WorldWideScience

Sample records for bacterial inhibition mechanical

  1. Structural insights into the inhibition mechanism of bacterial toxin LsoA by bacteriophage antitoxin Dmd.

    Science.gov (United States)

    Wan, Hua; Otsuka, Yuichi; Gao, Zeng-Qiang; Wei, Yong; Chen, Zhen; Masuda, Michiaki; Yonesaki, Tetsuro; Zhang, Heng; Dong, Yu-Hui

    2016-09-01

    Bacteria have obtained a variety of resistance mechanisms including toxin-antitoxin (TA) systems against bacteriophages (phages), whereas phages have also evolved to overcome bacterial anti-phage mechanisms. Dmd from T4 phage can suppress the toxicities of homologous toxins LsoA and RnlA from Escherichia coli, representing the first example of a phage antitoxin against multiple bacterial toxins in known TA systems. Here, the crystal structure of LsoA-Dmd complex showed Dmd is inserted into the deep groove between the N-terminal repeated domain (NRD) and the Dmd-binding domain (DBD) of LsoA. The NRD shifts significantly from a 'closed' to an 'open' conformation upon Dmd binding. Site-directed mutagenesis of Dmd revealed the conserved residues (W31 and N40) are necessary for LsoA binding and the toxicity suppression as determined by pull-down and cell toxicity assays. Further mutagenesis identified the conserved Dmd-binding residues (R243, E246 and R305) of LsoA are vital for its toxicity, and suggested Dmd and LsoB may possess different inhibitory mechanisms against LsoA toxicity. Our structure-function studies demonstrate Dmd can recognize LsoA and inhibit its toxicity by occupying the active site possibly via substrate mimicry. These findings have provided unique insights into the defense and counter-defense mechanisms between bacteria and phages in their co-evolution. © 2016 John Wiley & Sons Ltd.

  2. Influence of silver additions to type 316 stainless steels on bacterial inhibition, mechanical properties, and corrosion resistance

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Tseng, I-Sheng; Møller, Per

    2010-01-01

    techniques. The microstructure of these 316 stainless steels was examined, and the influences of silver additions to 316 stainless steels on bacterial inhibition, mechanical properties, and corrosion resistance were investigated. This study suggested that silver-bearing 316 stainless steels could be used......Bacterial contamination is a major concern in many areas. In this study, silver was added to type 316 stainless steels in order to obtain an expected bacteria inhibiting property to reduce the occurrence of bacterial contamination. Silver-bearing 316 stainless steels were prepared by vacuum melting...

  3. MECHANISM OF ACTION OF ANTIBIOTICS WHICH INHIBIT SYNTHESIS OF BACTERIAL CELL WALL

    Directory of Open Access Journals (Sweden)

    Indira Mujezinović

    2013-03-01

    Full Text Available Bacterial cell possess a cell wall, which is a main difference from mammalian cells. Its basic function is to provide the strength of bacteria, keeps its shape and provides an unusually high internal osmotic pressure. Synthesis of (construction of bacterial cell wall occurs in at least three phases. All of these three phases can be influence by a variety of antibiotics in way to inhibit its synthesis. The most important drugs that act in this manner are ß-lactam antibiotics (penicillins, cephalosporins, cephamycins and other ß-lactams. They interfere with the synthesis of the bacterial cell wall peptidoglycan. After attachment to penicillin binding proteins (PBP on bacteria, they inhibit the transpeptidation enzyme that cross-links the peptide chain attached to the backbone of the peptidoglycan. The final bactericidal event is the inactivation of an inhibitor of autolytic enzymes in the cell wall, wich leads to lysis of the bacteria. Vancomycin inhibits the release of the building block unit from the carrier, thus preventing its addition to the growing end of the peptidoglycan. Cycloserine, which is a structural analogue of D-alanine, prevents the addition of the two terminal alanine residue to the initial tripeptide side-chain on N-acetylmuramic acid by competitive inhibition. Bacitracin interferes with the regeneration of the lipid carrier by blocking its dephosphorylation. Key words: bacterial cell wall, paptidoglycan, antibiotics, ß-lactams

  4. Influence of silver additions to type 316 stainless steels on bacterial inhibition, mechanical properties, and corrosion resistance

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Tseng, I-Sheng; Møller, Per

    2010-01-01

    Bacterial contamination is a major concern in many areas. In this study, silver was added to type 316 stainless steels in order to obtain an expected bacteria inhibiting property to reduce the occurrence of bacterial contamination. Silver-bearing 316 stainless steels were prepared by vacuum melting...... techniques. The microstructure of these 316 stainless steels was examined, and the influences of silver additions to 316 stainless steels on bacterial inhibition, mechanical properties, and corrosion resistance were investigated. This study suggested that silver-bearing 316 stainless steels could be used...... in areas where hygiene is a major requirement. The possible mechanisms of silver dissolution from the surfaces of silver-bearing 316 stainless steels were also discussed in this report....

  5. Anthocyanin Incorporated Dental Copolymer: Bacterial Growth Inhibition, Mechanical Properties, and Compound Release Rates and Stability by 1H NMR

    Directory of Open Access Journals (Sweden)

    Halyna Hrynash

    2014-01-01

    Full Text Available Objective. To evaluate bacterial growth inhibition, mechanical properties, and compound release rate and stability of copolymers incorporated with anthocyanin (ACY; Vaccinium macrocarpon. Methods. Resin samples were prepared (Bis-GMA/TEGDMA at 70/30 mol% and incorporated with 2 w/w% of either ACY or chlorhexidine (CHX, except for the control group. Samples were individually immersed in a bacterial culture (Streptococcus mutans for 24 h. Cell viability (n=3 was assessed by counting the number of colony forming units on replica agar plates. Flexural strength (FS and elastic modulus (E were tested on a universal testing machine (n=8. Compound release and chemical stability were evaluated by UV spectrophotometry and 1H NMR (n=3. Data were analyzed by one-way ANOVA and Tukey’s test (α = 0.05. Results. Both compounds inhibited S. mutans growth, with CHX being most effective (P<0.05. Control resin had the lowest FS and E values, followed by ACY and CHX, with statistical difference between control and CHX groups for both mechanical properties (P<0.05. The 24 h compound release rates were ACY: 1.33 μg/mL and CHX: 1.92 μg/mL. 1H NMR spectra suggests that both compounds remained stable after being released in water. Conclusion. The present findings indicate that anthocyanins might be used as a natural antibacterial agent in resin based materials.

  6. Insights into the mechanism of inhibition of novel bacterial topoisomerase inhibitors from characterization of resistant mutants of Staphylococcus aureus.

    Science.gov (United States)

    Lahiri, Sushmita D; Kutschke, Amy; McCormack, Kathy; Alm, Richard A

    2015-09-01

    The type II topoisomerases DNA gyrase and topoisomerase IV are clinically validated bacterial targets that catalyze the modulation of DNA topology that is vital to DNA replication, repair, and decatenation. Increasing resistance to fluoroquinolones, which trap the topoisomerase-DNA complex, has led to significant efforts in the discovery of novel inhibitors of these targets. AZ6142 is a member of the class of novel bacterial topoisomerase inhibitors (NBTIs) that utilizes a distinct mechanism to trap the protein-DNA complex. AZ6142 has very potent activity against Gram-positive organisms, including Staphylococcus aureus, Streptococcus pneumoniae, and Streptococcus pyogenes. In this study, we determined the frequencies of resistance to AZ6142 and other representative NBTI compounds in S. aureus and S. pneumoniae. The frequencies of selection of resistant mutants at 4× the MIC were 1.7 × 10(-8) for S. aureus and topoisomerase subunits were identified. Many of these substitutions were located outside the NBTI binding pocket and impact the susceptibility of AZ6142, resulting in a 4- to 32-fold elevation in the MIC over the wild-type parent strain. Data on cross-resistance with other NBTIs and fluoroquinolones enabled the differentiation of scaffold-specific changes from compound-specific variations. Our results suggest that AZ6142 inhibits both type II topoisomerases in S. aureus but that DNA gyrase is the primary target. Further, the genotype of the resistant mutants suggests that domain conformations and DNA interactions may uniquely impact NBTIs compared to fluoroquinolones. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Bacterial Cell Mechanics.

    Science.gov (United States)

    Auer, George K; Weibel, Douglas B

    2017-07-25

    Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.

  8. MECHANISMS OF BACTERIAL POLYHOSTALITY

    Directory of Open Access Journals (Sweden)

    Markova Yu.A.

    2007-12-01

    Full Text Available In the review data about factors of pathogenicity of the bacteria, capable to amaze both animals, and a plant are collected. Such properties of microorganisms as adhesion, secretion of some enzymes, mobility, a phenomenon of cooperative sensitivity - play an essential role at defeat of different organisms. They are used for many universal offensive strategy overcoming protection of an organism, irrespective of its evolutionary origin. Studying of these mechanisms, will allow to provide new approaches to monitoring illnesses.

  9. Molecular mechanisms underlying bacterial persisters

    DEFF Research Database (Denmark)

    Maisonneuve, Etienne; Gerdes, Kenn

    2014-01-01

    All bacteria form persisters, cells that are multidrug tolerant and therefore able to survive antibiotic treatment. Due to the low frequencies of persisters in growing bacterial cultures and the complex underlying molecular mechanisms, the phenomenon has been challenging to study. However, recent...

  10. Menaquinone analogs inhibit growth of bacterial pathogens.

    Science.gov (United States)

    Schlievert, Patrick M; Merriman, Joseph A; Salgado-Pabón, Wilmara; Mueller, Elizabeth A; Spaulding, Adam R; Vu, Bao G; Chuang-Smith, Olivia N; Kohler, Petra L; Kirby, John R

    2013-11-01

    Gram-positive bacteria cause serious human illnesses through combinations of cell surface and secreted virulence factors. We initiated studies with four of these organisms to develop novel topical antibacterial agents that interfere with growth and exotoxin production, focusing on menaquinone analogs. Menadione, 1,4-naphthoquinone, and coenzymes Q1 to Q3 but not menaquinone, phylloquinone, or coenzyme Q10 inhibited the growth and to a greater extent exotoxin production of Staphylococcus aureus, Bacillus anthracis, Streptococcus pyogenes, and Streptococcus agalactiae at concentrations of 10 to 200 μg/ml. Coenzyme Q1 reduced the ability of S. aureus to cause toxic shock syndrome in a rabbit model, inhibited the growth of four Gram-negative bacteria, and synergized with another antimicrobial agent, glycerol monolaurate, to inhibit S. aureus growth. The staphylococcal two-component system SrrA/B was shown to be an antibacterial target of coenzyme Q1. We hypothesize that menaquinone analogs both induce toxic reactive oxygen species and affect bacterial plasma membranes and biosynthetic machinery to interfere with two-component systems, respiration, and macromolecular synthesis. These compounds represent a novel class of potential topical therapeutic agents.

  11. Mechanisms of bacterially catalyzed reductive dehalogenation

    Energy Technology Data Exchange (ETDEWEB)

    Picardal, Flynn William [Univ. of Arizona, Tucson, AZ (United States)

    1992-01-01

    Nine bacteria were tested for the ability to dehalogenate tetrachloromethane (CT), tetrachloroethene (PCE), and 1, 1, 1-trichloroethane (TCA) under anaerobic conditions. Three bacteria were able to reductively dehalogenate CT. Dehalogenation ability was not readily linked to a common metabolism or changes in culture redox potential. None of the bacteria tested were able to dehalogenate PCE or TCA. One of the bacteria capable of dehalogenating CT, Shewanella putrefaciens, was chosen as a model organism to study mechanisms of bacterially catalyzed reductive dehalogenation. The effect of a variety of alternate electron acceptors on CT dehalogenation ability by S. putrefaciens was determined. oxygen and nitrogen oxides were inhibitory but Fe (III), trimethylamine oxide, and fumarate were not. A model of the electron transport chain of S. putrefaciens was developed to explain inhibition patterns. A period of microaerobic growth prior to CT exposure increased the ability of S. putrefaciens to dehalogenate CT. A microaerobic growth period also increased cytochrome concentrations. A relationship between cytochrome content and dehalogenation ability was developed from studies in which cytochrome concentrations in S. putrefaciens were manipulated by changing growth conditions. Stoichiometry studies using 14C-CT suggested that CT was first reduced to form a trichloromethyl radical. Reduction of the radical to produce chloroform and reaction of the radical with cellular biochemicals explained observed product distributions. Carbon dioxide or other fully dehalogenated products were not found.

  12. Inhibition of bacterial quorum sensing by vanilla extract.

    Science.gov (United States)

    Choo, J H; Rukayadi, Y; Hwang, J-K

    2006-06-01

    The purpose of this study was to search for a novel quorum sensing inhibitor and analyse its inhibitory activity. Quorum sensing inhibition was monitored using the Tn-5 mutant, Chromobacterium violaceum CV026. Vanilla beans (Vanilla planifolia Andrews) were extracted using 75% (v/v) aqueous methanol and added to C. violaceum CV026 cultures. Inhibitory activity was measured by quantifying violacein production using a spectrophotometer. The results have revealed that vanilla extract significantly reduced violacein production in a concentration-dependent manner, indicating inhibition of quorum sensing. Vanilla, a widely used spice and flavour, can inhibit bacterial quorum sensing. The results suggest that the intake of vanilla-containing food materials might promote human health by inhibiting quorum sensing and preventing bacterial pathogenesis. Further studies are required to isolate specific substances from vanilla extract acting as quorum sensing inhibitors.

  13. Molecular Mechanisms of Bacterial Pathogenicity

    Science.gov (United States)

    Fuchs, Thilo Martin

    Cautious optimism has arisen over recent decades with respect to the long struggle against bacteria, viruses, and parasites. This has been offset, however, by a fatal complacency stemming from previous successes such as the development of antimicrobial drugs, the eradication of smallpox, and global immunization programs. Infectious diseases nevertheless remain the world's leading cause of death, killing at least 17 million persons annually [61]. Diarrheal diseases caused by Vibrio cholerae or Shigella dysenteriae kill about 3 million persons every year, most of them young children: Another 4 million die of tuberculosis or tetanus. Outbreaks of diphtheria in Eastern Europe threatens the population with a disease that had previously seemed to be overcome. Efforts to control infectious diseases more comprehensively are undermined not only by socioeconomic conditions but also by the nature of the pathogenic organisms itself; some isolates of Staphylococcus aureus and Enterobacter have become so resistant to drugs by horizontal gene transfer that they are almost untreatable. In addition, the mechanism of genetic variability helps pathogens to evade the human immune system, thus compromising the development of powerful vaccines. Therefore detailed knowledge of the molecular mechanisms of microbial pathogenicity is absolutely necessary to develop new strategies against infectious diseases and thus to lower their impact on human health and social development.

  14. A study of bacterial gene regulatory mechanisms

    DEFF Research Database (Denmark)

    Hansen, Sabine

    the different regulatory mechanisms affect system dynamics. We have designed a synthetic gene regulatory network (GRN) in bacterial cells that enables us to study the dynamics of GRNs. The results presented in this PhD thesis show that model equations based on the established mechanisms of action of each...... of a particular type of regulatory mechanism. The synthetic system presented in this thesis is, to our knowledge, the first of its kind to allow a direct comparison of the dynamic behaviors of gene regulatory networks that employ different mechanisms of regulation. In addition to studying the dynamic behavior...... switch off the expression of unfavorable proteins. This dynamic regulation requires a coordinated effort by a network of regulatory factors. The regulatory mechanisms employed by bacterial cell to regulate their protein expression have been extensively studied. However, little is known about how...

  15. Bacterial - Fungal Interactions: ecology, mechanisms and challenges.

    Science.gov (United States)

    Deveau, A; Bonito, G; Uehling, J; Paoletti, M; Becker, M; Bindschedler, S; Hacquard, S; Hervé, V; Labbé, J; Lastovetsky, O A; Mieszkin, S; Millet, L J; Vajna, B; Junier, P; Bonfante, P; Krom, B P; Olsson, S; Elsas, J D van; Wick, L Y

    2018-02-19

    Fungi and bacteria are found living together in a wide variety of environments. Their interactions are significant drivers of many ecosystem functions and are important for the health of plants and animals. A large number of fungal and bacterial families are engaged in complex interactions that lead to critical behavioural shifts of the microorganisms ranging from mutualism to pathogenicity. The importance of bacterial-fungal interactions (BFI) in environmental science, medicine and biotechnology has led to the emergence of a dynamic and multidisciplinary research field that combines highly diverse approaches including molecular biology, genomics, geochemistry, chemical and microbial ecology, biophysics and ecological modelling. In this review, we discuss most recent advances that underscore the roles of BFI across relevant habitats and ecosystems. A particular focus is placed on the understanding of BFI within complex microbial communities and in regards of the metaorganism concept. We also discuss recent discoveries that clarify the (molecular) mechanisms involved in bacterial-fungal relationships, and the contribution of new technologies to decipher generic principles of BFI in terms of physical associations and molecular dialogues. Finally, we discuss future directions for researches in order to catalyse a synergy within the BFI research area and to resolve outstanding questions.

  16. Examination of bacterial inhibition using a catalytic DNA.

    Directory of Open Access Journals (Sweden)

    Long Qu

    Full Text Available Determination of accurate dosage of existing antibiotics and discovery of new antimicrobials or probiotics entail simple but effective methods that can conveniently track bacteria growth and inhibition. Here we explore the application of a previously reported fluorogenic E. coli-specific DNAzyme (catalytic DNA, RFD-EC1, as a molecular probe for monitoring bacterial inhibition exerted by antibiotics and for studying bacterial competition as a result of cohabitation. Because the DNAzyme method provides a convenient way to monitor the growth of E. coli, it is capable of determining the minimal inhibitory concentration (MIC of antibiotics much faster than the conventional optical density (OD method. In addition, since the target for RFD-EC1 is an extracellular protein molecule from E. coli, RFD-EC1 is able to identify pore-forming antibiotics or compounds that can cause membrane leakage. Finally, RFD-EC1 can be used to analyse the competition of cohabitating bacteria, specifically the inhibition of growth of E. coli by Bacillus subtilis. The current work represents the first exploration of a catalytic DNA for microbiological applications and showcases the utility of bacteria-sensing fluorogenic DNAzymes as simple molecular probes to facilitate antibiotic and probiotic research.

  17. Antibacterial Mechanisms of Polymyxin and Bacterial Resistance

    Directory of Open Access Journals (Sweden)

    Zhiliang Yu

    2015-01-01

    Full Text Available Multidrug resistance in pathogens is an increasingly significant threat for human health. Indeed, some strains are resistant to almost all currently available antibiotics, leaving very limited choices for antimicrobial clinical therapy. In many such cases, polymyxins are the last option available, although their use increases the risk of developing resistant strains. This review mainly aims to discuss advances in unraveling the mechanisms of antibacterial activity of polymyxins and bacterial tolerance together with the description of polymyxin structure, synthesis, and structural modification. These are expected to help researchers not only develop a series of new polymyxin derivatives necessary for future medical care, but also optimize the clinical use of polymyxins with minimal resistance development.

  18. Inhibition of Bacterial Adhesion by Subinhibitory Concentrations of Antibiotics

    Directory of Open Access Journals (Sweden)

    Vidya K

    2005-01-01

    Full Text Available Background: Urinary Tract Infections (UTIs due to Escherichia coli is one of the most common diseases encountered in clinical practice. Most common recognised pathogenic factor in E.coli is adhesion. There is accumulating evidence that through subinhibitory concentrations (sub - MICs of many antibiotics do not kill bacteria, they are able to interfere with some important aspects of bacterial cell function. Materials and Methods: A study was conducted to investigate the effect of sub MICs (1/2-1/8 MIC of ciprofloxacin, ceftazidime, gentamicin, ampicillin and co - trimoxazole on E. coli adhesiveness to human vaginal epithelial cells using three strains ATCC 25922, MTCC 729 and U 105. Results: The 1/2 MIC of all the antibiotics tested produced the greatest inhibition of bacterial adhesion. Morphological changes were observed with ciprofloxacin, ceftazidime and ampicillin at 1/2 MIC and to a lesser extent at 1/4 and 1/8 MIC. Co-trimoxazole caused the greatest suppression of adhesion at 1/2 MIC of E. coli strain MTCC 729 when compared with the controls, followed by ceftazidime. Conclusion: These results suggest that co - trimoxazole is the most effective antibiotic in the treatment of urinary tract infections caused by uropathogenic E. coli.

  19. Two mechanisms of oral malodor inhibition by zinc ions.

    Science.gov (United States)

    Suzuki, Nao; Nakano, Yoshio; Watanabe, Takeshi; Yoneda, Masahiro; Hirofuji, Takao; Hanioka, Takashi

    2018-01-18

    The aim of this study was to reveal the mechanisms by which zinc ions inhibit oral malodor. The direct binding of zinc ions to gaseous hydrogen sulfide (H2S) was assessed in comparison with other metal ions. Nine metal chlorides and six metal acetates were examined. To understand the strength of H2S volatilization inhibition, the minimum concentration needed to inhibit H2S volatilization was determined using serial dilution methods. Subsequently, the inhibitory activities of zinc ions on the growth of six oral bacterial strains related to volatile sulfur compound (VSC) production and three strains not related to VSC production were evaluated. Aqueous solutions of ZnCl2, CdCl2, CuCl2, (CH3COO)2Zn, (CH3COO)2Cd, (CH3COO)2Cu, and CH3COOAg inhibited H2S volatilization almost entirely. The strengths of H2S volatilization inhibition were in the order Ag+ > Cd2+ > Cu2+ > Zn2+. The effect of zinc ions on the growth of oral bacteria was strain-dependent. Fusobacterium nucleatum ATCC 25586 was the most sensitive, as it was suppressed by medium containing 0.001% zinc ions. Zinc ions have an inhibitory effect on oral malodor involving the two mechanisms of direct binding with gaseous H2S and suppressing the growth of VSC-producing oral bacteria.

  20. Two mechanisms of oral malodor inhibition by zinc ions

    Directory of Open Access Journals (Sweden)

    Nao Suzuki

    2018-01-01

    Full Text Available Abstract Objectives The aim of this study was to reveal the mechanisms by which zinc ions inhibit oral malodor. Material and Methods The direct binding of zinc ions to gaseous hydrogen sulfide (H2S was assessed in comparison with other metal ions. Nine metal chlorides and six metal acetates were examined. To understand the strength of H2S volatilization inhibition, the minimum concentration needed to inhibit H2S volatilization was determined using serial dilution methods. Subsequently, the inhibitory activities of zinc ions on the growth of six oral bacterial strains related to volatile sulfur compound (VSC production and three strains not related to VSC production were evaluated. Results Aqueous solutions of ZnCl2, CdCl2, CuCl2, (CH3COO2Zn, (CH3COO2Cd, (CH3COO2Cu, and CH3COOAg inhibited H2S volatilization almost entirely. The strengths of H2S volatilization inhibition were in the order Ag+ > Cd2+ > Cu2+ > Zn2+. The effect of zinc ions on the growth of oral bacteria was strain-dependent. Fusobacterium nucleatum ATCC 25586 was the most sensitive, as it was suppressed by medium containing 0.001% zinc ions. Conclusions Zinc ions have an inhibitory effect on oral malodor involving the two mechanisms of direct binding with gaseous H2S and suppressing the growth of VSC-producing oral bacteria.

  1. MECHANICAL TRANSMISSION AND SURVIVAL OF BACTERIAL ...

    African Journals Online (AJOL)

    jen

    Key Words: Bacterial wilt, enset, survival, transmission, Xanthomonas campestris pv. musacearum. RÉSUMÉ. La transmission .... than young plants. A 100% disease incidence was recorded at 60 days after inoculation on plants inoculated at 6 months after transplanting. Plants inoculated at. 6 months after transplanting had ...

  2. Inhibition of beta-carbonic anhydrases from the bacterial pathogen Brucella suis with inorganic anions.

    Science.gov (United States)

    Maresca, Alfonso; Scozzafava, Andrea; Köhler, Stephan; Winum, Jean-Yves; Supuran, Claudiu T

    2012-05-01

    The bacterial pathogen Brucella suis encodes two carbonic anhydrases (CAs, EC 4.2.1.1) belonging to the β-class, bsCA1 and bsCA2, which are crucial for its life cycle. Sulfonamides, strong inhibitors of these enzymes, were shown to block the growth of the pathogen in vitro. Here we report the inhibition of these two CAs by inorganic and complex anions and other molecules interacting with zinc proteins, such as sulfamide, sulfamic acid, and phenylboronic/arsonic acids. The enzyme bsCA1 was inhibited in the low micromolar range by sulfamide, sulfamic acid, phenylboronic/arsonic acid, and in the submillimolar range by diethyldithiocarbamate. Isoform bsCA2 generally showed a stronger inhibition with most of these anions, with several low micromolar and many submillimolar inhibitors detected. Micromolar inhibition against bsCA2 was observed for sulfamide and sulfamic acid, whereas diethyldithiocarbamate, perruthenate, pyrovanadate, tellurate and phenylarsonic acid showed inhibition constants in the range of 0.29-1.52mM. These inhibitors may be used as leads for developing anti-Brucella agents with a diverse mechanism of action compared to clinically used antibiotics. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Kinetics, mechanism, and inhibition of monoamine oxidase.

    Science.gov (United States)

    Ramsay, Rona R; Albreht, Alen

    2018-03-07

    Monoamine oxidases (MAOs) catalyse the oxidation of neurotransmitter amines and a wide variety of primary, secondary and tertiary amine xenobiotics, including therapeutic drugs. While inhibition of MAO activity in the periphery removes protection from biogenic amines and so is undesirable, inhibition in the brain gives vital antidepressant and behavioural advantages that make MAO a major pharmaceutical target for inhibitor design. In neurodegenerative diseases, MAO inhibitors can help to maintain neurotransmitter levels, making it a common feature in novel multi-target combinations designed to combat Alzheimer's disease, albeit not yet proven clinically. Vital information for inhibitor design comes from an understanding of the structure, mechanism, and kinetics of the catalyst. This review will summarize the kinetic behaviour of MAO A and B and the kinetic evaluation of reversible inhibitors that transiently decrease catalysis. Kinetic parameters and crystal structures have enabled computational approaches to ligand discovery and validation of hits by docking. Kinetics and a wide variety of substrates and inhibitors along with theoretical modelling have also contributed to proposed schemes for the still debated chemical mechanism of amine oxidation. However, most of the marketed MAO drugs are long-lasting irreversible inactivators. The mechanism of irreversible inhibition by hydrazine, cyclopropylamine, and propargylamine drugs will be discussed. The article finishes with some examples of the propargylamine moiety in multi-target ligand design to combat neurodegeneration.

  4. Pharmacological inhibition of quorum sensing for the treatment of chronic bacterial infections

    DEFF Research Database (Denmark)

    Hentzer, Morten; Givskov, Michael Christian

    2003-01-01

    Traditional treatment of infectious diseases is based on compounds that aim to kill or inhibit bacterial growth. A major concern with this approach is the frequently observed development of resistance to antimicrobial compounds. The discovery of bacterial-communication systems (quorum-sensing sys......Traditional treatment of infectious diseases is based on compounds that aim to kill or inhibit bacterial growth. A major concern with this approach is the frequently observed development of resistance to antimicrobial compounds. The discovery of bacterial-communication systems (quorum...

  5. The papain inhibitor (SPI) of Streptomyces mobaraensis inhibits bacterial cysteine proteases and is an antagonist of bacterial growth.

    Science.gov (United States)

    Zindel, Stephan; Kaman, Wendy E; Fröls, Sabrina; Pfeifer, Felicitas; Peters, Anna; Hays, John P; Fuchsbauer, Hans-Lothar

    2013-07-01

    A novel papain inhibitory protein (SPI) from Streptomyces mobaraensis was studied to measure its inhibitory effect on bacterial cysteine protease activity (Staphylococcus aureus SspB) and culture supernatants (Porphyromonas gingivalis, Bacillus anthracis). Further, growth of Bacillus anthracis, Staphylococcus aureus, Pseudomonas aeruginosa, and Vibrio cholerae was completely inhibited by 10 μM SPI. At this concentration of SPI, no cytotoxicity was observed. We conclude that SPI inhibits bacterial virulence factors and has the potential to become a novel therapeutic treatment against a range of unrelated pathogenic bacteria.

  6. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  7. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  8. Mechanisms of bacterial resistance to antimicrobial agents.

    NARCIS (Netherlands)

    van Duijkeren, Engeline; Schink, Anne-Kathrin; Roberts, Marilyn C; Wang, Yang; Schwarz, Stefan

    During the past decades resistance to virtually all antimicrobial agents has been observed in bacteria of animal origin. This chapter describes in detail the mechanisms so far encountered for the various classes of antimicrobial agents. The main mechanisms include enzymatic inactivation by either

  9. Targeting bacterial topoisomerases: how to counter mechanisms of resistance.

    Science.gov (United States)

    Tse-Dinh, Yuk-Ching

    2016-06-01

    DNA gyrase and topoisomerase IV are type IIA bacterial topoisomerases that are targeted by highly effective antibiotics. However, resistance via multiple mechanisms arises to limit the efficacies of these drugs. Continued research on type IIA bacterial topoisomerases has provided novel approaches to counter the most common resistance mechanism for utilization of these proven targets in antibacterial therapy. Bacterial topoisomerase I is being explored as an alternative target that is not expected to show cross-resistance. Dual targeting or combination therapy could be strategies for circumventing the development of resistance to topoisomerase-targeting antibiotics. Bacterial topoisomerases are high-value bactericidal targets that could continue to be exploited for antibacterial therapy, if new tactics to counter resistance can be adopted.

  10. Mechanism of bacterial inactivation by cationic surfactants

    Energy Technology Data Exchange (ETDEWEB)

    Pavlova, I.B.; Samoylenko, I.I.

    1985-03-01

    The mechanism of bacteriocidal action of the cationic surfactant dimethylbenzylammonium chloride was studied on exposure of Staphylococcus aureus, Streptococcus faecium, Bacillus subtilis and Escherichia coli to different concentrations of the agent and determinations of survival plots. The data showed that the surfactant was bacteriocidal for all the bacteria tested at a concentration of 0.0001%, but more efficient in the case of the gram positives. Electron microscopy showed considerable damage and dissarrangement of the cytoplasmic membrane, indicating that the killing mechanism involved this organelle. It appears that cationic surfactants may constitute effective disinfectant preparations. 9 references, 2 figures.

  11. A rhodanine derivative CCR-11 inhibits bacterial proliferation by inhibiting the assembly and GTPase activity of FtsZ.

    Science.gov (United States)

    Singh, Parminder; Jindal, Bhavya; Surolia, Avadhesha; Panda, Dulal

    2012-07-10

    A perturbation of FtsZ assembly dynamics has been shown to inhibit bacterial cytokinesis. In this study, the antibacterial activity of 151 rhodanine compounds was assayed using Bacillus subtilis cells. Of 151 compounds, eight strongly inhibited bacterial proliferation at 2 μM. Subsequently, we used the elongation of B. subtilis cells as a secondary screen to identify potential FtsZ-targeted antibacterial agents. We found that three compounds significantly increased bacterial cell length. One of the three compounds, namely, CCR-11 [(E)-2-thioxo-5-({[3-(trifluoromethyl)phenyl]furan-2-yl}methylene)thiazolidin-4-one], inhibited the assembly and GTPase activity of FtsZ in vitro. CCR-11 bound to FtsZ with a dissociation constant of 1.5 ± 0.3 μM. A docking analysis indicated that CCR-11 may bind to FtsZ in a cavity adjacent to the T7 loop and that short halogen-oxygen, H-bonding, and hydrophobic interactions might be important for the binding of CCR-11 with FtsZ. CCR-11 inhibited the proliferation of B. subtilis cells with a half-maximal inhibitory concentration (IC(50)) of 1.2 ± 0.2 μM and a minimal inhibitory concentration of 3 μM. It also potently inhibited proliferation of Mycobacterium smegmatis cells. Further, CCR-11 perturbed Z-ring formation in B. subtilis cells; however, it neither visibly affected nucleoid segregation nor altered the membrane integrity of the cells. CCR-11 inhibited HeLa cell proliferation with an IC(50) value of 18.1 ± 0.2 μM (∼15 × IC(50) of B. subtilis cell proliferation). The results suggested that CCR-11 inhibits bacterial cytokinesis by inhibiting FtsZ assembly, and it can be used as a lead molecule to develop FtsZ-targeted antibacterial agents.

  12. Mechanisms of bacterial metals removal from solids

    International Nuclear Information System (INIS)

    Torma, A.E.; Pryfogle, P.A.

    1990-01-01

    The Great Lakes area sediments are contaminated with varying amounts of heavy metals and polychlorinated organic matter. With respect to the bioremediation of metallic contents of these sediments, it was shown that a number of microorganisms exist which can effectively solubilize heavy metals. The basic reaction mechanisms of bioleaching processes were discussed and the effects of semiconductor character of the sulfide substrate explained. A special emphasis was made to comment on INEL's bioremediation capability. 37 refs

  13. Cannabidiol inhibits angiogenesis by multiple mechanisms

    Science.gov (United States)

    Solinas, M; Massi, P; Cantelmo, AR; Cattaneo, MG; Cammarota, R; Bartolini, D; Cinquina, V; Valenti, M; Vicentini, LM; Noonan, DM; Albini, A; Parolaro, D

    2012-01-01

    BACKGROUND AND PURPOSE Several studies have demonstrated anti-proliferative and pro-apoptotic actions of cannabinoids on various tumours, together with their anti-angiogenic properties. The non-psychoactive cannabinoid cannabidiol (CBD) effectively inhibits the growth of different types of tumours in vitro and in vivo and down-regulates some pro-angiogenic signals produced by glioma cells. As its anti-angiogenic properties have not been thoroughly investigated to date, and given its very favourable pharmacological and toxicological profile, here, we evaluated the ability of CBD to modulate tumour angiogenesis. EXPERIMENTAL APPROACH Firstly, we evaluated the effect of CBD on human umbilical vein endothelial cell (HUVEC) proliferation and viability – through [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay and FACS analysis – and in vitro motility – both in a classical Boyden chamber test and in a wound-healing assay. We next investigated CBD effects on different angiogenesis-related proteins released by HUVECs, using an angiogenesis array kit and an ELISA directed at MMP2. Then we evaluated its effects on in vitro angiogenesis in treated HUVECs invading a Matrigel layer and in HUVEC spheroids embedded into collagen gels, and further characterized its effects in vivo using a Matrigel sponge model of angiogenesis in C57/BL6 mice. KEY RESULTS CBD induced HUVEC cytostasis without inducing apoptosis, inhibited HUVEC migration, invasion and sprouting in vitro, and angiogenesis in vivo in Matrigel sponges. These effects were associated with the down-modulation of several angiogenesis-related molecules. CONCLUSIONS AND IMPLICATIONS This study reveals that CBD inhibits angiogenesis by multiple mechanisms. Its dual effect on both tumour and endothelial cells supports the hypothesis that CBD has potential as an effective agent in cancer therapy. PMID:22624859

  14. Blue light (470 nm) effectively inhibits bacterial and fungal growth

    Science.gov (United States)

    The activity of blue light (470nm) alone on (1) bacterial viability, and (2) with a food grade photosensitizer on filamentous fungal viability, was studied. Suspensions of the bacteria Leuconostoc mesenteroides (LM), Bacillus atrophaeus (BA), and Pseudomonas aeruginosa (PA) were prepared and aliquo...

  15. Screening mycotoxins for quorum inhibition in a biocontrol bacterial endophyte

    Science.gov (United States)

    Bacterial endophytes are used as biocontrol organisms for plant pathogens such as the maize endophyte Fusarium verticillioides and its production of fumonisin mycotoxins. However, such applications are not always predictable and efficient. Bacteria communicate via cell-dependent signals, which are r...

  16. Post-translational Mechanisms of Host Subversion by Bacterial Effectors.

    Science.gov (United States)

    Scott, Nichollas E; Hartland, Elizabeth L

    2017-12-01

    Bacterial effector proteins are a specialized class of secreted proteins that are translocated directly into the host cytoplasm by bacterial pathogens. Effector proteins have diverse activities and targets, and many mediate post-translational modifications of host proteins. Effector proteins offer potential in novel biotechnological and medical applications as enzymes that may modify human proteins. Here, we discuss the mechanisms used by effectors to subvert the human host through blocking, blunting, or subverting immune mechanisms. This capacity allows bacteria to control host cell function to support pathogen survival, replication and dissemination to other hosts. In addition, we highlight that knowledge of effector protein activity may be used to develop chemical inhibitors as a new approach to treat bacterial infections. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Glycerol Monolaurate Inhibits Lipase Production by Clinical Ocular Isolates Without Affecting Bacterial Cell Viability.

    Science.gov (United States)

    Flanagan, Judith Louise; Khandekar, Neeta; Zhu, Hua; Watanabe, Keizo; Markoulli, Maria; Flanagan, John Terence; Papas, Eric

    2016-02-01

    We sought to determine the relative lipase production of a range of ocular bacterial isolates and to assess the efficacy of glycerol monolaurate (GML) in inhibiting this lipase production in high lipase-producing bacteria without affecting bacterial cell growth. Staphylococcus aureus,Staphylococcus epidermidis,Propionibacterium acnes, and Corynebacterium spp. were inoculated at a density of 10(6)/mL in varying concentrations of GML up to 25 μg/mL for 24 hours at 37 °C with constant shaking. Bacterial suspensions were centrifuged, bacterial cell density was determined, and production of bacterial lipase was quantified using a commercial lipase assay kit. Staphylococcus spp. produced high levels of lipase activity compared with P. acnes and Corynebacterium spp. GML inhibited lipase production by Staphylococcal spp. in a dose-dependent manner, with S. epidermidis lipase production consistently more sensitive to GML than S. aureus. Glycerol monolaurate showed significant (P lipase inhibition above concentrations of 15 μg/mL in S. aureus and was not cytotoxic up to 25 μg/mL. For S. epidermidis, GML showed significant (P lipase inhibition above 7.5 μg/mL. Lipase activity varied between species and between strains. Staphylococcal spp. produced higher lipase activity compared with P. acnes and Corynebacterium spp. Glycerol monolaurate inhibited lipase production by S. aureus and S. epidermidis at concentrations that did not adversely affect bacterial cell growth. GML can be used to inhibit ocular bacterial lipase production without proving detrimental to commensal bacteria viability.

  18. A host defense mechanism involving CFTR-mediated bicarbonate secretion in bacterial prostatitis.

    Directory of Open Access Journals (Sweden)

    Chen Xie

    Full Text Available BACKGROUND: Prostatitis is associated with a characteristic increase in prostatic fluid pH; however, the underlying mechanism and its physiological significance have not been elucidated. METHODOLOGY/PRINCIPAL FINDINGS: In this study a primary culture of rat prostatic epithelial cells and a rat prostatitis model were used. Here we reported the involvement of CFTR, a cAMP-activated anion channel conducting both Cl(- and HCO(3(-, in mediating prostate HCO(3(- secretion and its possible role in bacterial killing. Upon Escherichia coli (E. coli-LPS challenge, the expression of CFTR and carbonic anhydrase II (CA II, along with several pro-inflammatory cytokines was up-regulated in the primary culture of rat prostate epithelial cells. Inhibiting CFTR function in vitro or in vivo resulted in reduced bacterial killing by prostate epithelial cells or the prostate. High HCO(3(- content (>50 mM, rather than alkaline pH, was found to be responsible for bacterial killing. The direct action of HCO(3(- on bacterial killing was confirmed by its ability to increase cAMP production and suppress bacterial initiation factors in E. coli. The relevance of the CFTR-mediated HCO(3(- secretion in humans was demonstrated by the upregulated expression of CFTR and CAII in human prostatitis tissues. CONCLUSIONS/SIGNIFICANCE: The CFTR and its mediated HCO(3(- secretion may be up-regulated in prostatitis as a host defense mechanism.

  19. Mechanism of bacterial membrane poration by Antimicrobial Peptides

    Science.gov (United States)

    Arora, Ankita; Mishra, Abhijit

    2015-03-01

    Bacterial resistance to conventional antibiotics is a major health concern. Antimicrobial peptides (AMPs), an important component of mammalian immune system, are thought to utilize non-specific interactions to target common features on the outer membranes of pathogens; hence development of resistance to such AMPs may be less pronounced. Most AMPs are amphiphilic and cationic in nature. Most AMPs form pores in the bacterial membranes causing them to lyse, however, the exact mechanism is unknown. Here, we study the AMP CHRG01 (KSSTRGRKSSRRKK), derived from human β defensin 3 (hBD3) with all Cysteine residues substituted with Serine. Circular Dichorism studies indicate that CHRG01 shows helicity and there is change in helicity as it interacts with the lipid membrane. The AMP was effective against different species of bacteria. Leakage of cellular components from bacterial cells observed by SEM and AFM indicates AMP action by pore formation. Confocal microscopy studies on giant vesicles incubated with AMP confirm poration. The effect of this AMP on model bacterial membranes is characterized using Small Angle X-ray scattering and Fluorescence spectroscopy to elucidate the mechanism behind antimicrobial activity.

  20. Mechanism of uranium (VI) removal by two anaerobic bacterial communities

    International Nuclear Information System (INIS)

    Martins, Monica; Faleiro, Maria Leonor; Costa, Ana M. Rosa da; Chaves, Sandra; Tenreiro, Rogerio; Matos, Antonio Pedro; Costa, Maria Clara

    2010-01-01

    The mechanism of uranium (VI) removal by two anaerobic bacterial consortia, recovered from an uncontaminated site (consortium A) and other from an uranium mine (consortium U), was investigated. The highest efficiency of U (VI) removal by both consortia (97%) occurred at room temperature and at pH 7.2. Furthermore, it was found that U (VI) removal by consortium A occurred by enzymatic reduction and bioaccumulation, while the enzymatic process was the only mechanism involved in metal removal by consortium U. FTIR analysis suggested that after U (VI) reduction, U (IV) could be bound to carboxyl, phosphate and amide groups of bacterial cells. Phylogenetic analysis of 16S rRNA showed that community A was mainly composed by bacteria closely related to Sporotalea genus and Rhodocyclaceae family, while community U was mainly composed by bacteria related to Clostridium genus and Rhodocyclaceae family.

  1. Ultraviolet irradiated water containing humic substances inhibits bacterial metabolism

    International Nuclear Information System (INIS)

    Lund, V.; Hongve, D.

    1994-01-01

    Disinfection of drinking water by u.v. irradiation has been observed to reduce the biofilm formation in the pipes in a pilot plant. An apparently inhibitory effect that persists in the water after the u.v. treatment has been studied in the laboratory. Reduced numbers of viable bacteria and reduced bacterial metabolism were observed when irradiated waters were inoculated with fresh bacteria. Approximately 60% of the heterotrophic bacteria in the water samples were inactivated within a 1 h contact time with freshly u.v. disinfected water. The uptake rates of labelled tracer substances were significantly reduced when the bacteria were exposed to irradiated water. The inhibitory effect seems to last for at least 1 week. High concentrations of organic matter seem to counteract the inhibitory effect. No relationship was found between u.v. dose and effect within the dose range tested. The observed effects may be explained by the action of oxidizing reagents such as hydroxyl radicals, produced in photochemical reactions between u.v. irradiation and humic substances in the water. (author)

  2. Novel linear polymers able to inhibit bacterial quorum sensing.

    Science.gov (United States)

    Cavaleiro, Eliana; Duarte, Ana Sofia; Esteves, Ana Cristina; Correia, António; Whitcombe, Michael J; Piletska, Elena V; Piletsky, Sergey A; Chianella, Iva

    2015-05-01

    Bacterial phenotypes, such as biofilm formation, antibiotic resistance and virulence expression, are associated with quorum sensing. Quorum sensing is a density-dependent regulatory system of gene expression controlled by specific signal molecules, such as N-acyl homoserine lactones (AHLs), produced and released by bacteria. This study reports the development of linear polymers capable to attenuate quorum sensing by adsorption of AHLs. Linear polymers were synthesized using MMA as backbone monomer and methacrylic acid and itaconic acid as functional monomers. Two different quorum sensing-controlled phenotypes, Vibrio fischeri bioluminescence and Aeromonas hydrophila biofilm formation, were evaluated to test the polymers' efficiency. Results showed that both phenotypes were significantly affected by the polymers, with the itaconic acid-containing material being more effective than the methacrylic acid one. The polymer inhibitory effects were reverted by the addition of lactones, confirming attenuation of quorum sensing through sequestration of signal molecules. The polymers also showed no cytotoxicity when tested using a mammalian cell line. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. A Polymethyl Methacrylate-Based Acrylic Dental Resin Surface Bound with a Photoreactive Polymer Inhibits Accumulation of Bacterial Plaque.

    Science.gov (United States)

    Fukunishi, Miya; Inoue, Yuuki; Morisaki, Hirobumi; Kuwata, Hirotaka; Ishihara, Kazuhiko; Baba, Kazuyoshi

    The aim of this study was to examine the ability of a poly(2-methacryloyloxyethyl phosphorylcholine-co-n-butylmethacrylate-co-2-methacryloyloxyethyloxy-p-azidobenzoate) (PMBPAz) coating on polymethyl methacrylate (PMMA)-based dental resin to inhibit bacterial plaque formation, as well as the polymer's durability against water soaking and chemical exposure. Successful application of PMBPAz on PMMA surfaces was confirmed by x-ray photoelectron spectroscopy (XPS) and measuring the static air contact angle in water. The anti-adhesive effects to bacterial plaque were evaluated using Streptococcus mutans biofilm formation assay. The mechanical and chemical durabilities of the PMBPAz coating on the PMMA surfaces were examined using soaking and immersion tests, respectively. XPS signals for phosphorus and nitrogen atoms and hydrophilic status on PMMA surfaces treated with PMBPAz were observed, indicating the presence of the polymer on the substrates. The treated PMMA surfaces showed significant inhibition of S mutans biofilm formation compared to untreated surfaces. The PMBPAz coating was preserved after water soaking and chemical exposure. In addition, water soaking did not decrease the ability of treated PMMA to inhibit biofilm formation compared to treated PMMA specimens not subjected to water soaking. This study suggests that PMBPAz coating may represent a useful modification to PMMA surfaces for inhibiting denture plaque accumulation.

  4. Vizantin inhibits bacterial adhesion without affecting bacterial growth and causes Streptococcus mutans biofilm to detach by altering its internal architecture.

    Science.gov (United States)

    Takenaka, Shoji; Oda, Masataka; Domon, Hisanori; Ohsumi, Tatsuya; Suzuki, Yuki; Ohshima, Hayato; Yamamoto, Hirofumi; Terao, Yutaka; Noiri, Yuichiro

    2016-11-11

    An ideal antibiofilm strategy is to control both in the quality and quantity of biofilm while maintaining the benefits derived from resident microflora. Vizantin, a recently developed immunostimulating compound, has also been found to have antibiofilm property. This study evaluated the influence on biofilm formation of Streptococcus mutans in the presence of sulfated vizantin and biofilm development following bacterial adhesion on a hydroxyapatite disc coated with sulfated vizantin. Supplementation with sulfated vizantin up to 50 μM did not affect either bacterial growth or biofilm formation, whereas 50 μM sulfated vizantin caused the biofilm to readily detach from the surface. Sulfated vizantin at the concentration of 50 μM upregulated the expression of the gtfB and gtfC genes, but downregulated the expression of the gtfD gene, suggesting altered architecture in the biofilm. Biofilm development on the surface coated with sulfated vizantin was inhibited depending on the concentration, suggesting prevention from bacterial adhesion. Among eight genes related to bacterial adherence in S. mutans, expression of gtfB and gtfC was significantly upregulated, whereas the expression of gtfD, GbpA and GbpC was downregulated according to the concentration of vizantin, especially with 50 μM vizantin by 0.8-, 0.4-, and 0.4-fold, respectively. These findings suggest that sulfated vizantin may cause structural degradation as a result of changing gene regulation related to bacterial adhesion and glucan production of S. mutans. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. 40 CFR 798.5500 - Differential growth inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA...

    Science.gov (United States)

    2010-07-01

    ... repair proficient and repair deficient bacteria: âBacterial DNA damage or repair tests.â 798.5500 Section... inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA damage or repair tests.” (a... killing or growth inhibition of repair deficient bacteria in a set of repair proficient and deficient...

  6. Biofilm formation and ethanol inhibition by bacterial contaminants of biofuel fermentation.

    Science.gov (United States)

    Rich, Joseph O; Leathers, Timothy D; Bischoff, Kenneth M; Anderson, Amber M; Nunnally, Melinda S

    2015-11-01

    Bacterial contaminants can inhibit ethanol production in biofuel fermentations, and even result in stuck fermentations. Contaminants may persist in production facilities by forming recalcitrant biofilms. A two-year longitudinal study was conducted of bacterial contaminants from a Midwestern dry grind corn fuel ethanol facility. Among eight sites sampled in the facility, the combined liquefaction stream and yeast propagation tank were consistently contaminated, leading to contamination of early fermentation tanks. Among 768 contaminants isolated, 92% were identified as Lactobacillus sp., with the most abundant species being Lactobacillus plantarum, Lactobacillus casei, Lactobacillus mucosae, and Lactobacillus fermentum. Seven percent of total isolates showed the ability to form biofilms in pure cultures, and 22% showed the capacity to significantly inhibit ethanol production. However, these traits were not correlated. Ethanol inhibition appeared to be related to acetic acid production by contaminants, particularly by obligately heterofermentative species such as L. fermentum and L. mucosae. Published by Elsevier Ltd.

  7. Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics

    Science.gov (United States)

    Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.

    2017-12-01

    Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.

  8. The Magnetosome Model: Insights into the Mechanisms of Bacterial Biomineralization

    Directory of Open Access Journals (Sweden)

    Lilah eRahn-Lee

    2013-11-01

    Full Text Available Though the most ready example of biomineralization is the calcium phosphate of vertebrate bones and teeth, many bacteria are capable of creating biominerals inside their cells. Because of the diversity of these organisms and the minerals they produce, their study may reveal aspects of the fundamental mechanisms of biomineralization in more complex organisms. The best-studied case of intracellular biomineralization in bacteria is the magnetosome, an organelle produced by a diverse group of aquatic bacteria that contains single-domain crystals of the iron oxide magnetite (Fe3O4 or the iron sulfide greigite (Fe3S4. Here, recent advances in our understanding of the mechanisms of bacterial magnetite biomineralization are discussed and used as a framework for understanding less-well studied examples, including the bacterial intracellular biomineralization of cadmium, selenium, silver, nickel, uranium, and calcium carbonate. Understanding the molecular mechanisms underlying the biological formation of these minerals will have important implications for technologies such as the fabrication of nanomaterials and the bioremediation of toxic compounds.

  9. The magnetosome model: insights into the mechanisms of bacterial biomineralization.

    Science.gov (United States)

    Rahn-Lee, Lilah; Komeili, Arash

    2013-11-26

    Though the most ready example of biomineralization is the calcium phosphate of vertebrate bones and teeth, many bacteria are capable of creating biominerals inside their cells. Because of the diversity of these organisms and the minerals they produce, their study may reveal aspects of the fundamental mechanisms of biomineralization in more complex organisms. The best-studied case of intracellular biomineralization in bacteria is the magnetosome, an organelle produced by a diverse group of aquatic bacteria that contains single-domain crystals of the iron oxide magnetite (Fe3O4) or the iron sulfide greigite (Fe3S4). Here, recent advances in our understanding of the mechanisms of bacterial magnetite biomineralization are discussed and used as a framework for understanding less-well studied examples, including the bacterial intracellular biomineralization of cadmium, selenium, silver, nickel, uranium, and calcium carbonate. Understanding the molecular mechanisms underlying the biological formation of these minerals will have important implications for technologies such as the fabrication of nanomaterials and the bioremediation of toxic compounds.

  10. Bacterial transformation: distribution, shared mechanisms and divergent control.

    Science.gov (United States)

    Johnston, Calum; Martin, Bernard; Fichant, Gwennaele; Polard, Patrice; Claverys, Jean-Pierre

    2014-03-01

    Natural bacterial transformation involves the internalization and chromosomal integration of DNA and has now been documented in ~80 species. Recent advances have established that phylogenetically distant species share conserved uptake and processing proteins but differ in the inducing cues and regulatory mechanisms that are involved. In this Review, we highlight divergent and common principles that govern the transformation process in different bacteria. We discuss how this cumulative knowledge enables the prediction of new transformable species and supports the idea that the main role of internalized DNA is in the generation of genetic diversity or in chromosome repair rather than in nutrition.

  11. Mechanisms of dexamethasone-mediated inhibition of Toll-like receptor signaling induced by Neisseria meningitidis and Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Mogensen, Trine; Berg, Randi S; Paludan, Søren R

    2008-01-01

    significantly reduces mortality and morbidity from bacterial meningitis. Here we investigate the molecular mechanisms behind the inhibitory effect of dexamethasone upon the inflammatory responses evoked by Neisseria meningitidis and Streptococcus pneumoniae, two of the major causes of bacterial meningitis......B alpha synthesis. Our data also revealed that the timing of steroid treatment relative to infection was important for achieving strong inhibition, particularly in response to S. pneumoniae. Altogether, we describe important targets of dexamethasone in the inflammatory responses evoked by N. meningitidis...

  12. Mechanisms and consequences of bacterial resistance to antimicrobial peptides.

    Science.gov (United States)

    Andersson, D I; Hughes, D; Kubicek-Sutherland, J Z

    2016-05-01

    Cationic antimicrobial peptides (AMPs) are an intrinsic part of the human innate immune system. Over 100 different human AMPs are known to exhibit broad-spectrum antibacterial activity. Because of the increased frequency of resistance to conventional antibiotics there is an interest in developing AMPs as an alternative antibacterial therapy. Several cationic peptides that are derivatives of AMPs from the human innate immune system are currently in clinical development. There are also ongoing clinical studies aimed at modulating the expression of AMPs to boost the human innate immune response. In this review we discuss the potential problems associated with these therapeutic approaches. There is considerable experimental data describing mechanisms by which bacteria can develop resistance to AMPs. As for any type of drug resistance, the rate by which AMP resistance would emerge and spread in a population of bacteria in a natural setting will be determined by a complex interplay of several different factors, including the mutation supply rate, the fitness of the resistant mutant at different AMP concentrations, and the strength of the selective pressure. Several studies have already shown that AMP-resistant bacterial mutants display broad cross-resistance to a variety of AMPs with different structures and modes of action. Therefore, routine clinical administration of AMPs to treat bacterial infections may select for resistant bacterial pathogens capable of better evading the innate immune system. The ramifications of therapeutic levels of exposure on the development of AMP resistance and bacterial pathogenesis are not yet understood. This is something that needs to be carefully studied and monitored if AMPs are used in clinical settings. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Effects of bacterial communities on biofuel-producing microalgae: stimulation, inhibition and harvesting.

    Science.gov (United States)

    Wang, Hui; Hill, Russell T; Zheng, Tianling; Hu, Xiaoke; Wang, Bin

    2016-01-01

    Despite the great interest in microalgae as a potential source of biofuel to substitute for fossil fuels, little information is available on the effects of bacterial symbionts in mass algal cultivation systems. The bacterial communities associated with microalgae are a crucial factor in the process of microalgal biomass and lipid production and may stimulate or inhibit growth of biofuel-producing microalgae. In addition, we discuss here the potential use of bacteria to harvest biofuel-producing microalgae. We propose that aggregation of microalgae by bacteria to achieve >90% reductions in volume followed by centrifugation could be an economic approach for harvesting of biofuel-producing microalgae. Our aims in this review are to promote understanding of the effects of bacterial communities on microalgae and draw attention to the importance of this topic in the microalgal biofuel field.

  14. A novel bacterial transport mechanism of Acinetobacter baumannii via activated human neutrophils through interleukin-8.

    Science.gov (United States)

    Kamoshida, Go; Tansho-Nagakawa, Shigeru; Kikuchi-Ueda, Takane; Nakano, Ryuichi; Hikosaka, Kenji; Nishida, Satoshi; Ubagai, Tsuneyuki; Higashi, Shouichi; Ono, Yasuo

    2016-12-01

    Hospital-acquired infections as a result of Acinetobacter baumannii have become problematic because of high rates of drug resistance. Although neutrophils play a critical role in early protection against bacterial infection, their interactions with A. baumannii remain largely unknown. To elucidate the interactions between A. baumannii and human neutrophils, we cocultured these cells and analyzed them by microscopy and flow cytometry. We found that A. baumannii adhered to neutrophils. We next examined neutrophil and A. baumannii infiltration into Matrigel basement membranes by an in vitro transmigration assay. Neutrophils were activated by A. baumannii, and invasion was enhanced. More interestingly, A. baumannii was transported together by infiltrating neutrophils. Furthermore, we observed by live cell imaging that A. baumannii and neutrophils moved together. In addition, A. baumannii-activated neutrophils showed increased IL-8 production. The transport of A. baumannii was suppressed by inhibiting neutrophil infiltration by blocking the effect of IL-8. A. baumannii appears to use neutrophils for transport by activating these cells via IL-8. In this study, we revealed a novel bacterial transport mechanism that A. baumannii exploits human neutrophils by adhering to and inducing IL-8 release for bacterial portage. This mechanism might be a new treatment target. © Society for Leukocyte Biology.

  15. Unraveling the Molecular Mechanisms Underlying the Nasopharyngeal Bacterial Community Structure

    Directory of Open Access Journals (Sweden)

    Wouter A. A. de Steenhuijsen Piters

    2016-03-01

    Full Text Available The upper respiratory tract is colonized by a diverse array of commensal bacteria that harbor potential pathogens, such as Streptococcus pneumoniae. As long as the local microbial ecosystem—also called “microbiome”—is in balance, these potentially pathogenic bacterial residents cause no harm to the host. However, similar to macrobiological ecosystems, when the bacterial community structure gets perturbed, potential pathogens can overtake the niche and cause mild to severe infections. Recent studies using next-generation sequencing show that S. pneumoniae, as well as other potential pathogens, might be kept at bay by certain commensal bacteria, including Corynebacterium and Dolosigranulum spp. Bomar and colleagues are the first to explore a specific biological mechanism contributing to the antagonistic interaction between Corynebacterium accolens and S. pneumoniae in vitro [L. Bomar, S. D. Brugger, B. H. Yost, S. S. Davies, K. P. Lemon, mBio 7(1:e01725-15, 2016, doi:10.1128/mBio.01725-15]. The authors comprehensively show that C. accolens is capable of hydrolyzing host triacylglycerols into free fatty acids, which display antipneumococcal properties, suggesting that these bacteria might contribute to the containment of pneumococcus. This work exemplifies how molecular epidemiological findings can lay the foundation for mechanistic studies to elucidate the host-microbe and microbial interspecies interactions underlying the bacterial community structure. Next, translation of these results to an in vivo setting seems necessary to unveil the magnitude and importance of the observed effect in its natural, polymicrobial setting.

  16. Inhibition of bacterial adherence to saliva-coated through plant lectins.

    Science.gov (United States)

    Oliveira, Mara R T R; Napimoga, Marcelo H; Cogo, Karina; Gonçalves, Reginaldo B; Macedo, Maria L R; Freire, Maria G M; Groppo, Francisco C

    2007-06-01

    In the present study, we evaluated the ability of lectin from Talisia esculenta (TEL) and a protein from Labramia bojeri seeds (Labramin) to inhibit adherence of microorganisms and exert antimicrobial effects. The minimum inhibitory and bactericidal concentrations of these proteins were determined using 5 species of bacteria: Streptococcus mutans UA159, Streptococcus sobrinus 6715, Streptococcus sanguinis ATCC10556, Streptococcus mitis ATCC903 and Streptococcus oralis PB182. In addition, an adherence assay was performed using these 5 bacterial species and sterile polystyrene microtiter plates coated with human saliva. Filtered protein solutions (6.25 to 100 mug/ml) were added to saliva-coated plates, and the plates were then incubated for 1 h at 37 degrees C. After incubation, the plates were washed, and a bacterial suspension (10(6 )CFU/ml) was then transferred to each plate, followed by incubation at 37 degrees C for 1 h (10% CO(2)). Adherence of bacteria to the acquired pellicle was visualized by staining with crystal violet, and absorbance was measured using a plate reader at 575 nm. Neither Labramin nor TEL, at any of the concentrations used, inhibited growth of any of the microorganisms. However, Labramin inhibited adherence of S. mutans and S. sobrinus. The present results indicate that Labramin is potentially useful as a biofilm-inhibiting drug.

  17. Bacterial multidrug efflux pumps: mechanisms, physiology and pharmacological exploitations.

    Science.gov (United States)

    Sun, Jingjing; Deng, Ziqing; Yan, Aixin

    2014-10-17

    Multidrug resistance (MDR) refers to the capability of bacterial pathogens to withstand lethal doses of structurally diverse drugs which are capable of eradicating non-resistant strains. MDR has been identified as a major threat to the public health of human being by the World Health Organization (WHO). Among the four general mechanisms that cause antibiotic resistance including target alteration, drug inactivation, decreased permeability and increased efflux, drug extrusion by the multidrug efflux pumps serves as an important mechanism of MDR. Efflux pumps not only can expel a broad range of antibiotics owing to their poly-substrate specificity, but also drive the acquisition of additional resistance mechanisms by lowering intracellular antibiotic concentration and promoting mutation accumulation. Over-expression of multidrug efflux pumps have been increasingly found to be associated with clinically relevant drug resistance. On the other hand, accumulating evidence has suggested that efflux pumps also have physiological functions in bacteria and their expression is subject tight regulation in response to various of environmental and physiological signals. A comprehensive understanding of the mechanisms of drug extrusion, and regulation and physiological functions of efflux pumps is essential for the development of anti-resistance interventions. In this review, we summarize the development of these research areas in the recent decades and present the pharmacological exploitation of efflux pump inhibitors as a promising anti-drug resistance intervention. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Inhibition of bacterial conjugation by phage M13 and its protein g3p: quantitative analysis and model.

    Science.gov (United States)

    Lin, Abraham; Jimenez, Jose; Derr, Julien; Vera, Pedro; Manapat, Michael L; Esvelt, Kevin M; Villanueva, Laura; Liu, David R; Chen, Irene A

    2011-01-01

    Conjugation is the main mode of horizontal gene transfer that spreads antibiotic resistance among bacteria. Strategies for inhibiting conjugation may be useful for preserving the effectiveness of antibiotics and preventing the emergence of bacterial strains with multiple resistances. Filamentous bacteriophages were first observed to inhibit conjugation several decades ago. Here we investigate the mechanism of inhibition and find that the primary effect on conjugation is occlusion of the conjugative pilus by phage particles. This interaction is mediated primarily by phage coat protein g3p, and exogenous addition of the soluble fragment of g3p inhibited conjugation at low nanomolar concentrations. Our data are quantitatively consistent with a simple model in which association between the pili and phage particles or g3p prevents transmission of an F plasmid encoding tetracycline resistance. We also observe a decrease in the donor ability of infected cells, which is quantitatively consistent with a reduction in pili elaboration. Since many antibiotic-resistance factors confer susceptibility to phage infection through expression of conjugative pili (the receptor for filamentous phage), these results suggest that phage may be a source of soluble proteins that slow the spread of antibiotic resistance genes.

  19. Inhibition of bacterial conjugation by phage M13 and its protein g3p: quantitative analysis and model.

    Directory of Open Access Journals (Sweden)

    Abraham Lin

    Full Text Available Conjugation is the main mode of horizontal gene transfer that spreads antibiotic resistance among bacteria. Strategies for inhibiting conjugation may be useful for preserving the effectiveness of antibiotics and preventing the emergence of bacterial strains with multiple resistances. Filamentous bacteriophages were first observed to inhibit conjugation several decades ago. Here we investigate the mechanism of inhibition and find that the primary effect on conjugation is occlusion of the conjugative pilus by phage particles. This interaction is mediated primarily by phage coat protein g3p, and exogenous addition of the soluble fragment of g3p inhibited conjugation at low nanomolar concentrations. Our data are quantitatively consistent with a simple model in which association between the pili and phage particles or g3p prevents transmission of an F plasmid encoding tetracycline resistance. We also observe a decrease in the donor ability of infected cells, which is quantitatively consistent with a reduction in pili elaboration. Since many antibiotic-resistance factors confer susceptibility to phage infection through expression of conjugative pili (the receptor for filamentous phage, these results suggest that phage may be a source of soluble proteins that slow the spread of antibiotic resistance genes.

  20. Final Report - Molecular Mechanisms of Bacterial Mercury Transformation - UCSF

    Energy Technology Data Exchange (ETDEWEB)

    Miller, Susan M. [UCSF

    2014-04-24

    The bacterial mercury resistance (mer) operon functions in Hg biogeochemistry and bioremediation by converting reactive inorganic Hg(II) and organic [RHg(II)]1+ mercurials to relatively inert monoatomic mercury vapor, Hg(0). Its genes regulate operon expression (MerR, MerD, MerOP), import Hg(II) (MerT, MerP, and MerC), and demethylate (MerB) and reduce (MerA) mercurials. We focus on how these components interact with each other and with the host cell to allow cells to survive and detoxify Hg compounds. Understanding how this ubiquitous detoxification system fits into the biology and ecology of its bacterial host is essential to guide interventions that support and enhance Hg remediation. In the current overall project we focused on two aspects of this system: (1) investigations of the energetics of Hg(II)-ligand binding interactions, and (2) both experimental and computational approaches to investigating the molecular mechanisms of Hg(II) acquisition by MerA and intramolecular transfer of Hg(II) prior to reduction within the MerA enzyme active site. Computational work was led by Prof. Jeremy Smith and took place at the University of Tennessee, while experimental work on MerA was led by Prof. Susan Miller and took place at the University of California San Francisco.

  1. A molecular mechanism for bacterial susceptibility to zinc.

    Directory of Open Access Journals (Sweden)

    Christopher A McDevitt

    2011-11-01

    Full Text Available Transition row metal ions are both essential and toxic to microorganisms. Zinc in excess has significant toxicity to bacteria, and host release of Zn(II at mucosal surfaces is an important innate defence mechanism. However, the molecular mechanisms by which Zn(II affords protection have not been defined. We show that in Streptococcus pneumoniae extracellular Zn(II inhibits the acquisition of the essential metal Mn(II by competing for binding to the solute binding protein PsaA. We show that, although Mn(II is the high-affinity substrate for PsaA, Zn(II can still bind, albeit with a difference in affinity of nearly two orders of magnitude. Despite the difference in metal ion affinities, high-resolution structures of PsaA in complex with Mn(II or Zn(II showed almost no difference. However, Zn(II-PsaA is significantly more thermally stable than Mn(II-PsaA, suggesting that Zn(II binding may be irreversible. In vitro growth analyses show that extracellular Zn(II is able to inhibit Mn(II intracellular accumulation with little effect on intracellular Zn(II. The phenotype of S. pneumoniae grown at high Zn(II:Mn(II ratios, i.e. induced Mn(II starvation, closely mimicked a ΔpsaA mutant, which is unable to accumulate Mn(II. S. pneumoniae infection in vivo elicits massive elevation of the Zn(II:Mn(II ratio and, in vitro, these Zn(II:Mn(II ratios inhibited growth due to Mn(II starvation, resulting in heightened sensitivity to oxidative stress and polymorphonuclear leucocyte killing. These results demonstrate that microbial susceptibility to Zn(II toxicity is mediated by extracellular cation competition and that this can be harnessed by the innate immune response.

  2. Inhibition of bacterial adherence by cranberry juice: potential use for the treatment of urinary tract infections.

    Science.gov (United States)

    Sobota, A E

    1984-05-01

    Cranberry juice has been widely used for the treatment and prevention of urinary tract infections and is reputed to give symptomatic relief from these infections. Attempts to account for the potential benefit derived from the juice have focused on urine acidification and bacteriostasis. In this investigation it is demonstrated that cranberry juice is a potent inhibitor of bacterial adherence. A total of 77 clinical isolates of Escherichia coli were tested. Cranberry juice inhibited adherence by 75 per cent or more in over 60 per cent of the clinical isolates. Cranberry cocktail was also given to mice in the place of their normal water supply for a period of 14 days. Urine collected from these mice inhibited adherence of E. coli to uroepithelial cells by approximately 80 per cent. Antiadherence activity could also be detected in human urine. Fifteen of 22 subjects showed significant antiadherence activity in the urine 1 to 3 hours after drinking 15 ounces of cranberry cocktail. It is concluded that the reported benefits derived from the use of cranberry juice may be related to its ability to inhibit bacterial adherence.

  3. Molecular Mechanisms of Inhibition of Streptococcus Species by Phytochemicals

    Directory of Open Access Journals (Sweden)

    Soheila Abachi

    2016-02-01

    Full Text Available This review paper summarizes the antibacterial effects of phytochemicals of various medicinal plants against pathogenic and cariogenic streptococcal species. The information suggests that these phytochemicals have potential as alternatives to the classical antibiotics currently used for the treatment of streptococcal infections. The phytochemicals demonstrate direct bactericidal or bacteriostatic effects, such as: (i prevention of bacterial adherence to mucosal surfaces of the pharynx, skin, and teeth surface; (ii inhibition of glycolytic enzymes and pH drop; (iii reduction of biofilm and plaque formation; and (iv cell surface hydrophobicity. Collectively, findings from numerous studies suggest that phytochemicals could be used as drugs for elimination of infections with minimal side effects.

  4. Molecular Mechanisms of Inhibition of Streptococcus Species by Phytochemicals.

    Science.gov (United States)

    Abachi, Soheila; Lee, Song; Rupasinghe, H P Vasantha

    2016-02-17

    This review paper summarizes the antibacterial effects of phytochemicals of various medicinal plants against pathogenic and cariogenic streptococcal species. The information suggests that these phytochemicals have potential as alternatives to the classical antibiotics currently used for the treatment of streptococcal infections. The phytochemicals demonstrate direct bactericidal or bacteriostatic effects, such as: (i) prevention of bacterial adherence to mucosal surfaces of the pharynx, skin, and teeth surface; (ii) inhibition of glycolytic enzymes and pH drop; (iii) reduction of biofilm and plaque formation; and (iv) cell surface hydrophobicity. Collectively, findings from numerous studies suggest that phytochemicals could be used as drugs for elimination of infections with minimal side effects.

  5. Bacterial inhibiting surfaces caused by the effects of silver release and/or electrical field

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Hilbert, Lisbeth Rischel; Schroll, Casper

    2008-01-01

    In this study, silver-palladium surfaces and silver-bearing stainless steels were designed and investigated focusing on electrochemical principles to form inhibiting effects on planktonic and/or biofilm bacteria in water systems. Silver-resistant Escherichia coli and silver-sensitive E. coli were...... used for the evaluation of inhibiting effects and the inhibiting mechanism. For silver-palladium surfaces combined with bacteria in media, the inhibiting effect was a result of electrochemical interactions and/or electrical field, and in some specific media, such as ammonium containing, undesired...... silver ions release can occur from their Surfaces. For silver-bearing stainless steels, the inhibiting effect can only be explained by high local silver ions release. and can be limited or deactivated dependent on the specific environment. (c) 2008 Elsevier Ltd. All rights reserved....

  6. Coronatine inhibits stomatal closure and delays hypersensitive response cell death induced by nonhost bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Seonghee Lee

    2013-02-01

    Full Text Available Pseudomonas syringae is the most widespread bacterial pathogen in plants. Several strains of P. syringae produce a phytotoxin, coronatine (COR, which acts as a jasmonic acid mimic and inhibits plant defense responses and contributes to disease symptom development. In this study, we found that COR inhibits early defense responses during nonhost disease resistance. Stomatal closure induced by a nonhost pathogen, P. syringae pv. tabaci, was disrupted by COR in tomato epidermal peels. In addition, nonhost HR cell death triggered by P. syringae pv. tabaci on tomato was remarkably delayed when COR was supplemented along with P. syringae pv. tabaci inoculation. Using isochorismate synthase (ICS-silenced tomato plants and transcript profiles of genes in SA- and JA-related defense pathways, we show that COR suppresses SA-mediated defense during nonhost resistance.

  7. The bacterial fimbrial tip acts as a mechanical force sensor.

    Directory of Open Access Journals (Sweden)

    Pavel Aprikian

    2011-05-01

    Full Text Available There is increasing evidence that the catch bond mechanism, where binding becomes stronger under tensile force, is a common property among non-covalent interactions between biological molecules that are exposed to mechanical force in vivo. Here, by using the multi-protein tip complex of the mannose-binding type 1 fimbriae of Escherichia coli, we show how the entire quaternary structure of the adhesive organella is adapted to facilitate binding under mechanically dynamic conditions induced by flow. The fimbrial tip mediates shear-dependent adhesion of bacteria to uroepithelial cells and demonstrates force-enhanced interaction with mannose in single molecule force spectroscopy experiments. The mannose-binding, lectin domain of the apex-positioned adhesive protein FimH is docked to the anchoring pilin domain in a distinct hooked manner. The hooked conformation is highly stable in molecular dynamics simulations under no force conditions but permits an easy separation of the domains upon application of an external tensile force, allowing the lectin domain to switch from a low- to a high-affinity state. The conformation between the FimH pilin domain and the following FimG subunit of the tip is open and stable even when tensile force is applied, providing an extended lever arm for the hook unhinging under shear. Finally, the conformation between FimG and FimF subunits is highly flexible even in the absence of tensile force, conferring to the FimH adhesin an exploratory function and high binding rates. The fimbrial tip of type 1 Escherichia coli is optimized to have a dual functionality: flexible exploration and force sensing. Comparison to other structures suggests that this property is common in unrelated bacterial and eukaryotic adhesive complexes that must function in dynamic conditions.

  8. A search for new mechanisms to inhibit plasmid conjugation

    OpenAIRE

    Getino Redondo, María

    2011-01-01

    Infections due to antibiotic-resistant (AbR) bacteria are a major cause of morbidity and mortality throughout the world. In addition, the number of new antibiotics being developed has plummeted. Although resistance genes can disseminate by any horizontal gene transfer mechanism, the vast majority of reports of bacterial gene transfer in the environment involve conjugation. Our group developed a method for high-throughput analysis of conjugation. This method was used to check for host genes in...

  9. Mechanisms of Rose Bengal inhibition on SecA ATPase and ion channel activities.

    Science.gov (United States)

    Hsieh, Ying-Hsin; Huang, Ying-Ju; Jin, Jin-Shan; Yu, Liyan; Yang, Hsiuchin; Jiang, Chun; Wang, Binghe; Tai, Phang C

    2014-11-14

    SecA is an essential protein possessing ATPase activity in bacterial protein translocation for which Rose Bengal (RB) is the first reported sub-micromolar inhibitor in ATPase activity and protein translocation. Here, we examined the mechanisms of inhibition on various forms of SecA ATPase by conventional enzymatic assays, and by monitoring the SecA-dependent channel activity in the semi-physiological system in cells. We build on the previous observation that SecA with liposomes form active protein-conducting channels in the oocytes. Such ion channel activity is enhanced by purified Escherichia coli SecYEG-SecDF·YajC liposome complexes. Inhibition by RB could be monitored, providing correlation of in vitro activity and intact cell functionality. In this work, we found the intrinsic SecA ATPase is inhibited by RB competitively at low ATP concentration, and non-competitively at high ATP concentrations while the translocation ATPase with precursors and SecYEG is inhibited non-competitively by RB. The Inhibition by RB on SecA channel activity in the oocytes with exogenous ATP-Mg(2+), mimicking translocation ATPase activity, is also non-competitive. The non-competitive inhibition on channel activity has also been observed with SecA from other bacteria which otherwise would be difficult to examine without the cognate precursors and membranes. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. A novel mechanism of bacterial toxin transfer within host blood cell-derived microvesicles.

    Directory of Open Access Journals (Sweden)

    Anne-lie Ståhl

    2015-02-01

    Full Text Available Shiga toxin (Stx is the main virulence factor of enterohemorrhagic Escherichia coli, which are non-invasive strains that can lead to hemolytic uremic syndrome (HUS, associated with renal failure and death. Although bacteremia does not occur, bacterial virulence factors gain access to the circulation and are thereafter presumed to cause target organ damage. Stx was previously shown to circulate bound to blood cells but the mechanism by which it would potentially transfer to target organ cells has not been elucidated. Here we show that blood cell-derived microvesicles, shed during HUS, contain Stx and are found within patient renal cortical cells. The finding was reproduced in mice infected with Stx-producing Escherichia coli exhibiting Stx-containing blood cell-derived microvesicles in the circulation that reached the kidney where they were transferred into glomerular and peritubular capillary endothelial cells and further through their basement membranes followed by podocytes and tubular epithelial cells, respectively. In vitro studies demonstrated that blood cell-derived microvesicles containing Stx undergo endocytosis in glomerular endothelial cells leading to cell death secondary to inhibited protein synthesis. This study demonstrates a novel virulence mechanism whereby bacterial toxin is transferred within host blood cell-derived microvesicles in which it may evade the host immune system.

