WorldWideScience

Sample records for bacterial gntr transcription

  1. Structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn2+-binding FCD domains

    International Nuclear Information System (INIS)

    Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.; Yu, Minmin; Hung, Li-Wei; Cieslik, Marcin; Derewenda, Urszula; Lesley, Scott A.; Wilson, Ian A.; Giedroc, David P.; Derewenda, Zygmunt S.

    2009-01-01

    Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR-C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacterium glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni 2+ ions but that it is able to bind Zn 2+ with K d < 70 nM. It is concluded that Zn 2+ is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors

  2. Crystal structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn2+-binding FCD domains

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Meiying; Cooper, David; Grossoehmerb, Nickolas; Yu, Minmin; Hung, Li-Wei; Cieslik, Murcin; Derewendaro, Urszula; Lesley, Scott; Wilson, Ian; Giedrocb, David; Derewenda, Zygmunt

    2009-06-06

    The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged helix (WH) DNA-binding domains and diverse C-terminal, regulatory domains, which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all a-helical regulatory domains classified into two related Pfam families: FadR{_}C and FCD. Only two crystal structures of the FadR family members, i.e. the E. coli FadR protein and the LldR from C. glutamicum, have been described to date in literature. Here we describe the crystal structure of TM0439, a GntR regulator with an FCD domain, found in the Thermotoga maritima genome. The FCD domain is similar to that of the LldR regulator, and contains a buried metal binding site. Using atomic absorption spectroscopy and Trp fluorescence, we show that the recombinant protein contains bound Ni{sup 2+} ions, but it is able to bind Zn{sup 2+} with K{sub D} < 70 nM . We conclude that Zn{sup 2+} is the likely physiological metal, where it may perform either or both structural and regulatory roles. Finally, we compare the TM0439 structure to two other FadR family structures recently deposited by Structural Genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors.

  3. Systematic mutagenesis of all predicted gntR genes in Xanthomonas campestris pv. campestris reveals a GntR family transcriptional regulator controlling hypersensitive response and virulence.

    Science.gov (United States)

    An, Shi-Qi; Lu, Guang-Tao; Su, Hui-Zhao; Li, Rui-Fang; He, Yong-Qiang; Jiang, Bo-Le; Tang, Dong-Jie; Tang, Ji-Liang

    2011-09-01

    The GntR family is one of the most abundant and widely distributed groups of helix-turn-helix transcriptional regulators in bacteria. Six open reading frames in the genome of the plant pathogen Xanthomonas campestris pv. campestris were predicted to encode GntR regulators. All six of the predicted GntR-encoding genes were individually mutagenized and mutants from five of them were successfully obtained. Plant disease response assays revealed that one, whose product belongs to the YtrA subfamily and has been named HpaR1, is involved in the hypersensitive response (HR) and virulence. Electrophoretic mobility shift assays and in vitro transcription assays revealed that HpaR1 could repress its own transcription level through binding to its promoter sequence, indicating an autoregulatory feedback inhibition mechanism for HpaR1 expression. Promoter-gusA reporter and reverse-transcription polymerase chain reaction analyses revealed that HpaR1 positively and negatively affects the expression of HR and pathogenicity (hrp) genes in host plant and standard media, respectively. Constitutive expression of the key hrp regulator, hrpG, in the hpaR1 mutant could bypass the requirement of HpaR1 for the induction of wild-type HR, suggesting that HpaR1 regulates the expression of hrp genes that encode the type III secretion system via hrpG.

  4. Transcriptional regulator GntR of Brucella abortus regulates cytotoxicity, induces the secretion of inflammatory cytokines and affects expression of the type IV secretion system and quorum sensing system in macrophages.

    Science.gov (United States)

    Li, Zhiqiang; Wang, Shuli; Zhang, Hui; Zhang, Jinliang; Xi, Li; Zhang, Junbo; Chen, Chuangfu

    2017-03-01

    The pathogenic mechanisms of Brucella are still poorly understood. GntR is a transcriptional regulator and plays an important role in the intracellular survival of Brucella. To investigate whether GntR is involved in the cytotoxicity of Brucella abortus (B. abortus), we created a 2308ΔgntR mutant of B. abortus 2308 (S2308). Lactate dehydrogenase (LDH) cytotoxicity assays using a murine macrophage cell line (RAW 264.7) show that high-dose infection with the parental strain produces a high level of cytotoxicity to macrophages, but the 2308ΔgntR mutant exhibits a very low level of cytotoxicity, indicating that mutation of GntR impairs the cytotoxicity of B. abortus to macrophages. After the macrophages are infected with 2308ΔgntR, the levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-8 (IL-8) increase and are slightly higher than that for the S2308 infected group, indicating that the 2308ΔgntR mutant could induce the secretion of inflammatory cytokines. The virulence factor detection experiments indicate that genes involved in the type IV secretion system (T4SS) and quorum sensing system (QSS) are down-regulated in 2308ΔgntR. The lower levels of survival of 2308ΔgntR under various stress conditions and the increased sensitivity of 2308ΔgntR to polymyxin B suggest that GntR is a virulence factor and that deletion of gntR reduces of B. abortus to stress conditions. Taken together, our results demonstrate that GntR is involved in the cytotoxicity, virulence and intracellular survival of B. abortus during its infection.

  5. GntR family regulator SCO6256 is involved in antibiotic production and conditionally regulates the transcription of myo-inositol catabolic genes in Streptomyces coelicolor A3(2).

    Science.gov (United States)

    Yu, Lingjun; Gao, Wenyan; Li, Shuxian; Pan, Yuanyuan; Liu, Gang

    2016-03-01

    SCO6256 belongs to the GntR family and shows 74% identity with SCO6974, which is the repressor of myo-inositol catabolism in Streptomyces coelicolor A3(2). Disruption of SCO6256 significantly enhanced the transcription of myo-inositol catabolic genes in R2YE medium. The purified recombinant SCO6256 directly bound to the upstream regions of SCO2727, SCO6978 and SCO6985, as well as its encoding gene. Footprinting assays demonstrated that SCO6256 bound to the same sites in the myo-inositol catabolic gene cluster as SCO6974. The expression of SCO6256 was repressed by SCO6974 in minimal medium with myo-inositol as the carbon source, but not in R2YE medium. Glutathione-S-transferase pull-down assays demonstrated that SCO6974 and SCO6256 interacted with each other; and both of the proteins controlled the transcription of myo-inositol catabolic genes in R2YE medium. These results indicated SCO6256 regulates the transcription of myo-inositol catabolic genes in coordination with SCO6974 in R2YE medium. In addition, SCO6256 negatively regulated the production of actinorhodin and calcium-dependent antibiotic via control of the transcription of actII-ORF4 and cdaR. SCO6256 bound to the upstream region of cdaR and the binding sequence was proved to be TTTCGGCACGCAGACAT, which was further confirmed through base substitution. Four putative targets (SCO2652, SCO4034, SCO4237 and SCO6377) of SCO6256 were found by screening the genome sequence of Strep. coelicolor A3(2) based on the conserved binding motif, and confirmed by transcriptional analysis and electrophoretic mobility shift assays. These results revealed that SCO6256 is involved in the regulation of myo-inositol catabolic gene transcription and antibiotic production in Strep. coelicolor A3(2).

  6. GntR family of regulators in Mycobacterium smegmatis: a sequence and structure based characterization

    Directory of Open Access Journals (Sweden)

    Ranjan Akash

    2007-08-01

    Full Text Available Abstract Background Mycobacterium smegmatis is fast growing non-pathogenic mycobacteria. This organism has been widely used as a model organism to study the biology of other virulent and extremely slow growing species like Mycobacterium tuberculosis. Based on the homology of the N-terminal DNA binding domain, the recently sequenced genome of M. smegmatis has been shown to possess several putative GntR regulators. A striking characteristic feature of this family of regulators is that they possess a conserved N-terminal DNA binding domain and a diverse C-terminal domain involved in the effector binding and/or oligomerization. Since the physiological role of these regulators is critically dependent upon effector binding and operator sites, we have analysed and classified these regulators into their specific subfamilies and identified their potential binding sites. Results The sequence analysis of M. smegmatis putative GntRs has revealed that FadR, HutC, MocR and the YtrA-like regulators are encoded by 45, 8, 8 and 1 genes respectively. Further out of 45 FadR-like regulators, 19 were classified into the FadR group and 26 into the VanR group. All these proteins showed similar secondary structural elements specific to their respective subfamilies except MSMEG_3959, which showed additional secondary structural elements. Using the reciprocal BLAST searches, we further identified the orthologs of these regulators in Bacillus subtilis and other mycobacteria. Since the expression of many regulators is auto-regulatory, we have identified potential operator sites for a number of these GntR regulators by analyzing the upstream sequences. Conclusion This study helps in extending the annotation of M. smegmatis GntR proteins. It identifies the GntR regulators of M. smegmatis that could serve as a model for studying orthologous regulators from virulent as well as other saprophytic mycobacteria. This study also sheds some light on the nucleotide preferences in the

  7. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  8. DETECTION OF BACTERIAL SMALL TRANSCRIPTS FROM RNA-SEQ DATA: A COMPARATIVE ASSESSMENT.

    Science.gov (United States)

    Peña-Castillo, Lourdes; Grüell, Marc; Mulligan, Martin E; Lang, Andrew S

    2016-01-01

    Small non-coding RNAs (sRNAs) are regulatory RNA molecules that have been identified in a multitude of bacterial species and shown to control numerous cellular processes through various regulatory mechanisms. In the last decade, next generation RNA sequencing (RNA-seq) has been used for the genome-wide detection of bacterial sRNAs. Here we describe sRNA-Detect, a novel approach to identify expressed small transcripts from prokaryotic RNA-seq data. Using RNA-seq data from three bacterial species and two sequencing platforms, we performed a comparative assessment of five computational approaches for the detection of small transcripts. We demonstrate that sRNA-Detect improves upon current standalone computational approaches for identifying novel small transcripts in bacteria.

  9. Transcriptional response of Musca domestica larvae to bacterial infection.

    Directory of Open Access Journals (Sweden)

    Ting Tang

    Full Text Available The house fly Musca domestica, a cosmopolitan dipteran insect, is a significant vector for human and animal bacterial pathogens, but little is known about its immune response to these pathogens. To address this issue, we inoculated the larvae with a mixture of Escherichia coli and Staphylococcus aureus and profiled the transcriptome 6, 24, and 48 h thereafter. Many genes known to controlling innate immunity in insects were induced following infection, including genes encoding pattern recognition proteins (PGRPs, various components of the Toll and IMD signaling pathways and of the proPO-activating and redox systems, and multiple antimicrobial peptides. Interestingly, we also uncovered a large set of novel immune response genes including two broad-spectrum antimicrobial peptides (muscin and domesticin, which might have evolved to adapt to house-fly's unique ecological environments. Finally, genes mediating oxidative phosphorylation were repressed at 48 h post-infection, suggesting disruption of energy homeostasis and mitochondrial function at the late stages of infection. Collectively, our data reveal dynamic changes in gene expression following bacterial infection in the house fly, paving the way for future in-depth analysis of M. domestica's immune system.

  10. Role of the σ54 Activator Interacting Domain in Bacterial Transcription Initiation

    Energy Technology Data Exchange (ETDEWEB)

    Siegel, Alexander R. [Univ. of California, Berkeley, CA (United States); Wemmer, David E. [Univ. of California, Berkeley, CA (United States)

    2016-10-11

    Bacterial sigma factors are subunits of RNA polymerase that direct the holoenzyme to specific sets of promoters in the genome and are a central element of regulating transcription. Most polymerase holoenzymes open the promoter and initiate transcription rapidly after binding. However, polymerase containing the members of the σ54 family must be acted on by a transcriptional activator before DNA opening and initiation occur. A key domain in these transcriptional activators forms a hexameric AAA + ATPase that acts through conformational changes brought on by ATP hydrolysis. Contacts between the transcriptional activator and σ54 are primarily made through an N-terminal σ54 activator interacting domain (AID). To better understand this mechanism of bacterial transcription initiation, we characterized the σ54 AID by NMR spectroscopy and other biophysical methods and show that it is an intrinsically disordered domain in σ54 alone. In this paper, we identified a minimal construct of the Aquifex aeolicus σ54 AID that consists of two predicted helices and retains native-like binding affinity for the transcriptional activator NtrC1. Using the NtrC1 ATPase domain, bound with the non-hydrolyzable ATP analog ADP-beryllium fluoride, we studied the NtrC1–σ54 AID complex using NMR spectroscopy. We show that the σ54 AID becomes structured after associating with the core loops of the transcriptional activators in their ATP state and that the primary site of the interaction is the first predicted helix. Finally, understanding this complex, formed as the first step toward initiation, will help unravel the mechanism of σ54 bacterial transcription initiation.

  11. Quantification of yeast and bacterial gene transcripts in retail cheeses by reverse transcription-quantitative PCR.

    Science.gov (United States)

    Monnet, Christophe; Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

    2013-01-01

    The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed.

  12. Data from computational analysis of the peptide linkers in the MocR bacterial transcriptional regulators

    Directory of Open Access Journals (Sweden)

    Sebastiana Angelaccio

    2016-12-01

    Interpretation and discussion of reported data refer to the article “Structural properties of the linkers connecting the N- and C- terminal domains in the MocR bacterial transcriptional regulators” (T. Milano, S. Angelaccio, A. Tramonti, M. L. Di Salvo, R. Contestabile, S. Pascarella, 2016 [1].

  13. Transcriptional responses of Treponema denticola to other oral bacterial species.

    Directory of Open Access Journals (Sweden)

    Juni Sarkar

    presented here provide an in-depth understanding of the transcriptional responses triggered by contact-dependent interactions between microorganisms inhabiting the periodontal pocket.

  14. The dynamic nature and territory of transcriptional machinery in the bacterial chromosome

    Directory of Open Access Journals (Sweden)

    Ding Jun Jin

    2015-05-01

    Full Text Available Our knowledge of the regulation of genes involved in bacterial growth and stress responses is extensive; however, we have only recently begun to understand how environmental cues influence the dynamic, three-dimensional distribution of RNA polymerase (RNAP in Escherichia coli on the level of single cell, using wide-field fluorescence microscopy and state-of-the-art imaging techniques. Live-cell imaging using either an agarose-embedding procedure or a microfluidic system further underscores the dynamic nature of the distribution of RNAP in response to changes in the environment. A general agreement between live-cell and fixed-cell images has validated the formaldehyde-fixing procedure, which is a technical breakthrough in the study of the cell biology of RNAP. In this review we use a systems biology perspective to summarize the advances in the cell biology of RNAP in E. coli, including the discoveries of the bacterial nucleolus, the spatial compartmentalization of the transcription machinery at the periphery of the nucleoid, and the segregation of the chromosome territories for the two major cellular functions of transcription and replication in fast-growing cells. Our understanding of the coupling of transcription and bacterial chromosome (or nucleoid structure is also summarized. Using E. coli as a simple model system, co-imaging of RNAP with DNA and other factors during growth and stress responses will continue to be a useful tool for studying bacterial growth and adaptation in changing environment.

  15. Elongation factor P mediates a novel post-transcriptional regulatory pathway critical for bacterial virulence

    DEFF Research Database (Denmark)

    Zou, S Betty; Roy, Hervé; Ibba, Michael

    2012-01-01

    of the pathogen to respond to external cues are typically attenuating. Here we discuss our recent discovery of a novel post-transcriptional regulatory pathway critical for Salmonella virulence and stress resistance. The enzymes PoxA and YjeK coordinately attach a unique beta-amino acid onto a highly conserved......Bacterial pathogens detect and integrate multiple environmental signals to coordinate appropriate changes in gene expression including the selective expression of virulence factors, changes to metabolism and the activation of stress response systems. Mutations that abolish the ability...... changes in the translation machinery during stress adaptation, indicating that the role of these factors in physiology may be broadly conserved....

  16. Elongation factor P mediates a novel post-transcriptional regulatory pathway critical for bacterial virulence

    DEFF Research Database (Denmark)

    Zou, S Betty; Roy, Hervé; Ibba, Michael

    2012-01-01

    Bacterial pathogens detect and integrate multiple environmental signals to coordinate appropriate changes in gene expression including the selective expression of virulence factors, changes to metabolism and the activation of stress response systems. Mutations that abolish the ability...... of the pathogen to respond to external cues are typically attenuating. Here we discuss our recent discovery of a novel post-transcriptional regulatory pathway critical for Salmonella virulence and stress resistance. The enzymes PoxA and YjeK coordinately attach a unique beta-amino acid onto a highly conserved...

  17. Elucidating the role of transcription in shaping the 3D structure of the bacterial genome

    Science.gov (United States)

    Brandao, Hugo B.; Wang, Xindan; Rudner, David Z.; Mirny, Leonid

    Active transcription has been linked to several genome conformation changes in bacteria, including the recruitment of chromosomal DNA to the cell membrane and formation of nucleoid clusters. Using genomic and imaging data as input into mathematical models and polymer simulations, we sought to explore the extent to which bacterial 3D genome structure could be explained by 1D transcription tracks. Using B. subtilis as a model organism, we investigated via polymer simulations the role of loop extrusion and DNA super-coiling on the formation of interaction domains and other fine-scale features that are visible in chromosome conformation capture (Hi-C) data. We then explored the role of the condensin structural maintenance of chromosome complex on the alignment of chromosomal arms. A parameter-free transcription traffic model demonstrated that mean chromosomal arm alignment can be quantitatively explained, and the effects on arm alignment in genomically rearranged strains of B. subtilis were accurately predicted. H.B. acknowledges support from the Natural Sciences and Engineering Research Council of Canada for a PGS-D fellowship.

  18. Transcriptional responses of resistant and susceptible fish clones to the bacterial pathogen Flavobacterium psychrophilum.

    Directory of Open Access Journals (Sweden)

    Christelle Langevin

    Full Text Available Flavobacterium psychrophilum is a bacterial species that represents one of the most important pathogens for aquaculture worldwide, especially for salmonids. To gain insights into the genetic basis of the natural resistance to F. psychrophilum, we selected homozygous clones of rainbow trout with contrasted susceptibility to the infection. We compared the transcriptional response to the bacteria in the pronephros of a susceptible and a resistant line by micro-array analysis five days after infection. While the basal transcriptome of healthy fish was significantly different in the resistant and susceptible lines, the transcriptome modifications induced by the bacteria involved essentially the same genes and pathways. The response to F. psychrophilum involved antimicrobial peptides, complement, and a number of enzymes and chemokines. The matrix metalloproteases mmp9 and mmp13 were among the most highly induced genes in both genetic backgrounds. Key genes of both pro- and anti-inflammatory response such as IL1 and IL10, were up-regulated with a greater magnitude in susceptible animals where the bacterial load was also much higher. While higher resistance to F. psychrophilum does not seem to be based on extensive differences in the orientation of the immune response, several genes including complement C3 showed stronger induction in the resistant fish. They may be important for the variation of susceptibility to the infection.

  19. Bacterial rRNA-Targeted Reverse Transcription-PCR Used To Identify Pathogens Responsible for Fever with Neutropenia▿

    OpenAIRE

    Sakaguchi, Sachi; Saito, Masahiro; Tsuji, Hirokazu; Asahara, Takashi; Takata, Oto; Fujimura, Junya; Nagata, Satoru; Nomoto, Koji; Shimizu, Toshiaki

    2010-01-01

    The purpose of this study was to evaluate the clinical utility of bacterial rRNA-targeted reverse transcription-quantitative PCR (BrRNA RT-qPCR) assays for identifying the bacterial pathogens that cause fever with neutropenia in pediatric cancer patients, by comparing the bacterial detection rate of this technique with that of blood culture. One milliliter of blood was collected from pediatric patients who developed fever with neutropenia following cancer chemotherapy. BrRNA RT-qPCR was perfo...

  20. Structural studies of bacterial transcriptional regulatory proteins by multidimensional heteronuclear NMR

    Energy Technology Data Exchange (ETDEWEB)

    Volkman, Brian Finley [Univ. of California, Berkeley, CA (United States)

    1995-02-01

    Nuclear magnetic resonance spectroscopy was used to elucidate detailed structural information for peptide and protein molecules. A small peptide was designed and synthesized, and its three-dimensional structure was calculated using distance information derived from two-dimensional NMR measurements. The peptide was used to induce antibodies in mice, and the cross-reactivity of the antibodies with a related protein was analyzed with enzyme-linked immunosorbent assays. Two proteins which are involved in regulation of transcription in bacteria were also studied. The ferric uptake regulation (Fur) protein is a metal-dependent repressor which controls iron uptake in bacteria. Two- and three-dimensional NMR techniques, coupled with uniform and selective isotope labeling allowed the nearly complete assignment of the resonances of the metal-binding domain of the Fur protein. NTRC is a transcriptional enhancer binding protein whose N-terminal domain is a "receiver domain" in the family of "two-component" regulatory systems. Phosphorylation of the N-terminal domain of NTRC activates the initiation of transcription of aeries encoding proteins involved in nitrogen regulation. Three- and four-dimensional NMR spectroscopy methods have been used to complete the resonance assignments and determine the solution structure of the N-terminal receiver domain of the NTRC protein. Comparison of the solution structure of the NTRC receiver domain with the crystal structures of the homologous protein CheY reveals a very similar fold, with the only significant difference being the position of helix 4 relative to the rest of the protein. The determination of the structure of the NTRC receiver domain is the first step toward understanding a mechanism of signal transduction which is common to many bacterial regulatory systems.

  1. A Bacteriophage Capsid Protein Is an Inhibitor of a Conserved Transcription Terminator of Various Bacterial Pathogens.

    Science.gov (United States)

    Ghosh, Gairika; Reddy, Jayavardhana; Sambhare, Susmit; Sen, Ranjan

    2018-01-01

    Rho is a hexameric molecular motor that functions as a conserved transcription terminator in the majority of bacterial species and is a potential drug target. Psu is a bacteriophage P4 capsid protein that inhibits Escherichia coli Rho by obstructing its ATPase and translocase activities. In this study, we explored the anti-Rho activity of Psu for Rho proteins from different pathogens. Sequence alignment and homology modeling of Rho proteins from pathogenic bacteria revealed the conserved nature of the Psu-interacting regions in all these proteins. We chose Rho proteins from various pathogens, including Mycobacterium smegmatis , Mycobacterium bovis , Mycobacterium tuberculosis , Xanthomonas campestris , Xanthomonas oryzae , Corynebacterium glutamicum , Vibrio cholerae , Salmonella enterica , and Pseudomonas syringae The purified recombinant Rho proteins of these organisms showed variable rates of ATP hydrolysis on poly(rC) as the substrate and were capable of releasing RNA from the E. coli transcription elongation complexes. Psu was capable of inhibiting these two functions of all these Rho proteins. In vivo pulldown assays revealed direct binding of Psu with many of these Rho proteins. In vivo expression of psu induced killing of M. smegmatis , M. bovis , X. campestris , and E. coli expressing S. enterica Rho indicating Psu-induced inhibition of Rho proteins of these strains under physiological conditions. We propose that the "universal" inhibitory function of the Psu protein against the Rho proteins from both Gram-negative and Gram-positive bacteria could be useful for designing peptides with antimicrobial functions and that these peptides could contribute to synergistic antibiotic treatment of the pathogens by compromising the Rho functions. IMPORTANCE Bacteriophage-derived protein factors modulating different bacterial processes could be converted into unique antimicrobial agents. Bacteriophage P4 capsid protein Psu is an inhibitor of the E. coli transcription

  2. Diagnostic Test Accuracy of a 2-Transcript Host RNA Signature for Discriminating Bacterial vs Viral Infection in Febrile Children.

