

  6. Prediction of regulatory elements

    DEFF Research Database (Denmark)

    Sandelin, Albin

    2008-01-01

    Finding the regulatory mechanisms responsible for gene expression remains one of the most important challenges for biomedical research. A major focus in cellular biology is to find functional transcription factor binding sites (TFBS) responsible for the regulation of a downstream gene. As wet-lab...

  7. An invertebrate signal transducer and activator of transcription 5 (STAT5) ortholog from the disk abalone, Haliotis discus discus: Genomic structure, early developmental expression, and immune responses to bacterial and viral stresses.

    Science.gov (United States)

    Bathige, S D N K; Umasuthan, Navaneethaiyer; Park, Hae-Chul; Lee, Jehee

    2016-03-01

    Signal transducer and activator of transcription (STAT) family members are key signaling molecules that transduce cellular responses from the cell membrane to the nucleus upon Janus kinase (JAK) activation. Although seven STAT members have been reported in mammals, very limited information on STAT genes in molluscans is available. In this study, we identified and characterized a STAT paralog that is homologous to STAT5 from the disk abalone, Haliotis discus discus, and designated as AbSTAT5. Comparison of the deduced amino acid sequence for AbSTAT5 (790 amino acids) with other counterparts revealed conserved residues important for functions and typical domain regions, including the N-terminal domain, coiled-coil domain, DNA-binding domain, linker domain, and Src homology 2 (SH2) domains as mammalian counterparts. Analysis of STAT phylogeny revealed that AbSTAT5 was clustered with the molluscan subgroup in STAT5 clade with distinct evolution. According to the genomic structure of AbSTAT5, the coding sequence was distributed into 20 exons with 19 introns. Immunologically essential transcription factor-binding sites, such as GATA-1, HNF, SP1, C/EBP, Oct-1, AP1, c-Jun, and Sox-2, were predicted at the 5'-proximal region of AbSTAT5. Expression of AbSTAT5 mRNA was detected in different stages of embryonic development and observed at considerably higher levels in the morula and late veliger stages. Tissue-specific expressional studies revealed that the highest level of AbSTAT5 transcripts was detected in hemocytes, followed by gill tissues. Temporal expressions of AbSTAT5 were analyzed upon live bacterial (Vibrio parahemolyticus and Listeria monocytogenes), viral (viral hemorrhagic septicemia virus), and pathogen-associated molecular pattern (lipopolysaccharides and Poly I:C) stimulations, and significant elevations indicated immune modulation. These results suggest that AbSTAT5 may be involved in maintaining innate immune responses from developmental to adult stages in

  8. Bacterial Keratitis

    Science.gov (United States)

    ... Español Eye Health / Eye Health A-Z Bacterial Keratitis Sections What Is Bacterial Keratitis? Bacterial Keratitis Symptoms ... Lens Care Bacterial Keratitis Treatment What Is Bacterial Keratitis? Leer en Español: ¿Qué Es la Queratitis Bacteriana? ...

  9. Defining bacterial regulons using ChIP-seq.

    Science.gov (United States)

    Myers, Kevin S; Park, Dan M; Beauchene, Nicole A; Kiley, Patricia J

    2015-09-15

    Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) is a powerful method that identifies protein-DNA binding sites in vivo. Recent studies have illustrated the value of ChIP-seq in studying transcription factor binding in various bacterial species under a variety of growth conditions. These results show that in addition to identifying binding sites, correlation of ChIP-seq data with expression data can reveal important information about bacterial regulons and regulatory networks. In this chapter, we provide an overview of the current state of knowledge about ChIP-seq methodology in bacteria, from sample preparation to raw data analysis. We also describe visualization and various bioinformatic analyses of processed ChIP-seq data. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Defining Bacterial Regulons Using ChIP-seq Methods

    Science.gov (United States)

    Myers, Kevin S.; Park, Dan M.; Beauchene, Nicole A.; Kiley, Patricia J.

    2015-01-01

    Chromatin immunoprecitation followed by high-throughput sequencing (ChIP-seq) is a powerful method that identifies protein-DNA binding sites in vivo. Recent studies have illustrated the value of ChIP-seq in studying transcription factor binding in various bacterial species under a variety of growth conditions. These results show that in addition to identifying binding sites, correlation of ChIP-seq data with expression data can reveal important information about bacterial regulons and regulatory networks. In this chapter, we provide an overview of the current state of knowledge about ChIP-seq methodology in bacteria, from sample preparation to raw data analysis. We also describe visualization and various bioinformatic analyses of processed ChIP-seq data. PMID:26032817

  11. Eukaryotic transcription factors

    DEFF Research Database (Denmark)

    Staby, Lasse; O'Shea, Charlotte; Willemoës, Martin

    2017-01-01

    Gene-specific transcription factors (TFs) are key regulatory components of signaling pathways, controlling, for example, cell growth, development, and stress responses. Their biological functions are determined by their molecular structures, as exemplified by their structured DNA-binding domains...... them to participate in large interactomes, how they use only a few hydrophobic residues, short sequence motifs, prestructured motifs, and coupled folding and binding for their interactions with co-activators, and how their accessibility to post-translational modification affects their interactions...

  12. The multidrug ABC transporter BmrC/BmrD of Bacillus subtilis is regulated via a ribosome-mediated transcriptional attenuation mechanism

    OpenAIRE

    Reilman, E.; Mars, R. A. T.; van Dijl, J. M.; Denham, Emma

    2014-01-01

    Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology,...

  13. Regulatory Phosphorylation of Bacterial-Type PEP Carboxylase by the Ca2+-Dependent Protein Kinase RcCDPK1 in Developing Castor Oil Seeds.

    Science.gov (United States)

    Ying, Sheng; Hill, Allyson T; Pyc, Michal; Anderson, Erin M; Snedden, Wayne A; Mullen, Robert T; She, Yi-Min; Plaxton, William C

    2017-06-01

    Phosphoenolpyruvate carboxylase (PEPC) is a tightly controlled cytosolic enzyme situated at a crucial branch point of central plant metabolism. In developing castor oil seeds ( Ricinus communis ) a novel, allosterically desensitized 910-kD Class-2 PEPC hetero-octameric complex, arises from a tight interaction between 107-kD plant-type PEPC and 118-kD bacterial-type (BTPC) subunits. The native Ca 2+ -dependent protein kinase (CDPK) responsible for in vivo inhibitory phosphorylation of Class-2 PEPC's BTPC subunit's at Ser-451 was highly purified from COS and identified as RcCDPK1 (XP_002526815) by mass spectrometry. Heterologously expressed RcCDPK1 catalyzed Ca 2+ -dependent, inhibitory phosphorylation of BTPC at Ser-451 while exhibiting: ( i ) a pair of Ca 2+ binding sites with identical dissociation constants of 5.03 μM, ( ii ) a Ca 2+ -dependent electrophoretic mobility shift, and ( iii ) a marked Ca 2+ -independent hydrophobicity. Pull-down experiments established the Ca 2+ -dependent interaction of N-terminal GST-tagged RcCDPK1 with BTPC. RcCDPK1-Cherry localized to the cytosol and nucleus of tobacco bright yellow-2 cells, but colocalized with mitochondrial-surface associated BTPC-enhanced yellow fluorescent protein when both fusion proteins were coexpressed. Deletion analyses demonstrated that although its N-terminal variable domain plays an essential role in optimizing Ca 2+ -dependent RcCDPK1 autophosphorylation and BTPC transphosphorylation activity, it is not critical for in vitro or in vivo target recognition. Arabidopsis ( Arabidopsis thaliana ) CPK4 and soybean ( Glycine max ) CDPKβ are RcCDPK1 orthologs that effectively phosphorylated castor BTPC at Ser-451. Overall, the results highlight a potential link between cytosolic Ca 2+ signaling and the posttranslational control of respiratory CO 2 refixation and anaplerotic photosynthate partitioning in support of storage oil and protein biosynthesis in developing COS. © 2017 American Society of Plant

  14. Regulatory Phosphorylation of Bacterial-Type PEP Carboxylase by the Ca2+-Dependent Protein Kinase RcCDPK1 in Developing Castor Oil Seeds1[OPEN

    Science.gov (United States)

    Hill, Allyson T.; Anderson, Erin M.; She, Yi-Min

    2017-01-01

    Phosphoenolpyruvate carboxylase (PEPC) is a tightly controlled cytosolic enzyme situated at a crucial branch point of central plant metabolism. In developing castor oil seeds (Ricinus communis) a novel, allosterically desensitized 910-kD Class-2 PEPC hetero-octameric complex, arises from a tight interaction between 107-kD plant-type PEPC and 118-kD bacterial-type (BTPC) subunits. The native Ca2+-dependent protein kinase (CDPK) responsible for in vivo inhibitory phosphorylation of Class-2 PEPC’s BTPC subunit’s at Ser-451 was highly purified from COS and identified as RcCDPK1 (XP_002526815) by mass spectrometry. Heterologously expressed RcCDPK1 catalyzed Ca2+-dependent, inhibitory phosphorylation of BTPC at Ser-451 while exhibiting: (i) a pair of Ca2+ binding sites with identical dissociation constants of 5.03 μM, (ii) a Ca2+-dependent electrophoretic mobility shift, and (iii) a marked Ca2+-independent hydrophobicity. Pull-down experiments established the Ca2+-dependent interaction of N-terminal GST-tagged RcCDPK1 with BTPC. RcCDPK1-Cherry localized to the cytosol and nucleus of tobacco bright yellow-2 cells, but colocalized with mitochondrial-surface associated BTPC-enhanced yellow fluorescent protein when both fusion proteins were coexpressed. Deletion analyses demonstrated that although its N-terminal variable domain plays an essential role in optimizing Ca2+-dependent RcCDPK1 autophosphorylation and BTPC transphosphorylation activity, it is not critical for in vitro or in vivo target recognition. Arabidopsis (Arabidopsis thaliana) CPK4 and soybean (Glycine max) CDPKβ are RcCDPK1 orthologs that effectively phosphorylated castor BTPC at Ser-451. Overall, the results highlight a potential link between cytosolic Ca2+ signaling and the posttranslational control of respiratory CO2 refixation and anaplerotic photosynthate partitioning in support of storage oil and protein biosynthesis in developing COS. PMID:28363991

  15. Mutations in the control of virulence sensor gene from Streptococcus pyogenes after infection in mice lead to clonal bacterial variants with altered gene regulatory activity and virulence.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Mayfield

    Full Text Available The cluster of virulence sensor (CovS/responder (CovR two-component operon (CovRS regulates ∼15% of the genes of the Group A Streptococcal pyogenes (GAS genome. Bacterial clones containing inactivating mutations in the covS gene have been isolated from patients with virulent invasive diseases. We report herein an assessment of the nature and types of covS mutations that can occur in both virulent and nonvirulent GAS strains, and assess whether a nonvirulent GAS can attain enhanced virulence through this mechanism. A group of mice were infected with a globally-disseminated clonal M1T1 GAS (isolate 5448, containing wild-type (WT CovRS (5448/CovR+S+, or less virulent engineered GAS strains, AP53/CovR+S+ and Manfredo M5/CovR+S+. SpeB negative GAS clones from wound sites and/or from bacteria disseminated to the spleen were isolated and the covS gene was subjected to DNA sequence analysis. Numerous examples of inactivating mutations were found in CovS in all regions of the gene. The mutations found included frame-shift insertions and deletions, and in-frame small and large deletions in the gene. Many of the mutations found resulted in early translation termination of CovS. Thus, the covS gene is a genomic mutagenic target that gives GAS enhanced virulence. In cases wherein CovS- was discovered, these clonal variants exhibited high lethality, further suggesting that randomly mutated covS genes occur during the course of infection, and lead to the development of a more invasive infection.

  16. Opposing roles for interferon regulatory factor-3 (IRF-3 and type I interferon signaling during plague.

    Directory of Open Access Journals (Sweden)

    Ami A Patel

    Full Text Available Type I interferons (IFN-I broadly control innate immunity and are typically transcriptionally induced by Interferon Regulatory Factors (IRFs following stimulation of pattern recognition receptors within the cytosol of host cells. For bacterial infection, IFN-I signaling can result in widely variant responses, in some cases contributing to the pathogenesis of disease while in others contributing to host defense. In this work, we addressed the role of type I IFN during Yersinia pestis infection in a murine model of septicemic plague. Transcription of IFN-β was induced in vitro and in vivo and contributed to pathogenesis. Mice lacking the IFN-I receptor, Ifnar, were less sensitive to disease and harbored more neutrophils in the later stage of infection which correlated with protection from lethality. In contrast, IRF-3, a transcription factor commonly involved in inducing IFN-β following bacterial infection, was not necessary for IFN production but instead contributed to host defense. In vitro, phagocytosis of Y. pestis by macrophages and neutrophils was more effective in the presence of IRF-3 and was not affected by IFN-β signaling. This activity correlated with limited bacterial growth in vivo in the presence of IRF-3. Together the data demonstrate that IRF-3 is able to activate pathways of innate immunity against bacterial infection that extend beyond regulation of IFN-β production.

  17. Regulatory agencies and regulatory risk

    OpenAIRE

    Knieps, Günter; Weiß, Hans-Jörg

    2008-01-01

    The aim of this paper is to show that regulatory risk is due to the discretionary behaviour of regulatory agencies, caused by a too extensive regulatory mandate provided by the legislator. The normative point of reference and a behavioural model of regulatory agencies based on the positive theory of regulation are presented. Regulatory risk with regard to the future behaviour of regulatory agencies is modelled as the consequence of the ex ante uncertainty about the relative influence of inter...