  11. Calcium phosphate coating containing silver shows high antibacterial activity and low cytotoxicity and inhibits bacterial adhesion

    Energy Technology Data Exchange (ETDEWEB)

    Ando, Yoshiki, E-mail: andoy@jmmc.jp [Division of Microbiology, Department of Pathology and Microbiology, Faculty of Medicine, Saga University, 5-1-1 Nabeshima, Saga 849-8501 (Japan); Research Department, Japan Medical Materials Corporation, Uemura Nissei Bldg.9F 3-3-31 Miyahara, Yodogawa-ku, Osaka 532-0003 (Japan); Miyamoto, Hiroshi [Division of Microbiology, Department of Pathology and Microbiology, Faculty of Medicine, Saga University, 5-1-1 Nabeshima, Saga 849-8501 (Japan); Noda, Iwao; Sakurai, Nobuko [Research Department, Japan Medical Materials Corporation, Uemura Nissei Bldg.9F 3-3-31 Miyahara, Yodogawa-ku, Osaka 532-0003 (Japan); Akiyama, Tomonori [Division of Microbiology, Department of Pathology and Microbiology, Faculty of Medicine, Saga University, 5-1-1 Nabeshima, Saga 849-8501 (Japan); Yonekura, Yutaka; Shimazaki, Takafumi; Miyazaki, Masaki; Mawatari, Masaaki; Hotokebuchi, Takao [Department of Orthopaedic Surgery, Faculty of Medicine, Saga University, 5-1-1 Nabeshima, Saga 849-8501 (Japan)

    2010-01-01

    Surgical site infection is one of the serious complications of orthopedic implants. In order to reduce the incidence of implant-associated infections, we developed a novel coating technology of calcium phosphate (CP) containing silver (Ag), designated Ag-CP coating, using a thermal spraying technique. In this study, we evaluated the antibacterial efficacy and biological safety of this coating. In vitro antibacterial activity tests showed that the growths of Escherichia coli, Staphylococcus aureus and methicillin-resistant S. aureus (MRSA) are completely suppressed on Ag-CP coating. In vitro bacterial adherence tests revealed that the number of adherent bacteria on the surface of this coating is significantly less (p < 0.02) than that on the surface of the CP coating. Moreover, the Ag-CP coating completely inhibits MRSA adhesion [<10 colony-forming units (CFU)] when 10{sup 2} CFU MRSA is inoculated. On the other hand, V79 Chinese hamster lung cells were found to grow on the Ag-CP coating as well as on the CP coating in a cytotoxicity test. These results indicate that the Ag-CP coating on the surface of orthopedic implants exhibits antibacterial activity and inhibits bacterial adhesion without cytotoxicity.

  12. Inhibition of bacterial growth by different mixtures of propofol and thiopentone

    Directory of Open Access Journals (Sweden)

    K.E. Joubert

    2005-06-01

    Full Text Available Propofol is, as a result of its formulation, an ideal bacterial and yeast culture medium. An outbreak of sepsis in humans and an increase in wound infections in dogs has been ascribed to the use of propofol. It has been previously reported that a 1:1 mixture of propofol and thiopentone has bactericidal properties. This study was undertaken to determine if further serial mixtures of propofol and thiopentone maintained the bactericidal properties. Mixtures of 1:1 (solution A, 5:1 (solution B, 10:1 (solution C, 50:1 (solution D and 100:1 (solution E of 1 % propofol to 2.5 % thiopentone, 2.5 % thiopentone (solution T, 1 % propofol (solution P and saline (solution S were prepared and inoculated with between 105 and 106 colony-forming units of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa and Candida albicans. A sample was withdrawn from each solution at 0, 1, 6, 12, 48 and 120 hours after inoculation and a bacterial count was performed. This study showed that thiopentone and solution A behaved in similar fashion by inhibiting bacterial growth and was bactericidal after 48 hours. Solution B was not bactericidal against S. aureus and C. albicans. Propofol and solutions D and E all supported growth of all the organisms tested. These data indicate that mixtures of propofol and thiopentone at a ratio less than 1:1 do not maintain the bactericidal properties.

  13. Chitosanase purified from bacterial isolate Bacillus licheniformis of ruined vegetables displays broad spectrum biofilm inhibition.

    Science.gov (United States)

    Muslim, Sahira Nsayef; Al-Kadmy, Israa M S; Hussein, Nadheema Hammood; Mohammed Ali, Alaa Naseer; Taha, Buthainah Mohammed; Aziz, Sarah Naji; Kheraif, Abdulaziz Abdullah Al; Divakar, Darshan Devang; Ramakrishnaiah, Ravikumar

    2016-11-01

    A number of bacterial species produces chitosanases which has variety of applications because of its high biodegradability, non-toxicity and antimicrobial assets. In the present study chitosanase is purified from new bacterial species Bacillus licheniformis from spoiled vegetable. This novel strain of Bacillus licheniformis isolated from spoilt cucumber and pepper samples has the ability to produce the chitosanase enzyme when grown on chitosan substrate. Study also examined its antibiofilm properties against diverse bacterial species with biofilm forming ability. The purified chitosanase inhibited the biofilm formation ability for all Gram-negative and Gram-positive biofilm-forming bacteria [biofilm producers] tested in this study in congo red agar and microtiter plate's methods. Highly antibiofilm activity of chitosanase was recorded against Pseudomonas aeruginosa followed by Klebsiella pneumoniae with reduction of biofilm formation upto 22 and 29%, respectively compared with [100] % of control. Biofilm formation has multiple role including ability to enhance resistance and self-protection from external stress. This chitosanase has promising benefit as antibiofilm agent against biofilm forming pathogenic bacteria and has promising application as alternative antibiofilm agents to combat the growing number of multidrug resistant pathogen-associated infections, especially in situation where biofilms are involved. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Inhibition of bacterial motility and spreading via release of cranberry derived materials from silicone substrates.

    Science.gov (United States)

    Chan, Michelle; Hidalgo, Gabriela; Asadishad, Bahareh; Almeida, Sergio; Muja, Naser; Mohammadi, Maziar Shah; Nazhat, Showan N; Tufenkji, Nathalie

    2013-10-01

    The motility of bacteria plays a key role in their colonization of surfaces during infection. Derivatives of cranberry fruit have been shown to interfere with bacterial motility. Herein, we report on the incorporation of cranberry derived materials (CDMs) into silicone substrates with the aim of impairing bacterial pathogen motility and spreading on the substrate surface. The release of CDMs from the silicone substrates when soaking in an aqueous medium was quantified for a period of 24h. Next, we showed that CDMs released from two silicone substrates remain bioactive as they downregulate the expression of the flagellin gene of two key uropathogens - Escherichia coli CFT073 and Proteus mirabilis HI4320. Furthermore, we demonstrate that CDM-modified silicone inhibits the swarming motility of P. mirabilis, an aggressive swarmer. The bioactive, CDM-modified substrates can find broad applications in the medical device and food industries where the impairment of bacterial colonization of surfaces is of paramount importance. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Zinc-Triggered Hydrogelation of Self-assembled Small Molecules to Inhibit Bacterial Growth

    Science.gov (United States)

    Xu, Chao; Cai, Yanbin; Ren, Chunhua; Gao, Jie; Hao, Jihui

    2015-01-01

    There is a significant need to develop antibacterial materials that could be applied locally and directly to the places surrounded by large amount of bacteria, in order to address the problems of bacterial antibiotic-resistance or irreversible biofilm formation. Hydrogels are thought to be suitable candidates due to their versatile applications in biomedical field. Among them, small molecular hydrogels have been paid lots of attention because they are easy to design and fabricate and often sensitive to external stimuli. Meanwhile, the antibacterial activity of metal ions are attracting more and more attention because resistance to them are not yet found within bacteria. We therefore designed the zinc ion binding peptide of Nap-GFFYGGGHGRGD, who can self-assemble into hydrogels after binds Zn2+ and inhibit the growth of bacteria due to the excellent antibacterial activity of Zn2+. Upon the addition of zinc ions, solutions containing Nap-GFFYGGGHGRGD transformed into supramolecular hydrogels composed of network of long nano-fibers. Bacterial tests revealed an antibacterial effect of the zinc triggered hydrogels on E. coli. The studied small molecular hydrogel shows great potential in locally addressing bacterial infections.

  16. Inhibited Bacterial Adhesion and Biofilm Formation on Quaternized Chitosan-Loaded Titania Nanotubes with Various Diameters

    Directory of Open Access Journals (Sweden)

    Wen-tao Lin

    2016-03-01

    Full Text Available Titania nanotube-based local drug delivery is an attractive strategy for combating implant-associated infection. In our previous study, we demonstrated that the gentamicin-loaded nanotubes could dramatically inhibit bacterial adhesion and biofilm formation on implant surfaces. Considering the overuse of antibiotics may lead to the evolution of antibiotic-resistant bacteria, we synthesized a new quaternized chitosan derivative (hydroxypropyltrimethyl ammonium chloride chitosan, HACC with a 27% degree of substitution (DS; referred to as 27% HACC that had a strong antibacterial activity and simultaneously good biocompatibility with osteogenic cells. Titania nanotubes with various diameters (80, 120, 160, and 200 nm and 200 nm length were loaded with 2 mg of HACC using a lyophilization method and vacuum drying. Two standard strain, methicillin-resistant Staphylococcus aureus (American Type Culture Collection 43300 and Staphylococcus epidermidis (American Type Culture Collection 35984, and two clinical isolates, S. aureus 376 and S. epidermidis 389, were selected to investigate the bacterial adhesion at 6 h and biofilm formation at 24, 48, and 72 h on the HACC-loaded nanotubes (NT-H using the spread plate method, confocal laser scanning microscopy (CLSM, and scanning electron microscopy (SEM. Smooth titanium (Smooth Ti was also investigated and compared. We found that NT-H could significantly inhibit bacterial adhesion and biofilm formation on its surface compared with Smooth Ti, and the NT-H with 160 nm and 200 nm diameters had stronger antibacterial activity because of the extended HACC release time of NT-H with larger diameters. Therefore, NT-H can significantly improve the antibacterial ability of orthopedic implants and provide a promising strategy to prevent implant-associated infections.

  17. A new regulatory mechanism for bacterial lipoic acid synthesis.

    Science.gov (United States)

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  18. Mechanism of biological denitrification inhibition: procyanidins induce an allosteric transition of the membrane-bound nitrate reductase through membrane alteration.

    Science.gov (United States)

    Bardon, Clément; Poly, Franck; Piola, Florence; Pancton, Muriel; Comte, Gilles; Meiffren, Guillaume; Haichar, Feth el Zahar

    2016-05-01

    Recently, it has been shown that procyanidins from Fallopia spp. inhibit bacterial denitrification, a phenomenon called biological denitrification inhibition (BDI). However, the mechanisms involved in such a process remain unknown. Here, we investigate the mechanisms of BDI involving procyanidins, using the model strain Pseudomonas brassicacearum NFM 421. The aerobic and anaerobic (denitrification) respiration, cell permeability and cell viability of P. brassicacearum were determined as a function of procyanidin concentration. The effect of procyanidins on the bacterial membrane was observed using transmission electronic microscopy. Bacterial growth, denitrification, NO3- and NO2-reductase activity, and the expression of subunits of NO3- (encoded by the gene narG) and NO2-reductase (encoded by the gene nirS) under NO3 or NO2 were measured with and without procyanidins. Procyanidins inhibited the denitrification process without affecting aerobic respiration at low concentrations. Procyanidins also disturbed cell membranes without affecting cell viability. They specifically inhibited NO3- but not NO2-reductase.Pseudomonas brassicacearum responded to procyanidins by over-expression of the membrane-bound NO3-reductase subunit (encoded by the gene narG). Our results suggest that procyanidins can specifically inhibit membrane-bound NO3-reductase inducing enzymatic conformational changes through membrane disturbance and that P. brassicacearum responds by over-expressing membrane-bound NO3-reductase. Our results lead the way to a better understanding of BDI. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Mechanisms of caffeine-induced inhibition of UVB carcinogenesis

    Directory of Open Access Journals (Sweden)

    Allan H Conney

    2013-06-01

    Full Text Available Sunlight-induced nonmelanoma skin cancer is the most prevalent cancer in the United States with more than 2 million cases per year. Several studies have shown an inhibitory effect of caffeine administration on UVB-induced skin cancer in mice, and these studies are paralleled by epidemiology studies that indicate an inhibitory effect of coffee drinking on nonmelanoma skin cancer in humans. Strikingly, decaffeinated coffee consumption had no such inhibitory effect.Mechanism studies indicate that caffeine has a sunscreen effect that inhibits UVB-induced formation of thymine dimers and sunburn lesions in the epidermis of mice. In addition, caffeine administration has a biological effect that enhances UVB-induced apoptosis thereby enhancing the elimination of damaged precancerous cells, and caffeine administration also enhances apoptosis in tumors. Caffeine administration enhances UVB-induced apoptosis by p53-dependent and p53-independent mechanisms. Exploration of the p53-independent effect indicated that caffeine administration enhanced UVB-induced apoptosis by inhibiting the UVB-induced increase in ATR-mediated formation of phospho-Chk1 (Ser345 and abolishing the UVB-induced decrease in cyclin B1 which resulted in caffeine-induced premature and lethal mitosis in mouse skin. In studies with cultured primary human keratinocytes, inhibition of ATR with siRNA against ATR inhibited Chk1 phosphorylation and enhanced UVB-induced apoptosis. Transgenic mice with decreased epidermal ATR function that were irradiated chronically with UVB had 69% fewer tumors at the end of the study compared with irradiated littermate controls with normal ATR function. These results, which indicate that genetic inhibition of ATR (like pharmacologic inhibition of ATR via caffeine inhibits UVB-induced carcinogenesis and supports the concept that ATR-mediated phosphorylation of Chk1 is an important target for caffeine’s inhibitory effect on UVB-induced carcinogenesis.

  20. Ingestion of bacterial lipopolysaccharide inhibits peripheral taste responses to sucrose in mice

    Science.gov (United States)

    Zhu, Xiaobin; He, Lianying; McCluskey, Lynnette Phillips

    2013-01-01

    A fundamental role of the taste system is to discriminate between nutritive and toxic foods. However, it is unknown whether bacterial pathogens that might contaminate food and water modulate the transmission of taste input to the brain. We hypothesized that exogenous, bacterially-derived lipopolysaccharide (LPS), modulates neural responses to taste stimuli. Neurophysiological responses from the chorda tympani nerve, which innervates taste cells on the anterior tongue, were unchanged by acute exposure to LPS. Instead, neural responses to sucrose were selectively inhibited in mice that drank LPS during a single overnight period. Decreased sucrose sensitivity appeared 7 days after LPS ingestion, in parallel with decreased lingual expression of Tas1r2 and Tas1r3 transcripts, which are translated to T1R2+T1R3 subunits forming the sweet taste receptor. Tas1r2 and Tas1r3 mRNA expression levels and neural responses to sucrose were restored by 14 days after LPS consumption. Ingestion of LPS, rather than contact with taste receptor cells, appears to be necessary to suppress sucrose responses. Furthermore, mice lacking the Toll-like receptor (TLR) 4 for LPS were resistant to neurophysiological changes following LPS consumption. These findings demonstrate that ingestion of LPS during a single period specifically and transiently inhibits neural responses to sucrose. We suggest that LPS drinking initiates TLR4-dependent hormonal signals that downregulate sweet taste receptor genes in taste buds. Delayed inhibition of sweet taste signaling may influence food selection and the complex interplay between gastrointestinal bacteria and obesity. PMID:24215981

  1. Simultaneous Assessment of Acidogenesis-Mitigation and Specific Bacterial Growth-Inhibition by Dentifrices.

    Directory of Open Access Journals (Sweden)

    Sarah Forbes

    Full Text Available Dentifrices can augment oral hygiene by inactivating bacteria and at sub-lethal concentrations may affect bacterial metabolism, potentially inhibiting acidogenesis, the main cause of caries. Reported herein is the development of a rapid method to simultaneously measure group-specific bactericidal and acidogenesis-mitigation effects of dentifrices on oral bacteria. Saliva was incubated aerobically and anaerobically in Tryptone Soya Broth, Wilkins-Chalgren Broth with mucin, or artificial saliva and was exposed to dentifrices containing triclosan/copolymer (TD; sodium fluoride (FD; stannous fluoride and zinc lactate (SFD1; or stannous fluoride, zinc lactate and stannous chloride (SFD2. Minimum inhibitory concentrations (MIC were determined turbidometrically whilst group-specific minimum bactericidal concentrations (MBC were assessed using growth media and conditions selective for total aerobes, total anaerobes, streptococci and Gram-negative anaerobes. Minimum acid neutralization concentration (MNC was defined as the lowest concentration of dentifrice at which acidification was inhibited. Differences between MIC and MNC were calculated and normalized with respect to MIC to derive the combined inhibitory and neutralizing capacity (CINC, a cumulative measure of acidogenesis-mitigation and growth inhibition. The overall rank order for growth inhibition potency (MIC under aerobic and anaerobic conditions was: TD> SFD2> SFD1> FD. Acidogenesis-mitigation (MNC was ordered; TD> FD> SFD2> SFD1. CINC was ordered TD> FD> SFD2> SFD1 aerobically and TD> FD> SFD1> SFD2 anaerobically. With respect to group-specific bactericidal activity, TD generally exhibited the greatest potency, particularly against total aerobes, total anaerobes and streptococci. This approach enables the rapid simultaneous evaluation of acidity mitigation, growth inhibition and specific antimicrobial activity by dentifrices.

  2. Effective inhibition of bacterial respiration and growth by CuO microspheres composed of thin nanosheets.

    Science.gov (United States)

    Wahab, Rizwan; Khan, Shams Tabrez; Dwivedi, Sourabh; Ahamed, Maqusood; Musarrat, Javed; Al-Khedhairy, Abdulaziz A

    2013-11-01

    This study describes the synthesis, characterization and biocidal potential of copper oxide micro-spheres composed of thin sheets (CuOMSs-Ths). Microscopic observations of synthesized CuOMSs-Ths revealed the clusters of thin sheets arranged in small flower like micro-spheres. Diameter of each micro-sphere was determined in the range of 2-3 μm, whereas the size of each sheet was ∼ 80 nm. These micro-flowers like nanostructures were synthesized using copper nitrate hexahydrate and sodium hydroxide via solution process. The CuOMSs-Ths exhibited a broad-spectrum anti-bacterial activity involving significant growth inhibition of Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus and Micrococcus luteus. The IC50 values of these engineered NPs against E. coli, P. aeruginosa, S. aureus and M. luteus were determined to be 195, 200, 131 and 184 μg/ml, respectively. Also, the respiration of Gram+ ve organisms (M. luteus and S. aureus) was inhibited significantly (p value growth inhibition occurred at a much greater concentration of 100 μg/ml. The results explicitly demonstrated anti-microbial activity of CuOMSs-Ths with a higher level of toxicity against the Gram+ ve vis-a-vis Gram- ve bacteria. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Mechanism of Triplet Energy Transfer in Photosynthetic Bacterial Reaction Centers.

    Science.gov (United States)

    Mandal, Sarthak; Carey, Anne-Marie; Locsin, Joshua; Gao, Bing-Rong; Williams, JoAnn C; Allen, James P; Lin, Su; Woodbury, Neal W

    2017-07-13

    In purple bacterial reaction centers, triplet excitation energy transfer occurs from the primary donor P, a bacteriochlorophyll dimer, to a neighboring carotenoid to prevent photodamage from the generation of reactive oxygen species. The B B bacteriochlorophyll molecule that lies between P and the carotenoid on the inactive electron transfer branch is involved in triplet energy transfer between P and the carotenoid. To expand the high-resolution spectral and kinetic information available for describing the mechanism, we investigated the triplet excited state formation and energy transfer pathways in the reaction center of Rhodobacter sphaeroides using pump-probe transient absorption spectroscopy over a broad spectral region on the nanosecond to microsecond time scale at both room temperature and at 77 K. Wild-type reaction centers were compared with a reaction center mutant (M182HL) in which B B is replaced by a bacteriopheophytin (Φ), as well as to reaction centers that lack the carotenoid. In wild-type reaction centers, the triplet energy transfer efficiency from P to the carotenoid was essentially unity at room temperature and at 77 K. However, in the M182HL mutant reaction centers, both the rate and efficiency of triplet energy transfer were decreased at room temperature, and at 77 K, no triplet energy transfer was observed, attributable to a higher triplet state energy of the bacteriopheophytin that replaces bacteriochlorophyll in this mutant. Finally, detailed time-resolved spectral analysis of P, carotenoid, and B B (Φ in the M182HL mutant) reveals that the triplet state of the carotenoid is coupled fairly strongly to the bridging intermediate B B in wild-type and Φ in the M182HL mutant, a fact that is probably responsible for the lack of any obvious intermediate 3 B B / 3 Φ transient formation during triplet energy transfer.

  4. Turgor Pressure and Possible Constriction Mechanisms in Bacterial Division

    Directory of Open Access Journals (Sweden)

    Masaki Osawa

    2018-01-01

    Full Text Available Bacterial cytokinesis begins with the assembly of FtsZ into a Z ring at the center of the cell. The Z-ring constriction in Gram-negative bacteria may occur in an environment where the periplasm and the cytoplasm are isoosmotic, but in Gram-positive bacteria the constriction may have to overcome a substantial turgor pressure. We address three potential sources of invagination force. (1 FtsZ itself may generate force by curved protofilaments bending the attached membrane. This is sufficient to constrict liposomes in vitro. However, this force is on the order of a few pN, and would not be enough to overcome turgor. (2 Cell wall (CW synthesis may generate force by pushing the plasma membrane from the outside. However, this would probably require some kind of Brownian ratchet to separate the CW and membrane sufficiently to allow a glycan strand to slip in. The elastic element is not obvious. (3 Excess membrane production has the potential to contribute significantly to the invagination force. If the excess membrane is produced under the CW, it would force the membrane to bleb inward. We propose here that a combination of FtsZ pulling from the inside, and excess membrane pushing membrane inward may generate a substantial constriction force at the division site. This combined force generation mechanism may be sufficient to overcome turgor pressure. This would abolish the need for a Brownian ratchet for CW growth, and would permit CW to operate by reinforcing the constrictions generated by FtsZ and excess membrane.

  5. Inhibition of bacterial oxidation of ferrous iron by lead nitrate in sulfate-rich systems

    Science.gov (United States)

    Wang, Hongmei; Gong, Linfeng; Cravotta,, Charles A.; Yang, Xiaofen; Tuovinen, Olli H.; Dong, Hailiang; Fu, Xiang

    2013-01-01

    Inhibition of bacterial oxidation of ferrous iron (Fe(II)) by Pb(NO3)2 was investigated with a mixed culture of Acidithiobacillus ferrooxidans. The culture was incubated at 30 °C in ferrous-sulfate medium amended with 0–24.2 mM Pb(II) added as Pb(NO3)2. Anglesite (PbSO4) precipitated immediately upon Pb addition and was the only solid phase detected in the abiotic controls. Both anglesite and jarosite (KFe3(SO4)2(OH)6) were detected in inoculated cultures. Precipitation of anglesite maintained dissolved Pb concentrations at 16.9–17.6 μM regardless of the concentrations of Pb(NO3)2 added. Fe(II) oxidation was suppressed by 24.2 mM Pb(NO3)2 addition even when anglesite was removed before inoculation. Experiments with 0–48 mM KNO3 demonstrated that bacterial Fe(II) oxidation decreased as nitrate concentration increased. Therefore, inhibition of Fe(II) oxidation at 24.2 mM Pb(NO3)2 addition resulted from nitrate toxicity instead of Pb addition. Geochemical modeling that considered the initial precipitation of anglesite to equilibrium followed by progressive oxidation of Fe(II) and the precipitation of jarosite and an amorphous iron hydroxide phase, without allowing plumbojarosite to precipitate were consistent with the experimental time-series data on Fe(II) oxidation under biotic conditions. Anglesite precipitation in mine tailings and other sulfate-rich systems maintains dissolved Pb concentrations below the toxicity threshold of A. ferrooxidans.

  6. Receptor interacting protein kinase-2 inhibition by CYLD impairs anti-bacterial immune responses in macrophages

    Directory of Open Access Journals (Sweden)

    Katharina eWex

    2016-01-01

    Full Text Available Upon infection with intracellular bacteria, nucleotide oligomerization domain protein 2 (NOD2 recognizes bacterial muramyl dipeptide and binds, subsequently, to receptor-interacting serine/threonine kinase 2 (RIPK2. RIPK2 mediates the activation of immune responses via the nuclear factor-κB (NF-κB and extracellular-signal regulated kinase (ERK pathways. Previously, it has been shown that RIPK2 activation dependens on its K63-ubiquitination by the E3 ligases pellino-3 and ITCH, whereas the deubiquitinating enzyme A20 counter-regulates RIPK2 activity by cleaving K63-polyubiquitin chains from RIPK2. Here, we newly identify the deubiquitinating enzyme CYLD as a new interacting partner and inhibitor of RIPK2. We show that CYLD binds to and removes K63-polyubiquitin chains from RIPK2 in Listeria monocytogenes (Lm infected bone-marrow-derived macrophages (BMDM. CYLD-mediated K63-deubiquitination of RIPK2 resulted in an impaired activation of both NF-κB and ERK1/2 pathways, reduced production of proinflammatory cytokines (IL-6, IL-12, anti-listerial ROS and NO, and, finally, impaired pathogen control. In turn, RIPK2 inhibition by siRNA prevented activation of NF-κB and ERK1/2 and completely abolished the protective effect of CYLD-deficiency with respect to the production of IL-6, NO, ROS and pathogen control. Noteworthy, CYLD also inhibited autophagy of Listeria in a RIPK2-ERK1/2 dependent manner.The protective function of CYLD-deficiency was dependent on IFN-γ pre-stimulation of infected macrophages. Interestingly, the reduced NF-κB activation in CYLD-expressing macrophages limited the protective effect of IFN-γ by reducing NF-κB-dependent STAT1 activation. Taken together, our study identifies CYLD as an important inhibitor of RIPK2-dependent anti-bacterial immune responses in macrophages.

  7. Effect of chitosan solution on the inhibition of Acidovorax citrulli causing bacterial fruit blotch of watermelon.

    Science.gov (United States)

    Li, Bin; Shi, Yu; Shan, Changlin; Zhou, Qing; Ibrahim, Muhammad; Wang, Yanli; Wu, Guoxing; Li, Hongye; Xie, Guanlin; Sun, Guochang

    2013-03-30

    The production of watermelon in China has been seriously hampered by fruit blotch disease and limited control measures are now applied. Chitosan has been employed to control a variety of plant diseases and is considered to be the most promising biochemical to control this disease. The in vitro antibacterial effect of chitosan and its ability in protection of watermelon seedlings from bacterial fruit blotch were evaluated. Results showed that three types of chitosan, in particular, chitosan A at 0.40 mg mL⁻¹ significantly inhibited the growth of Acidovorax citrulli. The antibacterial activity of chitosan A was affected by chitosan concentration and incubation time. The direct antibacterial activity of chitosan may be attributed to membrane lysis evidenced by transmission electron microscopic observation. The disease index of watermelon seedlings planted in soil and the death rate of seedlings planted in perlite were significantly reduced by chitosan A at 0.40 mg mL⁻¹ compared to the pathogen control. Fresh and dry weight of watermelon seedlings planted in soil was increased by chitosan seed treatment, but not by chitosan leaf spraying. The results indicated that chitosan solution may have a potential in controlling bacterial fruit blotch of watermelon. © 2013 Society of Chemical Industry.

  8. Sulforaphane inhibits multiple inflammasomes through an Nrf2-independent mechanism.

    Science.gov (United States)

    Greaney, Allison J; Maier, Nolan K; Leppla, Stephen H; Moayeri, Mahtab

    2016-01-01

    The inflammasomes are intracellular complexes that have an important role in cytosolic innate immune sensing and pathogen defense. Inflammasome sensors detect a diversity of intracellular microbial ligands and endogenous danger signals and activate caspase-1, thus initiating maturation and release of the proinflammatory cytokines interleukin-1β and interleukin-18. These events, although crucial to the innate immune response, have also been linked to the pathology of several inflammatory and autoimmune disorders. The natural isothiocyanate sulforaphane, present in broccoli sprouts and available as a dietary supplement, has gained attention for its antioxidant, anti-inflammatory, and chemopreventive properties. We discovered that sulforaphane inhibits caspase-1 autoproteolytic activation and interleukin-1β maturation and secretion downstream of the nucleotide-binding oligomerization domain-like receptor leucine-rich repeat proteins NLRP1 and NLRP3, NLR family apoptosis inhibitory protein 5/NLR family caspase-1 recruitment domain-containing protein 4 (NAIP5/NLRC4), and absent in melanoma 2 (AIM2) inflammasome receptors. Sulforaphane does not inhibit the inflammasome by direct modification of active caspase-1 and its mechanism is not dependent on protein degradation by the proteasome or de novo protein synthesis. Furthermore, sulforaphane-mediated inhibition of the inflammasomes is independent of the transcription factor nuclear factor erythroid-derived 2-like factor 2 (Nrf2) and the antioxidant response-element pathway, to which many of the antioxidant and anti-inflammatory effects of sulforaphane have been attributed. Sulforaphane was also found to inhibit cell recruitment to the peritoneum and interleukin-1β secretion in an in vivo peritonitis model of acute gout and to reverse NLRP1-mediated murine resistance to Bacillus anthracis spore infection. These findings demonstrate that sulforaphane inhibits the inflammasomes through a novel mechanism and contributes to

  9. Mechanical transmission and survival of bacterial wilt on enset ...

    African Journals Online (AJOL)

    The transmission of enset bacterial wilt with contaminated knives and the survival of the causal agent in soil and enset plant debris was studied at the Awassa Agricultural Research Center, Awassa, Ethiopia. Contaminated knives were found to transmit the pathogen from infected to healthy plants. Disease symptoms were ...

  10. Possible mechanisms underlying bacterial-viral interactions in ...

    African Journals Online (AJOL)

    Materials and method: For this review, PubMed and Google search engines were used to select about 45 publications on bacterial-viral interactions in respiratory conditions. Studies on animal models were also included in the review. The publications were compared and summarized using a narrative review approach and ...

  11. Exploration into the spatial and temporal mechanisms of bacterial polarity

    DEFF Research Database (Denmark)

    Ebersbach, Gitte; Jacobs-Wagner, Christine; Charbon, Gitte Ebersbach

    2007-01-01

    The recognition of bacterial asymmetry is not new: the first high-resolution microscopy studies revealed that bacteria come in a multitude of shapes and sometimes carry asymmetrically localized external structures such as flagella on the cell surface. Even so, the idea that bacteria could have an...

  12. Optimization and integration of nanosilver on polycaprolactone nanofibrous mesh for bacterial inhibition and wound healing in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Liu M

    2017-09-01

    Full Text Available Menglong Liu,1,2 Gaoxing Luo,1,2 Ying Wang,1,2 Weifeng He,1,2 Tengfei Liu,1,2 Daijun Zhou,1,2 Xiaohong Hu,1,2 Malcolm Xing,1,3 Jun Wu1,2,4 1State Key Laboratory of Trauma, Burn and Combined Injury, Institute of Burn Research, Southwest Hospital, the Third Military Medical University, 2Department of Burns, Chongqing Key Laboratory for Disease Proteomics, Chongqing, People’s Republic of China; 3Department of Mechanical Engineering, University of Manitoba, Winnipeg, MB, Canada; 4Department of Burns, the First Affiliated Hospital of Sun Yat-Sen University, Guangzhou, People’s Republic of China Abstract: Bacterial infection is a major hurdle to wound healing, and the overuse of antibiotics have led to global issue, such as emergence of multidrug-resistant bacteria, even “super bacteria”. On the contrary, nanosilver (NS can kill bacteria without causing resistant bacterial strains. In this study, NS was simply generated in situ on the polycaprolactone (PCL nanofibrous mesh using an environmentally benign and mussel-inspired dopamine (DA. Scanning electron microscopy showed that NS uniformly formed on the nanofibers of PCL mesh. Fourier transform infrared spectroscopy revealed the step-by-step preparation of pristine PCL mesh, including DA coating and NS formation, which were further verified by water contact angle changing from hydrophobic to hydrophilic. To optimize the NS dose, the antibacterial activity of PCL/NS against Staphylococcus aureus, Escherichia coli and Acinetobacter baumannii was detected by bacterial suspension assay, and the cytotoxicity of NS was evaluated using cellular morphology observation and Cell Counting Kit-8 (CCK8 assay. Then, inductively coupled plasma atomic emission spectrometry exhibited that the optimized PCL/NS had a safe and sustained silver release. Moreover, PCL/NS could effectively inhibit bacterial infection in an infectious murine full-thickness skin wound model. As demonstrated by the enhanced level of

  13. Pump-free gradient-based micro-device enables quantitative and high-throughput bacterial growth inhibition analysis.

    Science.gov (United States)

    Ran, Min; Wang, Ying; Wang, Sida; Luo, Chunxiong

    2015-08-01

    Antibiotic susceptibility testing is very important in antibiotic therapy. Traditional methods to determine antibiotic susceptibility include disk diffusion and broth dilution. However, these tests are always labor intensive, time-consuming, and need large amounts of reagents. In this paper, we demonstrated a novel pump-free micro-device that enables quantitative and high-throughput bacterial growth inhibition analysis. This device consists of a series of wells and diffusion-based antibiotic gradient channels. The wells serve as antibiotic sources and buffer sinks, and we could easily observe the bacterial growth in the gradient channels .The design of the multi-wells is adapted to the commercialized multi-channel pipette, which makes it very convenient for loading reagents into the wells. For each assay, only about 20 μL antibiotic solution is needed. As a demonstration, we used both fluorescence images and dark-field images to quantify the bacterial growth inhibition effect under different antibiotics. The quantitative data of bacterial growth inhibition under different antibiotics can be obtained within 3 to 4 h. Considering the simple operation process and the high-throughput and quantitative result this device can offer, it has great potential to be widely used in clinics and may be useful for the study of the kinetics of bacterial growth.

  14. Multiple mechanisms for CRISPR-Cas inhibition by anti-CRISPR proteins.

    Science.gov (United States)

    Bondy-Denomy, Joseph; Garcia, Bianca; Strum, Scott; Du, Mingjian; Rollins, MaryClare F; Hidalgo-Reyes, Yurima; Wiedenheft, Blake; Maxwell, Karen L; Davidson, Alan R

    2015-10-01

    The battle for survival between bacteria and the viruses that infect them (phages) has led to the evolution of many bacterial defence systems and phage-encoded antagonists of these systems. Clustered regularly interspaced short palindromic repeats (CRISPR) and the CRISPR-associated (cas) genes comprise an adaptive immune system that is one of the most widespread means by which bacteria defend themselves against phages. We identified the first examples of proteins produced by phages that inhibit a CRISPR-Cas system. Here we performed biochemical and in vivo investigations of three of these anti-CRISPR proteins, and show that each inhibits CRISPR-Cas activity through a distinct mechanism. Two block the DNA-binding activity of the CRISPR-Cas complex, yet do this by interacting with different protein subunits, and using steric or non-steric modes of inhibition. The third anti-CRISPR protein operates by binding to the Cas3 helicase-nuclease and preventing its recruitment to the DNA-bound CRISPR-Cas complex. In vivo, this anti-CRISPR can convert the CRISPR-Cas system into a transcriptional repressor, providing the first example-to our knowledge-of modulation of CRISPR-Cas activity by a protein interactor. The diverse sequences and mechanisms of action of these anti-CRISPR proteins imply an independent evolution, and foreshadow the existence of other means by which proteins may alter CRISPR-Cas function.

  15. Isoform-Specific Substrate Inhibition Mechanism of Human Tryptophan Hydroxylase.

    Science.gov (United States)

    Tidemand, Kasper D; Peters, Günther H; Harris, Pernille; Stensgaard, Eva; Christensen, Hans E M

    2017-11-21

    Tryptophan hydroxylase (TPH) catalyzes the initial and rate-limiting step in the biosynthesis of serotonin, which is associated with a variety of disorders such as depression and irritable bowel syndrome. TPH exists in two isoforms: TPH1 and TPH2. TPH1 catalyzes the initial step in the synthesis of serotonin in the peripheral tissues, while TPH2 catalyzes this step in the brain. In this study, the steady-state kinetic mechanism for the catalytic domain of human TPH1 has been determined. Varying substrate tryptophan (Trp) and tetrahydrobiopterin (BH 4 ) results in a hybrid Ping Pong-ordered mechanism in which the reaction can either occur through a Ping Pong or a sequential mechanism depending on the concentration of tryptophan. The catalytic domain of TPH1 shares a sequence identity of 81% with TPH2. Despite the high sequence identity, differences in the kinetic parameters of the isoforms have been identified; i.e., only TPH1 displays substrate tryptophan inhibition. This study demonstrates that the difference can be traced to an active site loop which displays different properties in the TPH isoforms. Steady-state kinetic results of the isoforms, and variants with point mutations in a loop lining the active site, show that the kinetic parameters of only TPH1 are significantly changed upon mutations. Mutations in the active site loop of TPH1 result in an increase in the substrate inhibition constant, K i , and therefore turnover rate. Molecular dynamics simulations reveal that this substrate inhibition mechanism occurs through a closure of the cosubstrate, BH 4 , binding pocket, which is induced by Trp binding.

  16. Rapid Inhibition Profiling in Bacillus subtilis to Identify the Mechanism of Action of New Antimicrobials.

    Science.gov (United States)

    Lamsa, Anne; Lopez-Garrido, Javier; Quach, Diana; Riley, Eammon P; Pogliano, Joe; Pogliano, Kit

    2016-08-19

    Increasing antimicrobial resistance has become a major public health crisis. New antimicrobials with novel mechanisms of action (MOA) are desperately needed. We previously developed a method, bacterial cytological profiling (BCP), which utilizes fluorescence microscopy to rapidly identify the MOA of antimicrobial compounds. BCP is based upon our discovery that cells treated with antibiotics affecting different metabolic pathways generate different cytological signatures, providing quantitative information that can be used to determine a compound's MOA. Here, we describe a system, rapid inhibition profiling (RIP), for creating cytological profiles of new antibiotic targets for which there are currently no chemical inhibitors. RIP consists of the fast, inducible degradation of a target protein followed by BCP. We demonstrate that degrading essential proteins in the major metabolic pathways for DNA replication, transcription, fatty acid biosynthesis, and peptidoglycan biogenesis in Bacillus subtilis rapidly produces cytological profiles closely matching that of antimicrobials targeting the same pathways. Additionally, RIP and antibiotics targeting different steps in fatty acid biosynthesis can be differentiated from each other. We utilize RIP and BCP to show that the antibacterial MOA of four nonsteroidal anti-inflammatory antibiotics differs from that proposed based on in vitro data. RIP is a versatile method that will extend our knowledge of phenotypes associated with inactivating essential bacterial enzymes and thereby allow for screening for molecules that inhibit novel essential targets.

  17. Synthetic furanones inhibit quorum-sensing and enhance bacterial clearance in Pseudomonas aeruginosa lung infection in mice

    DEFF Research Database (Denmark)

    Wu, H.; Song, Z.; Hentzer, Morten

    2004-01-01

    lung infection by targeting bacterial quorum-sensing without directly killing bacteria or inhibiting their growth. Methods: Study I. Mice with Escherichia coli MT102 [luxR-PluxI-gfp(ASV)] lung infection were injected intravenously with N-acyl homoserine lactones with or without furanones to test...

  18. Assembly and Mechanical Properties of the Cargo-Free and Cargo-Loaded Bacterial Nanocompartment Encapsulin

    NARCIS (Netherlands)

    Snijder, Joost|info:eu-repo/dai/nl/338018328; Kononova, Olga; Barbu, Ioana M|info:eu-repo/dai/nl/313937532; Uetrecht, Charlotte|info:eu-repo/dai/nl/304824623; Rurup, W Frederik; Koay, Melissa S T; Burnley, Rebecca J; Cornelissen, Jeroen J L M; Roos, Wouter H; Barsegov, Valeri; Wuite, Gijs J L; Heck, Albert J R|info:eu-repo/dai/nl/105189332

    2016-01-01

    Prokaryotes mostly lack membranous compartments that are typical of eukaryotic cells, but instead, they have various protein-based organelles. These include bacterial microcompartments like the carboxysome and the virus-like nanocompartment encapsulin. Encapsulins have an adaptable mechanism for

  19. Assembly and Mechanical Properties of the Cargo-Free and Cargo Loaded Bacterial Nanocompartment Encapsulin

    NARCIS (Netherlands)

    Snijder, J.; Kononova, O.; Barbu, I.M.; Uetrecht, C.; Rurup, W.F.; Koay, M.S.T.; Cornelissen, J.J.L.M.; Roos, W.H.; Barsegov, V.; Wuite, G.J.L.; Heck, A.J.R.

    2016-01-01

    Prokaryotes mostly lack membranous compartments that are typical of eukaryotic cells, but instead, they have various protein-based organelles. These include bacterial microcompartments like the carboxysome and the virus-like nanocompartment encapsulin. Encapsulins have an adaptable mechanism for

  20. Assembly and mechanical properties of the cargo-free and cargo-loaded bacterial nanocompartment encapsulin

    NARCIS (Netherlands)

    Snijder, Joost; Kononova, Olga; Barbu, Ioana M; Uetrecht, Charlotte; Rurup, W Frederik; Burnley, Rebecca J; Koay, Melissa S T; Cornelissen, Jeroen J L M; Roos, Wouter H; Barsegov, Valeri; Wuite, Gijs J L; Heck, Albert J R

    2016-01-01

    Prokaryotes mostly lack membranous compartments that are typical of eukaryotic cells, but instead they have various protein-based organelles. These include bacterial microcompartments like the carboxysome and the virus-like nanocompartment encapsulin. Encapsulins have an adaptable mechanism for

  1. A new regulatory mechanism for bacterial lipoic acid synthesis

    OpenAIRE

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60?years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physi...

  2. Viral Inhibition of Bacterial Phagocytosis by Human Macrophages: Redundant Role of CD36.

    Directory of Open Access Journals (Sweden)

    Grace E Cooper

    Full Text Available Macrophages are essential to maintaining lung homoeostasis and recent work has demonstrated that influenza-infected lung macrophages downregulate their expression of the scavenger receptor CD36. This receptor has also been shown to be involved in phagocytosis of Streptococcus pneumoniae, a primary agent associated with pneumonia secondary to viral infection. The aim of this study was to investigate the role of CD36 in the effects of viral infection on macrophage phagocytic function. Human monocyte-derived macrophages (MDM were exposed to H3N2 X31 influenza virus, M37 respiratory syncytial virus (RSV or UV-irradiated virus. No infection of MDM was seen upon exposure to UV-irradiated virus but incubation with live X31 or M37 resulted in significant levels of viral detection by flow cytometry or RT-PCR respectively. Infection resulted in significantly diminished uptake of S. pneumoniae by MDM and significantly decreased expression of CD36 at both the cell surface and mRNA level. Concurrently, there was a significant increase in IFNβ gene expression in response to infection and we observed a significant decrease in bacterial phagocytosis (p = 0.031 and CD36 gene expression (p = 0.031 by MDM cultured for 24 h in 50IU/ml IFNβ. Knockdown of CD36 by siRNA resulted in decreased phagocytosis, but this was mimicked by transfection reagent alone. When MDM were incubated with CD36 blocking antibodies no effect on phagocytic ability was observed. These data indicate that autologous IFNβ production by virally-infected cells can inhibit bacterial phagocytosis, but that decreased CD36 expression by these cells does not play a major role in this functional deficiency.

  3. Type I interferon protects against pneumococcal invasive disease by inhibiting bacterial transmigration across the lung.

    Directory of Open Access Journals (Sweden)

    Kim S LeMessurier

    Full Text Available Streptococcus pneumoniae infection is a leading cause of bacterial pneumonia, sepsis and meningitis and is associated with high morbidity and mortality. Type I interferon (IFN-I, whose contribution to antiviral and intracellular bacterial immunity is well established, is also elicited during pneumococcal infection, yet its functional significance is not well defined. Here, we show that IFN-I plays an important role in the host defense against pneumococci by counteracting the transmigration of bacteria from the lung to the blood. Mice that lack the type I interferon receptor (Ifnar1 (-/- or mice that were treated with a neutralizing antibody against the type I interferon receptor, exhibited enhanced development of bacteremia following intranasal pneumococcal infection, while maintaining comparable bacterial numbers in the lung. In turn, treatment of mice with IFNβ or IFN-I-inducing synthetic double stranded RNA (poly(I:C, dramatically reduced the development of bacteremia following intranasal infection with S. pneumoniae. IFNβ treatment led to upregulation of tight junction proteins and downregulation of the pneumococcal uptake receptor, platelet activating factor receptor (PAF receptor. In accordance with these findings, IFN-I reduced pneumococcal cell invasion and transmigration across epithelial and endothelial layers, and Ifnar1 (-/- mice showed overall enhanced lung permeability. As such, our data identify IFN-I as an important component of the host immune defense that regulates two possible mechanisms involved in pneumococcal invasion, i.e. PAF receptor-mediated transcytosis and tight junction-dependent pericellular migration, ultimately limiting progression from a site-restricted lung infection to invasive, lethal disease.

  4. Triclocarban and Triclosan Inhibit Human Aromatase via Different Mechanisms

    Directory of Open Access Journals (Sweden)

    Huitao Li

    2017-01-01

    Full Text Available Human aromatase (CYP19A1 is an important enzyme, which produces estrogen from androgen for maintaining the female reproductive function and pregnancy. Triclocarban and triclosan are antimicrobial chemicals added to personal care, household, and industrial products. They could be endocrine disruptors and may disrupt human CYP19A1 activity. In the present study, we investigated the effects of triclocarban and triclosan on estradiol production and human CYP19A1 activity in JEG-3 cells. Triclocarban and triclosan reduced estradiol production in JEG-3 cells. Triclocarban and triclosan inhibited human CYP19A1 with IC50 values of 15.81 and 6.26 μM, respectively. Triclosan competitively inhibited CYP19A1, while triclocarban noncompetitively inhibited this enzyme. Docking study showed that triclosan bound to the steroid-binding pocket of CYP19A1, while triclocarban was off this target, suggesting a different mechanism. In conclusion, triclocarban and triclosan are inhibitors of human CYP19A1.

  5. Bacterial mechanisms to overcome inhibitory effects of dietary tannins

    NARCIS (Netherlands)

    Smith, A.H.; Zoetendal, E.G.; Mackie, R.I.

    2005-01-01

    High concentrations of tannins in fodder plants inhibit gastrointestinal bacteria and reduce ruminant performance. Increasing the proportion of tannin-resistant bacteria in the rumen protects ruminants from antinutritional effects. The reason for the protective effect is unclear, but could be

  6. The mechanism of OTUB1-mediated inhibition of ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Wiener, Reuven; Zhang, Xiangbin; Wang, Tao; Wolberger, Cynthia (JHU)

    2013-04-08

    Histones are ubiquitinated in response to DNA double-strand breaks (DSB), promoting recruitment of repair proteins to chromatin. UBC13 (also known as UBE2N) is a ubiquitin-conjugating enzyme (E2) that heterodimerizes with UEV1A (also known as UBE2V1) and synthesizes K63-linked polyubiquitin (K63Ub) chains at DSB sites in concert with the ubiquitin ligase (E3), RNF168 (ref. 3). K63Ub synthesis is regulated in a non-canonical manner by the deubiquitinating enzyme, OTUB1 (OTU domain-containing ubiquitin aldehyde-binding protein 1), which binds preferentially to the UBC13-Ub thiolester. Residues amino-terminal to the OTU domain, which had been implicated in ubiquitin binding, are required for binding to UBC13-Ub and inhibition of K63Ub synthesis. Here we describe structural and biochemical studies elucidating how OTUB1 inhibits UBC13 and other E2 enzymes. We unexpectedly find that OTUB1 binding to UBC13-Ub is allosterically regulated by free ubiquitin, which binds to a second site in OTUB1 and increases its affinity for UBC13-Ub, while at the same time disrupting interactions with UEV1A in a manner that depends on the OTUB1 N terminus. Crystal structures of an OTUB1-UBC13 complex and of OTUB1 bound to ubiquitin aldehyde and a chemical UBC13-Ub conjugate show that binding of free ubiquitin to OTUB1 triggers conformational changes in the OTU domain and formation of a ubiquitin-binding helix in the N terminus, thus promoting binding of the conjugated donor ubiquitin in UBC13-Ub to OTUB1. The donor ubiquitin thus cannot interact with the E2 enzyme, which has been shown to be important for ubiquitin transfer. The N-terminal helix of OTUB1 is positioned to interfere with UEV1A binding to UBC13, as well as with attack on the thiolester by an acceptor ubiquitin, thereby inhibiting K63Ub synthesis. OTUB1 binding also occludes the RING E3 binding site on UBC13, thus providing a further component of inhibition. The general features of the inhibition mechanism explain how OTUB1

  7. Turgor Pressure and Possible Constriction Mechanisms in Bacterial Division

    OpenAIRE

    Masaki Osawa; Harold P. Erickson

    2018-01-01

    Bacterial cytokinesis begins with the assembly of FtsZ into a Z ring at the center of the cell. The Z-ring constriction in Gram-negative bacteria may occur in an environment where the periplasm and the cytoplasm are isoosmotic, but in Gram-positive bacteria the constriction may have to overcome a substantial turgor pressure. We address three potential sources of invagination force. (1) FtsZ itself may generate force by curved protofilaments bending the attached membrane. This is sufficient to...

  8. Ketamine inhibits human sperm function by Ca(2+)-related mechanism.

    Science.gov (United States)

    He, Yuanqiao; Zou, Qianxing; Li, Bingda; Chen, Houyang; Du, Xiaohong; Weng, Shiqi; Luo, Tao; Zeng, Xuhui

    2016-09-09

    Ketamine, a dissociative anesthetic, which was widely used in human and animal medicine, has become a popular recreational drug, as it can induce hallucinatory effects. Ketamine abuse can cause serious damage to many aspects of the organism, mainly reflected in the nervous system and urinary system. It has also been reported that ketamine can impair the male genital system. However, the detailed effect of ketamine on human spermatozoa remains unclear. Thus, we investigated the in vitro effects of ketamine on human sperm functions, to elucidate the underlying mechanism. Human sperm were treated in vitro with different concentrations of ketamine (0, 0.125, 0.25, 0.5, 1 g/L). The results showed that 0.25-1 g/L ketamine inhibited sperm total motility, progressive motility and linear velocity, in a dose-dependent manner. In addition, the sperm's ability to penetrate viscous medium and the progesterone-induced acrosome reaction were significantly inhibited by ketamine. Ketamine did not affect sperm viability, capacitation and spontaneous acrosome reaction. The intracellular calcium concentration ([Ca(2+)]i), which is a central factor in the regulation of human sperm function, was decreased by ketamine (0.125-1 g/L) in a dose-dependent manner. Furthermore, the currents of the sperm-specific Ca(2+) channel, CatSper, which modulates Ca(2+) influx in sperm, were inhibited by ketamine (0.125-1 g/L) in a dose-dependent manner. Our findings suggest that ketamine induces its toxic effects on human sperm functions by reducing sperm [Ca(2+)]i through inhibition of CatSper channel. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Mechanism of Deep Brain Stimulation: Inhibition, Excitation, or Disruption?

    Science.gov (United States)

    Chiken, Satomi; Nambu, Atsushi

    2016-06-01

    Deep brain stimulation (DBS), applying high-frequency electrical stimulation to deep brain structures, has now provided an effective therapeutic option for treatment of various neurological and psychiatric disorders. DBS targeting the internal segment of the globus pallidus, subthalamic nucleus, and thalamus is used to treat symptoms of movement disorders, such as Parkinson's disease, dystonia, and tremor. However, the mechanism underlying the beneficial effects of DBS remains poorly understood and is still under debate: Does DBS inhibit or excite local neuronal elements? In this short review, we would like to introduce our recent work on the physiological mechanism of DBS and propose an alternative explanation: DBS dissociates input and output signals, resulting in the disruption of abnormal information flow through the stimulation site. © The Author(s) 2015.

  10. Inhibition of HERG potassium channels by celecoxib and its mechanism.

    Directory of Open Access Journals (Sweden)

    Roman V Frolov

    Full Text Available Celecoxib (Celebrex, a widely prescribed selective inhibitor of cyclooxygenase-2, can modulate ion channels independently of cyclooxygenase inhibition. Clinically relevant concentrations of celecoxib can affect ionic currents and alter functioning of neurons and myocytes. In particular, inhibition of Kv2.1 channels by celecoxib leads to arrhythmic beating of Drosophila heart and of rat heart cells in culture. However, the spectrum of ion channels involved in human cardiac excitability differs from that in animal models, including mammalian models, making it difficult to evaluate the relevance of these observations to humans. Our aim was to examine the effects of celecoxib on hERG and other human channels critically involved in regulating human cardiac rhythm, and to explore the mechanisms of any observed effect on the hERG channels.Celecoxib inhibited the hERG, SCN5A, KCNQ1 and KCNQ1/MinK channels expressed in HEK-293 cells with IC(50s of 6.0 µM, 7.5 µM, 3.5 µM and 3.7 µM respectively, and the KCND3/KChiP2 channels expressed in CHO cells with an IC(50 of 10.6 µM. Analysis of celecoxib's effects on hERG channels suggested gating modification as the mechanism of drug action.The above channels play a significant role in drug-induced long QT syndrome (LQTS and short QT syndrome (SQTS. Regulatory guidelines require that all new drugs under development be tested for effects on the hERG channel prior to first administration in humans. Our observations raise the question of celecoxib's potential to induce cardiac arrhythmias or other channel related adverse effects, and make a case for examining such possibilities.

  11. Bacterial Quorum Sensing Inhibition Activity of the Traditional Chinese Herbs, Ficus carica L. and Perilla frutescens.

    Science.gov (United States)

    Sun, Shiwei; Li, Hui; Zhou, Wanlong; Liu, Ao; Zhu, Hu

    2014-01-01

    Quorum sensing (QS), as the basis of bacterial cell-to-cell communication, is a promising approach to reduce the incidence of multidrug resistance. The objective of this study was to search for novel quorum sensing inhibitors from plants and control detrimental infections. The crude extracts of Ficus carica and Perilla frutescens were examined for their anti-QS properties. Powdered plant samples were treated sequentially with organic solvents of increasing polarity. The extracts of each solvent were concentrated in vacuo to give crude extracts and tested against Chromobacterium violaceum CV026 and Pseudomonas aeruginosa PA01 especially. Anti-QS activity was measured by quantifying violacein production and swarming motility. All extracts of these two plants display anti-QS ability. Interestingly, the extract of F. carica with dichloromethane and of P. frutescens with MeOH exhibited the most pronounced inhibition of QS activity. These two plants can offer bioactive natural products with potential for attenuating pathogens. © 2015 S. Karger AG, Basel.

  12. Inhibition of bacterial growth by tetracycline-impregnated enamel and dentin.

    Science.gov (United States)

    Bjorvatn, K; Skaug, N; Selvig, K A

    1984-12-01

    Tetracyclines can react with enamel and dentin to form relatively insoluble fluorescent compounds. The purpose of this study was to evaluate the possible antimicrobial effect of these reaction products on various microorganisms associated with human dental plaque and periodontal disease. Slabs of native dentin and enamel as well as demineralized dentin were immersed in aqueous solutions of tetracycline HCl, oxytetracycline HCl and doxycycline HCl for periods of 1 h or 24 h. Unimpregnated enamel and dentin slabs sterilized by gamma irradiation and specimens impregnated with phenoxymethylpenicillin calcium were used as controls. Test and control specimens were placed on agar plates seeded with B. cereus, C. ochraceus, S. sanguis, F. nucleatum, B. melaninogenicus or A. viscosus and were subsequently incubated aerobically or anaerobically at 37 degrees C. With the exception of enamel impregnated for 1 h in a 0.01 mg/ml tetracycline solution, all test specimens caused growth inhibition zones, varying in size according to concentration of the drug, immersion period and bacterial species. The results indicate that tetracyclines react with enamel and dentin to form slightly soluble compounds with a pronounced antibacterial effect. In comparison, the antimicrobial effect of dentin treated with penicillin was small.

  13. Computational tool for optimizing the essential oils utilization in inhibiting the bacterial growth

    Directory of Open Access Journals (Sweden)

    El-Attar NE

    2017-09-01

    Full Text Available Noha E El-Attar,1 Wael A Awad2 1Basic Science Department, Faculty of Engineering, Delta University, Mansoura, Egypt; 2Mathematics & Computer Science Dept. Faculty of Science, PortSaid University, PortSaid, Egypt Abstract: Day after day, the importance of relying on nature in many fields such as food, medical, pharmaceutical industries, and others is increasing. Essential oils (EOs are considered as one of the most significant natural products for use as antimicrobials, antioxidants, ­antitumorals, and anti-inflammatories. Optimizing the usage of EOs is a big challenge faced by the scientific researchers because of the complexity of chemical composition of every EO, in addition to the difficulties to determine the best in inhibiting the bacterial activity. The goal of this article is to present a new computational tool based on two methodologies: reduction by using rough sets and optimization with particle swarm optimization. The developed tool dubbed as Essential Oil Reduction and Optimization Tool is applied on 24 types of EOs that have been tested toward 17 different species of bacteria. Keywords: essential oils, reduction, optimization, rough sets, particle swarm optimization

  14. Inhibition of chrysin on xanthine oxidase activity and its inhibition mechanism.

    Science.gov (United States)

    Lin, Suyun; Zhang, Guowen; Liao, Yijing; Pan, Junhui

    2015-11-01

    Chrysin, a bioactive flavonoid, was investigated for its potential to inhibit the activity of xanthine oxidase (XO), a key enzyme catalyzing xanthine to uric acid and finally causing gout. The kinetic analysis showed that chrysin possessed a strong inhibition on XO ability in a reversible competitive manner with IC50 value of (1.26±0.04)×10(-6)molL(-1). The results of fluorescence titrations indicated that chrysin bound to XO with high affinity, and the interaction was predominately driven by hydrogen bonds and van der Waals forces. Analysis of circular dichroism demonstrated that chrysin induced the conformational change of XO with increases in α-helix and β-sheet and reductions in β-turn and random coil structures. Molecular simulation revealed that chrysin interacted with the amino acid residues Leu648, Phe649, Glu802, Leu873, Ser876, Glu879, Arg880, Phe1009, Thr1010, Val1011 and Phe1013 located within the active cavity of XO. The mechanism of chrysin on XO activity may be the insertion of chrysin into the active site occupying the catalytic center of XO to avoid the entrance of xanthine and causing conformational changes in XO. Furthermore, the interaction assays indicated that chrysin and its structural analog apigenin exhibited an additive effect on inhibition of XO. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Atomic force microscopy studies of bioprocess engineering surfaces - imaging, interactions and mechanical properties mediating bacterial adhesion.

    Science.gov (United States)

    James, Sean A; Hilal, Nidal; Wright, Chris J

    2017-07-01

    The detrimental effect of bacterial biofilms on process engineering surfaces is well documented. Thus, interest in the early stages of bacterial biofilm formation; in particular bacterial adhesion and the production of anti-fouling coatings has grown exponentially as a field. During this time, Atomic force microscopy (AFM) has emerged as a critical tool for the evaluation of bacterial adhesion. Due to its versatility AFM offers not only insight into the topographical landscape and mechanical properties of the engineering surfaces, but elucidates, through direct quantification the topographical and biomechnical properties of the foulants The aim of this review is to collate the current research on bacterial adhesion, both theoretical and practical, and outline how AFM as a technique is uniquely equipped to provide further insight into the nanoscale world at the bioprocess engineering surface. Copyright © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. The Salmonella effectors SseF and SseG inhibit Rab1A-mediated autophagy to facilitate intracellular bacterial survival and replication.

    Science.gov (United States)

    Feng, Zhao-Zhong; Jiang, An-Jie; Mao, An-Wen; Feng, Yuhan; Wang, Weinan; Li, Jingjing; Zhang, Xiaoyan; Xing, Ke; Peng, Xue

    2018-04-02

    In mammalian cells, autophagy plays crucial roles in restricting further spread of invading bacterial pathogens. Previous studies have established that the Salmonella virulence factors SseF and SseG are required for intracellular bacterial survival and replication. However, the underlying mechanism by which these two effectors facilitate bacterial infection remains elusive. Here, we report that SseF and SseG secreted by Salmonella Typhimurium (S. Typhimurium) inhibit autophagy in host cells and thereby establish a replicative niche for the bacteria in the cytosol. Mechanistically, SseF and SseG impaired autophagy initiation by directly interacting with the small GTPase Rab1A in the host cell. This interaction abolished Rab1A activation by disrupting the interaction with its guanine nucleotide exchange factor (GEF), the TRAPPIII ( abbreviation for the transport protein particle III ) complex. This disruption of Rab1A signaling blocked the recruitment and activation of Unc51 like autophagy activating kinase 1 (ULK1) and decreased phosphatidylinositol 3 phosphate biogenesis, which ultimately impeded autophagosome formation. Furthermore, SseF or SseG deficient bacterial strains exhibited reduced survival and growth in both mammalian cell lines and mouse infection models, and Rab1A depletion could rescue these defects. These results reveal that virulence factor dependent inactivation of the small GTPase Rab1A represents a previously unrecognized strategy of S. Typhimurium to evade autophagy and the host defense system. Copyright © 2018, The American Society for Biochemistry and Molecular Biology.

  17. Bacterial cell curvature through mechanical control of cell growth

    DEFF Research Database (Denmark)

    Cabeen, M.; Charbon, Godefroid; Vollmer, W.

    2009-01-01

    The cytoskeleton is a key regulator of cell morphogenesis. Crescentin, a bacterial intermediate filament-like protein, is required for the curved shape of Caulobacter crescentus and localizes to the inner cell curvature. Here, we show that crescentin forms a single filamentous structure...... that collapses into a helix when detached from the cell membrane, suggesting that it is normally maintained in a stretched configuration. Crescentin causes an elongation rate gradient around the circumference of the sidewall, creating a longitudinal cell length differential and hence curvature. Such curvature...... can be produced by physical force alone when cells are grown in circular microchambers. Production of crescentin in Escherichia coli is sufficient to generate cell curvature. Our data argue for a model in which physical strain borne by the crescentin structure anisotropically alters the kinetics...

  18. Modeling of the bacterial mechanism of methicillin-resistance by a systems biology approach.

    Directory of Open Access Journals (Sweden)

    Ida Autiero

    Full Text Available BACKGROUND: A microorganism is a complex biological system able to preserve its functional features against external perturbations and the ability of the living systems to oppose to these external perturbations is defined "robustness". The antibiotic resistance, developed by different bacteria strains, is a clear example of robustness and of ability of the bacterial system to acquire a particular functional behaviour in response to environmental changes. In this work we have modeled the whole mechanism essential to the methicillin-resistance through a systems biology approach. The methicillin is a beta-lactamic antibiotic that act by inhibiting the penicillin-binding proteins (PBPs. These PBPs are involved in the synthesis of peptidoglycans, essential mesh-like polymers that surround cellular enzymes and are crucial for the bacterium survival. METHODOLOGY: The network of genes, mRNA, proteins and metabolites was created using CellDesigner program and the data of molecular interactions are stored in Systems Biology Markup Language (SBML. To simulate the dynamic behaviour of this biochemical network, the kinetic equations were associated with each reaction. CONCLUSIONS: Our model simulates the mechanism of the inactivation of the PBP by methicillin, as well as the expression of PBP2a isoform, the regulation of the SCCmec elements (SCC: staphylococcal cassette chromosome and the synthesis of peptidoglycan by PBP2a. The obtained results by our integrated approach show that the model describes correctly the whole phenomenon of the methicillin resistance and is able to respond to the external perturbations in the same way of the real cell. Therefore, this model can be useful to develop new therapeutic approaches for the methicillin control and to understand the general mechanism regarding the cellular resistance to some antibiotics.

  19. Molecular mechanism of pore creation in bacterial membranes by amyloid proteins

    International Nuclear Information System (INIS)

    Tsigelny, I F; Sharikov, Y; Miller, M A; Masliah, E

    2009-01-01

    This study explores the mechanism of pore creation in cellular membranes by MccE92 bacterial proteins. The results of this study are then compared with the mechanism of alpha-synuclein (aS)-based pore formation in mammalian cells, and its role in Parkinson's disease.

  20. Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells

    International Nuclear Information System (INIS)

    Yu, L.D.; Sangwijit, K.; Prakrajang, K.; Phanchaisri, B.; Thongkumkoon, P.; Thopan, P.; Singkarat, S.; Anuntalabhochai, S.

    2014-01-01

    Highlights: • Ion bombardment could induce DNA transfer into E. coli cells. • The DNA transfer induction depended on ion energy and fluence. • The mechanism was associated with the bacterial cell envelope structure. • A mechanism phase diagram was proposed to summarize the mechanism. - Abstract: As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10–20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence

  1. Effect of Postnatal Myostatin Inhibition on Bite Mechanics in Mice.

    Directory of Open Access Journals (Sweden)

    Susan H Williams

    Full Text Available As a negative regulator of muscle size, myostatin (Mstn impacts the force-production capabilities of skeletal muscles. In the masticatory system, measures of temporalis-stimulated bite forces in constitutive myostatin KOs suggest an absolute, but not relative, increase in jaw-muscle force. Here, we assess the phenotypic and physiologic impact of postnatal myostatin inhibition on bite mechanics using an inducible conditional KO mouse in which myostatin is inhibited with doxycycline (DOX. Given the increased control over the timing of gene inactivation in this model, it may be more clinically-relevant for developing interventions for age-associated changes in the musculoskeletal system. DOX was administered for 12 weeks starting at age 4 months, during which time food intake was monitored. Sex, age and strain-matched controls were given the same food without DOX. Bite forces were recorded just prior to euthanasia after which muscle and skeletal data were collected. Food intake did not differ between control or DOX animals within each sex. DOX males were significantly larger and had significantly larger masseters than controls, but DOX and control females did not differ. Although there was a tendency towards higher absolute bite forces in DOX animals, this was not significant, and bite forces normalized to masseter mass did not differ. Mechanical advantage for incisor biting increased in the DOX group due to longer masseter moment arms, likely due to a more anteriorly-placed masseter insertion. Despite only a moderate increase in bite force in DOX males and none in DOX females, the increase in masseter mass in males indicates a potentially positive impact on jaw muscles. Our data suggest a sexual dimorphism in the role of mstn, and as such investigations into the sex-specific outcomes is warranted.

  2. Mapping of bacterial biofilm local mechanics by magnetic microparticle actuation.

    Science.gov (United States)

    Galy, Olivier; Latour-Lambert, Patricia; Zrelli, Kais; Ghigo, Jean-Marc; Beloin, Christophe; Henry, Nelly

    2012-09-19

    Most bacteria live in the form of adherent communities forming three-dimensional material anchored to artificial or biological surfaces, with profound impact on many human activities. Biofilms are recognized as complex systems but their physical properties have been mainly studied from a macroscopic perspective. To determine biofilm local mechanical properties, reveal their potential heterogeneity, and investigate their relation to molecular traits, we have developed a seemingly new microrheology approach based on magnetic particle infiltration in growing biofilms. Using magnetic tweezers, we achieved what was, to our knowledge, the first three-dimensional mapping of the viscoelastic parameters on biofilms formed by the bacterium Escherichia coli. We demonstrate that its mechanical profile may exhibit elastic compliance values spread over three orders of magnitude in a given biofilm. We also prove that heterogeneity strongly depends on external conditions such as growth shear stress. Using strains genetically engineered to produce well-characterized cell surface adhesins, we show that the mechanical profile of biofilm is exquisitely sensitive to the expression of different surface appendages such as F pilus or curli. These results provide a quantitative view of local mechanical properties within intact biofilms and open up an additional avenue for elucidating the emergence and fate of the different microenvironments within these living materials. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  3. Unravelling the mechanisms of bacterial interactions in model communities

    DEFF Research Database (Denmark)

    Herschend, Jakob

    individually. Using this approach, we show how a range of mechanisms can influence community development of mixed species. In Manuscript I we present how metabolic interplay can cause pH stabilization of the environment, which in turn enhances community growth. Manuscript II identifies cross feeding on amino...

  4. Responding to the challenge of untreatable gonorrhea: ETX0914, a first-in-class agent with a distinct mechanism-of-action against bacterial Type II topoisomerases

    OpenAIRE

    Basarab, Gregory S.; Kern, Gunther H.; McNulty, John; Mueller, John P.; Lawrence, Kenneth; Vishwanathan, Karthick; Alm, Richard A.; Barvian, Kevin; Doig, Peter; Galullo, Vincent; Gardner, Humphrey; Gowravaram, Madhusudhan; Huband, Michael; Kimzey, Amy; Morningstar, Marshall

    2015-01-01

    With the diminishing effectiveness of current antibacterial therapies, it is critically important to discover agents that operate by a mechanism that circumvents existing resistance. ETX0914, the first of a new class of antibacterial agent targeted for the treatment of gonorrhea, operates by a novel mode-of-inhibition against bacterial type II topoisomerases. Incorporating an oxazolidinone on the scaffold mitigated toxicological issues often seen with topoisomerase inhibitors. Organisms resis...

  5. Mechanisms of bacterial morphogenesis: evolutionary cell biology approaches provide new insights.

    Science.gov (United States)

    Jiang, Chao; Caccamo, Paul D; Brun, Yves V

    2015-04-01

    How Darwin's "endless forms most beautiful" have evolved remains one of the most exciting questions in biology. The significant variety of bacterial shapes is most likely due to the specific advantages they confer with respect to the diverse environments they occupy. While our understanding of the mechanisms generating relatively simple shapes has improved tremendously in the last few years, the molecular mechanisms underlying the generation of complex shapes and the evolution of shape diversity are largely unknown. The emerging field of bacterial evolutionary cell biology provides a novel strategy to answer this question in a comparative phylogenetic framework. This relatively novel approach provides hypotheses and insights into cell biological mechanisms, such as morphogenesis, and their evolution that would have been difficult to obtain by studying only model organisms. We discuss the necessary steps, challenges, and impact of integrating "evolutionary thinking" into bacterial cell biology in the genomic era. © 2015 WILEY Periodicals, Inc.

  6. Bacterial chitin degradation – mechanisms and ecophysiological strategies

    OpenAIRE

    Sara eBeier; Sara eBeier; Sara eBeier; Stefan eBertilsson

    2013-01-01

    Chitin is one the most abundant polymers in nature and interacts with both carbon and nitrogen cycles. Processes controlling chitin degradation are summarized in reviews published some 20 years ago, but the recent use of culture-independent molecular methods has led to a revised understanding of the ecology and biochemistry of this process and the organisms involved. This review summarizes different mechanisms and the principal steps involved in chitin degradation at a molecular level while a...

  7. Bacterial chitin degradation?mechanisms and ecophysiological strategies

    OpenAIRE

    Beier, Sara; Bertilsson, Stefan

    2013-01-01

    International audience; Chitin is one the most abundant polymers in nature and interacts with both carbon and nitrogen cycles. Processes controlling chitin degradation are summarized in reviews published some 20 years ago, but the recent use of culture-independent molecular methods has led to a revised understanding of the ecology and biochemistry of this process and the organisms involved. This review summarizes different mechanisms and the principal steps involved in chitin degradation at a...

  8. The magnetosome model: insights into the mechanisms of bacterial biomineralization

    OpenAIRE

    Rahn-Lee, Lilah; Komeili, Arash

    2013-01-01

    Though the most ready example of biomineralization is the calcium phosphate of vertebrate bones and teeth, many bacteria are capable of creating biominerals inside their cells. Because of the diversity of these organisms and the minerals they produce, their study may reveal aspects of the fundamental mechanisms of biomineralization in more complex organisms. The best-studied case of intracellular biomineralization in bacteria is the magnetosome, an organelle produced by a diverse group of a...

  9. Mechanism of colour discrimination by a bacterial sensory rhodopsin

    Science.gov (United States)

    Spudich, J. L.; Bogomolni, R. A.

    1984-01-01

    A photosensitive protein resembling the visual pigments of invertebrates enables phototactic archaebacteria to distinguish color. This protein exists in two spectrally-distinct forms, one of which is a transient photoproduct of the other and each of which undergoes photochemical reactions controlling the cell's swimming behaviour. Activation of a single pigment molecule in the cell is sufficient to signal the flagellar motor. This signal-transduction mechanism makes evident a color-sensing capability inherent in the retinal/protein chromophore.

  10. Regional cerebral blood flow during mechanical hyperventilation in patients with acute bacterial meningitis

    DEFF Research Database (Denmark)

    Møller, Kirsten; Høgh, Peter; Larsen, Fin Stolze

    2000-01-01

    Mechanical hyperventilation is often instituted in patients with acute bacterial meningitis when increased intracranial pressure is suspected. However, the effect on regional cerebral blood flow (CBF) is unknown. In this study, we measured regional CBF (rCBF) in patients with acute bacterial...... meningitis before and during short-term hyperventilation. In 17 patients with acute bacterial meningitis, absolute rCBF (in ml/100 g min-1) was measured during baseline ventilation and hyperventilation by single-photon emission computed tomography (SPECT) using intravenous 133Xe bolus injection. Intravenous...... in the frontal and parietal cortex as well as in the basal ganglia. Focal perfusion abnormalities were present in 10 of 12 patients. Regional cerebral blood flow abnormalities are frequent in patients with acute bacterial meningitis. Short-term hyperventilation does not enhance these abnormalities....

  11. [Ecology and mechanisms of bacterial resistance to antibiotics in peritonitis].

    Science.gov (United States)

    Edern, Anita; Fines-Guyon, Marguerite; Castrale, Cindy; Ficheux, Maxence; Ryckelynck, Jean-Philippe; Lobbedez, Thierry

    2012-11-01

    Peritonitis remains a common complication of peritoneal dialysis. The aim of our study is to describe the mechanisms of antibiotic resistance in bacteria isolated during peritonitis in peritoneal dialysis, to determine whether antibiotic therapy proposed by the International Society for Peritoneal Dialysis (ISPD) is adapted to the mechanisms of resistance. All causative microorganisms of peritonitis, isolated in 106 dialysis patients and reported 170 episodes of peritonitis, during the study period (01/01/2005 to 31/12/2010) were reviewed. According to the usual classification, twelve groups of microorganism were created. An interpretive reading of antibiograms was performed in each group to identify resistance phenotypes. The species most frequently isolated are coagulase-negative staphylococci (n=73) of which 46 had PBP2a (penicillin-binding protein). Many Enterobacteriaceae were also isolated (n=45), they are susceptible to third generation cephalosporins with the exception of Enterobacteriaceae producing an extended spectrum β-lactamase (ESBL) or a cephalosporinase. Except for staphylococci, probabilistic antibiotic therapy recommended by the ISPD to treat peritonitis is effective. Indeed, many staphylococci producing a PBP2a, a first-generation cephalosporin cannot be administered in all cases. It is therefore necessary to identify patients with a strain of staphylococcus producing a PBP2a, it must be treated by vancomycin. Copyright © 2012 Association Société de néphrologie. Published by Elsevier SAS. All rights reserved.

  12. Structure, mechanism and cooperation of bacterial multidrug transporters.

    Science.gov (United States)

    Du, Dijun; van Veen, Hendrik W; Murakami, Satoshi; Pos, Klaas M; Luisi, Ben F

    2015-08-01

    Cells from all domains of life encode energy-dependent trans-membrane transporters that can expel harmful substances including clinically applied therapeutic agents. As a collective body, these transporters perform as a super-system that confers tolerance to an enormous range of harmful compounds and consequently aid survival in hazardous environments. In the Gram-negative bacteria, some of these transporters serve as energy-transducing components of tripartite assemblies that actively efflux drugs and other harmful compounds, as well as deliver virulence agents across the entire cell envelope. We draw together recent structural and functional data to present the current models for the transport mechanisms for the main classes of multi-drug transporters and their higher-order assemblies. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Bacterial chitin degradation-mechanisms and ecophysiological strategies.

    Science.gov (United States)

    Beier, Sara; Bertilsson, Stefan

    2013-01-01

    Chitin is one the most abundant polymers in nature and interacts with both carbon and nitrogen cycles. Processes controlling chitin degradation are summarized in reviews published some 20 years ago, but the recent use of culture-independent molecular methods has led to a revised understanding of the ecology and biochemistry of this process and the organisms involved. This review summarizes different mechanisms and the principal steps involved in chitin degradation at a molecular level while also discussing the coupling of community composition to measured chitin hydrolysis activities and substrate uptake. Ecological consequences are then highlighted and discussed with a focus on the cross feeding associated with the different habitats that arise because of the need for extracellular hydrolysis of the chitin polymer prior to metabolic use. Principal environmental drivers of chitin degradation are identified which are likely to influence both community composition of chitin degrading bacteria and measured chitin hydrolysis activities.

  14. Bacterial chitin degradation – mechanisms and ecophysiological strategies

    Directory of Open Access Journals (Sweden)

    Sara eBeier

    2013-06-01

    Full Text Available Chitin is one the most abundant polymers in nature and interacts with both carbon and nitrogen cycles. Processes controlling chitin degradation are summarized in reviews published some 20 years ago, but the recent use of culture-independent molecular methods has led to a revised understanding of the ecology and biochemistry of this process and the organisms involved. This review summarizes different mechanisms and the principal steps involved in chitin degradation at a molecular level while also discussing the coupling of community composition to measured chitin hydrolysis activities and substrate uptake. Ecological consequences are then highlighted and discussed with a focus on the cross feeding associated with the different habitats that arise because of the need for extracellular hydrolysis of the chitin polymer prior to metabolic use. Principal environmental drivers of chitin degradation are identified which are likely to influence both community composition of chitin degrading bacteria and measured chitin hydrolysis activities.

  15. Fabrication and investigation of a biocompatible microfilament with high mechanical performance based on regenerated bacterial cellulose and bacterial cellulose.

    Science.gov (United States)

    Wu, Huan-Ling; Bremner, David H; Wang, Hai-Jun; Wu, Jun-Zi; Li, He-Yu; Wu, Jian-Rong; Niu, Shi-Wei; Zhu, Li-Min

    2017-10-01

    A high-strength regenerated bacterial cellulose (RBC)/bacterial cellulose (BC) microfilament of potential use as a biomaterial was successfully prepared via a wet spinning process. The BC not only consists of a 3-D network composed of nanofibers with a diameter of several hundred nanometers but also has a secondary structure consisting of highly oriented nanofibrils with a diameter ranging from a few nanometers to tens of nanometers which explains the reason for the high mechanical strength of BC. Furthermore, a strategy of partially dissolving BC was used and this greatly enhanced the mechanical performance of spun filament and a method called post-treatment was utilized to remove residual solvents from the RBC/BC filaments. A comparison of structure, properties, as well as cytocompatibility between BC nanofibers and RBC/BC microfilaments was achieved using morphology, mechanical properties, X-ray Diffraction (XRD) and an enzymatic hydrolysis assay. The RBC/BC microfilament has a uniform groove structure with a diameter of 50-60μm and XRD indicated that the crystal form was transformed from cellulose Iα to cellulose III I and the degree of crystallinity of RBC/BC (33.22%) was much lower than the original BC (60.29%). The enzymatic hydrolysis assay proved that the RBC/BC material was more easily degraded than BC. ICP detection indicated that the residual amount of lithium was 0.07mg/g (w/w) and GC-MS analysis showed the residual amount of DMAc to be 8.51μg/g (w/w) demonstrating that the post-treatment process is necessary and effective for removal of residual materials from the RBC/BC microfilaments. Also, a cell viability assay demonstrated that after post-treatment the RBC/BC filaments had good cytocompatibility. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Small-molecule inhibition of bacterial two-component systems to combat antibiotic resistance and virulence.