    Science.gov (United States)

    Herberg, Jethro A; Kaforou, Myrsini; Wright, Victoria J; Shailes, Hannah; Eleftherohorinou, Hariklia; Hoggart, Clive J; Cebey-López, Miriam; Carter, Michael J; Janes, Victoria A; Gormley, Stuart; Shimizu, Chisato; Tremoulet, Adriana H; Barendregt, Anouk M; Salas, Antonio; Kanegaye, John; Pollard, Andrew J; Faust, Saul N; Patel, Sanjay; Kuijpers, Taco; Martinón-Torres, Federico; Burns, Jane C; Coin, Lachlan J M; Levin, Michael

    Because clinical features do not reliably distinguish bacterial from viral infection, many children worldwide receive unnecessary antibiotic treatment, while bacterial infection is missed in others. To identify a blood RNA expression signature that distinguishes bacterial from viral infection in febrile children. Febrile children presenting to participating hospitals in the United Kingdom, Spain, the Netherlands, and the United States between 2009-2013 were prospectively recruited, comprising a discovery group and validation group. Each group was classified after microbiological investigation as having definite bacterial infection, definite viral infection, or indeterminate infection. RNA expression signatures distinguishing definite bacterial from viral infection were identified in the discovery group and diagnostic performance assessed in the validation group. Additional validation was undertaken in separate studies of children with meningococcal disease (n = 24) and inflammatory diseases (n = 48) and on published gene expression datasets. A 2-transcript RNA expression signature distinguishing bacterial infection from viral infection was evaluated against clinical and microbiological diagnosis. Definite bacterial and viral infection was confirmed by culture or molecular detection of the pathogens. Performance of the RNA signature was evaluated in the definite bacterial and viral group and in the indeterminate infection group. The discovery group of 240 children (median age, 19 months; 62% male) included 52 with definite bacterial infection, of whom 36 (69%) required intensive care, and 92 with definite viral infection, of whom 32 (35%) required intensive care. Ninety-six children had indeterminate infection. Analysis of RNA expression data identified a 38-transcript signature distinguishing bacterial from viral infection. A smaller (2-transcript) signature (FAM89A and IFI44L) was identified by removing highly correlated transcripts. When this 2-transcript

  3. Molecular approaches for viable bacterial population and transcriptional analyses in a rodent model of dental caries

    Science.gov (United States)

    Klein, Marlise I.; Scott-Anne, Kathleen M.; Gregoire, Stacy; Rosalen, Pedro L.; Koo, Hyun

    2012-01-01

    SUMMARY Culturing methods are the primary approach for microbiological analysis of plaque-biofilms in rodent models of dental caries. In this study, we developed strategies for isolation of DNA and RNA from in vivo formed plaque-biofilms to analyze the viable bacterial population and gene expression. Plaque-biofilm samples from rats were treated with propidium monoazide to isolate DNA from viable cells, and the purified DNA was used to quantify total bacteria and S. mutans population via qPCR and specific primers; the same samples were also analyzed by colony forming unit (CFU) counting. In parallel, RNA was isolated from plaque-biofilm samples (from same animals) and used for transcriptional analyses via RT-qPCR. The viable population of both S. mutans and total bacteria assessed by qPCR were positively correlated with the CFU data (P0.8). However, the qPCR data showed higher bacterial cell counts, particularly for total bacteria (vs. CFU). Moreover, S. mutans proportion in the plaque-biofilm determined by qPCR analysis showed strong correlation with incidence of smooth-surface caries (P=0.0022, r=0.71). The purified RNAs presented high RNA integrity numbers (>7), which allowed measurement of the expression of genes that are critical for S. mutans virulence (e.g. gtfB and gtfC). Our data show that the viable microbial population and the gene expression can be analyzed simultaneously, providing a global assessment of the infectious aspect of the disease dental caries. Our approach could enhance the value of the current rodent model in further understanding the pathophysiology of this disease and facilitating the exploration of novel anti-caries therapies. PMID:22958384

  4. Short term memory of Caenorhabditis elegans against bacterial pathogens involves CREB transcription factor.

    Science.gov (United States)

    Prithika, Udayakumar; Vikneswari, Ramaraj; Balamurugan, Krishnaswamy

    2017-04-01

    One of the key issues pertaining to the control of memory is to respond to a consistently changing environment or microbial niche present in it. Human cyclic AMP response element binding protein (CREB) transcription factor which plays a crucial role in memory has a homolog in C. elegans, crh-1. crh-1 appears to influence memory processes to certain extent by habituation of the host to a particular environment. The discrimination between the pathogen and a non-pathogen is essential for C. elegans in a microbial niche which determines its survival. Training the nematodes in the presence of a virulent pathogen (S. aureus) and an opportunistic pathogen (P. mirabilis) separately exhibits a different behavioural paradigm. This appears to be dependent on the CREB transcription factor. Here we show that C. elegans homolog crh-1 helps in memory response for a short term against the interacting pathogens. Following conditioning of the nematodes to S. aureus and P. mirabilis, the wild type nematodes exhibited a positive response towards the respective pathogens which diminished slowly after 2h. By contrast, the crh-1 deficient nematodes had a defective memory post conditioning. The molecular data reinforces the importance of crh-1 gene in retaining the memory of nematode. Our results also suggest that involvement of neurotransmitters play a crucial role in modulating the memory of the nematode with the assistance of CREB. Therefore, we elucidate that CREB is responsible for the short term memory response in C. elegans against bacterial pathogens. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. RNA Transcriptional Biosignature Analysis for Identifying Febrile Infants With Serious Bacterial Infections in the Emergency Department

    Science.gov (United States)

    Mahajan, Prashant; Kuppermann, Nathan; Suarez, Nicolas; Mejias, Asuncion; Casper, Charlie; Dean, J. Michael; Ramilo, Octavio

    2015-01-01

    Objectives To develop the infrastructure and demonstrate the feasibility of conducting microarray-based RNA transcriptional profile analyses for the diagnosis of serious bacterial infections in febrile infants 60 days and younger in a multicenter pediatric emergency research network. Methods We designed a prospective multicenter cohort study with the aim of enrolling more than 4000 febrile infants 60 days and younger. To ensure success of conducting complex genomic studies in emergency department (ED) settings, we established an infrastructure within the Pediatric Emergency Care Applied Research Network, including 21 sites, to evaluate RNA transcriptional profiles in young febrile infants. We developed a comprehensive manual of operations and trained site investigators to obtain and process blood samples for RNA extraction and genomic analyses. We created standard operating procedures for blood sample collection, processing, storage, shipping, and analyses. We planned to prospectively identify, enroll, and collect 1 mL blood samples for genomic analyses from eligible patients to identify logistical issues with study procedures. Finally, we planned to batch blood samples and determined RNA quantity and quality at the central microarray laboratory and organized data analysis with the Pediatric Emergency Care Applied Research Network data coordinating center. Below we report on establishment of the infrastructure and the feasibility success in the first year based on the enrollment of a limited number of patients. Results We successfully established the infrastructure at 21 EDs. Over the first 5 months we enrolled 79% (74 of 94) of eligible febrile infants. We were able to obtain and ship 1 mL of blood from 74% (55 of 74) of enrolled participants, with at least 1 sample per participating ED. The 55 samples were shipped and evaluated at the microarray laboratory, and 95% (52 of 55) of blood samples were of adequate quality and contained sufficient RNA for expression

  6. RAV transcription factors are essential for disease resistance against cassava bacterial blight via activation of melatonin biosynthesis genes.

    Science.gov (United States)

    Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao

    2018-01-01

    With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. The colitis-associated transcriptional profile of commensal Bacteroides thetaiotaomicron enhances adaptive immune responses to a bacterial antigen.

    Directory of Open Access Journals (Sweden)

    Jonathan J Hansen

    Full Text Available Inflammatory bowel diseases (IBD may be caused in part by aberrant immune responses to commensal intestinal microbes including the well-characterized anaerobic gut commensal Bacteroides thetaiotaomicron (B. theta. Healthy, germ-free HLA-B27 transgenic (Tg rats develop chronic colitis when colonized with complex gut commensal bacteria whereas non-transgenic (nTg rats remain disease-free. However, the role of B. theta in causing disease in Tg rats is unknown nor is much known about how gut microbes respond to host inflammation.Tg and nTg rats were monoassociated with a human isolate of B. theta. Colonic inflammation was assessed by histologic scoring and tissue pro-inflammatory cytokine measurement. Whole genome transcriptional profiling of B. theta recovered from ceca was performed using custom GeneChips and data analyzed using dChip, Significance Analysis of Microarrays, and Gene Set Enrichment Analysis (GSEA software. Western Blots were used to determine adaptive immune responses to a differentially expressed B. theta gene.B. theta monoassociated Tg rats, but not nTg or germ-free controls, developed chronic colitis. Transcriptional profiles of cecal B. theta were significantly different in Tg vs. nTg rats. GSEA revealed that genes in KEGG canonical pathways involved in bacterial growth and metabolism were downregulated in B. theta from Tg rats with colitis though luminal bacterial concentrations were unaffected. Bacterial genes in the Gene Ontology molecular function "receptor activity", most of which encode nutrient binding proteins, were significantly upregulated in B. theta from Tg rats and include a SusC homolog that induces adaptive immune responses in Tg rats.B. theta induces colitis in HLA-B27 Tg rats, which is associated with regulation of bacterial genes in metabolic and nutrient binding pathways that may affect host immune responses. These studies of the host-microbial dialogue may lead to the identification of novel microbial targets

  8. Nature of bacterial colonization influences transcription of mucin genes in mice during the first week of life

    Directory of Open Access Journals (Sweden)

    Bergström Anders

    2012-08-01

    Full Text Available Abstract Background Postnatal regulation of the small intestinal mucus layer is potentially important in the development of adult gut functionality. We hypothesized that the nature of bacterial colonization affects mucus gene regulation in early life. We thus analyzed the influence of the presence of a conventional microbiota as well as two selected monocolonizing bacterial strains on the transcription of murine genes involved in mucus layer development during the first week of life. Mouse pups (N = 8/group from differently colonized dams: Germ-free (GF, conventional specific pathogen free (SPF, monocolonized with either Lactobacillus acidophilus NCFM (Lb or Escherichia coli Nissle (Ec were analyzed by qPCR on isolated ileal tissue sections from postnatal days 1 and 6 (PND1, PND6 after birth with respect to: (i transcription of specific genes involved in mucus production (Muc1-4, Tff3 and (ii amounts of 16S rRNA of Lactobacillus and E. coli. Quantification of 16S rRNA genes was performed to obtain a measure for amounts of colonized bacteria. Results We found a microbiota-independent transcriptional increase of all five mucus genes from PND1 to PND6. Furthermore, the relative level of transcription of certain mucus genes on PND1 was increased by the presence of bacteria. This was observed for Tff3 in the SPF, Ec, and Lb groups; for Muc2 in SPF; and for Muc3 and Muc4 in Ec and Lb, respectively. Detection of bacterial 16S rRNA genes levels above the qPCR detection level occurred only on PND6 and only for some of the colonized animals. On PND6, we found significantly lower levels of Muc1, Muc2 and Muc4 gene transcription for Lb animals with detectable Lactobacillus levels as compared to animals with Lactobacillus levels below the detection limit. Conclusions In summary, our data show that development of the expression of genes encoding secreted (Muc2/Tff3 and membrane-bound (Muc1/Muc3/Muc4 mucus regulatory proteins, respectively, is distinct and

  9. Patterns of Transcriptional Response to 1,25-Dihydroxyvitamin D3 and Bacterial Lipopolysaccharide in Primary Human Monocytes

    Directory of Open Access Journals (Sweden)

    Silvia N. Kariuki

    2016-05-01

    Full Text Available The active form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25D, plays an important immunomodulatory role, regulating transcription of genes in the innate and adaptive immune system. The present study examines patterns of transcriptome-wide response to 1,25D, and the bacterial lipopolysaccharide (LPS in primary human monocytes, to elucidate pathways underlying the effects of 1,25D on the immune system. Monocytes obtained from healthy individuals of African-American and European-American ancestry were treated with 1,25D, LPS, or both, simultaneously. The addition of 1,25D during stimulation with LPS induced significant upregulation of genes in the antimicrobial and autophagy pathways, and downregulation of proinflammatory response genes compared to LPS treatment alone. A joint Bayesian analysis enabled clustering of genes into patterns of shared transcriptional response across treatments. The biological pathways enriched within these expression patterns highlighted several mechanisms through which 1,25D could exert its immunomodulatory role. Pathways such as mTOR signaling, EIF2 signaling, IL-8 signaling, and Tec Kinase signaling were enriched among genes with opposite transcriptional responses to 1,25D and LPS, respectively, highlighting the important roles of these pathways in mediating the immunomodulatory activity of 1,25D. Furthermore, a subset of genes with evidence of interethnic differences in transcriptional response was also identified, suggesting that in addition to the well-established interethnic variation in circulating levels of vitamin D, the intensity of transcriptional response to 1,25D and LPS also varies between ethnic groups. We propose that dysregulation of the pathways identified in this study could contribute to immune-mediated disease risk.

  10. Overlapping Podospora anserina transcriptional responses to bacterial and fungal non self indicate a multilayered innate immune response

    Directory of Open Access Journals (Sweden)

    Marina eLamacchia

    2016-04-01

    Full Text Available Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI, a genetically controlled process initiating a programmed cell death (PCD leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the

  11. Overlapping Podospora anserina Transcriptional Responses to Bacterial and Fungal Non Self Indicate a Multilayered Innate Immune Response.

    Science.gov (United States)

    Lamacchia, Marina; Dyrka, Witold; Breton, Annick; Saupe, Sven J; Paoletti, Mathieu

    2016-01-01

    Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI), a genetically controlled process initiating a programmed cell death (PCD) leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR) immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the fungus while most

  12. Bacterial gene expression detected in human faeces by reverse transcription-PCR

    NARCIS (Netherlands)

    Fitzsimons, N.A.; Akkermans, A.D.L.; Vos, de W.M.; Vaughan, E.E.

    2003-01-01

    A method to isolate and specifically detect bacterial messenger RNA (mRNA) in human faeces is presented. The surface layer protein gene slpA of Lactobacillus acidophilus ATCC 4356(T) was chosen as a model system because it is transcribed at a high level to a relatively stable mRNA (Boot et al.,

  13. Live Staphylococcus aureus and bacterial soluble factors induce different transcriptional responses in human airway cells.

    Science.gov (United States)

    Moreilhon, Chimène; Gras, Delphine; Hologne, Coralie; Bajolet, Odile; Cottrez, Françoise; Magnone, Virginie; Merten, Marc; Groux, Hervé; Puchelle, Edith; Barbry, Pascal

    2005-02-10

    To characterize the response of respiratory epithelium to infection by Staphylococcus aureus (S. aureus), human airway cells were incubated for 1 to 24 h with a supernatant of a S. aureus culture (bacterial supernatant), then profiled with a pangenomic DNA microarray. Because an upregulation of many genes was noticed around 3 h, three independent approaches were then used to characterize the host response to a 3-h contact either with bacterial supernatant or with live bacteria: 1) a DNA microarray containing 4,200 sequence-verified probes, 2) a semiquantitative RT-PCR with a set of 537 pairs of validated primers, or 3) ELISA assay of IL-8, IL-6, TNFalpha, and PGE(2). Among others, Fos, Jun, and EGR-1 were upregulated by the bacterial supernatant and by live bacteria. Increased expression of bhlhb2 and Mig-6, promoter regions which harbor HIF responding elements, was explained by an increased expression of the HIF-1alpha protein. Activation of the inducible form of cyclooxygenase, COX-2, and of the interleukins IL-1, IL-6, and IL-8, as well as of the NF-kappaB pathway, was observed preferentially in cells in contact with bacterial supernatant. Early infection was characterized by an upregulation of anti-apoptotic genes and a downregulation of pro-apoptotic genes. This correlated with a necrotic, rather than apoptotic cell death. Overall, this first global description of an airway epithelial infection by S. aureus demonstrates a larger global response to bacterial supernatant (in term of altered genes and variation factors) than to exponentially growing live bacteria.

  14. GATA Transcription Factor Required for Immunity to Bacterial and Fungal Pathogens

    Science.gov (United States)

    Gaddis, Nathan C.; Aballay, Alejandro

    2006-01-01

    In the past decade, Caenorhabditis elegans has been used to dissect several genetic pathways involved in immunity; however, little is known about transcription factors that regulate the expression of immune effectors. C. elegans does not appear to have a functional homolog of the key immune transcription factor NF-κB. Here we show that that the intestinal GATA transcription factor ELT-2 is required for both immunity to Salmonella enterica and expression of a C-type lectin gene, clec-67, which is expressed in the intestinal cells and is a good marker of S. enterica infection. We also found that ELT-2 is required for immunity to Pseudomonas aeruginosa, Enterococcus faecalis, and Cryptococcus neoformans. Lack of immune inhibition by DAF-2, which negatively regulates the FOXO transcription factor DAF-16, rescues the hypersusceptibility to pathogens phenotype of elt-2(RNAi) animals. Our results indicate that ELT-2 is part of a multi-pathogen defense pathway that regulates innate immunity independently of the DAF-2/DAF-16 signaling pathway. PMID:17183709

  15. Bacterial Genome Editing Strategy for Control of Transcription and Protein Stability

    DEFF Research Database (Denmark)

    Lauritsen, Ida; Martinez, Virginia; Ronda, Carlotta

    2018-01-01

    In molecular biology and cell factory engineering, tools that enable control of protein production and stability are highly important. Here, we describe protocols for tagging genes in Escherichia coli allowing for inducible degradation and transcriptional control of any soluble protein of interes...

  16. A cysteine protease (cathepsin Z) from disk abalone, Haliotis discus discus: Genomic characterization and transcriptional profiling during bacterial infections.

    Science.gov (United States)

    Godahewa, G I; Perera, N C N; Lee, Sukkyoung; Kim, Myoung-Jin; Lee, Jehee

    2017-09-05

    Cathepsin Z (CTSZ) is lysosomal cysteine protease of the papain superfamily. It participates in the host immune defense via phagocytosis, signal transduction, cell-cell communication, proliferation, and migration of immune cells such as monocytes, macrophages, and dendritic cells. Hence, CTSZ is also acknowledged as an acute-phase protein in host immunity. In this study, we sought to identify the CTSZ homolog from disk abalone (AbCTSZ) and characterize it at the molecular, genomic, and transcriptional levels. AbCTSZ encodes a protein with 318 amino acids and a molecular mass of 36kDa. The structure of AbCTSZ reveals amino acid sequences that are characteristic of the signal sequence, pro-peptide, peptidase-C1 papain family cysteine protease domain, mini-loop, HIP motif, N-linked glycosylation sites, active sites, and conserved Cys residues. A pairwise comparison revealed that AbCTSZ shared the highest amino acid homology with its molluscan counterpart from Crassostrea gigas. A multiple alignment analysis revealed the conservation of functionally crucial elements of AbCTSZ, and a phylogenetic study further confirmed a proximal evolutionary relationship with its invertebrate counterparts. Further, an analysis of AbCTSZ genomic structure revealed seven exons separated by six introns, which differs from that of its vertebrate counterparts. Quantitative real time PCR (qPCR) detected the transcripts of AbCTSZ in early developmental stages and in eight different tissues. Higher levels of AbCTSZ transcripts were found in trochophore, gill, and hemocytes, highlighting its importance in the early development and immunity of disk abalone. In addition, we found that viable bacteria (Vibrio parahaemolyticus and Listeria monocytogenes) and bacterial lipopolysaccharides significantly modulated AbCTSZ transcription. Collectively, these lines of evidences suggest that AbCTSZ plays an indispensable role in the innate immunity of disk abalone. Copyright © 2017. Published by Elsevier

  17. Transcriptional profiling at different sites in lungs of pigs during acute bacterial respiratory infection

    DEFF Research Database (Denmark)

    Mortensen, Shila; Skovgaard, Kerstin; Hedegaard, Jakob

    2011-01-01

    The local transcriptional response was studied in different locations of lungs from pigs experimentally infected with the respiratory pathogen Actinobacillus pleuropneumoniae serotype 5B, using porcine cDNA microarrays. This infection gives rise to well-demarcated infection loci in the lung, char...... of induced genes as, in unaffected areas a large part of differently expressed genes were involved in systemic reactions to infections, while differently expressed genes in necrotic areas were mainly concerned with homeostasis regulation....

  18. A reporter system coupled with high-throughput sequencing unveils key bacterial transcription and translation determinants.

    Science.gov (United States)

    Yus, Eva; Yang, Jae-Seong; Sogues, Adrià; Serrano, Luis

    2017-08-28

    Quantitative analysis of the sequence determinants of transcription and translation regulation is relevant for systems and synthetic biology. To identify these determinants, researchers have developed different methods of screening random libraries using fluorescent reporters or antibiotic resistance genes. Here, we have implemented a generic approach called ELM-seq (expression level monitoring by DNA methylation) that overcomes the technical limitations of such classic reporters. ELM-seq uses DamID (Escherichia coli DNA adenine methylase as a reporter coupled with methylation-sensitive restriction enzyme digestion and high-throughput sequencing) to enable in vivo quantitative analyses of upstream regulatory sequences. Using the genome-reduced bacterium Mycoplasma pneumoniae, we show that ELM-seq has a large dynamic range and causes minimal toxicity. We use ELM-seq to determine key sequences (known and putatively novel) of promoter and untranslated regions that influence transcription and translation efficiency. Applying ELM-seq to other organisms will help us to further understand gene expression and guide synthetic biology.Quantitative analysis of how DNA sequence determines transcription and translation regulation is of interest to systems and synthetic biologists. Here the authors present ELM-seq, which uses Dam activity as reporter for high-throughput analysis of promoter and 5'-UTR regions.

  19. Increasing the efficiency of bacterial transcription simulations: When to exclude the genome without loss of accuracy

    Directory of Open Access Journals (Sweden)

    McMillen David R

    2008-09-01

    Full Text Available Abstract Background Simulating the major molecular events inside an Escherichia coli cell can lead to a very large number of reactions that compose its overall behaviour. Not only should the model be accurate, but it is imperative for the experimenter to create an efficient model to obtain the results in a timely fashion. Here, we show that for many parameter regimes, the effect of the host cell genome on the transcription of a gene from a plasmid-borne promoter is negligible, allowing one to simulate the system more efficiently by removing the computational load associated with representing the presence of the rest of the genome. The key parameter is the on-rate of RNAP binding to the promoter (k_on, and we compare the total number of transcripts produced from a plasmid vector generated as a function of this rate constant, for two versions of our gene expression model, one incorporating the host cell genome and one excluding it. By sweeping parameters, we identify the k_on range for which the difference between the genome and no-genome models drops below 5%, over a wide range of doubling times, mRNA degradation rates, plasmid copy numbers, and gene lengths. Results We assess the effect of the simulating the presence of the genome over a four-dimensional parameter space, considering: 24 min Conclusion Exclusion of the genome is shown to yield less than 5% difference in transcript numbers over wide ranges of values, and computational speed is improved by two to 24 times by excluding explicit representation of the genome.

  20. Structure of a bacterial quorum-sensing transcription factor complexed with pheromone and DNA.

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, R.; Pappas, T.; Brace, J.; Miller, P.; Oulmassov, T.; Molyneaux, J.; Anderson, J.; Bashkin, J.; Winans, S.; Joachimiak, A.; Biosciences Division; Cornell Univ.; Monsanto Co.

    2002-06-27

    Many proteobacteria are able to monitor their population densities through the release of pheromones known as N-acylhomoserine lactones. At high population densities, these pheromones elicit diverse responses that include bioluminescence, biofilm formation, production of antimicrobials, DNA exchange, pathogenesis and symbiosis1. Many of these regulatory systems require a pheromone-dependent transcription factor similar to the LuxR protein of Vibrio fischeri. Here we present the structure of a LuxR-type protein. TraR of Agrobacterium tumefaciens was solved at 1.66 A as a complex with the pheromone N-3-oxooctanoyl-l-homoserine lactone (OOHL) and its TraR DNA-binding site. The amino-terminal domain of TraR is an {alpha}/{beta}/{alpha} sandwich that binds OOHL, whereas the carboxy-terminal domain contains a helix-turn-helix DNA-binding motif. The TraR dimer displays a two-fold symmetry axis in each domain; however, these two axes of symmetry are at an approximately 90 degree angle, resulting in a pronounced overall asymmetry of the complex. The pheromone lies fully embedded within the protein with virtually no solvent contact, and makes numerous hydrophobic contacts with the protein as well as four hydrogen bonds: three direct and one water-mediated.

  1. TALE-induced bHLH transcription factors that activate a pectate lyase contribute to water soaking in bacterial spot of tomato.

    Science.gov (United States)

    Schwartz, Allison R; Morbitzer, Robert; Lahaye, Thomas; Staskawicz, Brian J

    2017-01-31

    AvrHah1 [avirulence (avr) gene homologous to avrBs3 and hax2, no. 1] is a transcription activator-like (TAL) effector (TALE) in Xanthomonas gardneri that induces water-soaked disease lesions on fruits and leaves during bacterial spot of tomato. We observe that water from outside the leaf is drawn into the apoplast in X. gardneri-infected, but not X. gardneriΔavrHah1 (XgΔavrHah1)-infected, plants, conferring a dark, water-soaked appearance. The pull of water can facilitate entry of additional bacterial cells into the apoplast. Comparing the transcriptomes of tomato infected with X. gardneri vs. XgΔavrHah1 revealed the differential up-regulation of two basic helix-loop-helix (bHLH) transcription factors with predicted effector binding elements (EBEs) for AvrHah1. We mined our RNA-sequencing data for differentially up-regulated genes that could be direct targets of the bHLH transcription factors and therefore indirect targets of AvrHah1. We show that two pectin modification genes, a pectate lyase and pectinesterase, are targets of both bHLH transcription factors. Designer TALEs (dTALEs) for the bHLH transcription factors and the pectate lyase, but not for the pectinesterase, complement water soaking when delivered by XgΔavrHah1 By perturbing transcriptional networks and/or modifying the plant cell wall, AvrHah1 may promote water uptake to enhance tissue damage and eventual bacterial egression from the apoplast to the leaf surface. Understanding how disease symptoms develop may be a useful tool for improving the tolerance of crops from damaging disease lesions.

  2. Gene and transcript abundances of bacterial type III secretion systems from the rumen microbiome are correlated with methane yield in sheep.