  18. Integrated Approach to Reconstruction of Microbial Regulatory Networks

    Energy Technology Data Exchange (ETDEWEB)

    Rodionov, Dmitry A [Sanford-Burnham Medical Research Institute; Novichkov, Pavel S [Lawrence Berkeley National Laboratory

    2013-11-04

    This project had the goal(s) of development of integrated bioinformatics platform for genome-scale inference and visualization of transcriptional regulatory networks (TRNs) in bacterial genomes. The work was done in Sanford-Burnham Medical Research Institute (SBMRI, P.I. D.A. Rodionov) and Lawrence Berkeley National Laboratory (LBNL, co-P.I. P.S. Novichkov). The developed computational resources include: (1) RegPredict web-platform for TRN inference and regulon reconstruction in microbial genomes, and (2) RegPrecise database for collection, visualization and comparative analysis of transcriptional regulons reconstructed by comparative genomics. These analytical resources were selected as key components in the DOE Systems Biology KnowledgeBase (SBKB). The high-quality data accumulated in RegPrecise will provide essential datasets of reference regulons in diverse microbes to enable automatic reconstruction of draft TRNs in newly sequenced genomes. We outline our progress toward the three aims of this grant proposal, which were: Develop integrated platform for genome-scale regulon reconstruction; Infer regulatory annotations in several groups of bacteria and building of reference collections of microbial regulons; and Develop KnowledgeBase on microbial transcriptional regulation.

  19. Collective decisions among bacterial viruses

    Science.gov (United States)

    Joh, Richard; Mileyko, Yuriy; Voit, Eberhard; Weitz, Joshua

    2010-03-01

    For many temperate bacteriophages, the decision of whether to kill hosts or enter a latent state depends on the multiplicity of infection. In this talk, I present a quantitative model of gene regulatory dynamics to describe how phages make collective decisions within host cells. Unlike most previous studies, the copy number of viral genomes is treated as a variable. In the absence of feedback loops, viral mRNA transcription is expected to be proportional to the viral copy number. However, when there are nonlinear feedback loops in viral gene regulation, our model shows that gene expression patterns are sensitive to changes in viral copy number and there can be a domain of copy number where the system becomes bistable. Hence, the viral copy number is a key control parameter determining host cell fates. This suggests that bacterial viruses can respond adaptively to changes in population dynamics, and can make alternative decisions as a bet-hedging strategy. Finally, I present a stochastic version of viral gene regulation and discuss speed-accuracy trade-offs in the context of cell fate determination by viruses.

  20. CRISPR/Cas systems: new players in gene regulation and bacterial physiology

    Directory of Open Access Journals (Sweden)

    David eWeiss

    2014-04-01

    Full Text Available CRISPR-Cas systems are bacterial defenses against foreign nucleic acids derived from bacteriophages, plasmids or other sources. These systems are targeted in an RNA-dependent, sequence-specific manner, and are also adaptive, providing protection against previously encountered foreign elements. In addition to their canonical function in defense against foreign nucleic acid, their roles in various aspects of bacterial physiology are now being uncovered. We recently revealed a role for a Cas9-based Type II CRISPR-Cas system in the control of endogenous gene expression, a novel form of prokaryotic gene regulation. Cas9 functions in association with two small RNAs to target and alter the stability of an endogenous transcript encoding a bacterial lipoprotein (BLP. Since BLPs are recognized by the host innate immune protein Toll-like Receptor 2 (TLR2, CRISPR-Cas-mediated repression of BLP expression facilitates evasion of TLR2 by the intracellular bacterial pathogen Francisella novicida, and is essential for its virulence. Here we describe the Cas9 regulatory system in detail, as well as data on its role in controlling virulence traits of Neisseria meningitidis and Campylobacter jejuni. We also discuss potential roles of CRISPR-Cas systems in the response to envelope stress and other aspects of bacterial physiology. Since ~45% of bacteria and ~83% of Archaea encode these machineries, the newly appreciated regulatory functions of CRISPR-Cas systems are likely to play broad roles in controlling the pathogenesis and physiology of diverse prokaryotes.

  1. Oxymatrine attenuates hepatic steatosis in non-alcoholic fatty liver disease rats fed with high fructose diet through inhibition of sterol regulatory element binding transcription factor 1 (Srebf1) and activation of peroxisome proliferator activated receptor alpha (Pparα).

    Science.gov (United States)

    Shi, Li-juan; Shi, Lei; Song, Guang-yao; Zhang, He-fang; Hu, Zhi-juan; Wang, Chao; Zhang, Dong-hui

    2013-08-15

    The aim of this study was to examine the therapeutic effect of oxymatrine, a monomer isolated from the medicinal plant Sophora flavescens Ait, on the hepatic lipid metabolism in non-alcoholic fatty liver (NAFLD) rats and to explore the potential mechanism. Rats were fed with high fructose diet for 8 weeks to establish the NAFLD model, then were given oxymatrine treatment (40, 80, and 160 mg/kg, respectively) for another 8 weeks. Body weight gain, liver index, serum and liver lipids, and histopathological evaluation were measured. Enzymatic activity and gene expression of the key enzymes involved in the lipogenesis and fatty acid oxidation were assayed. The results showed that oxymatrine treatment reduced body weight gain, liver weight, liver index, dyslipidemia, and liver triglyceride level in a dose dependant manner. Importantly, the histopathological examination of liver confirmed that oxymatrine could decrease the liver lipid accumulation. The treatment also decreased the fatty acid synthase (FAS) enzymatic activity and increased the carnitine palmitoyltransferase 1A (CPT1A) enzymatic activity. Besides, oxymatrine treatment decreased the mRNA expression of sterol regulatory element binding transcription factor 1(Srebf1), fatty acid synthase (Fasn), and acetyl CoA carboxylase (Acc), and increased the mRNA expression of peroxisome proliferator activated receptor alpha (Pparα), carnitine palmitoyltransferase 1A (Cpt1a), and acyl CoA oxidase (Acox1) in high fructose diet induced NAFLD rats. These results suggested that the therapeutic effect of oxymatrine on the hepatic steatosis in high fructose diet induced fatty liver rats is partly due to down-regulating Srebf1 and up-regulating Pparα mediated metabolic pathways simultaneously. © 2013 Elsevier B.V. All rights reserved.

  2. Reconstructing the Prostate Cancer Transcriptional Regulatory Network

    Science.gov (United States)

    2010-09-01

    Matsushita N, Arakawa H, Lamerdin JE, et al. (2003) Fanconi anemia FANCG protein in mitigating radiation- and enzyme-induced DNA double-strand breaks by...preparation. 2. Malhotra S, Lapointe J, Higgins JP, Ferrari M, Montgomery K, Salari K, van de Rijn M, Brooks JD, and Pollack JR. A tri-marker...Jul 3;4(7):e6146. Lapointe J, Li C, Higgins JP, van de Rijn M, Bair E, Montgomery K, Ferrari M, Egevad L, Rayford W, Bergerheim U, Ekman P

  3. Transcriptional regulatory network controlling secondary cell wall ...

    African Journals Online (AJOL)

    Secondary wall is an abundant component of plant biomass and has a potential to be a renewable resource of bioenergy and biomaterials. It is important to unravel the molecular mechanism underlying secondary wall formation and how it contributes to plant biomass production. In this review, we summarized the potential ...

  4. Subgroup-specific intrinsic disorder profiles of arabidopsis NAC transcription factors

    DEFF Research Database (Denmark)

    Stender, Emil G.; O'Shea, Charlotte; Skriver, Karen

    2015-01-01

    Protein intrinsic disorder (ID), referring to the lack of a fixed tertiary structure, is significant in signaling and transcription. We recently characterized ID in 6 phylogenetically representative Arabidopsis thaliana NAC transcription factors. Their transcription regulatory domains are mostly...

  5. Concentration and length dependence of DNA looping in transcriptional regulation.

    Directory of Open Access Journals (Sweden)

    Lin Han

    2009-05-01

    Full Text Available In many cases, transcriptional regulation involves the binding of transcription factors at sites on the DNA that are not immediately adjacent to the promoter of interest. This action at a distance is often mediated by the formation of DNA loops: Binding at two or more sites on the DNA results in the formation of a loop, which can bring the transcription factor into the immediate neighborhood of the relevant promoter. These processes are important in settings ranging from the historic bacterial examples (bacterial metabolism and the lytic-lysogeny decision in bacteriophage, to the modern concept of gene regulation to regulatory processes central to pattern formation during development of multicellular organisms. Though there have been a variety of insights into the combinatorial aspects of transcriptional control, the mechanism of DNA looping as an agent of combinatorial control in both prokaryotes and eukaryotes remains unclear. We use single-molecule techniques to dissect DNA looping in the lac operon. In particular, we measure the propensity for DNA looping by the Lac repressor as a function of the concentration of repressor protein and as a function of the distance between repressor binding sites. As with earlier single-molecule studies, we find (at least two distinct looped states and demonstrate that the presence of these two states depends both upon the concentration of repressor protein and the distance between the two repressor binding sites. We find that loops form even at interoperator spacings considerably shorter than the DNA persistence length, without the intervention of any other proteins to prebend the DNA. The concentration measurements also permit us to use a simple statistical mechanical model of DNA loop formation to determine the free energy of DNA looping, or equivalently, the for looping.

  6. Mitotic bookmarking by transcription factors.

    Science.gov (United States)

    Kadauke, Stephan; Blobel, Gerd A

    2013-04-02

    Mitosis is accompanied by dramatic changes in chromatin organization and nuclear architecture. Transcription halts globally and most sequence-specific transcription factors and co-factors are ejected from mitotic chromatin. How then does the cell maintain its transcriptional identity throughout the cell division cycle? It has become clear that not all traces of active transcription and gene repression are erased within mitotic chromatin. Many histone modifications are stable or only partially diminished throughout mitosis. In addition, some sequence-specific DNA binding factors have emerged that remain bound to select sites within mitotic chromatin, raising the possibility that they function to transmit regulatory information through the transcriptionally silent mitotic phase, a concept that has been termed "mitotic bookmarking." Here we review recent approaches to studying potential bookmarking factors with regards to their mitotic partitioning, and summarize emerging ideas concerning the in vivo functions of mitotically bound nuclear factors.

  7. Bacterial meningitis

    NARCIS (Netherlands)

    Roos, Karen L.; van de Beek, Diederik

    2010-01-01

    Bacterial meningitis is a neurological emergency. Empiric antimicrobial and adjunctive therapy should be initiated as soon as a single set of blood cultures has been obtained. Clinical signs suggestive of bacterial meningitis include fever, headache, meningismus, vomiting, photophobia, and an

  8. RNA search engines empower the bacterial intranet.

    Science.gov (United States)

    Dendooven, Tom; Luisi, Ben F

    2017-08-15

    RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. © 2017 The Author(s).

  9. Expression of sterol regulatory element-binding transcription factor (SREBF 2 and SREBF cleavage-activating protein (SCAP in human atheroma and the association of their allelic variants with sudden cardiac death

    Directory of Open Access Journals (Sweden)

    Kytömäki Leena

    2008-12-01

    Full Text Available Abstract Background Disturbed cellular cholesterol homeostasis may lead to accumulation of cholesterol in human atheroma plaques. Cellular cholesterol homeostasis is controlled by the sterol regulatory element-binding transcription factor 2 (SREBF-2 and the SREBF cleavage-activating protein (SCAP. We investigated whole genome expression in a series of human atherosclerotic samples from different vascular territories and studied whether the non-synonymous coding variants in the interacting domains of two genes, SREBF-2 1784G>C (rs2228314 and SCAP 2386A>G, are related to the progression of coronary atherosclerosis and the risk of pre-hospital sudden cardiac death (SCD. Methods Whole genome expression profiling was completed in twenty vascular samples from carotid, aortic and femoral atherosclerotic plaques and six control samples from internal mammary arteries. Three hundred sudden pre-hospital deaths of middle-aged (33–69 years Caucasian Finnish men were subjected to detailed autopsy in the Helsinki Sudden Death Study. Coronary narrowing and areas of coronary wall covered with fatty streaks or fibrotic, calcified or complicated lesions were measured and related to the SREBF-2 and SCAP genotypes. Results Whole genome expression profiling showed a significant (p = 0.02 down-regulation of SREBF-2 in atherosclerotic carotid plaques (types IV-V, but not in the aorta or femoral arteries (p = NS for both, as compared with the histologically confirmed non-atherosclerotic tissues. In logistic regression analysis, a significant interaction between the SREBF-2 1784G>C and the SCAP 2386A>G genotype was observed on the risk of SCD (p = 0.046. Men with the SREBF-2 C allele and the SCAP G allele had a significantly increased risk of SCD (OR 2.68, 95% CI 1.07–6.71, compared to SCAP AA homologous subjects carrying the SREBF-2 C allele. Furthermore, similar trends for having complicated lesions and for the occurrence of thrombosis were found, although the

  10. Regulation of transcription in hyperthermophilic archaea

    NARCIS (Netherlands)

    Brinkman, A.B.

    2002-01-01

    The aim of the research presented here was to insight in the mechanisms by which transcription in hyperthermophilic archaea is regulated. To accomplish this, we have aimed (I) to identify transcriptional regulatory proteins from hyperthermophilic archaea, (II) to characterize these

  11. Specificity and robustness in transcription control networks.

    Science.gov (United States)

    Sengupta, Anirvan M; Djordjevic, Marko; Shraiman, Boris I

    2002-02-19

    Recognition by transcription factors of the regulatory DNA elements upstream of genes is the fundamental step in controlling gene expression. How does the necessity to provide stability with respect to mutation constrain the organization of transcription control networks? We examine the mutation load of a transcription factor interacting with a set of n regulatory response elements as a function of the factor/DNA binding specificity and conclude on theoretical grounds that the optimal specificity decreases with n. The predicted correlation between variability of binding sites (for a given transcription factor) and their number is supported by the genomic data for Escherichia coli. The analysis of E. coli genomic data was carried out using an algorithm suggested by the biophysical model of transcription factor/DNA binding. Complete results of the search for candidate transcription factor binding sites are available at http://www.physics.rockefeller.edu/~boris/public/search_ecoli.