    Science.gov (United States)

    Worthington, Roberta J; Blackledge, Meghan S; Melander, Christian

    2013-07-01

    Infections caused by multidrug-resistant bacteria are a considerable and increasing global problem. The development of new antibiotics is not keeping pace with the rapid evolution of resistance to almost all clinically available drugs, and novel strategies are required to fight bacterial infections. One such strategy is the control of pathogenic behaviors, as opposed to simply killing bacteria. Bacterial two-component system (TCS) signal transduction pathways control many pathogenic bacterial behaviors, such as virulence, biofilm formation and antibiotic resistance and are, therefore, an attractive target for the development of new drugs. This review presents an overview of TCS that are potential targets for such a strategy, describes small-molecules inhibitors of TCS identified to date and discusses assays for the identification of novel inhibitors. The future perspective for the identification and use of inhibitors of TCS to potentially provide new therapeutic options for the treatment of drug-resistant bacterial infections is discussed.

  17. The mechanics of bacterial cluster formation on plant leaf surfaces as revealed by bioreporter technology

    NARCIS (Netherlands)

    Tecon, R.; Leveau, J.H.J.

    2012-01-01

    Bacteria that colonize the leaves of terrestrial plants often occur in clusters whose size varies from a few to thousands of cells. For the formation of such bacterial clusters, two non-mutually exclusive but very different mechanisms may be proposed: aggregation of multiple cells or clonal

  18. Mechanisms of action of systemic antibiotics used in periodontal treatment and mechanisms of bacterial resistance to these drugs.

    Science.gov (United States)

    Soares, Geisla Mary Silva; Figueiredo, Luciene Cristina; Faveri, Marcelo; Cortelli, Sheila Cavalca; Duarte, Poliana Mendes; Feres, Magda

    2012-01-01

    Antibiotics are important adjuncts in the treatment of infectious diseases, including periodontitis. The most severe criticisms to the indiscriminate use of these drugs are their side effects and, especially, the development of bacterial resistance. The knowledge of the biological mechanisms involved with the antibiotic usage would help the medical and dental communities to overcome these two problems. Therefore, the aim of this manuscript was to review the mechanisms of action of the antibiotics most commonly used in the periodontal treatment (i.e. penicillin, tetracycline, macrolide and metronidazole) and the main mechanisms of bacterial resistance to these drugs. Antimicrobial resistance can be classified into three groups: intrinsic, mutational and acquired. Penicillin, tetracycline and erythromycin are broad-spectrum drugs, effective against gram-positive and gram-negative microorganisms. Bacterial resistance to penicillin may occur due to diminished permeability of the bacterial cell to the antibiotic; alteration of the penicillin-binding proteins, or production of β-lactamases. However, a very small proportion of the subgingival microbiota is resistant to penicillins. Bacteria become resistant to tetracyclines or macrolides by limiting their access to the cell, by altering the ribosome in order to prevent effective binding of the drug, or by producing tetracycline/macrolide-inactivating enzymes. Periodontal pathogens may become resistant to these drugs. Finally, metronidazole can be considered a prodrug in the sense that it requires metabolic activation by strict anaerobe microorganisms. Acquired resistance to this drug has rarely been reported. Due to these low rates of resistance and to its high activity against the gram-negative anaerobic bacterial species, metronidazole is a promising drug for treating periodontal infections.

  19. Mechanisms of action of systemic antibiotics used in periodontal treatment and mechanisms of bacterial resistance to these drugs

    Directory of Open Access Journals (Sweden)

    Geisla Mary Silva Soares

    2012-06-01

    Full Text Available Antibiotics are important adjuncts in the treatment of infectious diseases, including periodontitis. The most severe criticisms to the indiscriminate use of these drugs are their side effects and, especially, the development of bacterial resistance. The knowledge of the biological mechanisms involved with the antibiotic usage would help the medical and dental communities to overcome these two problems. Therefore, the aim of this manuscript was to review the mechanisms of action of the antibiotics most commonly used in the periodontal treatment (i.e. penicillin, tetracycline, macrolide and metronidazole and the main mechanisms of bacterial resistance to these drugs. Antimicrobial resistance can be classified into three groups: intrinsic, mutational and acquired. Penicillin, tetracycline and erythromycin are broad-spectrum drugs, effective against gram-positive and gram-negative microorganisms. Bacterial resistance to penicillin may occur due to diminished permeability of the bacterial cell to the antibiotic; alteration of the penicillin-binding proteins, or production of β-lactamases. However, a very small proportion of the subgingival microbiota is resistant to penicillins. Bacteria become resistant to tetracyclines or macrolides by limiting their access to the cell, by altering the ribosome in order to prevent effective binding of the drug, or by producing tetracycline/macrolide-inactivating enzymes. Periodontal pathogens may become resistant to these drugs. Finally, metronidazole can be considered a prodrug in the sense that it requires metabolic activation by strict anaerobe microorganisms. Acquired resistance to this drug has rarely been reported. Due to these low rates of resistance and to its high activity against the gram-negative anaerobic bacterial species, metronidazole is a promising drug for treating periodontal infections.

  20. Report on assessment of the mechanism of bacterially assisted oxidation of pyritic uranium tailings

    International Nuclear Information System (INIS)

    Halbert, B.B.; Scharer, J.M.; Knapp, R.A.

    1984-07-01

    The oxidation of pyritic minerals has been shown to be catalyzed by the presence of iron- and sulphur-oxidizing bacteria. Thiobacillus ferroxidans plays the most significant role in the formation and propagation of acidic conditions. Optimum growth conditions for the T. ferroxidans occurs at a temperature of 35 degrees C and pH of 2 to 3. Bacterially assisted oxidation of pyrite involves both direct and indirect contact mechanisms. The direct contact mechanism entails enzymatic oxidation of the insoluble sulphide moiety. The indirect mechanism involves bacterial oxidation of the dissolved ferrous component to the ferric state. The ferric iron, in turn, acts as the prime oxidant of pyrite and is reduced to ferrous iron. The re-oxidation of the dissolved ferrous component which is catalyzed by bacterial activity, completes the cyclic process. The rate of bacterial oxidation is affected by: the geochemistry and reactivity of the pyritic material; the amount of pyrite present in the waste material and the exposed surface area of the pyritic component; the availability of oxygen and carbon dioxide; the pH and temperature of the leach solution; and the presence (or absence) of organic inhibitors. Of the above factors, oxygen has been frequently identified as the rate limiting reactant in tailings

  1. Mechanism of acid corrosion inhibition using magnetic nanofluid

    Science.gov (United States)

    Parekh, Kinnari; Jauhari, Smita; Upadhyay, R. V.

    2016-12-01

    The inhibition effect of magnetic nanofluid on carbon steel in acid solutions was investigated using gravimetric, potentiodynamic and SEM measurement. The inhibition efficiency increases up to 95% and 75% for 51.7 mM concentration, respectively, in 1 M HCl and 1 M H2SO4 medium. The adsorption of nanoparticles to the steel surface forms a barrier between the metal and the aggressive environment, which is responsible for observed inhibition action. The adsorption of nanoparticles on steel surface is supported by the Langmuir and Freundlich adsorption isotherm and surface morphology scanned through SEM.

  2. The impact of aerosolized mucolytic agents on the airflow resistance of bacterial filters used in mechanical ventilation

    Directory of Open Access Journals (Sweden)

    Han-Chung Hu

    2015-08-01

    Conclusion: This study demonstrated the aerosolized mucolytic agents could increase the pressure drop of the bacterial filters during mechanical ventilation. The pressure drop of the bacterial filters was higher with 10% acetylcysteine. It is critical to continuously monitor the expiration resistance, auto-positive end-expiratory pressure, and ventilator output waveform when aerosolized 10% acetylcysteine was used in mechanical ventilation patients.

  3. Cyclic mechanical loading promotes bacterial penetration along composite restoration marginal gaps.

    Science.gov (United States)

    Khvostenko, D; Salehi, S; Naleway, S E; Hilton, T J; Ferracane, J L; Mitchell, J C; Kruzic, J J

    2015-06-01

    Secondary caries is the most common reason for composite restoration replacement and usually forms between dentin and the filling. The objective of this study was to investigate the combined effect of cyclic loading and bacterial exposure on bacterial penetration into gaps at the interface between dentin and resin composite restorative material using a novel bioreactor system and test specimen design. Human molars were machined into 3mm thick disks with 2mm deep × 5 mm diameter cavity preparations into which composite restorations were placed. A ∼ 15-30 μm (small) or ∼ 300 μm wide (large) marginal gap was introduced along half of the interface between the dentin and restoration. Streptococcus mutans UA 159 biofilms were grown on each sample prior to testing each in a bioreactor both with and without cyclic loading. Both groups of samples were tested for 2 weeks and post-test biofilm viability was confirmed with a live-dead assay. Samples were fixed, mounted and cross-sectioned to reveal the gaps and observe the depth of bacterial penetration. It was shown that for large gap samples the bacteria easily penetrated to the full depth of the gap independent of loading or non-loading conditions. The results for all cyclically loaded small gap samples show a consistently deep bacterial penetration down 100% of the gap while the average penetration depth was only 67% for the non-loaded samples with only two of six samples reaching 100%. A new bioreactor was developed that allows combining cyclic mechanical loading and bacterial exposure of restored teeth for bacterial biofilm and demineralization studies. Cyclic loading was shown to aid bacterial penetration into narrow marginal gaps, which could ultimately promote secondary caries formation. Copyright © 2015 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  4. Involvement of glucokinase translocation in the mechanism by which resorcinol inhibits glycolysis in hepatocytes.

    OpenAIRE

    Agius, L

    1997-01-01

    Proglycosyn and resorcinol stimulate glycogen synthesis and inhibit glycolysis in hepatocytes. The former effect is attributed to inactivation of phosphorylase mediated by glucuronidated metabolites. This study investigated the mechanism by which resorcinol inhibits glycolysis. Resorcinol (150 microM) inhibited glycolysis in hepatocytes incubated with glucose (15-35 mM) but not with dihydroxyacetone (10 mM). The inhibition of glycolysis at elevated glucose concentration was associated with in...

  5. Mechanism of cell integration on biomaterial implant surfaces in the presence of bacterial contamination.

    Science.gov (United States)

    Yue, Chongxia; van der Mei, Henny C; Kuijer, Roel; Busscher, Henk J; Rochford, Edward T J

    2015-11-01

    Bacterial contamination during biomaterial implantation is often unavoidable, yielding a combat between cells and bacteria. Here we aim to determine the modulatory function of bacterial components on stem-cell, fibroblast, and osteoblast adhesion to a titanium alloy, including the role of toll-like-receptors (TLRs). Presence of heat-sacrificed Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, or Pseudomonas aeruginosa induced dose and cell-type dependent responses. Stem-cells were most sensitive to bacterial presence, demonstrating decreased adhesion number yet increased adhesion effort with a relatively large focal adhesion contact area. Blocking TLRs had no effect on stem-cell adhesion in presence of S. aureus, but blocking both TLR2 and TLR4 induced an increased adhesion effort in presence of E. coli. Neither lipopolysaccharide, lipoteichoic acid, nor bacterial DNA provoked the same cell response as did whole bacteria. Herewith we suggest a new mechanism as to how biomaterials are integrated by cells despite the unavoidable presence of bacterial contamination. Stimulation of host cell integration of implant surfaces may open a new window to design new biomaterials with enhanced healing, thereby reducing the risk of biomaterial-associated infection of both "hardware-based" implants as well as of tissue-engineered constructs, known to suffer from similarly high infection risks as currently prevailing in "hardware-based" implants. © 2015 Wiley Periodicals, Inc.

  6. The natural antimicrobial carvacrol inhibits quorum sensing in Chromobacterium violaceum and reduces bacterial biofilm formation at sub-lethal concentrations.

    Directory of Open Access Journals (Sweden)

    Sara A Burt

    Full Text Available The formation of biofilm by bacteria confers resistance to biocides and presents problems in medical and veterinary clinical settings. Here we report the effect of carvacrol, one of the major antimicrobial components of oregano oil, on the formation of biofilms and its activity on existing biofilms. Assays were carried out in polystyrene microplates to observe (a the effect of 0-0.8 mM carvacrol on the formation of biofilms by selected bacterial pathogens over 24 h and (b the effect of 0-8 mM carvacrol on the stability of pre-formed biofilms. Carvacrol was able to inhibit the formation of biofilms of Chromobacterium violaceum ATCC 12472, Salmonella enterica subsp. Typhimurium DT104, and Staphylococcus aureus 0074, while it showed no effect on formation of Pseudomonas aeruginosa (field isolate biofilms. This inhibitory effect of carvacrol was observed at sub-lethal concentrations (<0.5 mM where no effect was seen on total bacterial numbers, indicating that carvacrol's bactericidal effect was not causing the observed inhibition of biofilm formation. In contrast, carvacrol had (up to 8 mM very little or no activity against existing biofilms of the bacteria described, showing that formation of the biofilm also confers protection against this compound. Since quorum sensing is an essential part of biofilm formation, the effect of carvacrol on quorum sensing of C. violaceum was also studied. Sub-MIC concentrations of carvacrol reduced expression of cviI (a gene coding for the N-acyl-L-homoserine lactone synthase, production of violacein (pigmentation and chitinase activity (both regulated by quorum sensing at concentrations coinciding with carvacrol's inhibiting effect on biofilm formation. These results indicate that carvacrol's activity in inhibition of biofilm formation may be related to the disruption of quorum sensing.

  7. Furanyl Fatty Acid Inhibition of FABP5 as a Mechanism for Treatment and Prevention of Cancer

    Science.gov (United States)

    2017-10-01

    AWARD NUMBER: W81XWH-16-1-0699 TITLE: Furanyl Fatty Acid Inhibition of FABP5 as a Mechanism for Treatment and Prevention of Cancer PRINCIPAL...pharmacologic inhibition will prevent the oncogenic effects of FABP5 overexpression in highly relevant breast cancer models that display a high ratio of...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 Furanyl Fatty Acid Inhibition of FABP5 as a Mechanism for Treatment and Prevention of

  8. Sharing the sandbox: Evolutionary mechanisms that maintain bacterial cooperation [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Eric Bruger

    2015-12-01

    Full Text Available Microbes are now known to participate in an extensive repertoire of cooperative behaviors such as biofilm formation, production of extracellular public-goods, group motility, and higher-ordered multicellular structures. A fundamental question is how these cooperative tasks are maintained in the face of non-cooperating defector cells. Recently, a number of molecular mechanisms including facultative participation, spatial sorting, and policing have been discovered to stabilize cooperation. Often these different mechanisms work in concert to reinforce cooperation. In this review, we describe bacterial cooperation and the current understanding of the molecular mechanisms that maintain it.

  9. S-layer proteins from Lactobacillus sp. inhibit bacterial infection by blockage of DC-SIGN cell receptor.

    Science.gov (United States)

    Prado Acosta, Mariano; Ruzal, Sandra M; Cordo, Sandra M

    2016-11-01

    Many species of Lactobacillus sp. possess Surface(s) layer proteins in their envelope. Among other important characteristics S-layer from Lactobacillus acidophilus binds to the cellular receptor DC-SIGN (Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin; CD209), which is involved in adhesion and infection of several families of bacteria. In this report we investigate the activity of new S-layer proteins from the Lactobacillus family (Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus helveticus and Lactobacillus kefiri) over the infection of representative microorganisms important to human health. After the treatment of DC-SIGN expressing cells with these proteins, we were able to diminish bacterial infection by up to 79% in both gram negative and mycobacterial models. We discovered that pre-treatment of the bacteria with S-layers from Lactobacillus acidophilus and Lactobacillus brevis reduced bacteria viability but also prevent infection by the pathogenic bacteria. We also proved the importance of the glycosylation of the S-layer from Lactobacillus kefiri in the binding to the receptor and thus inhibition of infection. This novel characteristic of the S-layers proteins may contribute to the already reported pathogen exclusion activity for these Lactobacillus probiotic strains; and might be also considered as a novel enzymatic antimicrobial agents to inhibit bacterial infection and entry to host cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Inhibition of bacterial growth by iron oxide nanoparticles with and without attached drug: Have we conquered the antibiotic resistance problem?

    Science.gov (United States)

    Armijo, Leisha M.; Jain, Priyanka; Malagodi, Angelina; Fornelli, F. Zuly; Hayat, Allison; Rivera, Antonio C.; French, Michael; Smyth, Hugh D. C.; Osiński, Marek

    2015-03-01

    Pseudomonas aeruginosa is among the top three leading causative opportunistic human pathogens, possessing one of the largest bacterial genomes and an exceptionally large proportion of regulatory genes therein. It has been known for more than a decade that the size and complexity of the P. aeruginosa genome is responsible for the adaptability and resilience of the bacteria to include its ability to resist many disinfectants and antibiotics. We have investigated the susceptibility of P. aeruginosa bacterial biofilms to iron oxide (magnetite) nanoparticles (NPs) with and without attached drug (tobramycin). We also characterized the susceptibility of zero-valent iron NPs, which are known to inactivate microbes. The particles, having an average diameter of 16 nm were capped with natural alginate, thus doubling the hydrodynamic size. Nanoparticle-drug conjugates were produced via cross-linking drug and alginate functional groups. Drug conjugates were investigated in the interest of determining dosage, during these dosage-curve experiments, NPs unbound to drug were tested in cultures as a negative control. Surprisingly, we found that the iron oxide NPs inhibited bacterial growth, and thus, biofilm formation without the addition of antibiotic drug. The inhibitory dosages of iron oxide NPs were investigated and the minimum inhibitory concentrations are presented. These findings suggest that NP-drug conjugates may overcome the antibiotic drug resistance common in P. aeruginosa infections.

  11. Zinc metalloproteinase ZmpC suppresses experimental pneumococcal meningitis by inhibiting bacterial invasion of central nervous systems.

    Science.gov (United States)

    Yamaguchi, Masaya; Nakata, Masanobu; Sumioka, Ryuichi; Hirose, Yujiro; Wada, Satoshi; Akeda, Yukihiro; Sumitomo, Tomoko; Kawabata, Shigetada

    2017-11-17

    Streptococcus pneumoniae is a leading cause of bacterial meningitis. Here, we investigated whether pneumococcal paralogous zinc metalloproteases contribute to meningitis onset. Findings of codon-based phylogenetic analyses indicated 3 major clusters in the Zmp family; ZmpA, ZmpC, and ZmpB, with ZmpD as a subgroup. In vitro invasion assays of human brain microvascular endothelial cells (hBMECs) showed that deletion of the zmpC gene in S. pneumoniae strain TIGR4 significantly increased bacterial invasion into hBMECs, whereas deletion of either zmpA or zmpB had no effect. In a mouse meningitis model, the zmpC deletion mutant exhibited increased invasion of the brain and was associated with increased matrix metalloproteinase-9 in plasma and mortality as compared with the wild type. We concluded that ZmpC suppresses pneumococcal virulence by inhibiting bacterial invasion of the central nervous system. Furthermore, ZmpC illustrates the evolutional theory stating that gene duplication leads to acquisition of novel function to suppress excessive mortality.

  12. Galanin can inhibit insulin release by a mechanism other than membrane hyperpolarization or inhibition of adenylate cyclase.

    Science.gov (United States)

    Sharp, G W; Le Marchand-Brustel, Y; Yada, T; Russo, L L; Bliss, C R; Cormont, M; Monge, L; Van Obberghen, E

    1989-05-05

    Studies on the mode of action of galanin to inhibit insulin release in RINm5F cells have shown that basal and glyceraldehyde-stimulated release were both inhibited. Galanin was inhibitory at concentrations in the low nanomolar range. Binding studies with 125I-labeled galanin indicated that the RINm5F cells exhibit a single set of sites estimated to be of the order of 30,000 sites/cell. Displacement of 125I-galanin by galanin from the receptor sites occurred over a similar concentration range to that which inhibited insulin release. Half-displacement was achieved with 2 nM galanin. Measurements of bis-(1,3-diethylthiobarbiturate) trimethineoxonol (bis-oxonol) fluorescence showed that galanin hyperpolarized the RINm5F cell plasma membrane. Measurements of intracellular free calcium, [Ca2+]i by means of the fluorescent indicator fura-2 showed that galanin decreased [Ca2+]i. As galanin did not inhibit either basal or glyceraldehyde-stimulated insulin release in the presence of the Ca2+ channel blocker nitrendipine, the hyperpolarization and reduction of Ca2+ entry appear to be a possible explanation for the galanin effects. However, quantitatively, the effects on membrane potential and [Ca2+]i appear to be insufficient to account for the potent inhibition of insulin release. Furthermore, evidence for an additional mechanism of action was obtained from experiments with 12-O-tetradecanoylphorbol-13-acetate (TPA), a phorbol ester which stimulates insulin secretion by at least two mechanisms, one Ca2+ dependent and one Ca2+ independent. TPA-stimulated insulin release was inhibited by galanin over the same concentration range as for the inhibition of glyceraldehyde-stimulated release. Galanin inhibited TPA-stimulated release in the presence of maximally effective concentrations of nitrendipine and in the absence of extracellular Ca2+. These effects cannot be explained by hyperpolarization of the plasma membrane and consequent reduction of Ca2+ entry via the voltage

  13. Irreversible inhibition of RANK expression as a possible mechanism for IL-3 inhibition of RANKL-induced osteoclastogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Khapli, Shruti M.; Tomar, Geetanjali B.; Barhanpurkar, Amruta P.; Gupta, Navita; Yogesha, S.D.; Pote, Satish T. [National Center for Cell Science, University of Pune Campus, Pune 411 007 (India); Wani, Mohan R., E-mail: mohanwani@nccs.res.in [National Center for Cell Science, University of Pune Campus, Pune 411 007 (India)

    2010-09-03

    Research highlights: {yields} IL-3 inhibits receptor activator of NF-{kappa}B ligand (RANKL)-induced osteoclastogenesis. {yields} IL-3 inhibits RANKL-induced JNK activation. {yields} IL-3 down-regulates expression of c-Fos and NFATc1 transcription factors. {yields} IL-3 down-regulates RANK expression posttranscriptionally and irreversibly. {yields} IL-3 inhibits in vivo RANK expression. -- Abstract: IL-3, a cytokine secreted by activated T lymphocytes, stimulates the proliferation, differentiation and survival of pluripotent hematopoietic stem cells. In this study, we investigated the mechanism of inhibitory action of IL-3 on osteoclast differentiation. We show here that IL-3 significantly inhibits receptor activator of NF-{kappa}B (RANK) ligand (RANKL)-induced activation of c-Jun N-terminal kinase (JNK). IL-3 down-regulates expression of c-Fos and nuclear factor of activated T cells (NFATc1) transcription factors. In addition, IL-3 down-regulates RANK expression posttranscriptionally in both purified osteoclast precursors and whole bone marrow cells. Furthermore, the inhibitory effect of IL-3 on RANK expression was irreversible. Interestingly, IL-3 inhibits in vivo RANK expression in mice. Thus, we provide the first evidence that IL-3 irreversibly inhibits RANK expression that results in inhibition of important signaling molecules induced by RANKL.

  14. Dicumarol inhibition of NADPH:quinone oxidoreductase induces growth inhibition of pancreatic cancer via a superoxide-mediated mechanism.

    Science.gov (United States)

    Cullen, Joseph J; Hinkhouse, Marilyn M; Grady, Matthew; Gaut, Andrew W; Liu, Jingru; Zhang, Yu Ping; Weydert, Christine J Darby; Domann, Frederick E; Oberley, Larry W

    2003-09-01

    NADPH:quinone oxidoreductase (NQO(1)), a homodimeric, ubiquitous, flavoprotein, catalyzes the two-electron reduction of quinones to hydroquinones. This reaction prevents the one-electron reduction of quinones by cytochrome P450 reductase and other flavoproteins that would result in oxidative cycling with generation of superoxide (O(2)(.-)). NQO(1) gene regulation may be up-regulated in some tumors to accommodate the needs of rapidly metabolizing cells to regenerate NAD(+). We hypothesized that pancreatic cancer cells would exhibit high levels of this enzyme, and inhibiting it would suppress the malignant phenotype. Reverse transcription-PCR, Western blots, and activity assays demonstrated that NQO(1) was up-regulated in the pancreatic cancer cell lines tested but present in very low amounts in the normal human pancreas. To determine whether inhibition of NQO(1) would alter the malignant phenotype, MIA PaCa-2 pancreatic cancer cells were treated with a selective inhibitor of NQO(1), dicumarol. Dicumarol increased intracellular production of O(2)(.-), as measured by hydroethidine staining, and inhibited cell growth. Both of these effects were blunted with infection of an adenoviral vector containing the cDNA for manganese superoxide dismutase. Dicumarol also inhibited cell growth, plating efficiency, and growth in soft agar. We conclude that inhibition of NQO(1) increases intracellular O(2)(.-) production and inhibits the in vitro malignant phenotype of pancreatic cancer. These mechanisms suggest that altering the intracellular redox environment of pancreatic cancer cells may inhibit growth and delineate a potential strategy directed against pancreatic cancer.

  15. Endogenous CO2 may inhibit bacterial growth and induce virulence gene expression in enteropathogenic Escherichia coli.

    Science.gov (United States)

    Martínez, Haydee; Buhse, Thomas; Rivera, Marco; Parmananda, P; Ayala, Guadalupe; Sánchez, Joaquín

    2012-07-01

    Analysis of the growth kinetics of enteropathogenic Escherichia coli (EPEC) revealed that growth was directly proportional to the ratio between the exposed surface area and the liquid culture volume (SA/V). It was hypothesized that this bacterial behavior was caused by the accumulation of an endogenous volatile growth inhibitor metabolite whose escape from the medium directly depended on the SA/V. The results of this work support the theory that an inhibitor is produced and indicate that it is CO(2). We also report that concomitant to the accumulation of CO(2), there is secretion of the virulence-related EspB and EspC proteins from EPEC. We therefore postulate that endogenous CO(2) may have an effect on both bacterial growth and virulence. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Grain coarsening of calcite: Fundamental mechanisms and biogenic inhibition

    DEFF Research Database (Denmark)

    Schultz, Logan Nicholas

    coarsening – small grains coarsen by aggregation at high temperatures, followed by Ostwald ripening. Alginate, a model for the acidic polysaccharides produced by coccolithiphores, inhibited coarsening at a steady rate. A Pseudomonas aeruginosa biofilm preserved particles for at least 60 days before...

  17. Preparation of Esterified Bacterial Cellulose for Improved Mechanical Properties and the Microstructure of Isotactic Polypropylene/Bacterial Cellulose Composites

    Directory of Open Access Journals (Sweden)

    Bo Wang

    2016-04-01

    Full Text Available Bacterial cellulose (BC has great potential to be used as a new filler to reinforce isotactic polypropylene (iPP due to its high crystallinity, biodegradability, and efficient mechanical properties. In this study, esterification was used to modify BC, which improved the surface compatibility of the iPP and BC. The results indicated that the cellulose octoate (CO changed the surface properties from hydrophilic to lipophilic. Compared to the pure iPP, the tensile strength, charpy notched impact strength, and tensile modulus of the iPP/BC composites increased by 9.9%, 7.77%, and 15.64%, respectively. However, the addition of CO reinforced the iPP/CO composites. The tensile strength, charpy notched impact strength, and tensile modulus of the iPP/CO composites increased by 14.23%, 14.08%, and 17.82% compared to the pure iPP. However, the elongation at break of both the composites is decreased. The SEM photographs and particle size distribution of the composites showed improvements when the change of polarity of the BC surface, interface compatibility, and dispersion of iPP improved.

  18. Molecular mechanisms of viral immune evasion proteins to inhibit MHC class I antigen processing and presentation.

    Science.gov (United States)

    Zhou, Fang

    2009-01-01

    Viral products inhibit MHC class I antigen processing and presentation via three major pathways: inhibition of major histocompatibility complex (MHC) class I expression on cells, blockade of peptide trafficking and loading on MHC class I molecules, and inhibition of peptide generation in host cells. Viral products also interfere with IFN-gamma -mediated JAK/STAT signal transduction in cells. These results imply that viral proteins probably inhibit the function of IFN-gamma in MHC class I antigen presentation via inactivation of JAK/STAT signal transduction in host cells. Mechanisms of viral products to inhibit IFN-gamma -mediated MHC class I antigen presentation were summarized in this literature review.

  19. Intracellular biomass flocculation as a key mechanism of rapid bacterial killing by cationic, amphipathic antimicrobial peptides and peptoids.

    Science.gov (United States)

    Chongsiriwatana, Nathaniel P; Lin, Jennifer S; Kapoor, Rinki; Wetzler, Modi; Rea, Jennifer A C; Didwania, Maruti K; Contag, Christopher H; Barron, Annelise E

    2017-12-01

    Many organisms rely on antimicrobial peptides (AMPs) as a first line of defense against pathogens. In general, most AMPs are thought to kill bacteria by binding to and disrupting cell membranes. However, certain AMPs instead appear to inhibit biomacromolecule synthesis, while causing less membrane damage. Despite an unclear understanding of mechanism(s), there is considerable interest in mimicking AMPs with stable, synthetic molecules. Antimicrobial N-substituted glycine (peptoid) oligomers ("ampetoids") are structural, functional and mechanistic analogs of helical, cationic AMPs, which offer broad-spectrum antibacterial activity and better therapeutic potential than peptides. Here, we show through quantitative studies of membrane permeabilization, electron microscopy, and soft X-ray tomography that both AMPs and ampetoids trigger extensive and rapid non-specific aggregation of intracellular biomacromolecules that correlates with microbial death. We present data demonstrating that ampetoids are "fast killers", which rapidly aggregate bacterial ribosomes in vitro and in vivo. We suggest intracellular biomass flocculation is a key mechanism of killing for cationic, amphipathic AMPs, which may explain why most AMPs require micromolar concentrations for activity, show significant selectivity for killing bacteria over mammalian cells, and finally, why development of resistance to AMPs is less prevalent than developed resistance to conventional antibiotics.

  20. Interfering with bacterial gossip

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Tolker-Nielsen, Tim; Givskov, Michael

    2011-01-01

    defense. Antibiotics exhibit a rather limited effect on biofilms. Furthermore, antibiotics have an ‘inherent obsolescence’ because they select for development of resistance. Bacterial infections with origin in bacterial biofilms have become a serious threat in developed countries. Pseudomonas aeruginosa...... that appropriately target bacteria in their relevant habitat with the aim of mitigating their destructive impact on patients. In this review we describe molecular mechanisms involved in “bacterial gossip” (more scientifically referred to as quorum sensing (QS) and c-di-GMP signaling), virulence, biofilm formation......, resistance and QS inhibition as future antimicrobial targets, in particular those that would work to minimize selection pressures for the development of resistant bacteria....

  1. Neutrophils to the ROScue: Mechanisms of NADPH Oxidase Activation and Bacterial Resistance

    Directory of Open Access Journals (Sweden)

    Giang T. Nguyen

    2017-08-01

    . Nonetheless, these pathogens often rely on repair and detoxifying proteins in addition to these secreted effectors and toxins in order to resist mammalian sources of ROS. This suggests that pathogens have both intrinsic and extrinsic mechanisms to avoid restriction by PMN-derived ROS. Here, we review mechanisms of oxidative burst in PMNs in response to bacterial infections, as well as the mechanisms by which bacterial pathogens thwart restriction by ROS to survive under conditions of oxidative stress.

  2. Inhibition of bacterial foodborne pathogens by the lactoperoxidase system in combination with monolaurin.

    Science.gov (United States)

    McLay, J C; Kennedy, M J; Orourke, A L; Elliot, R M; Simmonds, R S

    2002-02-25

    The lactoperoxidase system (LPS) and monolaurin (ML) are potential natural antimicrobial agents for use in foods. The LPS is considered to have greatest activity against Gram-negative bacteria while ML is usually considered to have greatest activity against Gram-positive bacteria. An LPS-ML combination system (utilizing lactoperoxidase (LPX) in the range 5-200 mg kg(-1) and ML in the range 50-1,000 ppm) inhibited growth of Escherichia coli O157:H7 and Staphylococcus aureus. Growth of S. aureus was inhibited more strongly in broth than in milk, in milk than in ground beef A similar pattern was observed for E. coli O157:H7, though enhanced inhibition by LPS-ML systems over that obtained in comparable LPS only systems was not observed in ground beef The inhibitory action of the LPS in combination with other lipids was also examined, with progressively weaker inhibition observed in combinations including palmitoleic acid, monopalmitolein, lauric acid, caprylic acid, and sodium lauryl sulphate.

  3. Understanding cellular responses to toxic agents: a model for mechanism-choice in bacterial metal resistance.

    Science.gov (United States)

    Rouch, D A; Lee, B T; Morby, A P

    1995-02-01

    Bacterial resistances to metals are heterogeneous in both their genetic and biochemical bases. Metal resistance may be chromosomally-, plasmid- or transposon-encoded, and one or more genes may be involved: at the biochemical level at least six different mechanisms are responsible for resistance. Various types of resistance mechanisms can occur singly or in combination and for a particular metal different mechanisms of resistance can occur in the same species. To understand better the diverse responses of bacteria to metal ion challenge we have constructed a qualitative model for the selection of metal resistance in bacteria. How a bacterium becomes resistant to a particular metal depends on the number and location of cellular components sensitive to the specific metal ion. Other important selective factors include the nature of the uptake systems for the metal, the role and interactions of the metal in the normal metabolism of the cell and the availability of plasmid (or transposon) encoded resistance mechanisms. The selection model presented is based on the interaction of these factors and allows predictions to be made about the evolution of metal resistance in bacterial populations. It also allows prediction of the genetic basis and of mechanisms of resistance which are in substantial agreement with those in well-documented populations. The interaction of, and selection for resistance to, toxic substances in addition to metals, such as antibiotics and toxic analogues, involve similar principles to those concerning metals. Potentially, models for selection of resistance to any substance can be derived using this approach.

  4. Salmonella infection inhibits intestinal biotin transport: cellular and molecular mechanisms.

    Science.gov (United States)

    Ghosal, Abhisek; Jellbauer, Stefan; Kapadia, Rubina; Raffatellu, Manuela; Said, Hamid M

    2015-07-15

    Infection with the nontyphoidal Salmonella is a common cause of food-borne disease that leads to acute gastroenteritis/diarrhea. Severe/prolonged cases of Salmonella infection could also impact host nutritional status, but little is known about its effect on intestinal absorption of vitamins, including biotin. We examined the effect of Salmonella enterica serovar Typhimurium (S. typhimurium) infection on intestinal biotin uptake using in vivo (streptomycin-pretreated mice) and in vitro [mouse (YAMC) and human (NCM460) colonic epithelial cells, and human intestinal epithelial Caco-2 cells] models. The results showed that infecting mice with wild-type S. typhimurium, but not with its nonpathogenic isogenic invA spiB mutant, leads to a significant inhibition in jejunal/colonic biotin uptake and in level of expression of the biotin transporter, sodium-dependent multivitamin transporter. In contrast, infecting YAMC, NCM460, and Caco-2 cells with S. typhimurium did not affect biotin uptake. These findings suggest that the effect of S. typhimurium infection is indirect and is likely mediated by proinflammatory cytokines, the levels of which were markedly induced in the intestine of S. typhimurium-infected mice. Consistent with this hypothesis, exposure of NCM460 cells to the proinflammatory cytokines TNF-α and IFN-γ led to a significant inhibition of biotin uptake, sodium-dependent multivitamin transporter expression, and activity of the SLC5A6 promoter. The latter effects appear to be mediated, at least in part, via the NF-κB signaling pathway. These results demonstrate that S. typhimurium infection inhibits intestinal biotin uptake, and that the inhibition is mediated via the action of proinflammatory cytokines.

  5. Studies on inhibition of respiratory cytochrome bc1 complex by the fungicide pyrimorph suggest a novel inhibitory mechanism.

    Directory of Open Access Journals (Sweden)

    Yu-Mei Xiao

    Full Text Available The respiratory chain cytochrome bc1 complex (cyt bc1 is a major target of numerous antibiotics and fungicides. All cyt bc1 inhibitors act on either the ubiquinol oxidation (QP or ubiquinone reduction (QN site. The primary cause of resistance to bc1 inhibitors is target site mutations, creating a need for novel agents that act on alternative sites within the cyt bc1 to overcome resistance. Pyrimorph, a synthetic fungicide, inhibits the growth of a broad range of plant pathogenic fungi, though little is known concerning its mechanism of action. In this study, using isolated mitochondria from pathogenic fungus Phytophthora capsici, we show that pyrimorph blocks mitochondrial electron transport by affecting the function of cyt bc1. Indeed, pyrimorph inhibits the activities of both purified 11-subunit mitochondrial and 4-subunit bacterial bc1 with IC50 values of 85.0 μM and 69.2 μM, respectively, indicating that it targets the essential subunits of cyt bc1 complexes. Using an array of biochemical and spectral methods, we show that pyrimorph acts on an area near the QP site and falls into the category of a mixed-type, noncompetitive inhibitor with respect to the substrate ubiquinol. In silico molecular docking of pyrimorph to cyt b from mammalian and bacterial sources also suggests that pyrimorph binds in the vicinity of the quinol oxidation site.

  6. Natural Products at Work: Structural Insights into Inhibition of the Bacterial Membrane Protein MraY.

    Science.gov (United States)

    Koppermann, Stefan; Ducho, Christian

    2016-09-19

    Natural(ly) fit: The X-ray crystal structure of the bacterial membrane protein MraY in complex with its natural product inhibitor muraymycin D2 is discussed. MraY catalyzes one of the membrane-associated steps in peptidoglycan biosynthesis and, therefore, represents a promising target for novel antibiotics. Structural insights derived from the protein-inhibitor complex might now pave the way for the development of new antimicrobial drugs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Quantum mechanics/molecular mechanics studies of the mechanism of cysteine protease inhibition by peptidyl-2,3-epoxyketones.

    Science.gov (United States)

    Arafet, Kemel; Ferrer, Silvia; González, Florenci V; Moliner, Vicent

    2017-05-24

    Cysteine proteases are the most abundant proteases in parasitic protozoa and they are essential enzymes to the life cycle of several of them, thus becoming attractive therapeutic targets for the development of new inhibitors. In this paper, a computational study of the inhibition mechanism of cysteine protease by dipeptidyl-2,3-epoxyketone Cbz-Phe-Hph-(S), a recently proposed inhibitor, has been carried out by means of molecular dynamics (MD) simulations with hybrid QM/MM potentials. The computed free energy surfaces of the inhibition mechanism of cysteine proteases by peptidyl epoxyketones showing how the activation of the epoxide ring and the attack of Cys25 on either C2 or C3 atoms take place in a concerted manner. According to our results, the acid species responsible for the protonation of the oxygen atom of the ring would be able to conserve His159, in contrast to previous studies that proposed a water molecule as the activating species. The low activation free energies for the reaction where Cys25 attacks the C2 atom of the epoxide ring (12.1 kcal mol -1 ) or to the C3 atom (15.4 kcal mol -1 ), together with the high negative reaction energies suggest that the derivatives of peptidyl-2,3-epoxyketones can be used to develop new potent inhibitors for the treatment of Chagas disease.

  8. Evolution of antibiotic resistance is linked to any genetic mechanism affecting bacterial duration of carriage.

    Science.gov (United States)

    Lehtinen, Sonja; Blanquart, François; Croucher, Nicholas J; Turner, Paul; Lipsitch, Marc; Fraser, Christophe

    2017-01-31

    Understanding how changes in antibiotic consumption affect the prevalence of antibiotic resistance in bacterial pathogens is important for public health. In a number of bacterial species, including Streptococcus pneumoniae, the prevalence of resistance has remained relatively stable despite prolonged selection pressure from antibiotics. The evolutionary processes allowing the robust coexistence of antibiotic sensitive and resistant strains are not fully understood. While allelic diversity can be maintained at a locus by direct balancing selection, there is no evidence for such selection acting in the case of resistance. In this work, we propose a mechanism for maintaining coexistence at the resistance locus: linkage to a second locus that is under balancing selection and that modulates the fitness effect of resistance. We show that duration of carriage plays such a role, with long duration of carriage increasing the fitness advantage gained from resistance. We therefore predict that resistance will be more common in strains with a long duration of carriage and that mechanisms maintaining diversity in duration of carriage will also maintain diversity in antibiotic resistance. We test these predictions in S. pneumoniae and find that the duration of carriage of a serotype is indeed positively correlated with the prevalence of resistance in that serotype. These findings suggest heterogeneity in duration of carriage is a partial explanation for the coexistence of sensitive and resistant strains and that factors determining bacterial duration of carriage will also affect the prevalence of resistance.

  9. Restriction endonuclease triggered bacterial apoptosis as a mechanism for long time survival.

    Science.gov (United States)

    Nagamalleswari, Easa; Rao, Sandhya; Vasu, Kommireddy; Nagaraja, Valakunja

    2017-08-21

    Programmed cell death (PCD) under certain conditions is one of the features of bacterial altruism. Given the bacterial diversity and varied life style, different PCD mechanisms must be operational that remain largely unexplored. We describe restriction endonuclease (REase) mediated cell death by an apoptotic pathway, beneficial for isogenic bacterial communities. Cell death is pronounced in stationary phase and when the enzyme exhibits promiscuous DNA cleavage activity. We have elucidated the molecular mechanism of REase mediated cell killing and demonstrate that released nutrients from dying cells support the growth of the remaining cells in the population. These findings illustrate a new intracellular moonlighting role for REases which are otherwise established host defence arsenals. REase induced PCD appears to be a cellular design to replenish nutrients for cells undergoing starvation stress and the phenomenon could be wide spread in bacteria, given the abundance of restriction-modification (R-M) systems in the microbial population. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Short chain and polyunsaturated fatty acids in host gut health and foodborne bacterial pathogen inhibition.

    Science.gov (United States)

    Peng, Mengfei; Biswas, Debabrata

    2017-12-12

    As a major source of microbes and their numerous beneficial effects, the gut microflora/microbiome is intimately linked to human health and disease. The exclusion of enteric pathogens by these commensal microbes partially depends upon the production of bioactive compounds such as short-chain fatty acids (SCFAs) and polyunsaturated fatty acids (PUFAs). These key intestinal microbial byproducts are crucial to the maintenance of a healthy gut microbial community. Moreover, SCFAs and PUFAs play multiple critical roles in host defense and immunity, including anti-cancer, anti-inflammation, and anti-oxidant activities, as well as out-competition of enteric bacterial pathogens. In this review article, we hereby aim to highlight the importance of SCFAs and PUFAs and the microbes involved in production of these beneficial intestinal components, and their biological functions, specifically as to their immunomodulation and interactions with enteric bacterial pathogens. Finally, we also advance potential applications of these fatty acids with regards to food safety and human gut health.

  11. Fluoride inhibits the response of bone cells to mechanical loading

    NARCIS (Netherlands)

    Willems, H.M.E.; van den Heuvel, E.G.H.M.; Castelein, S.; Buisman, J.K.; Bronckers, A.L.J.J.; Bakker, A.D.; Klein-Nulend, J.

    2011-01-01

    The response of bone cells to mechanical loading is mediated by the cytoskeleton. Since the bone anabolic agent fluoride disrupts the cytoskeleton, we investigated whether fluoride affects the response of bone cells to mechanical loading, and whether this is cytoskeleton mediated. The

  12. Mechanism of inhibited growth of Bacillus pumilus by Propionibacterium freudenreichii subsp. shermanii.

    Science.gov (United States)

    Marshall, D L; Odame-Darkwah, J K

    1994-04-01

    Physiological studies were conducted in an attempt to elucidate the mechanism of inhibition of Bacillus pumilus by Propionibacterium freudenreichii subsp. shermanii. Inhibition of B. pumilus by P. shermanii occurred in media supplemented with 1% glucose, indicating that glucose utilization by the latter bacterium was not responsible for growth inhibition of the former bacterium. The medium pH in which P. shermanii inhibited the growth of B. pumilus was 4.3. Propionic acid was positively identified in the culture medium in which B. pumilus was inhibited by P. shermanii. The presence of propionic acid and a low medium pH may account for the inhibition of B. pumilus by P. shermanii. Sodium lactate concentrations of 0.8-1.0% were essential for the continuous growth of and propionic acid production by P. shermanii. Thus, use of P. shermanii to inhibit B. pumilus in foods would likely require a lactate source.

  13. Diversification of bacterial genome content through distinct mechanisms over different timescales

    Science.gov (United States)

    Croucher, Nicholas J.; Coupland, Paul G.; Stevenson, Abbie E.; Callendrello, Alanna; Bentley, Stephen D.; Hanage, William P.

    2014-01-01

    Bacterial populations often consist of multiple co-circulating lineages. Determining how such population structures arise requires understanding what drives bacterial diversification. Using 616 systematically sampled genomes, we show that Streptococcus pneumoniae lineages are typically characterized by combinations of infrequently transferred stable genomic islands: those moving primarily through transformation, along with integrative and conjugative elements and phage-related chromosomal islands. The only lineage containing extensive unique sequence corresponds to a set of atypical unencapsulated isolates that may represent a distinct species. However, prophage content is highly variable even within lineages, suggesting frequent horizontal transmission that would necessitate rapidly diversifying anti-phage mechanisms to prevent these viruses sweeping through populations. Correspondingly, two loci encoding Type I restriction-modification systems able to change their specificity over short timescales through intragenomic recombination are ubiquitous across the collection. Hence short-term pneumococcal variation is characterized by movement of phage and intragenomic rearrangements, with the slower transfer of stable loci distinguishing lineages. PMID:25407023

  14. Significance of bacterial flora in abdominal irradiation-induced inhibition of lung metastases

    International Nuclear Information System (INIS)

    Matsumoto, T.; Ando, K.; Koike, S.

    1988-01-01

    We have previously reported that abdominal irradiation prior to i.v. injection of syngeneic tumor cells reduced metastases in lung. Our report described an investigation of the significance of intestinal organisms in the radiation effect. We found that eliminating intestinal organisms with antibiotics totally abolished the radiation effect. Monoassociation of germ-free mice revealed that the radiation effect was observable only for Enterobacter cloacae, never for Streptococcus faecium, Bifidobacterium adlesentis, or Escherichia coli. After abdominal irradiation of regular mice, E. cloacae multiplied in cecal contents, adhered to mucous membranes, invaded the cecal wall, and translocated to mesenteric lymph nodes. Intravenous administration of E. cloacae in place of abdominal irradiation inhibited metastases. E. cloacae-monoassociated mice developed fewer metastases than germ-free mice, and the reduction was further enhanced by abdominal irradiation. We concluded that abdominal irradiation caused the invasion of E. cloacae from the mucous membrane of the intestine and inhibited formation of lung metastases

  15. Significance of bacterial flora in abdominal irradiation-induced inhibition of lung metastases

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, T.; Ando, K.; Koike, S.

    1988-06-01

    We have previously reported that abdominal irradiation prior to i.v. injection of syngeneic tumor cells reduced metastases in lung. Our report described an investigation of the significance of intestinal organisms in the radiation effect. We found that eliminating intestinal organisms with antibiotics totally abolished the radiation effect. Monoassociation of germ-free mice revealed that the radiation effect was observable only for Enterobacter cloacae, never for Streptococcus faecium, Bifidobacterium adlesentis, or Escherichia coli. After abdominal irradiation of regular mice, E. cloacae multiplied in cecal contents, adhered to mucous membranes, invaded the cecal wall, and translocated to mesenteric lymph nodes. Intravenous administration of E. cloacae in place of abdominal irradiation inhibited metastases. E. cloacae-monoassociated mice developed fewer metastases than germ-free mice, and the reduction was further enhanced by abdominal irradiation. We concluded that abdominal irradiation caused the invasion of E. cloacae from the mucous membrane of the intestine and inhibited formation of lung metastases.

  16. Significance of bacterial flora in abdominal irradiation-induced inhibition of lung metastases.

    Science.gov (United States)

    Matsumoto, T; Ando, K; Koike, S

    1988-06-01

    We have previously reported that abdominal irradiation prior to i.v. injection of syngeneic tumor cells reduced metastases in lung. Our report described an investigation of the significance of intestinal organisms in the radiation effect. We found that eliminating intestinal organisms with antibiotics totally abolished the radiation effect. Monoassociation of germ-free mice revealed that the radiation effect was observable only for Enterobacter cloacae, never for Streptococcus faecium, Bifidobacterium adlesentis, or Escherichia coli. After abdominal irradiation of regular mice, E. cloacae multiplied in cecal contents, adhered to mucous membranes, invaded the cecal wall, and translocated to mesenteric lymph nodes. Intravenous administration of E. cloacae in place of abdominal irradiation inhibited metastases. E. cloacae-monoassociated mice developed fewer metastases than germ-free mice, and the reduction was further enhanced by abdominal irradiation. We concluded that abdominal irradiation caused the invasion of E. cloacae from the mucous membrane of the intestine and inhibited formation of lung metastases.

  17. Population Density Modulates Drug Inhibition and Gives Rise to Potential Bistability of Treatment Outcomes for Bacterial Infections.

    Directory of Open Access Journals (Sweden)

    Jason Karslake

    2016-10-01

    Full Text Available The inoculum effect (IE is an increase in the minimum inhibitory concentration (MIC of an antibiotic as a function of the initial size of a microbial population. The IE has been observed in a wide range of bacteria, implying that antibiotic efficacy may depend on population density. Such density dependence could have dramatic effects on bacterial population dynamics and potential treatment strategies, but explicit measures of per capita growth as a function of density are generally not available. Instead, the IE measures MIC as a function of initial population size, and population density changes by many orders of magnitude on the timescale of the experiment. Therefore, the functional relationship between population density and antibiotic inhibition is generally not known, leaving many questions about the impact of the IE on different treatment strategies unanswered. To address these questions, here we directly measured real-time per capita growth of Enterococcus faecalis populations exposed to antibiotic at fixed population densities using multiplexed computer-automated culture devices. We show that density-dependent growth inhibition is pervasive for commonly used antibiotics, with some drugs showing increased inhibition and others decreased inhibition at high densities. For several drugs, the density dependence is mediated by changes in extracellular pH, a community-level phenomenon not previously linked with the IE. Using a simple mathematical model, we demonstrate how this density dependence can modulate population dynamics in constant drug environments. Then, we illustrate how time-dependent dosing strategies can mitigate the negative effects of density-dependence. Finally, we show that these density effects lead to bistable treatment outcomes for a wide range of antibiotic concentrations in a pharmacological model of antibiotic treatment. As a result, infections exceeding a critical density often survive otherwise effective treatments.

  18. Organo-Selenium Coatings Inhibit Gram-Negative and Gram-Positive Bacterial Attachment to Ophthalmic Scleral Buckle Material.

    Science.gov (United States)

    Tran, Phat; Arnett, Avery; Jarvis, Courtney; Mosley, Thomas; Tran, Khien; Hanes, Rob; Webster, Dan; Mitchell, Kelly; Dominguez, Leo; Hamood, Abdul; Reid, Ted W

    2017-09-01

    Biofilm formation is a problem for solid and sponge-type scleral buckles. This can lead to complications that require removal of the buckle, and result in vision loss due to related ocular morbidity, primarily infection, or recurrent retinal detachment. We investigate the ability of a covalent organo-selenium coating to inhibit biofilm formation on a scleral buckle. Sponge and solid Labtican brand scleral buckles were coated with organo-selenium coupled to a silyation reagent. Staphylococcus aureus biofilm formation was monitored by a standard colony-forming unit assay and the confocal laser scanning microscopy, while Pseudomonas aeruginosa biofilm formation was examined by scanning electron microscopy. Stability studies were done, by soaking in phosphate buffer saline (PBS) at room temperature for 2 months. Toxicity against human corneal epithelial cell was examined by growing the cells in the presence of organo-selenium-coated scleral buckles. The organo-selenium coating inhibited biofilm formation by gram-negative and gram-positive bacteria. The buckle coatings also were shown to be fully active after soaking in PBS for 2 months. The organo-selenium coatings had no effect on the viability of human corneal epithelial cells. Organo-selenium can be used to covalently coat a scleral buckle, which is stable and inhibits biofilm formation for gram-negative and gram-positive bacteria. The organo-selenium buckle coating was stable and nontoxic to cell culture. This technology provides a means to inhibit bacterial attachment to devices attached to the eye, without damage to ocular cells.

  19. GsMTx4: Mechanism of Inhibiting Mechanosensitive Ion Channels.

    Science.gov (United States)

    Gnanasambandam, Radhakrishnan; Ghatak, Chiranjib; Yasmann, Anthony; Nishizawa, Kazuhisa; Sachs, Frederick; Ladokhin, Alexey S; Sukharev, Sergei I; Suchyna, Thomas M

    2017-01-10

    GsMTx4 is a spider venom peptide that inhibits cationic mechanosensitive channels (MSCs). It has six lysine residues that have been proposed to affect membrane binding. We synthesized six analogs with single lysine-to-glutamate substitutions and tested them against Piezo1 channels in outside-out patches and independently measured lipid binding. Four analogs had ∼20% lower efficacy than the wild-type (WT) peptide. The equilibrium constants calculated from the rates of inhibition and washout did not correlate with the changes in inhibition. The lipid association strength of the WT GsMTx4 and the analogs was determined by tryptophan autofluorescence quenching and isothermal calorimetry with membrane vesicles and showed no significant differences in binding energy. Tryptophan fluorescence-quenching assays showed that both WT and analog peptides bound superficially near the lipid-water interface, although analogs penetrated deeper. Peptide-lipid association, as a function of lipid surface pressure, was investigated in Langmuir monolayers. The peptides occupied a large fraction of the expanded monolayer area, but that fraction was reduced by peptide expulsion as the pressure approached the monolayer-bilayer equivalence pressure. Analogs with compromised efficacy had pressure-area isotherms with steeper slopes in this region, suggesting tighter peptide association. The pressure-dependent redistribution of peptide between "deep" and "shallow" binding modes was supported by molecular dynamics (MD) simulations of the peptide-monolayer system under different area constraints. These data suggest a model placing GsMTx4 at the membrane surface, where it is stabilized by the lysines, and occupying a small fraction of the surface area in unstressed membranes. When applied tension reduces lateral pressure in the lipids, the peptides penetrate deeper acting as "area reservoirs" leading to partial relaxation of the outer monolayer, thereby reducing the effective magnitude of

  20. Mechanism of single-layer 193-nm dissolution inhibition resist

    Science.gov (United States)

    Yan, Zhenglin; Houlihan, Francis M.; Reichmanis, Elsa; Nalamasu, Omkaram; Reiser, Arnost; Dabbagh, Gary; Hutton, Richard S.; Osei, Dan; Sousa, Jose; Bolan, Kevin J.

    2000-06-01

    We have found that the progress of developer base into films of terpolymers of norbornene (NB)-maleic anhydride (MA) and acrylic acid (AA) is a percolation process with a critical site concentration of x(c) equals 0.084 which suggests that every acrylic acid site in the terpolymer of norbornene-maleic anhydride-acrylic acid can make 12 monomer units of the polymer water compatible. In practice these systems are being used with various tert-butyl esters of cholic acid as dissolution inhibitors. The cholates differ very much in their dissolution inhibition factors (lowest t-butyl cholate (1.3) to highest t-butyl lithocholate glutarate dimer (7.4). The change in these factors corrected for molarity follow the hydrophobic character of the dissolution as measured by log(p). A quick screening method has also been established to evaluate dissolution inhibitors based on our observation that the cloud point (the volume % acetone in a water/acetone which gives persistent cloudiness) parallels the dissolution inhibiting power as measured by the dissolution inhibition factor. For dissolution promotion, optimal results are obtained with t-butyl 1,3,5-cyclohexanetricarboxylate (f equals -6.3) and poorest results with t-butyl lithocholate (f equals -2.8); this appears to track with the number of carboxyl groups and the hydrophobicity of the carboxylic acids. The Rmax found for resist formulations tracks well with these findings. Another factor in determining the ultimate achievable contrast is the degree of acidolytic deprotection achieved by the material. It appears that acidolyticaly cleaveable carboxylate esters with a higher concentration of electron withdrawing groups such as t-butyl 1,3,5-cyclohexanetricarboxylate are more effective.

  1. Ion Channels Activated by Mechanical Forces in Bacterial and Eukaryotic Cells.

    Science.gov (United States)

    Sokabe, Masahiro; Sawada, Yasuyuki; Kobayashi, Takeshi

    2015-01-01

    Since the first discovery of mechanosensitive ion channel (MSC) in non-sensory cells in 1984, a variety of MSCs has been identified both in prokaryotic and eukaryotic cells. One of the central issues concerning MSCs is to understand the molecular and biophysical mechanisms of how mechanical forces activate/open MSCs. It has been well established that prokaryotic (mostly bacterial) MSCs are activated exclusively by membrane tension. Thus the problem to be solved with prokaryotic MSCs is the mechanisms how the MSC proteins receive tensile forces from the lipid bilayer and utilize them for channel opening. On the other hand, the activation of many eukaryotic MSCs crucially depends on tension in the actin cytoskeleton. By using the actin cytoskeleton as a force sensing antenna, eukaryotic MSCs have obtained sophisticated functions such as remote force sensing and force-direction sensing, which bacterial MSCs do not have. Actin cytoskeletons also give eukaryotic MSCs an interesting and important function called "active touch sensing", by which cells can sense rigidity of their substrates. The contractile actin cytoskeleton stress fiber (SF) anchors its each end to a focal adhesion (FA) and pulls the substrate to generate substrate-rigidity-dependent stresses in the FA. It has been found that those stresses are sensed by some Ca2+-permeable MSCs existing in the vicinity of FAs, thus the MSCs work as a substrate rigidity sensor that can transduce the rigidity into intracellular Ca2+ levels. This short review, roughly constituting of two parts, deals with molecular and biophysical mechanisms underlying the MSC activation process mostly based on our recent studies; (1) structure-function in bacterial MSCs activation at the atomic level, and (2) roles of actin cytoskeletons in the activation of eukaryotic MSCs.

  2. Blue light (470 nm) effectively inhibits bacterial and fungal growth.

    Science.gov (United States)

    De Lucca, A J; Carter-Wientjes, C; Williams, K A; Bhatnagar, D

    2012-12-01

    Blue light (470 nm) LED antimicrobial properties were studied alone against bacteria and with or without the food grade photosensitizer, erythrosine (ERY) against filamentous fungi. Leuconostoc mesenteroides (LM), Bacillus atrophaeus (BA) or Pseudomonas aeruginosa (PA) aliquots were exposed on nutrient agar plates to Array 1 (AR1, 0·2 mW cm(-2)) or Array 2 (AR2, 80 mW cm(-2)), which emitted impure or pure blue light (0-300 J cm(-2)), respectively. Inoculated control (room light only) plates were incubated (48 h) and colonies enumerated. The antifungal properties of blue light combined with ERY (11·4 and 22·8 μmol l(-1)) on Penicillium digitatum (PD) and Fusarium graminearum (FG) conidia were determined. Conidial controls consisted of: no light, room light-treated conidia and ERY plus room light. Light-treated (ERY + blue light) conidial samples were exposed only to AR2 (0-100 J cm(-2)), aliquots spread on potato dextrose agar plates, incubated (48 h, 30°C) and colonies counted. Blue light alone significantly reduced bacterial and FG viability. Combined with ERY, it significantly reduced PD viability. Blue light is lethal to bacteria and filamentous fungi although effectiveness is dependent on light purity, energy levels and microbial genus. Light from two arrays of different blue LEDs significantly reduced bacterial (Leuconostoc mesenteroides, Bacillus atrophaeus and Pseudomonas aeruginosa) viabilities. Significant in vitro viability loss was observed for the filamentous fungi, Penicillium digitatum and Fusarium graminearum when exposed to pure blue light only plus a photosensitizer. F. graminearum viability was significantly reduced by blue light alone. Results suggest that (i) the amount of significant loss in bacterial viability observed for blue light that is pure or with traces of other wavelengths is genus dependent and (ii) depending on fungal genera, pure blue light is fungicidal with or without a photosensitizer. © 2012 The Society for

  3. Inhibition of bacterial growth in sweet cheese whey by carbon dioxide as determined by culture-independent community profiling.

    Science.gov (United States)

    Lo, Raquel; Xue, Tian; Weeks, Mike; Turner, Mark S; Bansal, Nidhi

    2016-01-18

    Whey is a valuable co-product from cheese making that serves as a raw material for a wide range of products. Its rich nutritional content lends itself to rapid spoilage, thus it typically needs to be pasteurised and refrigerated promptly. Despite the extensive literature on milk spoilage bacteria, little is known about the spoilage bacteria of whey. The utility of carbon dioxide (CO2) to extend the shelf-life of raw milk and cottage cheese has been well established, but its application in whey preservation has not yet been explored. This study aims to characterise the microbial populations of fresh and spoiled sweet whey by culture-independent community profiling using 454 pyrosequencing of 16S rRNA gene amplicons and to determine whether carbonation is effective in inhibiting bacterial growth in sweet whey. The microbiota of raw Cheddar and Mozzarella whey was dominated by cheese starter bacteria. After pasteurisation, two out of the three samples studied became dominated by diverse environmental bacteria from various phyla, with Proteobacteria being the most dominant. Diverse microbial profiles were maintained until spoilage occurred, when the entire population was dominated by just one or two genera. Whey spoilage bacteria were found to be similar to those of milk. Pasteurised Cheddar and Mozzarella whey was spoiled by Bacillus sp. or Pseudomonas sp., and raw Mozzarella whey was spoiled by Pseudomonas sp., Serratia sp., and other members of the Enterobacteriaceae family. CO2 was effective in inhibiting bacterial growth of pasteurised Cheddar and Mozzarella whey stored at 15°C and raw Mozzarella whey stored at 4°C. The spoilage bacteria of the carbonated samples were similar to those of the non-carbonated controls. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Elevated guanosine 5'-diphosphate 3'-diphosphate level inhibits bacterial growth and interferes with FtsZ assembly.

    Science.gov (United States)

    Yamaguchi, Takayoshi; Iida, Ken-Ichiro; Shiota, Susumu; Nakayama, Hiroaki; Yoshida, Shin-Ichi

    2015-12-01

    FtsZ, a protein essential for prokaryotic cell division, forms a ring structure known as the Z-ring at the division site. FtsZ has a GTP binding site and is assembled into linear structures in a GTP-dependent manner in vitro. We assessed whether guanosine 5'-diphosphate 3'-diphosphate (ppGpp), a global regulator of gene expression in starved bacteria, affects cell division in Salmonella Paratyphi A. Elevation of intracellular ppGpp levels by using the relA expression vector induced repression of bacterial growth and incorrect FtsZ assembly. We found that FtsZ forms helical structures in the presence of ppGpp by using the GTP binding site; however, ppGpp levels required to form helical structures were at least 20-fold higher than the required GTP levels in vitro. Furthermore, once formed, helical structures did not change to the straight form even after GTP addition. Our data indicate that elevation of the ppGpp level leads to inhibition of bacterial growth and interferes with FtsZ assembly. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Bacterial Peptide Deformylase Inhibition of Tetrazole-Substituted Biaryl Acid Analogs: Synthesis, Biological Evaluations, and Molecular Docking Study.

    Science.gov (United States)

    Khan, Firoz A Kalam; Patil, Rajendra H; Patil, Manjiri; Arote, Rohidas; Shinde, Devanand B; Sangshetti, Jaiprakash N

    2016-12-01

    The synthesis and screening of tetrazole-substituted biaryl acid analogs 7a-l as bacterial peptide deformylase (PDF) enzyme inhibitors is reported. The compounds 7e (IC 50 value = 5.50 μM) and 7g (IC 50 value = 7.25 μM) showed good PDF inhibition activity. The compounds 7e (MIC range = 10.75-11.66 μg/mL) and 7g (MIC range = 8.91-12.83 μg/mL) also showed potent antibacterial activity when compared with the standard ciprofloxacin (MIC range = 25-50 μg/mL). Thus, the active derivatives were not only potent PDF enzyme inhibitors but also efficient antibacterial agents. In order to gain more insight into the binding mode of the compounds with the PDF enzyme, the most active compounds 7e and 7g, the moderately active compound 7k, and the least active compound 7h were docked against the PDF enzyme of Escherichia coli. The docking study of the most active compounds 7e and 7g against the PDF enzyme exhibited good binding properties. Hence, we believe our synthesized compounds 7a-l could serve as reservoir for bacterial PDF inhibitor development. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Superoxide anions produced by Streptococcus pyogenes group A-stimulated keratinocytes are responsible for cellular necrosis and bacterial growth inhibition.

    Science.gov (United States)

    Regnier, Elodie; Grange, Philippe A; Ollagnier, Guillaume; Crickx, Etienne; Elie, Laetitia; Chouzenoux, Sandrine; Weill, Bernard; Plainvert, Céline; Poyart, Claire; Batteux, Frédéric; Dupin, Nicolas

    2016-02-01

    Gram-positive Streptococcus pyogenes (group A Streptococcus or GAS) is a major skin pathogen and interacts with keratinocytes in cutaneous tissues. GAS can cause diverse suppurative and inflammatory infections, such as cellulitis, a common acute bacterial dermo-hypodermitis with a high morbidity. Bacterial isolation yields from the lesions are low despite the strong local inflammation observed, raising numerous questions about the pathogenesis of the infection. Using an in vitro model of GAS-infected keratinocytes, we show that the major ROS produced is the superoxide anion ([Formula: see text]), and that its production is time- and dose-dependent. Using specific modulators of ROS production, we show that [Formula: see text] is mainly synthesized by the cytoplasmic NADPH oxidase. Superoxide anion production leads to keratinocyte necrosis but incomplete inhibition of GAS growth, suggesting that GAS may be partially resistant to the oxidative burst. In conclusion, GAS-stimulated keratinocytes are able to develop an innate immune response based on the production of ROS. This local immune response limits GAS development and induces keratinocyte cell death, resulting in the skin lesions observed in patients with cellulitis. © The Author(s) 2015.

  7. Surface-modified nanoparticles as a new, versatile, and mechanically robust nonadhesive coating : Suppression of protein adsorption and bacterial adhesion

    NARCIS (Netherlands)

    Holmes, P. F.; Currie, E. P. K.; Thies, J. C.; van der Mei, H. C.; Busscher, H. J.; Norde, W.

    2009-01-01

    The synthesis of surface-modified silica nanoparticles, chemically grafted with acrylate and poly(ethylene glycol) (PEG) groups, and the ability of the resulting crosslinked coatings to inhibit protein adsorption and bacterial adhesion are explored. Water contact angles, nanoindentation, and atomic

  8. Mechanism of leukotriene D4 inhibition of Na-alanine cotransport in intestinal epithelial cells

    OpenAIRE

    Talukder, Jamilur R.; Kekuda, Ramesh; Saha, Prosenjit; Sundaram, Uma

    2008-01-01

    In a rabbit model of chronic intestinal inflammation, we previously demonstrated inhibition of neutral Na-amino acid cotransport. The mechanism of the inhibition was secondary to a decrease in the affinity for amino acid rather than the number of cotransporters. Since leukotriene (LT)D4 is known to be elevated in enterocytes during chronic intestinal inflammation, we used rat intestinal epithelial cell (IEC-18) monolayers to determine the mechanism of regulation of Na-alanine cotransport (ala...

  9. Lysis of bacterial cells in the process of bacteriophage release – canonical and newly discovered mechanisms

    Directory of Open Access Journals (Sweden)

    Wioleta M. Woźnica

    2015-01-01

    Full Text Available The release of phage progeny from an infected bacterium is necessary for the spread of infection. Only helical phages are secreted from a cell without causing its destruction. The release of remaining phages is correlated with bacterial lysis and death. Thus, the understanding of phage lytic functions is crucial for their use in the fight with bacterial pathogens. Bacteriophages with small RNA or DNA genomes encode single proteins which are called amurins and cause lysis by the inhibition of cell wall synthesis. Bacteriophages of double-stranded DNA genomes, which dominate in the environment, encode enzymes that are called endolysins and contribute to lysis by the cleavage of cell wall peptydoglycan. Endolysins that do not contain signal sequences cannot pass the cytoplasmic membrane by themselves. Their access to peptidoglycan is provided by membrane proteins – holins, which can form in the membrane large pores, that are called “holes”. Some endolysins do not require holins for their transport, owing to the presence of the so called SAR sequence at their N-terminus. It enables their transport through the membrane by the bacterial sec system. However, it is not cleaved off, and thus these endolysins remain trapped in the membrane in an inactive form. Their release, which is correlated with the activation, occurs as a result of membrane depolarization and depends on proteins that are called pinholins. Pinholins form in membrane pores that are too small for the passage of endolysins but sufficient for membrane depolarization. Proteins that are called antiholins regulate the timing of lysis, through the blockage of holins action until the end of phage morphogenesis. Additionally, newly identified lytic proteins, spanins, participate in the release of progeny phages from Gram-negative bacteria cells. They cause the destruction of outer cell membrane by its spanning with the cytoplasmic membrane. This is possible after the endolysin

  10. Galactose inhibits auxin-induced growth of Avena coleoptiles by two mechanisms

    Science.gov (United States)

    Cheung, S. P.; Cleland, R. E.

    1991-01-01

    Galactose inhibits auxin-induced growth of Avena coleoptiles by at least two mechanisms. First, it inhibits auxin-induced H(+)-excretion needed for the initiation of rapid elongation. Galactose cannot be doing so by directly interfering with the ATPase since fusicoccin-induced H(+)-excretion is not affected. Secondly, galactose inhibits long-term auxin-induced growth, even in an acidic (pH 4.5) solution. This may be due to an inhibition of cell wall synthesis. However, galactose does not reduce the capacity of walls to be loosened by H+, given exogenously or excreted in response to fusicoccin.

  11. High-resolution bacterial growth inhibition profiling combined with HPLC-HRMS-SPE-NMR for identification of antibacterial constituents in Chinese plants used to treat snakebites.

    Science.gov (United States)

    Liu, Yueqiu; Nielsen, Mia; Staerk, Dan; Jäger, Anna K

    2014-09-11

    Bacterial infection is one of the main secondary infections caused by snakebite. The 88 plant species investigated in this study have been used as folk remedies for treatment of snakebite, and it is therefore the aim of this study to investigate whether the plants contain compounds with bacterial growth inhibition. The water and ethanol extracts of 88 plant species were screened at 200 μg/mL against Bacillus subtilis, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa for their antibacterial activity by micro-broth dilution assay. The most active extracts were fractionated into microplates using analytical-scale RP-HPLC, and subsequently growth inhibition was assessed for each well. The biochromatograms constructed from these assays were used to identify compounds responsible for antibacterial activity. The structures of five compounds were elucidated by HPLC-HRMS-SPE-NMR. Crude extracts of Boehmeria nivea, Colocasia esculenta, Fagopyrum cymosum, Glochidion puberum, Melastoma dodecandrum, Polygonum bistorta, Polygonum cuspidatum and Sanguisorba officinalis showed MIC values below 200 μg/mL against either Bacillus subtilis, Staphylococcus aureus, Escherichia coli or Pseudomonas aeruginosa. The biochromatograms demonstrated that tannins play a main role for the bacterial growth inhibition observed for all above-mentioned plants except for Polygonum cuspidatum. Furthermore, the high-resolution bacterial growth inhibition profiling combined with HPLC-HRMS-SPE-NMR allowed fast identification of three non-tannin active compounds, i.e., piceid, resveratrol and emodin from ethanol extract of Polygonum cuspidatum. The high-resolution bacterial growth inhibition profiling allowed fast pinpointing of constituents responsible for the bioactivity, e.g., either showing tannins being the main bacterial growth inhibitors as observed for the majority of the active plants, or combined with HPLC-HRMS-SPE-NMR for fast structural identification of non

  12. Isoform-Specific Substrate Inhibition Mechanism of Human Tryptophan Hydroxylase

    DEFF Research Database (Denmark)

    Tidemand, Kasper Damgaard; Peters, Günther H.J.; Harris, Pernille

    2017-01-01

    Tryptophan hydroxylase (TPH) catalyzes the initial and rate-limiting step in the biosynthesis of serotonin, which is associated with a variety of disorders such as depression and irritable bowel syndrome. TPH exists in two isoforms: TPH1 and TPH2. TPH1 catalyzes the initial step in the synthesis...... of serotonin in the peripheral tissues, while TPH2 catalyzes this step in the brain. In this study, the steady-state kinetic mechanism for the catalytic domain of human TPH1 has been determined. Varying substrate tryptophan (Trp) and tetrahydrobiopterin (BH4) results in a hybrid Ping Pong-ordered mechanism...... in which the reaction can either occur through a Ping Pong or a sequential mechanism depending on the concentration of tryptophan. The catalytic domain of TPH1 shares a sequence identity of 81% with TPH2. Despite the high sequence identity, differences in the kinetic parameters of the isoforms have been...

  13. Structural Studies of Bacterial Enzymes and their Relation to Antibiotic Resistance Mechanisms - Final Paper

    Energy Technology Data Exchange (ETDEWEB)

    Maltz, Lauren [SLAC National Accelerator Lab., Menlo Park, CA (United States)

    2015-08-27

    By using protein crystallography and X-ray diffraction, structures of bacterial enzymes were solved to gain a better understanding of how enzymatic modification acts as an antibacterial resistance mechanism. Aminoglycoside phosphotransferases (APHs) are one of three aminoglycoside modifying enzymes that confer resistance to the aminoglycoside antibiotics via enzymatic modification, rendering many drugs obsolete. Specifically, the APH(2”) family vary in their substrate specificities and also in their preference for the phosphate donor (ADP versus GDP). By solving the structures of members of the APH(2”) family of enzymes, we can see how domain movements are important to their substrate specificity. Our structure of the ternary complex of APH(2”)-IIIa with GDP and kanamycin, when compared to the known structures of APH(2”)-IVa, reveals that there are real physical differences between these two enzymes, a structural finding that explains why the two enzymes differ in their preferences for certain aminoglycosides. Another important group of bacterial resistance enzymes are the Class D β- lactamases. Oxacillinase carbapenemases (OXAs) are part of this enzyme class and have begun to confer resistance to ‘last resort’ drugs, most notably carbapenems. Our structure of OXA-143 shows that the conformational flexibility of a conserved hydrophobic residue in the active site (Val130) serves to control the entry of a transient water molecule responsible for a key step in the enzyme’s mechanism. Our results provide insight into the structural mechanisms of these two different enzymes

  14. Avoidance and Subversion of Eukaryotic Homeostatic Autophagy Mechanisms by Bacterial Pathogens.

    Science.gov (United States)

    Miller, Cheryl; Celli, Jean

    2016-08-28

    Autophagy is a conserved lysosomal recycling process, which maintains cellular homeostasis during stress and starvation conditions by degrading and recycling proteins, lipids, and carbohydrates, ultimately increasing nutrient availability in eukaryotes. An additional function of autophagy, termed xenophagy, is to detect, capture, and destroy invading microorganisms, such as viruses, bacteria, and protozoa, providing autophagy with a role in innate immunity. Many intracellular pathogens have, however, developed mechanisms to avoid xenophagy and have evolved strategies to take advantage of select autophagic processes to undergo their intracellular life cycle. This review article will discuss the molecular mechanisms used by the intracellular bacterial pathogens Francisella spp. and Brucella spp. to manipulate components of the autophagic pathway, promoting cytosolic growth in the case of Francisella spp. and facilitating cellular egress and cell-to-cell spread in the case of Brucella spp. These examples highlight how successful, highly infectious bacterial pathogens avoid or subvert host autophagy mechanisms normally employed to maintain eukaryotic homeostasis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Mechanisms of Bacterial (Serratia marcescens) Attachment to, Migration along, and Killing of Fungal Hyphae.

    Science.gov (United States)

    Hover, Tal; Maya, Tal; Ron, Sapir; Sandovsky, Hani; Shadkchan, Yana; Kijner, Nitzan; Mitiagin, Yulia; Fichtman, Boris; Harel, Amnon; Shanks, Robert M Q; Bruna, Roberto E; García-Véscovi, Eleonora; Osherov, Nir

    2016-05-01

    We have found a remarkable capacity for the ubiquitous Gram-negative rod bacterium Serratia marcescens to migrate along and kill the mycelia of zygomycete molds. This migration was restricted to zygomycete molds and several basidiomycete species. No migration was seen on any molds of the phylum Ascomycota. S. marcescens migration did not require fungal viability or surrounding growth medium, as bacteria migrated along aerial hyphae as well.S. marcescens did not exhibit growth tropism toward zygomycete mycelium. Bacterial migration along hyphae proceeded only when the hyphae grew into the bacterial colony. S. marcescens cells initially migrated along the hyphae, forming attached microcolonies that grew and coalesced to generate a biofilm that covered and killed the mycelium. Flagellum-defective strains of S. marcescens were able to migrate along zygomycete hyphae, although they were significantly slower than the wild-type strain and were delayed in fungal killing. Bacterial attachment to the mycelium does not necessitate type 1 fimbrial adhesion, since mutants defective in this adhesin migrated equally well as or faster than the wild-type strain. Killing does not depend on the secretion of S. marcescens chitinases, as mutants in which all three chitinase genes were deleted retained wild-type killing abilities. A better understanding of the mechanisms by which S. marcescens binds to, spreads on, and kills fungal hyphae might serve as an excellent model system for such interactions in general; fungal killing could be employed in agricultural fungal biocontrol. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  16. Bacterial immunostimulants--mechanism of action and clinical application in respiratory diseases.