    Science.gov (United States)

    Kamke, Janine; Soni, Priya; Li, Yang; Ganesh, Siva; Kelly, William J; Leahy, Sinead C; Shi, Weibing; Froula, Jeff; Rubin, Edward M; Attwood, Graeme T

    2017-08-08

    Ruminants are important contributors to global methane emissions via microbial fermentation in their reticulo-rumens. This study is part of a larger program, characterising the rumen microbiomes of sheep which vary naturally in methane yield (g CH 4 /kg DM/day) and aims to define differences in microbial communities, and in gene and transcript abundances that can explain the animal methane phenotype. Rumen microbiome metagenomic and metatranscriptomic data were analysed by Gene Set Enrichment, sparse partial least squares regression and the Wilcoxon Rank Sum test to estimate correlations between specific KEGG bacterial pathways/genes and high methane yield in sheep. KEGG genes enriched in high methane yield sheep were reassembled from raw reads and existing contigs and analysed by MEGAN to predict their phylogenetic origin. Protein coding sequences from Succinivibrio dextrinosolvens strains were analysed using Effective DB to predict bacterial type III secreted proteins. The effect of S. dextrinosolvens strain H5 growth on methane formation by rumen methanogens was explored using co-cultures. Detailed analysis of the rumen microbiomes of high methane yield sheep shows that gene and transcript abundances of bacterial type III secretion system genes are positively correlated with methane yield in sheep. Most of the bacterial type III secretion system genes could not be assigned to a particular bacterial group, but several genes were affiliated with the genus Succinivibrio, and searches of bacterial genome sequences found that strains of S. dextrinosolvens were part of a small group of rumen bacteria that encode this type of secretion system. In co-culture experiments, S. dextrinosolvens strain H5 showed a growth-enhancing effect on a methanogen belonging to the order Methanomassiliicoccales, and inhibition of a representative of the Methanobrevibacter gottschalkii clade. This is the first report of bacterial type III secretion system genes being associated with high

  3. Amplification of pico-scale DNA mediated by bacterial carrier DNA for small-cell-number transcription factor ChIP-seq

    DEFF Research Database (Denmark)

    Jakobsen, Janus S; Bagger, Frederik O; Hasemann, Marie S

    2015-01-01

    BACKGROUND: Chromatin-Immunoprecipitation coupled with deep sequencing (ChIP-seq) is used to map transcription factor occupancy and generate epigenetic profiles genome-wide. The requirement of nano-scale ChIP DNA for generation of sequencing libraries has impeded ChIP-seq on in vivo tissues of low...... cell numbers. RESULTS: We describe a robust, simple and scalable methodology for ChIP-seq of low-abundant cell populations, verified down to 10,000 cells. By employing non-mammalian genome mapping bacterial carrier DNA during amplification, we reliably amplify down to 50 pg of ChIP DNA from...... transcription factor (CEBPA) and histone mark (H3K4me3) ChIP. We further demonstrate that genomic profiles are highly resilient to changes in carrier DNA to ChIP DNA ratios. CONCLUSIONS: This represents a significant advance compared to existing technologies, which involve either complex steps of pre...

  4. Real-Time Reverse Transcription PCR as a Tool to Study Virulence Gene Regulation in Bacterial Pathogens.

    Science.gov (United States)

    Aviv, Gili; Gal-Mor, Ohad

    2018-01-01

    Quantitative real-time PCR (qRT-PCR) is a highly sensitive and reliable method for detection and quantification of DNA. When combined with a prior stage of RNA reverse transcription to generate complementary DNA (cDNA), this is a powerful approach to determine and analyze gene transcriptional expression. Real-time quantitative reverse transcription PCR has become the gold standard method in studying genes expression and virulence regulation under various genetic backgrounds (e.g., in the absence of regulators) or environmental conditions. Here we demonstrate the utilization of this approach to study the transcriptional regulation of the conjugation pilus of the Salmonella enterica serovar Infantis virulence plasmid (pESI).

  5. Two Cassava Basic Leucine Zipper (bZIP Transcription Factors (MebZIP3 and MebZIP5 Confer Disease Resistance against Cassava Bacterial Blight

    Directory of Open Access Journals (Sweden)

    Xiaolin Li

    2017-12-01

    Full Text Available Basic domain-leucine zipper (bZIP transcription factor, one type of conserved gene family, plays an important role in plant development and stress responses. Although 77 MebZIPs have been genome-wide identified in cassava, their in vivo roles remain unknown. In this study, we analyzed the expression pattern and the function of two MebZIPs (MebZIP3 and MebZIP5 in response to pathogen infection. Gene expression analysis indicated that MebZIP3 and MebZIP5 were commonly regulated by flg22, Xanthomonas axonopodis pv. manihotis (Xam, salicylic acid (SA, and hydrogen peroxide (H2O2. Subcellular localization analysis showed that MebZIP3 and MebZIP5 are specifically located in cell nucleus. Through overexpression in tobacco, we found that MebZIP3 and MebZIP5 conferred improved disease resistance against cassava bacterial blight, with more callose depositions. On the contrary, MebZIP3- and MebZIP5-silenced plants by virus-induced gene silencing (VIGS showed disease sensitive phenotype, lower transcript levels of defense-related genes and less callose depositions. Taken together, this study highlights the positive role of MebZIP3 and MebZIP5 in disease resistance against cassava bacterial blight for further utilization in genetic improvement of cassava disease resistance.

  6. Temporal and Spatial Coexistence of Archaeal and Bacterial amoA Genes and Gene Transcripts in Lake Lucerne

    Directory of Open Access Journals (Sweden)

    Elisabeth W. Vissers

    2013-01-01

    Full Text Available Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO. This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA and bacteria (AOB over a period of 16 months, shedding more light on the role of both AO in a deep, alpine lake environment. At the surface, at 42 m water depth, and in the water layer immediately above the sediment, AOA generally outnumbered AOB. However, in the surface water during summer stratification, when both AO were low in abundance, AOB were more numerous than AOA. Temporal distribution patterns of AOA and AOB were comparable. Higher abundances of amoA gene transcripts were observed at the onset and end of summer stratification. In summer, archaeal amoA genes and transcripts correlated negatively with temperature and conductivity. Concentrations of ammonium and oxygen did not vary enough to explain the amoA gene and transcript dynamics. The observed herbivorous zooplankton may have caused a hidden flux of mineralized ammonium and a change in abundance of genes and transcripts. At the surface, AO might have been repressed during summer stratification due to nutrient limitation caused by active phytoplankton.

  7. Selection Effects on the Positioning of Genes and Gene Structures from the Interplay of Replication and Transcription in Bacterial Genomes

    Directory of Open Access Journals (Sweden)

    Kazuharu Arakawa

    2007-01-01

    Full Text Available Bacterial chromosomes are partly shaped by the functional requirements for efficient replication, which lead to strand bias as commonly characterized by the excess of guanines over cytosines in the leading strand. Gene structures are also highly organized within bacterial genomes as a result of such functional constraints, displaying characteristic positioning and structuring along the genome. Here we analyze the gene structures in completely sequenced bacterial chromosomes to observe the positional constraints on gene orientation, length, and codon usage with regard to the positions of replication origin and terminus. Selection on these gene features is different in regions surrounding the terminus of replication from the rest of the genome, but the selection could be either positive or negative depending on the species, and these positional effects are partly attributed to the A-T enrichment near the terminus. Characteristic gene structuring relative to the position of replication origin and terminus is commonly observed among most bacterial species with circular chromosomes, and therefore we argue that the highly organized gene positioning as well as the strand bias should be considered for genomics studies of bacteria.

  8. Transcriptional responses of Italian ryegrass during interaction with Xanthomonas translucens pv. graminis reveal novel candidate genes for bacterial wilt resistance

    DEFF Research Database (Denmark)

    Wichmann, Fabienne; Asp, Torben; Widmer, Franko

    2011-01-01

    Xanthomonas translucens pv. graminis (Xtg) causes bacterial wilt, a severe disease of forage grasses such as Italian ryegrass (Lolium multiflorum Lam.). In order to gain a more detailed understanding of the genetic control of resistance mechanisms and to provide prerequisites for marker assisted...... selection, the partial transcriptomes of two Italian ryegrass genotypes, one resistant and one susceptible to bacterial wilt were compared at four time points after Xtg infection. A cDNA microarray developed from a perennial ryegrass (Lolium perenne) expressed sequence tag set consisting of 9,990 unique...... genes was used for transcriptome analysis in Italian ryegrass. An average of 4,487 (45%) of the perennial ryegrass sequences spotted on the cDNA microarray were detected by cross-hybridisation to Italian ryegrass. Transcriptome analyses of the resistant versus the susceptible genotype revealed...

  9. The Bacterial Effector HopX1 Targets JAZ Transcriptional Repressors to Activate Jasmonate Signaling and Promote Infection in Arabidopsis

    Science.gov (United States)

    Gimenez-Ibanez, Selena; Boter, Marta; Fernández-Barbero, Gemma; Chini, Andrea; Rathjen, John P.; Solano, Roberto

    2014-01-01

    Pathogenicity of Pseudomonas syringae is dependent on a type III secretion system, which secretes a suite of virulence effector proteins into the host cytoplasm, and the production of a number of toxins such as coronatine (COR), which is a mimic of the plant hormone jasmonate-isoleuce (JA-Ile). Inside the plant cell, effectors target host molecules to subvert the host cell physiology and disrupt defenses. However, despite the fact that elucidating effector action is essential to understanding bacterial pathogenesis, the molecular function and host targets of the vast majority of effectors remain largely unknown. Here, we found that effector HopX1 from Pseudomonas syringae pv. tabaci (Pta) 11528, a strain that does not produce COR, interacts with and promotes the degradation of JAZ proteins, a key family of JA-repressors. We show that hopX1 encodes a cysteine protease, activity that is required for degradation of JAZs by HopX1. HopX1 associates with JAZ proteins through its central ZIM domain and degradation occurs in a COI1-independent manner. Moreover, ectopic expression of HopX1 in Arabidopsis induces the expression of JA-dependent genes, represses salicylic acid (SA)-induced markers, and complements the growth of a COR-deficient P. syringae pv. tomato (Pto) DC3000 strain during natural bacterial infections. Furthermore, HopX1 promoted susceptibility when delivered by the natural type III secretion system, to a similar extent as the addition of COR, and this effect was dependent on its catalytic activity. Altogether, our results indicate that JAZ proteins are direct targets of bacterial effectors to promote activation of JA-induced defenses and susceptibility in Arabidopsis. HopX1 illustrates a paradigm of an alternative evolutionary solution to COR with similar physiological outcome. PMID:24558350

  10. The Campylobacter jejuni MarR-like transcriptional regulators RrpA and RrpB both influence bacterial responses to oxidative and aerobic stresses

    Directory of Open Access Journals (Sweden)

    Ozan eGundogdu

    2015-07-01

    Full Text Available The ability of the human intestinal pathogen Campylobacter jejuni to respond to oxidative stress is central to bacterial survival both in vivo during infection and in the environment. Re-annotation of the C. jejuni NCTC11168 genome revealed the presence of two MarR-type transcriptional regulators Cj1546 and Cj1556, originally annotated as hypothetical proteins, which we have designated RrpA and RrpB (regulator of response to peroxide respectively. Previously we demonstrated a role for RrpB in both oxidative and aerobic (O2 stress and that RrpB was a DNA binding protein with auto-regulatory activity, typical of MarR-type transcriptional regulators. In this study, we show that RrpA is also a DNA binding protein and that a rrpA mutant in strain 11168H exhibits increased sensitivity to hydrogen peroxide oxidative stress. Mutation of either rrpA or rrpB reduces catalase (KatA expression. However a rrpAB double mutant exhibits higher levels of resistance to hydrogen peroxide oxidative stress, with levels of KatA expression similar to the wild-type strain. Neither the rrpA nor rrpB mutant exhibits any significant difference in sensitivity to either cumene hydroperoxide or menadione oxidative stresses, but both mutants exhibit a reduced ability to survive aerobic (O2 stress, enhanced biofilm formation and reduced virulence in the Galleria mellonella infection model. The rrpAB double mutant exhibits wild-type levels of biofilm formation and wild-type levels of virulence in the Galleria mellonella infection model. Together these data indicate a role for both RrpA and RrpB in the C. jejuni peroxide oxidative and aerobic (O2 stress responses, enhancing bacterial survival in vivo and in the environment.

  11. Reference genes for quantitative, reverse-transcription PCR in Bacillus cereus group strains throughout the bacterial life cycle.

    Science.gov (United States)

    Reiter, Lillian; Kolstø, Anne-Brit; Piehler, Armin P

    2011-08-01

    Quantitative reverse-transcription PCR (RT-qPCR) has become a major tool to better understand the biology and pathogenesis of bacteria. One prerequisite of valid RT-qPCR data is their proper normalization to stably expressed reference genes. To identify and evaluate reference genes suitable for normalization of gene expression data in Bacillus cereus group strains, mRNA levels of eleven candidate reference genes (rpsU, nifU, udp (UDP-N-acetylglucosamine 2-epimerase), BT9727_5154/BC_5475, BT9727_4034/BC_4293, BT9727_4549/BC_4813, pspA, gatB_Yqey (gatB_Yqey domain containing protein), helicase (SWF/SNF family protein), adk and pta) and a target gene (BT9727_3305/BC3547+BC3546) were quantified by RT-qPCR at different time points throughout the entire life cycle of the wild-type B. cereus ATCC 14579 and Bacillus thuringiensis subsp. konkukian 97-27, a phylogenetically closely related strain to Bacillus anthracis. The programs geNorm and Normfinder were used to calculate expression stabilities and identified the genes gatB_Yqey, rpsU and udp as the most stably expressed reference genes. Compared to this combination or the sets of reference genes as recommended by geNorm or Normfinder, normalization using a traditional housekeeping gene (adk) alone resulted in significantly different gene expression results and in a significant overestimation of the target gene transcription. Normalization of the data to the reference gene gatB_Yqey alone showed no or only small differences to the reference gene combinations indicating that gatB_Yqey may be used as a single reference gene when investigating rather large changes in mRNA transcription. Otherwise, a combination of the stably expressed reference genes is recommended. In conclusion, the present study underlines the importance of normalization to stably expressed reference genes and presents valid endogenous controls suitable for normalization of transcriptional data throughout the life cycle of B. cereus group strains

  12. A Two-Tube Multiplex Reverse Transcription PCR Assay for Simultaneous Detection of Viral and Bacterial Pathogens of Infectious Diarrhea

    Directory of Open Access Journals (Sweden)

    Ji Wang

    2014-01-01

    Full Text Available Diarrhea caused by viral and bacterial infections is a major health problem in developing countries. The purpose of this study is to develop a two-tube multiplex PCR assay using automatic electrophoresis for simultaneous detection of 13 diarrhea-causative viruses or bacteria, with an intended application in provincial Centers for Diseases Control and Prevention, China. The assay was designed to detect rotavirus A, norovirus genogroups GI and GII, human astrovirus, enteric adenoviruses, and human bocavirus (tube 1, and Salmonella, Vibrio parahaemolyticus, diarrheagenic Escherichia coli, Campylobacter jejuni, Shigella, Yersinia, and Vibrio cholera (tube 2. The analytical specificity was examined with positive controls for each pathogen. The analytical sensitivity was evaluated by performing the assay on serial tenfold dilutions of in vitro transcribed RNA, recombinant plasmids, or bacterial culture. A total of 122 stool samples were tested by this two-tube assay and the results were compared with those obtained from reference methods. The two-tube assay achieved a sensitivity of 20–200 copies for a single virus and 102-103 CFU/mL for bacteria. The clinical performance demonstrated that the two-tube assay had comparable sensitivity and specificity to those of reference methods. In conclusion, the two-tube assay is a rapid, cost-effective, sensitive, specific, and high throughput method for the simultaneous detection of enteric bacteria and virus.

  13. A Bioinformatics Analysis Reveals a Group of MocR Bacterial Transcriptional Regulators Linked to a Family of Genes Coding for Membrane Proteins

    Directory of Open Access Journals (Sweden)

    Teresa Milano

    2016-01-01

    Full Text Available The MocR bacterial transcriptional regulators are characterized by an N-terminal domain, 60 residues long on average, possessing the winged-helix-turn-helix (wHTH architecture responsible for DNA recognition and binding, linked to a large C-terminal domain (350 residues on average that is homologous to fold type-I pyridoxal 5′-phosphate (PLP dependent enzymes like aspartate aminotransferase (AAT. These regulators are involved in the expression of genes taking part in several metabolic pathways directly or indirectly connected to PLP chemistry, many of which are still uncharacterized. A bioinformatics analysis is here reported that studied the features of a distinct group of MocR regulators predicted to be functionally linked to a family of homologous genes coding for integral membrane proteins of unknown function. This group occurs mainly in the Actinobacteria and Gammaproteobacteria phyla. An analysis of the multiple sequence alignments of their wHTH and AAT domains suggested the presence of specificity-determining positions (SDPs. Mapping of SDPs onto a homology model of the AAT domain hinted at possible structural/functional roles in effector recognition. Likewise, SDPs in wHTH domain suggested the basis of specificity of Transcription Factor Binding Site recognition. The results reported represent a framework for rational design of experiments and for bioinformatics analysis of other MocR subgroups.

  14. Functional role of pyruvate kinase from Lactobacillus bulgaricus in acid tolerance and identification of its transcription factor by bacterial one-hybrid.

    Science.gov (United States)

    Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling

    2015-11-19

    Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5'-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5'-TGTAAGCCCTAACA-3') upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network.

  15. Synthesis and biological activity of novel mono-indole and mono-benzofuran inhibitors of bacterial transcription initiation complex formation.

    Science.gov (United States)

    Mielczarek, Marcin; Thomas, Ruth V; Ma, Cong; Kandemir, Hakan; Yang, Xiao; Bhadbhade, Mohan; Black, David StC; Griffith, Renate; Lewis, Peter J; Kumar, Naresh

    2015-04-15

    Our ongoing research focused on targeting transcription initiation in bacteria has resulted in synthesis of several classes of mono-indole and mono-benzofuran inhibitors that targeted the essential protein-protein interaction between RNA polymerase core and σ(70)/σ(A) factors in bacteria. In this study, the reaction of indole-2-, indole-3-, indole-7- and benzofuran-2-glyoxyloyl chlorides with amines and hydrazines afforded a variety of glyoxyloylamides and glyoxyloylhydrazides. Similarly, condensation of 2- and 7-trichloroacetylindoles with amines and hydrazines delivered amides and hydrazides. The novel molecules were found to inhibit the RNA polymerase-σ(70)/σ(A) interaction as measured by ELISA, and also inhibited the growth of both Gram-positive and Gram-negative bacteria in culture. Structure-activity relationship (SAR) studies of the mono-indole and mono-benzofuran inhibitors suggested that the hydrophilic-hydrophobic balance is an important determinant of biological activity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Crystallization and preliminary X-ray analysis of Psu, an inhibitor of the bacterial transcription terminator Rho

    International Nuclear Information System (INIS)

    Khamrui, Susmita; Ranjan, Amitabh; Pani, Bibhusita; Sen, Ranjan; Sen, Udayaditya

    2010-01-01

    Psu, a unique 21 kDa protein from bacteriophage P4, is a non-essential capsid-decoration protein that inhibits Rho-dependent termination specifically and efficiently both in vivo and in vitro. Psu has been crystallized using PEG as precipitant and the crystals diffracted to 2.3 Å resolution. Psu, a coat protein from bacteriophage P4, inhibits Rho-dependent transcription termination both in vivo and in vitro. The Psu protein is α-helical in nature and appeared to be a dimer in solution. It interacts with Rho and affects the ATP binding and RNA-dependent ATPase activity of Rho, which in turn reduces the rate of RNA release from the elongation complex. Crystals of Psu were grown in space group I422 in the presence of PEG, with unit-cell parameters a = b = 148.76, c = 63.38 Å and a calculated Matthews coefficient of 2.1 Å 3 Da −1 (41.5% solvent content), assuming the presence of two molecules in the asymmetric unit. A native data set was collected to 2.3 Å resolution

  17. Three novel C1q domain containing proteins from the disk abalone Haliotis discus discus: Genomic organization and analysis of the transcriptional changes in response to bacterial pathogens.

    Science.gov (United States)

    Bathige, S D N K; Umasuthan, Navaneethaiyer; Jayasinghe, J D H E; Godahewa, G I; Park, Hae-Chul; Lee, Jehee

    2016-09-01

    The globular C1q (gC1q) domain containing proteins, commonly referred as C1q domain containing (C1qDC) proteins, are an essential family of proteins involved in various innate immune responses. In this study, three novel C1qDC proteins were identified from the disk abalone (Haliotis discus discus) transcriptome database and designated as AbC1qDC1, AbC1qDC2, and AbC1qDC3. The cDNA sequences of AbC1qDC1, AbC1qDC2, and AbC1qDC3 consisted of 807, 1305, and 660 bp open reading frames (ORFs) encoding 269, 435, and 220 amino acids (aa), respectively. Putative signal peptides and the N-terminal gC1q domain were identified in all three AbC1qDC proteins. An additional predicted motif region, known as the coiled coil region (CCR), was identified next to the signal sequence of AbC1qDC2. The genomic organization of the AbC1qDCs was determined using a bacterial artificial chromosome (BAC) library. It was found that the CDS of AbC1qDC1 was distributed among three exons, while the CDSs of AbC1qDC2 and AbC1qDC3 were distributed between two exons. Sequence analysis indicated that the AbC1qDC proteins shared <40% identity with other counterparts from different species. According to the neighbor-joining phylogenetic tree, the proteins were grouped within an invertebrate group with high evolutionary distances, which suggests that they are new members of the C1qDC family. Higher expression of AbC1qDC1 and AbC1qDC2 was detected in hepatopancreas, muscle, and mantle tissues compare to the other tissues analyzed, using reverse transcription, followed by quantitative real-time PCR (qPCR) using SYBR Green, whereas AbC1qDC3 was predominantly expressed in gill tissues, followed by muscles and the hepatopancreas. The temporal expression of AbC1qDC transcripts in gills after bacterial (Vibrio parahaemolyticus and Listeria monocytogenes) and lipopolysaccharide stimulation indicated that AbC1qDCs can be strongly induced by both Gram-negative and Gram-positive bacterial species with different

  18. Phytohormone priming elevates the accumulation of defense-related gene transcripts and enhances bacterial blight disease resistance in cassava.

    Science.gov (United States)

    Yoodee, Sunisa; Kobayashi, Yohko; Songnuan, Wisuwat; Boonchird, Chuenchit; Thitamadee, Siripong; Kobayashi, Issei; Narangajavana, Jarunya

    2018-01-01

    Cassava bacterial blight (CBB) disease caused by Xanthomonas axonopodis pv. manihotis (Xam) is a severe disease in cassava worldwide. In addition to causing significant cassava yield loss, CBB disease has not been extensively studied, especially in terms of CBB resistance genes. The present research demonstrated the molecular mechanisms underlining the defense response during Xam infection in two cassava cultivars exhibiting different degrees of disease resistance, Huay Bong60 (HB60) and Hanatee (HN). Based on gene expression analysis, ten of twelve putative defense-related genes including, leucine-rich repeat receptor-like kinases (LRR-RLKs), resistance (R), WRKY and pathogenesis-related (PR) genes, were differentially expressed between these two cassava cultivars during Xam infection. The up-regulation of defense-related genes observed in HB60 may be the mechanism required for the reduction of disease severity in the resistant cultivar. Interestingly, priming with salicylic acid (SA) or methyl jasmonate (MeJA) for 24 h before Xam inoculation could enhance the defense response in both cassava cultivars. The disease severity was decreased 10% in the resistant cultivar (HB60) and was remarkably reduced 21% in the susceptible cultivar (HN) by SA/MeJA priming. Priming with Xam inoculation modulated cassava4.1_013417, cassava4.1_030866 and cassava4.1_020555 (highest similarity to MeWRKY59, MePR1 and AtPDF2.2, respectively) expression and led to enhanced resistance of the susceptible cultivar in the second infection. The putative cis-regulatory elements were predicted in an upstream region of these three defense-related genes. The different gene expression levels in these genes between the two cultivars were due to the differences in cis-regulatory elements in their promoter regions. Taken together, our study strongly suggested that the induction of defense-related genes correlated with defense resistance against Xam infection, and exogenous application of SA or Me

  19. The Arabidopsis ATAF1, a NAC transcription factor, is a negative regulator of defense responses against necrotrophic fungal and bacterial pathogens.

    Science.gov (United States)

    Wang, Xiao'e; Basnayake, B M Vindhya S; Zhang, Huijuan; Li, Guojun; Li, Wei; Virk, Nasar; Mengiste, Tesfaye; Song, Fengming

    2009-10-01

    Transcription factors of the NAC family are known to be involved in various growth or developmental processes and in regulation of response to environmental stresses. In the present study, we report that Arabidopsis ATAF1 is a negative regulator of defense responses against both necrotrophic fungal and bacterial pathogens. Expression of ATAF1 was downregulated after infection with Botrytis cinerea or Pseudomonas syringae pv. tomato or after treatment with salicylic acid (SA), jasmonic acid, and 1-amino cyclopropane-1-carboxylic acid (the precursor of ethylene biosynthesis). Transgenic plants that overexpress the ATAF1 gene (ATAF1-OE) showed increased susceptibility while expression of an ATAF1 chimeric repressor construct (ATAF1-SRDX) exhibited enhanced resistance to P. syringae pv. tomato DC3000, B. cinerea, and Alternaria brassicicola. The ataf1 mutant plants showed no significant resistance against the pathogens tested. After inoculation with B. cinerea or P. syringae pv. tomato DC3000, expressions of defense-related genes PR-1, PR-5. and PDF1.2 were upregulated in the ATAF1-SRDX plants but attenuated or unchanged in the ATAF1-OE plants. In ATAF1-OE plants, SA-induced expression of pathogenesis-related genes and disease resistance against P. syringae pv. tomato DC3000 was partially suppressed. Increased levels of reactive oxygen species (i.e., H(2)O(2) and superoxide anion) accumulated only in the ATAF1-OE but not in the ATAF1-SRDX plants after Botrytis spp. infection. Our studies provide direct genetic evidence for the role of ATAF1 as a negative regulator of defense response against different type of pathogens.