  12. Regulatory activities

    International Nuclear Information System (INIS)

    2001-01-01

    This publication, compiled in 8 chapters, presents the regulatory system developed by the Nuclear Regulatory Authority (NRA) of the Argentine Republic. The following activities and developed topics in this document describe: the evolution of the nuclear regulatory activity in Argentina; the Argentine regulatory system; the nuclear regulatory laws and standards; the inspection and safeguards of nuclear facilities; the emergency systems; the environmental systems; the environmental monitoring; the analysis laboratories on physical and biological dosimetry, prenatal irradiation, internal irradiation, radiation measurements, detection techniques on nuclear testing, medical program on radiation protection; the institutional relations with national and international organization; the training courses and meeting; the technical information

  13. Mitotic Transcriptional Activation: Clearance of Actively Engaged Pol II via Transcriptional Elongation Control in Mitosis.

    Science.gov (United States)

    Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali

    2015-11-05

    Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. The Novel Transcriptional Regulator SA1804 Is Involved in Mediating the Invasion and Cytotoxicity of Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    JUNSHU eYANG

    2015-03-01

    Full Text Available The two-component regulatory system, SaeRS, controls expression of important virulence factors, including toxins and invasins, which contribute to the pathogenicity of Staphylococcus aureus. Previously, we conducted a transcriptomics study for identification of SaeRS regulon and found that inactivation of SaeRS dramatically enhances the transcription of a novel transcriptional regulator (SA1804. This led us to question whether SA1804 is involved in bacterial pathogenicity by regulating the expression of virulence factors. To address this question, we created sa1804, saeRS, and sa1804/saeRS double deletion mutants in a USA300 community-acquired MRSA strain, 923, and determined their impact on the pathogenicity. The deletion of sa1804 dramatically increased the cytotoxicity and enhanced the capacity of bacteria to invade into the epithelial cells (A549, whereas the deletion of saeRS eliminated the cytotoxicity and abolished the bacterial ability to invade into the epithelial cells. Moreover, the double deletions of sa1804 and saeRS appeared a similar phenotype with the saeRS null mutation. Furthermore, we determined the regulatory mechanism of SA1804 using qPCR and gel-shift approaches. Our data indicate that the novel virulence repressor SA1804 is dependent on the regulation of SaeRS. This study sheds light on the regulatory mechanism of virulence factors and allows for us further elucidate the molecular pathogenesis of S. aureus.

  15. Regulatory Snapshots: integrative mining of regulatory modules from expression time series and regulatory networks.

    Directory of Open Access Journals (Sweden)

    Joana P Gonçalves

    Full Text Available Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1 apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2 ignore local patterns, abundant in most interesting cases of transcriptional activity; (3 neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4 limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots. Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in

  16. RNA-Seq of Bacillus licheniformis: active regulatory RNA features expressed within a productive fermentation

    Science.gov (United States)

    2013-01-01

    Background The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. Results A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. Conclusion The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains. PMID:24079885

  17. Bacterial Proteasomes.

    Science.gov (United States)

    Jastrab, Jordan B; Darwin, K Heran

    2015-01-01

    Interest in bacterial proteasomes was sparked by the discovery that proteasomal degradation is required for the pathogenesis of Mycobacterium tuberculosis, one of the world's deadliest pathogens. Although bacterial proteasomes are structurally similar to their eukaryotic and archaeal homologs, there are key differences in their mechanisms of assembly, activation, and substrate targeting for degradation. In this article, we compare and contrast bacterial proteasomes with their archaeal and eukaryotic counterparts, and we discuss recent advances in our understanding of how bacterial proteasomes function to influence microbial physiology.

  18. Two independent transcription initiation codes overlap on vertebrate core promoters

    NARCIS (Netherlands)

    V. Haberle (Vanja); N. Li (Nan); Y. Hadzhiev (Yavor); C. Plessy (Charles); C. Previti (Christopher); C. Nepal (Chirag); P.A. Gehrig (Paola A.); X. Dong (Xianjun); A. Akalin (Altuna); A.M. Suzuki (Ana Maria); W.F.J. van IJcken (Wilfred); O. Armant (Olivier); M. Ferg (Marco); U. Strähle (Uwe); P. Carninci (Piero); F. Müller (Ferenc); B. Lenhard (Boris)

    2014-01-01

    textabstractA core promoter is a stretch of DNA surrounding the transcription start site (TSS) that integrates regulatory inputs and recruits general transcription factors to initiate transcription. The nature and causative relationship of the DNA sequence and chromatin signals that govern the

  19. Evolutionary dynamics and functional roles of regulatory systems in plants

    NARCIS (Netherlands)

    Berke, L.

    2015-01-01

    Transcription, the process of generating RNA copies of the genetic information stored in the DNA, is crucial for every organism. As with other essential processes in life, correct activation and repression of transcription is governed by complex regulatory mechanisms. These regulatory mechanisms

  20. Bacterial adhesion

    NARCIS (Netherlands)

    Loosdrecht, van M.C.M.

    1988-01-01

    As mentioned in the introduction of this thesis bacterial adhesion has been studied from a variety of (mostly practice oriented) starting points. This has resulted in a range of widely divergent approaches. In order to elucidate general principles in bacterial adhesion phenomena, we felt it

  1. Orthologous transcription factors in bacteria have different functions and regulate different genes.

    Directory of Open Access Journals (Sweden)

    Morgan N Price

    2007-09-01

    Full Text Available Transcription factors (TFs form large paralogous gene families and have complex evolutionary histories. Here, we ask whether putative orthologs of TFs, from bidirectional best BLAST hits (BBHs, are evolutionary orthologs with conserved functions. We show that BBHs of TFs from distantly related bacteria are usually not evolutionary orthologs. Furthermore, the false orthologs usually respond to different signals and regulate distinct pathways, while the few BBHs that are evolutionary orthologs do have conserved functions. To test the conservation of regulatory interactions, we analyze expression patterns. We find that regulatory relationships between TFs and their regulated genes are usually not conserved for BBHs in Escherichia coli K12 and Bacillus subtilis. Even in the much more closely related bacteria Vibrio cholerae and Shewanella oneidensis MR-1, predicting regulation from E. coli BBHs has high error rates. Using gene-regulon correlations, we identify genes whose expression pattern differs between E. coli and S. oneidensis. Using literature searches and sequence analysis, we show that these changes in expression patterns reflect changes in gene regulation, even for evolutionary orthologs. We conclude that the evolution of bacterial regulation should be analyzed with phylogenetic trees, rather than BBHs, and that bacterial regulatory networks evolve more rapidly than previously thought.

  2. Reconstruction of the core and extended regulons of global transcription factors.

    Directory of Open Access Journals (Sweden)

    Yann S Dufour

    2010-07-01

    Full Text Available The processes underlying the evolution of regulatory networks are unclear. To address this question, we used a comparative genomics approach that takes advantage of the large number of sequenced bacterial genomes to predict conserved and variable members of transcriptional regulatory networks across phylogenetically related organisms. Specifically, we developed a computational method to predict the conserved regulons of transcription factors across alpha-proteobacteria. We focused on the CRP/FNR super-family of transcription factors because it contains several well-characterized members, such as FNR, FixK, and DNR. While FNR, FixK, and DNR are each proposed to regulate different aspects of anaerobic metabolism, they are predicted to recognize very similar DNA target sequences, and they occur in various combinations among individual alpha-proteobacterial species. In this study, the composition of the respective FNR, FixK, or DNR conserved regulons across 87 alpha-proteobacterial species was predicted by comparing the phylogenetic profiles of the regulators with the profiles of putative target genes. The utility of our predictions was evaluated by experimentally characterizing the FnrL regulon (a FNR-type regulator in the alpha-proteobacterium Rhodobacter sphaeroides. Our results show that this approach correctly predicted many regulon members, provided new insights into the biological functions of the respective regulons for these regulators, and suggested models for the evolution of the corresponding transcriptional networks. Our findings also predict that, at least for the FNR-type regulators, there is a core set of target genes conserved across many species. In addition, the members of the so-called extended regulons for the FNR-type regulators vary even among closely related species, possibly reflecting species-specific adaptation to environmental and other factors. The comparative genomics approach we developed is readily applicable to other

  3. The cytidine repressor participates in the regulatory pathway of indole in Pantoea agglomerans.

    Science.gov (United States)

    Jia, Mengqi; Yu, Xuemei; Jiang, Jing; Li, Zihua; Feng, Yongjun

    2017-09-01

    Indole, an important signal molecule in both intraspecies and interspecies, regulates a variety of bacterial behaviors, but its regulatory mechanism is still unknown. Pantoea agglomerans YS19, a preponderant endophytic bacterium isolated from rice, does not produce indole, yet it senses exogenous indole. In this study, a mutant of YS19-Rp r whose target gene expression was downregulated by indole was selected through mTn5 transposon mutagenesis. Using the TAIL-PCR technique, the mutation gene was identified as a cytR homologue, which encodes a cytidine repressor (CytR) protein, a bacterial transcription factor involved in a complex regulation scheme. The negative regulation of indole in cytR, which is equivalent to the mutation in cytR, promotes the expression of a downstream gene deoC, which encodes the key enzyme deoxyribose-phosphate aldolase in participating in pentose metabolism. We found that DeoC is one of the regulatory proteins of P. agglomerans that is involved in counteracting starvation. Furthermore, the expression of deoC was induced by starvation conditions, accompanied by a decrease in cytR expression. This finding suggests that the indole signal and the mutation of cytR relieve inhibition of CytR in the transcription of deoC, facilitating better adaptation of the bacterium to the adverse conditions of the environment. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  4. Bacterial Vaginosis

    Science.gov (United States)

    ... Archive STDs Home Page Bacterial Vaginosis (BV) Chlamydia Gonorrhea Genital Herpes Hepatitis HIV/AIDS & STDs Human Papillomavirus ( ... of getting other STDs, such as chlamydia and gonorrhea . These bacteria can sometimes cause pelvic inflammatory disease ( ...

  5. Regulatory mechanisms of exoribonuclease PNPase and regulatory small RNA on T3SS of Dickeya dadantii.

    Science.gov (United States)

    Zeng, Quan; Ibekwe, A Mark; Biddle, Eulandria; Yang, Ching-Hong

    2010-10-01

    The type III secretion system (T3SS) is an essential virulence factor for many bacterial pathogens. Polynucleotide phosphorylase (PNPase) is one of the major exoribonucleases in bacteria and plays important roles in mRNA degradation, tRNA processing, and small RNA (sRNA) turnover. In this study, we showed that PNPase downregulates the transcription of T3SS structural and effector genes of the phytopathogenic bacterium Dickeya dadantii. This negative regulation of T3SS by PNPase occurs by repressing the expression of hrpL, encoding a master regulator of T3SS in D. dadantii. By reducing rpoN mRNA stability, PNPase downregulates the transcription of hrpL, which leads to a reduction in T3SS gene expression. Moreover, we have found that PNPase downregulates T3SS by decreasing hrpL mRNA stability. RsmB, a regulatory sRNA, enhances hrpL mRNA stability in D. dadantii. Our results suggest that PNPase decreases the amount of functional RsmB transcripts that could result in reduction of hrpL mRNA stability. In addition, bistable gene expression (differential expression of a single gene that creates two distinct subpopulations) of hrpA, hrpN, and dspE was observed in D. dadantii under in vitro conditions. Although PNPase regulates the proportion of cells in the high state and the low state of T3SS gene expression, it appears that PNPase is not the key switch that triggers the bistable expression patterns of T3SS genes.

  6. Transcription Factor NF-IL6 (C/EBPbeta) Activates the Expression of the Mouse MHC Class I H2-Kb Gene in Response to TNF-alpha via the Intragenic Downstream Regulatory Element

    Czech Academy of Sciences Publication Activity Database

    Hatina, J.; Jansa, Petr; Reischig, J.

    2002-01-01

    Roč. 22, - (2002), s. 741-749 ISSN 1079-9907 R&D Projects: GA MŠk(CZ) LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : Mouse MHC Class I Gene, Intragenic Downstream Regulatory Element Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.885, year: 2002

  7. Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum

    Directory of Open Access Journals (Sweden)

    Busche Tobias

    2012-09-01

    Full Text Available Abstract Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. Conclusions The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly

  8. Euglena Transcript Processing.

    Science.gov (United States)

    McWatters, David C; Russell, Anthony G

    2017-01-01

    RNA transcript processing is an important stage in the gene expression pathway of all organisms and is subject to various mechanisms of control that influence the final levels of gene products. RNA processing involves events such as nuclease-mediated cleavage, removal of intervening sequences referred to as introns and modifications to RNA structure (nucleoside modification and editing). In Euglena, RNA transcript processing was initially examined in chloroplasts because of historical interest in the secondary endosymbiotic origin of this organelle in this organism. More recent efforts to examine mitochondrial genome structure and RNA maturation have been stimulated by the discovery of unusual processing pathways in other Euglenozoans such as kinetoplastids and diplonemids. Eukaryotes containing large genomes are now known to typically contain large collections of introns and regulatory RNAs involved in RNA processing events, and Euglena gracilis in particular has a relatively large genome for a protist. Studies examining the structure of nuclear genes and the mechanisms involved in nuclear RNA processing have revealed that indeed Euglena contains large numbers of introns in the limited set of genes so far examined and also possesses large numbers of specific classes of regulatory and processing RNAs, such as small nucleolar RNAs (snoRNAs). Most interestingly, these studies have also revealed that Euglena possesses novel processing pathways generating highly fragmented cytosolic ribosomal RNAs and subunits and non-conventional intron classes removed by unknown splicing mechanisms. This unexpected diversity in RNA processing pathways emphasizes the importance of identifying the components involved in these processing mechanisms and their evolutionary emergence in Euglena species.