    Science.gov (United States)

    Rozy, Adriana; Chorostowska-Wynimko, Joanna

    2008-01-01

    Immunity towards bacteria might be achieved as a result of natural processes following infection, or as a consequence of medical intervention including vaccination, administration of immunoglobulins or therapy with immunostimulants derived from bacteria. Bacterial immunostimulants (ISs) containing bacterial lysate (OM-85 BV, LW 50020) or components of bacterial cells (ribosomal extracts) were shown to induce a non-specific response (i.e. intensification of phagocytosis) but also to orchestrate both cellular (B, T cell stimulation) and humoral responses (antibodies and proinflammatory cytokines production). Therefore, the duality of their immunomodulatory activity mimics or, to a certain extent, repeats the immune response evoked by the intrusion of a pathogen into the human body, which is initially non-specific, but subsequently becomes specific. However, their clinical efficacy in the prevention of respiratory tract infection (RTI) is still debated. This article reviews their mechanism of action, as well as the available clinical data, discussing the pros and cons of their use in the prevention of RITs in children and adults.

  17. Bacterial radiosensitivity to gamma and ultraviolet. Compositional dependence and repair mechanisms

    International Nuclear Information System (INIS)

    Saez Angulo, R. M.; Davila, C. A.

    1974-01-01

    The gamma and ultraviolet radiosensitivity of several species of bacteria has been determined its dependence on DNAs composition and repair processes has been studied. Base composition are evaluated by chromatography, DNA melting temperature and isopycnic sedimentation on CsCl gradient. Repair capacity of gamma -and UV- lesions has been studied in two bacterial strains with same DMA base composition. It is concluded that the postulated correlation between radiosensitivity and base composition can not be generalized, the enzymatic repair mechanisms being of determining on radiosensitivity. (Author) 248 refs

  18. Bacterial contaminants from frozen puff pastry production process and their growth inhibition by antimicrobial substances from lactic acid bacteria.

    Science.gov (United States)

    Rumjuankiat, Kittaporn; Keawsompong, Suttipun; Nitisinprasert, Sunee

    2017-05-01

    Seventy-five bacterial contaminants which still persisted to cleaning system from three puff pastry production lines (dough forming, layer and filling forming, and shock freezing) were identified using 16S rDNA as seven genera of Bacillus , Corynebacterium , Dermacoccus , Enterobacter , Klebsiella, Pseudomonas , and Staphylococcus with detection frequencies of 24.00, 2.66, 1.33, 37.33, 1.33, 2.66, and 30.66, respectively. Seventeen species were discovered while only 11 species Bacillus cereus, B. subtilis, B. pumilus, Corynebacterium striatum , Dermacoccus barathri , Enterobacter asburiae, Staphylococcus kloosii, S. haemolyticus, S. hominis, S. warneri , and S. aureus were detected at the end of production. Based on their abundance, the highest abundance of E. asburiae could be used as a biomarker for product quality. While a low abundance of the mesophile pathogen C. striatum , which causes respiratory and nervous infection and appeared only at the shock freezing step was firstly reported for its detection in bakery product. Six antimicrobial substances (AMSs) from lactic acid bacteria, FF1-4, FF1-7, PFUR-242, PFUR-255, PP-174, and nisin A were tested for their inhibition activities against the contaminants. The three most effective were FF1-7, PP-174, and nisin A exhibiting wide inhibition spectra of 88.00%, 85.33%, and 86.66%, respectively. The potential of a disinfectant solution containing 800 AU/ml of PP-174 and nisin A against the most resistant strains of Enterobacter , Staphylococcus , Bacillus and Klebsiella was determined on artificially contaminated conveyor belt coupons at 0, 4, 8, 12, and 16 hr. The survival levels of the test strains were below 1 log CFU/coupon at 0 hr. The results suggested that a combined solution of PP-174 and nisin A may be beneficial as a sanitizer to inhibit bacterial contaminants in the frozen puff pastry industry.

  19. Mechanisms of action of PDE5 inhibition in erectile dysfunction.

    Science.gov (United States)

    Corbin, J D

    2004-06-01

    A spinal reflex and the L-arginine-nitric oxide-guanylyl cyclase-cyclic guanosine monophosphate (cGMP) pathway mediate smooth muscle relaxation that results in penile erection. Nerves and endothelial cells directly release nitric oxide in the penis, where it stimulates guanylyl cyclase to produce cGMP and lowers intracellular calcium levels. This triggers relaxation of arterial and trabecular smooth muscle, leading to arterial dilatation, venous constriction, and erection. Phosphodiesterase 5 (PDE5) is the predominant phosphodiesterase in the corpus cavernosum. The catalytic site of PDE5 normally degrades cGMP, and PDE5 inhibitors such as sildenafil potentiate endogenous increases in cGMP by inhibiting its breakdown at the catalytic site. Phosphorylation of PDE5 increases its enzymatic activity as well as the affinity of its allosteric (noncatalytic/GAF domains) sites for cGMP. Binding of cGMP to the allosteric site further stimulates enzymatic activity. Thus phosphorylation of PDE5 and binding of cGMP to the noncatalytic sites mediate negative feedback regulation of the cGMP pathway.

  20. Mechanism of product inhibition for cellobiohydrolase Cel7A during hydrolysis of insoluble cellulose

    DEFF Research Database (Denmark)

    Olsen, Johan P.; Alasepp, Kadri; Kari, Jeppe

    2016-01-01

    the lines of conventional enzyme kinetic theory. We found that the product cellobiose lowered the maximal rate without affecting the Michaelis constant, and this kinetic pattern could be rationalized by two fundamentally distinct molecular mechanisms. One was simple reversibility, that is, an increasing...... rate of the reverse reaction, lowering the net hydrolytic velocity as product concentrations increase. Strictly this is not a case of inhibition, as no catalytically inactive is formed. The other mechanism that matched the kinetic data was noncompetitive inhibition with an inhibition constant of 490...... ± 40 μM. Noncompetitive inhibition implies that the inhibitor binds with comparable strength to either free enzyme or an enzymesubstrate complex, that is, that association between enzyme and substrate has no effect on the binding of the inhibitor. This mechanism is rarely observed, but we argue...

  1. Bacterial endophytes from wild maize suppress Fusarium graminearum in modern maize and inhibit mycotoxin accumulation

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2015-10-01

    Full Text Available Wild maize (teosinte has been reported to be less susceptible to pests than their modern maize (corn relatives. Endophytes, defined as microbes that inhabit plants without causing disease, are known for their ability to antagonize plant pests and pathogens. We hypothesized that the wild relatives of modern maize may host endophytes that combat pathogens. Fusarium graminearum is the fungus that causes Gibberella Ear Rot (GER in modern maize and produces the mycotoxin, deoxynivalenol (DON. In this study, 215 bacterial endophytes, previously isolated from diverse maize genotypes including wild teosintes, traditional landraces and modern varieties, were tested for their ability to antagonize F. graminearum in vitro. Candidate endophytes were then tested for their ability to suppress GER in modern maize in independent greenhouse trials. The results revealed that three candidate endophytes derived from wild teosintes were most potent in suppressing F. graminearum in vitro and GER in a modern maize hybrid. These wild teosinte endophytes could suppress a broad spectrum of fungal pathogens of modern crops in vitro. The teosinte endophytes also suppressed DON mycotoxin during storage to below acceptable safety threshold levels. A fourth, less robust anti-fungal strain was isolated from a modern maize hybrid. Three of the anti-fungal endophytes were predicted to be Paenibacillus polymyxa, along with one strain of Citrobacter. Microscopy studies suggested a fungicidal mode of action by all four strains. Molecular and biochemical studies showed that the P. polymyxa strains produced the previously characterized anti-Fusarium compound, fusaricidin. Our results suggest that the wild relatives of modern crops may serve as a valuable reservoir for endophytes in the ongoing fight against serious threats to modern agriculture. We discuss the possible impact of crop evolution and domestication on endophytes in the context of plant defense.

  2. Novel mechanisms to inhibit HIV reservoir seeding using Jak inhibitors.

    Directory of Open Access Journals (Sweden)

    Christina Gavegnano

    2017-12-01

    Full Text Available Despite advances in the treatment of HIV infection with ART, elucidating strategies to overcome HIV persistence, including blockade of viral reservoir establishment, maintenance, and expansion, remains a challenge. T cell homeostasis is a major driver of HIV persistence. Cytokines involved in regulating homeostasis of memory T cells, the major hub of the HIV reservoir, trigger the Jak-STAT pathway. We evaluated the ability of tofacitinib and ruxolitinib, two FDA-approved Jak inhibitors, to block seeding and maintenance of the HIV reservoir in vitro. We provide direct demonstration for involvement of the Jak-STAT pathway in HIV persistence in vivo, ex vivo, and in vitro; pSTAT5 strongly correlates with increased levels of integrated viral DNA in vivo, and in vitro Jak inhibitors reduce the frequency of CD4+ T cells harboring integrated HIV DNA. We show that Jak inhibitors block viral production from infected cells, inhibit γ-C receptor cytokine (IL-15-induced viral reactivation from latent stores thereby preventing transmission of infectious particles to bystander activated T cells. These results show that dysregulation of the Jak-STAT pathway is associated with viral persistence in vivo, and that Jak inhibitors target key events downstream of γ-C cytokine (IL-2, IL-7 and IL-15 ligation to their receptors, impacting the magnitude of the HIV reservoir in all memory CD4 T cell subsets in vitro and ex vivo. Jak inhibitors represent a therapeutic modality to prevent key events of T cell activation that regulate HIV persistence and together, specific, potent blockade of these events may be integrated to future curative strategies.

  3. Glucocorticoids Inhibit Wound Healing: Novel Mechanism of Action.

    Science.gov (United States)

    Slominski, Andrzej T; Zmijewski, Michal A

    2017-05-01

    Jozic et al. describe mechanisms of glucocorticoid (GC) downregulation of wound healing by interaction with the membrane bound GC receptor, followed by stimulation of β-catenin and c-myc pathways. Targeting the membrane bound GC receptor or the recently discovered interaction of GC with mineralocorticoid receptors may counteract negative effects of GC on the skin barrier and potentially could serve as a remedy for age-related skin atrophy. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Mechanisms of recurrent otitis media: importance of the immune response to bacterial surface antigens.

    Science.gov (United States)

    Murphy, T F; Yi, K

    1997-12-29

    Otitis-prone children experience recurrent episodes of otitis media due to nontypeable H. influenzae (NTHI). A protective immune response occurs following infection, but this immune response is specific for the infecting strain, leaving the child susceptible to infection by other strains of NTHI. Little is known about the mechanism by which a strain-specific antibody response occurs to nonencapsulated bacteria. To explore the mechanism by which this strain-specific response occurs, animals were inoculated with whole bacterial cells and the antibody response was studied. The antibody response was predominantly directed to a highly strain-specific, immunodominant surface loop on the major outer membrane protein. This exquisitely restricted immune response leaves the host susceptible to recurrent infections by many strains of NTHI. The ability of the bacterium to direct the host to make a strain-specific antibody response has important implications in understanding the immune response to otitis media due to NTHI and in designing strategies for vaccine development.

  5. Multifaceted mechanisms of HIV inhibition and resistance to CCR5 inhibitors PSC-RANTES and Maraviroc.

    Science.gov (United States)

    Lobritz, Michael A; Ratcliff, Annette N; Marozsan, Andre J; Dudley, Dawn M; Tilton, John C; Arts, Eric J

    2013-06-01

    Small-molecule CCR5 antagonists, such as maraviroc (MVC), likely block HIV-1 through an allosteric, noncompetitive inhibition mechanism, whereas inhibition by agonists such as PSC-RANTES is less defined and may involve receptor removal by cell surface downregulation, competitive inhibition by occluding the HIV-1 envelope binding, and/or allosteric effects by altering CCR5 conformation. We explored the inhibitory mechanisms of maraviroc and PSC-RANTES by employing pairs of virus clones with differential sensitivities to these inhibitors. Intrinsic PSC-RANTES-resistant virus (YA versus RT) or those selected in PSC-RANTES treated macaques (M584 versus P3-4) only displayed resistance in multiple-cycle assays or with a CCR5 mutant that cannot be downregulated. In single-cycle assays, these HIV-1 clones displayed equal sensitivity to PSC-RANTES inhibition, suggesting effective receptor downregulation. Prolonged PSC-RANTES exposure resulted in desensitization of the receptor to internalization such that increasing virus concentration (substrate) could saturate the receptors and overcome PSC-RANTES inhibition. In contrast, resistance to MVC was observed with the MVC-resistant HIV-1 (R3 versus S2) in both multiple- and single-cycle assays and with altered virus concentrations, which is indicative of allosteric inhibition. MVC could also mediate inhibition and possibly resistance through competitive mechanisms.

  6. Inhibition of Bacterial Quorum Sensing by Extracts from Aquatic Fungi: First Report from Marine Endophytes

    Directory of Open Access Journals (Sweden)

    Alberto J. Martín-Rodríguez

    2014-11-01

    Full Text Available In our search for quorum-sensing (QS disrupting molecules, 75 fungal isolates were recovered from reef organisms (endophytes, saline lakes and mangrove rhizosphere. Their QS inhibitory activity was evaluated in Chromobacterium violaceum CVO26. Four strains of endophytic fungi stood out for their potent activity at concentrations from 500 to 50 μg mL−1. The molecular characterization, based on the internal transcribed spacer (ITS region sequences (ITS1, 5.8S and ITS2 between the rRNA of 18S and 28S, identified these strains as belonging to four genera: Sarocladium (LAEE06, Fusarium (LAEE13, Epicoccum (LAEE14, and Khuskia (LAEE21. Interestingly, three came from coral species and two of them came from the same organism, the coral Diploria strigosa. Metabolic profiles obtained by Liquid Chromatography-High Resolution Mass Spectrometry (LC-HRMS suggest that a combination of fungal secondary metabolites and fatty acids could be the responsible for the observed activities. The LC-HRMS analysis also revealed the presence of potentially new secondary metabolites. This is, to the best of our knowledge, the first report of QS inhibition by marine endophytic fungi.

  7. Inhibition of bacterial quorum sensing by extracts from aquatic fungi: first report from marine endophytes.

    Science.gov (United States)

    Martín-Rodríguez, Alberto J; Reyes, Fernando; Martín, Jesús; Pérez-Yépez, Juan; León-Barrios, Milagros; Couttolenc, Alan; Espinoza, César; Trigos, Angel; Martín, Víctor S; Norte, Manuel; Fernández, José J

    2014-11-19

    In our search for quorum-sensing (QS) disrupting molecules, 75 fungal isolates were recovered from reef organisms (endophytes), saline lakes and mangrove rhizosphere. Their QS inhibitory activity was evaluated in Chromobacterium violaceum CVO26. Four strains of endophytic fungi stood out for their potent activity at concentrations from 500 to 50 μg mL-1. The molecular characterization, based on the internal transcribed spacer (ITS) region sequences (ITS1, 5.8S and ITS2) between the rRNA of 18S and 28S, identified these strains as belonging to four genera: Sarocladium (LAEE06), Fusarium (LAEE13), Epicoccum (LAEE14), and Khuskia (LAEE21). Interestingly, three came from coral species and two of them came from the same organism, the coral Diploria strigosa. Metabolic profiles obtained by Liquid Chromatography-High Resolution Mass Spectrometry (LC-HRMS) suggest that a combination of fungal secondary metabolites and fatty acids could be the responsible for the observed activities. The LC-HRMS analysis also revealed the presence of potentially new secondary metabolites. This is, to the best of our knowledge, the first report of QS inhibition by marine endophytic fungi.

  8. Bacterial β-glucuronidase inhibition protects mice against enteropathy induced by indomethacin, ketoprofen or diclofenac: mode of action and pharmacokinetics.

    Science.gov (United States)

    Saitta, Kyle S; Zhang, Carmen; Lee, Kang Kwang; Fujimoto, Kazunori; Redinbo, Matthew R; Boelsterli, Urs A

    2014-01-01

    1.  We have previously demonstrated that a small molecule inhibitor of bacterial β-glucuronidase (Inh-1; [1-((6,8-dimethyl-2-oxo-1,2-dihydroquinolin-3-yl)-3-(4-ethoxyphenyl)-1-(2-hydroxyethyl)thiourea]) protected mice against diclofenac (DCF)-induced enteropathy. Here we report that Inh-1 was equally protective against small intestinal injury induced by other carboxylic acid-containing non-steroidal anti-inflammatory drugs (NSAIDs), indomethacin (10 mg/kg, ip) and ketoprofen (100 mg/kg, ip). 2.  Inh-1 provided complete protection if given prior to DCF (60 mg/kg, ip), and partial protection if administered 3-h post-DCF, suggesting that the temporal window of mucosal protection can be extended for drugs undergoing extensive enterohepatic circulation. 3.  Pharmacokinetic analysis of Inh-1 revealed an absolute bioavailability (F) of 21% and a short t1/2 of <1 h. This low F was shown to be due to hepatic first-pass metabolism, as confirmed with the pan-CYP inhibitor, 1-aminobenzotriazole. 4.  Using the fluorescent probe 5 (and 6)-carboxy-2',7'-dichlorofluorescein, we demonstrated that Inh-1 did not interfere with hepatobiliary export of glucuronides in gall bladder-cannulated mice. 5.  These data are compatible with the hypothesis that pharmacological inhibition of bacterial β-glucuronidase-mediated cleavage of NSAID glucuronides in the small intestinal lumen can protect against NSAID-induced enteropathy caused by locally high concentrations of NSAID aglycones.

  9. Mechanism of leukotriene D4 inhibition of Na-alanine cotransport in intestinal epithelial cells.

    Science.gov (United States)

    Talukder, Jamilur R; Kekuda, Ramesh; Saha, Prosenjit; Sundaram, Uma

    2008-07-01

    In a rabbit model of chronic intestinal inflammation, we previously demonstrated inhibition of neutral Na-amino acid cotransport. The mechanism of the inhibition was secondary to a decrease in the affinity for amino acid rather than the number of cotransporters. Since leukotriene (LT)D4 is known to be elevated in enterocytes during chronic intestinal inflammation, we used rat intestinal epithelial cell (IEC-18) monolayers to determine the mechanism of regulation of Na-alanine cotransport (alanine, serine, cysteine transporter 1: ASCT1) by LTD4. Na-alanine cotransport was inhibited by LTD4 in IEC-18 cells. The mechanism of inhibition of ASCT1 (solute carrier, SLC1A4) by LTD4 is secondary to a decrease in the affinity of the cotransporter for alanine without a significant change in cotransporter numbers and is not secondary to an alteration in the Na+ extruding capacity of the cells. Real-time quantitative PCR and Western blot analysis results indicate that ASCT1 message and protein levels are also unchanged in LTD4-treated IEC-18 cells. These results indicate that LTD4 inhibits Na-dependent neutral amino acid cotransport in IEC. The mechanism of inhibition is secondary to a decrease in the affinity for alanine, which is identical to that seen in villus cells from the chronically inflamed rabbit small intestine, where LTD4 levels are significantly increased.

  10. A new cytogenetic mechanism for bacterial endosymbiont-induced parthenogenesis in Hymenoptera

    Science.gov (United States)

    Adachi-Hagimori, Tetsuya; Miura, Kazuki; Stouthamer, Richard

    2008-01-01

    Vertically transmitted endosymbiotic bacteria, such as Wolbachia, Cardinium and Rickettsia, modify host reproduction in several ways to facilitate their own spread. One such modification results in parthenogenesis induction, where males, which are unable to transmit the bacteria, are not produced. In Hymenoptera, the mechanism of diploidization due to Wolbachia infection, known as gamete duplication, is a post-meiotic modification. During gamete duplication, the meiotic mechanism is normal, but in the first mitosis the anaphase is aborted. The two haploid sets of chromosomes do not separate and thus result in a single nucleus containing two identical sets of haploid chromosomes. Here, we outline an alternative cytogenetic mechanism for bacterial endosymbiont-induced parthenogenesis in Hymenoptera. During female gamete formation in Rickettsia-infected Neochrysocharis formosa (Westwood) parasitoids, meiotic cells undergo only a single equational division followed by the expulsion of a single polar body. This absence of meiotic recombination and reduction corresponds well with a non-segregation pattern in the offspring of heterozygous females. We conclude that diploidy in N. formosa is maintained through a functionally apomictic cloning mechanism that differs entirely from the mechanism induced by Wolbachia. PMID:18713719

  11. Immunostimulation using bacterial antigens – mechanism ofaction and clinical practice inviral respiratory tract infections

    Directory of Open Access Journals (Sweden)

    Wojciech Feleszko

    2015-12-01

    Full Text Available Recurrent respiratory tract infections constitute a significant problem in the practice of a general practitioner and paediatrician. Antibiotic resistance of bacterial strains, which has been growing for years, prompts the search for alternative ways of combating pathogens. One of them is the usage of preparations based on cell lysis of various bacterial strains. Bacterial lysates have been available in Europe for many years. In preclinical trials, they are characterised by the capability of reducing infections caused by bacteria and viruses that are not the components of the preparations. A range of clinical trials have demonstrated their usefulness in reducing the frequency of seasonal respiratory tract infections and antibiotic use. Moreover, patients with chronic obstructive pulmonary disease gain an additional advantage in the form of the reduction of the risk of hospitalization due to disease exacerbations and a positive influence on the survival curve. The action of bacterial lysates is based on oral immunostimulation of gut-associated lymphoid tissue, which results in increased antibody production. Moreover, they activate a range of mucosal mechanisms of non-specific immunity, mainly by enhancing the activity of TLR-dependent mechanisms. The efficacy of this group of drugs has been confirmed in a range of clinical trials, systematic reviews and meta-analyses. Recent studies also indicate their immunoregulatory potential, suggesting that they might be used in the future in preventing allergies, asthma and autoimmune diseases. To conclude, physicians (paediatricians, laryngologists, pulmonologists should consider reducing the use of antibiotics in their daily practice. Instead, they should offer preparations that promote the immune system, thus controlling infections in a better way.

  12. Iodine from bacterial iodide oxidization by Roseovarius spp. inhibits the growth of other bacteria.

    Science.gov (United States)

    Zhao, Dan; Lim, Choon-Ping; Miyanaga, Kazuhiko; Tanji, Yasunori

    2013-03-01

    Microbial activities in brine, seawater, or estuarine mud are involved in iodine cycle. To investigate the effects of the microbiologically induced iodine on other bacteria in the environment, a total of 13 bacteria that potentially participated in the iodide-oxidizing process were isolated from water or biofilm at a location containing 131 μg ml(-1) iodide. Three distinct strains were further identified as Roseovarius spp. based on 16 S rRNA gene sequences after being distinguished by restriction fragment length polymorphism analysis. Morphological characteristics of these three Roseovarius spp. varied considerably across and within strains. Iodine production increased with Roseovarius spp. growth when cultured in Marine Broth with 200 μg ml(-1) iodide (I(-)). When 10(6) CFU/ml Escherichia coli, Pseudomonas aeruginosa, and Bacillus pumilus were exposed to various concentrations of molecular iodine (I(2)), the minimum inhibitory concentrations (MICs) were 0.5, 1.0, and 1.0 μg ml(-1), respectively. However, fivefold increases in the MICs for Roseovarius spp. were obtained. In co-cultured Roseovarius sp. IOB-7 and E. coli in Marine Broth containing iodide (I(-)), the molecular iodine concentration was estimated to be 0.76 μg ml(-1) after 24 h and less than 50 % of E. coli was viable compared to that co-cultured without iodide. The growth inhibition of E. coli was also observed in co-cultures with the two other Roseovarius spp. strains when the molecular iodine concentration was assumed to be 0.52 μg ml(-1).

  13. Involvement of glucokinase translocation in the mechanism by which resorcinol inhibits glycolysis in hepatocytes.

    Science.gov (United States)

    Agius, L

    1997-01-01

    Proglycosyn and resorcinol stimulate glycogen synthesis and inhibit glycolysis in hepatocytes. The former effect is attributed to inactivation of phosphorylase mediated by glucuronidated metabolites. This study investigated the mechanism by which resorcinol inhibits glycolysis. Resorcinol (150 microM) inhibited glycolysis in hepatocytes incubated with glucose (15-35 mM) but not with dihydroxyacetone (10 mM). The inhibition of glycolysis at elevated glucose concentration was associated with inhibition of glucose-induced dissociation of glucokinase and aldolase. The resorcinol concentration that caused half-maximal inhibition (20-43 microM) increased with increasing glucose concentration (15-35 mM). Resorcinol inhibited the translocation of glucokinase and the stimulation of detritiation of [2-3H]glucose and [3-3H]glucose caused by sorbitol (10-200 microM), but it potentiated the stimulation of glycogen synthesis. The inhibition of glycolysis by resorcinol could not be accounted for by diversion of substrate to glycogen. The glucose 6-phosphate content correlated with the free glucokinase activity. Resorcinol counteracted the increase in glucose 6-phosphate and fructose 2,6-bisphosphate caused by elevated glucose concentration or by sorbitol. The suppression of glucose 6-phosphate at high glucose concentration (15-35 mM) could be explained by the low activity of free glucokinase. However, the suppression at 5 mM glucose was due in part to an independent mechanism. The effect of resorcinol on glucokinase translocation was partly counteracted by galactosamine, which suppresses UDP-glucose and inhibits glucuronide formation, and was mimicked by phenol and p-nitrophenol but not by p-nitrophenylglucuronide. It is concluded that resorcinol inhibits glycolysis at elevated glucose concentration or when stimulated by sorbitol through increased glucokinase binding. The results indicate a link between glucuronidation and glucokinase translocation. PMID:9271087

  14. Novel mechanisms for caspase inhibition protecting cardiac function with chronic pressure overload

    OpenAIRE

    Park, Misun; Vatner, Stephen F.; Yan, Lin; Gao, Shumin; Yoon, Seunghun; Lee, Grace Jung Ah; Xie, Lai-Hua; Kitsis, Richard N.; Vatner, Dorothy E.

    2013-01-01

    Myocyte apoptosis is considered a major mechanism in the pathogenesis of heart failure. Accordingly, manipulations that inhibit apoptosis are assumed to preserve cardiac function by maintaining myocyte numbers. We tested this assumption by examining the effects of caspase inhibition (CI) on cardiac structure and function in C57BL/6 mouse with pressure overload model induced by transverse aortic constriction (TAC). CI preserved left ventricular (LV) function following TAC compared with the veh...

  15. Cytosine methylation inhibits replication of African cassava mosaic virus by two distinct mechanisms.

    OpenAIRE

    Ermak, G; Paszkowski, U; Wohlmuth, M; Scheid, O M; Paszkowski, J

    1993-01-01

    Extrachromosomally replicating viral DNA is usually free of cytosine methylation and viral templates methylated in vitro are poor substrates when used in replication assays. We have investigated the mechanism of inhibition of viral replication by DNA methylation using as a model the DNA A of African cassava mosaic virus. We have constructed two component helper systems which allow for separation of the transcriptional inhibition of viral genes necessary for replication from replication inhibi...

  16. Molecular Mechanisms of Enhanced Bacterial Growth on Hexadecane with Red Clay.

    Science.gov (United States)

    Jung, Jaejoon; Jang, In-Ae; Ahn, Sungeun; Shin, Bora; Kim, Jisun; Park, Chulwoo; Jee, Seung Cheol; Sung, Jung-Suk; Park, Woojun

    2015-11-01

    Red clay was previously used to enhance bioremediation of diesel-contaminated soil. It was speculated that the enhanced degradation of diesel was due to increased bacterial growth. In this study, we selected Acinetobacter oleivorans DR1, a soil-borne degrader of diesel and alkanes, as a model bacterium and performed transcriptional analysis using RNA sequencing to investigate the cellular response during hexadecane utilization and the mechanism by which red clay promotes hexadecane degradation. We confirmed that red clay promotes the growth of A. oleivorans DR1 on hexadecane, a major component of diesel, as a sole carbon source. Addition of red clay to hexadecane-utilizing DR1 cells highly upregulated β-oxidation, while genes related to alkane oxidation were highly expressed with and without red clay. Red clay also upregulated genes related to oxidative stress defense, such as superoxide dismutase, catalase, and glutaredoxin genes, suggesting that red clay supports the response of DR1 cells to oxidative stress generated during hexadecane utilization. Increased membrane fluidity in the presence of red clay was confirmed by fatty acid methyl ester analysis at different growth phases, suggesting that enhanced growth on hexadecane could be due to increased uptake of hexadecane coupled with upregulation of downstream metabolism and oxidative stress defense. The monitoring of the bacterial community in soil with red clay for a year revealed that red clay stabilized the community structure.

  17. Biogas production from coumarin-rich plants--inhibition by coumarin and recovery by adaptation of the bacterial community.

    Science.gov (United States)

    Popp, Denny; Schrader, Steffi; Kleinsteuber, Sabine; Harms, Hauke; Sträuber, Heike

    2015-09-01

    Plants like sweet clover (Melilotus spp.) are not suitable as fodder for cattle because of harmful effects of the plant secondary metabolite coumarin. As an alternative usage, the applicability of coumarin-rich plants as substrates for biogas production was investigated. When coumarin was added to continuous fermentation processes codigesting grass silage and cow manure, it caused a strong inhibition noticeable as decrease of biogas production by 19% and increase of metabolite concentrations to an organic acids/alkalinity ratio higher than 0.3(gorganic acids) gCaCO3 (-1). Microbial communities of methanogenic archaea were dominated by the genera Methanosarcina (77%) and Methanoculleus (11%). This community composition was not influenced by coumarin addition. The bacterial community analysis unraveled a divergence caused by coumarin addition correlating with the anaerobic degradation of coumarin and the recovery of the biogas process. As a consequence, biogas production resumed similar to the coumarin-free control with a biogas yield of 0.34 LN g(volatile solids) (-1) and at initial metabolite concentrations (∼ 0.2 g(organic acids) gCaCO3 (-1)). Coumarin acts as inhibitor and as substrate during anaerobic digestion. Hence, coumarin-rich plants might be suitable for biogas production, but should only be used after adaptation of the microbial community to coumarin. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Different mechanisms of intrinsic pain inhibition in early and late inflammation.

    Science.gov (United States)

    Machelska, Halina; Schopohl, Julia K; Mousa, Shaaban A; Labuz, Dominika; Schäfer, Michael; Stein, Christoph

    2003-08-01

    Neuroimmune interactions control pain through activation of opioid receptors on sensory nerves by immune-derived opioid peptides. Here we evaluate mechanisms of intrinsic pain inhibition at different stages of Freund's adjuvant-induced inflammation of the rat paw. We use immunohistochemistry and paw pressure testing. Our data show that in early (6 h) inflammation leukocyte-derived beta-endorphin, met-enkephalin and dynorphin A activate peripheral mu-, delta- and kappa-receptors to inhibit nociception. In addition, central opioid mechanisms seem to contribute significantly to this effect. At later stages (4 days), antinociception is exclusively produced by leukocyte-derived beta-endorphin acting at peripheral mu and delta receptors. Corticotropin-releasing hormone (CRH) is an endogenous trigger of these effects at both stages. These findings indicate that peripheral opioid mechanisms of pain inhibition gain functional relevance with the chronicity of inflammation.

  19. Antibacterial activity of Artemisia asiatica essential oil against some common respiratory infection causing bacterial strains and its mechanism of action in Haemophilus influenzae.

    Science.gov (United States)

    Huang, Jiehui; Qian, Chao; Xu, Hongjie; Huang, Yanjie

    2018-01-01

    The main objective of the current study was to investigate the chemical composition of the essential oil of Artemisia asiatica together with investigating the antibacterial effects it exerts on several common respiratory infection causing bacteria including Haemophilus influenzae. Its mechanism of action was studied using various state-of-the-art assays like scanning electron microscopy, DNA, RNA and protein leakage assays, growth curve assays etc. The essential oil was extracted from the leaves of A. asiatica by supercritical CO 2 fluid extraction technology. Chemical composition of essential oils was analyzed by gas chromatography-mass-spectrometry (GC-MS). The antibacterial activity was evaluated against 6 bacteria by the paper disc diffusion method. The minimum inhibitory concentration (MIC) and minimum bactericide concentration (MBC) values of the essential oil were estimated by agar dilution method. The antibacterial mechanism was evaluated by growth curve, the integrity of cell membrane and scanning electronmicroscope (SEM). Gas chromatographic analysis of the A. asiatica essential oil led to the identification of 16 chemical constituents accounting for 97.2% of the total oil composition. The major components were found to be Piperitone, (z)-davanone, p-cymene and 1, 8-cineole. The essential oil showed maximum growth inhibition against Haemophilus influenzae with a zone of inhibition of 24.5 mm and MIC/MBC values of 1.9/4.5 mg/mL respectively. Bacteria treated with the essential oil led to a rapid decrease in the number of viable cells. On adding the essential oil of A. asiatica to the bacterial culture, the constituents of the bacterial cell got released into the medium and this cell constituent release increased with increasing doses of the essential oil. SEM showed that the bacterial cells treated with the essential oil showed damaged cell wall, deformed cell morphology and shrunken cells. Copyright © 2017. Published by Elsevier Ltd.

  20. Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae

    Science.gov (United States)

    Camberlein, Emilie; Cohen, Jonathan M.; José, Ricardo; Hyams, Catherine J.; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A.; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad

    2015-01-01

    Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

  1. A study on the ability of quaternary ammonium groups attached to a polyurethane foam wound dressing to inhibit bacterial attachment and biofilm formation.

    Science.gov (United States)

    Tran, Phat L; Hamood, Abdul N; de Souza, Anselm; Schultz, Gregory; Liesenfeld, Bernd; Mehta, Dilip; Reid, Ted W

    2015-01-01

    Bacterial infection of acute and chronic wounds impedes wound healing significantly. Part of this impediment is the ability of bacterial pathogens to grow in wound dressings. In this study, we examined the effectiveness of a polyurethane (PU) foam wound dressings coated with poly diallyl-dimethylammonium chloride (pDADMAC-PU) to inhibit the growth and biofilm development by three main wound pathogens, Staphylococcus aureus, Pseudomonas aeruginosa, and Acinetobacter baumannii, within the wound dressing. pDADMAC-PU inhibited the growth of all three pathogens. Time-kill curves were conducted both with and without serum to determine the killing kinetic of pDADMAC-PU. pDADMAC-PU killed S. aureus, A. baumannii, and P. aeruginosa. The effect of pDADMAC-PU on biofilm development was analyzed quantitatively and qualitatively. Quantitative analysis, colony-forming unit assay, revealed that pDADMAC-PU dressing produced more than eight log reduction in biofilm formation by each pathogen. Visualization of the biofilms by either confocal laser scanning microscopy or scanning electron microscopy confirmed these findings. In addition, it was found that the pDADMAC-PU-treated foam totally inhibited migration of bacteria through the foam for all three bacterial strains. These results suggest that pDADMAC-PU is an effective wound dressing that inhibits the growth of wound pathogens both within the wound and in the wound dressing. © 2014 by the Wound Healing Society.

  2. Bacterial lipoprotein delays apoptosis in human neutrophils through inhibition of caspase-3 activity: regulatory roles for CD14 and TLR-2.

    LENUS (Irish Health Repository)

    Power, Colm P

    2012-02-03

    The human sepsis syndrome resulting from bacterial infection continues to account for a significant proportion of hospital mortality. Neutralizing strategies aimed at individual bacterial wall products (such as LPS) have enjoyed limited success in this arena. Bacterial lipoprotein (BLP) is a major constituent of the wall of diverse bacterial forms and profoundly influences cellular function in vivo and in vitro, and has been implicated in the etiology of human sepsis. Delayed polymorphonuclear cell (PMN) apoptosis is a characteristic feature of human sepsis arising from Gram-negative or Gram-positive bacterial infection. Bacterial wall product ligation and subsequent receptor-mediated events upstream of caspase inhibition in neutrophils remain incompletely understood. BLP has been shown to exert its cellular effects primarily through TLR-2, and it is now widely accepted that lateral associations with the TLRs represent the means by which CD14 communicates intracellular messages. In this study, we demonstrate that BLP inhibits neutrophil mitochondrial membrane depolarization with a subsequent reduction in caspase-3 processing, ultimately leading to a significant delay in PMN apoptosis. Pretreatment of PMNs with an anti-TLR-2 mAb or anti-CD14 mAb prevented BLP from delaying PMN apoptosis to such a marked degree. Combination blockade using both mAbs completely prevented the effects of BLP (in 1 and 10 ng\\/ml concentrations) on PMN apoptosis. At higher concentrations of BLP, the antiapoptotic effects were observed, but were not as pronounced. Our findings therefore provide the first evidence of a crucial role for both CD14 and TLR-2 in delayed PMN apoptosis arising from bacterial infection.

  3. [Effect of mechanical grinding of Sphagnum on the structure and physiological state of bacterial communities].

    Science.gov (United States)

    Dobrovol'skaya, T G; Golovchenko, A V; Yakushev, A V; Manucharova, N A; Yurchenko, E N

    2014-01-01

    The microcosm method was used to demonstrate an increase in bacterial numbers and drastic changes in the taxonomic structure of saprotrophic bacteria as a result of mechanical grinding of Sphagnum moss. Ekkrisotrophic agrobacteria predominant in untreated moss were replaced by hydrolytic bacteria. Molecular biological approaches revealed such specific hydrolytic bacteria as Janthinobacterium agaricum and Streptomyces purpurascens among the dominant taxa. The application of kinetic technique for determination of the physiological state of bacteria in situ revealed higher functional diversity of hydrolytic bacteria in ground moss than in untreated samples. A considerable decrease of the C/N ratio in ground samples of living Sphagnum incubated using the microcosm technique indicated decomposition of this substrate.

  4. Dehydroepiandrosterone inhibits intracellular calcium release in beta-cells by a plasma membrane-dependent mechanism.

    Science.gov (United States)

    Liu, Dongmin; Ren, Min; Bing, Xinyu; Stotts, Corey; Deorah, Sundeep; Love-Homan, Laurie; Dillon, Joseph S

    2006-08-01

    Both dehydroepiandrosterone (DHEA) and DHEA sulfate (DHEAS) affect glucose stimulated insulin secretion, though their cellular mechanisms of action are not well characterized. We tested the hypothesis that human physiological concentrations of DHEA alter insulin secretion by an action initiated at the plasma membrane of beta-cells. DHEA alone had no effect on intracellular calcium concentration ([Ca(2+)](i)) in a rat beta-cell line (INS-1). However, it caused an immediate and dose-dependent inhibition of carbachol-induced Ca(2+) release from intracellular stores, with a 25% inhibition at zero. One nanometer DHEA. DHEA also inhibited the Ca(2+) mobilizing effect of bombesin (29% decrease), but did not inhibit the influx of extracellular Ca(2+) evoked by glyburide (100 microM) or glucose (15 mM). The steroids (androstenedione, 17-alpha-hydroxypregnenolone, and DHEAS) had no inhibitory effect on carbachol-induced intracellular Ca(2+) release. The action of DHEA depended on a signal initiated at the plasma membrane, since membrane impermeant DHEA-BSA complexes also inhibited the carbachol effect on [Ca(2+)](i) (39% decrease). The inhibition of carbachol-induced Ca(2+) release by DHEA was blocked by pertussis toxin (PTX). DHEA also inhibited the carbachol induction of phosphoinositide generation, with a maximal inhibition at 0.1 nM DHEA. Furthermore, DHEA inhibited insulin secretion induced by carbachol in INS-1 cells by 25%, and in human pancreatic islets by 53%. Taken together, this is the first report showing that human physiological concentrations of DHEA decrease agonist-induced Ca(2+) release by a rapid, non-genomic mechanism in INS-1 cells. Furthermore, these data provide evidence consistent with the existence of a specific plasma membrane DHEA receptor, mediating this signal transduction pathway by pertussis toxin-sensitive G-proteins.

  5. Platelets and the innate immune system: mechanisms of bacterial-induced platelet activation.

    Science.gov (United States)

    Cox, D; Kerrigan, S W; Watson, S P

    2011-06-01

    It has become clear that platelets are not simply cell fragments that plug the leak in a damaged blood vessel; they are, in fact, also key components in the innate immune system, which is supported by the presence of Toll-like receptors (TLRs) on platelets. As the cells that respond first to a site of injury, they are well placed to direct the immune response to deal with any resulting exposure to pathogens. The response is triggered by bacteria binding to platelets, which usually triggers platelet activation and the secretion of antimicrobial peptides. The main platelet receptors that mediate these interactions are glycoprotein (GP)IIb-IIIa, GPIbα, FcγRIIa, complement receptors, and TLRs. This process may involve direct interactions between bacterial proteins and the receptors, or can be mediated by plasma proteins such as fibrinogen, von Willebrand factor, complement, and IgG. Here, we review the variety of interactions between platelets and bacteria, and look at the potential for inhibiting these interactions in diseases such as infective endocarditis and sepsis. © 2011 International Society on Thrombosis and Haemostasis.

  6. Bacterial metabolic 'toxins': a new mechanism for lactose and food intolerance, and irritable bowel syndrome.

    Science.gov (United States)

    Campbell, A K; Matthews, S B; Vassel, N; Cox, C D; Naseem, R; Chaichi, J; Holland, I B; Green, J; Wann, K T

    2010-12-30

    Lactose and food intolerance cause a wide range of gut and systemic symptoms, including gas, gut pain, diarrhoea or constipation, severe headaches, severe fatigue, loss of cognitive functions such as concentration, memory and reasoning, muscle and joint pain, heart palpitations, and a variety of allergies (Matthews and Campbell, 2000; Matthews et al., 2005; Waud et al., 2008). These can be explained by the production of toxic metabolites from gut bacteria, as a result of anaerobic digestion of carbohydrates and other foods, not absorbed in the small intestine. These metabolites include alcohols, diols such as butan 2,3 diol, ketones, acids, and aldehydes such as methylglyoxal (Campbell et al., 2005, 2009). These 'toxins' induce calcium signals in bacteria and affect their growth, thereby acting to modify the balance of microflora in the gut (Campbell et al., 2004, 2007a,b). These bacterial 'toxins' also affect signalling mechanisms in cells around the body, thereby explaining the wide range of symptoms in people with food intolerance. This new mechanism also explains the most common referral to gastroenterologists, irritable bowel syndrome (IBS), and the illness that afflicted Charles Darwin for 50 years (Campbell and Matthews, 2005a,b). We propose it will lead to a new understanding of the molecular mechanism of type 2 diabetes and some cancers. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  7. Different Inhibitory Potencies of Oseltamivir Carboxylate, Zanamivir, and Several Tannins on Bacterial and Viral Neuraminidases as Assessed in a Cell-Free Fluorescence-Based Enzyme Inhibition Assay.

    Science.gov (United States)

    Quosdorf, Stefanie; Schuetz, Anja; Kolodziej, Herbert

    2017-11-17

    Neuraminidaseis a key enzyme in the life cycle of influenza viruses and is present in some bacterial pathogens. We here assess the inhibitory potency of plant tannins versus clinically used inhibitors on both a viral and a bacterial model neuraminidase by applying the 2'-(4-methylumbelliferyl)-α-d- N -acetylneuraminic acid (MUNANA)-based activity assay. A range of flavan-3-ols, ellagitannins and chemically defined proanthocyanidin fractions was evaluated in comparison to oseltamivir carboxylate and zanamivir for their inhibitory activities against viral influenza A (H1N1) and bacterial Vibrio cholerae neuraminidase (VCNA). Compared to the positive controls, all tested polyphenols displayed a weak inhibition of the viral enzyme but similar or even higher potency on the bacterial neuraminidase. Structure-activity relationship analyses revealed the presence of galloyl groups and the hydroxylation pattern of the flavan skeleton to be crucial for inhibitory activity. The combination of zanamivir and EPs ® 7630 (root extract of Pelargonium sidoides ) showed synergistic inhibitory effects on the bacterial neuraminidase. Co-crystal structures of VCNA with oseltamivir carboxylate and zanamivir provided insight into bacterial versus viral enzyme-inhibitor interactions. The current data clearly indicate that inhibitor potency strongly depends on the biological origin of the enzyme and that results are not readily transferable. The therapeutic relevance of our findings is briefly discussed.

  8. Different Inhibitory Potencies of Oseltamivir Carboxylate, Zanamivir, and Several Tannins on Bacterial and Viral Neuraminidases as Assessed in a Cell-Free Fluorescence-Based Enzyme Inhibition Assay

    Directory of Open Access Journals (Sweden)

    Stefanie Quosdorf

    2017-11-01

    Full Text Available Neuraminidase is a key enzyme in the life cycle of influenza viruses and is present in some bacterial pathogens. We here assess the inhibitory potency of plant tannins versus clinically used inhibitors on both a viral and a bacterial model neuraminidase by applying the 2′-(4-methylumbelliferyl-α-d-N-acetylneuraminic acid (MUNANA-based activity assay. A range of flavan-3-ols, ellagitannins and chemically defined proanthocyanidin fractions was evaluated in comparison to oseltamivir carboxylate and zanamivir for their inhibitory activities against viral influenza A (H1N1 and bacterial Vibrio cholerae neuraminidase (VCNA. Compared to the positive controls, all tested polyphenols displayed a weak inhibition of the viral enzyme but similar or even higher potency on the bacterial neuraminidase. Structure–activity relationship analyses revealed the presence of galloyl groups and the hydroxylation pattern of the flavan skeleton to be crucial for inhibitory activity. The combination of zanamivir and EPs® 7630 (root extract of Pelargonium sidoides showed synergistic inhibitory effects on the bacterial neuraminidase. Co-crystal structures of VCNA with oseltamivir carboxylate and zanamivir provided insight into bacterial versus viral enzyme-inhibitor interactions. The current data clearly indicate that inhibitor potency strongly depends on the biological origin of the enzyme and that results are not readily transferable. The therapeutic relevance of our findings is briefly discussed.

  9. Mechanism of inhibition of human secretory phospholipase A2 by flavonoids: rationale for lead design

    Science.gov (United States)

    Lättig, Jens; Böhl, Markus; Fischer, Petra; Tischer, Sandra; Tietböhl, Claudia; Menschikowski, Mario; Gutzeit, Herwig O.; Metz, Peter; Pisabarro, M. Teresa

    2007-08-01

    The human secretory phospholipase A2 group IIA (PLA2-IIA) is a lipolytic enzyme. Its inhibition leads to a decrease in eicosanoids levels and, thereby, to reduced inflammation. Therefore, PLA2-IIA is of high pharmacological interest in treatment of chronic diseases such as asthma and rheumatoid arthritis. Quercetin and naringenin, amongst other flavonoids, are known for their anti-inflammatory activity by modulation of enzymes of the arachidonic acid cascade. However, the mechanism by which flavonoids inhibit Phospholipase A2 (PLA2) remained unclear so far. Flavonoids are widely produced in plant tissues and, thereby, suitable targets for pharmaceutical extractions and chemical syntheses. Our work focuses on understanding the binding modes of flavonoids to PLA2, their inhibition mechanism and the rationale to modify them to obtain potent and specific inhibitors. Our computational and experimental studies focused on a set of 24 compounds including natural flavonoids and naringenin-based derivatives. Experimental results on PLA2-inhibition showed good inhibitory activity for quercetin, kaempferol, and galangin, but relatively poor for naringenin. Several naringenin derivatives were synthesized and tested for affinity and inhibitory activity improvement. 6-(1,1-dimethylallyl)naringenin revealed comparable PLA2 inhibition to quercetin-like compounds. We characterized the binding mode of these compounds and the determinants for their affinity, selectivity, and inhibitory potency. Based on our results, we suggest C(6) as the most promising position of the flavonoid scaffold to introduce chemical modifications to improve affinity, selectivity, and inhibition of PLA2-IIA by flavonoids.

  10. A rapid in situ procedure for determination of bacterial susceptibility or resistance to antibiotics that inhibit peptidoglycan biosynthesis

    Directory of Open Access Journals (Sweden)

    Bou Germán

    2011-08-01

    Full Text Available Abstract Background Antibiotics which inhibit bacterial peptidoglycan biosynthesis are the most widely used in current clinical practice. Nevertheless, resistant strains increase dramatically, with serious economic impact and effects on public health, and are responsible for thousands of deaths each year. Critical clinical situations should benefit from a rapid procedure to evaluate the sensitivity or resistance to antibiotics that act at the cell wall. We have adapted a kit for rapid determination of bacterial DNA fragmentation, to assess cell wall integrity. Results Cells incubated with the antibiotic were embedded in an agarose microgel on a slide, incubated in an adapted lysis buffer, stained with a DNA fluorochrome, SYBR Gold and observed under fluorescence microscopy. The lysis affects the cells differentially, depending on the integrity of the wall. If the bacterium is susceptible to the antibiotic, the weakened cell wall is affected by the lysing solution so the nucleoid of DNA contained inside the bacterium is released and spread. Alternatively, if the bacterium is resistant to the antibiotic, it is practically unaffected by the lysis solution and does not liberate the nucleoid, retaining its normal morphological appearance. In an initial approach, the procedure accurately discriminates susceptible, intermediate and resistant strains of Escherichia coli to amoxicillin/clavulanic acid. When the bacteria came from an exponentially growing liquid culture, the effect on the cell wall of the β-lactam was evident much earlier that when they came from an agar plate. A dose-response experiment with an E. coli strain susceptible to ampicillin demonstrated a weak effect before the MIC dose. The cell wall damage was not homogenous among the different cells, but the level of damage increased as dose increased with a predominant degree of effect for each dose. A microgranular-fibrilar extracellular background was evident in gram

  11. An antisense peptide nucleic acid against Pseudomonas aeruginosa inhibiting bacterial-induced inflammatory responses in the cystic fibrosis IB3-1 cellular model system

    DEFF Research Database (Denmark)

    Montagner, Giulia; Bezzerri, Valentino; Cabrini, Giulio

    2017-01-01

    of the essential acpP gene of P. aeruginosa, and previously shown to inhibit bacterial growth, concomitantly also strongly inhibits induced up-regulation of the pro-inflammatory markers IL-8, IL-6, G-CSF, IFN-γ, IP-10, MCP-1 and TNF-α in IB3-1 cystic fibrosis cells infected by P. aeruginosa PAO1. Remarkably...... are significant considering the key role of this protein in the cystic fibrosis inflammatory process exacerbated by P. aeruginosa infection....

  12. MECHANICAL VIBRATION INHIBITS OSTEOCLAST FORMATION BY REDUCING DC-STAMP RECEPTOR EXPRESSION IN OSTEOCLAST PRECURSOR CELLS

    OpenAIRE

    Kulkarni, R.N.; Voglewede, P.A.; Liu, D.

    2013-01-01

    It is well known that physical inactivity leads to loss of muscle mass, but it also causes bone loss. Mechanistically, osteoclastogenesis and bone resorption have recently been shown to be regulated by vibration. However, the underlying mechanism behind the inhibition of osteoclast formation is yet unknown. Therefore, we investigated whether mechanical vibration of osteoclast precursor cells affects osteoclast formation by the involvement of fusion-related molecules such as dendritic cell-spe...

  13. MOLECULAR MECHANISMS OF DIABETOGENIC EFFECTS OF ARSENIC: INHIBITION OF INSULIN SIGNALING BY ARSENITE AND METHYLARSONOUS ACID

    Science.gov (United States)

    Increased prevalence of diabetes mellitus has been reported among individuals chronically exposed to inorganic arsenic (iAs). However, mechanisms underlying the diabetogenic effects of iAs have not been characterized. We have shown that trivalent metabolites of iAs inhibit insu...

  14. Different mechanisms are involved in the antibody mediated inhibition of ligand binding to the urokinase receptor

    DEFF Research Database (Denmark)

    List, K; Høyer-Hansen, G; Rønne, E

    1999-01-01

    Certain monoclonal antibodies are capable of inhibiting the biological binding reactions of their target proteins. At the molecular level, this type of effect may be brought about by completely different mechanisms, such as competition for common binding determinants, steric hindrance or interfer...

  15. A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.

    Directory of Open Access Journals (Sweden)

    Pengfei Ding

    2015-06-01

    Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.

  16. Mechanism-based inhibition of cancer metastasis with (−)-epigallocatechin gallate

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Atsushi [Research Institute for Clinical Oncology, Saitama Cancer Center, Saitama 362-0806 (Japan); Graduate School of Science and Engineering, Saitama University, Saitama 338-8570 (Japan); Green Tea Laboratory, Saitama Prefectural Agriculture and Forestry Research Center, Saitama 358-0042 (Japan); Watanabe, Tatsuro; Mondal, Anupom; Suzuki, Kaori; Kurusu-Kanno, Miki [Research Institute for Clinical Oncology, Saitama Cancer Center, Saitama 362-0806 (Japan); Li, Zhenghao; Yamazaki, Takashi [Research Institute for Clinical Oncology, Saitama Cancer Center, Saitama 362-0806 (Japan); Graduate School of Science and Engineering, Saitama University, Saitama 338-8570 (Japan); Fujiki, Hirota [Research Institute for Clinical Oncology, Saitama Cancer Center, Saitama 362-0806 (Japan); Suganuma, Masami, E-mail: masami@cancer-c.pref.saitama.jp [Research Institute for Clinical Oncology, Saitama Cancer Center, Saitama 362-0806 (Japan)

    2014-01-03

    Highlights: •EGCG reduced cell motility of highly metastatic human lung cancer cells. •EGCG increased cell stiffness of the cells, indicating the inhibition of phenotypes of EMT. •EGCG inhibited expression of vimentin and Slug in the cells at the leading edge of scratch. •Treatment of MβCD increased cell stiffness, and inhibited cell motility and vimentin expression. •Inhibition of EMT phenotypes with EGCG is a mechanism-based inhibition of cancer metastasis. -- Abstract: Cell motility and cell stiffness are closely related to metastatic activity of cancer cells. (−)-Epigallocatechin gallate (EGCG) has been shown to inhibit spontaneous metastasis of melanoma cell line into the lungs of mice, so we studied the effects of EGCG on cell motility, cell stiffness, and expression of vimentin and Slug, which are molecular phenotypes of epithelial–mesenchymal transition (EMT). Treatments of human non-small cell lung cancer cell lines H1299 and Lu99 with 50 and 100 μM EGCG reduced cell motility to 67.5% and 43.7% in H1299, and 71.7% and 31.5% in Lu99, respectively in in vitro wound healing assay. Studies on cell stiffness using atomic force microscope (AFM) revealed that treatment with 50 μM EGCG increased Young’s modulus of H1299 from 1.24 to 2.25 kPa and that of Lu99 from 1.29 to 2.28 kPa, showing a 2-fold increase in cell stiffness, i.e. rigid elasticity of cell membrane. Furthermore, treatment with 50 μM EGCG inhibited high expression of vimentin and Slug in the cells at a leading edge of scratch. Methyl-β-cyclodextrin, a reagent to deplete cholesterol in plasma membrane, showed inhibition of EMT phenotypes similar that by EGCG, suggesting that EGCG induces inhibition of EMT phenotypes by alteration of membrane organization.

  17. Bacterial radiosensitization by using radiation processing in combination with essential oil: Mechanism of action

    International Nuclear Information System (INIS)

    Lacroix, Monique; Caillet, Stephane; Shareck, Francois

    2009-01-01

    Spice extracts under the form of essential oils were tested for their efficiency to increase the relative radiosensitivity of Listeria monocytogenes and Escherichia coli O157H7 in culture media. The two pathogens were treated by gamma-irradiation alone or in combination with oregano essential oil to evaluate their mechanism of action. The membrane murein composition, and the intracellular and extracellular concentration of ATP was determined. The bacterial strains were treated with two irradiation doses: 1.2 kGy to induce cell damage and 3.5 kGy to cause cell death for L. monocytogenes. A dose of 0.4 kGy to induce cell damages, 1.1 kGy to obtain viable but nonculturable (VBNC) state and 1.3 kGy to obtain a lethal dose was also applied on E. coli O157H7. Oregano essential oil was used at 0.020% and 0.025% (w/v), which is the minimum inhibitory concentration (MIC) for L. monocytogenes. For E. coli O157H7, a concentration of 0.006% and 0.025% (w/v) which is the minimum inhibitory concentration was applied. The use of essential oils in combination with irradiation has permitted an increase of the bacterial radiosensitization by more than 3.1 times. All treatments had also a significant effect (p≤0.05) on the murein composition, although some muropeptides did not seem to be affected by the treatment. Each treatment influenced differently the relative percentage and number of muropeptides. There was a significant (p≤0.05) correlation between the reduction of intracellular ATP and increase in extracellular ATP following treatment of the cells with oregano oil. The reduction of intracellular ATP was even more important when essential oil was combined with irradiation, but irradiation of L. monocytogenes alone induced a significant decrease (p≤0.05) of the internal ATP without affecting the external ATP.

  18. Bacterial radiosensitization by using radiation processing in combination with essential oil: Mechanism of action

    Science.gov (United States)

    Lacroix, Monique; Caillet, Stéphane; Shareck, Francois

    2009-07-01

    Spice extracts under the form of essential oils were tested for their efficiency to increase the relative radiosensitivity of Listeria monocytogenes and Escherichia coli O157H7 in culture media. The two pathogens were treated by gamma-irradiation alone or in combination with oregano essential oil to evaluate their mechanism of action. The membrane murein composition, and the intracellular and extracellular concentration of ATP was determined. The bacterial strains were treated with two irradiation doses: 1.2 kGy to induce cell damage and 3.5 kGy to cause cell death for L. monocytogenes. A dose of 0.4 kGy to induce cell damages, 1.1 kGy to obtain viable but nonculturable (VBNC) state and 1.3 kGy to obtain a lethal dose was also applied on E. coli O157H7. Oregano essential oil was used at 0.020% and 0.025% (w/v), which is the minimum inhibitory concentration (MIC) for L. monocytogenes. For E. coli O157H7, a concentration of 0.006% and 0.025% (w/v) which is the minimum inhibitory concentration was applied. The use of essential oils in combination with irradiation has permitted an increase of the bacterial radiosensitization by more than 3.1 times. All treatments had also a significant effect ( p⩽0.05) on the murein composition, although some muropeptides did not seem to be affected by the treatment. Each treatment influenced differently the relative percentage and number of muropeptides. There was a significant ( p⩽0.05) correlation between the reduction of intracellular ATP and increase in extracellular ATP following treatment of the cells with oregano oil. The reduction of intracellular ATP was even more important when essential oil was combined with irradiation, but irradiation of L. monocytogenes alone induced a significant decrease ( p⩽0.05) of the internal ATP without affecting the external ATP.

  19. Bacterial radiosensitization by using radiation processing in combination with essential oil: Mechanism of action

    Energy Technology Data Exchange (ETDEWEB)

    Lacroix, Monique [Canadian Irradiation Center, Research Laboratory in Sciences Applied to Food, INRS-Institut Armand-Frappier, 531, Boulevard des Prairies, Laval, Quebec, H7V 1B7 (Canada)], E-mail: monique.lacroix@iaf.inrs.ca; Caillet, Stephane [Canadian Irradiation Center, Research Laboratory in Sciences Applied to Food, INRS-Institut Armand-Frappier, 531, Boulevard des Prairies, Laval, Quebec, H7V 1B7 (Canada); Shareck, Francois [INRS-Institut Armand-Frappier, 531, Boulevard des Prairies, Laval, Quebec, H7V 1B7 (Canada)

    2009-07-15

    Spice extracts under the form of essential oils were tested for their efficiency to increase the relative radiosensitivity of Listeria monocytogenes and Escherichia coli O157H7 in culture media. The two pathogens were treated by gamma-irradiation alone or in combination with oregano essential oil to evaluate their mechanism of action. The membrane murein composition, and the intracellular and extracellular concentration of ATP was determined. The bacterial strains were treated with two irradiation doses: 1.2 kGy to induce cell damage and 3.5 kGy to cause cell death for L. monocytogenes. A dose of 0.4 kGy to induce cell damages, 1.1 kGy to obtain viable but nonculturable (VBNC) state and 1.3 kGy to obtain a lethal dose was also applied on E. coli O157H7. Oregano essential oil was used at 0.020% and 0.025% (w/v), which is the minimum inhibitory concentration (MIC) for L. monocytogenes. For E. coli O157H7, a concentration of 0.006% and 0.025% (w/v) which is the minimum inhibitory concentration was applied. The use of essential oils in combination with irradiation has permitted an increase of the bacterial radiosensitization by more than 3.1 times. All treatments had also a significant effect (p{<=}0.05) on the murein composition, although some muropeptides did not seem to be affected by the treatment. Each treatment influenced differently the relative percentage and number of muropeptides. There was a significant (p{<=}0.05) correlation between the reduction of intracellular ATP and increase in extracellular ATP following treatment of the cells with oregano oil. The reduction of intracellular ATP was even more important when essential oil was combined with irradiation, but irradiation of L. monocytogenes alone induced a significant decrease (p{<=}0.05) of the internal ATP without affecting the external ATP.

  20. Molecular mechanism of bacterial Hsp90 pH-dependent ATPase activity.

    Science.gov (United States)

    Jin, Yi; Hoxie, Reyal S; Street, Timothy O

    2017-06-01

    Hsp90 is a dimeric molecular chaperone that undergoes an essential and highly regulated open-to-closed-to-open conformational cycle upon ATP binding and hydrolysis. Although it has been established that a large energy barrier to closure is responsible for Hsp90's low ATP hydrolysis rate, the specific molecular contacts that create this energy barrier are not known. Here we discover that bacterial Hsp90 (HtpG) has a pH-dependent ATPase activity that is unique among other Hsp90 homologs. The underlying mechanism is a conformation-specific electrostatic interaction between a single histidine, H255, and bound ATP. H255 stabilizes ATP only while HtpG adopts a catalytically inactive open configuration, resulting in a striking anti-correlation between nucleotide binding affinity and chaperone activity over a wide range of pH. Linkage analysis reveals that the H255-ATP salt bridge contributes 1.5 kcal/mol to the energy barrier of closure. This energetic contribution is structurally asymmetric, whereby only one H255-ATP salt-bridge per dimer of HtpG controls ATPase activation. We find that a similar electrostatic mechanism regulates the ATPase of the endoplasmic reticulum Hsp90, and that pH-dependent activity can be engineered into eukaryotic cytosolic Hsp90. These results reveal site-specific energetic information about an evolutionarily conserved conformational landscape that controls Hsp90 ATPase activity. © 2017 The Protein Society.

  1. Plant-insect interactions under bacterial influence: ecological implications and underlying mechanisms.

    Science.gov (United States)

    Sugio, Akiko; Dubreuil, Géraldine; Giron, David; Simon, Jean-Christophe

    2015-02-01

    Plants and insects have been co-existing for more than 400 million years, leading to intimate and complex relationships. Throughout their own evolutionary history, plants and insects have also established intricate and very diverse relationships with microbial associates. Studies in recent years have revealed plant- or insect-associated microbes to be instrumental in plant-insect interactions, with important implications for plant defences and plant utilization by insects. Microbial communities associated with plants are rich in diversity, and their structure greatly differs between below- and above-ground levels. Microbial communities associated with insect herbivores generally present a lower diversity and can reside in different body parts of their hosts including bacteriocytes, haemolymph, gut, and salivary glands. Acquisition of microbial communities by vertical or horizontal transmission and possible genetic exchanges through lateral transfer could strongly impact on the host insect or plant fitness by conferring adaptations to new habitats. Recent developments in sequencing technologies and molecular tools have dramatically enhanced opportunities to characterize the microbial diversity associated with plants and insects and have unveiled some of the mechanisms by which symbionts modulate plant-insect interactions. Here, we focus on the diversity and ecological consequences of bacterial communities associated with plants and herbivorous insects. We also highlight the known mechanisms by which these microbes interfere with plant-insect interactions. Revealing such mechanisms in model systems under controlled environments but also in more natural ecological settings will help us to understand the evolution of complex multitrophic interactions in which plants, herbivorous insects, and micro-organisms are inserted. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions

  2. Bacterial biofilm mechanical properties persist upon antibiotic treatment and survive cell death

    International Nuclear Information System (INIS)

    Zrelli, K; Galy, O; Henry, N; Latour-Lambert, P; Ghigo, J M; Beloin, C; Kirwan, L

    2013-01-01

    Bacteria living on surfaces form heterogeneous three-dimensional consortia known as biofilms, where they exhibit many specific properties one of which is an increased tolerance to antibiotics. Biofilms are maintained by a polymeric network and display physical properties similar to that of complex fluids. In this work, we address the question of the impact of antibiotic treatment on the physical properties of biofilms based on recently developed tools enabling the in situ mapping of biofilm local mechanical properties at the micron scale. This approach takes into account the material heterogeneity and reveals the spatial distribution of all the small changes that may occur in the structure. With an Escherichia coli biofilm, we demonstrate using in situ fluorescent labeling that the two antibiotics ofloxacin and ticarcillin—targeting DNA replication and membrane assembly, respectively—induced no detectable alteration of the biofilm mechanical properties while they killed the vast majority of the cells. In parallel, we show that a proteolytic enzyme that cleaves extracellular proteins into short peptides, but does not alter bacterial viability in the biofilm, clearly affects the mechanical properties of the biofilm structure, inducing a significant increase of the material compliance. We conclude that conventional biofilm control strategy relying on the use of biocides targeting cells is missing a key target since biofilm structural integrity is preserved. This is expected to efficiently promote biofilm resilience, especially in the presence of persister cells. In contrast, the targeting of polymer network cross-links—among which extracellular proteins emerge as major players—offers a promising route for the development of rational multi-target strategies to fight against biofilms. (paper)

  3. Bacterial biofilm mechanical properties persist upon antibiotic treatment and survive cell death

    Science.gov (United States)

    Zrelli, K.; Galy, O.; Latour-Lambert, P.; Kirwan, L.; Ghigo, J. M.; Beloin, C.; Henry, N.

    2013-12-01

    Bacteria living on surfaces form heterogeneous three-dimensional consortia known as biofilms, where they exhibit many specific properties one of which is an increased tolerance to antibiotics. Biofilms are maintained by a polymeric network and display physical properties similar to that of complex fluids. In this work, we address the question of the impact of antibiotic treatment on the physical properties of biofilms based on recently developed tools enabling the in situ mapping of biofilm local mechanical properties at the micron scale. This approach takes into account the material heterogeneity and reveals the spatial distribution of all the small changes that may occur in the structure. With an Escherichia coli biofilm, we demonstrate using in situ fluorescent labeling that the two antibiotics ofloxacin and ticarcillin—targeting DNA replication and membrane assembly, respectively—induced no detectable alteration of the biofilm mechanical properties while they killed the vast majority of the cells. In parallel, we show that a proteolytic enzyme that cleaves extracellular proteins into short peptides, but does not alter bacterial viability in the biofilm, clearly affects the mechanical properties of the biofilm structure, inducing a significant increase of the material compliance. We conclude that conventional biofilm control strategy relying on the use of biocides targeting cells is missing a key target since biofilm structural integrity is preserved. This is expected to efficiently promote biofilm resilience, especially in the presence of persister cells. In contrast, the targeting of polymer network cross-links—among which extracellular proteins emerge as major players—offers a promising route for the development of rational multi-target strategies to fight against biofilms.

  4. Ro 90-7501 inhibits PP5 through a novel, TPR-dependent mechanism.

    Science.gov (United States)

    Hong, Tae-Joon; Park, Kwanghyun; Choi, Eun-Wook; Hahn, Ji-Sook

    2017-01-08

    Protein phosphatase 5 (PP5) is a serine/threonine phosphatase that belongs to the PPP family phosphatases. PP5 and the other phosphatases of the PPP family share significantly similar catalytic domain structure. Due to this structural similarity, natural competitive inhibitors such as okadaic acid and cantharidin exhibit broad specificity over the PPP family phosphatases. In this study, we report the identification of three PP5 inhibitors, Ro 90-7501, aurothioglucose, and N-oleoyldopamine, along with a novel inhibitory mechanism of Ro 90-7501. Unlike other inhibitors binding to the phosphatase domain, Ro 90-7501 inhibited PP5 in a TPR-dependent manner. This TPR-dependent PP5 inhibition shown by Ro 90-7501 is a unique and novel inhibitory mechanism, which might be a useful tool for studies of PP5 on both regulatory mechanism and drug discovery. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Potential Mechanisms for IgG4 Inhibition of Immediate Hypersensitivity Reactions.

    Science.gov (United States)

    James, Louisa K; Till, Stephen J

    2016-03-01

    IgG4 is the least abundant IgG subclass in human serum, representing less than 5% of all IgG. Increases in IgG4 occur following chronic exposure to antigen and are generally associated with states of immune tolerance. In line with this, IgG4 is regarded as an anti-inflammatory antibody with a limited ability to elicit effective immune responses. Furthermore, IgG4 attenuates allergic responses by inhibiting the activity of IgE. The mechanism by which IgG4 inhibits IgE-mediated hypersensitivity has been investigated using a variety of model systems leading to two proposed mechanisms. First by sequestering antigen, IgG4 can function as a blocking antibody, preventing cross-linking of receptor bound IgE. Second IgG4 has been proposed to co-stimulate the inhibitory IgG receptor FcγRIIb, which can negatively regulate FcεRI signaling and in turn inhibit effector cell activation. Recent advances in our understanding of the structural features of human IgG4 have shed light on the unique functional and immunologic properties of IgG4. The aim of this review is to evaluate our current understanding of IgG4 biology and reassess the mechanisms by which IgG4 functions to inhibit IgE-mediated allergic responses.

  6. Boric acid inhibits embryonic histone deacetylases: A suggested mechanism to explain boric acid-related teratogenicity

    International Nuclear Information System (INIS)

    Di Renzo, Francesca; Cappelletti, Graziella; Broccia, Maria L.; Giavini, Erminio; Menegola, Elena

    2007-01-01

    Histone deacetylases (HDAC) control gene expression by changing histonic as well as non histonic protein conformation. HDAC inhibitors (HDACi) are considered to be among the most promising drugs for epigenetic treatment for cancer. Recently a strict relationship between histone hyperacetylation in specific tissues of mouse embryos exposed to two HDACi (valproic acid and trichostatin A) and specific axial skeleton malformations has been demonstrated. The aim of this study is to verify if boric acid (BA), that induces in rodents malformations similar to those valproic acid and trichostatin A-related, acts through similar mechanisms: HDAC inhibition and histone hyperacetylation. Pregnant mice were treated intraperitoneally with a teratogenic dose of BA (1000 mg/kg, day 8 of gestation). Western blot analysis and immunostaining were performed with anti hyperacetylated histone 4 (H4) antibody on embryos explanted 1, 3 or 4 h after treatment and revealed H4 hyperacetylation at the level of somites. HDAC enzyme assay was performed on embryonic nuclear extracts. A significant HDAC inhibition activity (compatible with a mixed type partial inhibition mechanism) was evident with BA. Kinetic analyses indicate that BA modifies substrate affinity by a factor α = 0.51 and maximum velocity by a factor β = 0.70. This work provides the first evidence for HDAC inhibition by BA and suggests such a molecular mechanism for the induction of BA-related malformations

  7. Mechanical Strength and Inhibition of the Staphylococcus aureus Collagen-Binding Protein Cna

    Directory of Open Access Journals (Sweden)

    Philippe Herman-Bausier

    2016-10-01

    Full Text Available The bacterial pathogen Staphylococcus aureus expresses a variety of cell surface adhesion proteins that bind to host extracellular matrix proteins. Among these, the collagen (Cn-binding protein Cna plays important roles in bacterium-host adherence and in immune evasion. While it is well established that the A region of Cna mediates ligand binding, whether the repetitive B region has a dedicated function is not known. Here, we report the direct measurement of the mechanical strength of Cna-Cn bonds on living bacteria, and we quantify the antiadhesion activity of monoclonal antibodies (MAbs targeting this interaction. We demonstrate that the strength of Cna-Cn bonds in vivo is very strong (~1.2 nN, consistent with the high-affinity “collagen hug” mechanism. The B region is required for strong ligand binding and has been found to function as a spring capable of sustaining high forces. This previously undescribed mechanical response of the B region is of biological significance as it provides a means to project the A region away from the bacterial surface and to maintain bacterial adhesion under conditions of high forces. We further quantified the antiadhesion activity of MAbs raised against the A region of Cna directly on living bacteria without the need for labeling or purification. Some MAbs are more efficient in blocking single-cell adhesion, suggesting that they act as competitive inhibitors that bind Cna residues directly involved in ligand binding. This report highlights the role of protein mechanics in activating the function of staphylococcal adhesion proteins and emphasizes the potential of antibodies to prevent staphylococcal adhesion and biofilm formation.

  8. Bacterial Exopolysaccharide mediated heavy metal removal: A Review on biosynthesis, mechanism and remediation strategies.

    Science.gov (United States)

    Gupta, Pratima; Diwan, Batul

    2017-03-01

    Heavy metal contamination has been recognized as a major public health risk, particularly in developing countries and their toxicological manifestations are well known. Conventional remediation strategies are either expensive or they generate toxic by-products, which adversely affect the environment. Therefore, necessity for an environmentally safe strategy motivates interest towards biological techniques. One of such most profoundly driven approach in recent times is biosorption through microbial biomass and their products. Extracellular polymeric substances are such complex blend of high molecular weight microbial (prokaryotic and eukaryotic) biopolymers. They are mainly composed of proteins, polysaccharides, uronic acids, humic substances, lipids etc. One of its essential constituent is the exopolysaccharide (EPS) released out of self defense against harsh conditions of starvation, pH and temperature, hence it displays exemplary physiological, rheological and physio-chemical properties. Its net anionic makeup allows the biopolymer to effectively sequester positively charged heavy metal ions. The polysaccharide has been expounded deeply in this article with reference to its biosynthesis and emphasizes heavy metal sorption abilities of polymer in terms of mechanism of action and remediation. It reports current investigation and strategic advancements in dealing bacterial cells and their EPS in diverse forms - mixed culture EPS, single cell EPS, live, dead or immobilized EPS. A significant scrutiny is also involved highlighting the existing challenges that still lie in the path of commercialization. The article enlightens the potential of EPS to bring about bio-detoxification of heavy metal contaminated terrestrial and aquatic systems in highly sustainable, economic and eco-friendly manner.

  9. Thelytokous parthenogenesis in the damselfly Ischnura hastata (Odonata, Coenagrionidae): genetic mechanisms and lack of bacterial infection.

    Science.gov (United States)

    Lorenzo-Carballa, M O; Cordero-Rivera, A

    2009-11-01

    Thelytokous parthenogenesis, the production of female-only offspring from unfertilized eggs, has been described in all the insect orders, but is a rare phenomenon in the Odonata (dragonflies and damselflies). The only-known case of parthenogenesis in this group is the North American damselfly species Ischnura hastata, which has parthenogenetic populations in the Azores Islands. Here, we present for the first time the results of laboratory rearing, which showed parthenogenetic reproduction in the Azorean I. hastata populations. In an attempt to understand how parthenogenesis could have evolved in this species, we first determined the genetic mode of parthenogenesis by analysing the genotype of parthenogenetic females and their offspring at three polymorphic microsatellite loci. In addition, we used polymerase chain reaction amplification to test whether parthenogenesis in I. hastata could be bacterially induced. Our data indicate that thelytoky is achieved through an (at least functionally) apomictic mechanism and that parthenogenesis is not caused by endosymbionts. Finally, we discuss possible routes to parthenogenetic reproduction, as well as the evolutionary implications of this type of parthenogenesis.

  10. Mechanical and Anti-bacterial Properties of Dental Adhesive Containing Diamond Nanoparticles

    Directory of Open Access Journals (Sweden)

    zeinab Ebadi

    2012-12-01

    Full Text Available The effect of nanoparticle diamond incorporated in an experimental dental adhesive formulation is valuated by examining the mechanical properties and shear bond strength of the system. Diamond nanoparticles were incorporated into the dentin adhesive system in different concentrations of 0, 0.05, 0.1, 0.2, 0.5, and 1.0 weight percentages. The suspensions were ultrasonicated to facilitate the nano-particle dispersion in an adhesive solution containing ethanol, bis-GMA, UDMA, TMPTMA, HEMA  and photo-initiator  system. Diametral  tensile  strength, fexural strength, fexural modulus, depth of cure and microshear bond strength of the adhesive system were measured. The adhesive-dentin interface was then observed by scanning electron microscopy. The results were analyzed using one-way ANOVA at a signifcant level of P>0.05. No signifcant difference was observed between the diametral tensile strength of the adhesive. At nanoparticle content level of 0.1% (by wt, however, 85% increase in fexural strength and 13% enhancement in fexural modulus were observed. Microshear bond strength test revealed 70% and 79% improvements of adhesion force in systems containing 0.1% and 0.2% nanoparticles, respectively. Although the neat diamond nanoparticles revealed antibacterial activity, the adhesive containing different percentages of the nano particles did not show any antibacterial activities when tested against, Staphilococcus Aureus, Staphilococcus Streptococcus, Staphilococcus ephidermidis, Saprophyticus, Enterococcus faecalis bacteries.

  11. Mechanical and thermal properties of bacterial-cellulose-fibre-reinforced Mater-Bi® bionanocomposite

    Directory of Open Access Journals (Sweden)

    Hamonangan Nainggolan

    2013-05-01

    Full Text Available The effects of the addition of fibres of bacterial cellulose (FBC to commercial starch of Mater-Bi® have been investigated. FBC produced by cultivating Acetobacter xylinum for 21 days in glucose-based medium were purified by sodium hydroxide 2.5 wt % and sodium hypochlorite 2.5 wt % overnight, consecutively. To obtain water-free BC nanofibres, the pellicles were freeze dried at a pressure of 130 mbar at a cooling rate of 10 °C min−1. Both Mater-Bi and FBC were blended by using a mini twin-screw extruder at 160 °C for 10 min at a rotor speed of 50 rpm. Tensile tests were performed according to ASTM D638 to measure the Young’s modulus, tensile strength and elongation at break. A field emission scanning electron microscope was used to observe the morphology at an accelerating voltage of 10 kV. The crystallinity (Tc and melting temperature (Tm were measured by DSC. Results showed a significant improvement in mechanical and thermal properties in accordance with the addition of FBC into Mater-Bi. FBC is easily incorporated in Mater-Bi matrix and produces homogeneous Mater-Bi/FBC composite. The crystallinity of the Mater-Bi/FBC composites decrease in relation to the increase in the volume fraction of FBC.