  20. Transcriptional and metabolic signatures of Arabidopsis responses to chewing damage by an insect herbivore and bacterial infection and the consequences of their interaction

    Science.gov (United States)

    Appel, Heidi M.; Maqbool, Shahina B.; Raina, Surabhi; Jagadeeswaran, Guru; Acharya, Biswa R.; Hanley, John C.; Miller, Kathryn P.; Hearnes, Leonard; Jones, A. Daniel; Raina, Ramesh; Schultz, Jack C.

    2014-01-01

    Plants use multiple interacting signaling systems to identify and respond to biotic stresses. Although it is often assumed that there is specificity in signaling responses to specific pests, this is rarely examined outside of the gene-for-gene relationships of plant-pathogen interactions. In this study, we first compared early events in gene expression and later events in metabolite profiles of Arabidopsis thaliana following attack by either the caterpillar Spodoptera exigua or avirulent (DC3000 avrRpm1) Pseudomonas syringae pv. tomato at three time points. Transcriptional responses of the plant to caterpillar feeding were rapid, occurring within 1 h of feeding, and then decreased at 6 and 24 h. In contrast, plant response to the pathogen was undetectable at 1 h but grew larger and more significant at 6 and 24 h. There was a surprisingly large amount of overlap in jasmonate and salicylate signaling in responses to the insect and pathogen, including levels of gene expression and individual hormones. The caterpillar and pathogen treatments induced different patterns of expression of glucosinolate biosynthesis genes and levels of glucosinolates. This suggests that when specific responses develop, their regulation is complex and best understood by characterizing expression of many genes and metabolites. We then examined the effect of feeding by the caterpillar Spodoptera exigua on Arabidopsis susceptibility to virulent (DC3000) and avirulent (DC3000 avrRpm1) P. syringae pv. tomato, and found that caterpillar feeding enhanced Arabidopsis resistance to the avirulent pathogen and lowered resistance to the virulent strain. We conclude that efforts to improve plant resistance to bacterial pathogens are likely to influence resistance to insects and vice versa. Studies explicitly comparing plant responses to multiple stresses, including the role of elicitors at early time points, are critical to understanding how plants organize responses in natural settings. PMID:25278943

  1. Transcriptional and metabolic signatures of Arabidopsis responses to chewing damage by an insect herbivore and bacterial infection and the consequences of their interaction

    Directory of Open Access Journals (Sweden)

    Heidi M Appel

    2014-09-01

    Full Text Available Plants use multiple interacting signaling systems to identify and respond to biotic stresses. Although it is often assumed that there is specificity in signaling responses to specific pests, this is rarely examined outside of the gene-for-gene relationships of plant-pathogen interactions. In this study, we first compared early events in gene expression and later events in metabolite profiles of Arabidopsis thaliana following attack by either the caterpillar Spodoptera exigua or avirulent (DC3000 avrRpm1 Pseudomonas syringae pv. tomato at three time points. Transcriptional responses of the plant to caterpillar feeding were rapid, occurring within 1 h of feeding, and then decreased at 6 h and 24 h. In contrast, plant response to the pathogen was undetectable at 1 h but grew larger and more significant at 6 h and 24 h. There was a surprisingly large amount of overlap in jasmonate and salicylate signaling in responses to the insect and pathogen, including levels of gene expression and individual hormones. The caterpillar and pathogen treatments induced different patterns of expression of glucosinolate biosynthesis genes and levels of glucosinolates. This suggests that when specific responses develop, their regulation is complex and best understood by characterizing expression of many genes and metabolites. We then examined the effect of feeding by the caterpillar Spodoptera exigua on Arabidopsis susceptibility to virulent (DC3000 and avirulent (DC3000 avrRpm1 P. syringae pv. tomato, and found that caterpillar feeding enhanced Arabidopsis resistance to the avirulent pathogen and lowered resistance to the virulent strain. We conclude that efforts to improve plant resistance to bacterial pathogens are likely to influence resistance to insects and vice versa. Studies explicitly comparing plant responses to multiple stresses, including the role of elicitors at early time points, are critical to understanding how plants organize responses in natural

  2. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo

    2005-10-01

    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  3. ORF Alignment: NC_005966 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available regulator for ferulate or vanillate catabolism ... (GntR family) [Acinetobacter sp. ADP1] emb|CAG678...70.1| ... transcriptional regulator for ferulate or vanillate ... catabolism (GntR family) [Ac

  4. Hippo, TGF-β, and Src-MAPK pathways regulate transcription of the upd3 cytokine in Drosophila enterocytes upon bacterial infection.

    Science.gov (United States)

    Houtz, Philip; Bonfini, Alessandro; Liu, Xi; Revah, Jonathan; Guillou, Aurélien; Poidevin, Mickael; Hens, Korneel; Huang, Hsin-Yi; Deplancke, Bart; Tsai, Yu-Chen; Buchon, Nicolas

    2017-11-01

    Cytokine signaling is responsible for coordinating conserved epithelial regeneration and immune responses in the digestive tract. In the Drosophila midgut, Upd3 is a major cytokine, which is induced in enterocytes (EC) and enteroblasts (EB) upon oral infection, and initiates intestinal stem cell (ISC) dependent tissue repair. To date, the genetic network directing upd3 transcription remains largely uncharacterized. Here, we have identified the key infection-responsive enhancers of the upd3 gene and show that distinct enhancers respond to various stresses. Furthermore, through functional genetic screening, bioinformatic analyses and yeast one-hybrid screening, we determined that the transcription factors Scalloped (Sd), Mothers against dpp (Mad), and D-Fos are principal regulators of upd3 expression. Our study demonstrates that upd3 transcription in the gut is regulated by the activation of multiple pathways, including the Hippo, TGF-β/Dpp, and Src, as well as p38-dependent MAPK pathways. Thus, these essential pathways, which are known to control ISC proliferation cell-autonomously, are also activated in ECs to promote tissue turnover the regulation of upd3 transcription.

  5. A Novel WRKY transcription factor is required for induction of PR-1a gene expression by salicylic acid and bacterial elicitors

    NARCIS (Netherlands)

    van Verk, Marcel C|info:eu-repo/dai/nl/327618671; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M

    PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of

  6. A bacterial community analysis using reverse transcription (RT) PCR which detects the bacteria with high activity in a wastewater treatment reactor

    Science.gov (United States)

    This research used reverse transcription polymerase chain reaction (RT-PCR) method to help detect active bacteria in a single-tank deammonification reactor combining partial nitritation and anammox. The single-tank aerobic deammonification reactor effectively removed the ammonia in anaerobically di...

  7. Gene and transcript abundances of bacterial type III secretion systems from the rumen microbiome are correlated with methane yield in sheep

    OpenAIRE

    Kamke, Janine; Soni, Priya; Li, Yang; Ganesh, Siva; Kelly, William J.; Leahy, Sinead C.; Shi, Weibing; Froula, Jeff; Rubin, Edward M.; Attwood, Graeme T.

    2017-01-01

    Background Ruminants are important contributors to global methane emissions via microbial fermentation in their reticulo-rumens. This study is part of a larger program, characterising the rumen microbiomes of sheep which vary naturally in methane yield (g CH4/kg DM/day) and aims to define differences in microbial communities, and in gene and transcript abundances that can explain the animal methane phenotype. Methods Rumen microbiome metagenomic and metatranscriptomic data were analysed by Ge...

  8. Molecular characterization of collagen IV evidences early transcription expression related to the immune response against bacterial infection in the red abalone (Haliotis rufescens).

    Science.gov (United States)

    Chovar-Vera, Ornella; Valenzuela-Muñoz, Valentina; Gallardo-Escárate, Cristian

    2015-02-01

    Collagen IV has been described as a structural protein of the basement membrane, which as a whole forms a specialized extracellular matrix. Recent studies have indicated a possible relationship between collagen IV and the innate immune response of invertebrate organisms. The present study characterized the alpha-1 chain of collagen IV in the red abalone Haliotis rufescens (Hr-ColIV) and evaluated its association with the innate immune response against Vibrio anguillarum. To further evidence the immune response, the matrix metalloproteinase-1 (Hr-MMP-1) and C-type lectin (Hr-CLEC) genes were also assessed. The complete sequence of Hr-ColIV was composed of 6658 bp, with a 5'UTR of 154 bp, a 3'UTR of 1177 bp, and an ORF of 5327 bp that coded for 1776 amino acids. The innate immune response generated against V. anguillarum resulted in a significant increase in the transcript levels of Hr-ColIV between 3 and 6 hpi, whereas Hr-MMP-1 and Hr-CLEC had the highest transcript activity 6 and 12 hpi, respectively. The results obtained in this study propose a putative biological function for collagen IV involved in the early innate immune response of the red abalone H. rufescens. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. An invertebrate signal transducer and activator of transcription 5 (STAT5) ortholog from the disk abalone, Haliotis discus discus: Genomic structure, early developmental expression, and immune responses to bacterial and viral stresses.

    Science.gov (United States)

    Bathige, S D N K; Umasuthan, Navaneethaiyer; Park, Hae-Chul; Lee, Jehee

    2016-03-01

    Signal transducer and activator of transcription (STAT) family members are key signaling molecules that transduce cellular responses from the cell membrane to the nucleus upon Janus kinase (JAK) activation. Although seven STAT members have been reported in mammals, very limited information on STAT genes in molluscans is available. In this study, we identified and characterized a STAT paralog that is homologous to STAT5 from the disk abalone, Haliotis discus discus, and designated as AbSTAT5. Comparison of the deduced amino acid sequence for AbSTAT5 (790 amino acids) with other counterparts revealed conserved residues important for functions and typical domain regions, including the N-terminal domain, coiled-coil domain, DNA-binding domain, linker domain, and Src homology 2 (SH2) domains as mammalian counterparts. Analysis of STAT phylogeny revealed that AbSTAT5 was clustered with the molluscan subgroup in STAT5 clade with distinct evolution. According to the genomic structure of AbSTAT5, the coding sequence was distributed into 20 exons with 19 introns. Immunologically essential transcription factor-binding sites, such as GATA-1, HNF, SP1, C/EBP, Oct-1, AP1, c-Jun, and Sox-2, were predicted at the 5'-proximal region of AbSTAT5. Expression of AbSTAT5 mRNA was detected in different stages of embryonic development and observed at considerably higher levels in the morula and late veliger stages. Tissue-specific expressional studies revealed that the highest level of AbSTAT5 transcripts was detected in hemocytes, followed by gill tissues. Temporal expressions of AbSTAT5 were analyzed upon live bacterial (Vibrio parahemolyticus and Listeria monocytogenes), viral (viral hemorrhagic septicemia virus), and pathogen-associated molecular pattern (lipopolysaccharides and Poly I:C) stimulations, and significant elevations indicated immune modulation. These results suggest that AbSTAT5 may be involved in maintaining innate immune responses from developmental to adult stages in

  10. Bacterial Keratitis

    Science.gov (United States)

    ... Español Eye Health / Eye Health A-Z Bacterial Keratitis Sections What Is Bacterial Keratitis? Bacterial Keratitis Symptoms ... Lens Care Bacterial Keratitis Treatment What Is Bacterial Keratitis? Leer en Español: ¿Qué Es la Queratitis Bacteriana? ...

  11. Bacterial meningitis

    NARCIS (Netherlands)

    Roos, Karen L.; van de Beek, Diederik

    2010-01-01

    Bacterial meningitis is a neurological emergency. Empiric antimicrobial and adjunctive therapy should be initiated as soon as a single set of blood cultures has been obtained. Clinical signs suggestive of bacterial meningitis include fever, headache, meningismus, vomiting, photophobia, and an

  12. ExtraTrain: a database of Extragenic regions and Transcriptional information in prokaryotic organisms

    Science.gov (United States)

    Pareja, Eduardo; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Bonal, Javier; Tobes, Raquel

    2006-01-01

    Background Transcriptional regulation processes are the principal mechanisms of adaptation in prokaryotes. In these processes, the regulatory proteins and the regulatory DNA signals located in extragenic regions are the key elements involved. As all extragenic spaces are putative regulatory regions, ExtraTrain covers all extragenic regions of available genomes and regulatory proteins from bacteria and archaea included in the UniProt database. Description ExtraTrain provides integrated and easily manageable information for 679816 extragenic regions and for the genes delimiting each of them. In addition ExtraTrain supplies a tool to explore extragenic regions, named Palinsight, oriented to detect and search palindromic patterns. This interactive visual tool is totally integrated in the database, allowing the search for regulatory signals in user defined sets of extragenic regions. The 26046 regulatory proteins included in ExtraTrain belong to the families AraC/XylS, ArsR, AsnC, Cold shock domain, CRP-FNR, DeoR, GntR, IclR, LacI, LuxR, LysR, MarR, MerR, NtrC/Fis, OmpR and TetR. The database follows the InterPro criteria to define these families. The information about regulators includes manually curated sets of references specifically associated to regulator entries. In order to achieve a sustainable and maintainable knowledge database ExtraTrain is a platform open to the contribution of knowledge by the scientific community providing a system for the incorporation of textual knowledge. Conclusion ExtraTrain is a new database for exploring Extragenic regions and Transcriptional information in bacteria and archaea. ExtraTrain database is available at . PMID:16539733

  13. Bacterial Proteasomes.

    Science.gov (United States)

    Jastrab, Jordan B; Darwin, K Heran

    2015-01-01

    Interest in bacterial proteasomes was sparked by the discovery that proteasomal degradation is required for the pathogenesis of Mycobacterium tuberculosis, one of the world's deadliest pathogens. Although bacterial proteasomes are structurally similar to their eukaryotic and archaeal homologs, there are key differences in their mechanisms of assembly, activation, and substrate targeting for degradation. In this article, we compare and contrast bacterial proteasomes with their archaeal and eukaryotic counterparts, and we discuss recent advances in our understanding of how bacterial proteasomes function to influence microbial physiology.

  14. Bacterial adhesion

    NARCIS (Netherlands)

    Loosdrecht, van M.C.M.

    1988-01-01

    As mentioned in the introduction of this thesis bacterial adhesion has been studied from a variety of (mostly practice oriented) starting points. This has resulted in a range of widely divergent approaches. In order to elucidate general principles in bacterial adhesion phenomena, we felt it

  15. Bacterial Vaginosis

    Science.gov (United States)

    ... Archive STDs Home Page Bacterial Vaginosis (BV) Chlamydia Gonorrhea Genital Herpes Hepatitis HIV/AIDS & STDs Human Papillomavirus ( ... of getting other STDs, such as chlamydia and gonorrhea . These bacteria can sometimes cause pelvic inflammatory disease ( ...

  16. BACTERIAL CONSORTIUM

    Directory of Open Access Journals (Sweden)

    Payel Sarkar

    2013-01-01

    Full Text Available Petroleum aromatic hydrocarbons like benzen e, toluene, ethyl benzene and xylene, together known as BTEX, has almost the same chemical structure. These aromatic hydrocarbons are released as pollutants in th e environment. This work was taken up to develop a solvent tolerant bacterial cons ortium that could degrade BTEX compounds as they all share a common chemical structure. We have isolated almost 60 different types of bacterial strains from different petroleum contaminated sites. Of these 60 bacterial strains almost 20 microorganisms were screene d on the basis of capability to tolerate high concentration of BTEX. Ten differe nt consortia were prepared and the compatibility of the bacterial strains within the consortia was checked by gram staining and BTEX tolerance level. Four successful mi crobial consortia were selected in which all the bacterial strains concomitantly grew in presence of high concentration of BTEX (10% of toluene, 10% of benzene 5% ethyl benzene and 1% xylene. Consortium #2 showed the highest growth rate in pr esence of BTEX. Degradation of BTEX by consortium #2 was monitored for 5 days by gradual decrease in the volume of the solvents. The maximum reduction observed wa s 85% in 5 days. Gas chromatography results also reveal that could completely degrade benzene and ethyl benzene within 48 hours. Almost 90% degradation of toluene and xylene in 48 hours was exhibited by consortium #2. It could also tolerate and degrade many industrial solvents such as chloroform, DMSO, acetonitrile having a wide range of log P values (0.03–3.1. Degradation of aromatic hydrocarbon like BTEX by a solvent tolerant bacterial consortium is greatly significant as it could degrade high concentration of pollutants compared to a bacterium and also reduces the time span of degradation.

  17. Bacterial Ecology

    DEFF Research Database (Denmark)

    Fenchel, Tom

    2011-01-01

    Bacterial ecology is concerned with the interactions between bacteria and their biological and nonbiological environments and with the role of bacteria in biogeochemical element cycling. Many fundamental properties of bacteria are consequences of their small size. Thus, they can efficiently exploit...

  18. Bacterial meningitis

    NARCIS (Netherlands)

    Heckenberg, Sebastiaan G. B.; Brouwer, Matthijs C.; van de Beek, Diederik

    2014-01-01

    Bacterial meningitis is a neurologic emergency. Vaccination against common pathogens has decreased the burden of disease. Early diagnosis and rapid initiation of empiric antimicrobial and adjunctive therapy are vital. Therapy should be initiated as soon as blood cultures have been obtained,

  19. Bacterial lipases

    NARCIS (Netherlands)

    Jaeger, Karl-Erich; Ransac, Stéphane; Dijkstra, Bauke W.; Colson, Charles; Heuvel, Margreet van; Misset, Onno

    Many different bacterial species produce lipases which hydrolyze esters of glycerol with preferably long-chain fatty acids. They act at the interface generated by a hydrophobic lipid substrate in a hydrophilic aqueous medium. A characteristic property of lipases is called interfacial activation,

  20. Bacterial Ecology

    DEFF Research Database (Denmark)

    Fenchel, Tom

    2011-01-01

    , the production and oxidation of methane, nitrate reduction and fixation of atmospheric nitrogen are exclusively carried out by different groups of bacteria. Some bacterial species – ‘extremophiles’ – thrive in extreme environments in which no eukaryotic organisms can survive with respect to temperature, salinity...

  1. Bacterial Vaginosis

    Science.gov (United States)

    ... that coats the walls of the vagina Vaginal discharge with an unpleasant or fishlike odor Vaginal pain or itching Burning during urination Doctors are unsure of the incubation period for bacterial vaginosis. How Is the Diagnosis Made? Your child’s pediatrician can make the diagnosis ...

  2. Bacterial stress

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Bacterial stress. Physicochemical and chemical parameters: temperature, pressure, pH, salt concentration, oxygen, irradiation. Nutritional depravation: nutrient starvation, water shortage. Toxic compounds: Antibiotics, heavy metals, toxins, mutagens. Interactions with other cells: ...

  3. Bacterial Adhesion & Blocking Bacterial Adhesion

    DEFF Research Database (Denmark)

    Vejborg, Rebecca Munk

    2008-01-01

    reduce or delay bacterial biofilm formation of a range of urinary tract infectious E.coli and Klebsiella isolates. Several other proteinaceous coatings were also found to display anti-adhesive properties, possibly providing a measure for controlling the colonization of implant materials. Several other...... components. These substances may both mediate and stabilize the bacterial biofilm. Finally, several adhesive structures were examined, and a novel physiological biofilm phenotype in E.coli biofilms was characterized, namely cell chain formation. The autotransporter protein, antigen 43, was implicated...

  4. Bacterial lipases

    OpenAIRE

    Jaeger, Karl-Erich; Ransac, Stéphane; Dijkstra, Bauke W.; Colson, Charles; Heuvel, Margreet van; Misset, Onno

    1994-01-01

    Many different bacterial species produce lipases which hydrolyze esters of glycerol with preferably long-chain fatty acids. They act at the interface generated by a hydrophobic lipid substrate in a hydrophilic aqueous medium. A characteristic property of lipases is called interfacial activation, meaning a sharp increase in lipase activity observed when the substrate starts to form an emulsion, thereby presenting to the enzyme an interfacial area. As a consequence, the kinetics of a lipase rea...

  5. The Transcription Bubble of the RNA Polymerase-Promoter Open Complex Exhibits Conformational Heterogeneity and Millisecond-Scale Dynamics : Implications for Transcription Start-Site Selection

    NARCIS (Netherlands)

    Robb, Nicole C.; Cordes, Thorben; Hwang, Ling Chin; Gryte, Kristofer; Duchi, Diego; Craggs, Timothy D.; Santoso, Yusdi; Weiss, Shimon; Ebright, Richard H.; Kapanidis, Achillefs N.

    2013-01-01

    Bacterial transcription is initiated after RNA polymerase (RNAP) binds to promoter DNA, melts similar to 14 bp around the transcription start site and forms a single-stranded "transcription bubble" within a catalytically active RNAP-DNA open complex (RPo). There is significant flexibility in the

  6. Bacterial mitosis

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Borch, Jonas; Dam, Mette

    2003-01-01

    Bacterial DNA segregation takes place in an active and ordered fashion. In the case of Escherichia coli plasmid R1, the partitioning system (par) separates paired plasmid copies and moves them to opposite cell poles. Here we address the mechanism by which the three components of the R1 par system...... movement is powered by insertional polymerization of ParM. Consistently, we find that segregating plasmids are positioned at the ends of extending ParM filaments. Thus, the process of R1 plasmid segregation in E. coli appears to be mechanistically analogous to the actin-based motility operating...

  7. Transcription of the T4 late genes

    OpenAIRE

    Geiduschek, E Peter; Kassavetis, George A

    2010-01-01

    Abstract This article reviews the current state of understanding of the regulated transcription of the bacteriophage T4 late genes, with a focus on the underlying biochemical mechanisms, which turn out to be unique to the T4-related family of phages or significantly different from other bacterial systems. The activator of T4 late transcription is the gene 45 protein (gp45), the sliding clamp of the T4 replisome. Gp45 becomes topologically linked to DNA through the action of its clamp-loader, ...

  8. Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism

    Science.gov (United States)

    Xu, Jie; Zhang, Huimin; Srinivas, Swaminath

    2013-01-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  9. BACTERIAL PLASMIDS

    Directory of Open Access Journals (Sweden)

    Marina Dinic

    2007-12-01

    Full Text Available Plasmids, extrachromosomal DNA, were identified in bacteria pertaining to family of Enterobacteriacae for the very first time. After that, they were discovered in almost every single observed strain. The structure of plasmids is made of circular double chain DNA molecules which are replicated autonomously in a host cell. Their length may vary from few up to several hundred kilobase (kb. Among the bacteria, plasmids are mostly transferred horizontally by conjugation process. Plasmid replication process can be divided into three stages: initiation, elongation, and termination. The process involves DNA helicase I, DNA gyrase, DNA polymerase III, endonuclease, and ligase.Plasmids contain genes essential for plasmid function and their preservation in a host cell (the beginning and the control of replication. Some of them possess genes whichcontrol plasmid stability. There is a common opinion that plasmids are unnecessary fora growth of bacterial population and their vital functions; thus, in many cases they can be taken up or kicked out with no lethal effects to a plasmid host cell. However,there are numerous biological functions of bacteria related to plasmids. Plasmids identification and classification are based upon their genetic features which are presented permanently in all of them, and these are: abilities to preserve themselves in a host cell and to control a replication process. In this way, plasmids classification among incompatibility groups is performed. The method of replicon typing, which is based on genotype and not on phenotype characteristics, has the same results as in compatibility grouping.

  10. The bacterial enhancer-dependent RNA polymerase.

    Science.gov (United States)

    Zhang, Nan; Darbari, Vidya C; Glyde, Robert; Zhang, Xiaodong; Buck, Martin

    2016-11-01

    Transcription initiation is highly regulated in bacterial cells, allowing adaptive gene regulation in response to environment cues. One class of promoter specificity factor called sigma54 enables such adaptive gene expression through its ability to lock the RNA polymerase down into a state unable to melt out promoter DNA for transcription initiation. Promoter DNA opening then occurs through the action of specialized transcription control proteins called bacterial enhancer-binding proteins (bEBPs) that remodel the sigma54 factor within the closed promoter complexes. The remodelling of sigma54 occurs through an ATP-binding and hydrolysis reaction carried out by the bEBPs. The regulation of bEBP self-assembly into typically homomeric hexamers allows regulated gene expression since the self-assembly is required for bEBP ATPase activity and its direct engagement with the sigma54 factor during the remodelling reaction. Crystallographic studies have now established that in the closed promoter complex, the sigma54 factor occupies the bacterial RNA polymerase in ways that will physically impede promoter DNA opening and the loading of melted out promoter DNA into the DNA-binding clefts of the RNA polymerase. Large-scale structural re-organizations of sigma54 require contact of the bEBP with an amino-terminal glutamine and leucine-rich sequence of sigma54, and lead to domain movements within the core RNA polymerase necessary for making open promoter complexes and synthesizing the nascent RNA transcript. © 2016 The Author(s).