  9. Regulation of host-pathogen interactions via the post-transcriptional Csr/Rsm system.

    Science.gov (United States)

    Kusmierek, Maria; Dersch, Petra

    2018-02-01

    A successful colonization of specific hosts requires a rapid and efficient adaptation of the virulence-relevant gene expression program by bacterial pathogens. An important element in this endeavor is the Csr/Rsm system. This multi-component, post-transcriptional control system forms a central hub within complex regulatory networks and coordinately adjusts virulence properties with metabolic and physiological attributes of the pathogen. A key function is elicited by the RNA-binding protein CsrA/RsmA. CsrA/RsmA interacts with numerous target mRNAs, many of which encode crucial virulence factors, and alters their translation, stability or elongation of transcription. Recent studies highlighted that important colonization factors, toxins, and bacterial secretion systems are under CsrA/RsmA control. CsrA/RsmA deficiency impairs host colonization and attenuates virulence, making this post-transcriptional regulator a suitable drug target. The CsrA/RsmA protein can be inactivated through sequestration by non-coding RNAs, or via binding to specific highly abundant mRNAs and interacting proteins. The wide range of interaction partners and RNA targets, as well as the overarching, interlinked genetic control circuits illustrate the complexity of this regulatory system in the different pathogens. Future work addressing spatio-temporal changes of Csr/Rsm-mediated control during the course of an infection will help us to understand how bacteria reprogram their expression profile to cope with continuous changes experienced in colonized niches. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. BACTERIAL CONSORTIUM

    Directory of Open Access Journals (Sweden)

    Payel Sarkar

    2013-01-01

    Full Text Available Petroleum aromatic hydrocarbons like benzen e, toluene, ethyl benzene and xylene, together known as BTEX, has almost the same chemical structure. These aromatic hydrocarbons are released as pollutants in th e environment. This work was taken up to develop a solvent tolerant bacterial cons ortium that could degrade BTEX compounds as they all share a common chemical structure. We have isolated almost 60 different types of bacterial strains from different petroleum contaminated sites. Of these 60 bacterial strains almost 20 microorganisms were screene d on the basis of capability to tolerate high concentration of BTEX. Ten differe nt consortia were prepared and the compatibility of the bacterial strains within the consortia was checked by gram staining and BTEX tolerance level. Four successful mi crobial consortia were selected in which all the bacterial strains concomitantly grew in presence of high concentration of BTEX (10% of toluene, 10% of benzene 5% ethyl benzene and 1% xylene. Consortium #2 showed the highest growth rate in pr esence of BTEX. Degradation of BTEX by consortium #2 was monitored for 5 days by gradual decrease in the volume of the solvents. The maximum reduction observed wa s 85% in 5 days. Gas chromatography results also reveal that could completely degrade benzene and ethyl benzene within 48 hours. Almost 90% degradation of toluene and xylene in 48 hours was exhibited by consortium #2. It could also tolerate and degrade many industrial solvents such as chloroform, DMSO, acetonitrile having a wide range of log P values (0.03–3.1. Degradation of aromatic hydrocarbon like BTEX by a solvent tolerant bacterial consortium is greatly significant as it could degrade high concentration of pollutants compared to a bacterium and also reduces the time span of degradation.

  11. Regulatory Governance

    DEFF Research Database (Denmark)

    Kjær, Poul F.; Vetterlein, Antje

    2018-01-01

    , legal and cultural, on a global scale. Against this background, this special issue sets out to explore the multifaceted meaning, potential and impact as well as the social praxis of regulatory governance. Under the notions rules, resistance and responsibility the special issue pins out three overall......Regulatory governance frameworks have become essential building blocks of world society. From supply chains to the regimes surrounding international organizations, extensive governance frameworks have emerged which structure and channel a variety of social exchanges, including economic, political...

  12. Transcription start site profiling uncovers divergent transcription and enhancer-associated RNAs in Drosophila melanogaster.

    Science.gov (United States)

    Meers, Michael P; Adelman, Karen; Duronio, Robert J; Strahl, Brian D; McKay, Daniel J; Matera, A Gregory

    2018-02-21

    High-resolution transcription start site (TSS) mapping in D. melanogaster embryos and cell lines has revealed a rich and detailed landscape of both cis- and trans-regulatory elements and factors. However, TSS profiling has not been investigated in an orthogonal in vivo setting. Here, we present a comprehensive dataset that links TSS dynamics with nucleosome occupancy and gene expression in the wandering third instar larva, a developmental stage characterized by large-scale shifts in transcriptional programs in preparation for metamorphosis. The data recapitulate major regulatory classes of TSSs, based on peak width, promoter-proximal polymerase pausing, and cis-regulatory element density. We confirm the paucity of divergent transcription units in D. melanogaster, but also identify notable exceptions. Furthermore, we identify thousands of novel initiation events occurring at unannotated TSSs that can be classified into functional categories by their local density of histone modifications. Interestingly, a sub-class of these unannotated TSSs overlaps with functionally validated enhancer elements, consistent with a regulatory role for "enhancer RNAs" (eRNAs) in defining developmental transcription programs. High-depth TSS mapping is a powerful strategy for identifying and characterizing low-abundance and/or low-stability RNAs. Global analysis of transcription initiation patterns in a developing organism reveals a vast number of novel initiation events that identify potential eRNAs as well as other non-coding transcripts critical for animal development.

  13. Bacterial Networks in Cells and Communities.

    Science.gov (United States)

    Sourjik, Victor; Vorholt, Julia A

    2015-11-20

    Research on the bacterial regulatory networks is currently experiencing a true revival, driven by advances in methodology and by emergence of novel concepts. The biannual conference Bacterial Networks (BacNet15) held in May 2015, in Sant Feliu de Guíxols, Spain, covered progress in the studies of regulatory networks that control bacterial physiology, cell biology, stress responses, metabolism, collective behavior and evolution. It demonstrated how interdisciplinary approaches that combine molecular biology and biochemistry with the latest microscopy developments, whole cell (-omics) approaches and mathematical modeling can help understand design principles relevant in microbiology. It further showed how current biotechnology and medical microbiology could profit from our knowledge of and ability to engineer regulatory networks of bacteria. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Bacterial Ecology

    DEFF Research Database (Denmark)

    Fenchel, Tom

    2011-01-01

    Bacterial ecology is concerned with the interactions between bacteria and their biological and nonbiological environments and with the role of bacteria in biogeochemical element cycling. Many fundamental properties of bacteria are consequences of their small size. Thus, they can efficiently exploit...

  15. Bacterial meningitis

    NARCIS (Netherlands)

    Heckenberg, Sebastiaan G. B.; Brouwer, Matthijs C.; van de Beek, Diederik

    2014-01-01

    Bacterial meningitis is a neurologic emergency. Vaccination against common pathogens has decreased the burden of disease. Early diagnosis and rapid initiation of empiric antimicrobial and adjunctive therapy are vital. Therapy should be initiated as soon as blood cultures have been obtained,

  16. Bacterial lipases

    NARCIS (Netherlands)

    Jaeger, Karl-Erich; Ransac, Stéphane; Dijkstra, Bauke W.; Colson, Charles; Heuvel, Margreet van; Misset, Onno

    Many different bacterial species produce lipases which hydrolyze esters of glycerol with preferably long-chain fatty acids. They act at the interface generated by a hydrophobic lipid substrate in a hydrophilic aqueous medium. A characteristic property of lipases is called interfacial activation,

  17. Bacterial Ecology

    DEFF Research Database (Denmark)

    Fenchel, Tom

    2011-01-01

    , the production and oxidation of methane, nitrate reduction and fixation of atmospheric nitrogen are exclusively carried out by different groups of bacteria. Some bacterial species – ‘extremophiles’ – thrive in extreme environments in which no eukaryotic organisms can survive with respect to temperature, salinity...

  18. Bacterial Vaginosis

    Science.gov (United States)

    ... that coats the walls of the vagina Vaginal discharge with an unpleasant or fishlike odor Vaginal pain or itching Burning during urination Doctors are unsure of the incubation period for bacterial vaginosis. How Is the Diagnosis Made? Your child’s pediatrician can make the diagnosis ...

  19. Bacterial stress

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Bacterial stress. Physicochemical and chemical parameters: temperature, pressure, pH, salt concentration, oxygen, irradiation. Nutritional depravation: nutrient starvation, water shortage. Toxic compounds: Antibiotics, heavy metals, toxins, mutagens. Interactions with other cells: ...

  20. Regulatory Anatomy

    DEFF Research Database (Denmark)

    Hoeyer, Klaus

    2015-01-01

    , legal documents, technological devices, organizational structures, and work practices aimed at minimizing risk. I use this term to reorient the analytical attention with respect to safety regulation. Instead of evaluating whether safety is achieved, the point is to explore the types of “safety” produced...... they arise. In short, I expose the regulatory anatomy of the policy landscape....

  1. Enhancer RNAs: the new molecules of transcription.

    Science.gov (United States)

    Lai, Fan; Shiekhattar, Ramin

    2014-04-01

    In the past few years, technological advances in nucleotide sequencing have culminated in a greater understanding of the complexity of the human transcriptome. Notably, the discovery that distal regulatory elements known as enhancers are transcribed and such enhancer-derived transcripts (eRNAs) serve a critical function in transcriptional activation has added a new dimension to transcriptional regulation. Here we review recent insights into the tissue-specific and temporal-specific gene regulation brought about by the discovery of eRNAs. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Bacterial Adhesion & Blocking Bacterial Adhesion

    DEFF Research Database (Denmark)

    Vejborg, Rebecca Munk

    2008-01-01

    reduce or delay bacterial biofilm formation of a range of urinary tract infectious E.coli and Klebsiella isolates. Several other proteinaceous coatings were also found to display anti-adhesive properties, possibly providing a measure for controlling the colonization of implant materials. Several other...... components. These substances may both mediate and stabilize the bacterial biofilm. Finally, several adhesive structures were examined, and a novel physiological biofilm phenotype in E.coli biofilms was characterized, namely cell chain formation. The autotransporter protein, antigen 43, was implicated...

  3. The Small Regulatory RNA Spot42 Inhibits Indole Biosynthesis to Negatively Regulate the Locus of Enterocyte Effacement of Enteropathogenic Escherichia coli

    Directory of Open Access Journals (Sweden)

    Shantanu Bhatt

    2017-12-01

    Full Text Available The locus of enterocyte effacement is necessary for enteropathogenic Escherichia coli (EPEC to form attaching and effacing (A/E lesions. A/E lesions are characterized by intimate bacterial adherence to intestinal cells and destruction of microvilli, which leads to diarrhea. Therefore, studies interrogating the regulation of the locus of enterocyte effacement (LEE are critical for understanding the molecular epidemiology of EPEC infections and developing interventional strategies. Hitherto, most studies have centered on protein-based regulators, whereas the role of small regulatory RNAs remains underappreciated. Previously, we identified the first sRNAs—MgrR, RyhB, and McaS—that regulate the LEE of EPEC. This study was undertaken to identify additional sRNAs that impact the LEE. Our results suggest that the catabolite-responsive sRNA, Spot42, indirectly controls the LEE by inhibiting synthesis of its inducer, indole. Spot42 base-pairs with the tnaCAB mRNA and presumably destabilizes the transcript, thereby preventing expression of the regulatory and structural proteins that are involved in the import and hydrolysis of tryptophan into indole. The absence of intracellular indole leads to reduced transcription of the LEE1-encoded master transcriptional activator Ler, thereby maintaining the LEE in its silenced state and delaying A/E lesion morphogenesis. Our results highlight the importance of riboregulators that synchronize metabolic and virulence pathways in bacterial infection.

  4. Evolution of regulatory genes governing biodegradation in acinetobacter calcoaceticus. Final report, 15 July 1991-31 December 1994

    Energy Technology Data Exchange (ETDEWEB)

    Ornston, L.N.

    1995-02-22

    The Acinetobacter calcoaceticus pca-qui-pob supraoperonic gene cluster encodes bacterial enzymes that metabolize aromatic and hydroaromatic compounds in the environment. Our investigation is directed to understanding how mutation, gene rearrangement and selection contributed to evolution of the transcriptional controls exercised over genes in the cluster. The complete nucleotide sequence of the 18 kbp gene cluster has been determined, and genetic manipulations have been used to explore mechanisms contributing to expression of the genes. The results reveal that structural gene expression is governed by complex interactions between the products of different regulatory genes some of which share common ancestry. Additional controls appear to be exercised by compartmentation of some catabolic enzymes outside the inner cell membrane. Recombination appears to have made a major contribution to the evolution of existing control mechanisms, and their maintenance may be influence by continuing recombination. Contributions of recombination to mutation and repair are under investigation as are specific molecular mechanisms underlying transcriptional controls.

  5. Transcription-dependent degradation controls the stability of the SREBP family of transcription factors.

    Science.gov (United States)

    Sundqvist, Anders; Ericsson, Johan

    2003-11-25

    Cholesterol metabolism is tightly controlled by members of the sterol regulatory element-binding protein (SREBP) family of transcription factors. Here we demonstrate that the ubiquitination and degradation of SREBPs depend on their transcriptional activity. Mutations in the transactivation or DNA-binding domains of SREBPs inhibit their transcriptional activity and stabilize the proteins. The transcriptional activity and degradation of these mutants are restored when fused to heterologous transactivation or DNA-binding domains. When SREBP1a was fused to the DBD of Gal4, the ubiquitination and degradation of the fusion protein depended on coexpression of a promoter-reporter gene containing Gal4-binding sites. In addition, disruption of the interaction between WT SREBP and endogenous p300/CBP resulted in inhibition of SREBP-dependent transcription and stabilization of SREBP. Chemical inhibitors of transcription reduced the degradation of transcriptionally active SREBP1a, whereas they had no effect on the stability of transcriptionally inactive mutants, demonstrating that transcriptional activation plays an important role in the degradation of SREBPs. Thus, transcription-dependent degradation of SREBP constitutes a feedback mechanism to regulate the expression of genes involved in cholesterol metabolism and may represent a general mechanism to regulate the duration of transcriptional responses.