  12. Inhibition of enzyme activity by nanomaterials: potential mechanisms and implications for nanotoxicity testing.

    Science.gov (United States)

    Maccormack, Tyson J; Clark, Rhett J; Dang, Michael K M; Ma, Guibin; Kelly, Joel A; Veinot, Jonathan G C; Goss, Greg G

    2012-08-01

    The objective of this study was to investigate whether nanoparticle-exposure affects enzyme function and to determine the mechanisms responsible. Silicon, Au, and CdSe nanoparticles were synthesized in house and their physicochemical properties were characterized. The activity of purified lactate dehydrogenase (LDH) was inhibited or abolished by all nanoparticles tested. Inhibition was dependent upon particle core and surface-functional group composition. Inhibition of LDH was absent in crude tissue homogenates, in the presence of albumin, and at the isoelectric point of the protein, indicating that nanoparticles bind non-specifically to abundant proteins via a charge interaction. Circular dichroism spectroscopy suggests that the structure of LDH may be altered by nanoparticles in a manner different from that of bulk controls. We present new data on the specific physicochemical properties of nanoparticles that may lead to bioactivity and highlight a number of potentially serious problems with common nanotoxicity testing methods.

  13. Mathematics anxiety and working memory: support for the existence of a deficient inhibition mechanism.

    Science.gov (United States)

    Hopko, D R; Ashcraft, M H; Gute, J; Ruggiero, K J; Lewis, C

    1998-01-01

    A current theory of anxiety effects in cognition claims that anxiety disrupts normal processing within the working memory system. We examined this theory in the context of a reading task, for participants who were high or low in assessed mathematics anxiety. The task was designed to measure the ability to inhibit attention to distracting information and the effects of this ability on explicit memory performance. The results suggested that math-anxious individuals have a deficient inhibition mechanism whereby working memory resources are consumed by task-irrelevant distracters. A consequence of this deficiency was that explicit memory performance was poorer for high-anxious individuals. Based on these results, the recommendation is made that Eysenck and Calvo's (1992) processing efficiency theory be integrated with Connelly, Hasher, and Zack's (1991) inhibition theory to portray more comprehensively the relation between anxiety and performance.

  14. Combinatorial epigenetic mechanisms and efficacy of early breast cancer inhibition by nutritive botanicals.

    Science.gov (United States)

    Li, Yuanyuan; Buckhaults, Phillip; Cui, Xiangqin; Tollefsbol, Trygve O

    2016-08-01

    Aberrant epigenetic events are important contributors to the pathogenesis of different types of cancers and dietary botanicals with epigenetic properties can influence early cancer development leading to cancer prevention effects. We sought to investigate potential combinatorial effects of bioactive dietary components including green tea polyphenols (GTPs) and broccoli sprouts (BSp) on neutralizing epigenetic aberrations during breast tumorigenesis. The combinatorial effects were evaluated in a breast cancer transformation cellular system and breast cancer mouse xenografts. Combined treatment with epigallocatechin-3-gallate in GTPs and sulforaphane in BSp resulted in a synergistic inhibition of breast cancer cellular growth. Further studies revealed this combination led to genome-wide epigenetic alterations. Combinatorial diets significantly inhibited tumor growth in breast cancer mouse xenografts. Collectively, these studies indicate that combined GTPs and BSp are highly effective in inhibiting early breast cancer development by, at least in part, regulating epigenetic mechanisms.

  15. Combinatorial epigenetic mechanisms and efficacy of early breast cancer inhibition by nutritive botanicals

    Science.gov (United States)

    Li, Yuanyuan; Buckhaults, Phillip; Cui, Xiangqin; Tollefsbol, Trygve O

    2016-01-01

    Aim: Aberrant epigenetic events are important contributors to the pathogenesis of different types of cancers and dietary botanicals with epigenetic properties can influence early cancer development leading to cancer prevention effects. We sought to investigate potential combinatorial effects of bioactive dietary components including green tea polyphenols (GTPs) and broccoli sprouts (BSp) on neutralizing epigenetic aberrations during breast tumorigenesis. Materials & methods: The combinatorial effects were evaluated in a breast cancer transformation cellular system and breast cancer mouse xenografts. Results & conclusion: Combined treatment with epigallocatechin-3-gallate in GTPs and sulforaphane in BSp resulted in a synergistic inhibition of breast cancer cellular growth. Further studies revealed this combination led to genome-wide epigenetic alterations. Combinatorial diets significantly inhibited tumor growth in breast cancer mouse xenografts. Collectively, these studies indicate that combined GTPs and BSp are highly effective in inhibiting early breast cancer development by, at least in part, regulating epigenetic mechanisms. PMID:27478970

  16. Mechanism of cell integration on biomaterial implant surfaces in the presence of bacterial contamination

    NARCIS (Netherlands)

    Yue, Chongxia; van der Mei, Henny C.; Kuijer, Roel; Busscher, Henk J.; Rochford, Edward T. J.

    2015-01-01

    Bacterial contamination during biomaterial implantation is often unavoidable, yielding a combat between cells and bacteria. Here we aim to determine the modulatory function of bacterial components on stem-cell, fibroblast, and osteoblast adhesion to a titanium alloy, including the role of

  17. Mechanism of inhibition of the tumor suppressor Patched by Sonic Hedgehog.

    Science.gov (United States)

    Tukachinsky, Hanna; Petrov, Kostadin; Watanabe, Miyako; Salic, Adrian

    2016-10-04

    The Hedgehog cell-cell signaling pathway is crucial for animal development, and its misregulation is implicated in numerous birth defects and cancers. In unstimulated cells, pathway activity is inhibited by the tumor suppressor membrane protein, Patched. Hedgehog signaling is triggered by the secreted Hedgehog ligand, which binds and inhibits Patched, thus setting in motion the downstream events in signal transduction. Despite its critical importance, the mechanism by which Hedgehog antagonizes Patched has remained unknown. Here, we show that vertebrate Patched1 inhibition is caused by direct, palmitate-dependent interaction with the Sonic Hedgehog ligand. We find that a short palmitoylated N-terminal fragment of Sonic Hedgehog binds Patched1 and, strikingly, is sufficient to inhibit it and to activate signaling. The rest of Sonic Hedgehog confers high-affinity Patched1 binding and internalization through a distinct binding site, but, surprisingly, it is not absolutely required for signaling. The palmitate-dependent interaction with Patched1 is specifically impaired in a Sonic Hedgehog mutant causing human holoprosencephaly, the most frequent congenital brain malformation, explaining its drastically reduced potency. The palmitate-dependent interaction is also abolished in constitutively inhibited Patched1 point mutants causing the Gorlin cancer syndrome, suggesting that they might adopt a conformation distinct from the wild type. Our data demonstrate that Sonic Hedgehog signals via the palmitate-dependent arm of a two-pronged contact with Patched1. Furthermore, our results suggest that, during Hedgehog signaling, ligand binding inhibits Patched by trapping it in an inactive conformation, a mechanism that explains the dramatically reduced activity of oncogenic Patched1 mutants.

  18. Response Mechanisms of Bacterial Degraders to Environmental Contaminants on the Level of Cell Walls and Cytoplasmic Membrane

    Directory of Open Access Journals (Sweden)

    Slavomíra Murínová

    2014-01-01

    Full Text Available Bacterial strains living in the environment must cope with the toxic compounds originating from humans production. Surface bacterial structures, cell wall and cytoplasmic membrane, surround each bacterial cell and create selective barriers between the cell interior and the outside world. They are a first site of contact between the cell and toxic compounds. Organic pollutants are able to penetrate into cytoplasmic membrane and affect membrane physiological functions. Bacteria had to evolve adaptation mechanisms to counteract the damage originated from toxic contaminants and to prevent their accumulation in cell. This review deals with various adaptation mechanisms of bacterial cell concerning primarily the changes in cytoplasmic membrane and cell wall. Cell adaptation maintains the membrane fluidity status and ratio between bilayer/nonbilayer phospholipids as well as the efflux of toxic compounds, protein repair mechanisms, and degradation of contaminants. Low energy consumption of cell adaptation is required to provide other physiological functions. Bacteria able to survive in toxic environment could help us to clean contaminated areas when they are used in bioremediation technologies.

  19. Response mechanisms of bacterial degraders to environmental contaminants on the level of cell walls and cytoplasmic membrane.

    Science.gov (United States)

    Murínová, Slavomíra; Dercová, Katarína

    2014-01-01

    Bacterial strains living in the environment must cope with the toxic compounds originating from humans production. Surface bacterial structures, cell wall and cytoplasmic membrane, surround each bacterial cell and create selective barriers between the cell interior and the outside world. They are a first site of contact between the cell and toxic compounds. Organic pollutants are able to penetrate into cytoplasmic membrane and affect membrane physiological functions. Bacteria had to evolve adaptation mechanisms to counteract the damage originated from toxic contaminants and to prevent their accumulation in cell. This review deals with various adaptation mechanisms of bacterial cell concerning primarily the changes in cytoplasmic membrane and cell wall. Cell adaptation maintains the membrane fluidity status and ratio between bilayer/nonbilayer phospholipids as well as the efflux of toxic compounds, protein repair mechanisms, and degradation of contaminants. Low energy consumption of cell adaptation is required to provide other physiological functions. Bacteria able to survive in toxic environment could help us to clean contaminated areas when they are used in bioremediation technologies.

  20. The bacterial dicarboxylate transporter VcINDY uses a two-domain elevator-type mechanism.

    Science.gov (United States)

    Mulligan, Christopher; Fenollar-Ferrer, Cristina; Fitzgerald, Gabriel A; Vergara-Jaque, Ariela; Kaufmann, Desirée; Li, Yan; Forrest, Lucy R; Mindell, Joseph A

    2016-03-01

    Secondary transporters use alternating-access mechanisms to couple uphill substrate movement to downhill ion flux. Most known transporters use a 'rocking bundle' motion, wherein the protein moves around an immobile substrate-binding site. However, the glutamate-transporter homolog GltPh translocates its substrate-binding site vertically across the membrane, through an 'elevator' mechanism. Here, we used the 'repeat swap' approach to computationally predict the outward-facing state of the Na(+)/succinate transporter VcINDY, from Vibrio cholerae. Our model predicts a substantial elevator-like movement of VcINDY's substrate-binding site, with a vertical translation of ~15 Å and a rotation of ~43°. Our observation that multiple disulfide cross-links completely inhibit transport provides experimental confirmation of the model and demonstrates that such movement is essential. In contrast, cross-links across the VcINDY dimer interface preserve transport, thus revealing an absence of large-scale coupling between protomers.

  1. Antibiotic Capture by Bacterial Lipocalins Uncovers an Extracellular Mechanism of Intrinsic Antibiotic Resistance.

    Science.gov (United States)

    El-Halfawy, Omar M; Klett, Javier; Ingram, Rebecca J; Loutet, Slade A; Murphy, Michael E P; Martín-Santamaría, Sonsoles; Valvano, Miguel A

    2017-03-14

    The potential for microbes to overcome antibiotics of different classes before they reach bacterial cells is largely unexplored. Here we show that a soluble bacterial lipocalin produced by Burkholderia cenocepacia upon exposure to sublethal antibiotic concentrations increases resistance to diverse antibiotics in vitro and in vivo These phenotypes were recapitulated by heterologous expression in B. cenocepacia of lipocalin genes from Pseudomonas aeruginosa , Mycobacterium tuberculosis , and methicillin-resistant Staphylococcus aureus Purified lipocalin bound different classes of bactericidal antibiotics and contributed to bacterial survival in vivo Experimental and X-ray crystal structure-guided computational studies revealed that lipocalins counteract antibiotic action by capturing antibiotics in the extracellular space. We also demonstrated that fat-soluble vitamins prevent antibiotic capture by binding bacterial lipocalin with higher affinity than antibiotics. Therefore, bacterial lipocalins contribute to antimicrobial resistance by capturing diverse antibiotics in the extracellular space at the site of infection, which can be counteracted by known vitamins. IMPORTANCE Current research on antibiotic action and resistance focuses on targeting essential functions within bacterial cells. We discovered a previously unrecognized mode of general bacterial antibiotic resistance operating in the extracellular space, which depends on bacterial protein molecules called lipocalins. These molecules are highly conserved in most bacteria and have the ability to capture different classes of antibiotics outside bacterial cells. We also discovered that liposoluble vitamins, such as vitamin E, overcome in vitro and in vivo antibiotic resistance mediated by bacterial lipocalins, providing an unexpected new alternative to combat resistance by using this vitamin or its derivatives as antibiotic adjuvants. Copyright © 2017 El-Halfawy et al.

  2. Structural insights into mechanisms for inhibiting amyloid β42 aggregation by non-catechol-type flavonoids.

    Science.gov (United States)

    Hanaki, Mizuho; Murakami, Kazuma; Akagi, Ken-ichi; Irie, Kazuhiro

    2016-01-15

    The prevention of 42-mer amyloid β-protein (Aβ42) aggregation is promising for the treatment of Alzheimer's disease. We previously described the site-specific inhibitory mechanism for Aβ42 aggregation by a catechol-type flavonoid, (+)-taxifolin, targeting Lys16,28 after its autoxidation. In contrast, non-catechol-type flavonoids (morin, datiscetin, and kaempferol) inhibited Aβ42 aggregation without targeting Lys16,28 with almost similar potencies to that of (+)-taxifolin. We herein provided structural insights into their mechanisms for inhibiting Aβ42 aggregation. Physicochemical analyses revealed that their inhibition did not require autoxidation. The (1)H-(15)N SOFAST-HMQC NMR of Aβ42 in the presence of morin and datiscetin revealed the significant perturbation of chemical shifts of His13,14 and Gln15, which were close to the intermolecular β-sheet region, Gln15-Ala21. His13,14 also played a role in radical formation at Tyr10, thereby inducing the oxidation of Met35, which has been implicated in Aβ42 aggregation. These results suggest the direct interaction of morin and datiscetin with the Aβ42 monomer. Although only kaempferol was oxidatively-degraded during incubation, its degradation products as well as kaempferol itself suppressed Aβ42 aggregation. However, neither kaempferol nor its decomposed products perturbed the chemical shifts of the Aβ42 monomer. Aggregation experiments using 1,1,1,3,3,3-hexafluoro-2-propanol-treated Aβ42 demonstrated that kaempferol and its degradation products inhibited the elongation rather than nucleation phase, implying that they interacted with small aggregates of Aβ42, but not with the monomer. In contrast, morin and datiscetin inhibited both phases. The position and number of hydroxyl groups on the B-ring of non-catechol-type flavonoids could be important for their inhibitory potencies and mechanisms against Aβ42 aggregation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. The mechanism of inhibition of metastasis by cartilage polysaccharide in breast-cancer cells.

    Science.gov (United States)

    Liu, An-jun; Hu, Yan-xun; Liu, Chang-jin; Yao, Xiu-ling; Zhang, Guo-rong

    2009-06-22

    As large amounts of porcine cartilage are discarded as waste in daily life, it is necessary to find new uses for them. We extracted polysaccharide from cartilage and performed in vitro and in vivo experiments in cancer cells. A mouse breast-cancer pulmonary metastasis model was set up, and we tried to determine the mechanism of the inhibition of metastasis by cartilage PS (polysaccharide). Effects on tumour size and the progression of metastasis indicated that cartilage PS can obviously inhibit metastasis in breast-cancer cells. The levels of LNR1 (laminin receptor 1), alphavbeta3 integrin and MMP-9 (matrix metalloproteinase-9) in mice treated or not with cartilage PS showed significant differences. Cartilage PS inhibited the growth of MCF-7 human breast adenocarcinoma cells, but had little effect on normal cells. Cartilage PS can inhibit the activity of the MMP-2 and the MMP-9 by decreasing the levels of LNR1 and alphavbeta3 integrin to inhibit metastasis further. In summary, we conclude that cartilage PS can act as a specific anti-metastatic agent in breast-cancer cells.

  4. Mechanism of the inhibition of milk xanthine oxidase activity by metal ions: a transient kinetic study.

    Science.gov (United States)

    Mondal, M S; Sau, A K; Mitra, S

    2000-07-14

    The nature and mechanism of the inhibition of the oxidoreductase activity of milk xanthine oxidase (XO) by Cu(2+), Hg(2+) and Ag(+) ions has been studied by steady state and stopped flow transient kinetic measurements. The results show that the nature of the inhibition is noncompetitive. The inhibition constants for Cu(2+) and Hg(2+) are in the micromolar and that for Ag(+) is in the nanomolar range. This suggests that the metal ions have strong affinity towards XO. pH dependence studies of the inhibition indicate that at least two ionisable groups of XO are involved in the binding of these metal ions. The effect of the interaction of the metal ions on the reductive and oxidative half reactions of XO has been investigated, and it is observed that the kinetic parameters of the reductive half reaction are not affected by these metal ions. However, the interaction of these metal ions with XO significantly affects the kinetic parameters of the oxidative half reaction. It is suggested that this may be the main cause for the inhibition of XO activity by the metal ions.

  5. Diblock copolymer of bacterial cellulose and poly(methyl methacrylate) initiated by chain-end-type radicals produced by mechanical scission of glycosidic linkages of bacterial cellulose.

    Science.gov (United States)

    Sakaguchi, Masato; Ohura, Takeshi; Iwata, Tadahisa; Takahashi, Shuhei; Akai, Shuji; Kan, Toshiyuki; Murai, Hisao; Fujiwara, Motoyasu; Watanabe, Osamu; Narita, Mamiko

    2010-11-08

    Bacterial cellulose (BC) was mechanically fractured in vacuum at 77 K; this resulted in the scission of the β-1,4 glycosidic linkages of BC. The chain-end-type radicals (mechanoradicals) generated from the scissions were assigned by electron spin resonance (ESR) spectral analyses. A diblock copolymer of BC and poly(methyl methacrylate) (BC-block-PMMA) was produced by the mechanical fracture of BC with MMA (methyl methacrylate) in vacuum at 77 K. Radical polymerization of MMA was initiated by the mechanoradicals located on the BC surface. The BC surface was fully covered with the PMMA chains of the BC-block-PMMA. Novel modification of the BC surface with the BC-block-PMMA was confirmed by spectral analyses of ESR, Fourier-transform infrared, (1)H NMR, and gel permeation chromatography.

  6. Silver nanoparticles inhibit vaccinia virus infection by preventing viral entry through a macropinocytosis-dependent mechanism.

    Science.gov (United States)

    Trefry, John C; Wooley, Dawn P

    2013-09-01

    Silver nanoparticles have been shown to inhibit viruses. However, very little is known about the mechanism of antiviral activity. This study tested the hypothesis that 25-nm silver nanoparticles inhibited Vaccinia virus replication by preventing viral entry. Plaque reduction, confocal microscopy, and beta-galactosidase reporter gene assays were used to examine viral attachment and entry in the presence and absence of silver nanoparticles. To explore the mechanism of inhibition, viral entry experiments were conducted with silver nanoparticles and small interfering RNAs designed to silence the gene coding for p21-activated kinase 1, a key mediator of macropinocytosis. The silver nanoparticles caused a 4- to 5-log reduction in viral titer at concentrations that were not toxic to cells. Virus was capable of adsorbing to cells but could not enter cells in the presence of silver nanoparticles. Virus particles that had adsorbed to cells in the presence of silver nanoparticles were found to be infectious upon removal from the cells, indicating lack of direct virucidal effect. The half maximal inhibitory concentration for viral entry in the presence of silver nanoparticles was 27.4+/-3.3 microg/ml. When macropinocytosis was blocked, this inhibition was significantly reduced. Thus, macropinocytosis was required for the full antiviral effect. For the first time, this study points to the novel result that a cellular process involved in viral entry is responsible for the antiviral effects of silver nanoparticles.

  7. Bacterial foraging-optimized PID control of a two-wheeled machine with a two-directional handling mechanism.

    Science.gov (United States)

    Goher, K M; Fadlallah, S O

    2017-01-01

    This paper presents the performance of utilizing a bacterial foraging optimization algorithm on a PID control scheme for controlling a five DOF two-wheeled robotic machine with two-directional handling mechanism. The system under investigation provides solutions for industrial robotic applications that require a limited-space working environment. The system nonlinear mathematical model, derived using Lagrangian modeling approach, is simulated in MATLAB/Simulink ® environment. Bacterial foraging-optimized PID control with decoupled nature is designed and implemented. Various working scenarios with multiple initial conditions are used to test the robustness and the system performance. Simulation results revealed the effectiveness of the bacterial foraging-optimized PID control method in improving the system performance compared to the PID control scheme.

  8. Azelnidipine inhibits cultured rat aortic smooth muscle cell death induced by cyclic mechanical stretch.

    Directory of Open Access Journals (Sweden)

    Jing Zhao

    Full Text Available Acute aortic dissection is the most common life-threatening vascular disease, with sudden onset of severe pain and a high fatality rate. Clarifying the detailed mechanism for aortic dissection is of great significance for establishing effective pharmacotherapy for this high mortality disease. In the present study, we evaluated the influence of biomechanical stretch, which mimics an acute rise in blood pressure using an experimental apparatus of stretching loads in vitro, on rat aortic smooth muscle cell (RASMC death. Then, we examined the effects of azelnidipine and mitogen-activated protein kinase inhibitors on mechanical stretch-induced RASMC death. The major findings of the present study are as follows: (1 cyclic mechanical stretch on RASMC caused cell death in a time-dependent manner up to 4 h; (2 cyclic mechanical stretch on RASMC induced c-Jun N-terminal kinase (JNK and p38 activation with peaks at 10 min; (3 azelnidipine inhibited RASMC death in a concentration-dependent manner as well as inhibited JNK and p38 activation by mechanical stretch; and (4 SP600125 (a JNK inhibitor and SB203580 (a p38 inhibitor protected against stretch-induced RASMC death; (5 Antioxidants, diphenylene iodonium and tempol failed to inhibit stretch-induced RASMC death. On the basis of the above findings, we propose a possible mechanism where an acute rise in blood pressure increases biomechanical stress on the arterial walls, which induces RASMC death, and thus, may lead to aortic dissection. Azelnidipine may be used as a pharmacotherapeutic agent for prevention of aortic dissection independent of its blood pressure lowering effect.

  9. Insight into the novel inhibition mechanism of apigenin to Pneumolysin by molecular modeling

    Science.gov (United States)

    Niu, Xiaodi; Yang, Yanan; Song, Meng; Wang, Guizhen; Sun, Lin; Gao, Yawen; Wang, Hongsu

    2017-11-01

    In this study, the mechanism of apigenin inhibition was explored using molecular modelling, binding energy calculation, and mutagenesis assays. Energy decomposition analysis indicated that apigenin binds in the gap between domains 3 and 4 of PLY. Using principal component analysis, we found that binding of apigenin to PLY weakens the motion of domains 3 and 4. Consequently, these domains cannot complete the transition from monomer to oligomer, thereby blocking oligomerisation of PLY and counteracting its haemolytic activity. This inhibitory mechanism was confirmed by haemolysis assays, and these findings will promote the future development of an antimicrobial agent.

  10. Vaccinia virus inhibits the maturation of human dendritic cells: a novel mechanism of immune evasion.

    Science.gov (United States)

    Engelmayer, J; Larsson, M; Subklewe, M; Chahroudi, A; Cox, W I; Steinman, R M; Bhardwaj, N

    1999-12-15

    Vaccinia virus employs multiple mechanisms to evade the immune system, yet is highly immunogenic. We studied the interaction between vaccinia and human dendritic cells (DCs), potent APCs. DCs develop from precursor cells in two stages: an immature stage in which Ag uptake and processing occur, and a mature stage in which there is up-regulation of costimulatory and HLA molecules and efficient T cell activation. Vaccinia virus undergoes an abortive replication in both stages of DCs and induces apoptotic cell death. Furthermore, maturation of immature DCs and consequently T cell activation are inhibited. Obstruction of DC maturation may constitute a novel mechanism by which vaccinia attempts to evade the immune response.

  11. Examining Mechanical Strength Characteristics of Selective Inhibition Sintered HDPE Specimens Using RSM and Desirability Approach

    Science.gov (United States)

    Rajamani, D.; Esakki, Balasubramanian

    2017-09-01

    Selective inhibition sintering (SIS) is a powder based additive manufacturing (AM) technique to produce functional parts with an inexpensive system compared with other AM processes. Mechanical properties of SIS fabricated parts are of high dependence on various process parameters importantly layer thickness, heat energy, heater feedrate, and printer feedrate. In this paper, examining the influence of these process parameters on evaluating mechanical properties such as tensile and flexural strength using Response Surface Methodology (RSM) is carried out. The test specimens are fabricated using high density polyethylene (HDPE) and mathematical models are developed to correlate the control factors to the respective experimental design response. Further, optimal SIS process parameters are determined using desirability approach to enhance the mechanical properties of HDPE specimens. Optimization studies reveal that, combination of high heat energy, low layer thickness, medium heater feedrate and printer feedrate yielded superior mechanical strength characteristics.

  12. Repaglinide-gemfibrozil drug interaction: inhibition of repaglinide glucuronidation as a potential additional contributing mechanism.

    Science.gov (United States)

    Gan, Jinping; Chen, Weiqi; Shen, Hong; Gao, Ling; Hong, Yang; Tian, Yuan; Li, Wenying; Zhang, Yueping; Tang, Yuwei; Zhang, Hongjian; Humphreys, William Griffith; Rodrigues, A David

    2010-12-01

    To further explore the mechanism underlying the interaction between repaglinide and gemfibrozil, alone or in combination with itraconazole. Repaglinide metabolism was assessed in vitro (human liver subcellular fractions, fresh human hepatocytes, and recombinant enzymes) and the resulting incubates were analyzed, by liquid chromatography-mass spectrometry (LC-MS) and radioactivity counting, to identify and quantify the different metabolites therein. Chemical inhibitors, in addition to a trapping agent, were also employed to elucidate the importance of each metabolic pathway. Finally, a panel of human liver microsomes (genotyped for UGT1A1*28 allele status) was used to determine the importance of UGT1A1 in the direct glucuronidation of repaglinide. The results of the present study demonstrate that repaglinide can undergo direct glucuronidation, a pathway that can possibly contribute to the interaction with gemfibrozil. For example, [³H]-repaglinide formed glucuronide and oxidative metabolites (M2 and M4) when incubated with primary human hepatocytes. Gemfibrozil effectively inhibited (∼78%) both glucuronide and M4 formation, but had a minor effect on M2 formation. Concomitantly, the overall turnover of repaglinide was also inhibited (∼80%), and was completely abolished when gemfibrozil was co-incubated with itraconazole. These observations are in qualitative agreement with the in vivo findings. UGT1A1 plays a significant role in the glucuronidation of repaglinide. In addition, gemfibrozil and its glucuronide inhibit repaglinide glucuronidation and the inhibition by gemfibrozil glucuronide is time-dependent. Inhibition of UGT enzymes, especially UGT1A1, by gemfibrozil and its glucuronide is an additional mechanism to consider when rationalizing the interaction between repaglinide and gemfibrozil. © 2010 The Authors. British Journal of Clinical Pharmacology © 2010 The British Pharmacological Society.

  13. Two distinct mechanisms for actin capping protein regulation--steric and allosteric inhibition.

    Science.gov (United States)

    Takeda, Shuichi; Minakata, Shiho; Koike, Ryotaro; Kawahata, Ichiro; Narita, Akihiro; Kitazawa, Masashi; Ota, Motonori; Yamakuni, Tohru; Maéda, Yuichiro; Nitanai, Yasushi

    2010-07-06

    The actin capping protein (CP) tightly binds to the barbed end of actin filaments, thus playing a key role in actin-based lamellipodial dynamics. V-1 and CARMIL proteins directly bind to CP and inhibit the filament capping activity of CP. V-1 completely inhibits CP from interacting with the barbed end, whereas CARMIL proteins act on the barbed end-bound CP and facilitate its dissociation from the filament (called uncapping activity). Previous studies have revealed the striking functional differences between the two regulators. However, the molecular mechanisms describing how these proteins inhibit CP remains poorly understood. Here we present the crystal structures of CP complexed with V-1 and with peptides derived from the CP-binding motif of CARMIL proteins (CARMIL, CD2AP, and CKIP-1). V-1 directly interacts with the primary actin binding surface of CP, the C-terminal region of the alpha-subunit. Unexpectedly, the structures clearly revealed the conformational flexibility of CP, which can be attributed to a twisting movement between the two domains. CARMIL peptides in an extended conformation interact simultaneously with the two CP domains. In contrast to V-1, the peptides do not directly compete with the barbed end for the binding surface on CP. Biochemical assays revealed that the peptides suppress the interaction between CP and V-1, despite the two inhibitors not competing for the same binding site on CP. Furthermore, a computational analysis using the elastic network model indicates that the interaction of the peptides alters the intrinsic fluctuations of CP. Our results demonstrate that V-1 completely sequesters CP from the barbed end by simple steric hindrance. By contrast, CARMIL proteins allosterically inhibit CP, which appears to be a prerequisite for the uncapping activity. Our data suggest that CARMIL proteins down-regulate CP by affecting its conformational dynamics. This conceptually new mechanism of CP inhibition provides a structural basis for the

  14. Mechanism of HERG potassium channel inhibition by tetra-n-octylammonium bromide and benzethonium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Long, Yan; Lin, Zuoxian [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China); Xia, Menghang; Zheng, Wei [National Center for Advancing Translational Sciences, National Institutes of Health, Bethesda, MD 20892 (United States); Li, Zhiyuan, E-mail: li_zhiyuan@gibh.ac.cn [Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530 (China)

    2013-03-01

    Tetra-n-octylammonium bromide and benzethonium chloride are synthetic quaternary ammonium salts that are widely used in hospitals and industries for the disinfection and surface treatment and as the preservative agent. Recently, the activities of HERG channel inhibition by these compounds have been found to have potential risks to induce the long QT syndrome and cardiac arrhythmia, although the mechanism of action is still elusive. This study was conducted to investigate the mechanism of HERG channel inhibition by these compounds by using whole-cell patch clamp experiments in a CHO cell line stably expressing HERG channels. Tetra-n-octylammonium bromide and benzethonium chloride exhibited concentration-dependent inhibitions of HERG channel currents with IC{sub 50} values of 4 nM and 17 nM, respectively, which were also voltage-dependent and use-dependent. Both compounds shifted the channel activation I–V curves in a hyperpolarized direction for 10–15 mV and accelerated channel activation and inactivation processes by 2-fold. In addition, tetra-n-octylammonium bromide shifted the inactivation I–V curve in a hyperpolarized direction for 24.4 mV and slowed the rate of channel deactivation by 2-fold, whereas benzethonium chloride did not. The results indicate that tetra-n-octylammonium bromide and benzethonium chloride are open-channel blockers that inhibit HERG channels in the voltage-dependent, use-dependent and state-dependent manners. - Highlights: ► Tetra-n-octylammonium and benzethonium are potent HERG channel inhibitors. ► Channel activation and inactivation processes are accelerated by the two compounds. ► Both compounds are the open-channel blockers to HERG channels. ► HERG channel inhibition by both compounds is use-, voltage- and state dependent. ► The in vivo risk of QT prolongation needs to be studied for the two compounds.

  15. Vaborbactam: Spectrum of Beta-Lactamase Inhibition and Impact of Resistance Mechanisms on Activity in Enterobacteriaceae.

    Science.gov (United States)

    Lomovskaya, Olga; Sun, Dongxu; Rubio-Aparicio, Debora; Nelson, Kirk; Tsivkovski, Ruslan; Griffith, David C; Dudley, Michael N

    2017-11-01

    Vaborbactam (formerly RPX7009) is a new beta-lactamase inhibitor based on a cyclic boronic acid pharmacophore. The spectrum of beta-lactamase inhibition by vaborbactam and the impact of bacterial efflux and permeability on its activity were determined using a panel of strains with beta-lactamases cloned from various classes and a panel of Klebsiella pneumoniae carbapenemase 3 (KPC-3)-producing isogenic strains with various combinations of efflux and porin mutations. Vaborbactam is a potent inhibitor of class A carbapenemases, such as KPC, as well as an inhibitor of other class A (CTX-M, SHV, TEM) and class C (P99, MIR, FOX) beta-lactamases. Vaborbactam does not inhibit class D or class B carbapenemases. When combined with meropenem, vaborbactam had the highest potency compared to the potencies of vaborbactam in combination with other antibiotics against strains producing the KPC beta-lactamase. Consistent with broad-spectrum beta-lactamase inhibition, vaborbactam reduced the meropenem MICs for engineered isogenic strains of K. pneumoniae with increased meropenem MICs due to a combination of extended-spectrum beta-lactamase production, class C beta-lactamase production, and reduced permeability due to porin mutations. Vaborbactam crosses the outer membrane of K. pneumoniae using both OmpK35 and OmpK36, but OmpK36 is the preferred porin. Efflux by the multidrug resistance efflux pump AcrAB-TolC had a minimal impact on vaborbactam activity. Investigation of the vaborbactam concentration necessary for restoration of meropenem potency showed that vaborbactam at 8 μg/ml results in meropenem MICs of ≤2 μg/ml in the most resistant engineered strains containing multiple mutations. Vaborbactam is a highly active beta-lactamase inhibitor that restores the activity of meropenem and other beta-lactam antibiotics in beta-lactamase-producing bacteria, particularly KPC-producing carbapenem-resistant Enterobacteriaceae . Copyright © 2017 Lomovskaya et al.

  16. Bacterial Exopolysaccharide mediated heavy metal removal: A Review on biosynthesis, mechanism and remediation strategies

    Directory of Open Access Journals (Sweden)

    Pratima Gupta

    2017-03-01

    Full Text Available Heavy metal contamination has been recognized as a major public health risk, particularly in developing countries and their toxicological manifestations are well known. Conventional remediation strategies are either expensive or they generate toxic by-products, which adversely affect the environment. Therefore, necessity for an environmentally safe strategy motivates interest towards biological techniques. One of such most profoundly driven approach in recent times is biosorption through microbial biomass and their products. Extracellular polymeric substances are such complex blend of high molecular weight microbial (prokaryotic and eukaryotic biopolymers. They are mainly composed of proteins, polysaccharides, uronic acids, humic substances, lipids etc. One of its essential constituent is the exopolysaccharide (EPS released out of self defense against harsh conditions of starvation, pH and temperature, hence it displays exemplary physiological, rheological and physio-chemical properties. Its net anionic makeup allows the biopolymer to effectively sequester positively charged heavy metal ions. The polysaccharide has been expounded deeply in this article with reference to its biosynthesis and emphasizes heavy metal sorption abilities of polymer in terms of mechanism of action and remediation. It reports current investigation and strategic advancements in dealing bacterial cells and their EPS in diverse forms – mixed culture EPS, single cell EPS, live, dead or immobilized EPS. A significant scrutiny is also involved highlighting the existing challenges that still lie in the path of commercialization. The article enlightens the potential of EPS to bring about bio-detoxification of heavy metal contaminated terrestrial and aquatic systems in highly sustainable, economic and eco-friendly manner.

  17. Spinal fMRI reveals decreased descending inhibition during secondary mechanical hyperalgesia.

    Directory of Open Access Journals (Sweden)

    Torge Rempe

    Full Text Available Mechanical hyperalgesia is one distressing symptom of neuropathic pain which is explained by central sensitization of the nociceptive system. This sensitization can be induced experimentally with the heat/capsaicin sensitization model. The aim was to investigate and compare spinal and supraspinal activation patterns of identical mechanical stimulation before and after sensitization using functional spinal magnetic resonance imaging (spinal fMRI. Sixteen healthy subjects (6 female, 10 male, mean age 27.2 ± 4.0 years were investigated with mechanical stimulation of the C6 dermatome of the right forearm during spinal fMRI. Testing was always performed in the area outside of capsaicin application (i.e. area of secondary mechanical hyperalgesia. During slightly noxious mechanical stimulation before sensitization, activity was observed in ipsilateral dorsolateral pontine tegmentum (DLPT which correlated with activity in ipsilateral spinal cord dorsal gray matter (dGM suggesting activation of descending nociceptive inhibition. During secondary mechanical hyperalgesia, decreased activity was observed in bilateral DLPT, ipsilateral/midline rostral ventromedial medulla (RVM, and contralateral subnucleus reticularis dorsalis, which correlated with activity in ipsilateral dGM. Comparison of voxel-based activation patterns during mechanical stimulation before/after sensitization showed deactivations in RVM and activations in superficial ipsilateral dGM. This study revealed increased spinal activity and decreased activity in supraspinal centers involved in pain modulation (SRD, RVM, DLPT during secondary mechanical hyperalgesia suggesting facilitation of nociception via decreased endogenous inhibition. Results should help prioritize approaches for further in vivo studies on pain processing and modulation in humans.

  18. Bacterial economics: adaptation to stress conditions via stage-wise changes in the response mechanism.

    Science.gov (United States)

    Baranyi, J; Metris, A; George, S M

    2015-02-01

    Common features of microbial adaptation are analysed with mathematical models and extended to stress conditions when the bacterial population declines before growing again. A parallel is drawn between bacterial and human communities in terms of non-mutation-based adaptation (acclimation) to stress. For a case study, the behaviour of Escherichia coli under osmotic stress, is detailed. It is suggested that stress modelling adaptation should be the focus of further developments in predictive food microbiology. Copyright © 2014. Published by Elsevier Ltd.

  19. MECHANICAL VIBRATION INHIBITS OSTEOCLAST FORMATION BY REDUCING DC-STAMP RECEPTOR EXPRESSION IN OSTEOCLAST PRECURSOR CELLS

    Science.gov (United States)

    Kulkarni, R.N.; Voglewede, P.A.; Liu, D.

    2014-01-01

    It is well known that physical inactivity leads to loss of muscle mass, but it also causes bone loss. Mechanistically, osteoclastogenesis and bone resorption have recently been shown to be regulated by vibration. However, the underlying mechanism behind the inhibition of osteoclast formation is yet unknown. Therefore, we investigated whether mechanical vibration of osteoclast precursor cells affects osteoclast formation by the involvement of fusion-related molecules such as dendritic cell-specific transmembrane protein (DC-STAMP), and P2X7 receptor (P2X7R). RAW264.7 (a murine osteoclastic-like cell line) cells were treated with 20 ng/ml receptor activator of NF-κB ligand (RANKL). For 3 consecutive days, the cells were subjected to 1 hour of mechanical vibration with 20 µm displacement at a frequency of 4 Hz and compared to the control cells that were treated under the same condition but without the vibration. After 5 days of culture, osteoclast formation was determined. Gene expression of DC-STAMP and P2X7R by RAW264.7 cells were determined after 1 hour mechanical vibration, while protein production of the DC-STAMP was determined after 6 hours of post incubation after vibration. As a result, mechanical vibration of RAW264.7 cells inhibited the formation of osteoclasts. Vibration down-regulated DC-STAMP gene expression by 1.6-fold in the presence of RANKL and by 1.4-fold in the absence of RANKL. Additionally, DC-STAMP protein production was also down-regulated by 1.4-fold in the presence of RANKL and by 1.2-fold in the absence of RANKL in RAW264.7 cells in response to mechanical vibration. However, vibration did not affect P2X7R gene expression. Mouse anti-DC-STAMP antibody inhibited osteoclast formation in the absence of vibration. Our results suggest that mechanical vibration of osteoclast precursor cells reduce DC-STAMP expression in osteoclast precursor cells leading to the inhibition of osteoclast formation. PMID:23994170

  20. Mechanical vibration inhibits osteoclast formation by reducing DC-STAMP receptor expression in osteoclast precursor cells.

    Science.gov (United States)

    Kulkarni, Rishikesh N; Voglewede, Philip A; Liu, Dawei

    2013-12-01

    It is well known that physical inactivity leads to loss of muscle mass, but it also causes bone loss. Mechanistically, osteoclastogenesis and bone resorption have recently been shown to be regulated by vibration. However, the underlying mechanism behind the inhibition of osteoclast formation is yet unknown. Therefore, we investigated whether mechanical vibration of osteoclast precursor cells affects osteoclast formation by the involvement of fusion-related molecules such as dendritic cell-specific transmembrane protein (DC-STAMP) and P2X7 receptor (P2X7R). RAW264.7 (a murine osteoclastic-like cell line) cells were treated with 20ng/ml receptor activator of NF-κB ligand (RANKL). For 3 consecutive days, the cells were subjected to 1h of mechanical vibration with 20μm displacement at a frequency of 4Hz and compared to the control cells that were treated under the same condition but without the vibration. After 5days of culture, osteoclast formation was determined. Gene expression of DC-STAMP and P2X7R by RAW264.7 cells was determined after 1h of mechanical vibration, while protein production of the DC-STAMP was determined after 6h of postincubation after vibration. As a result, mechanical vibration of RAW264.7 cells inhibited the formation of osteoclasts. Vibration down-regulated DC-STAMP gene expression by 1.6-fold in the presence of RANKL and by 1.4-fold in the absence of RANKL. Additionally, DC-STAMP protein production was also down-regulated by 1.4-fold in the presence of RANKL and by 1.2-fold in the absence of RANKL in RAW264.7 cells in response to mechanical vibration. However, vibration did not affect P2X7R gene expression. Mouse anti-DC-STAMP antibody inhibited osteoclast formation in the absence of vibration. Our results suggest that mechanical vibration of osteoclast precursor cells reduces DC-STAMP expression in osteoclast precursor cells leading to the inhibition of osteoclast formation. © 2013 Elsevier Inc. All rights reserved.

  1. Bacterial GroEL-like heat shock protein 60 protects epithelial cells from stress-induced death through activation of ERK and inhibition of caspase 3.

    Science.gov (United States)

    Zhang, Liangxuan; Pelech, Steven; Uitto, Veli-Jukka

    2004-01-01

    Bacterial heat shock proteins (hsps) can have various effects on human cells. We investigated whether bacterial hsp60s can protect epithelial cells from cell death by affecting the mitogen-activated protein kinase (MAPK) signal pathways. Cell protection was studied by adding bacterial hsp60s to skin keratinocyte cultures (HaCaT cell line) before UV radiation. The results show that hsp60 significantly protected against UV radiation-induced cell death. Effects of UV radiation and exogenous hsp60 on phosphorylation of MAPKs and on activation of caspase 3 were examined by Western blot analysis. UV radiation strongly induced phosphorylation of p38 MAPK and formation of active caspase 3. A p38 inhibitor, SB 203580, totally blocked UV radiation-mediated activation of caspase 3. Preincubation with hsp60 strongly induced phosphorylation of ERK1/2 and inhibited UV radiation-mediated activation of caspase 3. PD 98059, a specific inhibitor of the ERK1/2 pathway, blocked this inhibitory effect of exogenous hsp60. Studies on the association between activity of MAPKs or caspase 3 and cell death showed that the ERK1/2 pathway inhibitor reversed protective effect of hsp60 while specific inhibition of p38 and caspase 3 reduced cell death. These results indicate that in HaCaT cells UV radiation mediates cell death through activation of p38 followed by caspase 3 activation. Exogenous hsp60 partially protects against UV radiation-mediated epithelial cell death through activation of ERK1/2, which inhibits caspase 3 activation.

  2. Characterization of four arginine kinases in the ciliate Paramecium tetraurelia: Investigation on the substrate inhibition mechanism.

    Science.gov (United States)

    Yano, Daichi; Suzuki, Takaya; Hirokawa, Saki; Fuke, Kyoko; Suzuki, Tomohiko

    2017-08-01

    The ciliate Paramecium tetraurelia contains four arginine kinase genes (AK1-4). We detected cDNA for only three of the AKs (AK1-3) via PCR. Recombinant AK1-4 were expressed in Escherichia coli and their kinetics parameters determined. AK3 showed typical substrate inhibition toward arginine, and enzymatic activity markedly decreased when arginine concentration increased. This is the first example of substrate inhibition in wild-type phosphagen kinases. To explore the substrate inhibition mechanism, site-directed mutations were generated, targeting the amino acid sequence D-D-S-Q-V at positions 77-81 in P. tetraurelia AK3. Among the mutants, substrate inhibition was lost remarkably in the S79A mutant. In spite of high amino acid sequence identity (91%) between P. tetraurelia AK3 and AK4, the enzymatic activity of AK4 was less by 3% than that of AK3. We noticed that the conservative G298 was unusually replaced by R in P. tetraurelia AK4, and we constructed two mutants, R298G/AK4 and G298R/AK3. Enzymatic activity of the former mutant was comparable with that of the wild-type AK3, whereas that of the latter mutant was dramatically reduced. Thus, we concluded that the significantly low activity of P. tetraurelia AK4 is due to the residue R298. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Effect of growth times on the physical and mechanical properties of hydrophobic and oleophilic silylated bacterial cellulose membranes

    Science.gov (United States)

    Zakaria, M. N.; Sukirah, A. R.; Maizatulnisa, O.; Ayuni, J.; Khalisanni, K.; Rosmamuhamadani, R.

    2017-09-01

    Bacterial cellulose is an extracellular natural byproduct of the metabolism of various bacteria. Its physical and mechanical properties were determined by growth period, method of cultivation either static or agitate, fermentation condition and medium. Thispaper presented works done on the effect of culture time on the physical and mechanical properties of silylated bacteria cellulose membranes. Bacterial cellulose (BC) growth under 4, 5, 6 and 7 days had been used as a natural reinforcement material and silane as a hydrophobic coating material. With extended culture time, the tensile strength and tensile modulus were increased linearly as result of more compact structure. Due to hydrophobic properties of silane, the water absorption and thickness swelling improved correspondingly. Contact angle testingusing three different liquid proven the functionality of silane as hydrophobic and oleophilic coating agent. The experimental results suggested that hydropobicand oleophilicsilylatedbacteria cellulose membranes with controlled growth time could be prepared and regarded as a reusable oil spills membrane.

  4. Peripheral afferent mechanisms underlying acupuncture inhibition of cocaine behavioral effects in rats.

    Directory of Open Access Journals (Sweden)

    Seol Ah Kim

    Full Text Available Administration of cocaine increases locomotor activity by enhancing dopamine transmission. To explore the peripheral mechanisms underlying acupuncture treatment for drug addiction, we developed a novel mechanical acupuncture instrument (MAI for objective mechanical stimulation. The aim of this study was to evaluate whether acupuncture inhibition of cocaine-induced locomotor activity is mediated through specific peripheral nerves, the afferents from superficial or deep tissues, or specific groups of nerve fibers. Mechanical stimulation of acupuncture point HT7 with MAI suppressed cocaine-induced locomotor activity in a stimulus time-dependent manner, which was blocked by severing the ulnar nerve or by local anesthesia. Suppression of cocaine-induced locomotor activity was elicited after HT7 stimulation at frequencies of either 50 (for Meissner corpuscles or 200 (for Pacinian corpuscles Hz and was not affected by block of C/Aδ-fibers in the ulnar nerve with resiniferatoxin, nor generated by direct stimulation of C/Aδ-fiber afferents with capsaicin. These findings suggest that HT7 inhibition of cocaine-induced locomotor activity is mediated by A-fiber activation of ulnar nerve that originates in superficial and deep tissue.

  5. Influence of Gluteus Maximus Inhibition on Upper Trapezius Overactivity in Chronic Mechanical Neck Pain with Radiculopathy

    Directory of Open Access Journals (Sweden)

    Ghada Mohamed Koura

    2017-03-01

    Full Text Available Background: Mechanical neck pain is the most common type of neck pain and commonly to accompany with radiculopathy. Patients of neck pain exhibit greater activation of accessory muscles, (sternocleidomastoid, anterior scalene, and upper trapezius muscles and may also show changed patterns of motor control of other postural muscles as pelvic muscles for reducing activation of painful muscles of neck. Aim of the study: To determine if there is an association between gluteus maximus inhibition and overactivity of upper fibres of trapezius in patients with chronic mechanical neck pain with radiculopathy. Materials and Methods: Forty female patients participated in this study diagnosed as chronic mechanical neck pain with radiculopathy. Amplitude and onset of muscle activation were assessed by using the surface electromyography (EMG during prone hip extension test. Results: The results of this study demonstrated that there is no correlation between the amplitude of EMG activity of right and left gluteus maximus and the amplitude of EMG activity of right and left upper trapezius (P<0.05. Conclusion: It can be concluded that the overactivity of the upper trapezius muscle in patients with chronic mechanical neck pain with radiculopathy is not related to the inhibition of the gluteus maximus muscle during prone hip extension test.

  6. On the mechanism of phosphoenolpyruvate synthetase (PEPs) and its inhibition by sodium fluoride: potential magnesium and aluminum fluoride complexes of phosphoryl transfer.

    Science.gov (United States)

    McCormick, Nicole E; Jakeman, David L

    2015-06-01

    Phosphoenolpyruvate synthase (PEPs) catalyzes the conversion of pyruvate to phosphoenolpyruvate (PEP) using a two-step mechanism invoking a phosphorylated-His intermediate. Formation of PEP is an initial step in gluconeogenesis, and PEPs is essential for growth of Escherichia coli on 3-carbon sources such as pyruvate. The production of PEPs has also been linked to bacterial virulence and antibiotic resistance. As such, PEPs is of interest as a target for antibiotic development, and initial investigations of PEPs have indicated inhibition by sodium fluoride. Similar inhibition has been observed in a variety of phospho-transfer enzymes through the formation of metal fluoride complexes within the active site. Herein we quantify the inhibitory capacity of sodium fluoride through a coupled spectrophotometric assay. The observed inhibition provides indirect evidence for the formation of a MgF3(-) complex within the enzyme active site and insight into the phospho-transfer mechanism of PEPs. The effect of AlCl3 on PEPs enzyme activity was also assessed and found to decrease substrate binding and turnover.

  7. High-resolution bacterial growth inhibition profiling combined with HPLC-HRMS-SPE-NMR for identification of antibacterial constituents in Chinese plants used to treat snakebites

    DEFF Research Database (Denmark)

    Liu, Yueqiu; Nielsen, Mia; Stærk, Dan

    2014-01-01

    of five compounds were elucidated by HPLC–HRMS–SPE–NMR. Results Crude extracts of Boehmeria nivea, Colocasia esculenta, Fagopyrum cymosum, Glochidion puberum, Melastoma dodecandrum, Polygonum bistorta, Polygonum cuspidatum and Sanguisorba officinalis showed MIC values below 200 μg/mL against either...... contain compounds with bacterial growth inhibition. Materials and methods The water and ethanol extracts of 88 plant species were screened at 200 μg/mL against Bacillus subtilis, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa for their antibacterial activity by micro-broth dilution...... assay. The most active extracts were fractionated into microplates using analytical-scale RP-HPLC, and subsequently growth inhibition was assessed for each well. The biochromatograms constructed from these assays were used to identify compounds responsible for antibacterial activity. The structures...

  8. Activation of PAK by a bacterial type III effector EspG reveals alternative mechanisms of GTPase pathway regulation.

    Science.gov (United States)

    Selyunin, Andrey S; Alto, Neal M

    2011-07-01

    Small Rho GTPases regulate a diverse range of cellular behavior within a cell. Their ability to function as molecular switches in response to a bound nucleotide state allows them to regulate multiple dynamic processes, including cytoskeleton organization and cellular adhesion. Because the activation of downstream Rho GTPase signaling pathways relies on conserved structural features of target effector proteins (i.e., CRIB domain), these pathways are particularly vulnerable to microbial pathogenic attack. Here, we discuss new findings for how the bacterial virulence factor EspG from EHEC O157:H7 exploits a CRIB-independent activation mechanism of the Rho GTPase effector PAK. We also compare this mechanism to that of EHEC EspFU, a bacterial virulence factor that directly activates N-WASP. While both virulence factors break the inhibitory interaction between the autoinhibitory and activity-bearing domains of PAK or WASP, the underlying mechanics are very distinct from endogenous Cdc42/Rac GTPase regulation. The ability of bacterial proteins to identify novel regulatory principles of host signaling enzymes highlights the multi-level nature of protein activation, and makes them effective tools to study mammalian Rho GTPase signaling pathways.

  9. Investigation of a potential mechanism for the inhibition of SmTGR by Auranofin and its implications for Plasmodium falciparum inhibition

    KAUST Repository

    Caroli, Antonia

    2012-01-01

    Schistosoma mansoni and Plasmodium falciparum are pathogen parasites that spend part of their lives in the blood stream of the human host and are therefore heavily exposed to fluxes of toxic reactive oxygen species (ROS). SmTGR, an essential enzyme of the S. mansoni ROS detoxification machinery, is known to be inhibited by Auranofin although the inhibition mechanism has not been completely clarified. Auranofin also kills P. falciparum, even if its molecular targets are unknown. Here, we used computational and docking techniques to investigate the molecular mechanism of interaction between SmTGR and Auranofin. Furthermore, we took advantage of the homology relationship and of docking studies to assess if PfTR, the SmTGR malaria parasite homologue, can be a putative target for Auranofin. Our findings support a recently hypothesized molecular mechanism of inhibition for SmTGR and suggest that PfTR is indeed a possible and attractive drug target in P. falciparum. © 2011 Elsevier Inc.

  10. Calcium ion involvement in growth inhibition of mechanically stressed soybean (Glycine max) seedlings

    Science.gov (United States)

    Jones, R. S.; Mitchell, C. A.

    1989-01-01

    A 40-50% reduction in soybean [Glycine max (L.) Merr. cv. Century 84] hypocotyl elongation occurred 24 h after application of mechanical stress. Exogenous Ca2+ at 10 mM inhibited growth by 28% if applied with the Ca2+ ionophore A23187 to the zone of maximum hypocotyl elongation. La3+ was even more inhibitory than Ca2+, especially above 5 mM. Treatment with ethyleneglycol-bis-(beta-aminoethylether)-N, N, N', N'-tetraacetic acid (EGTA) alone had no effect on growth of non-stressed seedlings at the concentrations used but negated stress-induced growth reduction by 36% at 4 mM when compared to non-treated, stressed controls. Treatment with EDTA was ineffective in negating stress-induced growth inhibition. Calmodulin antagonists calmidazolium, chlorpromazine, and 48/80 also negated stress-induced growth reduction by 23, 50, and 35%, respectively.

  11. Bacterial Proteasomes.

    Science.gov (United States)

    Jastrab, Jordan B; Darwin, K Heran

    2015-01-01

    Interest in bacterial proteasomes was sparked by the discovery that proteasomal degradation is required for the pathogenesis of Mycobacterium tuberculosis, one of the world's deadliest pathogens. Although bacterial proteasomes are structurally similar to their eukaryotic and archaeal homologs, there are key differences in their mechanisms of assembly, activation, and substrate targeting for degradation. In this article, we compare and contrast bacterial proteasomes with their archaeal and eukaryotic counterparts, and we discuss recent advances in our understanding of how bacterial proteasomes function to influence microbial physiology.

  12. Receptors That Inhibit Macrophage Activation: Mechanisms and Signals of Regulation and Tolerance

    Directory of Open Access Journals (Sweden)

    Ranferi Ocaña-Guzman

    2018-01-01

    Full Text Available A variety of receptors perform the function of attenuating or inhibiting activation of cells in which they are expressed. Examples of these kinds of receptors include TIM-3 and PD-1, among others that have been widely studied in cells of lymphoid origin and, though to a lesser degree, in other cell lines. Today, several studies describe the function of these molecules as part of the diverse mechanisms of immune tolerance that exist in the immune system. This review analyzes the function of some of these proteins in monocytes and macrophages and as well as their participation as inhibitory molecules or elements of immunological tolerance that also act in innate defense mechanisms. We chose the receptors TIM-3, PD-1, CD32b, and CD200R because these molecules have distinct functional characteristics that provide examples of the different regulating mechanisms in monocytes and macrophages.

  13. Catalytic mechanism and inhibition of tRNA (Uracil-5-)methyltransferase: evidence for covalent catalysis

    International Nuclear Information System (INIS)

    Santi, D.V.; Hardy, L.W.

    1987-01-01

    tRNA (Ura-5-) methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine (AdoMet) to the 5-carbon of a specific Urd residue in tRNA. This results in stoichiometric release of tritium from [5- 3 H] Urd-labeled substrate tRNA isolated from methyltransferase-deficient Escherichia coli. The enzyme also catalyzes an AdoMet-independent exchange reaction between [5- 3 H]-Urd-labeled substrate tRNA and protons of water at a rate that is about 1% that of the normal methylation reaction, but with identical stoichiometry. S-Adenosylhomocysteine inhibits the rate of the exchange reaction by 2-3-fold, whereas an analog having the sulfur of AdoMet replaced by nitrogen accelerates the exchange reaction 9-fold. In the presence (but not absence) of AdoMet, 5-fluorouracil-substituted tRNA (FUra-tRNA) leads to the first-order inactivation of the enzyme. This is accompanied by the formation of a stable covalent complex containing the enzyme, FUra-tRNA, and the methyl group AdoMet. A mechanism for catalysis is proposed that explains both the 5-H exchange reaction and the inhibition by FUra-tRNA: the enzyme forms a covalent Michael adduct with substrate or inhibitor tRNA by attack of a nucleophilic group of the enzyme at carbon 6 of the pyrimidine residue to be modified. As a result, an anion equivalent is generated at carbon 5 that is sufficiently reactive to be methylated by AdoMet. Preliminary experiments and precedents suggest that the nucleophilic catalyst of the enzyme is a thiol group of cysteine. The potent irreversible inhibition by FUra-tRNA suggest that a mechanism for the RNA effects of FUra may also involve irreversible inhibition of RNA-modifying enzymes

  14. [Advances in molecular mechanisms of bacterial resistance caused by stress-induced transfer of resistance genes--a review].

    Science.gov (United States)

    Sun, Dongchang; Wang, Bing; Zhu, Lihong

    2013-07-04

    The transfer of resistance gene is one of the most important causes of bacterial resistance. Recent studies reveal that stresses induce the transfer of antibiotic resistance gene through multiple mechanisms. DNA damage stresses trigger bacterial SOS response and induce the transfer of resistance gene mediated by conjugative DNA. Antibiotic stresses induce natural bacterial competence for transformation in some bacteria which lack the SOS system. In addition, our latest studies show that the general stress response regulator RpoS regulates a novel type of resistance gene transfer which is mediated by double-stranded plasmid DNA and occurs exclusively on the solid surface. In this review, we summarized recent advances in SOS dependent and independent stress-induced DNA transfer which is mediated by conjugation and transformation respectively, and the transfer of double-stranded plasmid DNA on the solid surface which is regulated by RpoS. We propose that future work should address how stresses activate the key regulators and how these regulators control the expression of gene transfer related genes. Answers to the above questions would pave the way for searching for candidate targets for controlling bacterial resistance resulted from the transfer of antibiotic genes.

  15. GTP analogue inhibits polymerization and GTPase activity of the bacterial protein FtsZ without affecting its eukaryotic homologue tubulin

    NARCIS (Netherlands)

    Läppchen, Tilman; Hartog, Aloysius F.; Pinas, Victorine A.; Koomen, Gerrit-Jan; den Blaauwen, Tanneke

    2005-01-01

    The prokaryotic tubulin homologue FtsZ plays a key role in bacterial cell division. Selective inhibitors of the GTP-dependent polymerization of FtsZ are expected to result in a new class of antibacterial agents. One of the challenges is to identify compounds which do not affect the function of

  16. GTP analogue inhibits polymerization and GTPase activity of the bacterial protein FtsZ without affecting its eukaryotic homologue tubulin.

    NARCIS (Netherlands)

    Läppchen, T.; Hartog, A.F.; Pinas, V.; Koomen, G.J.; den Blaauwen, T.

    2005-01-01

    The prokaryotic tubulin homologue FtsZ plays a key role in bacterial cell division. Selective inhibitors of the GTP-dependent polymerization of FtsZ are expected to result in a new class of antibacterial agents. One of the challenges is to identify compounds which do not affect the function of

  17. Intelligent Textiles with Comfort Regulation and Inhibition of Bacterial Adhesion Realized by Cross-Linking Poly(n-isopropylacrylamide-co-ethylene glycol methacrylate) to Cotton Fabrics.

    Science.gov (United States)

    Wang, Jiping; Chen, Yangyi; An, Jie; Xu, Ke; Chen, Tao; Müller-Buschbaum, Peter; Zhong, Qi

    2017-04-19

    Comfort regulation and inhibition of bacterial adhesion to textiles is realized by cross-linking thermoresponsive random copolymer to the cotton fabrics. By introduction of ethylene glycol methacrylate (EGMA) monomers into n-isopropylacrylamide (NIPAM) with a molar ratio of 2:18, the obtained random copolymer poly(n-isopropylacrylamide-co-ethylene glycol methacrylate), abbreviated as P(NIPAM-co-EGMA), presents a transition temperature (TT) of 40 °C in an aqueous solution with a concentration of 1 mg/mL. Because of the additional EGMA in the copolymer, the obtained P(NIPAM-co-EGMA) shows a glass transition temperature (T g ) of 0 °C, which is much lower than that of pure PNIPAM (T g = 140 °C). Therefore, the introduction of P(NIPAM-co-EGMA) into the cotton fabrics will have little influence on the softness of the fabrics. Due to the cross-linked P(NIPAM-co-EGMA) layer on the cotton fabrics, the porosity of the polymer layer can be adjusted by varying the external temperature below or above TT, showing that regulation of the air and moisture permeability as well as the body comfort are feasible in the cotton fabrics cross-linked with P(NIPAM-co-EGMA). In addition, the cross-linked P(NIPAM-co-EGMA) layer is capable of absorbing moisture in the ambient atmosphere to form a hydrated layer on top, which can inhibit bacterial adhesion to the textiles.

  18. Infection of Tribolium castaneum with Bacillus thuringiensis: Quantification of Bacterial Replication within Cadavers, Transmission via Cannibalism, and Inhibition of Spore Germination

    Science.gov (United States)

    Milutinović, Barbara; Höfling, Christina; Futo, Momir; Scharsack, Jörn P.

    2015-01-01

    Reproduction within a host and transmission to the next host are crucial for the virulence and fitness of pathogens. Nevertheless, basic knowledge about such parameters is often missing from the literature, even for well-studied bacteria, such as Bacillus thuringiensis, an endospore-forming insect pathogen, which infects its hosts via the oral route. To characterize bacterial replication success, we made use of an experimental oral infection system for the red flour beetle Tribolium castaneum and developed a flow cytometric assay for the quantification of both spore ingestion by the individual beetle larvae and the resulting spore load after bacterial replication and resporulation within cadavers. On average, spore numbers increased 460-fold, showing that Bacillus thuringiensis grows and replicates successfully in insect cadavers. By inoculating cadaver-derived spores and spores from bacterial stock cultures into nutrient medium, we next investigated outgrowth characteristics of vegetative cells and found that cadaver-derived bacteria showed reduced growth compared to bacteria from the stock cultures. Interestingly, this reduced growth was a consequence of inhibited spore germination, probably originating from the host and resulting in reduced host mortality in subsequent infections by cadaver-derived spores. Nevertheless, we further showed that Bacillus thuringiensis transmission was possible via larval cannibalism when no other food was offered. These results contribute to our understanding of the ecology of Bacillus thuringiensis as an insect pathogen. PMID:26386058

  19. Polysaccharide-capped silver Nanoparticles inhibit biofilm formation and eliminate multi-drug-resistant bacteria by disrupting bacterial cytoskeleton with reduced cytotoxicity towards mammalian cells

    Science.gov (United States)

    Sanyasi, Sridhar; Majhi, Rakesh Kumar; Kumar, Satish; Mishra, Mitali; Ghosh, Arnab; Suar, Mrutyunjay; Satyam, Parlapalli Venkata; Mohapatra, Harapriya; Goswami, Chandan; Goswami, Luna

    2016-04-01

    Development of effective anti-microbial therapeutics has been hindered by the emergence of bacterial strains with multi-drug resistance and biofilm formation capabilities. In this article, we report an efficient green synthesis of silver nanoparticle (AgNP) by in situ reduction and capping with a semi-synthetic polysaccharide-based biopolymer (carboxymethyl tamarind polysaccharide). The CMT-capped AgNPs were characterized by UV, DLS, FE-SEM, EDX and HR-TEM. These AgNPs have average particle size of ~20-40 nm, and show long time stability, indicated by their unchanged SPR and Zeta-potential values. These AgNPs inhibit growth and biofilm formation of both Gram positive (B. subtilis) and Gram negative (E. coli and Salmonella typhimurium) bacterial strains even at concentrations much lower than the minimum inhibitory concentration (MIC) breakpoints of antibiotics, but show reduced or no cytotoxicity against mammalian cells. These AgNPs alter expression and positioning of bacterial cytoskeletal proteins FtsZ and FtsA. CMT-capped AgNPs can effectively block growth of several clinical isolates and MDR strains representing different genera and resistant towards multiple antibiotics belonging to different classes. We propose that the CMT-capped AgNPs can have potential bio-medical application against multi-drug-resistant microbes with minimal cytotoxicity towards mammalian cells.

  20. Infection of Tribolium castaneum with Bacillus thuringiensis: quantification of bacterial replication within cadavers, transmission via cannibalism, and inhibition of spore germination.

    Science.gov (United States)

    Milutinović, Barbara; Höfling, Christina; Futo, Momir; Scharsack, Jörn P; Kurtz, Joachim

    2015-12-01

    Reproduction within a host and transmission to the next host are crucial for the virulence and fitness of pathogens. Nevertheless, basic knowledge about such parameters is often missing from the literature, even for well-studied bacteria, such as Bacillus thuringiensis, an endospore-forming insect pathogen, which infects its hosts via the oral route. To characterize bacterial replication success, we made use of an experimental oral infection system for the red flour beetle Tribolium castaneum and developed a flow cytometric assay for the quantification of both spore ingestion by the individual beetle larvae and the resulting spore load after bacterial replication and resporulation within cadavers. On average, spore numbers increased 460-fold, showing that Bacillus thuringiensis grows and replicates successfully in insect cadavers. By inoculating cadaver-derived spores and spores from bacterial stock cultures into nutrient medium, we next investigated outgrowth characteristics of vegetative cells and found that cadaver-derived bacteria showed reduced growth compared to bacteria from the stock cultures. Interestingly, this reduced growth was a consequence of inhibited spore germination, probably originating from the host and resulting in reduced host mortality in subsequent infections by cadaver-derived spores. Nevertheless, we further showed that Bacillus thuringiensis transmission was possible via larval cannibalism when no other food was offered. These results contribute to our understanding of the ecology of Bacillus thuringiensis as an insect pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Effects of mechanical and bacterial stressors on cytokine and growth-factor expression in periodontal ligament cells.

    Science.gov (United States)

    Proff, P; Reicheneder, C; Faltermeier, A; Kubein-Meesenburg, D; Römer, P

    2014-05-01

    The goal of the study was to examine the effects of a mechanical (orthodontic force simulation by static compressive loading) and a bacterial (endotoxins from a heat-inactivated gram-negative periodontal pathogen) stressor on the expression patterns of factors that are key to regulating osteoclastogenesis and bone remodeling. Three experimental groups were formed with fifth-passage periodontal ligament (PDL) fibroblasts treated by the static application of compressive force (2 g/cm(2)), heat-inactivated aggregatibacter actinomycetemcomitans (1 × 10(7) cells), or both of these stressors combined. Real-time polymerase chain reaction (RT-PCR) was used to study gene expression of IL-6, IL-8, COX-2, IGF-1, VEGF, and MMP-13 in the 3 groups. Protein levels of COX-2, prostaglandin E2 (PGE(2)), and IL-8 production were quantified using immunoblotting and enzyme-linked immunosorbent assay (ELISA). The mechanical stressor upregulated the genes of COX-2, IL-8, IGF-1, and MMP-13 in PDL fibroblasts and the bacterial stressor upregulated IL-6, IL-8, COX-2 and MMP-13. Both stressors in combination upregulated VEGF and caused COX-2 gene expression to increase further; the latter effect was also detected at the protein level and indirectly via the enhanced production of PGE(2). We noted that the posttranscriptional regulation of IL-8 was induced by the mechanical stressor and influenced by PGE(2). While mechanical-stressor application increased the gene expression of COX-2, IL-8, and VEGF in the presence of the bacterial stressor, IL-8 production was posttranscriptionally regulated by the mechanical stressor, whereas COX-2 expression correlated with enhanced production of the inflammatory tissue hormone PGE(2), which exerted a suppressive effect on endotoxin-induced IL-8 production.

  2. Bacterial infections in Wegener's granulomatosis : mechanisms potentially involved in autoimmune pathogenesis

    NARCIS (Netherlands)

    Tadema, Henko; Heeringa, Peter; Kallenberg, Cees G. M.

    Purpose of review Wegener's granulomatosis is associated with bacterial infection, in particular nasal carriage of Staphylococcus aureus. Infection may play a role in the induction of autoimmunity as well as in the effector phase of the disease. Here, the current hypotheses aiming to explain the

  3. Melnikov method to a bacteria-immunity model with bacterial quorum sensing mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Zhonghua [School of Sciences, Xi' an University of Science and Technology, Xi' an 710054 (China)], E-mail: wwwzhonghua@sohu.com; Peng Jigen [Research Center for Applied Mathematics, Xi' an Jiaotong University, Xi' an 710049 (China); Zhang Juan [Department of Mathematics, North China Electric Power University, Beijing 102206 (China)

    2009-04-15

    A bacteria-immunity model with bacterial quorum sensing is formulated, which describes the competition between bacteria and immune cells. After periodic perturbation and a series of coordinate transformations, the model is brought into a standard form, and which is amenable to Melnikov method. By the method, the existences of chaotic motion and homoclinic bifurcations are proved.

  4. Experimental Induction of Bacterial Resistance to the Antimicrobial Peptide Tachyplesin I and Investigation of the Resistance Mechanisms.

    Science.gov (United States)

    Hong, Jun; Hu, Jianye; Ke, Fei

    2016-10-01

    Tachyplesin I is a 17-amino-acid cationic antimicrobial peptide (AMP) with a typical cyclic antiparallel β-sheet structure that is a promising therapeutic for infections, tumors, and viruses. To date, no bacterial resistance to tachyplesin I has been reported. To explore the safety of tachyplesin I as an antibacterial drug for wide clinical application, we experimentally induced bacterial resistance to tachyplesin I by using two selection procedures and studied the preliminary resistance mechanisms. Aeromonas hydrophila XS91-4-1, Pseudomonas aeruginosa CGMCC1.2620, and Escherichia coli ATCC 25922 and F41 showed resistance to tachyplesin I under long-term selection pressure with continuously increasing concentrations of tachyplesin I. In addition, P. aeruginosa and E. coli exhibited resistance to tachyplesin I under UV mutagenesis selection conditions. Cell growth and colony morphology were slightly different between control strains and strains with induced resistance. Cross-resistance to tachyplesin I and antimicrobial agents (cefoperazone and amikacin) or other AMPs (pexiganan, tachyplesin III, and polyphemusin I) was observed in some resistant mutants. Previous studies showed that extracellular protease-mediated degradation of AMPs induced bacterial resistance to AMPs. Our results indicated that the resistance mechanism of P. aeruginosa was not entirely dependent on extracellular proteolytic degradation of tachyplesin I; however, tachyplesin I could induce increased proteolytic activity in P. aeruginosa Most importantly, our findings raise serious concerns about the long-term risks associated with the development and clinical use of tachyplesin I. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Mechanisms of HIV-1 Nucleocapsid Protein Inhibition by Lysyl-Peptidyl-Anthraquinone Conjugates.

    Science.gov (United States)

    Sosic, Alice; Sinigaglia, Laura; Cappellini, Marta; Carli, Ilaria; Parolin, Cristina; Zagotto, Giuseppe; Sabatino, Giuseppina; Rovero, Paolo; Fabris, Dan; Gatto, Barbara

    2016-01-20

    The Nucleocapsid protein NCp7 (NC) is a nucleic acid chaperone responsible for essential steps of the HIV-1 life cycle and an attractive candidate for drug development. NC destabilizes nucleic acid structures and promotes the formation of annealed substrates for HIV-1 reverse transcription elongation. Short helical nucleic acid segments bordered by bulges and loops, such as the Trans-Activation Response element (TAR) of HIV-1 and its complementary sequence (cTAR), are nucleation elements for helix destabilization by NC and also preferred recognition sites for threading intercalators. Inspired by these observations, we have recently demonstrated that 2,6-disubstituted peptidyl-anthraquinone-conjugates inhibit the chaperone activities of recombinant NC in vitro, and that inhibition correlates with the stabilization of TAR and cTAR stem-loop structures. We describe here enhanced NC inhibitory activity by novel conjugates that exhibit longer peptidyl chains ending with a conserved N-terminal lysine. Their efficient inhibition of TAR/cTAR annealing mediated by NC originates from the combination of at least three different mechanisms, namely, their stabilizing effects on nucleic acids dynamics by threading intercalation, their ability to target TAR RNA substrate leading to a direct competition with the protein for the same binding sites on TAR, and, finally, their effective binding to the NC protein. Our results suggest that these molecules may represent the stepping-stone for the future development of NC-inhibitors capable of targeting the protein itself and its recognition site in RNA.

  6. Oxime-induced reactivation of sarin-inhibited AChE: a theoretical mechanisms study.

    Science.gov (United States)

    Wang, Jing; Gu, Jiande; Leszczynski, Jerzy; Feliks, Mikolaj; Sokalski, W Andrzej

    2007-03-08

    Oximes (especially oximate anions) are used as potential reactivators of OP-inhibited AChE due to their unique alpha-effect nucleophilic reactivity. In the present study, by applying the DFT approach at the B3LYP/6-311G(d,p) level and the Møller-Plesset perturbation theory at the MP2/6-311G(d,p) level, the formoximate-induced reactivation patterns of the sarin-AChE adduct and the corresponding reaction mechanism have been investigated. The potential energy surface along the pathway of the reactivation reaction of sarin-inhibited AChE by oxime reveals that the reaction can occur quickly due to the relatively low energy barriers. A two-step process is a major pathway proposed for the studied reactivation reaction. Through the nucleophilic attack, the oximate first binds to the sarin-AChE adduct to form a relatively stable phosphorus complex. The regeneration of the serine takes place subsequently through an elimination step, which is expected to be competitive with the nucleophilic attacking process. The polarizable continuum model (PCM) has been applied to evaluate the solvate effects on the pathway. It is concluded that the reaction energy barriers are also low enough for the reaction to easily occur in solvent. The results derived from both the gas-phase model and the aqueous solvation model suggest that the studied oximate anion is an efficient antidote reagent for sarin-inhibited AChE.

  7. The Nuclear Receptor LXR Limits Bacterial Infection of Host Macrophages through a Mechanism that Impacts Cellular NAD Metabolism

    Directory of Open Access Journals (Sweden)

    Jonathan Matalonga

    2017-01-01

    Full Text Available Macrophages exert potent effector functions against invading microorganisms but constitute, paradoxically, a preferential niche for many bacterial strains to replicate. Using a model of infection by Salmonella Typhimurium, we have identified a molecular mechanism regulated by the nuclear receptor LXR that limits infection of host macrophages through transcriptional activation of the multifunctional enzyme CD38. LXR agonists reduced the intracellular levels of NAD+ in a CD38-dependent manner, counteracting pathogen-induced changes in macrophage morphology and the distribution of the F-actin cytoskeleton and reducing the capability of non-opsonized Salmonella to infect macrophages. Remarkably, pharmacological treatment with an LXR agonist ameliorated clinical signs associated with Salmonella infection in vivo, and these effects were dependent on CD38 expression in bone-marrow-derived cells. Altogether, this work reveals an unappreciated role for CD38 in bacterial-host cell interaction that can be pharmacologically exploited by activation of the LXR pathway.

  8. A mechanism for the inhibition of neural progenitor cell proliferation by cocaine.

    Directory of Open Access Journals (Sweden)

    Chun-Ting Lee

    2008-06-01

    Full Text Available BACKGROUND: Prenatal exposure of the developing brain to cocaine causes morphological and behavioral abnormalities. Recent studies indicate that cocaine-induced proliferation inhibition and/or apoptosis in neural progenitor cells may play a pivotal role in causing these abnormalities. To understand the molecular mechanism through which cocaine inhibits cell proliferation in neural progenitors, we sought to identify the molecules that are responsible for mediating the effect of cocaine on cell cycle regulation. METHODS AND FINDINGS: Microarray analysis followed by quantitative real-time reverse transcription PCR was used to screen cocaine-responsive and cell cycle-related genes in a neural progenitor cell line where cocaine exposure caused a robust anti-proliferative effect by interfering with the G1-to-S transition. Cyclin A2, among genes related to the G1-to-S cell cycle transition, was most strongly down-regulated by cocaine. Down-regulation of cyclin A was also found in cocaine-treated human primary neural and A2B5+ progenitor cells, as well as in rat fetal brains exposed to cocaine in utero. Reversing cyclin A down-regulation by gene transfer counteracted the proliferation inhibition caused by cocaine. Further, we found that cocaine-induced accumulation of reactive oxygen species, which involves N-oxidation of cocaine via cytochrome P450, promotes cyclin A down-regulation by causing an endoplasmic reticulum (ER stress response, as indicated by increased phosphorylation of eIF2alpha and expression of ATF4. In the developing rat brain, the P450 inhibitor cimetidine counteracted cocaine-induced inhibition of neural progenitor cell proliferation as well as down-regulation of cyclin A. CONCLUSIONS: Our results demonstrate that down-regulation of cyclin A underlies cocaine-induced proliferation inhibition in neural progenitors. The down-regulation of cyclin A is initiated by N-oxidative metabolism of cocaine and consequent ER stress. Inhibition of

  9. Cementogenesis is inhibited under a mechanical static compressive force via Piezo1.

    Science.gov (United States)

    Zhang, Ying-Ying; Huang, Yi-Ping; Zhao, Hua-Xiang; Zhang, Ting; Chen, Feng; Liu, Yan

    2017-07-01

    To investigate whether Piezo1, a mechanotransduction gene mediates the cementogenic activity of cementoblasts under a static mechanical compressive force. Murine cementoblasts (OCCM-30) were exposed to a 2.0 g/cm 2 static compressive force for 3, 6, 12, and 24 hours. Then the expression profile of Piezo1 and the cementogenic activity markers osteoprotegerin (Opg), osteopontin (Opn), osteocalcin (Oc), and protein tyrosine phosphataselike member A (Ptpla) were analyzed. Opg, Opn, Oc, and Ptpla expression was further measured after using siRNA to knock down Piezo1. Real-time PCR, Western blot, and cell proliferation assays were performed according to standard procedures. After mechanical stimulation, cell morphology and proliferation did not change significantly. The expression of Piezo1, Opg, Opn, Oc, and Ptpla was significantly decreased, with a high positive correlation between Opg and Piezo1 expression. After Piezo1 knockdown, the expression of Opg, Opn, Oc, and Ptpla was further decreased under mechanical stimulation. Cementogenic activity was inhibited in OCCM-30 cells under static mechanical force, a process that was partially mediated by the decrease of Piezo1. This study provides a new viewpoint of the pathogenesis mechanism of orthodontically induced root resorption and repair.