  11. Lineage-specific partitions in archaeal transcription

    Directory of Open Access Journals (Sweden)

    Richard M. R. Coulson

    2006-01-01

    Full Text Available The phylogenetic distribution of the components comprising the transcriptional machinery in the crenarchaeal and euryarchaeal lineages of the Archaea was analyzed in a systematic manner by genome-wide profiling of transcription complements in fifteen complete archaeal genome sequences. Initially, a reference set of transcription-associated proteins (TAPs consisting of sequences functioning in all aspects of the transcriptional process, and originating from the three domains of life, was used to query the genomes. TAP-families were detected by sequence clustering of the TAPs and their archaeal homologues, and through extensive database searching, these families were assigned a function. The phylogenetic origins of archaeal genes matching hidden Markov model profiles of protein domains associated with transcription, and those encoding the TAP-homologues, showed there is extensive lineage-specificity of proteins that function as regulators of transcription: most of these sequences are present solely in the Euryarchaeota, with nearly all of them homologous to bacterial DNA-binding proteins. Strikingly, the hidden Markov model profile searches revealed that archaeal chromatin and histone-modifying enzymes also display extensive taxon-restrictedness, both across and within the two phyla.

  12. HIV-1 reverse transcription.

    Science.gov (United States)

    Hu, Wei-Shau; Hughes, Stephen H

    2012-10-01

    Reverse transcription and integration are the defining features of the Retroviridae; the common name "retrovirus" derives from the fact that these viruses use a virally encoded enzyme, reverse transcriptase (RT), to convert their RNA genomes into DNA. Reverse transcription is an essential step in retroviral replication. This article presents an overview of reverse transcription, briefly describes the structure and function of RT, provides an introduction to some of the cellular and viral factors that can affect reverse transcription, and discusses fidelity and recombination, two processes in which reverse transcription plays an important role. In keeping with the theme of the collection, the emphasis is on HIV-1 and HIV-1 RT.

  13. Bacterial subversion of host innate immune pathways.

    Science.gov (United States)

    Baxt, Leigh A; Garza-Mayers, Anna Cristina; Goldberg, Marcia B

    2013-05-10

    The pathogenesis of infection is a continuously evolving battle between the human host and the infecting microbe. The past decade has brought a burst of insights into the molecular mechanisms of innate immune responses to bacterial pathogens. In parallel, multiple specific mechanisms by which microorganisms subvert these host responses have been uncovered. This Review highlights recently characterized mechanisms by which bacterial pathogens avoid killing by innate host responses, including autophagy pathways and a proinflammatory cytokine transcriptional response, and by the manipulation of vesicular trafficking to avoid the toxicity of lysosomal enzymes.

  14. Transcription control engineering and applications in synthetic biology

    Directory of Open Access Journals (Sweden)

    Michael D. Engstrom

    2017-09-01

    Full Text Available In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein, a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators (cis-factors were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators (trans-factors, giving examples of how cis- and trans-acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli, we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  15. Transcription control engineering and applications in synthetic biology.

    Science.gov (United States)

    Engstrom, Michael D; Pfleger, Brian F

    2017-09-01

    In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein), a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity) levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators ( cis -factors) were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators ( trans- factors), giving examples of how cis- and trans -acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli , we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  16. HIV-1 Reverse Transcription

    OpenAIRE

    Hu, Wei-Shau; Hughes, Stephen H.

    2012-01-01

    Reverse transcription and integration are the defining features of the Retroviridae; the common name “retrovirus” derives from the fact that these viruses use a virally encoded enzyme, reverse transcriptase (RT), to convert their RNA genomes into DNA. Reverse transcription is an essential step in retroviral replication. This article presents an overview of reverse transcription, briefly describes the structure and function of RT, provides an introduction to some of the cellular and viral fact...

  17. Transcription of the T4 late genes

    Directory of Open Access Journals (Sweden)

    Kassavetis George A

    2010-10-01

    Full Text Available Abstract This article reviews the current state of understanding of the regulated transcription of the bacteriophage T4 late genes, with a focus on the underlying biochemical mechanisms, which turn out to be unique to the T4-related family of phages or significantly different from other bacterial systems. The activator of T4 late transcription is the gene 45 protein (gp45, the sliding clamp of the T4 replisome. Gp45 becomes topologically linked to DNA through the action of its clamp-loader, but it is not site-specifically DNA-bound, as other transcriptional activators are. Gp45 facilitates RNA polymerase recruitment to late promoters by interacting with two phage-encoded polymerase subunits: gp33, the co-activator of T4 late transcription; and gp55, the T4 late promoter recognition protein. The emphasis of this account is on the sites and mechanisms of actions of these three proteins, and on their roles in the formation of transcription-ready open T4 late promoter complexes.

  18. The Transcription Factor Encyclopedia

    NARCIS (Netherlands)

    Yusuf, Dimas; Butland, Stefanie L.; Swanson, Magdalena I.; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A.; Zhang, Xiao Yu Cindy; Dickman, Christopher T. D.; Fulton, Debra L.; Lim, Jonathan S.; Schnabl, Jake M.; Ramos, Oscar H. P.; Vasseur-Cognet, Mireille; de Leeuw, Charles N.; Simpson, Elizabeth M.; Ryffel, Gerhart U.; Lam, Eric W.-F.; Kist, Ralf; Wilson, Miranda S. C.; Marco-Ferreres, Raquel; Brosens, Jan J.; Beccari, Leonardo L.; Bovolenta, Paola; Benayoun, Bérénice A.; Monteiro, Lara J.; Schwenen, Helma D. C.; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A.; Chakravarthy, Harini; Hoodless, Pamela A.; Mancarelli, M. Michela; Torbett, Bruce E.; Banham, Alison H.; Reddy, Sekhar P.; Cullum, Rebecca L.; Liedtke, Michaela; Tschan, Mario P.; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J.; Eijkelenboom, Astrid; Brown, Philip J.; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L.; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H.; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J.; van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W. Z.; Breslin, Mary B.; Lan, Michael S.; Nanan, Kyster K.; Wegner, Michael; Hou, Juan; Mullen, Rachel D.; Colvin, Stephanie C.; Noy, Peter John; Webb, Carol F.; Witek, Matthew E.; Ferrell, Scott; Daniel, Juliet M.; Park, Jason; Waldman, Scott A.; Peet, Daniel J.; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J.; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M.; Woodcroft, Mark W.; Hough, Margaret R.; Chen, Edwin; Europe-Finner, G. Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; Lebrun, David P.; Biswal, Shyam; Harvey, Christopher J.; Debruyne, Jason P.; Hogenesch, John B.; Hevner, Robert F.; Héligon, Christophe; Luo, Xin M.; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S.; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M.; Bradley, Philip H.; Wasserman, Wyeth W.

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review

  19. The transcriptional landscape

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2011-01-01

    The application of new and less biased methods to study the transcriptional output from genomes, such as tiling arrays and deep sequencing, has revealed that most of the genome is transcribed and that there is substantial overlap of transcripts derived from the two strands of DNA. In protein codi...

  20. Mechanical Properties of Transcription

    Science.gov (United States)

    Sevier, Stuart A.; Levine, Herbert

    2017-06-01

    The mechanical properties of transcription have recently been shown to play a central role in gene expression. However, a full physical characterization of this central biological process is lacking. In this Letter, we introduce a simple description of the basic physical elements of transcription where RNA elongation, RNA polymerase rotation, and DNA supercoiling are coupled. The resulting framework describes the relative amount of RNA polymerase rotation and DNA supercoiling that occurs during RNA elongation. Asymptotic behavior is derived and can be used to experimentally extract unknown mechanical parameters of transcription. Mechanical limits to transcription are incorporated through the addition of a DNA supercoiling-dependent RNA polymerase velocity. This addition can lead to transcriptional stalling and resulting implications for gene expression, chromatin structure and genome organization are discussed.

  1. A model for genesis of transcription systems.

    Science.gov (United States)

    Burton, Zachary F; Opron, Kristopher; Wei, Guowei; Geiger, James H

    2016-01-01

    Repeating sequences generated from RNA gene fusions/ligations dominate ancient life, indicating central importance of building structural complexity in evolving biological systems. A simple and coherent story of life on earth is told from tracking repeating motifs that generate α/β proteins, 2-double-Ψ-β-barrel (DPBB) type RNA polymerases (RNAPs), general transcription factors (GTFs), and promoters. A general rule that emerges is that biological complexity that arises through generation of repeats is often bounded by solubility and closure (i.e., to form a pseudo-dimer or a barrel). Because the first DNA genomes were replicated by DNA template-dependent RNA synthesis followed by RNA template-dependent DNA synthesis via reverse transcriptase, the first DNA replication origins were initially 2-DPBB type RNAP promoters. A simplifying model for evolution of promoters/replication origins via repetition of core promoter elements is proposed. The model can explain why Pribnow boxes in bacterial transcription (i.e., (-12)TATAATG(-6)) so closely resemble TATA boxes (i.e., (-31)TATAAAAG(-24)) in archaeal/eukaryotic transcription. The evolution of anchor DNA sequences in bacterial (i.e., (-35)TTGACA(-30)) and archaeal (BRE(up); BRE for TFB recognition element) promoters is potentially explained. The evolution of BRE(down) elements of archaeal promoters is potentially explained.

  2. Gene transcription analysis during interaction between potato and Ralstonia solanacearum

    NARCIS (Netherlands)

    Li, G.C.; Jin, L.P.; Wang, X.W.; Xie, K.Y.; Yang, Y.; Vossen, van der E.A.G.; Huang, S.W.; Qu, D.Y.

    2010-01-01

    Bacterial wilt (BW) caused by Ralstonia solanacearum (Rs) is an important quarantine disease that spreads worldwide and infects hundreds of plant species. The BW defense response of potato is a complicated continuous process, which involves transcription of a battery of genes. The molecular

  3. Prevention of bacterial adhesion

    DEFF Research Database (Denmark)

    Klemm, Per; Vejborg, Rebecca Munk; Hancock, Viktoria

    2010-01-01

    Management of bacterial infections is becoming increasingly difficult due to the emergence and increasing prevalence of bacterial pathogens that are resistant to available antibiotics. Conventional antibiotics generally kill bacteria by interfering with vital cellular functions, an approach...... that imposes selection pressure for resistant bacteria. New approaches are urgently needed. Targeting bacterial virulence functions directly is an attractive alternative. An obvious target is bacterial adhesion. Bacterial adhesion to surfaces is the first step in colonization, invasion, and biofilm formation....... As such, adhesion represents the Achilles heel of crucial pathogenic functions. It follows that interference with adhesion can reduce bacterial virulence. Here, we illustrate this important topic with examples of techniques being developed that can inhibit bacterial adhesion. Some of these will become...

  4. Deciphering Transcriptional Regulation

    DEFF Research Database (Denmark)

    Valen, Eivind

    RNA); and ii) translation, in which the mRNA is translated into a protein. This thesis focus on the ¿rst of these steps, transcription, and speci¿cally the initiation of this. Simpli¿ed, initiation is preceded by the binding of several proteins, known as transcription factors (TFs), to DNA. This takes place...... published providing an unbiased overview of the transcription start site (TSS) usage in a tissue. We have paired this method with high-throughput sequencing technology to produce a library of unprecedented depth (DeepCAGE) for the mouse hippocampus. We investigated this in detail and focused particularly...... control spanning the range from completely muted to cranked up to maximum. The volume, in this case, is the production rate of proteins. This production is the result of a two step procedure: i) transcription, in which a small part of DNA from the genome (a gene) is transcribed into an RNA molecule (an m...

  5. Studying bacterial multispecies biofilms

    DEFF Research Database (Denmark)

    Røder, Henriette Lyng; Sørensen, Søren Johannes; Burmølle, Mette

    2016-01-01

    , but the identity and significance of interspecies bacterial interactions is neglected in these analyses. There is therefore an urgent need for bridging the gap between metagenomic analysis and in vitro models suitable for studies of bacterial interactions.Bacterial interactions and coadaptation are important......The high prevalence and significance of multispecies biofilms have now been demonstrated in various bacterial habitats with medical, industrial, and ecological relevance. It is highly evident that several species of bacteria coexist and interact in biofilms, which highlights the need for evaluating...

  6. Antisense transcription-dependent chromatin signature modulates sense transcript dynamics.

    Science.gov (United States)

    Brown, Thomas; Howe, Françoise S; Murray, Struan C; Wouters, Meredith; Lorenz, Philipp; Seward, Emily; Rata, Scott; Angel, Andrew; Mellor, Jane

    2018-02-12

    Antisense transcription is widespread in genomes. Despite large differences in gene size and architecture, we find that yeast and human genes share a unique, antisense transcription-associated chromatin signature. We asked whether this signature is related to a biological function for antisense transcription. Using quantitative RNA-FISH, we observed changes in sense transcript distributions in nuclei and cytoplasm as antisense transcript levels were altered. To determine the mechanistic differences underlying these distributions, we developed a mathematical framework describing transcription from initiation to transcript degradation. At GAL1 , high levels of antisense transcription alter sense transcription dynamics, reducing rates of transcript production and processing, while increasing transcript stability. This relationship with transcript stability is also observed as a genome-wide association. Establishing the antisense transcription-associated chromatin signature through disruption of the Set3C histone deacetylase activity is sufficient to similarly change these rates even in the absence of antisense transcription. Thus, antisense transcription alters sense transcription dynamics in a chromatin-dependent manner. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  7. RNA-guided transcriptional regulation in planta via synthetic dCas9-based transcription factors

    KAUST Repository

    Piatek, Agnieszka Anna

    2014-11-14

    Targeted genomic regulation is a powerful approach to accelerate trait discovery and development in agricultural biotechnology. Bacteria and archaea use clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) regulatory systems for adaptive molecular immunity against foreign nucleic acids introduced by invading phages and conjugative plasmids. The type II CRISPR/Cas system has been adapted for genome editing in many cell types and organisms. A recent study used the catalytically inactive Cas9 (dCas9) protein combined with guide-RNAs (gRNAs) as a DNA-targeting platform to modulate gene expression in bacterial, yeast, and human cells. Here, we modified this DNA-targeting platform for targeted transcriptional regulation in planta by developing chimeric dCas9-based transcriptional activators and repressors. To generate transcriptional activators, we fused the dCas9 C-terminus with the activation domains of EDLL and TAL effectors. To generate a transcriptional repressor, we fused the dCas9 C-terminus with the SRDX repression domain. Our data demonstrate that dCas9 fusion with the EDLL activation domain (dCas9:EDLL) and the TAL activation domain (dCas9:TAD), guided by gRNAs complementary to selected promoter elements, induce strong transcriptional activation on Bs3

  8. Cell-to-cell variation and specialization in sugar metabolism in clonal bacterial populations

    OpenAIRE

    Nikolic, Nela; Schreiber, Frank; Dal Co, Alma; Kiviet, Daniel J.; Bergmiller, Tobias; Littmann, Sten; Kuypers, Marcel M. M.; Ackermann, Martin

    2017-01-01

    Author summary This study addresses a fundamental question in bacterial metabolism: do all individuals in a clonal population express the same metabolic functions, or do individuals specialize on different metabolic functions and assimilate different substrates? Reports about stochastic gene expression in bacterial populations raise the possibility that transcriptional differences between individuals translate into different metabolic behaviors, but the prevalence and magnitude of such effect...

  9. In vitro transcription of a torsionally constrained template

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Peter E

    2002-01-01

    of torsionally constrained DNA by free RNAP. We asked whether or not a newly synthesized RNA chain would limit transcription elongation. For this purpose we developed a method to immobilize covalently closed circular DNA to streptavidin-coated beads via a peptide nucleic acid (PNA)-biotin conjugate in principle......RNA polymerase (RNAP) and the DNA template must rotate relative to each other during transcription elongation. In the cell, however, the components of the transcription apparatus may be subject to rotary constraints. For instance, the DNA is divided into topological domains that are delineated...... constrained. We conclude that transcription of a natural bacterial gene may proceed with high efficiency despite the fact that newly synthesized RNA is entangled around the template in the narrow confines of torsionally constrained supercoiled DNA....

  10. The Transcription Factor Encyclopedia

    DEFF Research Database (Denmark)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I

    2012-01-01

    mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written......ABSTRACT: Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130...... and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe....

  11. The transcription factor encyclopedia.

    Science.gov (United States)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe.

  12. Machine Dictation and Transcription.

    Science.gov (United States)

    Harvey, Evelyn; And Others

    This instructional package contains both an instructor's manual and a student's manual for a course in machine dictation and transcription. The instructor's manual contains an overview with tips on teaching the course, letters for dictation, and a key to the letters. The student's manual contains an overview of the course and of the skills needed…

  13. Automatic Music Transcription

    Science.gov (United States)

    Klapuri, Anssi; Virtanen, Tuomas

    Written musical notation describes music in a symbolic form that is suitable for performing a piece using the available musical instruments. Traditionally, musical notation indicates the pitch, target instrument, timing, and duration of each sound to be played. The aim of music transcription either by humans or by a machine is to infer these musical parameters, given only the acoustic recording of a performance.

  14. Bayesian Music Transcription

    NARCIS (Netherlands)

    Cemgil, A.T.

    2004-01-01

    Music transcription refers to extraction of a human readable and interpretable description from a recording of a music performance. The final goal is to implement a program that can automatically infer a musical notation that lists the pitch levels of notes and corresponding score positions in any

  15. Formaldehyde stress responses in bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Nathan Houqian Chen

    2016-03-01

    Full Text Available Formaldehyde is the simplest of all aldehydes and is highly cytotoxic. Its use and associated dangers from environmental exposure have been well documented. Detoxification systems for formaldehyde are found throughout the biological world and they are especially important in methylotrophic bacteria, which generate this compound as part of their metabolism of methanol. Formaldehyde metabolizing systems can be divided into those dependent upon pterin cofactors, sugar phosphates and those dependent upon glutathione. The more prevalent thiol-dependent formaldehyde detoxification system is found in many bacterial pathogens, almost all of which do not metabolize methane or methanol. This review describes the endogenous and exogenous sources of formaldehyde, its toxic effects and mechanisms of detoxification. The methods of formaldehyde sensing are also described with a focus on the formaldehyde responsive transcription factors HxlR, FrmR and NmlR. Finally, the physiological relevance of detoxification systems for formaldehyde in bacterial pathogens is discussed.

  16. [Spontaneous bacterial peritonitis].

    Science.gov (United States)

    Strauss, Edna; Caly, Wanda Regina

    2003-01-01

    Spontaneous bacterial peritonitis occurs in 30% of patients with ascites due to cirrhosis leading to high morbidity and mortality rates. The pathogenesis of spontaneous bacterial peritonitis is related to altered host defenses observed in end-stage liver disease, overgrowth of microorganisms, and bacterial translocation from the intestinal lumen to mesenteric lymph nodes. Clinical manifestations vary from severe to slight or absent, demanding analysis of the ascitic fluid. The diagnosis is confirmed by a number of neutrophils over 250/mm3 associated or not to bacterial growth in culture of an ascites sample. Enterobacteriae prevail and Escherichia coli has been the most frequent bacterium reported. Mortality rates decreased markedly in the last two decades due to early diagnosis and prompt antibiotic treatment. Third generation intravenous cephalosporins are effective in 70% to 95% of the cases. Recurrence of spontaneous bacterial peritonitis is common and can be prevented by the continuous use of oral norfloxacin. The development of bacterial resistance demands the search for new options in the prophylaxis of spontaneous bacterial peritonitis; probiotics are a promising new approach, but deserve further evaluation. Short-term antibiotic prophylaxis is recommended for patients with cirrhosis and ascites shortly after an acute episode of gastrointestinal bleeding.

  17. The chemical structure of DNA sequence signals for RNA transcription

    Science.gov (United States)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  18. Interfering with bacterial gossip

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Tolker-Nielsen, Tim; Givskov, Michael

    2011-01-01

    defense. Antibiotics exhibit a rather limited effect on biofilms. Furthermore, antibiotics have an ‘inherent obsolescence’ because they select for development of resistance. Bacterial infections with origin in bacterial biofilms have become a serious threat in developed countries. Pseudomonas aeruginosa...... that appropriately target bacteria in their relevant habitat with the aim of mitigating their destructive impact on patients. In this review we describe molecular mechanisms involved in “bacterial gossip” (more scientifically referred to as quorum sensing (QS) and c-di-GMP signaling), virulence, biofilm formation......, resistance and QS inhibition as future antimicrobial targets, in particular those that would work to minimize selection pressures for the development of resistant bacteria....

  19. Possible roles of σ-dependent RNA polymerase pausing in transcription regulation.

    Science.gov (United States)

    Petushkov, Ivan; Esyunina, Daria; Kulbachinskiy, Andrey

    2017-12-02

    The σ subunit of bacterial RNA polymerase is required for promoter recognition during transcription initiation but may also regulate transcription elongation. The principal σ 70 subunit of Escherichia coli was shown to travel with RNA polymerase and induce transcriptional pausing at promoter-like motifs, with potential regulatory output. We recently demonstrated that an alternative σ 38 subunit can also induce RNA polymerase pausing. Here, we outline proposed regulatory roles of σ-dependent pausing in bacteria and discuss possible interplay between alternative σ variants and regulatory factors during transcription elongation.

  20. Bacterial surface adaptation

    Science.gov (United States)

    Utada, Andrew

    2014-03-01

    Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.

  1. Bacterial Meningitis in Infants

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2004-04-01

    Full Text Available A retrospective study of 80 infantile patients (ages 30-365 days; 47 male, 33 female with culture-proven bacterial meningitis seen over a 16 year period (1986-2001 is reported from Taiwan.

  2. Factitious Bacterial Meningitis Revisited

    Science.gov (United States)

    Peterson, E.; Thrupp, L.; Uchiyama, N.; Hawkins, B.; Wolvin, B.; Greene, G.

    1982-01-01

    Nonviable gram-negative bacilli were seen in smears of cerebrospinal fluid from eight infants in whom bacterial meningitis was ruled out. Tubes from commercial kits were the source of the factitious organisms. PMID:7153328

  3. Vimentin in Bacterial Infections

    DEFF Research Database (Denmark)

    Mak, Tim N; Brüggemann, Holger

    2016-01-01

    filaments (IFs). IFs have not only roles in maintaining the structural integrity of the cell, but they are also involved in many cellular processes including cell adhesion, immune signaling, and autophagy, processes that are important in the context of bacterial infections. Here, we summarize the knowledge...... about the role of IFs in bacterial infections, focusing on the type III IF protein vimentin. Recent studies have revealed the involvement of vimentin in host cell defenses, acting as ligand for several pattern recognition receptors of the innate immune system. Two main aspects of bacteria......-vimentin interactions are presented in this review: the role of vimentin in pathogen-binding on the cell surface and subsequent bacterial invasion and the interaction of cytosolic vimentin and intracellular pathogens with regards to innate immune signaling. Mechanistic insight is presented involving distinct bacterial...

  4. DNA Topoisomerases in Transcription

    DEFF Research Database (Denmark)

    Rødgaard, Morten Terpager

    2015-01-01

    This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most of the ex......This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most...... topoisomerase-DNA cleavage complex. The second study is an investigation of how topoisomerases influence gene regulation by keeping the genome in an optimal topological state....

  5. [Diagnosis of bacterial vaginosis].

    Science.gov (United States)

    Djukić, Slobodanka; Ćirković, Ivana; Arsić, Biljana; Garalejić, Eliana

    2013-01-01

    Bacterial vaginosis is a common, complex clinical syndrome characterized by alterations in the normal vaginal flora. When symptomatic, it is associated with a malodorous vaginal discharge and on occasion vaginal burning or itching. Under normal conditions, lactobacilli constitute 95% of the bacteria in the vagina. Bacterial vaginosis is associated with severe reduction or absence of the normal H2O2-producing lactobacilli and overgrowth of anaerobic bacteria and Gardnerella vaginalis, Atopobium vaginae, Mycoplasma hominis and Mobiluncus species. Most types of infectious disease are diagnosed by culture, by isolating an antigen or RNA/DNA from the microbe, or by serodiagnosis to determine the presence of antibodies to the microbe. Therefore, demonstration of the presence of an infectious agent is often a necessary criterion for the diagnosis of the disease. This is not the case for bacterial vaginosis, since the ultimate cause of the disease is not yet known. There are a variety of methods for the diagnosis of bacterial vaginosis but no method can at present be regarded as the best. Diagnosing bacterial vaginosis has long been based on the clinical criteria of Amsel, whereby three of four defined criteria must be satisfied. Nugent's scoring system has been further developed and includes validation of the categories of observable bacteria structures. Up-to-date molecular tests are introduced, and better understanding of vaginal microbiome, a clear definition for bacterial vaginosis, and short-term and long-term fluctuations in vaginal microflora will help to better define molecular tests within the broader clinical context.

  6. Eukaryotic transcription factors

    DEFF Research Database (Denmark)

    Staby, Lasse; O'Shea, Charlotte; Willemoës, Martin

    2017-01-01

    Gene-specific transcription factors (TFs) are key regulatory components of signaling pathways, controlling, for example, cell growth, development, and stress responses. Their biological functions are determined by their molecular structures, as exemplified by their structured DNA-binding domains...... them to participate in large interactomes, how they use only a few hydrophobic residues, short sequence motifs, prestructured motifs, and coupled folding and binding for their interactions with co-activators, and how their accessibility to post-translational modification affects their interactions...

  7. Spanish dialects: phonetic transcription

    OpenAIRE

    Moreno Bilbao, M. Asunción; Mariño Acebal, José Bernardo

    1998-01-01

    It is well known that canonical Spanish, the dialectal variant `central' of Spain, so called Castilian, can be transcribed by rules. This paper deals with the automatic grapheme to phoneme transcription rules in several Spanish dialects from Latin America. Spanish is a language spoken by more than 300 million people, has an important geographical dispersion compared among other languages and has been historically influenced by many native languages. In this paper authors expand the Castilian ...