  6. Bacterial lipases

    OpenAIRE

    Jaeger, Karl-Erich; Ransac, Stéphane; Dijkstra, Bauke W.; Colson, Charles; Heuvel, Margreet van; Misset, Onno

    1994-01-01

    Many different bacterial species produce lipases which hydrolyze esters of glycerol with preferably long-chain fatty acids. They act at the interface generated by a hydrophobic lipid substrate in a hydrophilic aqueous medium. A characteristic property of lipases is called interfacial activation, meaning a sharp increase in lipase activity observed when the substrate starts to form an emulsion, thereby presenting to the enzyme an interfacial area. As a consequence, the kinetics of a lipase rea...

  7. REDfly: a Regulatory Element Database for Drosophila.

    Science.gov (United States)

    Gallo, Steven M; Li, Long; Hu, Zihua; Halfon, Marc S

    2006-02-01

    Bioinformatics studies of transcriptional regulation in the metazoa are significantly hindered by the absence of readily available data on large numbers of transcriptional cis-regulatory modules (CRMs). Even the richly annotated Drosophila melanogaster genome lacks extensive CRM information. We therefore present here a database of Drosophila CRMs curated from the literature complete with both DNA sequence and a searchable description of the gene expression pattern regulated by each CRM. This resource should greatly facilitate the development of computational approaches to CRM discovery as well as bioinformatics analyses of regulatory sequence properties and evolution.

  8. Phylogeny based discovery of regulatory elements

    Directory of Open Access Journals (Sweden)

    Cohen Barak A

    2006-05-01

    Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.

  9. Mutational robustness of gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

  10. FRUITING GENES OF SCHIZOPHYLLUM-COMMUNE ARE TRANSCRIPTIONALLY REGULATED

    NARCIS (Netherlands)

    SCHUREN, FHJ; VANDERLENDE, TR; WESSELS, JGH

    Fruiting genes in Schizophyllum commune are controlled by the mating-type genes and other regulatory genes. To examine whether differential accumulation of mRNAs for these fruiting genes is caused by transcriptional regulation, run-on transcription assaYs were performed with nuclei isolated from

  11. Genome Binding and Gene Regulation by Stem Cell Transcription Factors

    NARCIS (Netherlands)

    J.H. Brandsma (Johan)

    2016-01-01

    markdownabstractNearly all cells of an individual organism contain the same genome. However, each cell type transcribes a different set of genes due to the presence of different sets of cell type-specific transcription factors. Such transcription factors bind to regulatory regions such as promoters

  12. The pine Pschi4 promoter directs wound-induced transcription

    Science.gov (United States)

    Haiguo Wu; Charles H. Michler; Liborio LaRussa; John M. Davis

    1999-01-01

    Mechanical wounding stimulates the accumulation of Pschi4 transcripts (encoding a putative extracellular chitinase) in pine trees. To gain insight into the transcriptional regulatory region(s) in this gymnosperm defense gene, the 5'-flanking region of Pschi4 was fused to the uidA reporter gene encoding -...

  13. Battles and hijacks: Noncoding transcription in plants

    KAUST Repository

    Ariel, Federico

    2015-06-01

    Noncoding RNAs have emerged as major components of the eukaryotic transcriptome. Genome-wide analyses revealed the existence of thousands of long noncoding RNAs (lncRNAs) in several plant species. Plant lncRNAs are transcribed by the plant-specific RNA polymerases Pol IV and Pol V, leading to transcriptional gene silencing, as well as by Pol II. They are involved in a wide range of regulatory mechanisms impacting on gene expression, including chromatin remodeling, modulation of alternative splicing, fine-tuning of miRNA activity, and the control of mRNA translation or accumulation. Recently, dual noncoding transcription by alternative RNA polymerases was implicated in epigenetic and chromatin conformation dynamics. This review integrates the current knowledge on the regulatory mechanisms acting through plant noncoding transcription. © 2015 Elsevier Ltd.

  14. Transcription factors: Time to deliver.

    Science.gov (United States)

    Ulasov, Alexey V; Rosenkranz, Andrey A; Sobolev, Alexander S

    2018-01-10

    Transcription factors (TFs) are at the center of the broad regulatory network orchestrating gene expression programs that elicit different biological responses. For a long time, TFs have been considered as potent drug targets due to their implications in the pathogenesis of a variety of diseases. At the same time, TFs, located at convergence points of cellular regulatory pathways, are powerful tools providing opportunities both for cell type change and for managing the state of cells. This task formulation requires the TF modulation problem to come to the fore. We review several ways to manage TF activity (small molecules, transfection, nanocarriers, protein-based approaches), analyzing their limitations and the possibilities to overcome them. Delivery of TFs could revolutionize the biomedical field. Whether this forecast comes true will depend on the ability to develop convenient technologies for targeted delivery of TFs. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. The Transcription Bubble of the RNA Polymerase-Promoter Open Complex Exhibits Conformational Heterogeneity and Millisecond-Scale Dynamics : Implications for Transcription Start-Site Selection

    NARCIS (Netherlands)

    Robb, Nicole C.; Cordes, Thorben; Hwang, Ling Chin; Gryte, Kristofer; Duchi, Diego; Craggs, Timothy D.; Santoso, Yusdi; Weiss, Shimon; Ebright, Richard H.; Kapanidis, Achillefs N.

    2013-01-01

    Bacterial transcription is initiated after RNA polymerase (RNAP) binds to promoter DNA, melts similar to 14 bp around the transcription start site and forms a single-stranded "transcription bubble" within a catalytically active RNAP-DNA open complex (RPo). There is significant flexibility in the

  16. Enhancers and Transcriptional Regulation in CD4+ T Cells

    OpenAIRE

    Allison, Karmel Alon

    2015-01-01

    High-throughput sequencing has given us unprecedented insight into the regulatory networks that govern enhancer selection and transcription in mammalian cells, but many open questions remain as to how the mechanics of transcriptional regulation correspond to biological outputs such as gene expression and downstream signaling. In this dissertation, I address the nature of enhancer selection and transcriptional regulation in the context of CD4+ T cell signaling in two parts. The first study des...

  17. Parallel single-cell sequencing links transcriptional and epigenetic heterogeneity.

    Science.gov (United States)

    Angermueller, Christof; Clark, Stephen J; Lee, Heather J; Macaulay, Iain C; Teng, Mabel J; Hu, Tim Xiaoming; Krueger, Felix; Smallwood, Sebastien; Ponting, Chris P; Voet, Thierry; Kelsey, Gavin; Stegle, Oliver; Reik, Wolf

    2016-03-01

    We report scM&T-seq, a method for parallel single-cell genome-wide methylome and transcriptome sequencing that allows for the discovery of associations between transcriptional and epigenetic variation. Profiling of 61 mouse embryonic stem cells confirmed known links between DNA methylation and transcription. Notably, the method revealed previously unrecognized associations between heterogeneously methylated distal regulatory elements and transcription of key pluripotency genes.

  18. Bacterial mitosis

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Borch, Jonas; Dam, Mette

    2003-01-01

    Bacterial DNA segregation takes place in an active and ordered fashion. In the case of Escherichia coli plasmid R1, the partitioning system (par) separates paired plasmid copies and moves them to opposite cell poles. Here we address the mechanism by which the three components of the R1 par system...... movement is powered by insertional polymerization of ParM. Consistently, we find that segregating plasmids are positioned at the ends of extending ParM filaments. Thus, the process of R1 plasmid segregation in E. coli appears to be mechanistically analogous to the actin-based motility operating...

  19. Linking the transcriptional profiles and the physiological states of Mycobacterium tuberculosis during an extended intracellular infection.

    Directory of Open Access Journals (Sweden)

    Kyle H Rohde

    Full Text Available Intracellular pathogens such as Mycobacterium tuberculosis have evolved strategies for coping with the pressures encountered inside host cells. The ability to coordinate global gene expression in response to environmental and internal cues is one key to their success. Prolonged survival and replication within macrophages, a key virulence trait of M. tuberculosis, requires dynamic adaptation to diverse and changing conditions within its phagosomal niche. However, the physiological adaptations during the different phases of this infection process remain poorly understood. To address this knowledge gap, we have developed a multi-tiered approach to define the temporal patterns of gene expression in M. tuberculosis in a macrophage infection model that extends from infection, through intracellular adaptation, to the establishment of a productive infection. Using a clock plasmid to measure intracellular replication and death rates over a 14-day infection and electron microscopy to define bacterial integrity, we observed an initial period of rapid replication coupled with a high death rate. This was followed by period of slowed growth and enhanced intracellular survival, leading finally to an extended period of net growth. The transcriptional profiles of M. tuberculosis reflect these physiological transitions as the bacterium adapts to conditions within its host cell. Finally, analysis with a Transcriptional Regulatory Network model revealed linked genetic networks whereby M. tuberculosis coordinates global gene expression during intracellular survival. The integration of molecular and cellular biology together with transcriptional profiling and systems analysis offers unique insights into the host-driven responses of intracellular pathogens such as M. tuberculosis.

  20. Preliminary structural studies of the transcriptional regulator CmeR from Campylobacter jejuni

    Energy Technology Data Exchange (ETDEWEB)

    Su, Chih-Chia [Department of Biochemistry, Biophysics and Molecular Biology, Iowa State University, Ames, IA 50011 (United States); Shi, Feng [Department of Veterinary Microbiology, College of Veterinary Medicine, Iowa State University, Ames, IA 50011 (United States); Gu, Ruoyu; Li, Ming [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States); McDermott, Gerry [Department of Anatomy, School of Medicine, University of California, San Francisco, CA 94143 (United States); Yu, Edward W., E-mail: ewyu@iastate.edu [Department of Biochemistry, Biophysics and Molecular Biology, Iowa State University, Ames, IA 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States); Zhang, Qijing [Department of Veterinary Microbiology, College of Veterinary Medicine, Iowa State University, Ames, IA 50011 (United States); Department of Biochemistry, Biophysics and Molecular Biology, Iowa State University, Ames, IA 50011 (United States)

    2007-01-01

    The transcriptional regulator CmeR from C. jejuni has been purified and crystallized and X-ray diffraction data have been collected to a resolution of 2.2 Å. In Campylobacter jejuni, a Gram-negative bacterial pathogen causing gastroenteritis in humans, the CmeR regulatory protein controls transcription of the multidrug transporter gene operon cmeABC. CmeR belongs to the TetR family of transcriptional regulators. The 210-residue CmeR consists of two functional motifs: an N-terminal DNA-binding domain and a C-terminal ligand-binding domain. It is predicted that the DNA-binding domain interacts directly with target promoters, while the C-terminal motif interacts with inducing ligands (such as bile salts). As an initial step towards confirming this structural model, recombinant CmeR protein containing a 6×His tag at the N-terminus was crystallized. Crystals of ligand-free CmeR belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 37.4, b = 57.6, c = 93.3 Å. Diffraction was observed to at least 2.2 Å at 100 K. Analysis of the detailed CmeR structure is currently in progress.

  1. Flow cytometric immunophenotyping of regulatory T cells in chronic lymphocytic leukemia: comparative assessment of various markers and use of novel antibody panel with CD127 as alternative to transcription factor FoxP3.

    Science.gov (United States)

    Dasgupta, Alakananda; Mahapatra, Manoranjan; Saxena, Renu

    2013-04-01

    This study analyzed the frequency of regulatory T cells (Tregs) in chronic lymphocytic leukemia (CLL) by multiparameter flow cytometric immunophenotyping. Patients showed significantly increased frequencies of Tregs as compared to controls, a significantly higher percentage than that identified by previous studies, possibly indicating a different prognosis of CLL in different parts of the world and, more precisely, a worse prognosis of CLL in the Indian population. A higher frequency of Tregs was also seen in advanced stage of disease with significantly reduced frequencies of Tregs in patients with CLL after chemotherapy. A significant proportion of CD127low/-FoxP3+ Tregs expressed only low levels of CD25. Thus, CD127 appears to be a better marker than CD25 for the identification of CD4+FoxP3+ T cells as potential Tregs. Our results suggest that the specificity and sensitivity of CD4+CD127low/- cells are comparable to those of CD4+FoxP3+, which is the gold standard, and can be used as an alternative. This novel flow cytometric antibody panel with fewer number of antibodies is cost-effective and can be used to enumerate Tregs in resource-limited settings.

  2. Steroidogenic impairment due to reduced ovarian transcription of cytochrome P450 side-chain-cleavage (P450scc) and steroidogenic acute regulatory protein (StAR) during experimental nephrotic syndrome.

    Science.gov (United States)

    Peña-Rico, Miguel; Guadalupe Ortiz-López, María; Camacho-Castillo, Luz; Cárdenas, Mario; Pedraza-Chaverri, José; Menjívar, Marta

    2006-07-10

    The nephrotic syndrome is a renal disease characterized by proteinuria, hypoproteinemia, edema and hyperlipidemia. It has been reported that female nephrotic rats are characterized by loss of the oestrus cycle, follicle atresia, low gonadotropin and steroid concentrations; particularly, undetectable estradiol levels. Therefore, to determine the mechanisms involved in the ovarian steroidogenesis impairment, in this present study we evaluated the ovarian expression of the essential steroidogenesis components: cytochrome P450 side cholesterol chain cleavage enzyme (P450scc) and steroidogenic acute regulatory protein (StAR). The experiments were conducted in the rat experimental model of nephrosis induced by puromycin aminonucleoside (PAN) and in control groups. The evaluation of the expression of P450scc and StAR mRNA were performed during the acute phase of nephrosis as well as after the exogenous administration of 1 or 4 doses of human chorionic gonadotrophin (hCG), or a daily dose of FSH or FSH+hCG for 10 days. In addition, serum hormone concentrations, intra-ovarian steroid content, and the reproductive capacity were determined. The results revealed a decreased expression of mRNA of P450scc enzyme and StAR during nephrosis, and eventhough they increased after gonadotropins treatment, they did not conduce to a normal cycling rat period or fertility recovery. This study demonstrates that the mechanism by which ovarian steroid biosynthesis is altered during acute nephrosis involves damage at the P450scc and StAR mRNA synthesis and processing.