  10. Mechanism and site of inhibition of Bacillus cereus spore outgrowth by nitrosothiols

    International Nuclear Information System (INIS)

    Morris, S.L.

    1982-01-01

    Structure vs. activity studies demonstrate that nitrosothiols inhibit outgrowth of B. cereus spores by reversible covalent bond formation with sensitive spore components. Kinetic studies of the binding of nitrosothiols and iodoacetate, a known sulfhydryl reagent, show that they complete for the same spore sites. Since two other nitrite derivatives, the Perigo factor and the transferrin inhibitor, interfere with iodoacetate label uptake in a kinetically similar fashion, all of these compounds may inhibit spore outgrowth by interacting with the same spore thiol groups. Disruption of spores which have been inhibited by radioactive iodoacetate demonstrates that much of the label is incorporated into a membrane-rich fraction that sediments as a single peak on a sucrose density gradient. SDS gel electrophoresis and autofluorography allows the identification of four intensely labelled proteins with molecular weights of 13,000, 28,000, 29,000, and 30,000. If the iodoacetate labelling is carried out in the presence of nitrosothiol, incorporation is greatly reduced into all components. When germinating spores are labelled with succinate or the lactose analog, o-nitrophenylgalactopyranoside, a significant reduction in the amount of label bound is also observed suggesting that two iodoacetate-reactive sites may be the succinate and lactose permease systems. Severe decreases in the transport of succinate and lactose into iodoacetate and nitrosothiol inhibited spores further implicates a nitrosothiol (iodoacetate) permease interaction. Iodoacetate and nitrosothiols therefore may exert their inhibitory effects by interfering with critical membrane protein sulfhydryl groups, possibly by a a covalent modification mechanism. Some of these sensitive thiols may be involved in active transport processes

  11. Antibacterial activity againstStreptococcus mutansand inhibition of bacterial induced enamel demineralization of propolis, miswak, and chitosan nanoparticles based dental varnishes.

    Science.gov (United States)

    Wassel, Mariem O; Khattab, Mona A

    2017-07-01

    Using natural products can be a cost-effective approach for caries prevention especially in low income countries where dental caries is highly prevalent and the resources are limited. Specially prepared dental varnishes containing propolis, miswak, and chitosan nanoparticles (CS-NPs) with or without sodium fluoride (NaF) were assessed for antibacterial effect against Streptococcus mutans ( S. mutans ) using disk diffusion test. In addition, the protective effect of a single pretreatment of primary teeth enamel specimens against in vitro bacterial induced enamel demineralization was assessed for 3 days. All natural products containing varnishes inhibited bacterial growth significantly better than 5% NaF varnish, with NaF loaded CS-NPs (CSF-NPs) showing the highest antibacterial effect, though it didn't significantly differ than those of other varnishes except miswak ethanolic extract (M) varnish. Greater inhibitory effect was noted with varnish containing freeze dried aqueous miswak extract compared to that containing ethanolic miswak extract, possibly due to concentration of antimicrobial substances by freeze drying. Adding natural products to NaF in a dental varnish showed an additive effect especially compared to fluoride containing varnish. 5% NaF varnish showed the best inhibition of demineralization effect. Fluoride containing miswak varnish (MF) and CSF-NPs varnish inhibited demineralization significantly better than all experimental varnishes, especially during the first 2 days, though CSF-NPs varnish had a low fluoride concentration, probably due to better availability of fluoride ions and the smaller size of nanoparticles. Incorporating natural products with fluoride into dental varnishes can be an effective approach for caries prevention, especially miswak and propolis when financial resources are limited.

  12. Antibacterial activity against Streptococcus mutans and inhibition of bacterial induced enamel demineralization of propolis, miswak, and chitosan nanoparticles based dental varnishes

    Directory of Open Access Journals (Sweden)

    Mariem O. Wassel

    2017-07-01

    Full Text Available Using natural products can be a cost-effective approach for caries prevention especially in low income countries where dental caries is highly prevalent and the resources are limited. Specially prepared dental varnishes containing propolis, miswak, and chitosan nanoparticles (CS-NPs with or without sodium fluoride (NaF were assessed for antibacterial effect against Streptococcus mutans (S. mutans using disk diffusion test. In addition, the protective effect of a single pretreatment of primary teeth enamel specimens against in vitro bacterial induced enamel demineralization was assessed for 3 days. All natural products containing varnishes inhibited bacterial growth significantly better than 5% NaF varnish, with NaF loaded CS-NPs (CSF-NPs showing the highest antibacterial effect, though it didn’t significantly differ than those of other varnishes except miswak ethanolic extract (M varnish. Greater inhibitory effect was noted with varnish containing freeze dried aqueous miswak extract compared to that containing ethanolic miswak extract, possibly due to concentration of antimicrobial substances by freeze drying. Adding natural products to NaF in a dental varnish showed an additive effect especially compared to fluoride containing varnish. 5% NaF varnish showed the best inhibition of demineralization effect. Fluoride containing miswak varnish (MF and CSF-NPs varnish inhibited demineralization significantly better than all experimental varnishes, especially during the first 2 days, though CSF-NPs varnish had a low fluoride concentration, probably due to better availability of fluoride ions and the smaller size of nanoparticles. Incorporating natural products with fluoride into dental varnishes can be an effective approach for caries prevention, especially miswak and propolis when financial resources are limited.

  13. Pattern triggered immunity (PTI in tobacco: isolation of activated genes suggests role of the phenylpropanoid pathway in inhibition of bacterial pathogens.

    Directory of Open Access Journals (Sweden)

    Ágnes Szatmári

    Full Text Available BACKGROUND: Pattern Triggered Immunity (PTI or Basal Resistance (BR is a potent, symptomless form of plant resistance. Upon inoculation of a plant with non-pathogens or pathogenicity-mutant bacteria, the induced PTI will prevent bacterial proliferation. Developed PTI is also able to protect the plant from disease or HR (Hypersensitive Response after a challenging infection with pathogenic bacteria. Our aim was to reveal those PTI-related genes of tobacco (Nicotiana tabacum that could possibly play a role in the protection of the plant from disease. METHODOLOGY/PRINCIPAL FINDINGS: Leaves were infiltrated with Pseudomonas syringae pv. syringae hrcC- mutant bacteria to induce PTI, and samples were taken 6 and 48 hours later. Subtraction Suppressive Hybridization (SSH resulted in 156 PTI-activated genes. A cDNA microarray was generated from the SSH clone library. Analysis of hybridization data showed that in the early (6 hpi phase of PTI, among others, genes of peroxidases, signalling elements, heat shock proteins and secondary metabolites were upregulated, while at the late phase (48 hpi the group of proteolysis genes was newly activated. Microarray data were verified by real time RT-PCR analysis. Almost all members of the phenyl-propanoid pathway (PPP possibly leading to lignin biosynthesis were activated. Specific inhibition of cinnamic-acid-4-hydroxylase (C4H, rate limiting enzyme of the PPP, decreased the strength of PTI--as shown by the HR-inhibition and electrolyte leakage tests. Quantification of cinnamate and p-coumarate by thin-layer chromatography (TLC-densitometry supported specific changes in the levels of these metabolites upon elicitation of PTI. CONCLUSIONS/SIGNIFICANCE: We believe to provide first report on PTI-related changes in the levels of these PPP metabolites. Results implicated an actual role of the upregulation of the phenylpropanoid pathway in the inhibition of bacterial pathogenic activity during PTI.

  14. Stat3 inhibition attenuates mechanical allodynia through transcriptional regulation of chemokine expression in spinal astrocytes.

    Directory of Open Access Journals (Sweden)

    Xiaodong Liu

    Full Text Available BACKGROUND: Signal transducer and activator of transcription 3 (Stat3 is known to induce cell proliferation and inflammation by regulating gene transcription. Recent studies showed that Stat3 modulates nociceptive transmission by reducing spinal astrocyte proliferation. However, it is unclear whether Stat3 also contributes to the modulation of nociceptive transmission by regulating inflammatory response in spinal astrocytes. This study aimed at investigating the role of Stat3 on neuroinflammation during development of pain in rats after intrathecal injection of lipopolysaccharide (LPS. METHODS: Stat3 specific siRNA oligo and synthetic selective inhibitor (Stattic were applied to block the activity of Stat3 in primary astrocytes or rat spinal cord, respectively. LPS was used to induce the expression of proinflammatory genes in all studies. Immunofluorescence staining of cells and slices of spinal cord was performed to monitor Stat3 activation. The impact of Stat3 inhibition on proinflammatory genes expression was determined by cytokine antibody array, enzyme-linked immunosorbent assay and real-time polymerase chain reaction. Mechanical allodynia, as determined by the threshold pressure that could induce hind paw withdrawal after application of standardized von Frey filaments, was used to detect the effects of Stat3 inhibition after pain development with intrathecal LPS injection. RESULTS: Intrathecal injection of LPS activated Stat3 in reactive spinal astrocytes. Blockade of Stat3 activity attenuated mechanical allodynia significantly and was correlated with a lower number of reactive astrocytes in the spinal dorsal horn. In vitro study demonstrated that Stat3 modulated inflammatory response in primary astrocytes by transcriptional regulation of chemokine expression including Cx3cl1, Cxcl5, Cxcl10 and Ccl20. Similarly, inhibition of Stat3 reversed the expression of these chemokines in the spinal dorsal horn. CONCLUSIONS: Stat3 acted as a

  15. Inhibition Mechanism of Uranyl Reduction Induced by Calcium-Carbonato Complexes

    Science.gov (United States)

    Jones, M. E.; Bargar, J.; Fendorf, S. E.

    2015-12-01

    Uranium mobility in the subsurface is controlled by the redox state and chemical speciation, generally as minimally soluble U(IV) or soluble U(VI) species. In the presence of even low carbonate concentrations the uranyl-carbonato complex quickly becomes the dominant aqueous species; they are, in fact, the primary aqueous species in most groundwaters. Calcium in groundwater leads to ternary calcium-uranyl-carbonato complexes that limit the rate and extent of U(VI) reduction. This decrease in reduction rate has been attributed to surface processes, thermodynamic limitations, and kinetic factors. Here we present a new mechanism for the inhibition of ferrous iron reduction of uranyl-carbonato species in the presence of calcium. A series of experiments under variable Ca conditions were preformed to determine the role of Ca in the inhibition of U reduction by ferrous iron. Calcium ions in the Ca2UO2(CO3)3 complex sterically prevent the interaction of Fe(II) with U(VI), in turn preventing the Fe(II)-U(VI) distance required for electron transfer. The mechanism described here helps to predict U redox transformations in suboxic environments and clarifies the role of Ca in the fate and mobility of U. Electrochemical measurements further show the decrease of the U(VI) to U(V) redox potential of the uranyl-carbonato complex with decreasing pH suggesting the first electron transfer is critical determining the rate and extent of uranium reduction.

  16. Experimental Study of Bacterial Penetration into Chalk Rock: Mechanisms and Effect on Permeability

    DEFF Research Database (Denmark)

    Halim, Amalia Yunita; Shapiro, Alexander; Eliasson Lantz, Anna

    2014-01-01

    behavior of bacteria is lacking, especially in chalk formations where characteristic pore throat sizes are comparable with the sizes of bacterial cells. In this study, two bacterial strains, Bacillus licheniformis 421 (spore-forming) and Pseudomonas putida K12 (non-spore forming) were used to investigate...... extent. A significantly higher number of B. licheniformis 421 was detected in the effluents as compared to P. putida K12. It was demonstrated that the spore-forming B. licheniformis 421 penetrates in the form of spores. P. putida K12 is found to penetrate the core, however, in smaller numbers compared...... to B. licheniformis. It was shown that both bacteria, under different injection concentrations, were capable of plugging the porous rock, as indicated by reduction of the core permeability. An incubation period of 12 days did not allow the permeability to return to initial condition. Based...

  17. Targeting bacterial membrane function: an underexploited mechanism for treating persistent infections

    OpenAIRE

    Hurdle, Julian G.; O’Neill, Alex J.; Chopra, Ian; Lee, Richard E.

    2011-01-01

    Persistent infections involving slow-growing or non-growing bacteria are hard to treat with antibiotics that target biosynthetic processes in growing cells. Consequently, there is a need for antimicrobials that can treat infections containing dormant bacteria. In this Review, we discuss the emerging concept that disrupting the bacterial membrane bilayer or proteins that are integral to membrane function (including membrane potential and energy metabolism) in dormant bacteria is a strategy for...

  18. Nephroprotective mechanism(s) of pentoxifylline. Reduction of erythrocyte-mediated vascular congestion and inhibition of nitric oxide release

    Energy Technology Data Exchange (ETDEWEB)

    Vadiei, K. [Wyeth Lab., Inc., Philadelphia, PA (United States); Tucker, S.D. [Argus Pharmaceuticals, The Woodlands, TX (United States); Lopez-Berestein, G. [The Univ. of Texas, M.D. Anderson Cancer Center, Dept. of Clinical Investigations, Houston, TX (United States); Wasan, K.M. [The Univ. of British Columbia, Faculty of Pharmaceutical Sciences, Div. of Pharmaceutics and Biopharmaceutics, Vancouver, B.C. (Canada)

    1996-03-01

    The study attempted to evaluate pentoxifylline`s mechanism(s) of action in the prevention of acute renal failure by examining its vascular decongestant activity in a rat model for acute renal failure and inhibitory activity of nitric oxide release from activated macrophage-like (RAW 264.7 cells) and murine mammary adenocarcinoma (EMT-6 cells) cell lines. Radiolabeled chromium-erythrocytes were injected intravenously into all rats. In a set of experiments the nitrite synthesis and percent cytotoxicity of pentoxifylline- and dexamethasone-treated cells were determined. Pentoxifylline at concentrations of 4 mM and 8 mM significantly decreased nitrite synthesis in RAW 264.7 cells, and at pentoxifylline concentrations of 2 mM, 4 mM, and 8 mM in EMT-6 cells compared to untreated cells. Dexamethasone at a concentration of 1 {mu}M decreased nitrite synthesis in RAW 264.7 and EMT-6 cells compared to untreated cells. Pentoxifylline at concentrations of 0.5 mM through 8 mM significantly decreased cytotoxicity in RAW 264.7 and EMT-6 cells compared to untreated cells. Dexamethasone at a concentration of 1 {mu}M decreased cytotoxicity in RAW 264.7 and EMT-6 cells compared to untreated cells. These finding suggest that pentoxifylline`s ability to prevent acute renal failure may be a consequence of reduced vascular congestion and inhibition of nitric oxide release from activated macrophages. (au) 40 refs.

  19. Mechanisms of Host-Pathogen Protein Complex Formation and Bacterial Immune Evasion of Streptococcus suis Protein Fhb.

    Science.gov (United States)

    Li, Xueqin; Liu, Peng; Gan, Shuzhen; Zhang, Chunmao; Zheng, Yuling; Jiang, Yongqiang; Yuan, Yuan

    2016-08-12

    Streptococcus suis serotype 2 (S. suis 2)-induced sepsis and meningitis are often accompanied by bacteremia. The evasion of polymorphonuclear leukocyte-mediated phagocytic clearance is central to the establishment of bacteremia caused by S. suis 2 and is facilitated by the ability of factor H (FH)-binding protein (Fhb) to bind FH on the bacterial surface, thereby impeding alternative pathway complement activation and phagocytic clearance. Here, C3b/C3d was found to bind to Fhb, along with FH, forming a large immune complex. The formation of this immune complex was mediated by domain II of Fhb via electrostatic and hydrophobic interactions, which, to our knowledge, is a new type of interaction. Interestingly, Fhb was found to be associated with the cell envelope and also present in the culture supernatant, where secreted Fhb inhibited complement activation via interactions with domain II, thereby enhancing antiphagocytic clearance by polymorphonuclear leukocytes. Thus, Fhb is a multifunctional bacterial protein, which binds host complement component C3 as well as FH and interferes with innate immune recognition in a secret protein manner. S. suis 2 therefore appears to have developed a new strategy to combat host innate immunity and enhance survival in host blood. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Mechanisms of Host-Pathogen Protein Complex Formation and Bacterial Immune Evasion of Streptococcus suis Protein Fhb*

    Science.gov (United States)

    Li, Xueqin; Liu, Peng; Gan, Shuzhen; Zhang, Chunmao; Zheng, Yuling; Jiang, Yongqiang; Yuan, Yuan

    2016-01-01

    Streptococcus suis serotype 2 (S. suis 2)-induced sepsis and meningitis are often accompanied by bacteremia. The evasion of polymorphonuclear leukocyte-mediated phagocytic clearance is central to the establishment of bacteremia caused by S. suis 2 and is facilitated by the ability of factor H (FH)-binding protein (Fhb) to bind FH on the bacterial surface, thereby impeding alternative pathway complement activation and phagocytic clearance. Here, C3b/C3d was found to bind to Fhb, along with FH, forming a large immune complex. The formation of this immune complex was mediated by domain II of Fhb via electrostatic and hydrophobic interactions, which, to our knowledge, is a new type of interaction. Interestingly, Fhb was found to be associated with the cell envelope and also present in the culture supernatant, where secreted Fhb inhibited complement activation via interactions with domain II, thereby enhancing antiphagocytic clearance by polymorphonuclear leukocytes. Thus, Fhb is a multifunctional bacterial protein, which binds host complement component C3 as well as FH and interferes with innate immune recognition in a secret protein manner. S. suis 2 therefore appears to have developed a new strategy to combat host innate immunity and enhance survival in host blood. PMID:27342778

  1. Organomineral interactions as an important mechanism for stabilisation of bacterial residues in soil

    Science.gov (United States)

    Miltner, Anja; Achtenhagen, Jan; Kästner, Matthias

    2017-04-01

    Although plant material is the original input of organic matter to soils, microbial residues have been identified to contribute to a large extent to soil organic matter. However, until now it is unclear how microbial residues are stabilised in soil and protected from degradation. We hypothesised that organomineral interactions, in particular encrustation by oxides, may play an important role, which might vary depending on environmental conditions, e.g. redox potential. Therefore we produced 14C-labelled Escherichia coli cells and cell envelope fragments and coprecipitated these materials with Fe oxide or Al oxide. Mineral-free (control) and mineral-encrusted bacterial residues were incubated for 345 days at 20˚ C under either oxic or oxygen-limited conditions, and mineralisation was quantified by scintillation counting of the CO2 produced during incubation. Oxygen limitation was achieved by first exchanging the atmosphere in the incubation vessels with dinitrogen gas. After 100 days of incubation, the anoxic treatments were waterlogged to further decrease the redox potential, and after 290 days, glucose and nutrients were supplied to all treatments in order to foster microbial activity and consumption of electron acceptors. The mineralisation curves were fitted by double-exponential (0-100 days), first-order kinetic (100-290 days) and linear (290-345 days) models. The model parameters were tested for significant differences between the treatments by three-way ANOVA with post-hoc Bonferroni t-test. We found that encrustation by the oxides significantly reduced mineralisation of the bacterial residues. This effect was inversed by reductive dissolution of Fe oxides after substrate and nutrient addition to the oxygen-limited treatments, suggesting a significant role of the encrustation in stabilisation of the bacterial residues. We also observed that bacterial cell envelope fragments were generally slightly more resistant to mineralisation than whole cells. The

  2. NSAIDS inhibit in vitro MSC chondrogenesis but not osteogenesis: implications for mechanism of bone formation inhibition in man.

    Science.gov (United States)

    Pountos, Ippokratis; Giannoudis, Peter V; Jones, Elena; English, Anne; Churchman, Sarah; Field, Sarah; Ponchel, Frederique; Bird, Howard; Emery, Paul; McGonagle, Dennis

    2011-03-01

    The non-steroidal anti-inflammatory drugs (NSAIDs) are widely used for analgesia but may inhibit bone formation. We investigated whether the reported NSAID effect on bone is related to inhibition of bone marrow mesenchymal stem cell (MSC) proliferation and osteogenic and chondrogenic differentiation and evaluated both cyclooxygenase (COX)-1 and COX-2 specific drugs. The effects of seven COX-1 and COX-2 inhibitors on MSC proliferation and osteogenic and chondrogenic differentiation were tested using Vybrant, sodium 3'-[1-(phenylaminocarbonyl)- 3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate (XTT), functional and quantitative assays of MSC differentiation. The MSC expression of COX-1 and COX-2 and prostaglandin E2 (PGE-2) levels were evaluated serially during lineage differentiation by quantitative PCR and ELISA. None of the NSAIDs at broad range of concentration (range 10(-3) to 100 μg/ml) significantly affected MSC proliferation. Surprisingly, MSC osteogenic differentiation inhibition was not evident. However, NSAIDs affected chondrogenic potential with a reduction in sulphated glycosaminoglycans (sGAG) content by 45% and 55% with diclofenac and ketorolac, respectively (P NSAIDs may inhibit bone formation via blockage of MSC chondrogenic differentiation which is an important intermediate phase in normal endochondral bone formation. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  3. Alleviating Bone Cancer-induced Mechanical Hypersensitivity by Inhibiting Neuronal Activity in the Anterior Cingulate Cortex.

    Science.gov (United States)

    Chiou, Chiuan-Shiou; Chen, Chien-Chung; Tsai, Tsung-Chih; Huang, Chiung-Chun; Chou, Dylan; Hsu, Kuei-Sen

    2016-10-01

    The anterior cingulate cortex (ACC) is a brain region that has been critically implicated in the processing of pain perception and modulation. While much evidence has pointed to an increased activity of the ACC under chronic pain states, less is known about whether pain can be alleviated by inhibiting ACC neuronal activity. The authors used pharmacologic, chemogenetic, and optogenetic approaches in concert with viral tracing technique to address this issue in a mouse model of bone cancer-induced mechanical hypersensitivity by intratibia implantation of osteolytic fibrosarcoma cells. Bilateral intra-ACC microinjections of γ-aminobutyric acid receptor type A receptor agonist muscimol decreased mechanical hypersensitivity in tumor-bearing mice (n =10). Using adenoviral-mediated expression of engineered Gi/o-coupled human M4 (hM4Di) receptors, we observed that activation of Gi/o-coupled human M4 receptors with clozapine-N-oxide reduced ACC neuronal activity and mechanical hypersensitivity in tumor-bearing mice (n = 11). In addition, unilateral optogenetic silencing of ACC excitatory neurons with halorhodopsin significantly decreased mechanical hypersensitivity in tumor-bearing mice (n = 4 to 9), and conversely, optogenetic activation of these neurons with channelrhodopsin-2 was sufficient to provoke mechanical hypersensitivity in sham-operated mice (n = 5 to 9). Furthermore, we found that excitatory neurons in the ACC send direct descending projections to the contralateral dorsal horn of the lumbar spinal cord via the dorsal corticospinal tract. The findings of this study indicate that enhanced neuronal activity in the ACC contributes to maintain bone cancer-induced mechanical hypersensitivity and suggest that the ACC may serve as a potential therapeutic target for treating bone cancer pain.

  4. Encephalitozoon intestinalis inhibits dendritic cell differentiation through an IL-6-dependent mechanism

    Directory of Open Access Journals (Sweden)

    Carmen Elisa Bernal Silva

    2016-02-01

    Full Text Available AbstractMicrosporidia are a group of intracellular pathogens causing self-limited and severe diseases in immunocompetent and immunocompromised individuals, respectively. A cellular type 1 adaptive response, mediated by IL-12, IFNg, CD4+ and CD8+ T cells has been shown to be essential for host resistance, and dendritic cells (DC play a key role at eliciting anti-microsporidial immunity. We investigated the in vitro response of DC and DC precursors/progenitors to infection with Encephalitozoon intestinalis (Ei, a common agent of human microsporidosis. Ei-exposed DC cultures up-regulated the surface expression of MHC class II and the costimulatory molecules CD86 and CD40, only when high loads of spores were used. A vigorous secretion of IL-6 but not of IL-1b or IL-12p70 was also observed in these cultures. Ei-exposed DC cultures consisted of immature infected and mature bystander DC, as assessed by MHC class II and costimulatory molecules expression, suggesting that intracellular Ei spores deliver inhibitory signals in DC. Moreover, Ei selectively inhibited the secretion of IL-12p70 in LPS-stimulated DC. Whereas Ei-exposed DC promoted allogeneic naïve T cell proliferation and IL-2 and IFNg secretion in DC-CD4+ T cell co-cultures, separated co-cultures with bystander or infected DCs showed stimulation or inhibition of IFNg secretion, respectively. When DC precursors/progenitors were exposed to Ei spores, a significant inhibition of DC differentiation was observed without shifting the development towards cells phenotypically or functionally compatible with myeloid-derived suppressor cells. Neutralization experiments demonstrated that this inhibitory effect is IL-6-dependent. Altogether this investigation reveals a novel potential mechanism of immune escape of microsporidian parasites through the modulation of DC differentiation and maturation.

  5. Neferine inhibits cultured hepatic stellate cell activation and facilitates apoptosis: A possible molecular mechanism.

    Science.gov (United States)

    Ding, Hui; Shi, Jinghong; Wang, Ying; Guo, Jia; Zhao, Juhui; Dong, Lei

    2011-01-10

    Neferine is a major alkaloid component of "Lian Zi Xin", embryos of the seeds of Nelumbo nucifera Gaertner, Nymphaeaceae. Previous studies have shown that neferine has an inhibitory effect on pulmonary fibrosis through its anti-inflammatory and anti-oxidative activities and inhibition of cytokines and NF-κB. However, it is unknown whether neferine also has an inhibitory effect on liver fibrosis through inhibition of TGF-β1 and collagen I and facilitation of apoptosis of hepatic stellate cells. This study examined the effects of neferine on cultured hepatic stellate (HSC-T6) cells and explored its possible action mechanisms by means of MTT assay, enzyme-linked immunosorbent assay, flow-cytometric annexin V-PI assay and Hoechst 33258 staining, as well as real-time PCR and western blotting. The results showed that neferine administration (2, 4, 6, 8 and 10μmol/l) significantly decreased the TGF-β1 and collagen I produced in HSC-T6 cells, and increased the HSC-T6 cell apoptosis in a dose-dependent manner. Neferine treatment for 48h at concentrations of 6 and 10μmol/l significantly increased Bax and caspase 3 mRNAs and proteins, and reduced Bcl2 and alpha-smooth muscle actin (α-SMA) mRNAs and proteins. Our data indicate that neferine efficiently inhibits cultured HSC-T6 cell activation and induces apoptosis by increasing Bax and caspase 3 expression via the mitochondrial pathway. Copyright © 2010 Elsevier B.V. All rights reserved.

  6. Bacterial cytological profiling : : a shortcut for determining mechanism of action of antibacterial molecules

    OpenAIRE

    Nonejuie, Poochit

    2014-01-01

    After the golden era of antibiotic discovery, we have been falling behind in stocking up our arsenal to fight against bacterial pathogens. If this trend continues, we will eventually return to the pre-antibiotic era and millions of lives will be at risk. An alarming increase in the rate of multidrug resistant pathogens and the lack of new antibiotics are a nightmare combination that we have to conquer in order to alleviate the current dire situation and regain control over pathogens. In order...

  7. Inhibition of pathogenic bacterial growth on excision wound by green synthesized copper oxide nanoparticles leads to accelerated wound healing activity in Wistar Albino rats.

    Science.gov (United States)

    Sankar, Renu; Baskaran, Athmanathan; Shivashangari, Kanchi Subramanian; Ravikumar, Vilwanathan

    2015-07-01

    An impaired wound healing is one of the major health related problem in diabetic and non-diabetic patients around the globe. The pathogenic bacteria play a predominant role in delayed wound healing, owing to interaction in the wound area. In our previous work we developed green chemistry mediated copper oxide nanoparticles using Ficus religiosa leaf extract. In the present study we make an attempt to evaluate the anti-bacterial, and wound healing activity of green synthesized copper oxide nanoparticles in male Wistar Albino rats. The agar well diffusion assay revealed copper oxide nanoparticles have substantial inhibition activity against human pathogenic strains such as Klebsiella pneumoniae, Shigella dysenteriae, Staphylococcus aureus, Salmonella typhimurium and Escherichia coli, which were responsible for delayed wound healing process. Furthermore, the analyses results of wound closure, histopathology and protein profiling confirmed that the F. religiosa leaf extract tailored copper oxide nanoparticles have enhanced wound healing activity in Wistar Albino rats.

  8. A dominant-negative mutant inhibits multiple prion variants through a common mechanism.

    Directory of Open Access Journals (Sweden)

    Fen Pei

    2017-10-01

    Full Text Available Prions adopt alternative, self-replicating protein conformations and thereby determine novel phenotypes that are often irreversible. Nevertheless, dominant-negative prion mutants can revert phenotypes associated with some conformations. These observations suggest that, while intervention is possible, distinct inhibitors must be developed to overcome the conformational plasticity of prions. To understand the basis of this specificity, we determined the impact of the G58D mutant of the Sup35 prion on three of its conformational variants, which form amyloids in S. cerevisiae. G58D had been previously proposed to have unique effects on these variants, but our studies suggest a common mechanism. All variants, including those reported to be resistant, are inhibited by G58D but at distinct doses. G58D lowers the kinetic stability of the associated amyloid, enhancing its fragmentation by molecular chaperones, promoting Sup35 resolubilization, and leading to amyloid clearance particularly in daughter cells. Reducing the availability or activity of the chaperone Hsp104, even transiently, reverses curing. Thus, the specificity of inhibition is determined by the sensitivity of variants to the mutant dosage rather than mode of action, challenging the view that a unique inhibitor must be developed to combat each variant.

  9. Macrocycle peptides delineate locked-open inhibition mechanism for microorganism phosphoglycerate mutases

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Hao; Dranchak, Patricia; Li, Zhiru; MacArthur, Ryan; Munson, Matthew S.; Mehzabeen, Nurjahan; Baird, Nathan J.; Battalie, Kevin P.; Ross, David; Lovell, Scott; Carlow, Clotilde K.S.; Suga, Hiroaki; Inglese, James (U of Tokyo); (NEB); (Kansas); (NIH); (NIST); (HHMI)

    2017-04-03

    Glycolytic interconversion of phosphoglycerate isomers is catalysed in numerous pathogenic microorganisms by a cofactor-independent mutase (iPGM) structurally distinct from the mammalian cofactor-dependent (dPGM) isozyme. The iPGM active site dynamically assembles through substrate-triggered movement of phosphatase and transferase domains creating a solvent inaccessible cavity. Here we identify alternate ligand binding regions using nematode iPGM to select and enrich lariat-like ligands from an mRNA-display macrocyclic peptide library containing >1012 members. Functional analysis of the ligands, named ipglycermides, demonstrates sub-nanomolar inhibition of iPGM with complete selectivity over dPGM. The crystal structure of an iPGM macrocyclic peptide complex illuminated an allosteric, locked-open inhibition mechanism placing the cyclic peptide at the bi-domain interface. This binding mode aligns the pendant lariat cysteine thiolate for coordination with the iPGM transition metal ion cluster. The extended charged, hydrophilic binding surface interaction rationalizes the persistent challenges these enzymes have presented to small-molecule screening efforts highlighting the important roles of macrocyclic peptides in expanding chemical diversity for ligand discovery.

  10. Bypass mechanisms of resistance to tyrosine kinase inhibition in chronic myelogenous leukaemia.

    Science.gov (United States)

    Marfe, Gabriella; Di Stefano, Carla

    2014-06-01

    Chronic myeloid leukaemia (CML) is a disease induced by the BCR-ABL oncogene. Tyrosine kinase inhibitors (TKIs) were introduced in the late 1990s and have revolutionized the management of CML. The majority of such patients can now expect to live a normal life providing they continue to comply with TKI treatment. However, in a significant proportion of cases, TKI resistance develops over time, requiring a change of therapy. Over the past few years, multiple molecular mechanisms of resistance have been identified and some common themes have emerged. One is the development of resistance mutations in the drug target that prevent the drug from effectively inhibiting the respective TK domain. The second is activation of alternative molecules that maintain the signalling of key downstream pathways despite sustained inhibition of the original drug target. In this mini-review, we summarize the concepts underlying resistance, the specific examples known to date and the challenges of applying this knowledge to develop improved therapeutic strategies to prevent or overcome resistance.

  11. Structural basis for the mechanism of inhibition of uridine phosphorylase from Salmonella typhimurium

    Energy Technology Data Exchange (ETDEWEB)

    Lashkov, A. A.; Zhukhlistova, N. E.; Sotnichenko, S. E.; Gabdulkhakov, A. G.; Mikhailov, A. M., E-mail: amm@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2010-01-15

    The three-dimensional structures of three complexes of Salmonella typhimurium uridine phosphorylase with the inhibitor 2,2'-anhydrouridine, the substrate PO{sub 4}, and with both the inhibitor 2,2'-anhydrouridine and the substrate PO{sub 4} (a binary complex) were studied in detail by X-ray diffraction. The structures of the complexes were refined at 2.38, 1.5, and 1.75 A resolution, respectively. Changes in the three-dimensional structure of the subunits in different crystal structures are considered depending on the presence or absence of the inhibitor molecule and (or) the phosphate ion in the active site of the enzyme. The presence of the phosphate ion in the phosphate-binding site was found to substantially change the orientations of the side chains of the amino-acid residues Arg30, Arg91, and Arg48 coordinated to this ion. A comparison showed that the highly flexible loop L9 is unstable. The atomic coordinates of the refined structures of the complexes and the corresponding structure factors were deposited in the Protein Data Bank (their PDB ID codes are 3DD0 and 3C74). The experimental data on the spatial reorganization of the active site caused by changes in its functional state from the unligated to the completely inhibited state suggest the structural basis for the mechanism of inhibition of Salmonella typhimurium uridine phosphorylase.

  12. Temporal predictive mechanisms modulate motor reaction time during initiation and inhibition of speech and hand movement.

    Science.gov (United States)

    Johari, Karim; Behroozmand, Roozbeh

    2017-08-01

    Skilled movement is mediated by motor commands executed with extremely fine temporal precision. The question of how the brain incorporates temporal information to perform motor actions has remained unanswered. This study investigated the effect of stimulus temporal predictability on response timing of speech and hand movement. Subjects performed a randomized vowel vocalization or button press task in two counterbalanced blocks in response to temporally-predictable and unpredictable visual cues. Results indicated that speech and hand reaction time was decreased for predictable compared with unpredictable stimuli. This finding suggests that a temporal predictive code is established to capture temporal dynamics of sensory cues in order to produce faster movements in responses to predictable stimuli. In addition, results revealed a main effect of modality, indicating faster hand movement compared with speech. We suggest that this effect is accounted for by the inherent complexity of speech production compared with hand movement. Lastly, we found that movement inhibition was faster than initiation for both hand and speech, suggesting that movement initiation requires a longer processing time to coordinate activities across multiple regions in the brain. These findings provide new insights into the mechanisms of temporal information processing during initiation and inhibition of speech and hand movement. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Oestrogen inhibits human colonic motility by a non-genomic cell membrane receptor-dependent mechanism.

    LENUS (Irish Health Repository)

    Hogan, A M

    2012-02-01

    BACKGROUND: Classical effects of oestrogen involve activation of target genes after binding nuclear receptors. Oestrogenic effects too rapid for DNA transcription (non-genomic) are known to occur. The effect of oestrogen on colonic motility is unknown despite the prevalence of gastrointestinal symptoms in pregnant and premenopausal women. METHODS: Histologically normal colon was obtained from proximal resection margins of colorectal carcinoma specimens. Circular smooth muscle strips were microdissected and suspended in organ baths under 1 g of tension. After equilibration, they were exposed to 17beta-oestradiol (n = 8) or bovine serum albumin (BSA)-conjugated 17beta-oestradiol (n = 8). Fulvestrant, an oestrogen receptor antagonist, was added to some baths (n = 8). Other strips were exposed to calphostin C or cycloheximide. Carbachol was added in increasing concentrations and contractile activity was recorded isometrically. RESULTS: Oestrogen inhibited colonic contractility (mean difference 19.7 per cent; n = 8, P < 0.001). In keeping with non-genomic, rapid-onset steroid action, the effect was apparent within minutes and reversible. It was observed with both 17beta-oestradiol and BSA-conjugated oestrogen, and was not altered by cycloheximide. Effects were inhibited by fulvestrant, suggesting receptor mediation. CONCLUSION: Oestrogen decreases contractility in human colonic smooth muscle by a non-genomic mechanism involving cell membrane coupling.

  14. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    Science.gov (United States)

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  15. Mechanism by which DHA inhibits the aggregation of KLVFFA peptides: A molecular dynamics study

    Science.gov (United States)

    Zhou, Hong; Liu, Shengtang; Shao, Qiwen; Ma, Dongfang; Yang, Zaixing; Zhou, Ruhong

    2018-03-01

    Docosahexaenoic acid (DHA) is one of the omega-3 polyunsaturated fatty acids, which has shown promising applications in lowering Aβ peptide neurotoxicity in vitro by preventing aggregation of Aβ peptides and relieving accumulation of Aβ fibrils. Unfortunately, the underlying molecular mechanisms of how DHA interferes with the aggregation of Aβ peptides remain largely enigmatic. Herein, aggregation behaviors of amyloid-β(Aβ)16-21 peptides (KLVFFA) with or without the presence of a DHA molecule were comparatively studied using extensive all-atom molecular dynamics simulations. We found that DHA could effectively suppress the aggregation of KLVFFA peptides by redirecting peptides to unstructured oligomers. The highly hydrophobic and flexible nature of DHA made it randomly but tightly entangled with Leu-17, Phe-19, and Phe-20 residues to form unstructured but stable complexes. These lower-ordered unstructured oligomers could eventually pass through energy barriers to form ordered β-sheet structures through large conformational fluctuations. This study depicts a microscopic picture for understanding the role and mechanism of DHA in inhibition of aggregation of Aβ peptides, which is generally believed as one of the important pathogenic mechanisms of Alzheimer's disease.

  16. Diverse mechanisms evolved by DNA viruses to inhibit early host defenses

    Science.gov (United States)

    Sheng, Xinlei; Song, Bokai; Cristea, Ileana M.

    2016-01-01

    In mammalian cells, early defenses against infection by pathogens are mounted through a complex network of signaling pathways shepherded by immune-modulatory pattern-recognition receptors. As obligate parasites, the survival of viruses is dependent upon the evolutionary acquisition of mechanisms that tactfully dismantle and subvert the cellular intrinsic and innate immune responses. Here, we review the diverse mechanisms by which viruses that accommodate DNA genomes are able to circumvent activation of cellular immunity. We start by discussing viral manipulation of host defense protein levels by either transcriptional regulation or protein degradation. We next review viral strategies used to repurpose or inhibit these cellular immune factors by molecular hijacking or by regulating their post-translational modification status. Additionally, we explore the infection-induced temporal modulation of apoptosis to facilitate viral replication and spread. Lastly, the co-evolution of viruses with their hosts is highlighted by the acquisition of elegant mechanisms for suppressing host defenses via viral mimicry of host factors. In closing, we present a perspective on how characterizing these viral evasion tactics both broadens the understanding of virus-host interactions and reveals essential functions of the immune system at the molecular level. This knowledge is critical in understanding the sources of viral pathogenesis, as well as for the design of antiviral therapeutics and autoimmunity treatments. PMID:27650455

  17. Mycobacterium tuberculosis inhibits macrophage responses to IFN-gamma through myeloid differentiation factor 88-dependent and -independent mechanisms.

    Science.gov (United States)

    Fortune, Sarah M; Solache, Alejandra; Jaeger, Alejandra; Hill, Preston J; Belisle, John T; Bloom, Barry R; Rubin, Eric J; Ernst, Joel D

    2004-05-15

    Mycobacterium tuberculosis overcomes macrophage bactericidal activities and persists intracellularly. One mechanism by which M. tuberculosis avoids macrophage killing might be through inhibition of IFN-gamma-mediated signaling. In this study we provide evidence that at least two distinct components of M. tuberculosis, the 19-kDa lipoprotein and cell wall peptidoglycan (contained in the mycolylarabinogalactan peptidoglycan (mAGP) complex), inhibit macrophage responses to IFN-gamma at a transcriptional level. Moreover, these components engage distinct proximal signaling pathways to inhibit responses to IFN-gamma: the 19-kDa lipoprotein inhibits IFN-gamma signaling in a Toll-like receptor (TLR)2-dependent and myeloid differentiation factor 88-dependent fashion whereas mAGP inhibits independently of TLR2, TLR4, and myeloid differentiation factor 88. In addition to inhibiting the induction of specific IFN-gamma responsive genes, the 19-kDa lipoprotein and mAGP inhibit the ability of IFN-gamma to activate murine macrophages to kill virulent M. tuberculosis without inhibiting production of NO. These results imply that inhibition of macrophage responses to IFN-gamma may contribute to the inability of an apparently effective immune response to eradicate M. tuberculosis.

  18. Transglycosylation reactions, a main mechanism of phenolics incorporation in coffee melanoidins: Inhibition by Maillard reaction.

    Science.gov (United States)

    Moreira, Ana S P; Nunes, Fernando M; Simões, Cristiana; Maciel, Elisabete; Domingues, Pedro; Domingues, M Rosário M; Coimbra, Manuel A

    2017-07-15

    Under roasting conditions, polysaccharides depolymerize and also are able to polymerize, forming new polymers through non-enzymatic transglycosylation reactions (TGRs). TGRs can also occur between carbohydrates and aglycones, such as the phenolic compounds present in daily consumed foods like coffee. In this study, glycosidically-linked phenolic compounds were quantified in coffee melanoidins, the polymeric nitrogenous brown-colored compounds formed during roasting, defined as end-products of Maillard reaction. One third of the phenolics present were in glycosidically-linked form. In addition, the roasting of solid-state mixtures mimicking coffee beans composition allowed the conclusion that proteins play a regulatory role in TGRs extension and, consequently, modulate melanoidins composition. Overall, the results obtained showed that TGRs are a main mechanism of phenolics incorporation in melanoidins and are inhibited by amino groups through Maillard reaction. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Nanosilver-Silica Composite: Prolonged Antibacterial Effects and Bacterial Interaction Mechanisms for Wound Dressings.

    Science.gov (United States)

    Mosselhy, Dina A; Granbohm, Henrika; Hynönen, Ulla; Ge, Yanling; Palva, Airi; Nordström, Katrina; Hannula, Simo-Pekka

    2017-09-06

    Infected superficial wounds were traditionally controlled by topical antibiotics until the emergence of antibiotic-resistant bacteria. Silver (Ag) is a kernel for alternative antibacterial agents to fight this resistance quandary. The present study demonstrates a method for immobilizing small-sized (~5 nm) silver nanoparticles on silica matrix to form a nanosilver-silica (Ag-SiO₂) composite and shows the prolonged antibacterial effects of the composite in vitro. The composite exhibited a rapid initial Ag release after 24 h and a slower leaching after 48 and 72 h and was effective against both methicillin-resistant Staphylococcus aureus (MRSA) and Escherichia coli ( E . coli ). Ultraviolet (UV)-irradiation was superior to filter-sterilization in retaining the antibacterial effects of the composite, through the higher remaining Ag concentration. A gauze, impregnated with the Ag-SiO₂ composite, showed higher antibacterial effects against MRSA and E . coli than a commercial Ag-containing dressing, indicating a potential for the management and infection control of superficial wounds. Transmission and scanning transmission electron microscope analyses of the composite-treated MRSA revealed an interaction of the released silver ions with the bacterial cytoplasmic constituents, causing ultimately the loss of bacterial membranes. The present results indicate that the Ag-SiO₂ composite, with prolonged antibacterial effects, is a promising candidate for wound dressing applications.

  20. Aerossol bacteriano gerado por respiradores mecânicos: estudo comparativo Bacterial aerosol generated by mechanical ventilators: a comparative study

    Directory of Open Access Journals (Sweden)

    M. D'Agostino Dias

    1997-03-01

    Full Text Available Respiradores mecânicos emitem aerossóis que podem estar colonizados com bactérias. OBJETIVO. Estudar a contaminação ambiental gerada por respiradores, comparando-se dois siste-mas de umidificação. MÉTODOS. Realizaram-se 51 estudos, comparando-se a colonização dos aerossóis emitidos pela válvula expiratória dos aparelhos de ventilação mecânica, sendo em 31 com nebulizadores convencionais e em 20 com condensadores higroscópicos, em quinze minutos de observação. RESULTADOS. Houve emissão de bactérias para o ambiente, pela válvula expiratória, de 32,2% de respiradores equipados com sistema de nebulização convencional e de 5% com condensador (p = 0,0340. CONCLUSÃO. A umidificação da mistura gasosa com o uso de condensadores pode ser um meio eficiente de reduzir a contaminação bacteriana ambiental.Mechanical ventilators generate aerosol which may be bacterially colonized. PURPOSE - To determine the environmental contamination generated by ventilators with two different humidification techniques. METHODS - The study was done comparing the generation of bacterial colonized aerosol by the expiratory valve of mechanical respirators with conventional water nebulization or with hygroscopic condensator as the humidifier source during 15 minutes of observation. RESULTS - The aerosol got positive cultures in 32.2% of the conventional system and in 5% of the condensator system (p = 0.0340. CONCLUSION - We concluded that the humidification by the hygroscopic condensator may be an efficient way to reduce environmental bacterial contamination.

  1. Antimicrobial Activity and Mechanism of inhibition of Silver Nanoparticles against Extreme Halophilic Archaea

    Directory of Open Access Journals (Sweden)

    Rebecca Thombre

    2016-09-01

    Full Text Available Haloarchaea are salt-loving halophilic microorganism’s that inhabit marine environments, sea water, salterns, and lakes. The resistance of haloarchaea to physical extremities that challenge organismic survival is ubiquitous. Metal and antibiotic resistance of haloarchaea has been on an upsurge due to the exposure of these organisms to metal sinks and drug resistance genes augmented in their natural habitats due to anthropogenic activities and environmental pollution. The efficacy of silver nanoparticles (SNPs as a potent and broad spectrum inhibitory agent is known however, there are no reports on the inhibitory activity of SNPs against haloarchaea. In the present study, we have investigated the antimicrobial potentials of SNPs synthesized using aqueous leaf extract of Cinnamomum tamala against antibiotic resistant haloarchaeal isolates Haloferax prahovense RR8, Haloferax lucentense RR15, Haloarcula argentinensis RR10 and Haloarcula tradensis RR13. The synthesized SNPs were characterized by UV-Vis spectroscopy, scanning electron microscopy, energy dispersive X-ray spectroscopy, dynamic light scattering, X-ray diffraction and Fourier transform infrared spectroscopy. The SNPs demonstrated potent antimicrobial activity against the haloarchaea with a minimum inhibitory concentration of 300- 400µg/ml. Growth kinetics of haloarchaea in the presence of SNPs was studied by employing the Baranyi mathematical model for microbial growth using the DMFit curve fitting programme. The C. tamala SNPs also demonstrated cytotoxic activity against human lung adenocarcinoma epithelial cell line (A540 and human breast adenocarcinoma cell line (MCF-7. The mechanism of inhibition of haloarchaea by the SNPs was investigated. The plausible mechanism proposed is the alterations and disruption of haloarchaeal membrane permeability by turbulence, inhibition of respiratory dehydrogenases and lipid peroxidation causing cellular and DNA damage resulting in cell death.

  2. Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

    Science.gov (United States)

    Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

    2018-04-01

    Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

  3. Mechanisms underlying food-drug interactions: inhibition of intestinal metabolism and transport.

    Science.gov (United States)

    Won, Christina S; Oberlies, Nicholas H; Paine, Mary F

    2012-11-01

    Food-drug interaction studies are critical to evaluate appropriate dosing, timing, and formulation of new drug candidates. These interactions often reflect prandial-associated changes in the extent and/or rate of systemic drug exposure. Physiologic and physicochemical mechanisms underlying food effects on drug disposition are well-characterized. However, biochemical mechanisms involving drug metabolizing enzymes and transport proteins remain underexplored. Several plant-derived beverages have been shown to modulate enzymes and transporters in the intestine, leading to altered pharmacokinetic (PK) and potentially negative pharmacodynamic (PD) outcomes. Commonly consumed fruit juices, teas, and alcoholic drinks contain phytochemicals that inhibit intestinal cytochrome P450 and phase II conjugation enzymes, as well as uptake and efflux transport proteins. Whereas myriad phytochemicals have been shown to inhibit these processes in vitro, translation to the clinic has been deemed insignificant or undetermined. An overlooked prerequisite for elucidating food effects on drug PK is thorough knowledge of causative bioactive ingredients. Substantial variability in bioactive ingredient composition and activity of a given dietary substance poses a challenge in conducting robust food-drug interaction studies. This confounding factor can be addressed by identifying and characterizing specific components, which could be used as marker compounds to improve clinical trial design and quantitatively predict food effects. Interpretation and integration of data from in vitro, in vivo, and in silico studies require collaborative expertise from multiple disciplines, from botany to clinical pharmacology (i.e., plant to patient). Development of more systematic methods and guidelines is needed to address the general lack of information on examining drug-dietary substance interactions prospectively. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Antimicrobial Activity and Mechanism of Inhibition of Silver Nanoparticles against Extreme Halophilic Archaea.

    Science.gov (United States)

    Thombre, Rebecca S; Shinde, Vinaya; Thaiparambil, Elvina; Zende, Samruddhi; Mehta, Sourabh

    2016-01-01

    Haloarchaea are salt-loving halophilic microorganisms that inhabit marine environments, sea water, salterns, and lakes. The resistance of haloarchaea to physical extremities that challenge organismic survival is ubiquitous. Metal and antibiotic resistance of haloarchaea has been on an upsurge due to the exposure of these organisms to metal sinks and drug resistance genes augmented in their natural habitats due to anthropogenic activities and environmental pollution. The efficacy of silver nanoparticles (SNPs) as a potent and broad spectrum inhibitory agent is known, however, there are no reports on the inhibitory activity of SNPs against haloarchaea. In the present study, we have investigated the antimicrobial potentials of SNPs synthesized using aqueous leaf extract of Cinnamomum tamala against antibiotic resistant haloarchaeal isolates Haloferax prahovense RR8, Haloferax lucentense RR15, Haloarcula argentinensis RR10 and Haloarcula tradensis RR13. The synthesized SNPs were characterized by UV-Vis spectroscopy, scanning electron microscopy, energy dispersive X-ray spectroscopy, dynamic light scattering, X-ray diffraction and Fourier transform infrared spectroscopy. The SNPs demonstrated potent antimicrobial activity against the haloarchaea with a minimum inhibitory concentration of 300-400 μg/ml. Growth kinetics of haloarchaea in the presence of SNPs was studied by employing the Baranyi mathematical model for microbial growth using the DMFit curve fitting program. The C. tamala SNPs also demonstrated cytotoxic activity against human lung adenocarcinoma epithelial cell line (A540) and human breast adenocarcinoma cell line (MCF-7). The mechanism of inhibition of haloarchaea by the SNPs was investigated. The plausible mechanism proposed is the alterations and disruption of haloarchaeal membrane permeability by turbulence, inhibition of respiratory dehydrogenases and lipid peroxidation causing cellular and DNA damage resulting in cell death.

  5. Kinetics and mechanism of jack bean urease inhibition by Hg2+.

    Science.gov (United States)

    Du, Nana; Chen, Mingming; Liu, Zhaodi; Sheng, Liangquan; Xu, Huajie; Chen, Shuisheng

    2012-12-10

    Jack bean urease (EC 3.5.1.5) is a metalloenzyme, which catalyzes the hydrolysis of urea to produce ammonia and carbon dioxide. The heavy metal ions are common inhibitors to control the rate of the enzymatic urea hydrolysis, which take the Hg2+ as the representative. Hg2+ affects the enzyme activity causing loss of the biological function of the enzyme, which threatens the survival of many microorganism and plants. However, inhibitory kinetics of urease by the low concentration Hg2+ has not been explored fully. In this study, the inhibitory effect of the low concentration Hg2+ on jack bean urease was investigated in order to elucidate the mechanism of Hg2+ inhibition. According to the kinetic parameters for the enzyme obtained from Lineweaver-Burk plot, it is shown that the Km is equal to 4.6±0.3 mM and Vm is equal to 29.8±1.7 μmol NH3/min mg. The results show that the inhibition of jack bean urease by Hg2+ at low concentration is a reversible reaction. Equilibrium constants have been determined for Hg2+ binding with the enzyme or the enzyme-substrate complexes (Ki =0.012 μM). The results show that the Hg2+ is a noncompetitive inhibitor. In addition, the kinetics of enzyme inhibition by the low concentration Hg2+ has been studied using the kinetic method of the substrate reaction. The results suggest that the enzyme first reversibly and quickly binds Hg2+ and then undergoes a slow reversible course to inactivation. Furthermore, the rate constant of the forward reactions (k+0) is much larger than the rate constant of the reverse reactions (k-0). By combining with the fact that the enzyme activity is almost completely lost at high concentration, the enzyme is completely inactivated when the Hg2+ concentration is high enough. These results suggest that Hg2+ has great impacts on the urease activity and the established inhibition kinetics model is suitable.

  6. Kinetics and mechanism of jack bean urease inhibition by Hg2+

    Directory of Open Access Journals (Sweden)

    Du Nana

    2012-12-01

    Full Text Available Abstract Background Jack bean urease (EC 3.5.1.5 is a metalloenzyme, which catalyzes the hydrolysis of urea to produce ammonia and carbon dioxide. The heavy metal ions are common inhibitors to control the rate of the enzymatic urea hydrolysis, which take the Hg2+ as the representative. Hg2+ affects the enzyme activity causing loss of the biological function of the enzyme, which threatens the survival of many microorganism and plants. However, inhibitory kinetics of urease by the low concentration Hg2+ has not been explored fully. In this study, the inhibitory effect of the low concentration Hg2+ on jack bean urease was investigated in order to elucidate the mechanism of Hg2+ inhibition. Results According to the kinetic parameters for the enzyme obtained from Lineweaver–Burk plot, it is shown that the Km is equal to 4.6±0.3 mM and Vm is equal to 29.8±1.7 μmol NH3/min mg. The results show that the inhibition of jack bean urease by Hg2+ at low concentration is a reversible reaction. Equilibrium constants have been determined for Hg2+ binding with the enzyme or the enzyme-substrate complexes (Ki =0.012 μM. The results show that the Hg2+ is a noncompetitive inhibitor. In addition, the kinetics of enzyme inhibition by the low concentration Hg2+ has been studied using the kinetic method of the substrate reaction. The results suggest that the enzyme first reversibly and quickly binds Hg2+ and then undergoes a slow reversible course to inactivation. Furthermore, the rate constant of the forward reactions (k+0 is much larger than the rate constant of the reverse reactions (k-0. By combining with the fact that the enzyme activity is almost completely lost at high concentration, the enzyme is completely inactivated when the Hg2+ concentration is high enough. Conclusions These results suggest that Hg2+ has great impacts on the urease activity and the established inhibition kinetics model is suitable.

  7. Isotope Effects Associated with N2O Production by Fungal and Bacterial Nitric Oxide Reductases: Implications for Enzyme Mechanisms

    Science.gov (United States)

    Hegg, E. L.; Yang, H.; Gandhi, H.; McQuarters, A.; Lehnert, N.; Ostrom, N. E.

    2014-12-01

    Nitrous oxide (N2O) is both a powerful greenhouse gas and a key participant in ozone destruction. Microbial activity accounts for over 70% of the N2O produced annually, and the atmospheric concentration of N2O continues to rise. Because the fungal and bacterial denitrification pathways are major contributors to microbial N2O production, understanding the mechanism by which NO is reduced to N2O will contribute to both N2O source tracing and quantification. Our strategy utilizes stable isotopes to probe the enzymatic mechanism of microbial N2O production. Although the use of stable isotopes to study enzyme mechanisms is not new, our approach is distinct in that we employ both measurements of isotopic preferences of purified enzyme and DFT calculations, thereby providing a synergistic combination of experimental and computational approaches. We analyzed δ18O, δ15Nα (central N atom in N2O), and δ15Nβ (terminal N atom) of N2O produced by purified fungal cytochrome P450 nitric oxide reductase (P450nor) from Histoplasma capsulatum as well as bacterial cytochrome c dependent nitric oxide reductase (cNOR) from Paracoccus denitrificans. P450nor exhibits an inverse kinetic isotope effect for Nβ (KIE = 0.9651) but a normal isotope effect for both Nα (KIE = 1.0127) and the oxygen atom (KIE = 1.0264). These results suggest a mechanism where NO binds to the ferric heme in the P450nor active site and becomes Nβ. Analysis of the NO-binding step indicated a greater difference in zero point energy in the transition state than the ground state, resulting in the inverse KIE observed for Nβ. Following protonation and rearrangement, it is speculated that this complex forms a FeIV-NHOH- species as a key intermediate. Our data are consistent with the second NO (which becomes Nα and O in the N2O product) attacking the FeIV-NHOH- species to generate a FeIII-N2O2H2 complex that enzymatically (as opposed to abiotically) breaks down to release N2O. Conversely, our preliminary data

  8. A preconditioning nerve lesion inhibits mechanical pain hypersensitivity following subsequent neuropathic injury

    Directory of Open Access Journals (Sweden)

    Wu Ann

    2011-01-01

    Full Text Available Abstract Background A preconditioning stimulus can trigger a neuroprotective phenotype in the nervous system - a preconditioning nerve lesion causes a significant increase in axonal regeneration, and cerebral preconditioning protects against subsequent ischemia. We hypothesized that a preconditioning nerve lesion induces gene/protein modifications, neuronal changes, and immune activation that may affect pain sensation following subsequent nerve injury. We examined whether a preconditioning lesion affects neuropathic pain and neuroinflammation after peripheral nerve injury. Results We found that a preconditioning crush injury to a terminal branch of the sciatic nerve seven days before partial ligation of the sciatic nerve (PSNL; a model of neuropathic pain induced a significant attenuation of pain hypersensitivity, particularly mechanical allodynia. A preconditioning lesion of the tibial nerve induced a long-term significant increase in paw-withdrawal threshold to mechanical stimuli and paw-withdrawal latency to thermal stimuli, after PSNL. A preconditioning lesion of the common peroneal induced a smaller but significant short-term increase in paw-withdrawal threshold to mechanical stimuli, after PSNL. There was no difference between preconditioned and unconditioned animals in neuronal damage and macrophage and T-cell infiltration into the dorsal root ganglia (DRGs or in astrocyte and microglia activation in the spinal dorsal and ventral horns. Conclusions These results suggest that prior exposure to a mild nerve lesion protects against adverse effects of subsequent neuropathic injury, and that this conditioning-induced inhibition of pain hypersensitivity is not dependent on neuroinflammation in DRGs and spinal cord. Identifying the underlying mechanisms may have important implications for the understanding of neuropathic pain due to nerve injury.

  9. Pre-breakdown and Breakdown Mechanisms of an Inhibited Gas to Liquid Hydrocarbon Transformer Oil under Negative Lightning Impulse Voltage

    OpenAIRE

    Lu, Wu; Liu, Qian; Wang, Z.D

    2017-01-01

    In this paper, streamer and breakdown phenomena and their mechanisms of an inhibited Gas-To-Liquid (GTL) transformer oil under standard negative lightning impulse voltages were studied. A conventional inhibited mineral oil was also tested as the benchmark. Experiments were carried out in 25 mm and 50 mm point-plane gaps. Streamer and breakdown phenomena of both oils were observed from the streamer inception voltage level up to the voltage level at which fast streamer appears with velocity ove...

  10. Sphingosine Prevents Bacterial Adherence to Endotracheal Tubes: A Novel Mechanism to Prevent Ventilator-Associated Pneumonia

    Science.gov (United States)

    2016-06-21

    rinsed in 100 mL HEPES/saline (H/S) (132 mM NaCl [sodium chloride], 20 mM HEPES [ pH 7.4], 5 mM KCl [potassium chloride], 1 mM CaCl2 [calcium chloride...kinase reaction was initiated by addition of 0.004 units sphingosine kinase in 50 mM HEPES ( pH 7.4), 250 mM NaCl, 30 mM MgCl2, 1 µM adenosine...adhere to the surface prior to biofilm formation. The source of the bacterial inoculant (i.e., oral secretions, gastric reflux, inhaled droplets, etc

  11. Mechanism study of endothelial protection and inhibits platelet activation of low molecular weight fucoidan from Laminaria japonica

    Science.gov (United States)

    Chen, Anjin; Zhang, Fang; Shi, Jie; Zhao, Xue; Yan, Meixing

    2016-10-01

    Several studies have indicated that fucoidan fractions with low molecular weight and different sulfate content from Laminaria japonica could inhibit the activation of platelets directly by reducing the platelet aggregation. To explore the direct effect of LMW fucoidan on the platelet system furthermore and examine the possible mechanism, the endothelial protection and inhibits platelet activation effects of two LMW fucoidan were investigated. In the present study, Endothelial injury model of rats was made by injection of adrenaline (0.4 mg kg-1) and human umbilical vein endothelial cells were cultured. vWF level was be investigated in vivo and in vitro as an important index of endothelial injury. LMW fucoidan could significantly reduce vWF level in vascular endothelial injury rats and also significantly reduce vWF level in vitro. The number of EMPs was be detected as another important index of endothelial injury. The results showed that LMW fucoidan reduced EMPs stimulated by tumor necrosis factor. In this study, it was found that by inhibiting platelet adhesion, LMW fucoidan played a role in anti-thrombosis and the specific mechanism of action is to inhibit the flow of extracellular Ca2+. All in a word, LMW fucoidan could inhibit the activation of platelets indirectly by reducing the concentration of EMPs and vWF, at the same time; LMW fucoidan inhibited the activation of platelets directly by inhibiting the flow of extracellular Ca2+.

  12. Responding to the challenge of untreatable gonorrhea: ETX0914, a first-in-class agent with a distinct mechanism-of-action against bacterial Type II topoisomerases.

    Science.gov (United States)

    Basarab, Gregory S; Kern, Gunther H; McNulty, John; Mueller, John P; Lawrence, Kenneth; Vishwanathan, Karthick; Alm, Richard A; Barvian, Kevin; Doig, Peter; Galullo, Vincent; Gardner, Humphrey; Gowravaram, Madhusudhan; Huband, Michael; Kimzey, Amy; Morningstar, Marshall; Kutschke, Amy; Lahiri, Sushmita D; Perros, Manos; Singh, Renu; Schuck, Virna J A; Tommasi, Ruben; Walkup, Grant; Newman, Joseph V

    2015-07-14

    With the diminishing effectiveness of current antibacterial therapies, it is critically important to discover agents that operate by a mechanism that circumvents existing resistance. ETX0914, the first of a new class of antibacterial agent targeted for the treatment of gonorrhea, operates by a novel mode-of-inhibition against bacterial type II topoisomerases. Incorporating an oxazolidinone on the scaffold mitigated toxicological issues often seen with topoisomerase inhibitors. Organisms resistant to other topoisomerase inhibitors were not cross-resistant with ETX0914 nor were spontaneous resistant mutants to ETX0914 cross-resistant with other topoisomerase inhibitor classes, including the widely used fluoroquinolone class. Preclinical evaluation of ETX0914 pharmacokinetics and pharmacodynamics showed distribution into vascular tissues and efficacy in a murine Staphylococcus aureus infection model that served as a surrogate for predicting efficacious exposures for the treatment of Neisseria gonorrhoeae infections. A wide safety margin to the efficacious exposure in toxicological evaluations supported progression to Phase 1. Dosing ETX0914 in human volunteers showed sufficient exposure and minimal adverse effects to expect a highly efficacious anti-gonorrhea therapy.

  13. Responding to the challenge of untreatable gonorrhea: ETX0914, a first-in-class agent with a distinct mechanism-of-action against bacterial Type II topoisomerases

    Science.gov (United States)

    Basarab, Gregory S.; Kern, Gunther H.; McNulty, John; Mueller, John P.; Lawrence, Kenneth; Vishwanathan, Karthick; Alm, Richard A.; Barvian, Kevin; Doig, Peter; Galullo, Vincent; Gardner, Humphrey; Gowravaram, Madhusudhan; Huband, Michael; Kimzey, Amy; Morningstar, Marshall; Kutschke, Amy; Lahiri, Sushmita D.; Perros, Manos; Singh, Renu; Schuck, Virna J. A.; Tommasi, Ruben; Walkup, Grant; Newman, Joseph V.

    2015-01-01

    With the diminishing effectiveness of current antibacterial therapies, it is critically important to discover agents that operate by a mechanism that circumvents existing resistance. ETX0914, the first of a new class of antibacterial agent targeted for the treatment of gonorrhea, operates by a novel mode-of-inhibition against bacterial type II topoisomerases. Incorporating an oxazolidinone on the scaffold mitigated toxicological issues often seen with topoisomerase inhibitors. Organisms resistant to other topoisomerase inhibitors were not cross-resistant with ETX0914 nor were spontaneous resistant mutants to ETX0914 cross-resistant with other topoisomerase inhibitor classes, including the widely used fluoroquinolone class. Preclinical evaluation of ETX0914 pharmacokinetics and pharmacodynamics showed distribution into vascular tissues and efficacy in a murine Staphylococcus aureus infection model that served as a surrogate for predicting efficacious exposures for the treatment of Neisseria gonorrhoeae infections. A wide safety margin to the efficacious exposure in toxicological evaluations supported progression to Phase 1. Dosing ETX0914 in human volunteers showed sufficient exposure and minimal adverse effects to expect a highly efficacious anti-gonorrhea therapy. PMID:26168713

  14. Role of contact inhibition of locomotion and junctional mechanics in epithelial collective responses to injury

    Science.gov (United States)

    Coburn, Luke; Lopez, Hender; Schouwenaar, Irin-Maya; Yap, Alpha S.; Lobaskin, Vladimir; Gomez, Guillermo A.

    2018-03-01

    Epithelial tissues form physically integrated barriers against the external environment protecting organs from infection and invasion. Within each tissue, epithelial cells respond to different challenges that can potentially compromise tissue integrity. In particular, cells collectively respond to injuries by reorganizing their cell–cell junctions and migrating directionally towards the sites of damage. Notwithstanding, the mechanisms that drive collective responses in epithelial aggregates remain poorly understood. In this work, we develop a minimal mechanistic model that is able to capture the essential features of epithelial collective responses to injuries. We show that a model that integrates the mechanics of cells at the cell–cell and cell–substrate interfaces as well as contact inhibition of locomotion (CIL) correctly predicts two key properties of epithelial response to injury as: (1) local relaxation of the tissue and (2) collective reorganization involving the extension of cryptic lamellipodia that extend, on average, up to 3 cell diameters from the site of injury and morphometric changes in the basal regions. Our model also suggests that active responses (like the actomyosin purse string and softening of cell–cell junctions) are needed to drive morphometric changes in the apical region. Therefore, our results highlight the importance of the crosstalk between junctional biomechanics, cell substrate adhesion, and CIL, as well as active responses, in guiding the collective rearrangements that are required to preserve the epithelial barrier in response to injury.

  15. Broad-spectrum non-toxic antiviral nanoparticles with a virucidal inhibition mechanism

    Science.gov (United States)

    Cagno, Valeria; Andreozzi, Patrizia; D'Alicarnasso, Marco; Jacob Silva, Paulo; Mueller, Marie; Galloux, Marie; Le Goffic, Ronan; Jones, Samuel T.; Vallino, Marta; Hodek, Jan; Weber, Jan; Sen, Soumyo; Janeček, Emma-Rose; Bekdemir, Ahmet; Sanavio, Barbara; Martinelli, Chiara; Donalisio, Manuela; Rameix Welti, Marie-Anne; Eleouet, Jean-Francois; Han, Yanxiao; Kaiser, Laurent; Vukovic, Lela; Tapparel, Caroline; Král, Petr; Krol, Silke; Lembo, David; Stellacci, Francesco

    2018-02-01

    Viral infections kill millions yearly. Available antiviral drugs are virus-specific and active against a limited panel of human pathogens. There are broad-spectrum substances that prevent the first step of virus-cell interaction by mimicking heparan sulfate proteoglycans (HSPG), the highly conserved target of viral attachment ligands (VALs). The reversible binding mechanism prevents their use as a drug, because, upon dilution, the inhibition is lost. Known VALs are made of closely packed repeating units, but the aforementioned substances are able to bind only a few of them. We designed antiviral nanoparticles with long and flexible linkers mimicking HSPG, allowing for effective viral association with a binding that we simulate to be strong and multivalent to the VAL repeating units, generating forces (~190 pN) that eventually lead to irreversible viral deformation. Virucidal assays, electron microscopy images, and molecular dynamics simulations support the proposed mechanism. These particles show no cytotoxicity, and in vitro nanomolar irreversible activity against herpes simplex virus (HSV), human papilloma virus, respiratory syncytial virus (RSV), dengue and lenti virus. They are active ex vivo in human cervicovaginal histocultures infected by HSV-2 and in vivo in mice infected with RSV.

  16. Inhibition of bacterial and filamentous fungal growth in high moisture, nonsterile corn with intermittent pumping of trans-2-hexenal vapor.

    Science.gov (United States)

    De Lucca, Anthony J; Carter-Wientjes, Carol H; Boué, Stephen M; Lovisa, Mary P; Bhatnagar, Deepak

    2013-07-01

    Trans-2-hexenal (T2H), a plant-produced aldehyde, was intermittently pumped over a 7 d period into a small, bench top model of stored corn (nonsterile, moisture content about 23%). Naturally occurring bacteria and fungi, including added Aspergillus flavus, grew rapidly on corn not treated with T2H vapor. However, intermittently pumped T2H (30 min per 2 h or 30 min per 12 h) significantly reduced bacterial and fungal viable populations, with nearly 100% fungal viability loss observed after either (1) one day of pumping at the 30 min per 2 h rate or (2) pumping cycles of 30 min per 12 h period over the initial 48 to 72 h of incubation. Data suggest that short-term intermittent fumigation of stored corn with T2H could prevent growth of bacteria and mycotoxigenic fungi such as A. flavus. Journal of Food Science © 2013 Institute of Food Technologists® No claim to original US government works.

  17. Bacterial subversion of cAMP signalling inhibits cathelicidin expression, which is required for innate resistance to Mycobacterium tuberculosis

    Science.gov (United States)

    Gupta, Shashank; Winglee, Kathryn; Gallo, Richard; Bishai, William R

    2017-01-01

    Antimicrobial peptides such as cathelicidins are an important component of innate immune defence against inhaled microorganisms and have demonstrated antimicrobial activity against Mycobacterium tuberculosis with in vitro models. Despite this, little is known about the regulation and expression of cathelicidin during tuberculosis in vivo. We sought to determine whether the cathelicidin-related antimicrobial peptide (Cramp) gene, the murine functional homologue of the human cathelicidin gene (CAMP or LL-37), is required for regulating protective immunity during M. tuberculosis infection in vivo. We used Cramp−/− mice in a validated model of pulmonary tuberculosis and conducted cell-based assays with macrophages from these mice. We evaluated the in vivo susceptibility of Cramp−/− mice to infection and further dissected various pro-inflammatory immune responses against M. tuberculosis. We observed increased susceptibility of Cramp−/− mice to M. tuberculosis compared to wild type mice. Macrophages from Cramp−/− mice were unable to control M. tuberculosis growth in an in vitro infection model, were deficient in intracellular calcium influx and were defective in stimulating T-cells. Additionally, CD4 and CD8 T-cells from Cramp−/− mice produced less IFNβ upon stimulation. Furthermore, bacterial-derived cyclic-AMP modulated cathelicidin expression in macrophages. Our results demonstrate that cathelicidin is required for innate resistance to M. tuberculosis in a relevant animal model and is a key mediator in regulating the levels of pro-inflammatory cytokines by calcium and cyclic nucleotides. PMID:28097645

  18. Insight into bacterial virulence mechanisms against host immune response via the Yersinia pestis-human protein-protein interaction network.

    Science.gov (United States)

    Yang, Huiying; Ke, Yuehua; Wang, Jian; Tan, Yafang; Myeni, Sebenzile K; Li, Dong; Shi, Qinghai; Yan, Yanfeng; Chen, Hui; Guo, Zhaobiao; Yuan, Yanzhi; Yang, Xiaoming; Yang, Ruifu; Du, Zongmin

    2011-11-01

    A Yersinia pestis-human protein interaction network is reported here to improve our understanding of its pathogenesis. Up to 204 interactions between 66 Y. pestis bait proteins and 109 human proteins were identified by yeast two-hybrid assay and then combined with 23 previously published interactions to construct a protein-protein interaction network. Topological analysis of the interaction network revealed that human proteins targeted by Y. pestis were significantly enriched in the proteins that are central in the human protein-protein interaction network. Analysis of this network showed that signaling pathways important for host immune responses were preferentially targeted by Y. pestis, including the pathways involved in focal adhesion, regulation of cytoskeleton, leukocyte transendoepithelial migration, and Toll-like receptor (TLR) and mitogen-activated protein kinase (MAPK) signaling. Cellular pathways targeted by Y. pestis are highly relevant to its pathogenesis. Interactions with host proteins involved in focal adhesion and cytoskeketon regulation pathways could account for resistance of Y. pestis to phagocytosis. Interference with TLR and MAPK signaling pathways by Y. pestis reflects common characteristics of pathogen-host interaction that bacterial pathogens have evolved to evade host innate immune response by interacting with proteins in those signaling pathways. Interestingly, a large portion of human proteins interacting with Y. pestis (16/109) also interacted with viral proteins (Epstein-Barr virus [EBV] and hepatitis C virus [HCV]), suggesting that viral and bacterial pathogens attack common cellular functions to facilitate infections. In addition, we identified vasodilator-stimulated phosphoprotein (VASP) as a novel interaction partner of YpkA and showed that YpkA could inhibit in vitro actin assembly mediated by VASP.

  19. Chronic alcohol exposure inhibits biotin uptake by pancreatic acinar cells: possible involvement of epigenetic mechanisms.

    Science.gov (United States)

    Srinivasan, Padmanabhan; Kapadia, Rubina; Biswas, Arundhati; Said, Hamid M

    2014-11-01

    Chronic exposure to alcohol affects different physiological aspects of pancreatic acinar cells (PAC), but its effect on the uptake process of biotin is not known. We addressed this issue using mouse-derived pancreatic acinar 266-6 cells chronically exposed to alcohol and wild-type and transgenic mice (carrying the human SLC5A6 5'-promoter) fed alcohol chronically. First we established that biotin uptake by PAC is Na(+) dependent and carrier mediated and involves sodium-dependent multivitamin transporter (SMVT). Chronic exposure of 266-6 cells to alcohol led to a significant inhibition in biotin uptake, expression of SMVT protein, and mRNA as well as in the activity of the SLC5A6 promoter. Similarly, chronic alcohol feeding of wild-type and transgenic mice carrying the SLC5A6 promoter led to a significant inhibition in biotin uptake by PAC, as well as in the expression of SMVT protein and mRNA and the activity of the SLC5A6 promoters expressed in the transgenic mice. We also found that chronic alcohol feeding of mice is associated with a significant increase in the methylation status of CpG islands predicted to be in the mouse Slc5a6 promoters and a decrease in the level of expression of transcription factor KLF-4, which plays an important role in regulating SLC5A6 promoter activity. These results demonstrate, for the first time, that chronic alcohol exposure negatively impacts biotin uptake in PAC and that this effect is exerted (at least in part) at the level of transcription of the SLC5A6 gene and may involve epigenetic/molecular mechanisms. Copyright © 2014 the American Physiological Society.

  20. Inhibition of angiogenesis: a novel antitumor mechanism of the herbal compound arctigenin.

    Science.gov (United States)

    Gu, Yuan; Scheuer, Claudia; Feng, Dilu; Menger, Michael D; Laschke, Matthias W

    2013-09-01

    Arctigenin, a functional ingredient of several traditional Chinese herbs, has been reported to have potential antitumor activity. However, its mechanisms of action are still not well elucidated. Because the establishment and metastatic spread of tumors is crucially dependent on angiogenesis, here we investigated whether arctigenin inhibits tumor growth by disturbing blood vessel formation. For this purpose, human dermal microvascular endothelial cells were exposed to different arctigenin doses to study their viability, proliferation, protein expression, migration, and tube formation compared with vehicle-treated controls. In addition, arctigenin action on vascular sprouting was analyzed in an aortic ring assay. Furthermore, we studied direct arctigenin effects on CT26.WT colon carcinoma cells. Spheroids of these tumor cells were transplanted into the dorsal skinfold chamber of arctigenin-treated and vehicle-treated BALB/c mice for the in-vivo analysis of tumor vascularization and growth by intravital fluorescence microscopy, histology, and immunohistochemistry. We found that noncytotoxic doses of arctigenin dose dependently reduced the proliferation of human dermal microvascular endothelial cells without affecting their migratory and tube-forming capacity. Arctigenin treatment also resulted in a decreased cellular expression of phosphorylated serine/threonine protein kinase AKT, vascular endothelial growth factor receptor 2, and proliferating cell nuclear antigen and inhibited vascular sprouting from aortic rings. In addition, proliferation, but not secretion of vascular endothelial growth factor, was decreased in arctigenin-treated tumor cells. Finally, arctigenin suppressed the vascularization and growth of engrafting CT26.WT tumors in the dorsal skinfold chamber model. Taken together, these results show for the first time an antiangiogenic action of arctigenin, which may contribute considerably toward its antitumor activity.