  8. Transcription, Processing, and Function of CRISPR Cassettes in Escherichia coli

    OpenAIRE

    Pougach, Ksenia; Semenova, Ekaterina; Bogdanova, Ekaterina; Datsenko, Kirill A.; Djordjevic, Marko; Wanner, Barry L.; Severinov, Konstantin

    2010-01-01

    CRISPR/Cas, bacterial and archaeal systems of interference with foreign genetic elements such as viruses or plasmids, consist of DNA loci called CRISPR cassettes (a set of variable spacers regularly separated by palindromic repeats) and associated cas genes. When a CRISPR spacer sequence exactly matches a sequence in a viral genome, the cell can become resistant to the virus. The CRISPR/Cas systems function through small RNAs originating from longer CRISPR cassette transcripts. While laborato...

  9. Community structure of the metabolically active rumen bacterial and archaeal communities of dairy cows over the transition period

    DEFF Research Database (Denmark)

    Zhu, Zhigang; Noel, Samantha Joan; Difford, Gareth Frank

    2017-01-01

    was extracted from the rumen samples and cDNA thereof was subsequently used for characterizing the metabolically active bacterial (16S rRNA transcript amplicon sequencing) and archaeal (qPCR, T-RFLP and mcrA and 16S rRNA transcript amplicon sequencing) communities. The metabolically active bacterial community......% of the total reads, dominated by the genera Methanobrevibacter (75%) and Methanosphaera (24%), whereas the Methanomassiliicoccales order covered only 0.2% of the total reads. In conclusion, the present study showed that the structure of the metabolically active bacterial and archaeal rumen communities changed...... prepartum to postpartum decrease (from 15% to 2%) was observed in relative abundance of Methanomassiliicoccales 16S rRNA transcripts. In contrast to qPCR analysis of the 16S rRNA transcripts, quantification of mcrA transcripts revealed no change in total abundance of metabolically active methanogens over...

  10. Collective decisions among bacterial viruses

    Science.gov (United States)

    Joh, Richard; Mileyko, Yuriy; Voit, Eberhard; Weitz, Joshua

    2010-03-01

    For many temperate bacteriophages, the decision of whether to kill hosts or enter a latent state depends on the multiplicity of infection. In this talk, I present a quantitative model of gene regulatory dynamics to describe how phages make collective decisions within host cells. Unlike most previous studies, the copy number of viral genomes is treated as a variable. In the absence of feedback loops, viral mRNA transcription is expected to be proportional to the viral copy number. However, when there are nonlinear feedback loops in viral gene regulation, our model shows that gene expression patterns are sensitive to changes in viral copy number and there can be a domain of copy number where the system becomes bistable. Hence, the viral copy number is a key control parameter determining host cell fates. This suggests that bacterial viruses can respond adaptively to changes in population dynamics, and can make alternative decisions as a bet-hedging strategy. Finally, I present a stochastic version of viral gene regulation and discuss speed-accuracy trade-offs in the context of cell fate determination by viruses.

  11. Bacterial Cell Mechanics.

    Science.gov (United States)

    Auer, George K; Weibel, Douglas B

    2017-07-25

    Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.

  12. Post-transcriptional regulation of gene expression in Yersinia species

    Directory of Open Access Journals (Sweden)

    Chelsea A Schiano

    2012-11-01

    Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

  13. Transcription of the soybean leghemoglobin genes during nodule development

    DEFF Research Database (Denmark)

    Marcker, Anne; Lund, Marianne; Jensen, Erik Ø

    1984-01-01

    During the early stages of soybean nodule development the leghemoglobin (Lb) genes are activated sequentially in the opposite order to which they are arranged in the soybean genome. At a specific stage after the initial activation of all the Lb genes, a large increment occurs in the transcription...... of the Lb(c1), Lb(c3) and Lb(a) genes while the transcription of the Lb(c2) gene is not amplified to a similar extent. All the Lb genes retain significant activity for a long period during the lifetime of a nodule. Consequently the soybean Lb genes are not regulated by a developmental gene switching...... mechanism as is the case for vertebrate globin genes. Concomitantly with the increase in Lb gene transcription some of the other nodule specific plant genes are activated. These specific changes in the activities of the Lb and nodulin genes precede the activation of the bacterial nitrogenase gene. Thus...

  14. Bacterial meningitis in children

    International Nuclear Information System (INIS)

    Marji, S.

    2007-01-01

    To demonstrate the epidemiology, clinical manifestations and bacteriological profile of bacterial meningitis in children beyond the neonatal period in our hospital. This was a retrospective descriptive study conducted at Prince Rashid Hospital in Irbid, Jordan. The medical records of 50 children with the diagnosis of bacterial meningitis during 4 years period, were reviewed. The main cause of infection was streptococcus pneumoniae, followed by Haemophilus influenza and Niesseria meningitides. Mortality was higher in infants and meningococcal infection, while complications were more encountered in cases of streptococcus pneumoniae. Cerebrospinal fluid culture was positive in 11 cases and Latex agglutination test in 39. There is a significant reduction of the numbers of bacterial meningitis caused by Haemophilus influenza type B species. (author)

  15. Interfering with bacterial gossip

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Tolker-Nielsen, Tim; Givskov, Michael

    2011-01-01

    Biofilm resilience poses major challenges to the development of novel antimicrobial agents. Biofilm bacteria can be considered small groups of “Special Forces” capable of infiltrating the host and destroying important components of the cellular defense system with the aim of crippling the host...... defense. Antibiotics exhibit a rather limited effect on biofilms. Furthermore, antibiotics have an ‘inherent obsolescence’ because they select for development of resistance. Bacterial infections with origin in bacterial biofilms have become a serious threat in developed countries. Pseudomonas aeruginosa...... that appropriately target bacteria in their relevant habitat with the aim of mitigating their destructive impact on patients. In this review we describe molecular mechanisms involved in “bacterial gossip” (more scientifically referred to as quorum sensing (QS) and c-di-GMP signaling), virulence, biofilm formation...

  16. Diagnosis of bacterial vaginosis

    Directory of Open Access Journals (Sweden)

    Đukić Slobodanka

    2013-01-01

    Full Text Available Bacterial vaginosis is a common, complex clinical syndrome characterized by alterations in the normal vaginal flora. When symptomatic, it is associated with a malodorous vaginal discharge and on occasion vaginal burning or itching. Under normal conditions, lactobacilli constitute 95% of the bacteria in the vagina. Bacterial vaginosis is associated with severe reduction or absence of the normal H2O2­producing lactobacilli and overgrowth of anaerobic bacteria and Gardnerella vaginalis, Atopobium vaginae, Mycoplasma hominis and Mobiluncus species. Most types of infectious disease are diagnosed by culture, by isolating an antigen or RNA/DNA from the microbe, or by serodiagnosis to determine the presence of antibodies to the microbe. Therefore, demonstration of the presence of an infectious agent is often a necessary criterion for the diagnosis of the disease. This is not the case for bacterial vaginosis, since the ultimate cause of the disease is not yet known. There are a variety of methods for the diagnosis of bacterial vaginosis but no method can at present be regarded as the best. Diagnosing bacterial vaginosis has long been based on the clinical criteria of Amsel, whereby three of four defined criteria must be satisfied. Nugent’s scoring system has been further developed and includes validation of the categories of observable bacteria structures. Up­to­date molecular tests are introduced, and better understanding of vaginal microbiome, a clear definition for bacterial vaginosis, and short­term and long­term fluctuations in vaginal microflora will help to better define molecular tests within the broader clinical context.

  17. Adult bacterial meningitis

    DEFF Research Database (Denmark)

    Meyer, C N; Samuelsson, I S; Galle, M

    2004-01-01

    Episodes of adult bacterial meningitis (ABM) at a Danish hospital in 1991-2000 were identified from the databases of the Department of Clinical Microbiology, and compared with data from the Danish National Patient Register and the Danish National Notification System. Reduced penicillin susceptibi......Episodes of adult bacterial meningitis (ABM) at a Danish hospital in 1991-2000 were identified from the databases of the Department of Clinical Microbiology, and compared with data from the Danish National Patient Register and the Danish National Notification System. Reduced penicillin...

  18. Bacterial blight of cotton

    Directory of Open Access Journals (Sweden)

    Aïda JALLOUL

    2015-04-01

    Full Text Available Bacterial blight of cotton (Gossypium ssp., caused by Xanthomonas citri pathovar malvacearum, is a severe disease occurring in all cotton-growing areas. The interactions between host plants and the bacteria are based on the gene-for-gene concept, representing a complex resistance gene/avr gene system. In light of the recent data, this review focuses on the understanding of these interactions with emphasis on (1 the genetic basis for plant resistance and bacterial virulence, (2 physiological mechanisms involved in the hypersensitive response to the pathogen, including hormonal signaling, the oxylipin pathway, synthesis of antimicrobial molecules and alteration of host cell structures, and (3 control of the disease.

  19. Bacterial meningitis in infants.

    Science.gov (United States)

    Ku, Lawrence C; Boggess, Kim A; Cohen-Wolkowiez, Michael

    2015-03-01

    Neonatal bacterial meningitis is uncommon but devastating. Morbidity among survivors remains high. The types and distribution of pathogens are related to gestational age, postnatal age, and geographic region. Confirming the diagnosis is difficult. Clinical signs are often subtle, lumbar punctures are frequently deferred, and cerebrospinal fluid (CSF) cultures can be compromised by prior antibiotic exposure. Infants with bacterial meningitis can have negative blood cultures and normal CSF parameters. Promising tests such as the polymerase chain reaction require further study. Prompt treatment with antibiotics is essential. Clinical trials investigating a vaccine for preventing neonatal Group B Streptococcus infections are ongoing. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Transcription profile of Escherichia coli: genomic SELEX search for regulatory targets of transcription factors

    Science.gov (United States)

    Ishihama, Akira; Shimada, Tomohiro; Yamazaki, Yukiko

    2016-01-01

    Bacterial genomes are transcribed by DNA-dependent RNA polymerase (RNAP), which achieves gene selectivity through interaction with sigma factors that recognize promoters, and transcription factors (TFs) that control the activity and specificity of RNAP holoenzyme. To understand the molecular mechanisms of transcriptional regulation, the identification of regulatory targets is needed for all these factors. We then performed genomic SELEX screenings of targets under the control of each sigma factor and each TF. Here we describe the assembly of 156 SELEX patterns of a total of 116 TFs performed in the presence and absence of effector ligands. The results reveal several novel concepts: (i) each TF regulates more targets than hitherto recognized; (ii) each promoter is regulated by more TFs than hitherto recognized; and (iii) the binding sites of some TFs are located within operons and even inside open reading frames. The binding sites of a set of global regulators, including cAMP receptor protein, LeuO and Lrp, overlap with those of the silencer H-NS, suggesting that certain global regulators play an anti-silencing role. To facilitate sharing of these accumulated SELEX datasets with the research community, we compiled a database, ‘Transcription Profile of Escherichia coli’ (www.shigen.nig.ac.jp/ecoli/tec/). PMID:26843427

  1. Transcription profile of Escherichia coli: genomic SELEX search for regulatory targets of transcription factors.

    Science.gov (United States)

    Ishihama, Akira; Shimada, Tomohiro; Yamazaki, Yukiko

    2016-03-18

    Bacterial genomes are transcribed by DNA-dependent RNA polymerase (RNAP), which achieves gene selectivity through interaction with sigma factors that recognize promoters, and transcription factors (TFs) that control the activity and specificity of RNAP holoenzyme. To understand the molecular mechanisms of transcriptional regulation, the identification of regulatory targets is needed for all these factors. We then performed genomic SELEX screenings of targets under the control of each sigma factor and each TF. Here we describe the assembly of 156 SELEX patterns of a total of 116 TFs performed in the presence and absence of effector ligands. The results reveal several novel concepts: (i) each TF regulates more targets than hitherto recognized; (ii) each promoter is regulated by more TFs than hitherto recognized; and (iii) the binding sites of some TFs are located within operons and even inside open reading frames. The binding sites of a set of global regulators, including cAMP receptor protein, LeuO and Lrp, overlap with those of the silencer H-NS, suggesting that certain global regulators play an anti-silencing role. To facilitate sharing of these accumulated SELEX datasets with the research community, we compiled a database, 'Transcription Profile of Escherichia coli' (www.shigen.nig.ac.jp/ecoli/tec/). © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. The Bacterial Growth Curve.

    Science.gov (United States)

    Paulton, Richard J. L.

    1991-01-01

    A procedure that allows students to view an entire bacterial growth curve during a two- to three-hour student laboratory period is described. Observations of the lag phase, logarithmic phase, maximum stationary phase, and phase of decline are possible. A nonpathogenic, marine bacterium is used in the investigation. (KR)

  3. Bacterial fingerprints across Europe

    NARCIS (Netherlands)

    Glasner, Corinna

    2014-01-01

    Bacterial pathogens, such as Staphylococcus aureus and carbapenemase-producing Enterobacteriaceae (CPE), impose major threats to human health worldwide. Both have a ‘Jekyll & Hyde’ character, since they can be present as human commensals, but can also become harmful invasive pathogens especially

  4. [Bacterial biofilms and infection].

    Science.gov (United States)

    Lasa, I; Del Pozo, J L; Penadés, J R; Leiva, J

    2005-01-01

    In developed countries we tend to think of heart disease and the numerous forms of cancer as the main causes of mortality, but on a global scale infectious diseases come close, or may even be ahead: 14.9 million deaths in 2002 compared to cardiovascular diseases (16.9 million deaths) and cancer (7.1 million deaths) (WHO report 2004). The infectious agents responsible for human mortality have evolved as medical techniques and hygienic measures have changed. Modern-day acute infectious diseases caused by specialized bacterial pathogens such as diphtheria, tetanus, cholera, plague, which represented the main causes of death at the beginning of XX century, have been effectively controlled with antibiotics and vaccines. In their place, more than half of the infectious diseases that affect mildly immunocompromised patients involve bacterial species that are commensal with the human body; these can produce chronic infections, are resistant to antimicrobial agents and there is no effective vaccine against them. Examples of these infections are the otitis media, native valve endocarditis, chronic urinary infections, bacterial prostatitis, osteomyelitis and all the infections related to medical devices. Direct analysis of the surface of medical devices or of tissues that have been foci of chronic infections shows the presence of large numbers of bacteria surrounded by an exopolysaccharide matrix, which has been named the "biofilm". Inside the biofilm, bacteria grow protected from the action of the antibodies, phagocytic cells and antimicrobial treatments. In this article, we describe the role of bacterial biofilms in human persistent infections.

  5. EDITORIAL SPONTANEOUS BACTERIAL PERITONITIS ...

    African Journals Online (AJOL)

    hi-tech

    Spontaneous bacterial peritonitis (SBP) frequent]y occurs in patients with liver cirrhosis and ascites. It is defined as an infection of previously sterile ascitic fluid without any demonstrable intrabdominal source of infection. It is now internationally agreed that a polymorphonuclear (PMN) cell count in the ascitic fluid of over 250 ...

  6. Bacterial membrane proteomics.

    Science.gov (United States)

    Poetsch, Ansgar; Wolters, Dirk

    2008-10-01

    About one quarter to one third of all bacterial genes encode proteins of the inner or outer bacterial membrane. These proteins perform essential physiological functions, such as the import or export of metabolites, the homeostasis of metal ions, the extrusion of toxic substances or antibiotics, and the generation or conversion of energy. The last years have witnessed completion of a plethora of whole-genome sequences of bacteria important for biotechnology or medicine, which is the foundation for proteome and other functional genome analyses. In this review, we discuss the challenges in membrane proteome analysis, starting from sample preparation and leading to MS-data analysis and quantification. The current state of available proteomics technologies as well as their advantages and disadvantages will be described with a focus on shotgun proteomics. Then, we will briefly introduce the most abundant proteins and protein families present in bacterial membranes before bacterial membrane proteomics studies of the last years will be presented. It will be shown how these works enlarged our knowledge about the physiological adaptations that take place in bacteria during fine chemical production, bioremediation, protein overexpression, and during infections. Furthermore, several examples from literature demonstrate the suitability of membrane proteomics for the identification of antigens and different pathogenic strains, as well as the elucidation of membrane protein structure and function.

  7. Seizures Complicating Bacterial Meningitis

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2004-09-01

    Full Text Available The clinical data of 116 patients, 1 month to <5 years of age, admitted for bacterial meningitis, and grouped according to those with and without seizures during hospitalization, were compared in a study at Buddhist Dalin Tzu Chi General Hospital, Chang Gung Memorial Hospital and other centers in Taiwan.

  8. Diagnosis of bacterial infection

    African Journals Online (AJOL)

    rapid and easy-to-use test for bacterial infections. Clearly, this is a very ... detect antigens or specific antibodies, e.g. group A streptococcal antigen testing can be employed to reduce antibiotic use. Culture-based tests are often ... White blood cell count 12 000 cells/mm³; or the presence of >10% ...

  9. Bacterial Meningitis Outcome

    OpenAIRE

    J Gordon Millichap

    1995-01-01

    The neurologic, psychological, and educational outcomes of bacterial meningitis in 130 children evaluated at a mean age of 8 years, and 6 years after their meningitis, are reported from the Department of Paediatrics and Clinical Epidemiology and Biostatistics Unit, University of Melbourne, and the Royal Children’s Hospital, Victoria, Australia.

  10. Corticosteroids for Bacterial Keratitis

    Science.gov (United States)

    Srinivasan, Muthiah; Mascarenhas, Jeena; Rajaraman, Revathi; Ravindran, Meenakshi; Lalitha, Prajna; Glidden, David V.; Ray, Kathryn J.; Hong, Kevin C.; Oldenburg, Catherine E.; Lee, Salena M.; Zegans, Michael E.; McLeod, Stephen D.; Lietman, Thomas M.; Acharya, Nisha R.

    2013-01-01

    Objective To determine whether there is a benefit in clinical outcomes with the use of topical corticosteroids as adjunctive therapy in the treatment of bacterial corneal ulcers. Methods Randomized, placebo-controlled, double-masked, multicenter clinical trial comparing prednisolone sodium phosphate, 1.0%, to placebo as adjunctive therapy for the treatment of bacterial corneal ulcers. Eligible patients had a culture-positive bacterial corneal ulcer and received topical moxifloxacin for at least 48 hours before randomization. Main Outcome Measures The primary outcome was best spectacle-corrected visual acuity (BSCVA) at 3 months from enrollment. Secondary outcomes included infiltrate/scar size, reepithelialization, and corneal perforation. Results Between September 1, 2006, and February 22, 2010, 1769 patients were screened for the trial and 500 patients were enrolled. No significant difference was observed in the 3-month BSCVA (−0.009 logarithm of the minimum angle of resolution [logMAR]; 95% CI, −0.085 to 0.068; P = .82), infiltrate/scar size (P = .40), time to reepithelialization (P = .44), or corneal perforation (P > .99). A significant effect of corticosteroids was observed in subgroups of baseline BSCVA (P = .03) and ulcer location (P = .04). At 3 months, patients with vision of counting fingers or worse at baseline had 0.17 logMAR better visual acuity with corticosteroids (95% CI, −0.31 to −0.02; P = .03) compared with placebo, and patients with ulcers that were completely central at baseline had 0.20 logMAR better visual acuity with corticosteroids (−0.37 to −0.04; P = .02). Conclusions We found no overall difference in 3-month BSCVA and no safety concerns with adjunctive corticosteroid therapy for bacterial corneal ulcers. Application to Clinical Practice Adjunctive topical corticosteroid use does not improve 3-month vision in patients with bacterial corneal ulcers. PMID:21987582

  11. Transcriptional Regulation in Haematopoiesis:

    DEFF Research Database (Denmark)

    Lauridsen, Felicia K B

    Haematopoietic stem cells (HSCs) are responsible for the formation of all of the distinct mature cell types found in the blood. HSCs can – as the only cells of the haematopoietic system – regenerate all of the blood cells when transplanted into a irradiated host, because they are endowed...... of distinct lineage affiliated genes in the otherwise highly purified HSCs. Taken together, these studies demonstrate the use of our model as a tool for isolating superior HSCs, and show that low-level expression of mature lineage markers is inherent in the highly purified stem cell compartment. In the second...... in transplantation studies. Consistent with this, transcriptome profiling revealed very low expression of cell cycle genes in these reporter-dim HSCs. Sequencing of >1200 single HSCs confirmed that the main source of transcriptional heterogeneity was the cell cycle. It also revealed a low-level expression...

  12. Rickettsia conorii transcriptional response within inoculation eschar.

    Directory of Open Access Journals (Sweden)

    Patricia Renesto

    Full Text Available BACKGROUND: Rickettsia conorii, the causative agent of the Mediterranean spotted fever, is transmitted to humans by the bite of infected ticks Rhipicephalus sanguineus. The skin thus constitutes an important barrier for the entry and propagation of R. conorii. Given this, analysis of the survival strategies used by the bacterium within infected skin is critical for our understanding of rickettsiosis. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report the first genome-wide analysis of R. conorii gene expression from infected human skin biopsies. Our data showed that R. conorii exhibited a striking transcript signature that is remarkably conserved across patients, regardless of genotype. The expression profiles obtained using custom Agilent microarrays were validated by quantitative RT-PCR. Within eschars, the amount of detected R. conorii transcripts was of 55%, this value being of 74% for bacteria grown in Vero cells. In such infected host tissues, approximately 15% (n = 211 of the total predicted R. conorii ORFs appeared differentially expressed compared to bacteria grown in standard laboratory conditions. These genes are mostly down-regulated and encode proteins essential for bacterial replication. Some of the strategies displayed by rickettsiae to overcome the host defense barriers, thus avoiding killing, were also pointed out. The observed up-regulation of rickettsial genes associated with DNA repair is likely to correspond to a DNA-damaging agent enriched environment generated by the host cells to eradicate the pathogens. Survival of R. conorii within eschars also involves adaptation to osmotic stress, changes in cell surface proteins and up-regulation of some virulence factors. Interestingly, in contrast to down-regulated transcripts, we noticed that up-regulated ones rather exhibit a small nucleotide size, most of them being exclusive for the spotted fever group rickettsiae. CONCLUSION/SIGNIFICANCE: Because eschar is a site for rickettsial

  13. Euglena Transcript Processing.

    Science.gov (United States)

    McWatters, David C; Russell, Anthony G

    2017-01-01

    RNA transcript processing is an important stage in the gene expression pathway of all organisms and is subject to various mechanisms of control that influence the final levels of gene products. RNA processing involves events such as nuclease-mediated cleavage, removal of intervening sequences referred to as introns and modifications to RNA structure (nucleoside modification and editing). In Euglena, RNA transcript processing was initially examined in chloroplasts because of historical interest in the secondary endosymbiotic origin of this organelle in this organism. More recent efforts to examine mitochondrial genome structure and RNA maturation have been stimulated by the discovery of unusual processing pathways in other Euglenozoans such as kinetoplastids and diplonemids. Eukaryotes containing large genomes are now known to typically contain large collections of introns and regulatory RNAs involved in RNA processing events, and Euglena gracilis in particular has a relatively large genome for a protist. Studies examining the structure of nuclear genes and the mechanisms involved in nuclear RNA processing have revealed that indeed Euglena contains large numbers of introns in the limited set of genes so far examined and also possesses large numbers of specific classes of regulatory and processing RNAs, such as small nucleolar RNAs (snoRNAs). Most interestingly, these studies have also revealed that Euglena possesses novel processing pathways generating highly fragmented cytosolic ribosomal RNAs and subunits and non-conventional intron classes removed by unknown splicing mechanisms. This unexpected diversity in RNA processing pathways emphasizes the importance of identifying the components involved in these processing mechanisms and their evolutionary emergence in Euglena species.

  14. Initiation of HIV Reverse Transcription

    Directory of Open Access Journals (Sweden)

    Roland Marquet

    2010-01-01

    Full Text Available Reverse transcription of retroviral genomes into double stranded DNA is a key event for viral replication. The very first stage of HIV reverse transcription, the initiation step, involves viral and cellular partners that are selectively packaged into the viral particle, leading to an RNA/protein complex with very specific structural and functional features, some of which being, in the case of HIV-1, linked to particular isolates. Recent understanding of the tight spatio-temporal regulation of reverse transcription and its importance for viral infectivity further points toward reverse transcription and potentially its initiation step as an important drug target.

  15. Insulated transcriptional elements enable precise design of genetic circuits.

    Science.gov (United States)

    Zong, Yeqing; Zhang, Haoqian M; Lyu, Cheng; Ji, Xiangyu; Hou, Junran; Guo, Xian; Ouyang, Qi; Lou, Chunbo

    2017-07-03

    Rational engineering of biological systems is often complicated by the complex but unwanted interactions between cellular components at multiple levels. Here we address this issue at the level of prokaryotic transcription by insulating minimal promoters and operators to prevent their interaction and enable the biophysical modeling of synthetic transcription without free parameters. This approach allows genetic circuit design with extraordinary precision and diversity, and consequently simplifies the design-build-test-learn cycle of circuit engineering to a mix-and-match workflow. As a demonstration, combinatorial promoters encoding NOT-gate functions were designed from scratch with mean errors of 96% using our insulated transcription elements. Furthermore, four-node transcriptional networks with incoherent feed-forward loops that execute stripe-forming functions were obtained without any trial-and-error work. This insulation-based engineering strategy improves the resolution of genetic circuit technology and provides a simple approach for designing genetic circuits for systems and synthetic biology.Unwanted interactions between cellular components can complicate rational engineering of biological systems. Here the authors design insulated minimal promoters and operators that enable biophysical modeling of bacterial transcription without free parameters for precise circuit design.