  3. Screening Driving Transcription Factors in the Processing of Gastric Cancer

    Directory of Open Access Journals (Sweden)

    Guangzhong Xu

    2016-01-01

    Full Text Available Background. Construction of the transcriptional regulatory network can provide additional clues on the regulatory mechanisms and therapeutic applications in gastric cancer. Methods. Gene expression profiles of gastric cancer were downloaded from GEO database for integrated analysis. All of DEGs were analyzed by GO enrichment and KEGG pathway enrichment. Transcription factors were further identified and then a global transcriptional regulatory network was constructed. Results. By integrated analysis of the six eligible datasets (340 cases and 43 controls, a bunch of 2327 DEGs were identified, including 2100 upregulated and 227 downregulated DEGs. Functional enrichment analysis of DEGs showed that digestion was a significantly enriched GO term for biological process. Moreover, there were two important enriched KEGG pathways: cell cycle and homologous recombination. Furthermore, a total of 70 differentially expressed TFs were identified and the transcriptional regulatory network was constructed, which consisted of 566 TF-target interactions. The top ten TFs regulating most downstream target genes were BRCA1, ARID3A, EHF, SOX10, ZNF263, FOXL1, FEV, GATA3, FOXC1, and FOXD1. Most of them were involved in the carcinogenesis of gastric cancer. Conclusion. The transcriptional regulatory network can help researchers to further clarify the underlying regulatory mechanisms of gastric cancer tumorigenesis.

  4. Hypoxia-inducible factor (HIF)-1α and CCN2 form a regulatory circuit in hypoxic nucleus pulposus cells: CCN2 suppresses HIF-1α level and transcriptional activity.

    Science.gov (United States)

    Tran, Cassie M; Fujita, Nobuyuki; Huang, Bau-Lin; Ong, Jessica R; Lyons, Karen M; Shapiro, Irving M; Risbud, Makarand V

    2013-05-03

    The objective of the study was to investigate if hypoxia-inducible factor (HIF)-1α and connective tissue growth factor (CCN2) form a regulatory network in hypoxic nucleus pulposus (NP) cells. A decrease in CCN2 expression and proximal promoter activity was observed in NP cells after hypoxic culture. Analysis of both human and mouse CCN2 promoters using the JASPAR core database revealed the presence of putative hypoxia response elements. Transfection experiments showed that both promoter activities and CCN2 expression decreases in hypoxia in a HIF-1α-dependent fashion. Interestingly, deletion analysis and mutation of the hypoxia responsive elements individually or in combination resulted in no change in promoter activity in response to hypoxia or in response to HIF-1α, suggesting an indirect mode of regulation. Notably, silencing of endogenous CCN2 increased HIF-1α levels and its target gene expression, suggesting a role for CCN2 in controlling basal HIF-1α levels. On the other hand, treatment of cells with rCCN2 resulted in a decrease in the ability of HIF-1α transactivating domain to recruit co-activators and diminished target gene expression. Last, knockdown of CCN2 in NP cells results in a significant decrease in GAG synthesis and expression of AGGRECAN and COLLAGEN II. Immunohistochemical staining of intervertebral discs of Ccn2 null embryos shows a decrease in aggrecan. These findings reveal a negative feedback loop between CCN2 and HIF-1α in NP cells and demonstrate a role for CCN2 in maintaining matrix homeostasis in this tissue.

  5. Comparison of Transcription Factor Binding Site Models

    KAUST Repository

    Bhuyan, Sharifulislam

    2012-05-01

    Modeling of transcription factor binding sites (TFBSs) and TFBS prediction on genomic sequences are important steps to elucidate transcription regulatory mechanism. Dependency of transcription regulation on a great number of factors such as chemical specificity, molecular structure, genomic and epigenetic characteristics, long distance interaction, makes this a challenging problem. Different experimental procedures generate evidence that DNA-binding domains of transcription factors show considerable DNA sequence specificity. Probabilistic modeling of TFBSs has been moderately successful in identifying patterns from a family of sequences. In this study, we compare performances of different probabilistic models and try to estimate their efficacy over experimental TFBSs data. We build a pipeline to calculate sensitivity and specificity from aligned TFBS sequences for several probabilistic models, such as Markov chains, hidden Markov models, Bayesian networks. Our work, containing relevant statistics and evaluation for the models, can help researchers to choose the most appropriate model for the problem at hand.

  6. Regulatory Physiology

    Science.gov (United States)

    Lane, Helen W.; Whitson, Peggy A.; Putcha, Lakshmi; Baker, Ellen; Smith, Scott M.; Stewart, Karen; Gretebeck, Randall; Nimmagudda, R. R.; Schoeller, Dale A.; Davis-Street, Janis

    1999-01-01

    As noted elsewhere in this report, a central goal of the Extended Duration Orbiter Medical Project (EDOMP) was to ensure that cardiovascular and muscle function were adequate to perform an emergency egress after 16 days of spaceflight. The goals of the Regulatory Physiology component of the EDOMP were to identify and subsequently ameliorate those biochemical and nutritional factors that deplete physiological reserves or increase risk for disease, and to facilitate the development of effective muscle, exercise, and cardiovascular countermeasures. The component investigations designed to meet these goals focused on biochemical and physiological aspects of nutrition and metabolism, the risk of renal (kidney) stone formation, gastrointestinal function, and sleep in space. Investigations involved both ground-based protocols to validate proposed methods and flight studies to test those methods. Two hardware tests were also completed.

  7. The regulatory epicenter of miRNAs

    Indian Academy of Sciences (India)

    Based on our findings, we propose that the observed characteristic distribution of regulatory sites in precursor miRNA sequence regions could be critical inmiRNA transcription, processing, stability and formation and are important for therapeutic studies. Our findings also support the recently proposed theory of self-sufficient ...

  8. Analysis of regulatory networks constructed based on gene ...

    Indian Academy of Sciences (India)

    For pituitary adenoma-specific coexpressed genes, we integrated transcription factor (TF) and microRNA (miRNA) regulation to construct a complex regulatory network from the transcriptional and posttranscriptional perspectives. Network module analysis identified the synergistic regulation of genes by miRNAs and TFs in ...

  9. Parsing regulatory DNA: General tasks, techniques, and the ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    recruitment of the RNA polymerase that transcribes a messenger RNA molecule), or at the post-transcriptional level (by targeting the mRNA molecule). In recent years much attention has been paid to the post-transcriptional regulatory machinery in cells, mediated by RNA molecules. (for recent reviews, see He and Hannon ...

  10. Regulatory principles governing Salmonella and Yersinia virulence

    Science.gov (United States)

    Erhardt, Marc; Dersch, Petra

    2015-01-01

    Enteric pathogens such as Salmonella and Yersinia evolved numerous strategies to survive and proliferate in different environmental reservoirs and mammalian hosts. Deciphering common and pathogen-specific principles for how these bacteria adjust and coordinate spatiotemporal expression of virulence determinants, stress adaptation, and metabolic functions is fundamental to understand microbial pathogenesis. In order to manage sudden environmental changes, attacks by the host immune systems and microbial competition, the pathogens employ a plethora of transcriptional and post-transcriptional control elements, including transcription factors, sensory and regulatory RNAs, RNAses, and proteases, to fine-tune and control complex gene regulatory networks. Many of the contributing global regulators and the molecular mechanisms of regulation are frequently conserved between Yersinia and Salmonella. However, the interplay, arrangement, and composition of the control elements vary between these closely related enteric pathogens, which generate phenotypic differences leading to distinct pathogenic properties. In this overview we present common and different regulatory networks used by Salmonella and Yersinia to coordinate the expression of crucial motility, cell adhesion and invasion determinants, immune defense strategies, and metabolic adaptation processes. We highlight evolutionary changes of the gene regulatory circuits that result in different properties of the regulatory elements and how this influences the overall outcome of the infection process. PMID:26441883

  11. Dissimilatory Metabolism of Nitrogen Oxides in Bacteria:Comparative Reconstruction of Transcriptional Networks

    Energy Technology Data Exchange (ETDEWEB)

    Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.; Alm, EricJ.; Gelfand, Mikhail S.

    2005-09-01

    Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpR for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As the

  12. Dissimilatory metabolism of nitrogen oxides in bacteria: comparative reconstruction of transcriptional networks.

    Directory of Open Access Journals (Sweden)

    2005-10-01

    Full Text Available Bacterial response to nitric oxide (NO is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR, and NnrR; two-component systems NarXL and NarQP; NO-responsive activator NorR; and nitrite-sensitive repressor NsrR. Using comparative genomics approaches, we predict DNA-binding motifs for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA recognition motif. Highly conserved regulon HcpR for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria, including Clostridia, Thermotogales, and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides' metabolism, not only in most gamma- and beta-proteobacteria (including well-studied species such as Escherichia coli, but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding motif. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon also includes two nitrite-responsive loci, nipAB (hcp-hcr and nipC (dnrN, thus confirming the identity of the effector, i.e. nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include

  13. Mining and polishing of the treasure trove in the bacterial genus streptomyces.

    Science.gov (United States)

    Horinouchi, Sueharu

    2007-02-01

    The complex morphogenesis of the bacterial genus Streptomyces has made this genus a model prokaryote for study of multicellular differentiation, and its ability to produce a wide variety of secondary metabolites has made it an excellent supplier of biologically active substances, including antibiotics. This review summarizes our study of these two characteristics of Streptomyces, focusing on the A-factor regulatory cascade and work derived from the A-factor study. A microbial hormone, A-factor (2-isocapryloyl-3R-hydroxymethyl-gamma-butyrolactone), triggers morphological differentiation and secondary metabolism in Streptomyces griseus. The key steps in the A-factor regulatory cascade, including afsA, encoding the key enzyme for A-factor biosynthesis, arpA, encoding the A-factor receptor, and adpA, encoding a transcriptional activator, are elucidated. The target genes of the regulatory cascade include genes of various functions required for morphological development and secondary metabolite formation. The biosynthesis gene clusters for grixazone and hexahydroxyperylenequinone are examples. The former contains the enzymes for novel benzene ring formation and phenoxazinone formation, and the latter contains enzymes belonging to a type III polyketide synthase and a cytochrome P-450. Enzymes of various catalytic functions in Streptomyces are useful as members of an artificial gene cluster constructed in Escherichia coli for fermentative production of plant-specific flavonoids, including isoflavones and unnatural compounds.

  14. Multiple steps in the regulation of transcription-factor level and activity

    NARCIS (Netherlands)

    Calkhoven, CF; Ab, G

    1996-01-01

    This review focuses on the regulation of transcription factors, many of which are DNA-binding proteins that recognize cis-regulatory elements of target genes and are the most direct regulators of gene transcription. Transcription factors serve as integration centres of the different

  15. Uncovering transcriptional regulation of metabolism by using metabolic network topology

    DEFF Research Database (Denmark)

    Patil, Kiran Raosaheb; Nielsen, Jens

    2005-01-01

    therefore developed an algorithm that is based on hypothesis-driven data analysis to uncover the transcriptional regulatory architecture of metabolic networks. By using information on the metabolic network topology from genome-scale metabolic reconstruction, we show that it is possible to reveal patterns...... changes induced by complex regulatory mechanisms coordinating the activity of different metabolic pathways. It is difficult to map such global transcriptional responses by using traditional methods, because many genes in the metabolic network have relatively small changes at their transcription level. We...... in the metabolic network that follow a common transcriptional response. Thus, the algorithm enables identification of so-called reporter metabolites (metabolites around which the most significant transcriptional changes occur) and a set of connected genes with significant and coordinated response to genetic...

  16. Bacterial Biofilm Control by Perturbation of Bacterial Signaling Processes

    Directory of Open Access Journals (Sweden)

    Tim Holm Jakobsen

    2017-09-01

    Full Text Available The development of effective strategies to combat biofilm infections by means of either mechanical or chemical approaches could dramatically change today’s treatment procedures for the benefit of thousands of patients. Remarkably, considering the increased focus on biofilms in general, there has still not been invented and/or developed any simple, efficient and reliable methods with which to “chemically” eradicate biofilm infections. This underlines the resilience of infective agents present as biofilms and it further emphasizes the insufficiency of today’s approaches used to combat chronic infections. A potential method for biofilm dismantling is chemical interception of regulatory processes that are specifically involved in the biofilm mode of life. In particular, bacterial cell to cell signaling called “Quorum Sensing” together with intracellular signaling by bis-(3′-5′-cyclic-dimeric guanosine monophosphate (cyclic-di-GMP have gained a lot of attention over the last two decades. More recently, regulatory processes governed by two component regulatory systems and small non-coding RNAs have been increasingly investigated. Here, we review novel findings and potentials of using small molecules to target and modulate these regulatory processes in the bacterium Pseudomonas aeruginosa to decrease its pathogenic potential.

  17. Transcription of the T4 late genes

    OpenAIRE

    Geiduschek, E Peter; Kassavetis, George A

    2010-01-01

    Abstract This article reviews the current state of understanding of the regulated transcription of the bacteriophage T4 late genes, with a focus on the underlying biochemical mechanisms, which turn out to be unique to the T4-related family of phages or significantly different from other bacterial systems. The activator of T4 late transcription is the gene 45 protein (gp45), the sliding clamp of the T4 replisome. Gp45 becomes topologically linked to DNA through the action of its clamp-loader, ...