  1. Inhibition of the chlorinating activity of myeloperoxidase by tempol: revisiting the kinetics and mechanisms.

    Science.gov (United States)

    Queiroz, Raphael F; Vaz, Sandra M; Augusto, Ohara

    2011-11-01

    The nitroxide tempol (4-hydroxy-2,2,6,6-tetramethyl piperidine-1-oxyl) reduces tissue injury in animal models of inflammation by mechanisms that are not completely understood. MPO (myeloperoxidase), which plays a fundamental role in oxidant production by neutrophils, is an important target for anti-inflammatory action. By amplifying the oxidative potential of H2O2, MPO produces hypochlorous acid and radicals through the oxidizing intermediates MPO-I [MPO-porphyrin•+-Fe(IV)=O] and MPO-II [MPO-porphyrin-Fe(IV)=O]. Previously, we reported that tempol reacts with MPO-I and MPO-II with second-order rate constants similar to those of tyrosine. However, we noticed that tempol inhibits the chlorinating activity of MPO, in contrast with tyrosine. Thus we studied the inhibition of MPO-mediated taurine chlorination by tempol at pH 7.4 and re-determined the kinetic constants of the reactions of tempol with MPO-I (k=3.5×105 M-1·s-1) and MPO-II, the kinetics of which indicated a binding interaction (K=2.0×10-5 M; k=3.6×10-2 s-1). Also, we showed that tempol reacts extremely slowly with hypochlorous acid (k=0.29 and 0.054 M-1·s-1 at pH 5.4 and 7.4 respectively). The results demonstrated that tempol acts mostly as a reversible inhibitor of MPO by trapping it as MPO-II and the MPO-II-tempol complex, which are not within the chlorinating cycle. After turnover, a minor fraction of MPO is irreversibly inactivated, probably due to its reaction with the oxammonium cation resulting from tempol oxidation. Kinetic modelling indicated that taurine reacts with enzyme-bound hypochlorous acid. Our investigation complements a comprehensive study reported while the present study was underway

  2. Mechanism of Cu(II) adsorption inhibition on biochar by its aging process.

    Science.gov (United States)

    Guo, Yue; Tang, Wei; Wu, Jinggui; Huang, Zhaoqin; Dai, Jingyu

    2014-10-01

    Biochar exposed in the environment may experience a series of surface changes, which is called biochar aging. In order to study the effects of biochar aging on Cu(II) adsorption, we analyzed the surface properties before and after biochar aging with scanning electron microscopy (SEM) coupled to an energy-dispersive X-ray spectrometer (EDX) and diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS), and then explored the influence of the aging process on Cu(II) adsorption by batch experiments. After the aging process, the oxygen concentration, phenolic hydroxyl groups, aromatic ethers and other oxygen-containing functional groups on the biochar surface increased, while carboxyl groups slightly decreased. Thus, over a range of pH, the cation exchange capacity (CEC) and adsorption capacity of Cu(II) on the aged biochar were smaller than those of new biochar, indicating that when biochar is incubated at constant temperature and water holding capacity in the dark, the aging process may inhibit Cu(II) adsorption. Meanwhile, the dissociation characteristics of oxygen-containing functional groups changed through the aging process, which may be the mechanism by which the biochar aging process inhibits the Cu(II) adsorption. Carboxyl groups became more easily dissociated at low pH (3.3-5.0), and the variation of maximum adsorption capability (qm) of Cu(II) on the old biochar was enlarged. Phenolic hydroxyl groups increased after the aging, making them and carboxyl groups more difficult to dissociate at high pH (5.0-6.8), and the variation of qm of Cu(II) on the aged biochar was reduced. Copyright © 2014. Published by Elsevier B.V.

  3. A Neurobehavioral Mechanism Linking Behaviorally Inhibited Temperament and Later Adolescent Social Anxiety.

    Science.gov (United States)

    Buzzell, George A; Troller-Renfree, Sonya V; Barker, Tyson V; Bowman, Lindsay C; Chronis-Tuscano, Andrea; Henderson, Heather A; Kagan, Jerome; Pine, Daniel S; Fox, Nathan A

    2017-12-01

    Behavioral inhibition (BI) is a temperament identified in early childhood that is a risk factor for later social anxiety. However, mechanisms underlying the development of social anxiety remain unclear. To better understand the emergence of social anxiety, longitudinal studies investigating changes at behavioral neural levels are needed. BI was assessed in the laboratory at 2 and 3 years of age (N = 268). Children returned at 12 years, and an electroencephalogram was recorded while children performed a flanker task under 2 conditions: once while believing they were being observed by peers and once while not being observed. This methodology isolated changes in error monitoring (error-related negativity) and behavior (post-error reaction time slowing) as a function of social context. At 12 years, current social anxiety symptoms and lifetime diagnoses of social anxiety were obtained. Childhood BI prospectively predicted social-specific error-related negativity increases and social anxiety symptoms in adolescence; these symptoms directly related to clinical diagnoses. Serial mediation analysis showed that social error-related negativity changes explained relations between BI and social anxiety symptoms (n = 107) and diagnosis (n = 92), but only insofar as social context also led to increased post-error reaction time slowing (a measure of error preoccupation); this model was not significantly related to generalized anxiety. Results extend prior work on socially induced changes in error monitoring and error preoccupation. These measures could index a neurobehavioral mechanism linking BI to adolescent social anxiety symptoms and diagnosis. This mechanism could relate more strongly to social than to generalized anxiety in the peri-adolescent period. Copyright © 2017 American Academy of Child and Adolescent Psychiatry. All rights reserved.

  4. Mechanisms of neuroblastoma cell growth inhibition by CARP-1 functional mimetics.

    Directory of Open Access Journals (Sweden)

    Magesh Muthu

    Full Text Available Neuroblastomas (NBs are a clinically heterogeneous group of extra cranial pediatric tumors. Patients with high-risk, metastatic NBs have a long-term survival rate of below 40%, and are often resistant to current therapeutic modalities. Due to toxic side effects associated with radiation and chemotherapies, development of new agents is warranted to overcome resistance and effectively treat this disease in clinic. CARP-1 functional mimetics (CFMs are an emerging class of small molecule compounds that inhibit growth of diverse cancer cell types. Here we investigated NB inhibitory potential of CFMs and the molecular mechanisms involved. CFM-1, -4, and -5 inhibited NB cell growth, in vitro, independent of their p53 and MYCN status. CFM-4 and -5 induced apoptosis in NB cells in part by activating pro-apoptotic stress-activated kinases (SAPKs p38 and JNK, stimulating CARP-1 expression and cleavage of PARP1, while promoting loss of the oncogenes C and N-myc as well as mitotic cyclin B1. Treatments of NB cells with CFM-4 or -5 also resulted in loss of Inhibitory κB (IκB α and β proteins. Micro-RNA profiling revealed upregulation of XIAP-targeting miR513a-3p in CFM-4-treated NB, mesothelioma, and breast cancer cells. Moreover, exposure of NB and breast cancer cells to CFM-4 or -5 resulted in diminished expression of anti-apoptotic XIAP1, cIAP1, and Survivin proteins. Expression of anti-miR513a-5p or miR513a-5p mimic, however, interfered with or enhanced, respectively, the breast cancer cell growth inhibition by CFM-4. CFMs also impacted biological properties of the NB cells by blocking their abilities to migrate, form colonies in suspension, and invade through the matrix-coated membranes. Our studies indicate anti-NB properties of CFM-4 and 5, and suggest that these CFMs and/or their future analogs have potential as anti-NB agents.

  5. Celery extract inhibits mouse CYP2A5 and human CYP2A6 activities via different mechanisms.

    Science.gov (United States)

    Deng, Xiao; Pu, Qianghong; Wang, Erhao; Yu, Chao

    2016-12-01

    Human cytochrome P450 (CYP) 2A6 participates in the metabolism of nicotine and precarcinogens, thus the deliberate inhibition of CYP2A6 may reduce cigarette consumption and therefore reduce the risk of developing the types of cancer associated with smoking. The inhibitory effects and mechanisms of celery ( Apium graveolens ) extract on mouse CYP2A5 and human CYP2A6 activity remain unclear. These effects were investigated in mouse and human liver microsomes using coumarin 7-hydroxylation in a probe reaction. Celery extract reduced CYP2A5 and CYP2A6 activities in vitro in a dose-dependent manner. In vivo experiments also showed that celery extract markedly decreased CYP2A5 activity. The inhibition of celery extract on CYP2A5 was time- and nicotinamide adenine dinucleotide phosphate (NADPH)-independent, and was markedly reduced by ultracentrifugation. Additionally, the inhibition of celery extract on CYP2A6 was time and NADPH-dependent. Levels of inhibition were characterized by a K i , the measure of the tightness of bonds between the enzyme and its inhibitor, of 266.4 µg/ml for CYP2A5, and a K i of 1,018 µg/ml and K inact of 0.3/min for CYP2A6. K inact is the maximal rate of enzyme inactivation at a saturating concentration of inhibitor. The coumarin derivative 5-methoxypsoralen present in celery extract did not solely to the inhibition of CYP2A5/6 activity. In conclusion, celery extract inhibited the levels of mouse CYP2A5 and human CYP2A6 activity via different mechanisms: Mixed competitive inhibition for CYP2A5 and mechanism-based inhibition for CYP2A6.

  6. Two-Swim Operators in the Modified Bacterial Foraging Algorithm for the Optimal Synthesis of Four-Bar Mechanisms

    Science.gov (United States)

    Hernández-Ocaña, Betania; Pozos-Parra, Ma. Del Pilar; Mezura-Montes, Efrén; Portilla-Flores, Edgar Alfredo; Vega-Alvarado, Eduardo; Calva-Yáñez, Maria Bárbara

    2016-01-01

    This paper presents two-swim operators to be added to the chemotaxis process of the modified bacterial foraging optimization algorithm to solve three instances of the synthesis of four-bar planar mechanisms. One swim favors exploration while the second one promotes fine movements in the neighborhood of each bacterium. The combined effect of the new operators looks to increase the production of better solutions during the search. As a consequence, the ability of the algorithm to escape from local optimum solutions is enhanced. The algorithm is tested through four experiments and its results are compared against two BFOA-based algorithms and also against a differential evolution algorithm designed for mechanical design problems. The overall results indicate that the proposed algorithm outperforms other BFOA-based approaches and finds highly competitive mechanisms, with a single set of parameter values and with less evaluations in the first synthesis problem, with respect to those mechanisms obtained by the differential evolution algorithm, which needed a parameter fine-tuning process for each optimization problem. PMID:27057156

  7. Two-Swim Operators in the Modified Bacterial Foraging Algorithm for the Optimal Synthesis of Four-Bar Mechanisms

    Directory of Open Access Journals (Sweden)

    Betania Hernández-Ocaña

    2016-01-01

    Full Text Available This paper presents two-swim operators to be added to the chemotaxis process of the modified bacterial foraging optimization algorithm to solve three instances of the synthesis of four-bar planar mechanisms. One swim favors exploration while the second one promotes fine movements in the neighborhood of each bacterium. The combined effect of the new operators looks to increase the production of better solutions during the search. As a consequence, the ability of the algorithm to escape from local optimum solutions is enhanced. The algorithm is tested through four experiments and its results are compared against two BFOA-based algorithms and also against a differential evolution algorithm designed for mechanical design problems. The overall results indicate that the proposed algorithm outperforms other BFOA-based approaches and finds highly competitive mechanisms, with a single set of parameter values and with less evaluations in the first synthesis problem, with respect to those mechanisms obtained by the differential evolution algorithm, which needed a parameter fine-tuning process for each optimization problem.

  8. Bacterial subversion of cAMP signalling inhibits cathelicidin expression, which is required for innate resistance to Mycobacterium tuberculosis.

    Science.gov (United States)

    Gupta, Shashank; Winglee, Kathryn; Gallo, Richard; Bishai, William R

    2017-05-01

    Antimicrobial peptides such as cathelicidins are important components of innate immune defence against inhaled microorganisms, and have shown antimicrobial activity against Mycobacterium tuberculosis in in vitro models. Despite this, little is known about the regulation and expression of cathelicidin during tuberculosis in vivo. We sought to determine whether the cathelicidin-related antimicrobial peptide gene (Cramp), the murine functional homologue of the human cathelicidin gene (CAMP or LL-37), is required for regulation of protective immunity during M. tuberculosis infection in vivo. We used Cramp -/- mice in a validated model of pulmonary tuberculosis, and conducted cell-based assays with macrophages from these mice. We evaluated the in vivo susceptibility of Cramp -/- mice to infection, and also dissected various pro-inflammatory immune responses against M. tuberculosis. We observed increased susceptibility of Cramp -/- mice to M. tuberculosis as compared with wild-type mice. Macrophages from Cramp -/- mice were unable to control M. tuberculosis growth in an in vitro infection model, were deficient in intracellular calcium influx, and were defective in stimulating T cells. Additionally, CD4 + and CD8 + T cells from Cramp -/- mice produced less interferon-β upon stimulation. Furthermore, bacterial-derived cAMP modulated cathelicidin expression in macrophages. Our results demonstrate that cathelicidin is required for innate resistance to M. tuberculosis in a relevant animal model and is a key mediator in regulation of the levels of pro-inflammatory cytokines by calcium and cyclic nucleotides. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  9. Mechanisms of the harmful effects of bacterial semen infection on ejaculated human spermatozoa: potential inflammatory markers in semen.

    Science.gov (United States)

    Fraczek, Monika; Kurpisz, Maciej

    2015-01-01

    The invasion of the male reproductive tract by microorganisms, and its subsequent consequences for sperm fertilizing potential, has been intensely discussed. The role of the bacteria that are responsible for the colonization and contamination of the male urogenital tract, rather than its infection, in diminished sperm parameters raises the most controversy. There are numerous premises suggesting that bacterial semen infection is associated with male infertility. However, the molecular mechanism by which the fertility is affected is complex and multifactorial, and still presents a puzzle. Some authors have suggested that direct interactions between bacteria and human spermatozoa facilitate sperm immobilization, affect sperm morphology, and thus weaken the ability of sperm to fertilize. On the other hand, the massive infiltration of activated leukocytes into the inflammatory site may be associated with impairment of sperm fertilizing potential, due to oxidative, apoptotic, and immune processes. This review presents current research trends and aims to summarize the present knowledge of semen inflammation and causative bacterial agents in the male urogenital tract, with its consequence on seminological parameters, and male fertility status.

  10. Harnessing the Maltodextrin Transport Mechanism for Targeted Bacterial Imaging: Structural Requirements for Improved in vivo Stability in Tracer Design.

    Science.gov (United States)

    Axer, Alexander; Hermann, Sven; Kehr, Gerald; Clases, David; Karst, Uwe; Fischer-Riepe, Lena; Roth, Johannes; Fobker, Manfred; Schäfers, Michael; Gilmour, Ryan; Faust, Andreas

    2018-02-06

    Diagnosis and localization of bacterial infections remains a significant clinical challenge. Harnessing bacteria-specific metabolic pathways, such as the maltodextrin transport mechanism, may allow specific localization and imaging of small or hidden colonies. This requires that the intrabacterial tracer accumulation provided by the transporter is matched by high serum stability of the tracer molecule. Herein, radiolabeled maltodextrins of varying chain lengths and with free nonreducing/reducing ends are reported and their behavior against starch-degrading enzymes in the blood, which compromise their serum stability, is evaluated. Successful single-photon emission computed tomography (SPECT) imaging is shown in a footpad infection model in vivo by using the newly developed model tracer, [ 99m Tc]MB1143, and the signal is compared with that of 18 F-fluorodeoxyglucose positron emission tomography ([ 18 F]FDG-PET) as a nonbacterial specific marker for inflammation. Although the [ 99m Tc]MB1143 imaging signal is highly specific, it is low, most probably due to insufficient serum stability of the tracer. A series of stability tests with different 18 F-labeled maltodextrins finally yielded clear structural guidelines regarding substitution patterns and chain lengths of maltodextrin-based tracers for nuclear imaging of bacterial infections. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Nano- and macroscale structural and mechanical properties of in situ synthesized bacterial cellulose/PEO-b-PPO-b-PEO biocomposites.

    Science.gov (United States)

    Tercjak, Agnieszka; Gutierrez, Junkal; Barud, Hernane S; Domeneguetti, Rafael R; Ribeiro, Sidney J L

    2015-02-25

    Highly transparent biocomposite based on bacterial cellulose (BC) mat modified with poly(ethylene oxide-b-propylene oxide-b-ethylene oxide) block copolymer (EPE) were fabricated in situ during biosynthesis of bacterial cellulose in a static culture from Gluconacetobacter xylinum. The effect of the addition to the culture medium of water-soluble EPE block copolymer on structure, morphology, crystallinity, and final properties of the novel biocomposites was investigated at nano- and macroscale. High compatibility between components was confirmed by ATR-FTIR indicating hydrogen bond formation between the OH group of BC and the PEO block of EPE block copolymer. Structural properties of EPE/BC biocomposites showed a strong effect of EPE block copolymer on the morphology of the BC mats. Thus, the increase of the EPE block copolymer content lead to the generation of spherulites of PEO block, clearly visualized using AFM and MO technique, changing crystallinity of the final EPE/BC biocomposites investigated by XRD. Generally, EPE/BC biocomposites maintain thermal stability and mechanical properties of the BC mat being 1 wt % EPE/BC biocomposite material with the best properties. Biosynthesis of EPE/BC composites open new strategy to the utilization of water-soluble block copolymers in the preparation of BC mat based biocomposites with tunable properties.

  12. Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07.

    Science.gov (United States)

    Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting

    2016-02-25

    Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis.

  13. Pharmacological Inhibition of Host Heme Oxygenase-1 Suppresses Mycobacterium tuberculosis Infection In Vivo by a Mechanism Dependent on T Lymphocytes

    Directory of Open Access Journals (Sweden)

    Diego L. Costa

    2016-10-01

    Full Text Available Heme oxygenase-1 (HO-1 is a stress response antioxidant enzyme which catalyzes the degradation of heme released during inflammation. HO-1 expression is upregulated in both experimental and human Mycobacterium tuberculosis infection, and in patients it is a biomarker of active disease. Whether the enzyme plays a protective versus pathogenic role in tuberculosis has been the subject of debate. To address this controversy, we administered tin protoporphyrin IX (SnPPIX, a well-characterized HO-1 enzymatic inhibitor, to mice during acute M. tuberculosis infection. These SnPPIX-treated animals displayed a substantial reduction in pulmonary bacterial loads comparable to that achieved following conventional antibiotic therapy. Moreover, when administered adjunctively with antimycobacterial drugs, the HO-1 inhibitor markedly enhanced and accelerated pathogen clearance. Interestingly, both the pulmonary induction of HO-1 expression and the efficacy of SnPPIX treatment in reducing bacterial burden were dependent on the presence of host T lymphocytes. Although M. tuberculosis expresses its own heme-degrading enzyme, SnPPIX failed to inhibit its enzymatic activity or significantly restrict bacterial growth in liquid culture. Together, the above findings reveal mammalian HO-1 as a potential target for host-directed monotherapy and adjunctive therapy of tuberculosis and identify the immune response as a critical regulator of this function.

  14. Molecular Mechanisms of the Whole DNA Repair System: A Comparison of Bacterial and Eukaryotic Systems

    Directory of Open Access Journals (Sweden)

    Rihito Morita

    2010-01-01

    Full Text Available DNA is subjected to many endogenous and exogenous damages. All organisms have developed a complex network of DNA repair mechanisms. A variety of different DNA repair pathways have been reported: direct reversal, base excision repair, nucleotide excision repair, mismatch repair, and recombination repair pathways. Recent studies of the fundamental mechanisms for DNA repair processes have revealed a complexity beyond that initially expected, with inter- and intrapathway complementation as well as functional interactions between proteins involved in repair pathways. In this paper we give a broad overview of the whole DNA repair system and focus on the molecular basis of the repair machineries, particularly in Thermus thermophilus HB8.

  15. Cycle inhibiting factors (CIFs are a growing family of functional cyclomodulins present in invertebrate and mammal bacterial pathogens.

    Directory of Open Access Journals (Sweden)

    Grégory Jubelin

    Full Text Available The cycle inhibiting factor (Cif produced by enteropathogenic and enterohemorrhagic Escherichia coli was the first cyclomodulin to be identified that is injected into host cells via the type III secretion machinery. Cif provokes cytopathic effects characterized by G(1 and G(2 cell cycle arrests, accumulation of the cyclin-dependent kinase inhibitors (CKIs p21(waf1/cip1 and p27(kip1 and formation of actin stress fibres. The X-ray crystal structure of Cif revealed it to be a divergent member of a superfamily of enzymes including cysteine proteases and acetyltransferases that share a conserved catalytic triad. Here we report the discovery and characterization of four Cif homologs encoded by different pathogenic or symbiotic bacteria isolated from vertebrates or invertebrates. Cif homologs from the enterobacteria Yersinia pseudotuberculosis, Photorhabdus luminescens, Photorhabdus asymbiotica and the beta-proteobacterium Burkholderia pseudomallei all induce cytopathic effects identical to those observed with Cif from pathogenic E. coli. Although these Cif homologs are remarkably divergent in primary sequence, the catalytic triad is strictly conserved and was shown to be crucial for cell cycle arrest, cytoskeleton reorganization and CKIs accumulation. These results reveal that Cif proteins form a growing family of cyclomodulins in bacteria that interact with very distinct hosts including insects, nematodes and humans.

  16. Bacteriophage Resistance Mechanisms in the Fish Pathogen Flavobacterium psychrophilum: Linking Genomic Mutations to Changes in Bacterial Virulence Factors

    DEFF Research Database (Denmark)

    Castillo, Daniel; Christiansen, Rói Hammershaimb; Dalsgaard, Inger

    2015-01-01

    requires overcoming the selection for phage resistance in the bacterial populations. Here, we analyzed resistance mechanisms in F. psychrophilum after phage exposure using whole-genome sequencing of the ancestral phage-sensitive strain 950106-1/1 and six phage-resistant isolates. The phage-resistant...... resistance and the genetic modifications were supported by direct measurements of bacteriophage adsorption rates, biofilm formation, and secretion of extracellular enzymes, which were all impaired in the resistant strains, probably due to superficial structural changes. The clustered regularly interspaced...... were associated with a number of derived effects on the physiological properties of the pathogen, including reduced virulence under in vitro conditions. Consequently, phage-driven physiological changes associated with resistance may have implications for the impact of the pathogen in aquaculture...

  17. Inhibition of human cAMP-phosphodiesterase as a mechanism of the spasmolytic effect of Matricaria recutita L.

    Science.gov (United States)

    Maschi, Omar; Cero, Esther Dal; Galli, Germana V; Caruso, Donatella; Bosisio, Enrica; Dell'Agli, Mario

    2008-07-09

    Mechanisms underlying the spasmolytic activity of chamomile still remain unclear. Inhibition of cAMP- and cGMP-phosphodiesterases (PDE) is one of the mechanisms operated by spasmolytic drugs. In this study, the effect of chamomile on PDE was investigated. Human platelet cAMP-PDE and recombinant PDE5A1 were assayed in the presence of infusions prepared from sifted flowers and capitula. LC-ESI-MS/MS analysis showed different compositions in infusions made with sifted flowers and capitula. Chamomile inhibited cAMP-PDE activity (IC50 = 17.9-40.5 microg/mL), while cGMP-PDE5 was less affected (-15% at 50 microg/mL). Among the individual compounds tested, only flavonoids showed an inhibitory effect (IC50 = 1.3-14.9 microM), contributing to around 39% of the infusion inhibition; other compounds responsible for cAMP-PDE inhibition still remain unknown. Although experimental evidence supporting the use of chamomile for gastrointestinal minor spasms dates back to the fifties, cAMP-PDE inhibition as a likely mechanism underlying the spasmolytic activity is reported for the first time.

  18. Inhibition of heparin precipitation, bacterial growth, and fungal growth with a combined isopropanol-ethanol locking solution for vascular access devices.

    Science.gov (United States)

    Restrepo, Daniel; Laconi, Nicholas S; Alcantar, Norma A; West, Leigh A; Buttice, Audrey L; Patel, Saumil; Kayton, Mark L

    2015-03-01

    Clinical reports of ethanol-lock use for the prevention of catheter-related bloodstream infections have been marked by the occurrence of serious catheter occlusions, particularly among children with mediports. We hypothesized that precipitate forms when ethanol mixes with heparin at the concentrations relevant for vascular access devices, but that the use of a combination of two alcohols, ethanol and isopropanol, would diminish heparin-related precipitation, while retaining anti-bacterial and anti-fungal effects. Heparin (0-100units/mL) was incubated in ethanol-water solutions (30%-70% vol/vol) or in an aqueous solution containing equal parts (35% and 35% vol/vol) of isopropanol and ethanol. Precipitation at temperatures from 4 to 40°C was measured in nephelometric turbidity units using a benchtop turbidimeter. Growth of Escherichia coli, Staphylococcus aureus, and Candida albicans colonies were measured following exposure to solutions of ethanol or isopropanol-ethanol. Groupwise comparisons were performed using analysis of variance with Bonferroni-corrected, post-hoc T-testing. Seventy percent ethanol and heparin exhibit dose-dependent precipitation that is pronounced and significant at the concentrations typically used in mediports (pbacterial and anti-fungal properties. On the other hand, although ethanol solutions under 70% form less precipitate with heparin, such concentrations are also less effective at bacterial colony inhibition than solutions of either 70% ethanol or 35% isopropanol-35% ethanol (pbacterial and fungal growth similarly to 70% ethanol, but results in less precipitate than 70% ethanol when exposed to heparin. Further study of a combined isopropanol-ethanol locking solution for the prevention of catheter-related bloodstream infections should focus on the determination as to whether such a locking solution may reduce the rate of precipitation-related catheter occlusion, and whether it may be administered with low systemic toxicity. Copyright

  19. Characterization of nicotinamidases: steady state kinetic parameters, classwide inhibition by nicotinaldehydes, and catalytic mechanism.

    Science.gov (United States)

    French, Jarrod B; Cen, Yana; Vrablik, Tracy L; Xu, Ping; Allen, Eleanor; Hanna-Rose, Wendy; Sauve, Anthony A

    2010-12-14

    Nicotinamidases are metabolic enzymes that hydrolyze nicotinamide to nicotinic acid. These enzymes are widely distributed across biology, with examples found encoded in the genomes of Mycobacteria, Archaea, Eubacteria, Protozoa, yeast, and invertebrates, but there are none found in mammals. Although recent structural work has improved our understanding of these enzymes, their catalytic mechanism is still not well understood. Recent data show that nicotinamidases are required for the growth and virulence of several pathogenic microbes. The enzymes of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans regulate life span in their respective organisms, consistent with proposed roles in the regulation of NAD(+) metabolism and organismal aging. In this work, the steady state kinetic parameters of nicotinamidase enzymes from C. elegans, Sa. cerevisiae, Streptococcus pneumoniae (a pathogen responsible for human pneumonia), Borrelia burgdorferi (the pathogen that causes Lyme disease), and Plasmodium falciparum (responsible for most human malaria) are reported. Nicotinamidases are generally efficient catalysts with steady state k(cat) values typically exceeding 1 s(-1). The K(m) values for nicotinamide are low and in the range of 2 -110 μM. Nicotinaldehyde was determined to be a potent competitive inhibitor of these enzymes, binding in the low micromolar to low nanomolar range for all nicotinamidases tested. A variety of nicotinaldehyde derivatives were synthesized and evaluated as inhibitors in kinetic assays. Inhibitions are consistent with reaction of the universally conserved catalytic Cys on each enzyme with the aldehyde carbonyl carbon to form a thiohemiacetal complex that is stabilized by a conserved oxyanion hole. The S. pneumoniae nicotinamidase can catalyze exchange of (18)O into the carboxy oxygens of nicotinic acid with H(2)(18)O. The collected data, along with kinetic analysis of several mutants, allowed us to propose a catalytic

  20. Modeling the detailed kinetics of mitochondrial cytochrome c oxidase: Catalytic mechanism and nitric oxide inhibition.

    Science.gov (United States)

    Pannala, Venkat R; Camara, Amadou K S; Dash, Ranjan K

    2016-11-01

    Cytochrome c oxidase (CcO) catalyzes the exothermic reduction of O 2 to H 2 O by using electrons from cytochrome c, and hence plays a crucial role in ATP production. Although details on the enzyme structure and redox centers involved in O 2 reduction have been known, there still remains a considerable ambiguity on its mechanism of action, e.g., the number of sequential electrons donated to O 2 in each catalytic step, the sites of protonation and proton pumping, and nitric oxide (NO) inhibition mechanism. In this work, we developed a thermodynamically constrained mechanistic mathematical model for the catalytic action of CcO based on available kinetic data. The model considers a minimal number of redox centers on CcO and couples electron transfer and proton pumping driven by proton motive force (PMF), and accounts for the inhibitory effects of NO on the reaction kinetics. The model is able to fit well all the available kinetic data under diverse experimental conditions with a physiologically realistic unique parameter set. The model predictions show that: 1) the apparent K m of O 2 varies considerably and increases from fully reduced to fully oxidized cytochrome c depending on pH and the energy state of mitochondria, and 2) the intermediate enzyme states depend on pH and cytochrome c redox fraction and play a central role in coupling mitochondrial respiration to PMF. The developed CcO model can easily be integrated into existing mitochondrial bioenergetics models to understand the role of the enzyme in controlling oxidative phosphorylation in normal and disease conditions. Copyright © 2016 the American Physiological Society.

  1. Growth Inhibition of Refractory Human Gallbladder Cancer Cells by Retinol, and Its Mechanism of Action.

    Science.gov (United States)

    Li, Chuan; Imai, Masahiko; Hasegawa, Shinya; Yamasaki, Masahiro; Takahashi, Noriko

    2017-04-01

    Among the constituents of the essential nutrient vitamin A, retinol is a potent suppressor of refractory cancer cell growth linked to tumor progression, showing greater efficacy than retinoic acid (RA). However, the mechanisms of retinol action on human refractory cancer are not known well. In the current study, we examined the actions of retinol on proliferation of human gallbladder cancer NOZ C-1 cells. Retinol and RA inhibited the proliferation of human NOZ C-1 cells in dose-dependent manner, while RA was less potent than retinol. Cell incorporation of RA was approximately two-fold higher than retinol and was not correlated with anti-proliferative activity. Retinol did not affect caspase-3 activity or mRNA expression of Bax and Bcl-2, which are associated with apoptosis. In addition, protein expression of phosphorylated extracellular signal-regulated kinase (p-ERK)/ERK and p-Akt/Akt were not significantly changed by retinol treatment. In contrast, retinol treatment significantly increased the mRNA expression of endoplasmic reticulum (ER) stress factors (heme oxygenase 1 (HMOX1), CCAAT/enhancer-binding protein homologous protein (CHOP), 78 kDa glucose-regulated protein (GRP78), and DnaJ (Hsp40) homolog, subfamily B, member 9 (DNAJB9)). Furthermore, the number of cells in the G 0 /G 1 phase was increased, while the number of cells in the S phase were decreased by retinol treatment. Retinol increased expression of the autophagy-associated protein, LC3-II. These results indicate that retinol is a potent suppressor of gallbladder cancer cell growth by mechanisms that involve ER stress, which results in autophagy and cell cycle delay. This suggests that retinol might be useful for anticancer prevention and therapy in the clinic.

  2. Small molecules VP-14637 and JNJ-2408068 inhibit respiratory syncytial virus fusion by similar mechanisms.

    Science.gov (United States)

    Douglas, Janet L; Panis, Marites L; Ho, Edmund; Lin, Kuei-Ying; Krawczyk, Steve H; Grant, Deborah M; Cai, Ruby; Swaminathan, Swami; Chen, Xiaowu; Cihlar, Tomas

    2005-06-01

    Here we present data on the mechanism of action of VP-14637 and JNJ-2408068 (formerly R-170591), two small-molecule inhibitors of respiratory syncytial virus (RSV). Both inhibitors exhibited potent antiviral activity with 50% effective concentrations (EC50s) of 1.4 and 2.1 nM, respectively. A similar inhibitory effect was observed in a RSV-mediated cell fusion assay (EC50=5.4 and 0.9 nM, respectively). Several drug-resistant RSV variants were selected in vitro in the presence of each compound. All selected viruses exhibited significant cross-resistance to both inhibitors and contained various single amino acid substitutions in two distinct regions of the viral F protein, the heptad repeat 2 (HR2; mutations D486N, E487D, and F488Y), and the intervening domain between HR1 and HR2 (mutation K399I and T400A). Studies using [3H]VP-14637 revealed a specific binding of the compound to RSV-infected cells that was efficiently inhibited by JNJ-2408068 (50% inhibitory concentration=2.9 nM) but not by the HR2-derived peptide T-118. Further analysis using a transient T7 vaccinia expression system indicated that RSV F protein is sufficient for this interaction. F proteins containing either the VP-14637 or JNJ-2408068 resistance mutations exhibited greatly reduced binding of [3H]VP-14637. Molecular modeling analysis suggests that both molecules may bind into a small hydrophobic cavity in the inner core of F protein, interacting simultaneously with both the HR1 and HR2 domains. Altogether, these data indicate that VP-14637 and JNJ-2408068 interfere with RSV fusion through a mechanism involving a similar interaction with the F protein.

  3. Classification and possible mechanisms of action of some drugs that inhibit platelet aggregation

    International Nuclear Information System (INIS)

    Holmsen, H.

    1976-01-01

    Aggregating agents usually activate the 'basic platelet reaction' which induces the functions of shape change, aggregation, dense granule secretion and α-granule secretion in platelets. The process is subdivided into induction, transmission and execution. During induction the agents interact with membrane receptors that are specific for each indicidual agent. The subsequent transmission is identical for all inducers and is believed to make Ca 2+ available in the cytosol which may trigger ATP-dependent processes, perhaps contractile mechanisms. It is hypothesized that the degree of the propagation of the basic platelet reaction is proportional to the concentration of cytocolic Ca 2+ and that this concentration is proportional to the strength of the induction phase. At an early stage in this propagation, the membrane is induced to alter its form and at a later stage it is made adhesive toward other platelets' membranes. At still later stages, the process brings the membrane into contact with dense granules and α-granules. The execution of the measurable platelet functions can occur at these stages, but only when certain conditions are fulfilled. The dense granule secretion process is important, since the platelet aggregating agents ADP and cyclic endoperoxides are made available and increase the overall stimulus of the basic platelet reaction (positive feedback). Drugs and substances that inhibit aggregation can be subdivided into extrinsic and intrisic inhibitors. (author)

  4. Will the Amaranthus tuberculatus Resistance Mechanism to PPO-Inhibiting Herbicides Evolve in Other Amaranthus Species?

    Directory of Open Access Journals (Sweden)

    Chance W. Riggins

    2012-01-01

    Full Text Available Resistance to herbicides that inhibit protoporphyrinogen oxidase (PPO has been slow to evolve and, to date, is confirmed for only four weed species. Two of these species are members of the genus Amaranthus L. Previous research has demonstrated that PPO-inhibitor resistance in A. tuberculatus (Moq. Sauer, the first weed to have evolved this type of resistance, involves a unique codon deletion in the PPX2 gene. Our hypothesis is that A. tuberculatus may have been predisposed to evolving this resistance mechanism due to the presence of a repetitive motif at the mutation site and that lack of this motif in other amaranth species is why PPO-inhibitor resistance has not become more common despite strong herbicide selection pressure. Here we investigate inter- and intraspecific variability of the PPX2 gene—specifically exon 9, which includes the mutation site—in ten amaranth species via sequencing and a PCR-RFLP assay. Few polymorphisms were observed in this region of the gene, and intraspecific variation was observed only in A. quitensis. However, sequencing revealed two distinct repeat patterns encompassing the mutation site. Most notably, A. palmeri S. Watson possesses the same repetitive motif found in A. tuberculatus. We thus predict that A. palmeri will evolve resistance to PPO inhibitors via the same PPX2 codon deletion that evolved in A. tuberculatus.

  5. Mechanism and stereoselectivity of HDAC I inhibition by (R)-9-hydroxystearic acid in colon cancer.

    Science.gov (United States)

    Parolin, Carola; Calonghi, Natalia; Presta, Enrica; Boga, Carla; Caruana, Paolo; Naldi, Marina; Andrisano, Vincenza; Masotti, Lanfranco; Sartor, Giorgio

    2012-10-01

    9-Hydroxystearic acid (9-HSA) belongs to the endogenous lipid peroxidation by-products that decrease in tumors, causing as a consequence the loss of one of the control mechanisms on cell division. It acts as a histone deacetylase (HDAC, E.C 3.5.1.98) inhibitor, and the interaction of the two enantiomers of 9-HSA with the catalytic site of the enzyme, investigated by using a molecular modelling approach, has been reported to be different. In this work we tested out this prediction by synthesizing the two enantiomers (R)-9-HSA (R-9) and (S)-9-HSA (S-9) starting from the natural source methyl dimorphecolate obtained from Dimorphotheca sinuata seeds and investigating their biological activity in HT29 cells. Both enantiomers inhibit the enzymatic activity of HDAC1, HDAC2 and HDAC3, R-9 being more active; R-9 and S-9 inhibitory effect induces an increase in histone H4 acetylation. We also demonstrate that the antiproliferative effect brought about by R-9 is more pronounced as well as we observe increase of p21 transcription and protein content, while the expression of cyclin D1 is decreased. Starting from these observations it can be hypothesized that the interaction of R-9 with HDAC1 induce conformational changes in the enzyme causing loss of its interaction with other proteins, like cyclin D1 itself. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Multiple Molecular and Cellular Mechanisms of Action of Lycopene in Cancer Inhibition

    Directory of Open Access Journals (Sweden)

    Cristina Trejo-Solís

    2013-01-01

    Full Text Available Epidemiological studies suggest that including fruits, vegetables, and whole grains in regular dietary intake might prevent and reverse cellular carcinogenesis, reducing the incidence of primary tumours. Bioactive components present in food can simultaneously modulate more than one carcinogenic process, including cancer metabolism, hormonal balance, transcriptional activity, cell-cycle control, apoptosis, inflammation, angiogenesis and metastasis. Some studies have shown an inverse correlation between a diet rich in fruits, vegetables, and carotenoids and a low incidence of different types of cancer. Lycopene, the predominant carotenoid found in tomatoes, exhibits a high antioxidant capacity and has been shown to prevent cancer, as evidenced by clinical trials and studies in cell culture and animal models. In vitro studies have shown that lycopene treatment can selectively arrest cell growth and induce apoptosis in cancer cells without affecting normal cells. In vivo studies have revealed that lycopene treatment inhibits tumour growth in the liver, lung, prostate, breast, and colon. Clinical studies have shown that lycopene protects against prostate cancer. One of the main challenges in cancer prevention is the integration of new molecular findings into clinical practice. Thus, the identification of molecular biomarkers associated with lycopene levels is essential for improving our understanding of the mechanisms underlying its antineoplastic activity.

  7. Exploring the mechanism of high degree of delignification inhibits cellulose conversion efficiency.

    Science.gov (United States)

    Ding, Dayong; Zhou, Xia; You, Tingting; Zhang, Xun; Zhang, Xueming; Xu, Feng

    2018-02-01

    This study explored the mechanism that high degree of delignification (DD) inhibits enzymatic hydrolysis. Sample with DD of 86.22% achieved the highest cellulose conversion of 68.26%, and the cell wall exhibited defibrillation of macrofibrils and erosion of microfibrils during enzymatic hydrolysis. Cracks between microfibrils are formed within the cell wall, getting the largest specific surface area, which greatly enhanced cellulose conversion. However, high DD of 96.58% resulted in dramatic reduction of cellulose conversion to 56.60% which was evidenced to be the synergistic effect of internal cell wall collapse and microfibrils reaggregation. These ultrastructural changes dominated upon this condition and induced a more compact surface structure which significantly hinders the accessibility of cellulase. The CrI value increased after delignification but changed little with the increased DD, suggesting limited influence of DD on crystalline structure. The results indicate that certain amount of lignin retained may be essential to enhance cellulose conversion. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Structure of the Mycobacterium tuberculosis proteasome and mechanism of inhibition by a peptidyl boronate

    Energy Technology Data Exchange (ETDEWEB)

    Hu,G.; Lin, G.; Wang, M.; Dick, L.; Xu, R.; Nathan, C.; Li, H.

    2006-01-01

    Mycobacterium tuberculosis (Mtb) has the remarkable ability to resist killing by human macrophages. The 750 kDa proteasome, not available in most eubacteria except Actinomycetes, appears to contribute to Mtb's resistance. The crystal structure of the Mtb proteasome at 3.0 Angstroms resolution reveals a substrate-binding pocket with composite features of the distinct {beta}1, {beta}2 and {beta}5 substrate binding sites of eukaryotic proteasomes, accounting for the broad specificity of the Mtb proteasome towards oligopeptides described in the companion article [Lin et al. (2006), Mol Microbiol doi:10.1111/j.1365-2958.2005.05035.x]. The substrate entrance at the end of the cylindrical proteasome appears open in the crystal structure due to partial disorder of the a-subunit N-terminal residues. However, cryo-electron microscopy of the core particle reveals a closed end, compatible with the density observed in negative-staining electron microscopy that depended on the presence of the N-terminal octapeptides of the a-subunits in the companion article, suggesting that the Mtb proteasome has a gated structure. We determine for the first time the proteasomal inhibition mechanism of the dipeptidyl boronate N-(4-morpholine)carbonyl-{beta}-(1-naphthyl)-l-alanine-l-leucine boronic acid (MLN-273), an analogue of the antimyeloma drug bortezomib. The structure improves prospects for designing Mtb-specific proteasomal inhibitors as a novel approach to chemotherapy of tuberculosis.

  9. Research on corrosion mechanism of suspension insulator steel foot of direct current system and measures for corrosion inhibition

    Science.gov (United States)

    Chen, He; Yang, Yueguang; Su, Guolei; Wang, Xiaoqing; Zhang, Hourong; Sun, Xiaoyu; Fan, Youping

    2017-09-01

    There are increasingly serious electrocorrosion phenomena on insulator hardware caused by direct current transmission due to the wide-range popularization of extra high voltage direct current transmission engineering in our country. Steel foot corrosion is the main corrosion for insulators on positive polarity side of transmission lines. On one hand, the corrosion leads to the tapering off of steel foot diameter, having a direct influence on mechanical property of insulators; on the other hand, in condition of corrosion on steel foot wrapped in porcelain ware, the volume of the corrosion product is at least 50% more than that of the original steel foot, leading to bursting of porcelain ware, threatening safe operation of transmission lines. Therefore, it is necessary to conduct research on the phenomenon and propose feasible measures for corrosion inhibition. Starting with the corrosion mechanism, this article proposes two measures for corrosion inhibition, and verifies the inhibition effect in laboratory conditions, providing reference for application in engineering.

  10. Mechanisms of inhibition of CaV3.1 T-type calcium current by aliphatic alcohols

    OpenAIRE

    Eckle, Veit-Simon; Todorovic, Slobodan M

    2010-01-01

    Many aliphatic alcohols modulate activity of various ion channels involved in sensory processing and also exhibit anesthetic capacity in vivo. Although the interaction of one such compound, 1-octanol (octanol) with different T-type calcium channels (T-channels) has been described, the mechanisms of current modulation and its functional significance are not well studied. Using patch-clamp technique, we investigated the mechanisms of inhibition of T-currents by a series of aliphatic alcohols in...

  11. A Common Mechanism for Resistance to Oxime Reactivation of Acetylcholinesterase Inhibited by Organophosphorus Compounds

    Science.gov (United States)

    2013-01-01

    reactivators, we conducted a QSAR analysis for oxime reactivation of AChE inhibited by OP agents and their analogues. Our objective was to identify...reactivation as tabun-inhibited AChE. QSAR analysis of oxime reactivation of AChE inhibited by these OP compounds and others suggested that the presence of...organophosphorus; QSAR , quan- titative structure–activity relationship; VR, O-isobutyl methylphosphonofluoridate. ⇑ Corresponding author. Tel.: +1 410

  12. A new bacterial staining method involving Gram stain with theoretical considerations of the staining mechanism.

    Science.gov (United States)

    Noda, Y; Tôei, K

    1992-01-01

    In order to investigate the mechanism of Gram staining of bacteria, tests with anionic dyes followed by treatment with cationic octyltrimethylammonium (OTMA) were carried out. The study revealed that tetrabromophenolphthalein ethylester (TBPE) gave the most reliable staining of Gram-negative bacteria with negative staining of Gram-positive bacteria. Tests on many species of bacteria showed that TBPE positive bacteria were Gram-negative and vice versa, without exception.

  13. Investigation of the Mechanism That Powers DNA Translocation During Bacterial Natural Transformation

    OpenAIRE

    Foster, Hannah

    2016-01-01

    If deoxyribonucleic acids are the building blocks of life, perhaps the proteins that move, shape, and assemble nucleic acids should be called architects. These proteins come in every size and shape and have vastly different roles and mechanisms, but they share one thing in common: they help determine what life looks like by their interactions with DNA and RNA. Several of these protein architects play integral roles in the spread of genetic material among bacteria in natural transformation, th...

  14. Mechanism of inhibition and induction of cytolytic activity in cytotoxic T lymphocytes by CD3 monoclonal antibodies

    NARCIS (Netherlands)

    van Seventer, G. A.; Kuijpers, K. C.; van Lier, R. A.; de Groot, E. R.; Aarden, L. A.; Melief, C. J.

    1987-01-01

    The objective of this study was to elucidate the mechanism responsible for inhibition as well as induction of cytolytic activity in cytotoxic T lymphocytes (CTL) by cluster-defined 3 (T3) (CD3) monoclonal antibodies (mAb). A series of isotype heavy chain switch variants (murine IgG1, IgG2a, IgG2b,

  15. Ricinoleic acid inhibits methanogenesis and fatty acid biohydrogenation in ruminal digesta from sheep and in bacterial cultures.

    Science.gov (United States)

    Ramos Morales, E; Mata Espinosa, M A; McKain, N; Wallace, R J

    2012-12-01

    Ricinoleic acid (RA; 12-hydroxy-cis-9-18:1) is the main fatty acid component of castor oil. Although a precursor for CLA synthesis in lactic acid bacteria, RA was found previously not to form CLA in ruminal digesta but to have some inhibitory properties. The present study was undertaken to evaluate the potential of RA to modulate ruminal biohydrogenation and methanogenesis. Ruminal digesta from 4 sheep receiving a mixed hay-concentrate diet was incubated in vitro with 0.167 g/L of linoleic acid (LA; cis-9,cis-12-18:2) or with a combination of LA and RA or LA and castor oil (LA, RA, and castor oil added to a final concentration of 0.167 g/L) in the presence and absence of lipase. The CLA rumenic acid (cis-9,trans-11-18:2) accumulated when either RA or castor oil and lipase was present. Vaccenic acid (VA; trans-11-18:1) also accumulated, and a decrease of the rate of production of stearic acid (SA; 18:0) was observed. When LA was incubated with castor oil in the absence of lipase, no effects on biohydrogenation were observed. Ricinoleic acid at 0.02 g/L did not affect growth of Butyrivibrio fibrisolvens but it inhibited growth of Butyrivibrio proteoclasticus. Butyrivibrio proteoclasticus but not B. fibrisolvens metabolized RA to 12-hydroxystearate. Linoleic acid metabolism by B. proteoclasticus appeared to be unaffected by RA addition whereas rumenic acid accumulation increased (P = 0.015 at 12 h) when RA was added. A 28% decrease (P = 0.004) in methane was obtained in 24 h in vitro incubations of diluted buffered ruminal fluid with added 0.2 g RA/L. There was no effect on the total concentration of VFA after 24 h as a result of RA addition, but the molar proportions of acetate and butyrate were decreased (P = 0.041 and P methane emissions. In vivo studies are now required to confirm the potential of these additives.

  16. Antimalarial Drug Artemether Inhibits Neuroinflammation in BV2 Microglia Through Nrf2-Dependent Mechanisms.

    Science.gov (United States)

    Okorji, Uchechukwu P; Velagapudi, Ravikanth; El-Bakoush, Abdelmeneim; Fiebich, Bernd L; Olajide, Olumayokun A

    2016-11-01

    Artemether, a lipid-soluble derivative of artemisinin has been reported to possess anti-inflammatory properties. In this study, we have investigated the molecular mechanisms involved in the inhibition of neuroinflammation by the drug. The effects of artemether on neuroinflammation-mediated HT22 neuronal toxicity were also investigated in a BV2 microglia/HT22 neuron co-culture. To investigate effects on neuroinflammation, we used LPS-stimulated BV2 microglia treated with artemether (5-40 μM) for 24 h. ELISAs and western blotting were used to detect pro-inflammatory cytokines, nitric oxide, prostaglandin E 2 (PGE 2 ), inducible nitric oxide synthase (iNOS), cyclooxygenase (COX)-2 and microsomal prostaglandin E synthase-1 (mPGES-1). Beta-site amyloid precursor protein cleaving enzyme 1 (BACE-1) activity and Aβ levels were measured with ELISA kits. Protein levels of targets in nuclear factor kappa B (NF-κB) and p38 mitogen-activated protein kinase (MAPK) signalling, as well as heme oxygenase-1 (HO-1), NQO1 and nuclear factor-erythroid 2-related factor 2 (Nrf2) were also measured with western blot. NF-κB binding to the DNA was investigated using electrophoretic mobility shift assays (EMSA). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), DNA fragmentation and reactive oxygen species (ROS) assays in BV2-HT22 neuronal co-culture were used to evaluate the effects of artemether on neuroinflammation-induced neuronal death. The role of Nrf2 in the anti-inflammatory activity of artemether was investigated in BV2 cells transfected with Nrf2 siRNA. Artemether significantly suppressed pro-inflammatory mediators (NO/iNOS, PGE 2 /COX-2/mPGES-1, tumour necrosis factor-alpha (TNFα) and interleukin (IL)-6); Aβ and BACE-1 in BV2 cells following LPS stimulation. These effects of artemether were shown to be mediated through inhibition of NF-κB and p38 MAPK signalling. Artemether produced increased levels of HO-1, NQO1 and GSH in BV2 microglia. The drug

  17. Insight into the molecular basis of pathogen abundance: group A Streptococcus inhibitor of complement inhibits bacterial adherence and internalization into human cells.

    Science.gov (United States)

    Hoe, Nancy P; Ireland, Robin M; DeLeo, Frank R; Gowen, Brian B; Dorward, David W; Voyich, Jovanka M; Liu, Mengyao; Burns, Eugene H; Culnan, Derek M; Bretscher, Anthony; Musser, James M

    2002-05-28

    Streptococcal inhibitor of complement (Sic) is a secreted protein made predominantly by serotype M1 Group A Streptococcus (GAS), which contributes to persistence in the mammalian upper respiratory tract and epidemics of human disease. Unexpectedly, an isogenic sic-negative mutant adhered to human epithelial cells significantly better than the wild-type parental strain. Purified Sic inhibited the adherence of a sic negative serotype M1 mutant and of non-Sic-producing GAS strains to human epithelial cells. Sic was rapidly internalized by human epithelial cells, inducing cell flattening and loss of microvilli. Ezrin and moesin, human proteins that functionally link the cytoskeleton to the plasma membrane, were identified as Sic-binding proteins by affinity chromatography and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis. Sic colocalized with ezrin inside epithelial cells and bound to the F-actin-binding site region located in the carboxyl terminus of ezrin and moesin. Synthetic peptides corresponding to two regions of Sic had GAS adherence-inhibitory activity equivalent to mature Sic and inhibited binding of Sic to ezrin. In addition, the sic mutant was phagocytosed and killed by human polymorphonuclear leukocytes significantly better than the wild-type strain, and Sic colocalized with ezrin in discrete regions of polymorphonuclear leukocytes. The data suggest that binding of Sic to ezrin alters cellular processes critical for efficient GAS contact, internalization, and killing. Sic enhances bacterial survival by enabling the pathogen to avoid the intracellular environment. This process contributes to the abundance of M1 GAS in human infections and their ability to cause epidemics.

  18. Molecular mechanisms underlying mancozeb-induced inhibition of TNF-alpha production

    International Nuclear Information System (INIS)

    Corsini, Emanuela; Viviani, Barbara; Birindelli, Sarah; Gilardi, Federica; Torri, Anna; Codeca, Ilaria; Lucchi, Laura; Bartesaghi, Stefano; Galli, Corrado L.; Marinovich, Marina; Colosio, Claudio

    2006-01-01

    Mancozeb, a polymeric complex of manganese ethylenebisdithiocarbamate with zinc salt, is widely used in agriculture as fungicide. Literature data indicate that ethylenebisdithiocarbamates (EBDTCs) may have immunomodulatory effects in humans. We have recently found in agricultural workers occupationally exposed to the fungicide mancozeb a statistically significant decrease in lipopolysaccharide (LPS)-induced tumor necrosis factor-alpha (TNF) production in leukocytes. TNF is an essential proinflammatory cytokine whose production is normally stimulated during an infection. The purpose of this work was to establish an in vitro model reflecting in vivo data and to characterize the molecular mechanism of action of mancozeb. The human promyelocytic cell line THP-1 was used as in vitro model to study the effects of mancozeb and its main metabolite ethylenthiourea (ETU) on LPS-induced TNF release. Mancozeb, but not ETU, at non-cytotoxic concentrations (1-100 μg/ml), induced a dose- and time-dependent inhibition of LPS-induced TNF release, reflecting in vivo data. The modulatory effect observed was not limited to mancozeb but also other EBDTCs, namely zineb and ziram, showed similar inhibitory effects. Mancozeb must be added before or simultaneously to LPS in order to observe the effect, indicating that it acts on early events triggered by LPS. It is known that nuclear factor-κB (NF-κB) tightly regulates TNF transcription. We could demonstrate that mancozeb, modulating LPS-induced reactive oxygen species generation, prevented IκB degradation and NF-κB nuclear translocation, which in turn resulted in decreased TNF production. To further understand the mechanism of the effect of mancozeb on TNF transcription, THP-1 cells were transfected with NF-κB promoter-luciferase construct, and the effect of mancozeb on luciferase activity was measured. Cells transfected with promoter constructs containing κB site showed decreased LPS-induced luciferase activity relative to control

  19. Mechanical unloading reduces microtubule actin crosslinking factor 1 expression to inhibit β-catenin signaling and osteoblast proliferation.

    Science.gov (United States)

    Yin, Chong; Zhang, Yan; Hu, Lifang; Tian, Ye; Chen, Zhihao; Li, Dijie; Zhao, Fan; Su, Peihong; Ma, Xiaoli; Zhang, Ge; Miao, Zhiping; Wang, Liping; Qian, Airong; Xian, Cory J

    2017-12-08

    Mechanical unloading was considered a major threat to bone homeostasis, and has been shown to decrease osteoblast proliferation although the underlying mechanism is unclear. Microtubule actin crosslinking factor 1 (MACF1) is a cytoskeletal protein that regulates cellular processes and Wnt/β-catenin pathway, an essential signaling pathway for osteoblasts. However, the relationship between MACF1 expression and mechanical unloading, and the function and the associated mechanisms of MACF1 in regulating osteoblast proliferation are unclear. This study investigated effects of mechanical unloading on MACF1 expression levels in cultured MC3T3-E1 osteoblastic cells and in femurs of mice with hind limb unloading; and it also examined the role and potential action mechanisms of MACF1 in osteoblast proliferation in MACF1-knockdown, overexpressed or control MC3T3-E1 cells treated with or without the mechanical unloading condition. Results showed that the mechanical unloading condition inhibited osteoblast proliferation and MACF1 expression in MC3T3-E1 osteoblastic cells and mouse femurs. MACF1 knockdown decreased osteoblast proliferation, while MACF1 overexpression increased it. The inhibitory effect of mechanical unloading on osteoblast proliferation also changed with MACF1 expression levels. Furthermore, MACF1 was found to enhance β-catenin expression and activity, and mechanical unloading decreased β-catenin expression through MACF1. Moreover, β-catenin was found an important regulator of osteoblast proliferation, as its preservation by treatment with its agonist lithium attenuated the inhibitory effects of MACF1-knockdown or mechanical unloading on osteoblast proliferation. Taken together, mechanical unloading decreases MACF1 expression, and MACF1 up-regulates osteoblast proliferation through enhancing β-catenin signaling. This study has thus provided a mechanism for mechanical unloading-induced inhibited osteoblast proliferation. © 2017 Wiley Periodicals, Inc.

  20. Panax ginseng has anti-infective activity against opportunistic pathogen Pseudomonas aeruginosa by inhibiting quorum sensing, a bacterial communication process critical for establishing infection

    DEFF Research Database (Denmark)

    Song, Z; Kong, K F; Wu, H

    2010-01-01

    Virulent factors produced by pathogens play an important role in the infectious process, which is regulated by a cell-to-cell communication mechanism called quorum sensing (QS). Pseudomonas aeruginosa is an important opportunistic human pathogen, which causes infections in patients with compromised......-controlled virulence factors on the prototypic P. aeruginosa PAO1 and its isogenic mucoid variant (PAOmucA22) was determined. Ginseng did not inhibit the growth of the bacteria, enhanced the extracellular protein production and stimulated the production of alginate. However, ginseng suppressed the production of Las...

  1. Mechanism of Bacterial Inactivation by (+)-Limonene and Its Potential Use in Food Preservation Combined Processes

    Science.gov (United States)

    Espina, Laura; Gelaw, Tilahun K.; de Lamo-Castellví, Sílvia; Pagán, Rafael; García-Gonzalo, Diego

    2013-01-01

    This work explores the bactericidal effect of (+)-limonene, the major constituent of citrus fruits' essential oils, against E. coli. The degree of E. coli BJ4 inactivation achieved by (+)-limonene was influenced by the pH of the treatment medium, being more bactericidal at pH 4.0 than at pH 7.0. Deletion of rpoS and exposure to a sub-lethal heat or an acid shock did not modify E. coli BJ4 resistance to (+)-limonene. However, exposure to a sub-lethal cold shock decreased its resistance to (+)-limonene. Although no sub-lethal injury was detected in the cell envelopes after exposure to (+)-limonene by the selective-plating technique, the uptake of propidium iodide by inactivated E. coli BJ4 cells pointed out these structures as important targets in the mechanism of action. Attenuated Total Reflectance Infrared Microspectroscopy (ATR-IRMS) allowed identification of altered E. coli BJ4 structures after (+)-limonene treatments as a function of the treatment pH: β-sheet proteins at pH 4.0 and phosphodiester bonds at pH 7.0. The increased sensitivity to (+)-limonene observed at pH 4.0 in an E. coli MC4100 lptD4213 mutant with an increased outer membrane permeability along with the identification of altered β-sheet proteins by ATR-IRMS indicated the importance of this structure in the mechanism of action of (+)-limonene. The study of mechanism of inactivation by (+)-limonene led to the design of a synergistic combined process with heat for the inactivation of the pathogen E. coli O157:H7 in fruit juices. These results show the potential of (+)-limonene in food preservation, either acting alone or in combination with lethal heat treatments. PMID:23424676

  2. Mechanism of bacterial inactivation by (+-limonene and its potential use in food preservation combined processes.

    Directory of Open Access Journals (Sweden)

    Laura Espina

    Full Text Available This work explores the bactericidal effect of (+-limonene, the major constituent of citrus fruits' essential oils, against E. coli. The degree of E. coli BJ4 inactivation achieved by (+-limonene was influenced by the pH of the treatment medium, being more bactericidal at pH 4.0 than at pH 7.0. Deletion of rpoS and exposure to a sub-lethal heat or an acid shock did not modify E. coli BJ4 resistance to (+-limonene. However, exposure to a sub-lethal cold shock decreased its resistance to (+-limonene. Although no sub-lethal injury was detected in the cell envelopes after exposure to (+-limonene by the selective-plating technique, the uptake of propidium iodide by inactivated E. coli BJ4 cells pointed out these structures as important targets in the mechanism of action. Attenuated Total Reflectance Infrared Microspectroscopy (ATR-IRMS allowed identification of altered E. coli BJ4 structures after (+-limonene treatments as a function of the treatment pH: β-sheet proteins at pH 4.0 and phosphodiester bonds at pH 7.0. The increased sensitivity to (+-limonene observed at pH 4.0 in an E. coli MC4100 lptD4213 mutant with an increased outer membrane permeability along with the identification of altered β-sheet proteins by ATR-IRMS indicated the importance of this structure in the mechanism of action of (+-limonene. The study of mechanism of inactivation by (+-limonene led to the design of a synergistic combined process with heat for the inactivation of the pathogen E. coli O157:H7 in fruit juices. These results show the potential of (+-limonene in food preservation, either acting alone or in combination with lethal heat treatments.

  3. Bacterial biofilms, resistance mechanisms to disinfection; Biopeliculas bacterianas (biofilms), mecanismos de resistencia a la desinfeccion

    Energy Technology Data Exchange (ETDEWEB)

    Codony Iglesias, F.; Morato Farreras, J.

    2002-07-01

    Biofilm is a cell community attached to a support surface, frequently enmeshed within a polymeric matrix secreted by the bacteria. Usually, such structures are developed in a wide range of materials. This development as attached to surfaces or forming suspended aggregates, greatly improve the microbial growth and their survival. This fact may be responsible of adverse effects over equipment and may constitute a public health hazard. In this work are reviewed the basis of the different microbial resistance mechanisms to disinfection from the cellular level to more complex microbial structure. (Author) 16 refs.

  4. Structure and Mechanism of the S Component of a Bacterial ECF Transporter

    Energy Technology Data Exchange (ETDEWEB)

    P Zhang; J Wang; Y Shi

    2011-12-31

    The energy-coupling factor (ECF) transporters, responsible for vitamin uptake in prokaryotes, are a unique family of membrane transporters. Each ECF transporter contains a membrane-embedded, substrate-binding protein (known as the S component), an energy-coupling module that comprises two ATP-binding proteins (known as the A and A' components) and a transmembrane protein (known as the T component). The structure and transport mechanism of the ECF family remain unknown. Here we report the crystal structure of RibU, the S component of the ECF-type riboflavin transporter from Staphylococcus aureus at 3.6-{angstrom} resolution. RibU contains six transmembrane segments, adopts a previously unreported transporter fold and contains a riboflavin molecule bound to the L1 loop and the periplasmic portion of transmembrane segments 4-6. Structural analysis reveals the essential ligand-binding residues, identifies the putative transport path and, with sequence alignment, uncovers conserved structural features and suggests potential mechanisms of action among the ECF transporters.

  5. Perceptual Surprise Improves Action Stopping by Nonselectively Suppressing Motor Activity via a Neural Mechanism for Motor Inhibition.

    Science.gov (United States)

    Dutra, Isabella C; Waller, Darcy A; Wessel, Jan R

    2018-02-07

    important in daily life (e.g., stopping to cross the street when a car approaches) and is severely impaired in many neuropsychiatric disorders. Therefore, finding ways to improve action stopping could aid adaptive behaviors in health and disease. Our current study shows that presenting unexpected sounds in stopping situations facilitates successful stopping. This improvement is specifically due to a surprise-related increase in a neural mechanism for motor inhibition, which rapidly suppresses the excitability of the motor system after unexpected events. These findings suggest a tight interaction between the neural systems for surprise processing and motor inhibition and yield a promising avenue for future research. Copyright © 2018 the authors 0270-6474/18/381482-11$15.00/0.

  6. Anti-protozoal and anti-bacterial antibiotics that inhibit protein synthesis kill cancer subtypes enriched for stem cell-like properties.

    Science.gov (United States)

    Cuyàs, Elisabet; Martin-Castillo, Begoña; Corominas-Faja, Bruna; Massaguer, Anna; Bosch-Barrera, Joaquim; Menendez, Javier A

    2015-01-01

    Key players in translational regulation such as ribosomes might represent powerful, but hitherto largely unexplored, targets to eliminate drug-refractory cancer stem cells (CSCs). A recent study by the Lisanti group has documented how puromycin, an old antibiotic derived from Streptomyces alboniger that inhibits ribosomal protein translation, can efficiently suppress CSC states in tumorspheres and monolayer cultures. We have used a closely related approach based on Biolog Phenotype Microarrays (PM), which contain tens of lyophilized antimicrobial drugs, to assess the chemosensitivity profiles of breast cancer cell lines enriched for stem cell-like properties. Antibiotics directly targeting active sites of the ribosome including emetine, puromycin and cycloheximide, inhibitors of ribosome biogenesis such as dactinomycin, ribotoxic stress agents such as daunorubicin, and indirect inhibitors of protein synthesis such as acriflavine, had the largest cytotoxic impact against claudin-low and basal-like breast cancer cells. Thus, biologically aggressive, treatment-resistant breast cancer subtypes enriched for stem cell-like properties exhibit exacerbated chemosensitivities to anti-protozoal and anti-bacterial antibiotics targeting protein synthesis. These results suggest that old/existing microbicides might be repurposed not only as new cancer therapeutics, but also might provide the tools and molecular understanding needed to develop second-generation inhibitors of ribosomal translation to eradicate CSC traits in tumor tissues.

  7. Anti-protozoal and anti-bacterial antibiotics that inhibit protein synthesis kill cancer subtypes enriched for stem cell-like properties

    Science.gov (United States)

    Cuyàs, Elisabet; Martin-Castillo, Begoña; Corominas-Faja, Bruna; Massaguer, Anna; Bosch-Barrera, Joaquim; Menendez, Javier A

    2015-01-01

    Key players in translational regulation such as ribosomes might represent powerful, but hitherto largely unexplored, targets to eliminate drug-refractory cancer stem cells (CSCs). A recent study by the Lisanti group has documented how puromycin, an old antibiotic derived from Streptomyces alboniger that inhibits ribosomal protein translation, can efficiently suppress CSC states in tumorspheres and monolayer cultures. We have used a closely related approach based on Biolog Phenotype Microarrays (PM), which contain tens of lyophilized antimicrobial drugs, to assess the chemosensitivity profiles of breast cancer cell lines enriched for stem cell-like properties. Antibiotics directly targeting active sites of the ribosome including emetine, puromycin and cycloheximide, inhibitors of ribosome biogenesis such as dactinomycin, ribotoxic stress agents such as daunorubicin, and indirect inhibitors of protein synthesis such as acriflavine, had the largest cytotoxic impact against claudin-low and basal-like breast cancer cells. Thus, biologically aggressive, treatment-resistant breast cancer subtypes enriched for stem cell-like properties exhibit exacerbated chemosensitivities to anti-protozoal and anti-bacterial antibiotics targeting protein synthesis. These results suggest that old/existing microbicides might be repurposed not only as new cancer therapeutics, but also might provide the tools and molecular understanding needed to develop second-generation inhibitors of ribosomal translation to eradicate CSC traits in tumor tissues. PMID:25970790

  8. Atomic Layer Deposition of a Silver Nanolayer on Advanced Titanium Orthopedic Implants Inhibits Bacterial Colonization and Supports Vascularized de Novo Bone Ingrowth.

    Science.gov (United States)

    Devlin-Mullin, Aine; Todd, Naomi M; Golrokhi, Zahra; Geng, Hua; Konerding, Moritz A; Ternan, Nigel G; Hunt, John A; Potter, Richard J; Sutcliffe, Chris; Jones, Eric; Lee, Peter D; Mitchell, Christopher A

    2017-06-01

    Joint replacement surgery is associated with significant morbidity and mortality following infection with either methicillin-resistant Staphylococcus aureus (MRSA) or Staphylococcus epidermidis. These organisms have strong biofilm-forming capability in deep wounds and on prosthetic surfaces, with 10 3 -10 4 microbes resulting in clinically significant infections. To inhibit biofilm formation, we developed 3D titanium structures using selective laser melting and then coated them with a silver nanolayer using atomic layer deposition. On bare titanium scaffolds, S. epidermidis growth was slow but on silver-coated implants there were significant further reductions in both bacterial recovery (p titanium scaffolds and not further affected by silver coating. Ultrastructural examination and viability assays using either human bone or endothelial cells, demonstrated strong adherence and growth on titanium-only or silver-coated implants. Histological, X-ray computed microtomographic, and ultrastructural analyses revealed that silver-coated titanium scaffolds implanted into 2.5 mm defects in rat tibia promoted robust vascularization and conspicuous bone ingrowth. We conclude that nanolayer silver of titanium implants significantly reduces pathogenic biofilm formation in vitro, facilitates vascularization and osseointegration in vivo making this a promising technique for clinical orthopedic applications. © 2017 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Trichothecene Mycotoxins Inhibit Mitochondrial Translation—Implication for the Mechanism of Toxicity

    Directory of Open Access Journals (Sweden)

    Susan McCormick

    2011-12-01

    Full Text Available Fusarium head blight (FHB reduces crop yield and results in contamination of grains with trichothecene mycotoxins. We previously showed that mitochondria play a critical role in the toxicity of a type B trichothecene. Here, we investigated the direct effects of type A and type B trichothecenes on mitochondrial translation and membrane integrity in Saccharomyces cerevisiae. Sensitivity to trichothecenes increased when functional mitochondria were required for growth, and trichothecenes inhibited mitochondrial translation at concentrations, which did not inhibit total translation. In organello translation in isolated mitochondria was inhibited by type A and B trichothecenes, demonstrating that these toxins have a direct effect on mitochondrial translation. In intact yeast cells trichothecenes showed dose-dependent inhibition of mitochondrial membrane potential and reactive oxygen species, but only at doses higher than those affecting mitochondrial translation. These results demonstrate that inhibition of mitochondrial translation is a primary target of trichothecenes and is not secondary to the disruption of mitochondrial membranes.

  10. New infrared-assisted method for sol-gel derived ZnO:Ag thin films: Structural and bacterial inhibition properties.

    Science.gov (United States)

    González-Penguelly, Brenely; Morales-Ramírez, Ángel de Jesús; Rodríguez-Rosales, Miriam Guadalupe; Rodríguez-Nava, Celestino Odín; Carrera-Jota, María Luz

    2017-09-01

    darkness, to analyze the effect of light. A significance reduction in growth was obtained for doped coatings with silver in comparison with the control ZnO substrate. Furthermore, the analysis bacteria growth inhibition on a solid surface showed that the films effectively present antibacterial activity. The best result was obtained with ZnO:Ag 1% in light conditions, about 67%, but all the coatings inhibited the bacterial activity. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. [Advances in the molecular mechanism of natural bacterial transformation--a review].

    Science.gov (United States)

    Sun, Dongchang; Zhang, Yanmei; Shi, Yuefeng

    2012-01-01

    Naturally transformable bacteria are able to take up DNA to acquire new genetic traits in the environment. To be naturally transformed, bacteria need to establish a physiological state, called natural competence, in which DNA uptake and processing genes are expressed. DNA uptake proteins assemble a complex to pull exogenous DNA into the cytoplasm where it can recombine with the genome DNA or establish as a plasmid. In general, DNA uptake of bacteria could be divided into two stages: DNA is transported from the milieu to the periplasm at the first stage (for Gram-negative bacteria) and is translocated across the inner membrane at the second stage. Our work and other studies revealed new plasmid DNA transformation modes in Escherichia coli. Here, we first reviewed recent advances in the molecular mechanism of natural transformation and then described the distinctive plasmid transformation mode in E. coli.

  12. New Insight into the Catalytic Mechanism of Bacterial MraY from Enzyme Kinetics and Docking Studies*

    Science.gov (United States)

    Liu, Yao; Rodrigues, João P. G. L. M.; Bonvin, Alexandre M. J. J.; Zaal, Esther A.; Berkers, Celia R.; Heger, Michal; Gawarecka, Katarzyna; Swiezewska, Ewa; Breukink, Eefjan; Egmond, Maarten R.

    2016-01-01

    Phospho-MurNAc-pentapeptide translocase (MraY) catalyzes the synthesis of Lipid I, a bacterial peptidoglycan precursor. As such, MraY is essential for bacterial survival and therefore is an ideal target for developing novel antibiotics. However, the understanding of its catalytic mechanism, despite the recently determined crystal structure, remains limited. In the present study, the kinetic properties of Bacillus subtilis MraY (BsMraY) were investigated by fluorescence enhancement using dansylated UDP-MurNAc-pentapeptide and heptaprenyl phosphate (C35-P, short-chain homolog of undecaprenyl phosphate, the endogenous substrate of MraY) as second substrate. Varying the concentrations of both of these substrates and fitting the kinetics data to two-substrate models showed that the concomitant binding of both UDP-MurNAc-pentapeptide-DNS and C35-P to the enzyme is required before the release of the two products, Lipid I and UMP. We built a model of BsMraY and performed docking studies with the substrate C35-P to further deepen our understanding of how MraY accommodates this lipid substrate. Based on these modeling studies, a novel catalytic role was put forward for a fully conserved histidine residue in MraY (His-289 in BsMraY), which has been experimentally confirmed to be essential for MraY activity. Using the current model of BsMraY, we propose that a small conformational change is necessary to relocate the His-289 residue, such that the translocase reaction can proceed via a nucleophilic attack of the phosphate moiety of C35-P on bound UDP-MurNAc-pentapeptide. PMID:27226570

  13. Ion Selectivity Mechanism in a Bacterial Pentameric Ligand-Gated Ion Channel

    International Nuclear Information System (INIS)

    Wang, Hailong; Cheng, Xiaolin

    2011-01-01

    The proton-gated ion channel from Gloeobacter violaceus (GLIC) is a prokaryotic homolog of the eukaryotic nicotinic acetylcholine receptor (nAChR) that responds to the binding of neurotransmitter acetylcholine and mediates fast signal transmission. Recent emergence of a high resolution crystal structure of GLIC captured in a potentially open state allowed detailed, atomic-level insight into ion conduction and selectivity mechanisms in these channels. Herein, we have examined the barriers to ion conduction and origins of ion selectivity in the GLIC channel by the construction of potential of mean force (PMF) profiles for sodium and chloride ions inside the transmembrane region. Our calculations reveal that the GLIC channel is open for a sodium ion to transport, but presents a ∼10 kcal/mol free energy barrier for a chloride ion, which arises primarily from the unfavorable interactions with a ring of negatively charged glutamate residues (E-2) at the intracellular end and a ring of hydrophobic residues (I9) in the middle of the transmembrane domain. Our collective findings further suggest that the charge selection mechanism can, to a large extent, be attributed to the narrow intracellular end and a ring of glutamate residues in this position their strong negative electrostatics and ability to bind cations. By contrast, E19 at the extracellular entrance only plays a minor role in ion selectivity of GLIC. In addition to electrostatics, both ion hydration and protein dynamics are found to be crucial for ion conduction as well, which explains why a chloride ion experiences a much greater barrier than a sodium ion in the hydrophobic region of the pore.

  14. Ion Selectivity Mechanism in a Bacterial Pentameric Ligand-Gated Ion Channel

    Energy Technology Data Exchange (ETDEWEB)

    Fritsch, Sebastian M [ORNL; Ivanov, Ivaylo N [ORNL; Wang, Hailong [Mayo Clinic College of Medicine; Cheng, Xiaolin [ORNL

    2011-01-01

    The proton-gated ion channel from Gloeobacter violaceus (GLIC) is a prokaryotic homolog of the eukaryotic nicotinic acetylcholine receptor (nAChR) that responds to the binding of neurotransmitter acetylcholine and mediates fast signal transmission. Recent emergence of a high resolution crystal structure of GLIC captured in a potentially open state allowed detailed, atomic-level insight into ion conduction and selectivity mechanisms in these channels. Herein, we have examined the barriers to ion conduction and origins of ion selectivity in the GLIC channel by the construction of potential of mean force (PMF) profiles for sodium and chloride ions inside the transmembrane region. Our calculations reveal that the GLIC channel is open for a sodium ion to transport, but presents a ~10 kcal/mol free energy barrier for a chloride ion, which arises primarily from the unfavorable interactions with a ring of negatively charged glutamate residues (E-2 ) at the intracellular end and a ring of hydrophobic residues (I9 ) in the middle of the transmembrane domain. Our collective findings further suggest that the charge selection mechanism can, to a large extent, be attributed to the narrow intracellular end and a ring of glutamate residues in this position their strong negative electrostatics and ability to bind cations. By contrast, E19 at the extracellular entrance only plays a minor role in ion selectivity of GLIC. In addition to electrostatics, both ion hydration and protein dynamics are found to be crucial for ion conduction as well, which explains why a chloride ion experiences a much greater barrier than a sodium ion in the hydrophobic region of the pore.

  15. New therapeutic strategy for hepatocellular carcinoma by molecular targeting agents via inhibition of cellular stress defense mechanisms.

    Science.gov (United States)

    Honma, Yuichi; Harada, Masaru

    2014-12-01

    The prognosis of advanced hepatocellular carcinoma (HCC) has remained very poor.It has recently been reported that the molecular targeting agent sorafenib can improve the prognosis of patients with advanced HCC. However, the detailed mechanisms of sorafenib, especially its direct effects on hepatoma and hepatocyte cells, are poorly understood, making a more detailed investigation about the molecular mechanism of sorafenib necessary. Endoplasmic reticulum (ER) stress is related to the pathophysiology of various liver diseases, including chronic viral hepatitis, alcoholic and nonalcoholic steatohepatitis and HCC. In this regard, our recent data examining the molecular effects of sorafenib focused on the cellular defense mechanisms from ER stress, the unfolded protein response (UPR) and keratin phosphorylation, demonstrated that sorafenib inhibited both important cytoprotective mechanisms, UPR and keratin phosphorylation, and enhances the anti-tumor effect in combination with proteasome inhibitors. This review summarizes the cytoprotective mechanisms from ER stress and our results about the direct effect of sorafenib on the cytoprotective mechanisms.