  16. Modeling the integration of bacterial rRNA fragments into the human cancer genome.

    Science.gov (United States)

    Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C

    2016-03-21

    Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.

  17. Radiometric detection of bacterial metabolism

    International Nuclear Information System (INIS)

    Camargo, E.E.; Wagner Junior, H.N.

    1979-01-01

    The measurement of 14 CO 2 produced by the bacterial oxidation of labelled compounds is discussed as a means of evaluating the bacterial metabolism. The following items are discussed:automated radiometric detection, types of graphs, clinical applications of the radiometric system and influential factors. Complementary studies on bacterial assimilation of substances are presented. (M.A.) [pt

  18. Bacterial Cell Wall Components

    Science.gov (United States)

    Ginsberg, Cynthia; Brown, Stephanie; Walker, Suzanne

    Bacterial cell-surface polysaccharides cells are surrounded by a variety of cell-surface structures that allow them to thrive in extreme environments. Components of the cell envelope and extracellular matrix are responsible for providing the cells with structural support, mediating intercellular communication, allowing the cells to move or to adhere to surfaces, protecting the cells from attack by antibiotics or the immune system, and facilitating the uptake of nutrients. Some of the most important cell wall components are polysaccharide structures. This review discusses the occurrence, structure, function, and biosynthesis of the most prevalent bacterial cell surface polysaccharides: peptidoglycan, lipopolysaccharide, arabinogalactan, and lipoarabinomannan, and capsular and extracellular polysaccharides. The roles of these polysaccharides in medicine, both as drug targets and as therapeutic agents, are also described.

  19. Bacterial meningitis in Nottingham.

    OpenAIRE

    Ispahani, P.

    1983-01-01

    Records of 171 cases of bacterial meningitis admitted to Nottingham hospitals from January 1974 to June 1980 were reviewed. The distribution of organisms producing meningitis and the factors influencing mortality in different age groups were assessed. Neisseria meningitidis, Haemophilus influenzae and Streptococcus pneumoniae accounted for 69% of all proven cases. The overall mortality was 26% being lowest in patients with meningococcal meningitis (0%) and highest in those with pneumococcal m...

  20. Neglected bacterial zoonoses.

    Science.gov (United States)

    Chikeka, I; Dumler, J S

    2015-05-01

    Bacterial zoonoses comprise a group of diseases in humans or animals acquired by direct contact with or by oral consumption of contaminated animal materials, or via arthropod vectors. Among neglected infections, bacterial zoonoses are among the most neglected given emerging data on incidence and prevalence as causes of acute febrile illness, even in areas where recognized neglected tropical diseases occur frequently. Although many other bacterial infections could also be considered in this neglected category, five distinct infections stand out because they are globally distributed, are acute febrile diseases, have high rates of morbidity and case fatality, and are reported as commonly as malaria, typhoid or dengue virus infections in carefully designed studies in which broad-spectrum diagnoses are actively sought. This review will focus attention on leptospirosis, relapsing fever borreliosis and rickettsioses, including scrub typhus, murine typhus and spotted fever group rickettsiosis. Of greatest interest is the lack of distinguishing clinical features among these infections when in humans, which confounds diagnosis where laboratory confirmation is lacking, and in regions where clinical diagnosis is often attributed to one of several perceived more common threats. As diseases such as malaria come under improved control, the real impact of these common and under-recognized infections will become evident, as will the requirement for the strategies and allocation of resources for their control. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  1. Bacterial growth kinetics

    International Nuclear Information System (INIS)

    Boonkitticharoen, V.; Ehrhardt, J.C.; Kirchner, P.T.

    1989-01-01

    Quantitative measurement of bacterial growth may be made using a radioassay technique. This method measures, by scintillation counting, the 14 CO 2 derived from the bacterial metabolism of a 14 C-labeled substrate. Mathematical growth models may serve as reliable tools for estimation of the generation rate constant (or slope of the growth curve) and provide a basis for evaluating assay performance. Two models, i.e., exponential and logistic, are proposed. Both models yielded an accurate fit to the data from radioactive measurement of bacterial growth. The exponential model yielded high precision values of the generation rate constant, with an average relative standard deviation of 1.2%. Under most conditions the assay demonstrated no changes in the slopes of growth curves when the number of bacteria per inoculation was changed. However, the radiometric assay by scintillation method had a growth-inhibiting effect on a few strains of bacteria. The source of this problem was thought to be hypersensitivity to trace amounts of toluene remaining on the detector

  2. Mitotic bookmarking by transcription factors.

    Science.gov (United States)

    Kadauke, Stephan; Blobel, Gerd A

    2013-04-02

    Mitosis is accompanied by dramatic changes in chromatin organization and nuclear architecture. Transcription halts globally and most sequence-specific transcription factors and co-factors are ejected from mitotic chromatin. How then does the cell maintain its transcriptional identity throughout the cell division cycle? It has become clear that not all traces of active transcription and gene repression are erased within mitotic chromatin. Many histone modifications are stable or only partially diminished throughout mitosis. In addition, some sequence-specific DNA binding factors have emerged that remain bound to select sites within mitotic chromatin, raising the possibility that they function to transmit regulatory information through the transcriptionally silent mitotic phase, a concept that has been termed "mitotic bookmarking." Here we review recent approaches to studying potential bookmarking factors with regards to their mitotic partitioning, and summarize emerging ideas concerning the in vivo functions of mitotically bound nuclear factors.

  3. CprK crystal structures reveal mechanism for transcriptional control of halorespiration

    NARCIS (Netherlands)

    Joyce, M.G.; Levy, C.; Gabor, K.; Pop, S.M.; Biehl, B.D.; Doukov, T.I.; Ryter, J.M.; Mazon, H.; Smidt, H.; Heuvel, van den R.H.H.; Ragsdale, S.W.; Oost, van der J.; Leys, D.

    2006-01-01

    Halorespiration is a bacterial respiratory process in which haloorganic compounds act as terminal electron acceptors. This process is controlled at transcriptional level by CprK, a member of the ubiquitous CRP-FNR family. Here we present the crystal structures of oxidized CprK in presence of the

  4. 21 CFR 12.98 - Official transcript.

    Science.gov (United States)

    2010-04-01

    ..., participants, and counsel have 30 days from the time the transcript becomes available to propose corrections in the transcript of oral testimony. Corrections are permitted only for transcription errors. The... a verbatim stenographic transcript of oral testimony and for necessary copies of the transcript. (b...

  5. Radiology of bacterial pneumonia

    Energy Technology Data Exchange (ETDEWEB)

    Vilar, Jose E-mail: vilar_jlu@gva.es; Domingo, Maria Luisa; Soto, Cristina; Cogollos, Jonathan

    2004-08-01

    Bacterial pneumonia is commonly encountered in clinical practice. Radiology plays a prominent role in the evaluation of pneumonia. Chest radiography is the most commonly used imaging tool in pneumonias due to its availability and excellent cost benefit ratio. CT should be used in unresolved cases or when complications of pneumonia are suspected. The main applications of radiology in pneumonia are oriented to detection, characterisation and follow-up, especially regarding complications. The classical classification of pneumonias into lobar and bronchial pneumonia has been abandoned for a more clinical classification. Thus, bacterial pneumonias are typified into three main groups: Community acquired pneumonia (CAD), Aspiration pneumonia and Nosocomial pneumonia (NP).The usual pattern of CAD is that of the previously called lobar pneumonia; an air-space consolidation limited to one lobe or segment. Nevertheless, the radiographic patterns of CAD may be variable and are often related to the causative agent. Aspiration pneumonia generally involves the lower lobes with bilateral multicentric opacities. Nosocomial Pneumonia (NP) occurs in hospitalised patients. The importance of NP is related to its high mortality and, thus, the need to obtain a prompt diagnosis. The role of imaging in NP is limited but decisive. The most valuable information is when the chest radiographs are negative and rule out pneumonia. The radiographic patterns of NP are very variable, most commonly showing diffuse multifocal involvement and pleural effusion. Imaging plays also an important role in the detection and evaluation of complications of bacterial pneumonias. In many of these cases, especially in hospitalised patients, chest CT must be obtained in order to better depict these associate findings.

  6. Radiology of bacterial pneumonia

    International Nuclear Information System (INIS)

    Vilar, Jose; Domingo, Maria Luisa; Soto, Cristina; Cogollos, Jonathan

    2004-01-01

    Bacterial pneumonia is commonly encountered in clinical practice. Radiology plays a prominent role in the evaluation of pneumonia. Chest radiography is the most commonly used imaging tool in pneumonias due to its availability and excellent cost benefit ratio. CT should be used in unresolved cases or when complications of pneumonia are suspected. The main applications of radiology in pneumonia are oriented to detection, characterisation and follow-up, especially regarding complications. The classical classification of pneumonias into lobar and bronchial pneumonia has been abandoned for a more clinical classification. Thus, bacterial pneumonias are typified into three main groups: Community acquired pneumonia (CAD), Aspiration pneumonia and Nosocomial pneumonia (NP).The usual pattern of CAD is that of the previously called lobar pneumonia; an air-space consolidation limited to one lobe or segment. Nevertheless, the radiographic patterns of CAD may be variable and are often related to the causative agent. Aspiration pneumonia generally involves the lower lobes with bilateral multicentric opacities. Nosocomial Pneumonia (NP) occurs in hospitalised patients. The importance of NP is related to its high mortality and, thus, the need to obtain a prompt diagnosis. The role of imaging in NP is limited but decisive. The most valuable information is when the chest radiographs are negative and rule out pneumonia. The radiographic patterns of NP are very variable, most commonly showing diffuse multifocal involvement and pleural effusion. Imaging plays also an important role in the detection and evaluation of complications of bacterial pneumonias. In many of these cases, especially in hospitalised patients, chest CT must be obtained in order to better depict these associate findings

  7. A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

    DEFF Research Database (Denmark)

    Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather

    2018-01-01

    . Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....

  8. Bacterial Degradation of Pesticides

    DEFF Research Database (Denmark)

    Knudsen, Berith Elkær

    This PhD project was carried out as part of the Microbial Remediation of Contaminated Soil and Water Resources (MIRESOWA) project, funded by the Danish Council for Strategic Research (grant number 2104-08-0012). The environment is contaminated with various xenobiotic compounds e.g. pesticides......D student, to construct fungal-bacterial consortia in order to potentially stimulate pesticide degradation thereby increasing the chance of successful bioaugmentation. The results of the project are reported in three article manuscripts, included in this thesis. In manuscript I, the mineralization of 2...

  9. Bacterial mitotic machineries

    DEFF Research Database (Denmark)

    Gerdes, Kenn; Møller-Jensen, Jakob; Ebersbach, Gitte

    2004-01-01

    Here, we review recent progress that yields fundamental new insight into the molecular mechanisms behind plasmid and chromosome segregation in prokaryotic cells. In particular, we describe how prokaryotic actin homologs form mitotic machineries that segregate DNA before cell division. Thus, the Par......M protein of plasmid R1 forms F actin-like filaments that separate and move plasmid DNA from mid-cell to the cell poles. Evidence from three different laboratories indicate that the morphogenetic MreB protein may be involved in segregation of the bacterial chromosome....

  10. Changes in bacterial meningitis.

    OpenAIRE

    Carter, P E; Barclay, S M; Galloway, W H; Cole, G F

    1990-01-01

    In 1964, one of us (WHG) undertook a retrospective study of bacterial meningitis in childhood in the north east of Scotland during the period 1946-61. We have recently carried out a similar review of cases occurring during 1971-86, to compare the incidence, mortality, and bacteriological patterns. During the earlier period 285 cases occurred, a total incidence of 16.9/100,000 children per year. In the later period 274 children were affected, an annual incidence of 17.8/100,000. The overall mo...

  11. Herpesviral-bacterial coinfection in periapical pathosis.

    Science.gov (United States)

    Sabeti, Mohammad; Slots, Jørgen

    2004-02-01

    Two members of the herpesvirus family, human cytomegalovirus (HCMV) and Epstein-Barr virus (EBV), seem to be important putative pathogens of human periodontitis and symptomatic periapical lesions, causing pathosis either by inducing immunosuppression with a subsequent risk of aggressive bacterial infections or by infecting of periodontal cells directly. This study aimed to relate periapical occurrence of HCMV, EBV, and herpes simplex virus active infections to clinical characteristics of periapical lesions and periapical bacterial flora. Microbial samples were collected from 34 periapical lesions in conjunction with periapical surgery. Part of the periapical specimen was frozen for virologic examination, and another part was transferred to anaerobic transport medium for bacteriologic examination. RNA was isolated by means of a guanidinium isothiocyanate-acid phenol procedure, and cDNA was produced using herpesvirus-specific primers and reverse-transcription polymerase chain reaction amplification. Bacteriologic examination was performed according to established anaerobic culture methods. Of the 34 periapical lesions studied, 20 showed both HCMV and EBV, seven showed only HCMV, one showed only EBV, and six showed neither HCMV nor EBV. Herpes simplex virus was detected in two lesions. Higher occurrence of herpesvirus was detected in large versus small periapical lesions (p aggressive types of periapical pathosis in humans.

  12. Chromosomal contact permits transcription between coregulated genes

    CSIR Research Space (South Africa)

    Fanucchi, Stephanie

    2013-10-01

    Full Text Available Transcription of coregulated genes occurs in the context of long-range chromosomal contacts that form multigene complexes. Such contacts and transcription are lost in knockout studies of transcription factors and structural chromatin proteins...

  13. RNA search engines empower the bacterial intranet.

    Science.gov (United States)

    Dendooven, Tom; Luisi, Ben F

    2017-08-15

    RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. © 2017 The Author(s).

  14. Transcriptional control of megakaryocyte development.

    Science.gov (United States)

    Goldfarb, A N

    2007-10-15

    Megakaryocytes are highly specialized cells that arise from a bipotent megakaryocytic-erythroid progenitor (MEP). This developmental leap requires coordinated activation of megakaryocyte-specific genes, radical changes in cell cycle properties, and active prevention of erythroid differentiation. These programs result from upregulation of megakaryocyte-selective transcription factors, downregulation of erythroid-selective transcription factors and ongoing mediation of common erythro-megakaryocytic transcription factors. Unlike most developmental programs, no single lineage-unique family of master regulators exerts executive control over the megakaryocytic plan. Rather, an assemblage of non-unique factors and signals converge to determine lineage and differentiation. In human megakaryopoiesis, hereditary disorders of platelet production have confirmed contributions from three distinct transcription factor families. Murine models have extended this repertoire to include multiple additional factors. At a mechanistic level, the means by which these non-unique factors collaborate in the establishment of a perfectly unique cell type remains a central question.

  15. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    Although retroviral vector systems have been found to efficiently transduce a variety of cell types in vitro, the use of vectors based on murine leukemia virus in preclinical models of somatic gene therapy has led to the identification of transcriptional silencing in vivo as an important problem....... Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t...

  16. RNA-guided transcriptional regulation

    Science.gov (United States)

    Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.

    2016-02-23

    Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.

  17. Evolution of transcriptional regulation in closely related bacteria

    Directory of Open Access Journals (Sweden)

    Tsoy Olga V

    2012-10-01

    Full Text Available Abstract Background The exponential growth of the number of fully sequenced genomes at varying taxonomic closeness allows one to characterize transcriptional regulation using comparative-genomics analysis instead of time-consuming experimental methods. A transcriptional regulatory unit consists of a transcription factor, its binding site and a regulated gene. These units constitute a graph which contains so-called “network motifs”, subgraphs of a given structure. Here we consider genomes of closely related Enterobacteriales and estimate the fraction of conserved network motifs and sites as well as positions under selection in various types of non-coding regions. Results Using a newly developed technique, we found that the highest fraction of positions under selection, approximately 50%, was observed in synvergon spacers (between consecutive genes from the same strand, followed by ~45% in divergon spacers (common 5’-regions, and ~10% in convergon spacers (common 3’-regions. The fraction of selected positions in functional regions was higher, 60% in transcription factor-binding sites and ~45% in terminators and promoters. Small, but significant differences were observed between Escherichia coli and Salmonella enterica. This fraction is similar to the one observed in eukaryotes. The conservation of binding sites demonstrated some differences between types of regulatory units. In E. coli, strains the interactions of the type “local transcriptional factor gene” turned out to be more conserved in feed-forward loops (FFLs compared to non-motif interactions. The coherent FFLs tend to be less conserved than the incoherent FFLs. A natural explanation is that the former imply functional redundancy. Conclusions A naïve hypothesis that FFL would be highly conserved turned out to be not entirely true: its conservation depends on its status in the transcriptional network and also from its usage. The fraction of positions under selection in

  18. Initiation of HIV Reverse Transcription

    OpenAIRE

    Isel, Catherine; Ehresmann, Chantal; Marquet, Roland

    2010-01-01

    Reverse transcription of retroviral genomes into double stranded DNA is a key event for viral replication. The very first stage of HIV reverse transcription, the initiation step, involves viral and cellular partners that are selectively packaged into the viral particle, leading to an RNA/protein complex with very specific structural and functional features, some of which being, in the case of HIV-1, linked to particular isolates. Recent understanding of the tight spatio-temporal regulation of...

  19. Animal Models of Bacterial Keratitis

    Science.gov (United States)

    Marquart, Mary E.

    2011-01-01

    Bacterial keratitis is a disease of the cornea characterized by pain, redness, inflammation, and opacity. Common causes of this disease are Pseudomonas aeruginosa and Staphylococcus aureus. Animal models of keratitis have been used to elucidate both the bacterial factors and the host inflammatory response involved in the disease. Reviewed herein are animal models of bacterial keratitis and some of the key findings in the last several decades. PMID:21274270

  20. Concentration and length dependence of DNA looping in transcriptional regulation.

    Directory of Open Access Journals (Sweden)

    Lin Han

    2009-05-01

    Full Text Available In many cases, transcriptional regulation involves the binding of transcription factors at sites on the DNA that are not immediately adjacent to the promoter of interest. This action at a distance is often mediated by the formation of DNA loops: Binding at two or more sites on the DNA results in the formation of a loop, which can bring the transcription factor into the immediate neighborhood of the relevant promoter. These processes are important in settings ranging from the historic bacterial examples (bacterial metabolism and the lytic-lysogeny decision in bacteriophage, to the modern concept of gene regulation to regulatory processes central to pattern formation during development of multicellular organisms. Though there have been a variety of insights into the combinatorial aspects of transcriptional control, the mechanism of DNA looping as an agent of combinatorial control in both prokaryotes and eukaryotes remains unclear. We use single-molecule techniques to dissect DNA looping in the lac operon. In particular, we measure the propensity for DNA looping by the Lac repressor as a function of the concentration of repressor protein and as a function of the distance between repressor binding sites. As with earlier single-molecule studies, we find (at least two distinct looped states and demonstrate that the presence of these two states depends both upon the concentration of repressor protein and the distance between the two repressor binding sites. We find that loops form even at interoperator spacings considerably shorter than the DNA persistence length, without the intervention of any other proteins to prebend the DNA. The concentration measurements also permit us to use a simple statistical mechanical model of DNA loop formation to determine the free energy of DNA looping, or equivalently, the for looping.

  1. Engineering transcriptional regulation to control Pdu microcompartment formation.

    Directory of Open Access Journals (Sweden)

    Edward Y Kim

    Full Text Available Bacterial microcompartments (MCPs show great promise for the organization of engineered metabolic pathways within the bacterial cytoplasm. This subcellular organelle is composed of a protein shell of 100-200 nm diameter that natively encapsulates multi-enzyme pathways. The high energy cost of synthesizing the thousands of protein subunits required for each MCP demands precise regulation of MCP formation for both native and engineered systems. Here, we study the regulation of the propanediol utilization (Pdu MCP, for which growth on 1,2-propanediol induces expression of the Pdu operon for the catabolism of 1,2-propanediol. We construct a fluorescence-based transcriptional reporter to investigate the activation of the Ppdu promoter, which drives the transcription of 21 pdu genes. Guided by this reporter, we find that MCPs can be expressed in strains grown in rich media, provided that glucose is not present. We also characterize the response of the Ppdu promoter to a transcriptional activator of the pdu operon, PocR, and find PocR to be a necessary component of Pdu MCP formation. Furthermore, we find that MCPs form normally upon the heterologous expression of PocR even in the absence of the natural inducer 1,2-propanediol and in the presence of glucose, and that Pdu MCPs formed in response to heterologous PocR expression can metabolize 1,2-propanediol in vivo. We anticipate that this technique of overexpressing a key transcription factor may be used to study and engineer the formation, size, and/or number of MCPs for the Pdu and related MCP systems.

  2. National Capital Planning Commission Meeting Transcripts

    Data.gov (United States)

    National Capital Planning Commission — Transcripts of the monthly (with the exception of August) National Capital Planning Commission meeting transcripts are provided for research to confirm actions taken...

  3. Aerotaxis in Bacterial Turbulence

    Science.gov (United States)

    Fernandez, Vicente; Bisson, Antoine; Bitton, Cindy; Waisbord, Nicolas; Smriga, Steven; Rusconi, Roberto; Stocker, Roman

    2012-11-01

    Concentrated suspensions of motile bacteria exhibit correlated dynamics on spatial scales much larger than an individual bacterium. The resulting flows, visually similar to turbulence, can increase mixing and decrease viscosity. However, it remains unclear to what degree the collective dynamics depend on the motile behavior of bacteria at the individual level. Using a new microfluidic device to create controlled horizontal oxygen gradients, we studied the two dimensional behavior of dense suspensions of Bacillus subtilis. This system makes it possible to assess the interplay between the coherent large-scale motions of the suspension, oxygen transport, and the directional response of cells to oxygen gradients (aerotaxis). At the same time, this device has enabled us to examine the onset of bacterial turbulence and its influence on the propagation of the diffusing oxygen front, as the bacteria begin in a dormant state and transition to swimming when exposed to oxygen.

  4. Bacterial intermediate filaments

    DEFF Research Database (Denmark)

    Charbon, Godefroid; Cabeen, M.; Jacobs-Wagner, C.

    2009-01-01

    Crescentin, which is the founding member of a rapidly growing family of bacterial cytoskeletal proteins, was previously proposed to resemble eukaryotic intermediate filament (IF) proteins based on structural prediction and in vitro polymerization properties. Here, we demonstrate that crescentin...... also shares in vivo properties of assembly and dynamics with IF proteins by forming stable filamentous structures that continuously incorporate subunits along their length and that grow in a nonpolar fashion. De novo assembly of crescentin is biphasic and involves a cell size-dependent mechanism...... a new function for MreB and providing a parallel to the role of actin in IF assembly and organization in metazoan cells. Additionally, analysis of an MreB localization mutant suggests that cell wall insertion during cell elongation normally occurs along two helices of opposite handedness, each...

  5. Bacterial polyhydroxyalkanoates: Still fabulous?

    Science.gov (United States)

    Możejko-Ciesielska, Justyna; Kiewisz, Robert

    2016-11-01

    Bacterial polyhydroxyalkanoates (PHA) are polyesters accumulated as carbon and energy storage materials under limited growth conditions in the presence of excess carbon sources. They have been developed as biomaterials with unique properties for the past many years being considered as a potential substitute for conventional non-degradable plastics. Due to the increasing concern towards global climate change, depleting petroleum resource and problems with an utilization of a growing number of synthetic plastics, PHAs have gained much more attention from industry and research. These environmentally friendly microbial polymers have great potential in biomedical, agricultural, and industrial applications. However, their production on a large scale is still limited. This paper describes the backgrounds of PHAs and discussed the current state of knowledge on the polyhydroxyalkanoates. Ability of bacteria to convert different carbon sources to PHAs, the opportunities and challenges of their introduction to global market as valuable renewable products have been also discussed. Copyright © 2016 Elsevier GmbH. All rights reserved.

  6. Biosensors of bacterial cells.

    Science.gov (United States)

    Burlage, Robert S; Tillmann, Joshua

    2017-07-01

    Biosensors are devices which utilize both an electrical component (transducer) and a biological component to study an environment. They are typically used to examine biological structures, organisms and processes. The field of biosensors has now become so large and varied that the technology can often seem impenetrable. Yet the principles which underlie the technology are uncomplicated, even if the details of the mechanisms are elusive. In this review we confine our analysis to relatively current advancements in biosensors for the detection of whole bacterial cells. This includes biosensors which rely on an added labeled component and biosensors which do not have a labeled component and instead detect the binding event or bound structure on the transducer. Methods to concentrate the bacteria prior to biosensor analysis are also described. The variety of biosensor types and their actual and potential uses are described. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Bacterial proteases and virulence

    DEFF Research Database (Denmark)

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell......Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing...... signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated...

  8. Bacteriële meningitis

    NARCIS (Netherlands)

    Brouwer, M. C.; van de Beek, D.

    2012-01-01

    Bacterial meningitis is a severe disease which affects 35.000 Europeans each year and has a mortality rate of about 20%. During the past 25 years the epidemiology of bacterial meningitis has changed significantly due to the implementation of vaccination against Haemophilus influenzae, Neisseria

  9. Bacterial meningitis in immunocompromised patients

    NARCIS (Netherlands)

    van Veen, K.E.B.