  18. A Phase Separation Model for Transcriptional Control.

    Science.gov (United States)

    Hnisz, Denes; Shrinivas, Krishna; Young, Richard A; Chakraborty, Arup K; Sharp, Phillip A

    2017-03-23

    Phase-separated multi-molecular assemblies provide a general regulatory mechanism to compartmentalize biochemical reactions within cells. We propose that a phase separation model explains established and recently described features of transcriptional control. These features include the formation of super-enhancers, the sensitivity of super-enhancers to perturbation, the transcriptional bursting patterns of enhancers, and the ability of an enhancer to produce simultaneous activation at multiple genes. This model provides a conceptual framework to further explore principles of gene control in mammals. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Transcriptional regulation by Ferric Uptake Regulator (Fur in pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Hosni M Hassan

    2013-10-01

    Full Text Available In the ancient anaerobic environment, ferrous iron (Fe2+ was one of the first metal cofactors. Oxygenation of the ancient world challenged bacteria to acquire the insoluble ferric iron (Fe3+ and later to defend against reactive oxygen species (ROS generated by the Fenton chemistry. To acquire Fe3+, bacteria produce low-molecular weight compounds, known as siderophores, which have extremely high affinity for Fe3+. However, during infection the host restricts iron from pathogens by producing iron- and siderophore-chelating proteins, by exporting iron from intracellular pathogen-containing compartments, and by limiting absorption of dietary iron. Ferric Uptake Regulator (Fur is a transcription factor which utilizes Fe2+ as a corepressor and represses siderophore synthesis in pathogens. Fur, directly or indirectly, controls expression of enzymes that protect against ROS damage. Thus, the challenges of iron homeostasis and defense against ROS are addressed via Fur. Although the role of Fur as a repressor is well documented, emerging evidence demonstrates that Fur can function as an activator. Fur activation can occur through three distinct mechanisms 1 indirectly via small RNAs, 2 binding at cis regulatory elements that enhance recruitment of the RNA polymerase holoenzyme (RNAP, and 3 functioning as an antirepressor by removing or blocking DNA binding of a repressor of transcription. In addition, Fur homologs control defense against peroxide stress (PerR and control uptake of other metals such as zinc (Zur and manganese (Mur in pathogenic bacteria. Fur family members are important for virulence within bacterial pathogens since mutants of fur, perR, or zur exhibit reduced virulence within numerous animal and plant models of infection. This review focuses on the breadth of Fur regulation in pathogenic bacteria.

  20. Transcriptional regulation by Ferric Uptake Regulator (Fur) in pathogenic bacteria.

    Science.gov (United States)

    Troxell, Bryan; Hassan, Hosni M

    2013-01-01

    In the ancient anaerobic environment, ferrous iron (Fe(2+)) was one of the first metal cofactors. Oxygenation of the ancient world challenged bacteria to acquire the insoluble ferric iron (Fe(3+)) and later to defend against reactive oxygen species (ROS) generated by the Fenton chemistry. To acquire Fe(3+), bacteria produce low-molecular weight compounds, known as siderophores, which have extremely high affinity for Fe(3+). However, during infection the host restricts iron from pathogens by producing iron- and siderophore-chelating proteins, by exporting iron from intracellular pathogen-containing compartments, and by limiting absorption of dietary iron. Ferric Uptake Regulator (Fur) is a transcription factor which utilizes Fe(2+) as a corepressor and represses siderophore synthesis in pathogens. Fur, directly or indirectly, controls expression of enzymes that protect against ROS damage. Thus, the challenges of iron homeostasis and defense against ROS are addressed via Fur. Although the role of Fur as a repressor is well-documented, emerging evidence demonstrates that Fur can function as an activator. Fur activation can occur through three distinct mechanisms (1) indirectly via small RNAs, (2) binding at cis regulatory elements that enhance recruitment of the RNA polymerase holoenzyme (RNAP), and (3) functioning as an antirepressor by removing or blocking DNA binding of a repressor of transcription. In addition, Fur homologs control defense against peroxide stress (PerR) and control uptake of other metals such as zinc (Zur) and manganese (Mur) in pathogenic bacteria. Fur family members are important for virulence within bacterial pathogens since mutants of fur, perR, or zur exhibit reduced virulence within numerous animal and plant models of infection. This review focuses on the breadth of Fur regulation in pathogenic bacteria.

  1. A systems biology approach to construct the gene regulatory network of systemic inflammation via microarray and databases mining

    Directory of Open Access Journals (Sweden)

    Lan Chung-Yu

    2008-09-01

    Full Text Available Abstract Background Inflammation is a hallmark of many human diseases. Elucidating the mechanisms underlying systemic inflammation has long been an important topic in basic and clinical research. When primary pathogenetic events remains unclear due to its immense complexity, construction and analysis of the gene regulatory network of inflammation at times becomes the best way to understand the detrimental effects of disease. However, it is difficult to recognize and evaluate relevant biological processes from the huge quantities of experimental data. It is hence appealing to find an algorithm which can generate a gene regulatory network of systemic inflammation from high-throughput genomic studies of human diseases. Such network will be essential for us to extract valuable information from the complex and chaotic network under diseased conditions. Results In this study, we construct a gene regulatory network of inflammation using data extracted from the Ensembl and JASPAR databases. We also integrate and apply a number of systematic algorithms like cross correlation threshold, maximum likelihood estimation method and Akaike Information Criterion (AIC on time-lapsed microarray data to refine the genome-wide transcriptional regulatory network in response to bacterial endotoxins in the context of dynamic activated genes, which are regulated by transcription factors (TFs such as NF-κB. This systematic approach is used to investigate the stochastic interaction represented by the dynamic leukocyte gene expression profiles of human subject exposed to an inflammatory stimulus (bacterial endotoxin. Based on the kinetic parameters of the dynamic gene regulatory network, we identify important properties (such as susceptibility to infection of the immune system, which may be useful for translational research. Finally, robustness of the inflammatory gene network is also inferred by analyzing the hubs and "weak ties" structures of the gene network

  2. BACTERIAL PLASMIDS

    Directory of Open Access Journals (Sweden)

    Marina Dinic

    2007-12-01

    Full Text Available Plasmids, extrachromosomal DNA, were identified in bacteria pertaining to family of Enterobacteriacae for the very first time. After that, they were discovered in almost every single observed strain. The structure of plasmids is made of circular double chain DNA molecules which are replicated autonomously in a host cell. Their length may vary from few up to several hundred kilobase (kb. Among the bacteria, plasmids are mostly transferred horizontally by conjugation process. Plasmid replication process can be divided into three stages: initiation, elongation, and termination. The process involves DNA helicase I, DNA gyrase, DNA polymerase III, endonuclease, and ligase.Plasmids contain genes essential for plasmid function and their preservation in a host cell (the beginning and the control of replication. Some of them possess genes whichcontrol plasmid stability. There is a common opinion that plasmids are unnecessary fora growth of bacterial population and their vital functions; thus, in many cases they can be taken up or kicked out with no lethal effects to a plasmid host cell. However,there are numerous biological functions of bacteria related to plasmids. Plasmids identification and classification are based upon their genetic features which are presented permanently in all of them, and these are: abilities to preserve themselves in a host cell and to control a replication process. In this way, plasmids classification among incompatibility groups is performed. The method of replicon typing, which is based on genotype and not on phenotype characteristics, has the same results as in compatibility grouping.

  3. Transcriptional responses to sucrose mimic the plant-associated life style of the plant growth promoting endophyte Enterobacter sp. 638.

    Directory of Open Access Journals (Sweden)

    Safiyh Taghavi

    Full Text Available Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g., flagella biosynthesis and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.

  4. Transcriptional responses to sucrose mimic the plant-associated life style of the plant growth promoting endophyte Enterobacter sp. 638.

    Science.gov (United States)

    Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Zhang, Yian Biao; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

    2015-01-01

    Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g., flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.

  5. Monascus-fermented red mold dioscorea protects mice against alcohol-induced liver injury, whereas its metabolites ankaflavin and monascin regulate ethanol-induced peroxisome proliferator-activated receptor-γ and sterol regulatory element-binding transcription factor-1 expression in HepG2 cells.

    Science.gov (United States)

    Cheng, Chih-Fu; Pan, Tzu-Ming

    2018-03-01

    Alcoholic hepatitis is a necroinflammatory process that is associated with fibrosis and leads to cirrhosis in 40% of cases. The hepatoprotective effects of red mold dioscorea (RMD) from Monascus purpureus NTU 568 were evaluated in vivo using a mouse model of chronic alcohol-induced liver disease (ALD). ALD mice were orally administered vehicle (ALD group) or vehicle plus 307.5, 615.0 or 1537.5 mg kg -1 (1 ×, 2 × and 5 ×) RMD for 5 weeks. RMD lowered serum leptin, hepatic total cholesterol, free fatty acid and hepatic triglyceride levels and increased serum adiponectin, hepatic alcohol dehydrogenase and antioxidant enzyme levels. Furthermore, ankaflavin (AK) and monascin (MS), metabolites of RMD fermented with M. purpureus 568, induced peroxisome proliferator-activated receptor-γ expression and the concomitant suppression of ethanol-induced elevation of sterol regulatory element-binding transcription factor-1 and TG in HepG2 cells. These results indicate the hepatoprotective effect of Monascus-fermented RMD. Moreover, AK and MS were identified as the active constituents of RMD for the first time and were shown to protect against ethanol-induced liver damage. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  6. Multilocus analysis of extracellular putative virulence proteins made by group A Streptococcus: population genetics, human serologic response, and gene transcription.

    Science.gov (United States)

    Reid, S D; Green, N M; Buss, J K; Lei, B; Musser, J M

    2001-06-19

    Species of pathogenic microbes are composed of an array of evolutionarily distinct chromosomal genotypes characterized by diversity in gene content and sequence (allelic variation). The occurrence of substantial genetic diversity has hindered progress in developing a comprehensive understanding of the molecular basis of virulence and new therapeutics such as vaccines. To provide new information that bears on these issues, 11 genes encoding extracellular proteins in the human bacterial pathogen group A Streptococcus identified by analysis of four genomes were studied. Eight of the 11 genes encode proteins with a LPXTG(L) motif that covalently links Gram-positive virulence factors to the bacterial cell surface. Sequence analysis of the 11 genes in 37 geographically and phylogenetically diverse group A Streptococcus strains cultured from patients with different infection types found that recent horizontal gene transfer has contributed substantially to chromosomal diversity. Regions of the inferred proteins likely to interact with the host were identified by molecular population genetic analysis, and Western immunoblot analysis with sera from infected patients confirmed that they were antigenic. Real-time reverse transcriptase-PCR (TaqMan) assays found that transcription of six of the 11 genes was substantially up-regulated in the stationary phase. In addition, transcription of many genes was influenced by the covR and mga trans-acting gene regulatory loci. Multilocus investigation of putative virulence genes by the integrated approach described herein provides an important strategy to aid microbial pathogenesis research and rapidly identify new targets for therapeutics research.

  7. Ranges of control in the transcriptional regulation of Escherichia coli.

    Science.gov (United States)

    Sonnenschein, Nikolaus; Hütt, Marc-Thorsten; Stoyan, Helga; Stoyan, Dietrich

    2009-12-24

    The positioning of genes in the genome is an important evolutionary degree of freedom for organizing gene regulation. Statistical properties of these distributions have been studied particularly in relation to the transcriptional regulatory network. The systematics of gene-gene distances then become important sources of information on the control, which different biological mechanisms exert on gene expression. Here we study a set of categories, which has to our knowledge not been analyzed before. We distinguish between genes that do not participate in the transcriptional regulatory network (i.e. that are according to current knowledge not producing transcription factors and do not possess binding sites for transcription factors in their regulatory region), and genes that via transcription factors either are regulated by or regulate other genes. We find that the two types of genes ("isolated" and "regulatory" genes) show a clear statistical repulsion and have different ranges of correlations. In particular we find that isolated genes have a preference for shorter intergenic distances. These findings support previous evidence from gene expression patterns for two distinct logical types of control, namely digital control (i.e. network-based control mediated by dedicated transcription factors) and analog control (i.e. control based on genome structure and mediated by neighborhood on the genome).

  8. eRNAs promote transcription by establishing chromatin accessibility at defined genomic loci

    DEFF Research Database (Denmark)

    Mousavi, Kambiz; Zare, Hossein; Dell'orso, Stefania

    2013-01-01

    Transcription factors and DNA regulatory binding motifs are fundamental components of the gene regulatory network. Here, by using genome-wide binding profiling, we show extensive occupancy of transcription factors of myogenesis (MyoD and Myogenin) at extragenic enhancer regions coinciding with RNA...... synthesis (i.e., eRNA). In particular, multiple regions were transcribed to eRNA within the regulatory region of MYOD1, including previously characterized distal regulatory regions (DRR) and core enhancer (CE). While (CE)RNA enhanced RNA polymerase II (Pol II) occupancy and transcription at MYOD1, (DRR)RNA...... acted to activate the downstream myogenic genes. The deployment of transcriptional machinery to appropriate loci is contingent on chromatin accessibility, a rate-limiting step preceding Pol II assembly. By nuclease sensitivity assay, we found that eRNAs regulate genomic access of the transcriptional...

  9. Theory of site-specific interactions of the combinatorial transcription factors with DNA

    International Nuclear Information System (INIS)

    Murugan, R

    2010-01-01

    We derive a functional relationship between the mean first passage time associated with the concurrent binding of multiple transcription factors (TFs) at their respective combinatorial cis-regulatory module sites (CRMs) and the number n of TFs involved in the regulation of the initiation of transcription of a gene of interest. Our results suggest that the overall search time τ s that is required by the n TFs to locate their CRMs which are all located on the same DNA chain scales with n as τ s ∼n α where α ∼ (2/5). When the jump size k that is associated with the dynamics of all the n TFs along DNA is higher than that of the critical jump size k c that scales with the size of DNA N as k c ∼ N 2/3 , we observe a similar power law scaling relationship and also the exponent α. When k c , α shows a strong dependence on both n and k. Apparently there is a critical number of combinatorial TFs n c ∼ 20 that is required to efficiently regulate the initiation of transcription of a given gene below which (2/5) 1. These results seem to be independent of the initial distances between the TFs and their corresponding CRMs and also suggest that the maximum number of TFs involved in a given combinatorial regulation of the initiation of transcription of a gene of interest seems to be restricted by the degree of condensation of the genomic DNA. The optimum number m opt of roadblock protein molecules per genome at which the search time associated with these n TFs to locate their binding sites is a minimum seems to scale as m opt ∼Ln α/2 where L is the sliding length of TFs whose maximum value seems to be such that L ≤ 10 4 bps for the E. coli bacterial genome.