  16. A randomized trial of chlorhexidine gluconate on oral bacterial pathogens in mechanically ventilated patients

    Science.gov (United States)

    2009-01-01

    Introduction Dental plaque biofilms are colonized by respiratory pathogens in mechanically-ventilated intensive care unit patients. Thus, improvements in oral hygiene in these patients may prevent ventilator-associated pneumonia. The goal of this study was to determine the minimum frequency (once or twice a day) for 0.12% chlorhexidine gluconate application necessary to reduce oral colonization by pathogens in 175 intubated patients in a trauma intensive care unit. Methods A randomized, double-blind, placebo-controlled clinical trial tested oral topical 0.12% chlorhexidine gluconate or placebo (vehicle alone), applied once or twice a day by staff nurses. Quantitation of colonization of the oral cavity by respiratory pathogens (teeth/denture/buccal mucosa) was measured. Results Subjects were recruited from 1 March, 2004 until 30 November, 2007. While 175 subjects were randomized, microbiologic baseline data was available for 146 subjects, with 115 subjects having full outcome assessment after at least 48 hours. Chlorhexidine reduced the number of Staphylococcus aureus, but not the total number of enterics, Pseudomonas or Acinetobacter in the dental plaque of test subjects. A non-significant reduction in pneumonia rate was noted in groups treated with chlorhexidine compared with the placebo group (OR = 0.54, 95% CI: 0.23 to 1.25, P = 0.15). No evidence for resistance to chlorhexidine was noted, and no adverse events were observed. No differences were noted in microbiologic or clinical outcomes between treatment arms. Conclusions While decontamination of the oral cavity with chlorhexidine did not reduce the total number of potential respiratory pathogens, it did reduce the number of S. aureus in dental plaque of trauma intensive care patients. Trial Registration clinicaltrials.gov NCT00123123. PMID:19765321

  17. A Novel Mechanism for Adenylyl Cyclase Inhibition from the Crystal Structure of its Complex with Catechol Estrogen

    Energy Technology Data Exchange (ETDEWEB)

    Steegborn,C.; Litvin, T.; Hess, K.; Capper, A.; Taussig, R.; Buck, J.; Levin, L.; Wu, H.

    2005-01-01

    Catechol estrogens are steroid metabolites that elicit physiological responses through binding to a variety of cellular targets. We show here that catechol estrogens directly inhibit soluble adenylyl cyclases and the abundant trans-membrane adenylyl cyclases. Catechol estrogen inhibition is non-competitive with respect to the substrate ATP, and we solved the crystal structure of a catechol estrogen bound to a soluble adenylyl cyclase from Spirulina platensis in complex with a substrate analog. The catechol estrogen is bound to a newly identified, conserved hydrophobic patch near the active center but distinct from the ATP-binding cleft. Inhibitor binding leads to a chelating interaction between the catechol estrogen hydroxyl groups and the catalytic magnesium ion, distorting the active site and trapping the enzyme substrate complex in a non-productive conformation. This novel inhibition mechanism likely applies to other adenylyl cyclase inhibitors, and the identified ligand-binding site has important implications for the development of specific adenylyl cyclase inhibitors.

  18. Naringenin inhibits seed germination and seedling root growth through a salicylic acid-independent mechanism in Arabidopsis thaliana.

    Science.gov (United States)

    Hernández, Iker; Munné-Bosch, Sergi

    2012-12-01

    Flavonoids fulfill an enormous range of biological functions in plants. In seeds, these compounds play several roles; for instance proanthocyanidins protect them from moisture, pathogen attacks, mechanical stress, UV radiation, etc., and flavonols have been suggested to protect the embryo from oxidative stress. The present study aimed at determining the role of flavonoids in Arabidopsis thaliana (L.) seed germination, and the involvement of salicylic acid (SA) and auxin (indole-3-acetic acid), two phytohormones with the same biosynthetic origin as flavonoids, the shikimate pathway, in such a putative role. We show that naringenin, a flavanone, strongly inhibits the germination of A. thaliana seeds in a dose-dependent and SA-independent manner. Altered auxin levels do not affect seed germination in Arabidopsis, but impaired auxin transport does, although to a minor extent. Naringenin and N-1-naphthylphthalamic acid (NPA) impair auxin transport through the same mechanisms, so the inhibition of germination by naringenin might involve impaired auxin transport among other mechanisms. From the present study it is concluded that naringenin inhibits the germination of Arabidopsis seeds in a dose-dependent and SA-independent manner, and the results also suggest that such effects are exerted, at least to some extent, through impaired auxin transport, although additional mechanisms seem to operate as well. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  19. Mechanism of inhibition of the tumor suppressor Patched by Sonic Hedgehog

    OpenAIRE

    Tukachinsky, Hanna; Petrov, Kostadin; Watanabe, Miyako; Salic, Adrian

    2016-01-01

    The Hedgehog-signaling pathway plays key roles in animal development and physiology. Insufficient Hedgehog signaling causes birth defects, whereas uncontrolled signaling is implicated in cancer. Signaling is triggered by the secreted protein, Sonic Hedgehog, which inhibits the membrane protein Patched1, leading to pathway activation. Despite its fundamental importance, we do not understand how Sonic Hedgehog inhibits Patched1. Here, we uncover a critical interaction between the fatty-acid?mod...

  20. Inhibiting Mitophagy as a Novel Mechanism to Kill Prostate Cancer Cells

    Science.gov (United States)

    2014-10-01

    The research proposed to examine the ability of inhibition of mitophagy, the mitochondrial-specific form of autophagy, to kill prostate cancer cells . Cancer ...whether inhibition of mitophagy can lead to the death of prostate cancer cells . Key mediators of the mitophagic process, specifically Parkin, dynamin...CypD is NOT a valid candidate for prostate cancer treatment. However, targeting of Fis1 and Parkin may have therapeutic value as they both sensitized prostate cancer cells to the necrotic effects of doxorubicin.

  1. Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism

    Science.gov (United States)

    Xu, Jie; Zhang, Huimin; Srinivas, Swaminath

    2013-01-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  2. Quasi-Instantaneous Bacterial Inactivation on Cu-Ag Nanoparticulate 3D Catheters in the Dark and Under Light: Mechanism and Dynamics.

    Science.gov (United States)

    Rtimi, Sami; Sanjines, Rosendo; Pulgarin, Cesar; Kiwi, John

    2016-01-13

    The first evidence for Cu-Ag (50%/50%) nanoparticulate hybrid coatings is presented leading to a complete and almost instantaneous bacterial inactivation in the dark (≤5 min). Dark bacterial inactivation times on Cu-Ag (50%/50%) were observed to coincide with the times required by actinic light irradiation. This provides the evidence that the bimetal Cu-Ag driven inactivation predominates over a CuO/Cu2O and Ag2O oxides inducing a semiconductor driven behavior. Cu- or Ag-coated polyurethane (PU) catheters led to bacterial inactivation needing about ∼30 min. The accelerated bacterial inactivation by Cu-Ag coated on 3D catheters sputtered was investigated in a detailed way. The release of Cu/Ag ions during bacterial inactivation was followed by inductively coupled plasma mass-spectrometry (ICP-MS) and the amount of Cu and Ag-ions released were below the cytotoxicity levels permitted by the sanitary regulations. By stereomicroscopy the amount of live/dead cells were followed during the bacterial inactivation time. By Fourier transform infrared spectroscopy (FTIR), the systematic shift of the -(CH2) band stretching of the outer lipo-polysaccharide bilayer (LPS) was followed to monitor the changes leading to cell lysis. A hydrophobic to hydrophilic transformation of the Cu-Ag PU catheter surface under light was observed within 30 min followed concomitantly to a longer back transformation to the hydrophobic initial state in the dark. Physical insight is provided for the superior performance of Cu-Ag films compared to Cu or Ag films in view of the drastic acceleration of the bacterial inactivation observed on bimetal Cu-Ag films coating PU catheters. A mechanism of bacterial inactivation is suggested that is consistent with the findings reported in this study.

  3. Inhibition of cAMP-activated intestinal chloride secretion by diclofenac: cellular mechanism and potential application in cholera.

    Science.gov (United States)

    Pongkorpsakol, Pawin; Pathomthongtaweechai, Nutthapoom; Srimanote, Potjanee; Soodvilai, Sunhapas; Chatsudthipong, Varanuj; Muanprasat, Chatchai

    2014-09-01

    Cyclic AMP-activated intestinal Cl- secretion plays an important role in pathogenesis of cholera. This study aimed to investigate the effect of diclofenac on cAMP-activated Cl- secretion, its underlying mechanisms, and possible application in the treatment of cholera. Diclofenac inhibited cAMP-activated Cl- secretion in human intestinal epithelial (T84) cells with IC50 of ∼ 20 µM. The effect required no cytochrome P450 enzyme-mediated metabolic activation. Interestingly, exposures of T84 cell monolayers to diclofenac, either in apical or basolateral solutions, produced similar degree of inhibitions. Analyses of the apical Cl- current showed that diclofenac reversibly inhibited CFTR Cl- channel activity (IC50 ∼ 10 µM) via mechanisms not involving either changes in intracellular cAMP levels or CFTR channel inactivation by AMP-activated protein kinase and protein phosphatase. Of interest, diclofenac had no effect on Na(+)-K(+) ATPases and Na(+)-K(+)-Cl- cotransporters, but inhibited cAMP-activated basolateral K(+) channels with IC50 of ∼ 3 µM. In addition, diclofenac suppressed Ca(2+)-activated Cl- channels, inwardly rectifying Cl- channels, and Ca(2+)-activated basolateral K(+) channels. Furthermore, diclofenac (up to 200 µM; 24 h of treatment) had no effect on cell viability and barrier function in T84 cells. Importantly, cholera toxin (CT)-induced Cl- secretion across T84 cell monolayers was effectively suppressed by diclofenac. Intraperitoneal administration of diclofenac (30 mg/kg) reduced both CT and Vibrio cholerae-induced intestinal fluid secretion by ∼ 70% without affecting intestinal fluid absorption in mice. Collectively, our results indicate that diclofenac inhibits both cAMP-activated and Ca(2+)-activated Cl- secretion by inhibiting both apical Cl- channels and basolateral K+ channels in intestinal epithelial cells. Diclofenac may be useful in the treatment of cholera and other types of secretory diarrheas resulting from intestinal

  4. Inhibition of cAMP-activated intestinal chloride secretion by diclofenac: cellular mechanism and potential application in cholera.

    Directory of Open Access Journals (Sweden)

    Pawin Pongkorpsakol

    2014-09-01

    Full Text Available Cyclic AMP-activated intestinal Cl- secretion plays an important role in pathogenesis of cholera. This study aimed to investigate the effect of diclofenac on cAMP-activated Cl- secretion, its underlying mechanisms, and possible application in the treatment of cholera. Diclofenac inhibited cAMP-activated Cl- secretion in human intestinal epithelial (T84 cells with IC50 of ∼ 20 µM. The effect required no cytochrome P450 enzyme-mediated metabolic activation. Interestingly, exposures of T84 cell monolayers to diclofenac, either in apical or basolateral solutions, produced similar degree of inhibitions. Analyses of the apical Cl- current showed that diclofenac reversibly inhibited CFTR Cl- channel activity (IC50 ∼ 10 µM via mechanisms not involving either changes in intracellular cAMP levels or CFTR channel inactivation by AMP-activated protein kinase and protein phosphatase. Of interest, diclofenac had no effect on Na(+-K(+ ATPases and Na(+-K(+-Cl- cotransporters, but inhibited cAMP-activated basolateral K(+ channels with IC50 of ∼ 3 µM. In addition, diclofenac suppressed Ca(2+-activated Cl- channels, inwardly rectifying Cl- channels, and Ca(2+-activated basolateral K(+ channels. Furthermore, diclofenac (up to 200 µM; 24 h of treatment had no effect on cell viability and barrier function in T84 cells. Importantly, cholera toxin (CT-induced Cl- secretion across T84 cell monolayers was effectively suppressed by diclofenac. Intraperitoneal administration of diclofenac (30 mg/kg reduced both CT and Vibrio cholerae-induced intestinal fluid secretion by ∼ 70% without affecting intestinal fluid absorption in mice. Collectively, our results indicate that diclofenac inhibits both cAMP-activated and Ca(2+-activated Cl- secretion by inhibiting both apical Cl- channels and basolateral K+ channels in intestinal epithelial cells. Diclofenac may be useful in the treatment of cholera and other types of secretory diarrheas resulting from intestinal

  5. Mechanism of inhibition of rat brain adenosine triphosphatase by mercuric chloride

    International Nuclear Information System (INIS)

    Chetty, C.S.; Rajanna, B.; Rajanna, S.

    1989-01-01

    Mercuric Chloride (Hg), a neurotoxic compound inhibited ATPase system of rat brain microsomes. Membrane bound enzymes, Na + -K + ATPase (IC 50 = 2.35 x 10 -7M ) and K-paranitrophenyl phosphatase (K-PNPPase) (IC 50 = 2.7 x 10 -7M ) and 3 H-Ouabain binding (IC 50 = 3.3 x 10 -7M ) were inhibited by Hg at micromolar concentrations in a dose dependent manner. Hydrolysis of ATP was linear with time with or without Hg in the reaction mixtures. Altered pH or temperature versus enzyme activity showed higher inhibition by Hg at basic pH (8.0-9.0) and at lower temperatures (17-32 degree C). Activation energy (ΔE) values were increased at 27-37 degree C in the presence of Hg. Kinetic studies of cationic-substrate activation of Na + -K + ATPase and K-PNPPase in the presence of Hg showed significant changes in kinetic constant (K m and V max ). Inhibition of Na + -K + ATPase was partially restored by repeated washings of microsomes. Preincubation with sulfhydryl agents protected Na + -K + ATPase from Hg inhibition. Cumulative inhibition studies with Hg and ouabain indicated possible interaction between the two inhibitors of Na + -K + ATPase by interacting at Na + and K + sites

  6. Mechanism of inhibition of mouse Slo3 (KCa 5.1) potassium channels by quinine, quinidine and barium.

    Science.gov (United States)

    Wrighton, David C; Muench, Stephen P; Lippiat, Jonathan D

    2015-09-01

    The Slo3 (KCa 5.1) channel is a major component of mammalian KSper (sperm potassium conductance) channels and inhibition of these channels by quinine and barium alters sperm motility. The aim of this investigation was to determine the mechanism by which these drugs inhibit Slo3 channels. Mouse (m) Slo3 (KCa 5.1) channels or mutant forms were expressed in Xenopus oocytes and currents recorded with 2-electrode voltage-clamp. Gain-of-function mSlo3 mutations were used to explore the state-dependence of the inhibition. The interaction between quinidine and mSlo3 channels was modelled by in silico docking. Several drugs known to block KSper also affected mSlo3 channels with similar levels of inhibition. The inhibition induced by extracellular barium was prevented by increasing the extracellular potassium concentration. R196Q and F304Y mutations in the mSlo3 voltage sensor and pore, respectively, both increased channel activity. The F304Y mutation did not alter the effects of barium, but increased the potency of inhibition by both quinine and quinidine approximately 10-fold; this effect was not observed with the R196Q mutation. Block of mSlo3 channels by quinine, quinidine and barium is not state-dependent. Barium inhibits mSlo3 outside the cell by interacting with the selectivity filter, whereas quinine and quinidine act from the inside, by binding in a hydrophobic pocket formed by the S6 segment of each subunit. Furthermore, we propose that the Slo3 channel activation gate lies deep within the pore between F304 in the S6 segment and the selectivity filter. © 2015 The Authors. British Journal of Pharmacology published by John Wiley & Sons Ltd on behalf of The British Pharmacological Society.

  7. Mechanisms of pyruvate kinase M2 isoform inhibits cell motility in hepatocellular carcinoma cells.

    Science.gov (United States)

    Chen, Yan-Ling; Song, Jun-Jiao; Chen, Xiao-Chun; Xu, Wei; Zhi, Qiang; Liu, Yun-Peng; Xu, Hong-Zhi; Pan, Jin-Shui; Ren, Jian-Lin; Guleng, Bayasi

    2015-08-14

    To investigate biological mechanisms underlying pyruvate kinase M2 isoform (PKM2) regulation of cell migration and invasion in hepatocellular carcinoma cells. HepG2 and Huh-7 hepatocellular carcinoma cell lines were stably transfected and cultured in DMEM (HyClone, Logan, UT, United States). To investigate the effects of PKM2 on cellular proliferation, hepatocellular carcinoma cells were subjected to the Cell Counting Kit-8 (Dojindo, Kamimashiki-gun, Kumamoto, Japan). And investigate the effects of PKM2 on cell signal pathway related with migration and invasion, Western immunoblotting were used to find out the differential proteins. All the antibody used was purchaseed from Cell Signal Technology. In order to explore cell motility used Transwell invasion and wound healing assays. The transwell plate with 0.5 mg/mL collagen type I (BD Bioscience, San Jose, CA)-coated filters. The wound-healing assay was performed in 6-well plates. Total RNA was extracted using TRIzol reagent (Invitrogen, CA, United States) and then reverse transcription was conducted. Quantitative reverse transcription-polymerase chain reaction (PCR) analysis was performed with the ABI 7500 real-time PCR system (Applied Biosystems). We further use digital gene expression tag profiling and identification of differentially expressed genes. The cells seeded in four 96-well plates were measured OD450 by conducted Cell Counting Kit-8. From this conduction we observed that both HepG2 and Huh-7 hepatocellular carcinoma cells with silenced PKM2 turn on a proliferate inhibition; however, cell migration and invasion were enhanced compared with the control upon stimulation with epidermal growth factor (EGF). Our results indicate that the knockdown of PKM2 decreased the expression of E-cadherin and enhanced the activity of the EGF/EGFR signaling pathway, furthermore up-regulate the subsequent signal molecular the PLCγ1 and extracellular signal-regulated kinase 1/2 expression in the hepatocellular carcinoma

  8. Prevention of bacterial adhesion

    DEFF Research Database (Denmark)

    Klemm, Per; Vejborg, Rebecca Munk; Hancock, Viktoria

    2010-01-01

    Management of bacterial infections is becoming increasingly difficult due to the emergence and increasing prevalence of bacterial pathogens that are resistant to available antibiotics. Conventional antibiotics generally kill bacteria by interfering with vital cellular functions, an approach...... that imposes selection pressure for resistant bacteria. New approaches are urgently needed. Targeting bacterial virulence functions directly is an attractive alternative. An obvious target is bacterial adhesion. Bacterial adhesion to surfaces is the first step in colonization, invasion, and biofilm formation....... As such, adhesion represents the Achilles heel of crucial pathogenic functions. It follows that interference with adhesion can reduce bacterial virulence. Here, we illustrate this important topic with examples of techniques being developed that can inhibit bacterial adhesion. Some of these will become...

  9. A mechanism for bacterial transformation of dimethylsulfide to dimethylsulfoxide: a missing link in the marine organic sulfur cycle.

    Science.gov (United States)

    Lidbury, Ian; Kröber, Eileen; Zhang, Zhidong; Zhu, Yijun; Murrell, J Colin; Chen, Yin; Schäfer, Hendrik

    2016-09-01

    The volatile organosulfur compound, dimethylsulfide (DMS), plays an important role in climate regulation and global sulfur biogeochemical cycles. Microbial oxidation of DMS to dimethylsulfoxide (DMSO) represents a major sink of DMS in surface seawater, yet the underlying molecular mechanisms and key microbial taxa involved are not known. Here, we reveal that Ruegeria pomeroyi, a model marine heterotrophic bacterium, can oxidize DMS to DMSO using trimethylamine monooxygenase (Tmm). Purified Tmm oxidizes DMS to DMSO at a 1:1 ratio. Mutagenesis of the tmm gene in R. pomeroyi completely abolished DMS oxidation and subsequent DMSO formation. Expression of Tmm and DMS oxidation in R. pomeroyi is methylamine-dependent and regulated at the post-transcriptional level. Considering that Tmm is present in approximately 20% of bacterial cells inhabiting marine surface waters, particularly the marine Roseobacter clade and the SAR11 clade, our observations contribute to a mechanistic understanding of biological DMSO production in surface seawater. © 2016 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  10. Seeing is believing: Direct imaging of charge flow along pili proteins reveals new mechanism for bacterial electron transfer

    Science.gov (United States)

    Malvankar, Nikhil; Yalcin, Sibel Ebru; Adhikari, Ramesh; Tuominen, Mark; Lovley, Derek

    2015-03-01

    Visualization of charge flow on the nanoscale in proteins is crucial for a fundamental understanding of several life processes. Here, we report direct visualization of charge propagation along native pili of Geobacter sulfurreducens at nanometer resolution using electrostatic force microscopy. Surprisingly, charges injected at a single point into individual, untreated pili, still attached to cells, propagate over the entire filament. The charges propagate despite a lack of cytochromes on the pili, in contrast to the dominant biochemical model that proteins are electronically insulating and must incorporate redox-active cofactors in order to achieve electron transport functionality. The mobile charge density in pili is comparable to synthetic organic conductors, increasing with proton doping, and with temperature-dependence consistent with previously discovered metallic-like transport mechanism. Conductive pili enable syntrophic bacteria to share energy by directly exchanging electrons among each other. Measurements along individual pilus using nanoelectrodes showed ohmic behavior strongly dependent on the amino acid composition of pili. Electron transfer rate measurement revealed that the pili conductivity is the decisive factor in controlling the bacterial respiration rate. Funded by Office of Naval Research, DOE Genomic Sciences, NSF-NSEC CHM (CMMI-1025020) and Burroughs Wellcome Fund.

  11. Insights into the Antimicrobial Mechanism of Action of Human RNase6: Structural Determinants for Bacterial Cell Agglutination and Membrane Permeation

    Science.gov (United States)

    Pulido, David; Arranz-Trullén, Javier; Prats-Ejarque, Guillem; Velázquez, Diego; Torrent, Marc; Moussaoui, Mohammed; Boix, Ester

    2016-01-01

    Human Ribonuclease 6 is a secreted protein belonging to the ribonuclease A (RNaseA) superfamily, a vertebrate specific family suggested to arise with an ancestral host defense role. Tissue distribution analysis revealed its expression in innate cell types, showing abundance in monocytes and neutrophils. Recent evidence of induction of the protein expression by bacterial infection suggested an antipathogen function in vivo. In our laboratory, the antimicrobial properties of the protein have been evaluated against Gram-negative and Gram-positive species and its mechanism of action was characterized using a membrane model. Interestingly, our results indicate that RNase6, as previously reported for RNase3, is able to specifically agglutinate Gram-negative bacteria as a main trait of its antimicrobial activity. Moreover, a side by side comparative analysis with the RN6(1–45) derived peptide highlights that the antimicrobial activity is mostly retained at the protein N-terminus. Further work by site directed mutagenesis and structural analysis has identified two residues involved in the protein antimicrobial action (Trp1 and Ile13) that are essential for the cell agglutination properties. This is the first structure-functional characterization of RNase6 antimicrobial properties, supporting its contribution to the infection focus clearance. PMID:27089320

  12. Research on the inhibition mechanism of tetraphenylporphyrin on AZ91D magnesium alloy

    International Nuclear Information System (INIS)

    Hu, Junying; Huang, Daobing; Zhang, Guoan; Song, Guang-Ling; Guo, Xingpeng

    2012-01-01

    Highlights: ► Environment-friendly tetraphenylporphyrin is synthesized in the lab. ► The tetraphenylporphyrin can efficiently inhibit AZ91D corrosion. ► The inhibitor chelates with Mg ions to form a film retarding Mg dissolution. - Abstract: 5,10,15,20-Tetraphenylporphyrin (TPP) is synthesized and its inhibition effect on AZ91D magnesium alloy in 0.05 wt.% NaCl solution is studied. Electrochemical measurement and immersion corrosion test results indicate that the inhibition efficiency of TPP reaches 90%. SEM, FT-IR, ultraviolet–visible absorption spectrum (UV), fluorescent spectrometry and XPS analyses suggest that TPP molecules can chelate with Mg via their N atoms to form a TPP–Mg complex, which can precipitate as a film on AZ91D alloy. The precipitated TPP–Mg reduces the porosity of the original Mg(OH) 2 surface film and retards the dissolution of the Mg alloy.

  13. Quantum mechanical and electrochemical investigations on corrosion inhibition properties of novel heterocyclic Schiff bases

    Directory of Open Access Journals (Sweden)

    Nimmy Kuriakose

    2017-07-01

    Full Text Available The corrosion inhibition efficiencies of two novel Schiff bases, namely (E-3-[thiophen-2-ylmethyleneamino]benzoic acid (T2YMABA and (E-4-(5-[(2-phenylhydrazono methyl]thiophen-2-ylbenzoic acid (PHMT2YBA on mild steel (MS in 1.0M HCl solution has been investigated and compared using electrochemical impedance spectroscopy and potentiodynamic polarization analysis. The Schiff bases exhibited very good corrosion inhibitions on mild steel in 1.0M HCl medium and the inhibition efficiency increased with the increase in concentration of the inhibitor. Polarization studies revealed that T2YMABA acted as a mixed type inhibitor whereas PHMT2YBA molecules acted as anodic inhibitor.

  14. Compound C inhibits macrophage chemotaxis through an AMPK-independent mechanism

    International Nuclear Information System (INIS)

    Lee, Youngyi; Park, Byung-Hyun; Bae, Eun Ju

    2016-01-01

    Macrophage infiltration in adipose tissue is a well-established cause of obesity-linked insulin resistance. AMP-activated protein kinase (AMPK) activation in peripheral tissues such as adipose tissue has beneficial effects on the protection against obesity-induced insulin resistance, which is mainly mediated by prevention of adipose tissue macrophage infiltration and inflammation. In examining the role of AMPK on adipose tissue inflammation, we unexpectedly found that compound C (CC), despite its inhibition of AMPK, robustly inhibited macrophage chemotaxis in RAW 264.7 cells when adipocyte conditioned medium (CM) was used as a chemoattractant. Here, we report that CC inhibition of macrophage migration occurred independently of AMPK. Mechanistically, this inhibitory effect of cell migration by CC was mediated by inhibition of the focal adhesion kinase, AKT, nuclear factor κB pathways. Moreover, the expression of chemokine monocyte chemoattractant protein-1 and pro-inflammatory genes such as tumor necrosis factor α and inducible nitric oxide synthase were prevented by CC treatment in RAW 264.7 cells stimulated with either adipocyte CM or lipopolysaccharide. Lastly, in accord with the findings of the anti-inflammatory effect of CC, we demonstrated that CC functioned as a repressor of macrophage CM-mediated insulin resistance in adipocytes. Taken together, our results suggest that CC serves as a useful inhibitory molecule against macrophage chemotaxis into adipose tissue and thus might have therapeutic potential for the treatment of obesity-linked adipose inflammation. - Highlights: • Compound C (CC) inhibits macrophage chemotaxis regardless of AMPK suppression. • CC enhances insulin sensitivity in adipocytes. • CC inhibits focal adhesion kinase, AKT, and NF-κB signaling in RAW 264.7 cells.

  15. Combined Pan-RAF and MEK Inhibition Overcomes Multiple Resistance Mechanisms to Selective RAF Inhibitors.

    Science.gov (United States)

    Whittaker, Steven R; Cowley, Glenn S; Wagner, Steve; Luo, Flora; Root, David E; Garraway, Levi A

    2015-12-01

    RAF and MEK inhibitors are effective in BRAF-mutant melanoma but not in BRAF-mutant colorectal cancer. To gain additional insights into this difference, we performed a genome-scale pooled shRNA enhancer screen in a BRAF-mutant, RAF inhibitor-resistant colorectal cancer cell line exposed to the selective RAF inhibitor PLX4720. We identified multiple genes along the receptor tyrosine kinase (RTK)/mitogen-activated protein kinase (MAPK) signaling axis that, when suppressed, either genetically or pharmacologically, sensitized cells to the selective RAF inhibitor through sustained inhibition of MAPK signaling. Strikingly, CRAF was a key mediator of resistance that could be overcome by the use of pan-RAF inhibitors in combination with a MEK inhibitor. Furthermore, the combination of pan-RAF and MEK inhibitors displayed strong synergy in melanoma and colorectal cancer cell lines with RAS-activating events such as RTK activation, KRAS mutation, or NF1 loss-of-function mutations. Combinations of selective RAF inhibitors, such as PLX4720 or dabrafenib, with MEK inhibitors did not incur such profound synergy, suggesting that inhibition of CRAF by pan-RAF inhibitors plays a key role in determining cellular response. Importantly, in contrast to the modest activity seen with single-agent treatment, dual pan-RAF and MEK inhibition results in the induction of apoptosis, greatly enhancing efficacy. Notably, combined pan-RAF and MEK inhibition can overcome intrinsic and acquired resistance to single-agent RAF/MEK inhibition, supporting dual pan-RAF and MEK inhibition as a novel therapeutic strategy for BRAF- and KRAS-mutant cancers. ©2015 American Association for Cancer Research.

  16. Compound C inhibits macrophage chemotaxis through an AMPK-independent mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Youngyi [College of Pharmacy, Woosuk University, Wanju, Jeonbuk 55338 (Korea, Republic of); Department of Biochemistry, Chonbuk National University Medical School, Jeonju, Jeonbuk 54896 (Korea, Republic of); Park, Byung-Hyun, E-mail: bhpark@jbnu.ac.kr [Department of Biochemistry, Chonbuk National University Medical School, Jeonju, Jeonbuk 54896 (Korea, Republic of); Bae, Eun Ju, E-mail: ejbae@woosuk.ac.kr [College of Pharmacy, Woosuk University, Wanju, Jeonbuk 55338 (Korea, Republic of)

    2016-01-15

    Macrophage infiltration in adipose tissue is a well-established cause of obesity-linked insulin resistance. AMP-activated protein kinase (AMPK) activation in peripheral tissues such as adipose tissue has beneficial effects on the protection against obesity-induced insulin resistance, which is mainly mediated by prevention of adipose tissue macrophage infiltration and inflammation. In examining the role of AMPK on adipose tissue inflammation, we unexpectedly found that compound C (CC), despite its inhibition of AMPK, robustly inhibited macrophage chemotaxis in RAW 264.7 cells when adipocyte conditioned medium (CM) was used as a chemoattractant. Here, we report that CC inhibition of macrophage migration occurred independently of AMPK. Mechanistically, this inhibitory effect of cell migration by CC was mediated by inhibition of the focal adhesion kinase, AKT, nuclear factor κB pathways. Moreover, the expression of chemokine monocyte chemoattractant protein-1 and pro-inflammatory genes such as tumor necrosis factor α and inducible nitric oxide synthase were prevented by CC treatment in RAW 264.7 cells stimulated with either adipocyte CM or lipopolysaccharide. Lastly, in accord with the findings of the anti-inflammatory effect of CC, we demonstrated that CC functioned as a repressor of macrophage CM-mediated insulin resistance in adipocytes. Taken together, our results suggest that CC serves as a useful inhibitory molecule against macrophage chemotaxis into adipose tissue and thus might have therapeutic potential for the treatment of obesity-linked adipose inflammation. - Highlights: • Compound C (CC) inhibits macrophage chemotaxis regardless of AMPK suppression. • CC enhances insulin sensitivity in adipocytes. • CC inhibits focal adhesion kinase, AKT, and NF-κB signaling in RAW 264.7 cells.

  17. Mechanisms Controlling the Effects of Bevacizumab (Avastin) on the Inhibition of Early but Not Late Formed Corneal Neovascularization

    Science.gov (United States)

    Chu, Hsiao-Sang; Lin, Chung-Tien; Chow, Lu-Ping; Chen, Chih-Ta; Hu, Fung-Rong

    2014-01-01

    Purpose To evaluate the effects and underlying mechanisms of early and late subconjunctival injection of bevacizumab on the inhibition of corneal neovascularization (NV). Methods Corneal NV was induced by closed eye contact lens wear followed by a silk suture tarsorrhaphy in rabbits. Weekly subconjunctival injections of bevacizumab (5.0 mg) for 1 month were started immediately (early treatment group) or 1 month after induction of corneal NV with continuous induction (late treatment group). The severity of corneal NV was evaluated. Immunostaining was used to evaluate the intracorneal diffusion of bevacizumab, and the existence of pericytes and smooth muscle cells around the NV. The expression of AM-3K, an anti-macrophage antibody, vascular endothelial growth factor (VEGF) with its receptors (VEGFR1 and VEGFR2), and vascular endothelial apoptosis were also evaluated. Western blot analysis was performed to quantify the expression level of VEGF, VEGFR1 and VEGFR2 on corneal epithelium and stroma in different groups. Results Early treatment with bevacizumab inhibited corneal NV more significantly than late treatment. Intracorneal diffusion of bevacizumab was not different among different groups. Immunostaining showed pericytes and smooth muscle cells around newly formed vessels as early as 2 weeks after induction. Immunostaining and Western blot analysis showed that VEGF, VEGFR1, and VEGFR2 on corneal stroma increased significantly in no treatment groups and late treatment groups, but not in early treatment group. Bevacizumab significantly inhibited macrophage infiltration in the early but not late treatment group. Sporadic vascular endothelial apoptosis was found at 4 weeks in the late but not early treatment group. Conclusions Early but not late injection of bevacizumab inhibited corneal NV. Late injection of bevacizumab did not alter macrophage infiltration, and can't inhibit the expression of VEGF, VEGFR1, and VEGFR2 on corneal vessels. The inhibition of corneal NV

  18. Strategies for combating bacterial biofilms: A focus on anti-biofilm agents and their mechanisms of action.

    Science.gov (United States)

    Roy, Ranita; Tiwari, Monalisa; Donelli, Gianfranco; Tiwari, Vishvanath

    2018-01-01

    Biofilm refers to the complex, sessile communities of microbes found either attached to a surface or buried firmly in an extracellular matrix as aggregates. The biofilm matrix surrounding bacteria makes them tolerant to harsh conditions and resistant to antibacterial treatments. Moreover, the biofilms are responsible for causing a broad range of chronic diseases and due to the emergence of antibiotic resistance in bacteria it has really become difficult to treat them with efficacy. Furthermore, the antibiotics available till date are ineffective for treating these biofilm related infections due to their higher values of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC), which may result in in-vivo toxicity. Hence, it is critically important to design or screen anti-biofilm molecules that can effectively minimize and eradicate biofilm related infections. In the present article, we have highlighted the mechanism of biofilm formation with reference to different models and various methods used for biofilm detection. A major focus has been put on various anti-biofilm molecules discovered or tested till date which may include herbal active compounds, chelating agents, peptide antibiotics, lantibiotics and synthetic chemical compounds along with their structures, mechanism of action and their respective MICs, MBCs, minimum biofilm inhibitory concentrations (MBICs) as well as the half maximal inhibitory concentration (IC 50 ) values available in the literature so far. Different mode of action of anti biofilm molecules addressed here are inhibition via interference in the quorum sensing pathways, adhesion mechanism, disruption of extracellular DNA, protein, lipopolysaccharides, exopolysaccharides and secondary messengers involved in various signaling pathways. From this study, we conclude that the molecules considered here might be used to treat biofilm-associated infections after significant structural modifications, thereby investigating

  19. A possible mechanism of action of plant growth-promoting rhizobacteria (PGPR) strain Bacillus pumilus WP8 via regulation of soil bacterial community structure.

    Science.gov (United States)

    Kang, Yijun; Shen, Min; Wang, Huanli; Zhao, Qingxin

    2013-01-01

    According to the traditional view, establishment and maintenance of critical population densities in the rhizosphere was the premise of PGPR to exert growth-promoting effects. In light of the facts that soil bacterial community structures can be changed by some PGPR strains including Bacillus pumilus WP8, we hypothesize that regulation of soil bacterial community structure is one of the plant growth-promoting mechanisms of B. pumilus WP8, rather than depending on high-density cells in soil. In this study, denaturing gradient gel electrophoresis (PCR-DGGE) was performed to evaluate the relationship between changes in soil bacterial community structure and growth-promoting effect on the seedling growth of fava beans (Vicia faba L.) during three successive cultivations. We found that B. pumilus WP8 lacks capacity to reproduce in large enough numbers to survive in bulk soil more than 40 days, yet the bacterial community structures were gradually influenced by inoculation of WP8, especially on dominant populations. Despite WP8 being short-lived, it confers the ability of steadily promoting fava bean seedling growth on soil during the whole growing period for at least 90 days. Pseudomonas chlororaphis RA6, another tested PGPR strain, exists in large numbers for at least 60 days but less than 90 days, whilst giving rise to slight influence on bacterial community structure. In addition, along with the extinction of RA6 cells in bulk soils, the effect of growth promotion disappeared simultaneously. Furthermore, the increment of soil catalase activity from WP8 treatment implied the ability to stimulate soil microbial activity, which may be the reason why the dominant population changed and increased as time passed. Our study suggests that regulation of treated soil bacterial community structure may be another possible action mechanism.

  20. Developmental Emergence of Self-Referential and Inhibition Mechanisms of Body Movements Underling Felicitous Behaviors

    Science.gov (United States)

    Watanabe, Hama; Homae, Fumitaka; Taga, Gentaro

    2011-01-01

    In young infants, activation or inhibition of body movements on perception of environmental events is important to enable them to act on the world or understand the world. To reveal the development of this ability, we observed movement patterns in all four limbs under the two experimental conditions. Infants assigned to the interaction condition…

  1. Whole-body prepulse inhibition protocol to test sensorymotor gating mechanisms in monkeys.

    Science.gov (United States)

    Saletti, Patricia G; Maior, Rafael S; Hori, Etsuro; Almeida, Ricardo Miyasaka de; Nishijo, Hisao; Tomaz, Carlos

    2014-01-01

    Prepulse inhibition (PPI) is the decrease of startle reflex amplitude when a slight stimulus is previously generated. This paradigm may provide valuable information about sensorimotor gating functionality. Here we aimed at determining the inhibited and uninhibited startle response of capuchin monkeys (Sapajus spp.), and to evaluate the role of the superior colliculus in PPI. Capuchin monkeys were tested in a whole-body protocol, to determine the best startle amplitude and interstimuli interval. Additionally we tested two subjects with bilateral superior colliculus damage in this protocol. Results show that 115 dB auditory pulse has induced the best startle response. In contrast to reports in other species, no habituation to the auditory stimuli was observed here in capuchins. Also, startle reflex inhibition was optimal after 120 msec interstimuli interval. Finally, there was a downward tendency of percentage inhibition in superior colliculus-lesioned monkeys. Our data provides the possibility of further studies with whole-body protocol in capuchin monkeys and reinforces the importance of the superior colliculus in PPI.

  2. Mechanism of inhibition of growth hormone receptor signaling by suppressor of cytokine signaling proteins

    DEFF Research Database (Denmark)

    Hansen, J A; Lindberg, K; Hilton, D J

    1999-01-01

    In this study we have investigated the role of suppressor of cytokine signaling (SOCS) proteins in GH receptor-mediated signaling. GH-induced transcription was inhibited by SOCS-1 and SOCS-3, while SOCS-2 and cytokine inducible SH2-containing protein (CIS) had no effect By using chimeric SOCS pro...

  3. Potential mechanisms for the inhibition of tumor cell growth by manganese superoxide dismutase.

    Science.gov (United States)

    Kim, K H; Rodriguez, A M; Carrico, P M; Melendez, J A

    2001-06-01

    Studies from many laboratories have shown that overexpression of manganese superoxide dismutase (MnSOD) inhibits the growth of numerous tumor cell types. The inhibition of tumor cell growth can be attributed to the increase in the steady-state levels of H2O2 as a result of the increased dismuting activity of MnSOD. Here we demonstrate that overexpression of MnSOD enhances the activity of the superoxide (O2*-)-sensitive enzyme aconitase, decreases the intracellular GSH/GSSG ratio, and dose-dependently inhibits pyruvate carboxylase activity. Thus, alterations in the steady-state concentrations of mitochondrial O2*- and H2O2 as a result of MnSOD overexpression can alter the metabolic capacity of the cell leading to inhibition of cell growth. Furthermore, we propose that MnSOD overexpression can modulate the activity of nitric oxide (*NO) by preventing its reaction with O2*-. This hypothesis suggests that the redox environment of the mitochondria can be altered to favor the activity of *NO rather than peroxynitrite (ONOO-) and may explain the enhanced toxicity of *NO-generating compounds toward MnSOD-overexpressing cell lines. These findings indicate that therapeutic strategies targeted at overexpressing MnSOD in tumor tissue may be more effective when used in combination with agents that deplete the oxidant-buffering and enhance the *NO-generating capacity of the tumor and host, respectively.

  4. Quercetin Inhibits Peripheral and Spinal Cord Nociceptive Mechanisms to Reduce Intense Acute Swimming-Induced Muscle Pain in Mice

    Science.gov (United States)

    Borghi, Sergio M.; Pinho-Ribeiro, Felipe A.; Fattori, Victor; Bussmann, Allan J. C.; Vignoli, Josiane A.; Camilios-Neto, Doumit; Casagrande, Rubia; Verri, Waldiceu A.

    2016-01-01

    The present study aimed to evaluate the effects of the flavonoid quercetin (3,3´,4´,5,7-pentahydroxyflavone) in a mice model of intense acute swimming-induced muscle pain, which resembles delayed onset muscle soreness. Quercetin intraperitoneal (i.p.) treatment dose-dependently reduced muscle mechanical hyperalgesia. Quercetin inhibited myeloperoxidase (MPO) and N-acetyl-β-D- glucosaminidase (NAG) activities, cytokine production, oxidative stress, cyclooxygenase-2 (COX-2) and gp91phox mRNA expression and muscle injury (creatinine kinase [CK] blood levels and myoblast determination protein [MyoD] mRNA expression) as well as inhibited NFκB activation and induced Nrf2 and HO-1 mRNA expression in the soleus muscle. Beyond inhibiting those peripheral effects, quercetin also inhibited spinal cord cytokine production, oxidative stress and glial cells activation (glial fibrillary acidic protein [GFAP] and ionized calcium-binding adapter molecule 1 [Iba-1] mRNA expression). Concluding, the present data demonstrate that quercetin is a potential molecule for the treatment of muscle pain conditions related to unaccustomed exercise. PMID:27583449

  5. Chemical PARP inhibition enhances growth of Arabidopsis and reduces anthocyanin accumulation and the activation of stress protective mechanisms.

    Directory of Open Access Journals (Sweden)

    Philipp Schulz

    Full Text Available Poly-ADP-ribose polymerase (PARP post-translationally modifies proteins through the addition of ADP-ribose polymers, yet its role in modulating plant development and stress responses is only poorly understood. The experiments presented here address some of the gaps in our understanding of its role in stress tolerance and thereby provide new insights into tolerance mechanisms and growth. Using a combination of chemical and genetic approaches, this study characterized phenotypes associated with PARP inhibition at the physiological level. Molecular analyses including gene expression analysis, measurement of primary metabolites and redox metabolites were used to understand the underlying processes. The analysis revealed that PARP inhibition represses anthocyanin and ascorbate accumulation under stress conditions. The reduction in defense is correlated with enhanced biomass production. Even in unstressed conditions protective genes and molecules are repressed by PARP inhibition. The reduced anthocyanin production was shown to be based on the repression of transcription of key regulatory and biosynthesis genes. PARP is a key factor for understanding growth and stress responses of plants. PARP inhibition allows plants to reduce protection such as anthocyanin, ascorbate or Non-Photochemical-Quenching whilst maintaining high energy levels likely enabling the observed enhancement of biomass production under stress, opening interesting perspectives for increasing crop productivity.

  6. Molecular mechanisms involved in the inhibition of tumor cells proliferation exposed to elevated concentrations of the epidermal growth factor

    International Nuclear Information System (INIS)

    Guillen, Isabel A; Berlanga, Jorge; Camacho, Hanlet

    2013-01-01

    The EGF promotes inhibition of cell proliferation in vitro and in vivo models depending on its concentration, application schema and the type of tumor cells on which it acts. Our research hypothesis was based on the fact that the EGF varies the expression of genes involved in a negative regulation of tumor cell lines proliferation carrying high levels of its receptor (EGFR). Our objectives were, to obtain information about the effect of EGF on tumor cell proliferation in vitro and in vivo models and, know the gene expression patterns of a group of genes involved in cancer signaling pathways and EGFR. The results showed that EGF at nanomolar concentrations inhibits the tumor cells proliferation bearing high levels of EGFR and, promotes the survival of treated animals, establishing a direct relationship between the inhibition of cell proliferation, high concentrations of EGF and, high amount of EGFR in the cells. The differential gene expression profile showed a variation in a group of genes which exert a powerful control over the cell cycle progression, gene transcription and apoptosis. It was concluded that the inhibition of tumor cell proliferation by the action of EGF is due to activation of molecular mechanisms controlling cell cycle progression. This work won the Annual Award of the Cuban Academy of Sciences in 2012

  7. Antibacterial compounds of Canadian honeys target bacterial cell wall inducing phenotype changes, growth inhibition and cell lysis that resemble action of β-lactam antibiotics.

    Science.gov (United States)

    Brudzynski, Katrina; Sjaarda, Calvin

    2014-01-01

    Honeys show a desirable broad spectrum activity against Gram-positive and negative bacteria making antibacterial activity an intrinsic property of honey and a desirable source for new drug development. The cellular targets and underlying mechanism of action of honey antibacterial compounds remain largely unknown. To facilitate the target discovery, we employed a method of phenotypic profiling by directly comparing morphological changes in Escherichia coli induced by honeys to that of ampicillin, the cell wall-active β-lactam of known mechanism of action. Firstly, we demonstrated the purity of tested honeys from potential β-lactam contaminations using quantitative LC-ESI-MS. Exposure of log-phase E. coli to honey or ampicillin resulted in time- and concentration-dependent changes in bacterial cell shape with the appearance of filamentous phenotypes at sub-inhibitory concentrations and spheroplasts at the MBC. Cell wall destruction by both agents, clearly visible on microscopic micrographs, was accompanied by increased permeability of the lipopolysaccharide outer membrane as indicated by fluorescence-activated cell sorting (FACS). More than 90% E. coli exposed to honey or ampicillin became permeable to propidium iodide. Consistently with the FACS results, both honey-treated and ampicillin-treated E. coli cells released lipopolysaccharide endotoxins at comparable levels, which were significantly higher than controls (ptransformed with the ampicillin-resistance gene (β-lactamase) remained sensitive to honey, displayed the same level of cytotoxicity, cell shape changes and endotoxin release as ampicillin-sensitive cells. As expected, β-lactamase protected the host cell from antibacterial action of ampicillin. Thus, both honey and ampicillin induced similar structural changes to the cell wall and LPS and that this ability underlies antibacterial activities of both agents. Since the cell wall is critical for cell growth and survival, honey active compounds would be

  8. Structural and Molecular Mechanism of CdpR Involved in Quorum-Sensing and Bacterial Virulence in Pseudomonas aeruginosa.

    Directory of Open Access Journals (Sweden)

    Jingru Zhao

    2016-04-01

    Full Text Available Although quorum-sensing (QS systems are important regulators of virulence gene expression in the opportunistic human pathogen Pseudomonas aeruginosa, their detailed regulatory mechanisms have not been fully characterized. Here, we show that deletion of PA2588 resulted in increased production of pyocyanin and biofilm, as well as enhanced pathogenicity in a mouse model. To gain insights into the function of PA2588, we performed a ChIP-seq assay and identified 28 targets of PA2588, including the intergenic region between PA2588 and pqsH, which encodes the key synthase of Pseudomonas quinolone signal (PQS. Though the C-terminal domain was similar to DNA-binding regions of other AraC family members, structural studies revealed that PA2588 has a novel fold at the N-terminal region (NTR, and its C-terminal HTH (helix-turn-helix domain is also unique in DNA recognition. We also demonstrated that the adaptor protein ClpS, an essential regulator of ATP-dependent protease ClpAP, directly interacted with PA2588 before delivering CdpR to ClpAP for degradation. We named PA2588 as CdpR (ClpAP-degradation and pathogenicity Regulator. Moreover, deletion of clpP or clpS/clpA promotes bacterial survival in a mouse model of acute pneumonia infection. Taken together, this study uncovered that CdpR is an important QS regulator, which can interact with the ClpAS-P system to regulate the expression of virulence factors and pathogenicity.

  9. Role of a novel PH-kinase domain interface in PKB/Akt regulation: structural mechanism for allosteric inhibition.

    Directory of Open Access Journals (Sweden)

    Véronique Calleja

    2009-01-01

    Full Text Available Protein kinase B (PKB/Akt belongs to the AGC superfamily of related serine/threonine protein kinases. It is a key regulator downstream of various growth factors and hormones and is involved in malignant transformation and chemo-resistance. Full-length PKB protein has not been crystallised, thus studying the molecular mechanisms that are involved in its regulation in relation to its structure have not been simple. Recently, the dynamics between the inactive and active conformer at the molecular level have been described. The maintenance of PKB's inactive state via the interaction of the PH and kinase domains prevents its activation loop to be phosphorylated by its upstream activator, phosphoinositide-dependent protein kinase-1 (PDK1. By using a multidisciplinary approach including molecular modelling, classical biochemical assays, and Förster resonance energy transfer (FRET/two-photon fluorescence lifetime imaging microscopy (FLIM, a detailed model depicting the interaction between the different domains of PKB in its inactive conformation was demonstrated. These findings in turn clarified the molecular mechanism of PKB inhibition by AKT inhibitor VIII (a specific allosteric inhibitor and illustrated at the molecular level its selectivity towards different PKB isoforms. Furthermore, these findings allude to the possible function of the C-terminus in sustaining the inactive conformer of PKB. This study presents essential insights into the quaternary structure of PKB in its inactive conformation. An understanding of PKB structure in relation to its function is critical for elucidating its mode of activation and discovering how to modulate its activity. The molecular mechanism of inhibition of PKB activation by the specific drug AKT inhibitor VIII has critical implications for determining the mechanism of inhibition of other allosteric inhibitors and for opening up opportunities for the design of new generations of modulator drugs.

  10. Mechanisms of inhibition of HIV replication by nonnucleoside reverse transcriptase inhibitors

    OpenAIRE

    Sluis-Cremer, Nicolas; Tachedjian, Gilda

    2008-01-01

    The nonnucleoside reverse transcriptase (RT) inhibitors (NNRTIs) are a therapeutic class of compounds that are routinely used, in combination with other antiretroviral drugs, to treat HIV-1 infection. NNRTIs primarily block HIV-1 replication by preventing RT from completing reverse transcription of the viral single-stranded RNA genome into DNA. However, some NNRTIs, such as efavirenz, have been shown to inhibit the late stages of HIV-1 replication by interfering with HIV-1 Gag-Pol polyprotein...

  11. The inhibition effect of starch nanoparticles on tyrosinase activity and its mechanism.

    Science.gov (United States)

    Yang, Jie; Chang, Ranran; Ge, Shengju; Zhao, Mei; Liang, Caifeng; Xiong, Liu; Sun, Qingjie

    2016-12-07

    The objective of the current research was to investigate the effects of starch nanoparticles (SNPs) prepared from waxy maize, potato, normal corn, and tapioca starches on the activity of tyrosinase. As a main polyphenol oxidase, tyrosinase not only induces fruit and vegetable browning but also causes skin diseases by overproducing melanin. Herein, for the first time, we evaluated the inhibitory kinetics of SNPs on tyrosinase. It turned out that SNPs inhibited tyrosinase activity reversibly. The IC 50 values of hollow nanoparticles, amylopectin nanoparticles, corn starch nanoparticles, and tapioca starch nanoparticles were 0.308, 0.669, 1.490, and 4.774 μM, respectively. Assay of fluorescence spectra demonstrated that SNPs quenched the tyrosinase intrinsic fluorescence. Moreover, binding constant and binding sites found that SNPs were bound to tyrosinase through van der Waals forces, hydrogen bonds, as well as electrostatic interactions. Analysis of circular dichroism indicated that the incorporation of SNPs into tyrosinase prompted conformational alteration of the enzyme. Furthermore, inhibition of browning by SNPs loading with l-dopa compound indicated that not only the tyrosinase activity was inhibited, but also SNPs decreased free dopa content by adsorption. This research on SNPs as potential inhibitors could give rise to advancement in the realm of anti-tyrosinase and have versatile applications in medicine, food, cosmetics, materials and drugs.

  12. Mechanisms of growth inhibition of Phytomonas serpens by the alkaloids tomatine and tomatidine

    Directory of Open Access Journals (Sweden)

    Jorge Mansur Medina

    2015-02-01

    Full Text Available Phytomonas serpens are flagellates in the family Trypanosomatidae that parasitise the tomato plant (Solanum lycopersicum L., which results in fruits with low commercial value. The tomato glycoalkaloid tomatine and its aglycone tomatidine inhibit the growth of P. serpens in axenic cultures. Tomatine, like many other saponins, induces permeabilisation of the cell membrane and a loss of cell content, including the cytosolic enzyme pyruvate kinase. In contrast, tomatidine does not cause permeabilisation of membranes, but instead provokes morphological changes, including vacuolisation. Phytomonas treated with tomatidine show an increased accumulation of labelled neutral lipids (BODYPY-palmitic, a notable decrease in the amount of C24-alkylated sterols and an increase in zymosterol content. These results are consistent with the inhibition of 24-sterol methyltransferase (SMT, which is an important enzyme that is responsible for the methylation of sterols at the 24 position. We propose that the main target of tomatidine is the sterols biosynthetic pathway, specifically, inhibition of the 24-SMT. Altogether, the results obtained in the present paper suggest a more general effect of alkaloids in trypanosomatids, which opens potential therapeutic possibilities for the treatment of the diseases caused by these pathogens.

  13. Mechanisms of growth inhibition of Phytomonas serpens by the alkaloids tomatine and tomatidine.

    Science.gov (United States)

    Medina, Jorge Mansur; Rodrigues, Juliany Cola Fernandes; Moreira, Otacilio C; Atella, Geórgia; Souza, Wanderley de; Barrabin, Hector

    2015-02-01

    Phytomonas serpens are flagellates in the family Trypanosomatidae that parasitise the tomato plant (Solanum lycopersicum L.), which results in fruits with low commercial value. The tomato glycoalkaloid tomatine and its aglycone tomatidine inhibit the growth of P. serpens in axenic cultures. Tomatine, like many other saponins, induces permeabilisation of the cell membrane and a loss of cell content, including the cytosolic enzyme pyruvate kinase. In contrast, tomatidine does not cause permeabilisation of membranes, but instead provokes morphological changes, including vacuolisation. Phytomonas treated with tomatidine show an increased accumulation of labelled neutral lipids (BODYPY-palmitic), a notable decrease in the amount of C24-alkylated sterols and an increase in zymosterol content. These results are consistent with the inhibition of 24-sterol methyltransferase (SMT), which is an important enzyme that is responsible for the methylation of sterols at the 24 position. We propose that the main target of tomatidine is the sterols biosynthetic pathway, specifically, inhibition of the 24-SMT. Altogether, the results obtained in the present paper suggest a more general effect of alkaloids in trypanosomatids, which opens potential therapeutic possibilities for the treatment of the diseases caused by these pathogens.

  14. Enzyme Mechanism and Slow-Onset Inhibition of Plasmodium falciparum Enoyl-Acyl Carrier Protein Reductase by an Inorganic Complex

    Science.gov (United States)

    de Medeiros, Patrícia Soares de Maria; Ducati, Rodrigo Gay; Basso, Luiz Augusto; Santos, Diógenes Santiago; da Silva, Luiz Hildebrando Pereira

    2011-01-01

    Malaria continues to be a major cause of children's morbidity and mortality worldwide, causing nearly one million deaths annually. The human malaria parasite, Plasmodium falciparum, synthesizes fatty acids employing the Type II fatty acid biosynthesis system (FAS II), unlike humans that rely on the Type I (FAS I) pathway. The FAS II system elongates acyl fatty acid precursors of the cell membrane in Plasmodium. Enoyl reductase (ENR) enzyme is a member of the FAS II system. Here we present steady-state kinetics, pre-steady-state kinetics, and equilibrium fluorescence spectroscopy data that allowed proposal of P. falciparum ENR (PfENR) enzyme mechanism. Moreover, building on previous results, the present study also evaluates the PfENR inhibition by the pentacyano(isoniazid)ferrateII compound. This inorganic complex represents a new class of lead compounds for the development of antimalarial agents focused on the inhibition of PfENR. PMID:21603269

  15. Rosiglitazone inhibits HMC-1 cell migration and adhesion through a peroxisome proliferator-activated receptor gamma-dependent mechanism.

    Science.gov (United States)

    Zhang, Guqin; Yang, Jiong; Li, Ping; Cao, Jie; Nie, Hanxiang

    2014-02-01

    Mast cells play an important role in a variety of inflammatory diseases, particularly asthma and atopy. Peroxisome proliferator-activated receptor gamma (PPARγ) is a member of the large nuclear hormone receptor transcription factor superfamily, and has been recently implicated in the anti-inflammatory response. To investigate a possible role for PPARγ in human mast cells, we studied the effects of a PPARγ ligand, rosiglitazone (RG), on stem cell factor (SCF)-induced migration and fibronectin-induced adhesion in human mast cell-1(HMC-1) cells. It was found that HMC-1 cells expressed PPARγ mRNA. RG inhibited SCF-induced HMC-1 cell migration and fibronectin-induced HMC-1 cell adhesion, the selective PPARγ antagonist GW9662 prevented the inhibitory effect of RG on HMC-1 cells. In conclusion, RG inhibits the migration and adhesion of HMC-1 cells by a PPARγ-dependent mechanism.

  16. The symbiotic bacterial surface factor polysaccharide A on Bacteroides fragilis inhibits IL-1β-induced inflammation in human fetal enterocytes via toll receptors 2 and 4.

    Directory of Open Access Journals (Sweden)

    Fei Jiang

    Full Text Available Colonizing bacteria interacting with the immature, unlike the mature, human intestine favors inflammation over immune homeostasis. As a result, ten percent of premature infants under 1500 grams weight develop an inflammatory necrosis of the intestine after birth, e.g., necrotizing enterocolitis (NEC. NEC is a major health problem in this population causing extensive morbidity and mortality and an enormous expenditure of health care dollars. NEC can be prevented by giving preterm infants their mother's expressed breast milk or ingesting selective probiotic organisms. Vaginally delivered, breast fed newborns develop health promoting bacteria ("pioneer" bacteria which preferentially stimulate intestinal host defense and anti-inflammation. One such "pioneer" organism is Bacteroides fragilis with a polysaccharide (PSA on its capsule. B. fragilis has been shown developmentally in intestinal lymphocytes and dendritic cells to produce a balanced T-helper cell (TH1/TH2 response and to reduce intestinal inflammation by activity through the TLR2 receptor stimulating IL-10 which inhibits IL-17 causing inflammation. No studies have been done on the role of B. fragilis PSA on fetal enterocytes and its increased inflammation. Accordingly, using human and mouse fetal intestinal models, we have shown that B. fragilis with PSA and PSA alone inhibits IL-1β-induced IL-8 inflammation in fetal and NEC intestine. We have also begun to define the mechanism for this unique inflammation noted in fetal intestine. We have shown that B. fragilis PSA anti-inflammation requires both the TLR2 and TLR4 receptor and is in part mediated by the AP1 transcription factor (TLR2 which is developmentally regulated. These observations may help to devise future preventative treatments of premature infants against NEC.

  17. LY294002 inhibits glucocorticoid-induced COX-2 gene expression in cardiomyocytes through a phosphatidylinositol 3 kinase-independent mechanism

    International Nuclear Information System (INIS)

    Sun Haipeng; Xu Beibei; Sheveleva, Elena; Chen, Qin M.

    2008-01-01

    Glucocorticoids induce COX-2 expression in rat cardiomyocytes. While investigating whether phosphatidylinositol 3 kinase (PI3K) plays a role in corticosterone (CT)-induced COX-2, we found that LY294002 (LY29) but not wortmannin (WM) attenuates CT from inducing COX-2 gene expression. Expression of a dominant-negative mutant of p85 subunit of PI3K failed to inhibit CT from inducing COX-2 expression. CT did not activate PI3K/AKT signaling pathway whereas LY29 and WM decreased the activity of PI3K. LY303511 (LY30), a structural analogue and a negative control for PI3K inhibitory activity of LY29, also suppressed COX-2 induction. These data suggest PI3K-independent mechanisms in regulating CT-induced COX-2 expression. LY29 and LY30 do not inhibit glucocorticoid receptor transactivity. Both compounds have been reported to inhibit Casein Kinase 2 activity and modulate potassium and calcium levels independent of PI3K, while LY29 has been reported to inhibit mammalian Target of Rapamycin (mTOR), and DNA-dependent Protein Kinase (DNA-PK). Inhibitor of Casein Kinase 2 (CK2), mTOR or DNA-PK failed to prevent CT from inducing COX-2 expression. Tetraethylammonium (TEA), a potassium channel blocker, and nimodipine, a calcium channel blocker, both attenuated CT from inducing COX-2 gene expression. CT was found to increase intracellular Ca 2+ concentration, which can be inhibited by LY29, TEA or nimodipine. These data suggest a possible role of calcium instead of PI3K in CT-induced COX-2 expression in cardiomyocytes

  18. Mechanism of mercurial inhibition of sodium-coupled alanine uptake in liver plasma membrane vesicles from Raja erinacea

    International Nuclear Information System (INIS)

    Sellinger, M.; Ballatori, N.; Boyer, J.L.

    1991-01-01

    In mammalian hepatocytes the L-alanine carrier contains a sulfhydryl group that is essential for its activity and is inhibited by mercurials. In hepatocytes of the evolutionarily primitive little skate (Raja erinacea), HgCl2 inhibits Na(+)-dependent alanine uptake and Na+/K(+)-ATPase and increase K+ permeability. To distinguish between direct effects of HgCl2 on the Na(+)-alanine cotransporter and indirect effects on membrane permeability, [3H]alanine transport was studied in plasma membrane vesicles. [3H]Alanine uptake was stimulated by an out-to-in Na+ but not K+ gradient and was saturable confirming the presence of Na(+)-alanine cotransport in liver plasma membranes from this species. Preincubation of the vesicles with HgCl2 for 5 min reduced initial rates of Na(+)-dependent but not Na(+)-independent alanine uptake in a dose-dependent manner (10-200 microM). In the presence of equal concentrations of NaCl or KCl inside and outside of the vesicles, 75 microM HgCl2 directly inhibited sodium-dependent alanine-[3H]alanine exchange, demonstrating that HgCl2 directly affected the alanine cotransporter. Inhibition of Na(+)-dependent alanine uptake by 30 microM HgCl2 was reversed by dithiothreitol (1 mM). HgCl2 (10-30 microM) also increased initial rates of 22Na uptake (at 5 sec), whereas 22Na uptake rates were decreased at HgCl2 concentrations greater than 50 microM. Higher concentrations of HgCl2 (100-200 microM) produced nonspecific effects on vesicle integrity. These studies indicate that HgCl2 inhibits Na(+)-dependent alanine uptake in skate hepatocytes by three different concentration-dependent mechanisms: direct interaction with the transporters, dissipation of the driving force (Na+ gradient), and loss of membrane integrity

  19. Systematic study of imidazoles inhibiting IDO1 via the integration of molecular mechanics and quantum mechanics calculations.

    Science.gov (United States)

    Zou, Yi; Wang, Fang; Wang, Yan; Guo, Wenjie; Zhang, Yihua; Xu, Qiang; Lai, Yisheng

    2017-05-05

    Indoleamine 2,3-dioxygenase 1 (IDO1) is regarded as an attractive target for cancer immunotherapy. To rationalize the detailed interactions between IDO1 and its inhibitors at the atomic level, an integrated computational approach by combining molecular mechanics and quantum mechanics methods was employed in this report. Specifically, the binding modes of 20 inhibitors was initially investigated using the induced fit docking (IFD) protocol, which outperformed other two docking protocols in terms of correctly predicting ligand conformations. Secondly, molecular dynamics (MD) simulations and MM/PBSA free energy calculations were employed to determine the dynamic binding process and crucial residues were confirmed through close contact analysis, hydrogen-bond analysis and binding free energy decomposition calculations. Subsequent quantum mechanics and nonbonding interaction analysis were carried out to provide in-depth explanations on the critical role of those key residues, and Arg231 and 7-propionate of the heme group were major contributors to ligand binding, which lowed a great amount of interaction energy. We anticipate that these findings will be valuable for enzymatic studies and rational drug design. Copyright © 2017. Published by Elsevier Masson SAS.

  20. Structure-function analyses of a pertussis-like toxin from pathogenicEscherichia colireveal a distinct mechanism of inhibition of trimeric G-proteins.

    Science.gov (United States)

    Littler, Dene R; Ang, Sheng Y; Moriel, Danilo G; Kocan, Martina; Kleifeld, Oded; Johnson, Matthew D; Tran, Mai T; Paton, Adrienne W; Paton, James C; Summers, Roger J; Schembri, Mark A; Rossjohn, Jamie; Beddoe, Travis

    2017-09-08

    Pertussis-like toxins are secreted by several bacterial pathogens during infection. They belong to the AB 5 virulence factors, which bind to glycans on host cell membranes for internalization. Host cell recognition and internalization are mediated by toxin B subunits sharing a unique pentameric ring-like assembly. Although the role of pertussis toxin in whooping cough is well-established, pertussis-like toxins produced by other bacteria are less studied, and their mechanisms of action are unclear. Here, we report that some extra-intestinal Escherichia coli pathogens ( i.e. those that reside in the gut but can spread to other bodily locations) encode a pertussis-like toxin that inhibits mammalian cell growth in vitro We found that this protein, Ec Plt, is related to toxins produced by both nontyphoidal and typhoidal Salmonella serovars. Pertussis-like toxins are secreted as disulfide-bonded heterohexamers in which the catalytic ADP-ribosyltransferase subunit is activated when exposed to the reducing environment in mammalian cells. We found here that the reduced Ec Plt exhibits large structural rearrangements associated with its activation. We noted that inhibitory residues tethered within the NAD + -binding site by an intramolecular disulfide in the oxidized state dissociate upon the reduction and enable loop restructuring to form the nucleotide-binding site. Surprisingly, although pertussis toxin targets a cysteine residue within the α subunit of inhibitory trimeric G-proteins, we observed that activated Ec Plt toxin modifies a proximal lysine/asparagine residue instead. In conclusion, our results reveal the molecular mechanism underpinning activation of pertussis-like toxins, and we also identified differences in host target specificity. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Angiotensin II inhibits insulin-stimulated GLUT4 translocation and Akt activation through tyrosine nitration-dependent mechanisms.

    Directory of Open Access Journals (Sweden)

    Alfredo Csibi

    Full Text Available Angiotensin II (Ang II plays a major role in the pathogenesis of insulin resistance and diabetes by inhibiting insulin's metabolic and potentiating its trophic effects. Whereas the precise mechanisms involved remain ill-defined, they appear to be associated with and dependent upon increased oxidative stress. We found Ang II to block insulin-dependent GLUT4 translocation in L6 myotubes in an NO- and O(2(*--dependent fashion suggesting the involvement of peroxynitrite. This hypothesis was confirmed by the ability of Ang II to induce tyrosine nitration of the MAP kinases ERK1/2 and of protein kinase B/Akt (Akt. Tyrosine nitration of ERK1/2 was required for their phosphorylation on Thr and Tyr and their subsequent activation, whereas it completely inhibited Akt phosphorylation on Ser(473 and Thr(308 as well as its activity. The inhibitory effect of nitration on Akt activity was confirmed by the ability of SIN-1 to completely block GSK3alpha phosphorylation in vitro. Inhibition of nitric oxide synthase and NAD(PHoxidase and scavenging of free radicals with myricetin restored insulin-stimulated Akt phosphorylation and GLUT4 translocation in the presence of Ang II. Similar restoration was obtained by inhibiting the ERK activating kinase MEK, indicating that these kinases regulate Akt activation. We found a conserved nitration site of ERK1/2 to be located in their kinase domain on Tyr(156/139, close to their active site Asp(166/149, in agreement with a permissive function of nitration for their activation. Taken together, our data show that Ang II inhibits insulin-mediated GLUT4 translocation in this skeletal muscle model through at least two pathways: first through the transient activation of ERK1/2 which inhibit IRS-1/2 and second through a direct inhibitory nitration of Akt. These observations indicate that not only oxidative but also nitrative stress play a key role in the pathogenesis of insulin resistance. They underline the role of protein

  2. Periostin inhibits mechanical stretch-induced apoptosis in osteoblast-like MG-63 cells.

    Science.gov (United States)

    Yu, Kai-Wen; Yao, Chung-Chen; Jeng, Jiiang-Huei; Shieh, Hao-Ying; Chen, Yi-Jane

    2018-04-01

    Appropriate mechanical stress plays an important role in regulating the proliferation and differentiation of osteoblasts, whereas high-level mechanical stress may be harmful and compromise cell survival. Periostin, a matricellular protein, is essential in maintaining functional integrity of bone and collagen-rich connective tissue in response to mechanical stress. This study investigated whether or not high-level mechanical stretch induces cell apoptosis and the regulatory role of periostin in mechanical stretch-induced apoptosis in osteoblastic cells. Osteoblast-like MG-63 cells were seeded onto Bio-Flex I culture plates and subjected to cyclic mechanical stretching (15% elongation, 0.1 Hz) in a Flexercell tension plus system-5000. The same process was applied to cells pre-treated with exogenous human recombinant periostin before mechanical stretching. We used a chromatin condensation and membrane permeability dead cell apoptosis kit to evaluate the stretch-induced cell responses. Expression of caspase-3 and cPARP was examined by immunofluorescent stain and flow cytometry. The expression of periostin in MG-63 cells is involved in the TGF-β signaling pathway. High-level cyclic mechanical stretch induced apoptotic responses in MG-63 osteoblastic cells. The percentages of apoptotic cells and cells expressing cPARP protein increased in the groups of cells subjected to mechanical stretch, but these responses were absent in the presence of exogenous periostin. Our study revealed that high-level mechanical stretch induces apoptotic cell death, and that periostin plays a protective role against mechanical stretch-induced apoptosis in osteoblastic cells. Copyright © 2017. Published by Elsevier B.V.

  3. Probenecid and N-Acetylcysteine Prevent Loss of Intracellular Glutathione and Inhibit Neuronal Death after Mechanical Stretch Injury In Vitro.

    Science.gov (United States)

    Du, Lina; Empey, Philip E; Ji, Jing; Chao, Honglu; Kochanek, Patrick M; Bayır, Hülya; Clark, Robert S B

    2016-10-15

    Probenecid and N-acetylcysteine (NAC) can preserve intracellular levels of the vital antioxidant glutathione (GSH) via two distinct biochemical pathways. Probenecid inhibits transporter-mediated GSH efflux and NAC serves as a cysteine donor for GSH synthesis. We hypothesized that probenecid and NAC alone would maintain intracellular GSH concentrations and inhibit neuronal death after traumatic stretch injury, and that the drugs in combination would produce additive effects. Sex-segregated rat primary cortical neurons were treated with probenecid (100 μM) and NAC (50 μM), alone and in combination (Pro-NAC), then subjected to mechanical stretch (10s -1 strain rate, 50% membrane deformation). At 24 h, both probenecid and NAC inhibited trauma-induced intracellular GSH depletion, lactate dehydrogenase (LDH) release, and propidium iodide (PI) uptake in both XY- and XX-neurons. Combined Pro-NAC treatment was superior to probenecid or NAC alone in maintenance of intracellular GSH and neuronal death assessed by PI uptake. Interestingly, caspase 3 activity 24 h after mechanical trauma was more prominent in XX-neurons, and treatment effects (probenecid, NAC, and Pro-NAC) were observed in XX- but not XY-neurons; however, XY-neurons were ultimately more vulnerable to mechanical stretch-induced injury than their XX counterparts, as was evidenced by more neuronal death detected by LDH release and PI uptake. In addition, after stretch injury in HT22 hippocampal cells, both NAC and probenecid were highly effective at reducing oxidative stress detected by dichlorofluorescein fluorescence. These in vitro data support further testing of this drug combination in models of traumatic neuronal injury in vivo.

  4. Inhibition of cAMP-Activated Intestinal Chloride Secretion by Diclofenac: Cellular Mechanism and Potential Application in Cholera

    OpenAIRE

    Pongkorpsakol, Pawin; Pathomthongtaweechai, Nutthapoom; Srimanote, Potjanee; Soodvilai, Sunhapas; Chatsudthipong, Varanuj; Muanprasat, Chatchai

    2014-01-01

    Cyclic AMP-activated intestinal Cl- secretion plays an important role in pathogenesis of cholera. This study aimed to investigate the effect of diclofenac on cAMP-activated Cl- secretion, its underlying mechanisms, and possible application in the treatment of cholera. Diclofenac inhibited cAMP-activated Cl- secretion in human intestinal epithelial (T84) cells with IC50 of ∼ 20 µM. The effect required no cytochrome P450 enzyme-mediated metabolic activation. Interestingly, exposures of T84 cell...

  5. Salvianolic Acid B inhibits platelet adhesion under conditions of flow by a mechanism involving the collagen receptor alpha 2 beta 1

    NARCIS (Netherlands)

    Wu, Ya Ping; Zhao, Xiao Min; Pan, Shao Dong; Guo, De An; Wei, Ran; Han, Ji Ju; Kainoh, Mie; Xia, Zuo Li; de Groot, Philip G.; Lisman, Ton

    2008-01-01

    Salvianolic acid B (SAB) is a component of Danshen, a herb widely used in Chinese medicine, and was previously shown to exert a number of biological activities including inhibition of platelet function, but the exact mechanisms involved are unclear. SAB dose-dependently inhibited platelet deposition

  6. A novel regulatory mechanism of naringenin through inhibition of T lymphocyte function in contact hypersensitivity suppression

    Energy Technology Data Exchange (ETDEWEB)

    Fang, Feng; Tang, Yijun; Gao, Zhe [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, 22 Hankou Road, Nanjing 210093 (China); Xu, Qiang, E-mail: molpharm@163.com [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, 22 Hankou Road, Nanjing 210093 (China)

    2010-06-25

    Naringenin, a flavonoid in grapefruits and citrus fruits, has been reported to exhibit anti-inflammatory and anti-oxidative activities. Contact hypersensitivity (CHS) is a T cell-mediated immune reaction, and the factors released from macrophages also contribute to this response. Previous studies showed that naringenin suppressed CHS by inhibiting activation and migration of macrophages. However, little is known about naringenin's effects on T lymphocytes. Our study indicated that naringenin potently suppressed picryl chloride (PCl)-induced contact hypersensitivity by inhibiting the proliferation and activation of T lymphocytes. In vitro, both of the activated hapten-specific T cells and the T cells stimulated with anti-CD3/anti-CD28 showed growth arrest after naringenin treatment. Furthermore, naringenin reduced CD69 (the protein level) and cytokines such as IL-2, TNF-{alpha}, and IFN-{gamma} (the mRNA level) expressions which highly expressed by activated T cells. Meanwhile, naringenin also induced T cell apoptosis by upregulation of Bax, Bad, PARP, cleaved-caspase 3 and downregulation of phosphorylated Akt, Bcl-2. These findings suggest that, besides its anti-inflammatory activities in macrophages, naringenin also showed inhibitory effects on the activation and proliferation of T cells to alleviate symptoms of contact hypersensitivity.

  7. Thermoanaerobacterium thermosulfurigenes cyclodextrin glycosyltransferase. Mechanism and kinetics of inhibition by acarbose and cyclodextrins

    NARCIS (Netherlands)

    Leemhuis, Hans; Dijkstra, Bauke W.; Dijkhuizen, Lubbert

    2003-01-01

    Cyclodextrin glycosyltransferase (CGTase) uses an α-retaining double displacement mechanism to catalyze three distinct transglycosylation reactions. To investigate these reactions as catalyzed by the CGTase from Thermoanaerobacterium thermosulfurigenes the enzyme was overproduced (8 mg·L-1 culture)

  8. Thermoanaerobacterium thermosulfurigenes cyclodextrin glycosyltransferase - Mechanism and kinetics of inhibition by acarbose and cyclodextrins

    NARCIS (Netherlands)

    Leemhuis, H; Dijkstra, BW; Dijkhuizen, L

    Cyclodextrin glycosyltransferase (CGTase) uses an alpha-retaining double displacement mechanism to catalyze three distinct transglycosylation reactions. To investigate these reactions as catalyzed by the CGTase from Thermoanaerobacterium thermosulfurigenes the enzyme was overproduced (8 mg.L-1

  9. A role of TRPA1 in mechanical hyperalgesia is revealed by pharmacological inhibition

    Directory of Open Access Journals (Sweden)

    Huynh Truc

    2007-12-01

    Full Text Available Abstract Mechanical hyperalgesia is a clinically-relevant form of pain sensitization that develops through largely unknown mechanisms. TRPA1, a Transient Receptor Potential ion channel, is a sensor of pungent chemicals that may play a role in acute noxious mechanosensation and cold thermosensation. We have developed a specific small molecule TRPA1 inhibitor (AP18 that can reduce cinnameldehyde-induced nociception in vivo. Interestingly, AP18 is capable of reversing CFA-induced mechanical hyperalgesia in mice. Although TRPA1-deficient mice develop normal CFA-induced hyperalgeisa, AP18 is ineffective in the knockout mice, consistent with an on-target mechanism. Therefore, TRPA1 plays a role in sensitization of nociception, and that compensation in TRPA1-deficient mice masks this requirement.

  10. Insight into the metabolic mechanism of scoparone on biomarkers for inhibiting Yanghuang syndrome