  10. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.

    Directory of Open Access Journals (Sweden)

    Amanda Malvessi Cattani

    Full Text Available Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.

  11. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.

    Science.gov (United States)

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.

  12. The bacterial enhancer-dependent RNA polymerase.

    Science.gov (United States)

    Zhang, Nan; Darbari, Vidya C; Glyde, Robert; Zhang, Xiaodong; Buck, Martin

    2016-11-01

    Transcription initiation is highly regulated in bacterial cells, allowing adaptive gene regulation in response to environment cues. One class of promoter specificity factor called sigma54 enables such adaptive gene expression through its ability to lock the RNA polymerase down into a state unable to melt out promoter DNA for transcription initiation. Promoter DNA opening then occurs through the action of specialized transcription control proteins called bacterial enhancer-binding proteins (bEBPs) that remodel the sigma54 factor within the closed promoter complexes. The remodelling of sigma54 occurs through an ATP-binding and hydrolysis reaction carried out by the bEBPs. The regulation of bEBP self-assembly into typically homomeric hexamers allows regulated gene expression since the self-assembly is required for bEBP ATPase activity and its direct engagement with the sigma54 factor during the remodelling reaction. Crystallographic studies have now established that in the closed promoter complex, the sigma54 factor occupies the bacterial RNA polymerase in ways that will physically impede promoter DNA opening and the loading of melted out promoter DNA into the DNA-binding clefts of the RNA polymerase. Large-scale structural re-organizations of sigma54 require contact of the bEBP with an amino-terminal glutamine and leucine-rich sequence of sigma54, and lead to domain movements within the core RNA polymerase necessary for making open promoter complexes and synthesizing the nascent RNA transcript. © 2016 The Author(s).

  13. mRNA Transcript Diversity Creates New Opportunities for Pharmacological Intervention

    OpenAIRE

    Barrie, Elizabeth S.; Smith, Ryan M.; Sanford, Jonathan C.; Sadee, Wolfgang

    2012-01-01

    Most protein coding genes generate multiple RNA transcripts through alternative splicing, variable 3′ and 5′UTRs, and RNA editing. Although drug design typically targets the main transcript, alternative transcripts can have profound physiological effects, encoding proteins with distinct functions or regulatory properties. Formation of these alternative transcripts is tissue-selective and context-dependent, creating opportunities for more effective and targeted therapies with reduced adverse e...

  14. Lineage-specific partitions in archaeal transcription

    Directory of Open Access Journals (Sweden)

    Richard M. R. Coulson

    2006-01-01

    Full Text Available The phylogenetic distribution of the components comprising the transcriptional machinery in the crenarchaeal and euryarchaeal lineages of the Archaea was analyzed in a systematic manner by genome-wide profiling of transcription complements in fifteen complete archaeal genome sequences. Initially, a reference set of transcription-associated proteins (TAPs consisting of sequences functioning in all aspects of the transcriptional process, and originating from the three domains of life, was used to query the genomes. TAP-families were detected by sequence clustering of the TAPs and their archaeal homologues, and through extensive database searching, these families were assigned a function. The phylogenetic origins of archaeal genes matching hidden Markov model profiles of protein domains associated with transcription, and those encoding the TAP-homologues, showed there is extensive lineage-specificity of proteins that function as regulators of transcription: most of these sequences are present solely in the Euryarchaeota, with nearly all of them homologous to bacterial DNA-binding proteins. Strikingly, the hidden Markov model profile searches revealed that archaeal chromatin and histone-modifying enzymes also display extensive taxon-restrictedness, both across and within the two phyla.

  15. Thermodynamics-based models of transcriptional regulation with gene sequence.

    Science.gov (United States)

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  16. HIV-1 reverse transcription.

    Science.gov (United States)

    Hu, Wei-Shau; Hughes, Stephen H

    2012-10-01

    Reverse transcription and integration are the defining features of the Retroviridae; the common name "retrovirus" derives from the fact that these viruses use a virally encoded enzyme, reverse transcriptase (RT), to convert their RNA genomes into DNA. Reverse transcription is an essential step in retroviral replication. This article presents an overview of reverse transcription, briefly describes the structure and function of RT, provides an introduction to some of the cellular and viral factors that can affect reverse transcription, and discusses fidelity and recombination, two processes in which reverse transcription plays an important role. In keeping with the theme of the collection, the emphasis is on HIV-1 and HIV-1 RT.

  17. Regulation of bacterial virulence by Csr (Rsm) systems.

    Science.gov (United States)

    Vakulskas, Christopher A; Potts, Anastasia H; Babitzke, Paul; Ahmer, Brian M M; Romeo, Tony

    2015-06-01

    Most bacterial pathogens have the remarkable ability to flourish in the external environment and in specialized host niches. This ability requires their metabolism, physiology, and virulence factors to be responsive to changes in their surroundings. It is no surprise that the underlying genetic circuitry that supports this adaptability is multilayered and exceedingly complex. Studies over the past 2 decades have established that the CsrA/RsmA proteins, global regulators of posttranscriptional gene expression, play important roles in the expression of virulence factors of numerous proteobacterial pathogens. To accomplish these tasks, CsrA binds to the 5' untranslated and/or early coding regions of mRNAs and alters translation, mRNA turnover, and/or transcript elongation. CsrA activity is regulated by noncoding small RNAs (sRNAs) that contain multiple CsrA binding sites, which permit them to sequester multiple CsrA homodimers away from mRNA targets. Environmental cues sensed by two-component signal transduction systems and other regulatory factors govern the expression of the CsrA-binding sRNAs and, ultimately, the effects of CsrA on secretion systems, surface molecules and biofilm formation, quorum sensing, motility, pigmentation, siderophore production, and phagocytic avoidance. This review presents the workings of the Csr system, the paradigm shift that it generated for understanding posttranscriptional regulation, and its roles in virulence networks of animal and plant pathogens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Quick change: post-transcriptional regulation in Pseudomonas.

    Science.gov (United States)

    Grenga, Lucia; Little, Richard H; Malone, Jacob G

    2017-08-01

    Pseudomonas species have evolved dynamic and intricate regulatory networks to fine-tune gene expression, with complex regulation occurring at every stage in the processing of genetic information. This approach enables Pseudomonas to generate precise individual responses to the environment in order to improve their fitness and resource economy. The weak correlations we observe between RNA and protein abundance highlight the significant regulatory contribution of a series of intersecting post-transcriptional pathways, influencing mRNA stability, translational activity and ribosome function, to Pseudomonas environmental responses. This review examines our current understanding of three major post-transcriptional regulatory systems in Pseudomonas spp.; Gac/Rsm, Hfq and RimK, and presents an overview of new research frontiers, emerging genome-wide methodologies, and their potential for the study of global regulatory responses in Pseudomonas. © FEMS 2017.

  19. Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells.

    Directory of Open Access Journals (Sweden)

    Colin R Lickwar

    2017-08-01

    Full Text Available The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development

  20. The bacterial two-hybrid system uncovers the involvement of acetylation in regulating of Lrp activity in Salmonella Typhimurium

    Directory of Open Access Journals (Sweden)

    Ran Qin

    2016-11-01

    Full Text Available Nε-lysine acetylation is an abundant and important Post-translational modification in bacteria. We used the bacterial two-hybrid system to screen the genome library of the Salmonella Typhimurium to identify potential proteins involved in acetyltransferase Pat - or deacetylase CobB-mediated acetylation. Then, the in vitro (deacetylation assays were used to validate the potential targets, such as STM14_1074, NrdF, RhaR. Lrp, a leucine-responsive regulatory protein and global regulator, was shown to interact with Pat. We further demonstrate that Lrp could be acetylated by Pat and deacetylated by NAD+-dependent CobB in vitro. Specifically, the conserved lysine residue 36 (K36 in helix-turn-helix (HTH DNA-binding domain of Lrp was acetylated. Acetylation of K36 impaired the function of Lrp through altering the affinity with the target promoter. The mutation of K36 in chromosome mimicking acetylation enhanced the transcriptional level of itself and attenuated the mRNA levels of Lrp-regulated genes including fimA, which was confirmed by yeast agglutination assay. These findings demonstrate that the acetylation regulates the DNA-binding activity of Lrp, suggesting that acetylation modification of transcription factors is a conserved regulatory manner to modulate gene expression in bacteria and eukaryotes.

  1. Statistical significance of cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Smith Andrew D

    2007-01-01

    Full Text Available Abstract Background It is becoming increasingly important for researchers to be able to scan through large genomic regions for transcription factor binding sites or clusters of binding sites forming cis-regulatory modules. Correspondingly, there has been a push to develop algorithms for the rapid detection and assessment of cis-regulatory modules. While various algorithms for this purpose have been introduced, most are not well suited for rapid, genome scale scanning. Results We introduce methods designed for the detection and statistical evaluation of cis-regulatory modules, modeled as either clusters of individual binding sites or as combinations of sites with constrained organization. In order to determine the statistical significance of module sites, we first need a method to determine the statistical significance of single transcription factor binding site matches. We introduce a straightforward method of estimating the statistical significance of single site matches using a database of known promoters to produce data structures that can be used to estimate p-values for binding site matches. We next introduce a technique to calculate the statistical significance of the arrangement of binding sites within a module using a max-gap model. If the module scanned for has defined organizational parameters, the probability of the module is corrected to account for organizational constraints. The statistical significance of single site matches and the architecture of sites within the module can be combined to provide an overall estimation of statistical significance of cis-regulatory module sites. Conclusion The methods introduced in this paper allow for the detection and statistical evaluation of single transcription factor binding sites and cis-regulatory modules. The features described are implemented in the Search Tool for Occurrences of Regulatory Motifs (STORM and MODSTORM software.

  2. Dataset of transcriptional landscape of B cell early activation

    Directory of Open Access Journals (Sweden)

    Alexander S. Garruss

    2015-09-01

    Full Text Available Signaling via B cell receptors (BCR and Toll-like receptors (TLRs result in activation of B cells with distinct physiological outcomes, but transcriptional regulatory mechanisms that drive activation and distinguish these pathways remain unknown. At early time points after BCR and TLR ligand exposure, 0.5 and 2 h, RNA-seq was performed allowing observations on rapid transcriptional changes. At 2 h, ChIP-seq was performed to allow observations on important regulatory mechanisms potentially driving transcriptional change. The dataset includes RNA-seq, ChIP-seq of control (Input, RNA Pol II, H3K4me3, H3K27me3, and a separate RNA-seq for miRNA expression, which can be found at Gene Expression Omnibus Dataset GSE61608. Here, we provide details on the experimental and analysis methods used to obtain and analyze this dataset and to examine the transcriptional landscape of B cell early activation.

  3. RNA synthetic biology inspired from bacteria: construction of transcription attenuators under antisense regulation

    International Nuclear Information System (INIS)

    Dawid, Alexandre; Cayrol, Bastien; Isambert, Hervé

    2009-01-01

    Among all biopolymers, ribonucleic acids or RNA have unique functional versatility, which led to the early suggestion that RNA alone (or a closely related biopolymer) might have once sustained a primitive form of life based on a single type of biopolymer. This has been supported by the demonstration of processive RNA-based replication and the discovery of 'riboswitches' or RNA switches, which directly sense their metabolic environment. In this paper, we further explore the plausibility of this 'RNA world' scenario and show, through synthetic molecular design guided by advanced RNA simulations, that RNA can also perform elementary regulation tasks on its own. We demonstrate that RNA synthetic regulatory modules directly inspired from bacterial transcription attenuators can efficiently activate or repress the expression of other RNA by merely controlling their folding paths 'on the fly' during transcription through simple RNA–RNA antisense interaction. Factors, such as NTP concentration and RNA synthesis rate, affecting the efficiency of this kinetic regulation mechanism are also studied and discussed in the light of evolutionary constraints. Overall, this suggests that direct coupling among synthesis, folding and regulation of RNAs may have enabled the early emergence of autonomous RNA-based regulation networks in absence of both DNA and protein partners

  4. RNA synthetic biology inspired from bacteria: construction of transcription attenuators under antisense regulation.

    Science.gov (United States)

    Dawid, Alexandre; Cayrol, Bastien; Isambert, Hervé

    2009-07-01

    Among all biopolymers, ribonucleic acids or RNA have unique functional versatility, which led to the early suggestion that RNA alone (or a closely related biopolymer) might have once sustained a primitive form of life based on a single type of biopolymer. This has been supported by the demonstration of processive RNA-based replication and the discovery of 'riboswitches' or RNA switches, which directly sense their metabolic environment. In this paper, we further explore the plausibility of this 'RNA world' scenario and show, through synthetic molecular design guided by advanced RNA simulations, that RNA can also perform elementary regulation tasks on its own. We demonstrate that RNA synthetic regulatory modules directly inspired from bacterial transcription attenuators can efficiently activate or repress the expression of other RNA by merely controlling their folding paths 'on the fly' during transcription through simple RNA-RNA antisense interaction. Factors, such as NTP concentration and RNA synthesis rate, affecting the efficiency of this kinetic regulation mechanism are also studied and discussed in the light of evolutionary constraints. Overall, this suggests that direct coupling among synthesis, folding and regulation of RNA