    2018-01-01

    Bacterial meningitis is an acute infection of the meninges, in The Netherlands most commonly caused by Streptococcus pneumoniae and Neisseria meningitides. Risk factors for acquiring bacterial meningitis include a decreased function of the immune system. The aim of this thesis was to study

  10. Molecular approaches for bacterial azoreductases

    Directory of Open Access Journals (Sweden)

    Montira Leelakriangsak

    2013-12-01

    Full Text Available Azo dyes are the dominant types of synthetic dyes, widely used in textiles, foods, leather, printing, tattooing, cosmetics, and pharmaceutical industries. Many microorganisms are able to decolorize azo dyes, and there is increasing interest in biological waste treatment methods. Bacterial azoreductases can cleave azo linkages (-N=N- in azo dyes, forming aromatic amines. This review mainly focuses on employing molecular approaches, including gene manipulation and recombinant strains, to study bacterial azoreductases. The construction of the recombinant protein by cloning and the overexpression of azoreductase is described. The mechanisms and function of bacterial azoreductases can be studied by other molecular techniques discussed in this review, such as RT-PCR, southern blot analysis, western blot analysis, zymography, and muta-genesis in order to understand bacterial azoreductase properties, function and application. In addition, understanding the regulation of azoreductase gene expression will lead to the systematic use of gene manipulation in bacterial strains for new strategies in future waste remediation technologies.

  11. 16 CFR 1502.36 - Official transcript.

    Science.gov (United States)

    2010-01-01

    ... the time the transcript becomes available to propose corrections in the transcript of oral testimony. Corrections are permitted only for transcription errors. The presiding officer shall promptly order justified... presiding officer will arrange for a verbatim stenographic transcript of oral testimony and for necessary...

  12. Transcription elongation factor GreA has functional chaperone activity.

    Science.gov (United States)

    Li, Kun; Jiang, Tianyi; Yu, Bo; Wang, Limin; Gao, Chao; Ma, Cuiqing; Xu, Ping; Ma, Yanhe

    2012-01-01

    Bacterial GreA is an indispensable factor in the RNA polymerase elongation complex. It plays multiple roles in transcriptional elongation, and may be implicated in resistance to various stresses. In this study, we show that Escherichia coli GreA inhibits aggregation of several substrate proteins under heat shock condition. GreA can also effectively promote the refolding of denatured proteins. These facts reveal that GreA has chaperone activity. Distinct from many molecular chaperones, GreA does not form stable complexes with unfolded substrates. GreA overexpression confers the host cells with enhanced resistance to heat shock and oxidative stress. Moreover, GreA expression in the greA/greB double mutant could suppress the temperature-sensitive phenotype, and dramatically alleviate the in vivo protein aggregation. The results suggest that bacterial GreA may act as chaperone in vivo. These results suggest that GreA, in addition to its function as a transcription factor, is involved in protection of cellular proteins against aggregation.

  13. Transcriptional networks of TCP transcription factors in Arabidopsis development

    NARCIS (Netherlands)

    Danisman, S.D.

    2011-01-01

    Leaves are a plant’s main organs of photosynthesis and hence the development of this organ is under strict control. The different phases of leaf development are under the control of both endogenous and exogenous influences. In this work we were interested in a particular class of transcription

  14. Chromatin and Transcription in Yeast

    Science.gov (United States)

    Rando, Oliver J.; Winston, Fred

    2012-01-01

    Understanding the mechanisms by which chromatin structure controls eukaryotic transcription has been an intense area of investigation for the past 25 years. Many of the key discoveries that created the foundation for this field came from studies of Saccharomyces cerevisiae, including the discovery of the role of chromatin in transcriptional silencing, as well as the discovery of chromatin-remodeling factors and histone modification activities. Since that time, studies in yeast have continued to contribute in leading ways. This review article summarizes the large body of yeast studies in this field. PMID:22345607

  15. Bacterial topoisomerase I as a target for discovery of antibacterial compounds.

    Science.gov (United States)

    Tse-Dinh, Yuk-Ching

    2009-02-01

    Bacterial topoisomerase I is a potential target for discovery of new antibacterial compounds. Mutant topoisomerases identified by SOS induction screening demonstrated that accumulation of the DNA cleavage complex formed by type IA topoisomerases is bactericidal. Characterization of these mutants of Yersinia pestis and Escherichia coli topoisomerase I showed that DNA religation can be inhibited while maintaining DNA cleavage activity by decreasing the binding affinity of Mg(II) ions. This can be accomplished either by mutation of the TOPRIM motif involved directly in Mg(II) binding or by altering the charge distribution of the active site region. Besides being used to elucidate the key elements for the control of the cleavage-religation equilibrium, the SOS-inducing mutants of Y. pestis and E. coli topoisomerase I have also been utilized as models to study the cellular response following the accumulation of bacterial topoisomerase I cleavage complex. Bacterial topoisomerase I is required for preventing hypernegative supercoiling of DNA during transcription. It plays an important role in transcription of stress genes during bacterial stress response. Topoisomerase I targeting poisons may be particularly effective when the bacterial pathogen is responding to host defense, or in the presence of other antibiotics that induce the bacterial stress response.

  16. Zoonotic bacterial meningitis in human adults

    NARCIS (Netherlands)

    van Samkar, Anusha; Brouwer, Matthijs C.; van der Ende, Arie; van de Beek, Diederik

    2016-01-01

    To describe the epidemiology, etiology, clinical characteristics, treatment, outcome, and prevention of zoonotic bacterial meningitis in human adults. We identified 16 zoonotic bacteria causing meningitis in adults. Zoonotic bacterial meningitis is uncommon compared to bacterial meningitis caused by

  17. Role of sex steroid hormones in bacterial-host interactions.

    Science.gov (United States)

    García-Gómez, Elizabeth; González-Pedrajo, Bertha; Camacho-Arroyo, Ignacio

    2013-01-01

    Sex steroid hormones play important physiological roles in reproductive and nonreproductive tissues, including immune cells. These hormones exert their functions by binding to either specific intracellular receptors that act as ligand-dependent transcription factors or membrane receptors that stimulate several signal transduction pathways. The elevated susceptibility of males to bacterial infections can be related to the usually lower immune responses presented in males as compared to females. This dimorphic sex difference is mainly due to the differential modulation of the immune system by sex steroid hormones through the control of proinflammatory and anti-inflammatory cytokines expression, as well as Toll-like receptors (TLRs) expression and antibody production. Besides, sex hormones can also affect the metabolism, growth, or virulence of pathogenic bacteria. In turn, pathogenic, microbiota, and environmental bacteria are able to metabolize and degrade steroid hormones and their related compounds. All these data suggest that sex steroid hormones play a key role in the modulation of bacterial-host interactions.

  18. Defining bacterial regulons using ChIP-seq.

    Science.gov (United States)

    Myers, Kevin S; Park, Dan M; Beauchene, Nicole A; Kiley, Patricia J

    2015-09-15

    Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) is a powerful method that identifies protein-DNA binding sites in vivo. Recent studies have illustrated the value of ChIP-seq in studying transcription factor binding in various bacterial species under a variety of growth conditions. These results show that in addition to identifying binding sites, correlation of ChIP-seq data with expression data can reveal important information about bacterial regulons and regulatory networks. In this chapter, we provide an overview of the current state of knowledge about ChIP-seq methodology in bacteria, from sample preparation to raw data analysis. We also describe visualization and various bioinformatic analyses of processed ChIP-seq data. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Defining Bacterial Regulons Using ChIP-seq Methods

    Science.gov (United States)

    Myers, Kevin S.; Park, Dan M.; Beauchene, Nicole A.; Kiley, Patricia J.

    2015-01-01

    Chromatin immunoprecitation followed by high-throughput sequencing (ChIP-seq) is a powerful method that identifies protein-DNA binding sites in vivo. Recent studies have illustrated the value of ChIP-seq in studying transcription factor binding in various bacterial species under a variety of growth conditions. These results show that in addition to identifying binding sites, correlation of ChIP-seq data with expression data can reveal important information about bacterial regulons and regulatory networks. In this chapter, we provide an overview of the current state of knowledge about ChIP-seq methodology in bacteria, from sample preparation to raw data analysis. We also describe visualization and various bioinformatic analyses of processed ChIP-seq data. PMID:26032817

  20. Evolution of Bacterial Suicide

    Science.gov (United States)

    Tchernookov, Martin; Nemenman, Ilya

    2013-03-01

    While active, controlled cellular suicide (autolysis) in bacteria is commonly observed, it has been hard to argue that autolysis can be beneficial to an individual who commits it. We propose a theoretical model that predicts that bacterial autolysis is evolutionarily advantageous to an individualand would fixate in physically structured environments for stationary phase colonies. We perform spatially resolved agent-based simulations of the model, which predict that lower mixing in the environment results in fixation of a higher autolysis rate from a single mutated cell, regardless of the colony's genetic diversity. We argue that quorum sensing will fixate as well, even if initially rare, if it is coupled to controlling the autolysis rate. The model does not predict a strong additional competitive advantage for cells where autolysis is controlled by quorum sensing systems that distinguish self from nonself. These predictions are broadly supported by recent experimental results in B. subtilisand S. pneumoniae. Research partially supported by the James S McDonnell Foundation grant No. 220020321 and by HFSP grant No. RGY0084/2011.

  1. Electromagnetism of Bacterial Growth

    Science.gov (United States)

    Ainiwaer, Ailiyasi

    2011-10-01

    There has been increasing concern from the public about personal health due to the significant rise in the daily use of electrical devices such as cell phones, radios, computers, GPS, video games and television. All of these devices create electromagnetic (EM) fields, which are simply magnetic and electric fields surrounding the appliances that simultaneously affect the human bio-system. Although these can affect the human system, obstacles can easily shield or weaken the electrical fields; however, magnetic fields cannot be weakened and can pass through walls, human bodies and most other objects. The present study was conducted to examine the possible effects of bacteria when exposed to magnetic fields. The results indicate that a strong causal relationship is not clear, since different magnetic fields affect the bacteria differently, with some causing an increase in bacterial cells, and others causing a decrease in the same cells. This phenomenon has yet to be explained, but the current study attempts to offer a mathematical explanation for this occurrence. The researchers added cultures to the magnetic fields to examine any effects to ion transportation. Researchers discovered ions such as potassium and sodium are affected by the magnetic field. A formula is presented in the analysis section to explain this effect.

  2. Type III secretion systems: the bacterial flagellum and the injectisome

    Science.gov (United States)

    Diepold, Andreas; Armitage, Judith P.

    2015-01-01

    The flagellum and the injectisome are two of the most complex and fascinating bacterial nanomachines. At their core, they share a type III secretion system (T3SS), a transmembrane export complex that forms the extracellular appendages, the flagellar filament and the injectisome needle. Recent advances, combining structural biology, cryo-electron tomography, molecular genetics, in vivo imaging, bioinformatics and biophysics, have greatly increased our understanding of the T3SS, especially the structure of its transmembrane and cytosolic components, the transcriptional, post-transcriptional and functional regulation and the remarkable adaptivity of the system. This review aims to integrate these new findings into our current knowledge of the evolution, function, regulation and dynamics of the T3SS, and to highlight commonalities and differences between the two systems, as well as their potential applications. PMID:26370933

  3. Bacterial growth on macrophyte leachate and fate of bacterial production

    International Nuclear Information System (INIS)

    Findlay, S.; Carlough, L.; Crocker, M.T.; Gill, H.K.; Meyer, J.L.; Smith, P.J.

    1986-01-01

    The role bacteria play in transferring organic carbon to other trophic levels in aquatic ecosystems depends on the efficiency with which they convert dissolved organic [ 14 C]-labelled carbon into bacterial biomass and on the ability of consumers to graze bacteria. The authors have measured the conversion efficiency for bacteria growing on macrophyte-derived dissolved organic carbon and estimated the amount of bacterial production removed by grazing. Bacteria converted this DOC into new tissue with an efficiency of 53%, substantially higher than the apparent conversion efficiency of macrophyte-derived particulate organic carbon or other types of DOC. Two estimates of grazing indicate that the decline in bacterial numbers after the bloom was probably due to grazing by flagellates. These results show the significance of the bacterial link between DOC and other trophic levels

  4. SPARTA: Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis.

    Science.gov (United States)

    Johnson, Benjamin K; Scholz, Matthew B; Teal, Tracy K; Abramovitch, Robert B

    2016-02-04

    Many tools exist in the analysis of bacterial RNA sequencing (RNA-seq) transcriptional profiling experiments to identify differentially expressed genes between experimental conditions. Generally, the workflow includes quality control of reads, mapping to a reference, counting transcript abundance, and statistical tests for differentially expressed genes. In spite of the numerous tools developed for each component of an RNA-seq analysis workflow, easy-to-use bacterially oriented workflow applications to combine multiple tools and automate the process are lacking. With many tools to choose from for each step, the task of identifying a specific tool, adapting the input/output options to the specific use-case, and integrating the tools into a coherent analysis pipeline is not a trivial endeavor, particularly for microbiologists with limited bioinformatics experience. To make bacterial RNA-seq data analysis more accessible, we developed a Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis (SPARTA). SPARTA is a reference-based bacterial RNA-seq analysis workflow application for single-end Illumina reads. SPARTA is turnkey software that simplifies the process of analyzing RNA-seq data sets, making bacterial RNA-seq analysis a routine process that can be undertaken on a personal computer or in the classroom. The easy-to-install, complete workflow processes whole transcriptome shotgun sequencing data files by trimming reads and removing adapters, mapping reads to a reference, counting gene features, calculating differential gene expression, and, importantly, checking for potential batch effects within the data set. SPARTA outputs quality analysis reports, gene feature counts and differential gene expression tables and scatterplots. SPARTA provides an easy-to-use bacterial RNA-seq transcriptional profiling workflow to identify differentially expressed genes between experimental conditions. This software will enable microbiologists with

  5. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    Science.gov (United States)

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. © 2013.

  6. Adjunctive Therapies for Bacterial Keratitis.

    Science.gov (United States)

    Dakhil, Turki Abdulaziz Bin; Stone, Donald U; Gritz, David C

    2017-01-01

    Bacterial keratitis is the most common type among all types of infectious keratitis. Currently, antibiotics are the main-stay of treatment. The objective of this systematic review is to review published clinical studies which discuss the adjunctive treatment of bacterial keratitis to guide clinical decision-making. We reviewed the role of a variety of medications and surgeries which can help in managing bacterial keratitis complications, which include as thinning, perforation, and impaired wound healing. We have included appropriate animal and laboratory studies, case reports and case series, and randomized clinical trials regarding each therapy.

  7. Molecular detection of human bacterial pathogens

    National Research Council Canada - National Science Library

    Liu, Dongyou

    2011-01-01

    .... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...

  8. Structural insights into transcription complexes

    NARCIS (Netherlands)

    Berger, I.; Blanco, A.G.; Boelens, R.; Cavarelli, J.; Coll, M.; Folkers, G.E.; Nie, Y.; Pogenberg, V.; Schultz, P.; Wilmanns, M.; Moras, D.; Poterszman, A.

    2011-01-01

    Control of transcription allows the regulation of cell activity in response to external stimuli and research in the field has greatly benefited from efforts in structural biology. In this review, based on specific examples from the European SPINE2-COMPLEXES initiative, we illustrate the impact of

  9. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...

  10. NAC transcription factors in senescence

    DEFF Research Database (Denmark)

    Podzimska-Sroka, Dagmara; O'Shea, Charlotte; Gregersen, Per L.

    2015-01-01

    Within the last decade, NAC transcription factors have been shown to play essential roles in senescence, which is the focus of this review. Transcriptome analyses associate approximately one third of Arabidopsis NAC genes and many crop NAC genes with senescence, thereby implicating NAC genes as i...

  11. Transcription factor-based biosensor

    Science.gov (United States)

    Dietrich, Jeffrey A; Keasling, Jay D

    2013-10-08

    The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

  12. HDG1 transcription factor targets

    NARCIS (Netherlands)

    Horstman, A.; Boutilier, K.A.; Sanchez Perez, Gabino

    2015-01-01

    The AIL transcription factor BABY BOOM (BBM) is required together with the related PLETHORA proteins for embryo and root meristem development and its expression is sufficient to confer pluripotency and totipotency to somatic tissues. We show that BBM and other AIL proteins interact with multiple

  13. Simultaneous transcriptional profiling of bacteria and their host cells.

    Directory of Open Access Journals (Sweden)

    Michael S Humphrys

    Full Text Available We developed an RNA-Seq-based method to simultaneously capture prokaryotic and eukaryotic expression profiles of cells infected with intracellular bacteria. As proof of principle, this method was applied to Chlamydia trachomatis-infected epithelial cell monolayers in vitro, successfully obtaining transcriptomes of both C. trachomatis and the host cells at 1 and 24 hours post-infection. Chlamydiae are obligate intracellular bacterial pathogens that cause a range of mammalian diseases. In humans chlamydiae are responsible for the most common sexually transmitted bacterial infections and trachoma (infectious blindness. Disease arises by adverse host inflammatory reactions that induce tissue damage & scarring. However, little is known about the mechanisms underlying these outcomes. Chlamydia are genetically intractable as replication outside of the host cell is not yet possible and there are no practical tools for routine genetic manipulation, making genome-scale approaches critical. The early timeframe of infection is poorly understood and the host transcriptional response to chlamydial infection is not well defined. Our simultaneous RNA-Seq method was applied to a simplified in vitro model of chlamydial infection. We discovered a possible chlamydial strategy for early iron acquisition, putative immune dampening effects of chlamydial infection on the host cell, and present a hypothesis for Chlamydia-induced fibrotic scarring through runaway positive feedback loops. In general, simultaneous RNA-Seq helps to reveal the complex interplay between invading bacterial pathogens and their host mammalian cells and is immediately applicable to any bacteria/host cell interaction.

  14. Synthetic Transcription Amplifier System for Orthogonal Control of Gene Expression in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Anssi Rantasalo

    Full Text Available This work describes the development and characterization of a modular synthetic expression system that provides a broad range of adjustable and predictable expression levels in S. cerevisiae. The system works as a fixed-gain transcription amplifier, where the input signal is transferred via a synthetic transcription factor (sTF onto a synthetic promoter, containing a defined core promoter, generating a transcription output signal. The system activation is based on the bacterial LexA-DNA-binding domain, a set of modified, modular LexA-binding sites and a selection of transcription activation domains. We show both experimentally and computationally that the tuning of the system is achieved through the selection of three separate modules, each of which enables an adjustable output signal: 1 the transcription-activation domain of the sTF, 2 the binding-site modules in the output promoter, and 3 the core promoter modules which define the transcription initiation site in the output promoter. The system has a novel bidirectional architecture that enables generation of compact, yet versatile expression modules for multiple genes with highly diversified expression levels ranging from negligible to very strong using one synthetic transcription factor. In contrast to most existing modular gene expression regulation systems, the present system is independent from externally added compounds. Furthermore, the established system was minimally affected by the several tested growth conditions. These features suggest that it can be highly useful in large scale biotechnology applications.

  15. Transcriptional interactions suggest niche segregation among microorganisms in the human gut

    DEFF Research Database (Denmark)

    Plichta, Damian Rafal; Juncker, Agnieszka; dos Santos, Marcelo Bertalan Quintanilha

    2016-01-01

    functional and metabolic interactions between cohabiting species 2,3. To move beyond species co-occurrence networks, we systematically identified transcriptional interactions between pairs of coexisting gut microbes using metagenomics and microarray-based metatranscriptomics data from 233 stool samples from...... biosynthesis, ATP-binding cassette (ABC) transporters, flagella assembly and bacterial chemotaxis, as well as for the metabolism of carbohydrates, amino acids and cofactors. The analysis gives the first insight into the microbial community-wide transcriptional interactions, and suggests that the regulation...

  16. Bacterial sepsis and chemokines.

    Science.gov (United States)

    Kobayashi, Makiko; Tsuda, Yasuhiro; Yoshida, Tsuyoshi; Takeuchi, Dan; Utsunomiya, Tokuichiro; Takahashi, Hitoshi; Suzuki, Fujio

    2006-01-01

    Bacterial sepsis causes a high mortality rate when it occurs in patients with compromised host defenses. Severely burned patients, typical immunocompromised hosts, are extremely susceptible to infections from various pathogens, and a local wound infection frequently escalates into sepsis. In these patients, Staphylococcus aureus, Enterococcus faecalis and Pseudomonas aeruginosa are familiar pathogens that cause opportunistic infections. Also, polymicrobial sepsis frequently occurs in these patients. In this review, therefore, the roles of chemokines in thermally injured patients infected with these 3 pathogens and polymicrobial sepsis will be discussed. These infections in thermally injured patients may be controlled immunologically, because immunocompetent hosts are resistant to infections with these pathogens. Classically activated macrophages (M1Mphi) are major effector cells for host innate immune responses against these infections. However, M1Mphi are not generated in thermally injured patients whose alternatively activated macrophages (M2Mphi) predominate. M2Mphi appear in patients early after severe burn injuries. M2Mphi inhibit M1Mphi generation through the secretion of CCL17 and IL-10. As a modulator of Mphi, two different subsets of neutrophils (PMN-I, PMN-II) are described. PMN-I direct the polarization of resident Mphi into M1Mphi through the production of CCL3. M2Mphi are induced from resident Mphi by CCL2 released from PMN-II. Therefore, as an inhibitor of CCL2, glycyrrhizin protects individuals infected with S. aureus. Sepsis stemming from P. aeruginosa wound infection is also influenced by CCL2 released from immature myeloid cells. A large number of immature myeloid cells appear in association with burn injuries. Host resistance to S. aureus, E. faecalis, P. aeruginosa or polymicrobial infections may be improved in thermally injured patients through the induction of M1Mphi, elimination of CCL2 and/or depletion of M2Mphi induced by CCL2.

  17. Autoregulation of topoisomerase I expression by supercoiling sensitive transcription.

    Science.gov (United States)

    Ahmed, Wareed; Menon, Shruti; Karthik, Pullela V D N B; Nagaraja, Valakunja

    2016-02-29

    The opposing catalytic activities of topoisomerase I (TopoI/relaxase) and DNA gyrase (supercoiling enzyme) ensure homeostatic maintenance of bacterial chromosome supercoiling. Earlier studies in Escherichia coli suggested that the alteration in DNA supercoiling affects the DNA gyrase and TopoI expression. Although, the role of DNA elements around the promoters were proposed in regulation of gyrase, the molecular mechanism of supercoiling mediated control of TopoI expression is not yet understood. Here, we describe the regulation of TopoI expression from Mycobacterium tuberculosis and Mycobacterium smegmatis by a mechanism termed Supercoiling Sensitive Transcription (SST). In both the organisms, topoI promoter(s) exhibited reduced activity in response to chromosome relaxation suggesting that SST is intrinsic to topoI promoter(s). We elucidate the role of promoter architecture and high transcriptional activity of upstream genes in topoI regulation. Analysis of the promoter(s) revealed the presence of sub-optimal spacing between the -35 and -10 elements, rendering them supercoiling sensitive. Accordingly, upon chromosome relaxation, RNA polymerase occupancy was decreased on the topoI promoter region implicating the role of DNA topology in SST of topoI. We propose that negative supercoiling induced DNA twisting/writhing align the -35 and -10 elements to facilitate the optimal transcription of topoI. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Bacterial Communities: Interactions to Scale

    Directory of Open Access Journals (Sweden)

    Reed M. Stubbendieck

    2016-08-01

    Full Text Available In the environment, bacteria live in complex multispecies communities. These communities span in scale from small, multicellular aggregates to billions or trillions of cells within the gastrointestinal tract of animals. The dynamics of bacterial communities are determined by pairwise interactions that occur between different species in the community. Though interactions occur between a few cells at a time, the outcomes of these interchanges have ramifications that ripple through many orders of magnitude, and ultimately affect the macroscopic world including the health of host organisms. In this review we cover how bacterial competition influences the structures of bacterial communities. We also emphasize methods and insights garnered from culture-dependent pairwise interaction studies, metagenomic analyses, and modeling experiments. Finally, we argue that the integration of multiple approaches will be instrumental to future understanding of the underlying dynamics of bacterial communities.

  19. Bacterial flora of sturgeon fingerling

    International Nuclear Information System (INIS)

    Arani, A.S.; Mosahab, R.

    2008-01-01

    The study on microbial populations is a suitable tool to understand and apply control methods to improve the sanitary level of production in fish breeding and rearing centers, ensure health of sturgeon fingerlings at the time of their release into the rivers and also in the conversation and restoration of these valuable stocks in the Caspian Sea, Iran. A laboratory research based on Austin methods (Austin, B., Austin, D.A. 1993) was conducted for bacterial study on 3 sturgeon species naming A. persicus, A. stellatus and A. nudiventris during different growth stages. Bacterial flora of Acinetobacter, Moraxella, Aeromonas, Vibrio, Edwardsiella, Staphylococcus, Proteus, Yersinia, Pseudomonas and Plesiomonas were determined. The factors which may induce changes in bacterial populations during different stages of fife are the followings: quality of water in rearing ponds, different conditions for growth stages, suitable time for colonization of bacterial flora in rearing pond, water temperature increase in fingerlings size and feeding condition. (author)

  20. Subdural Empyema in Bacterial Meningitis

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2013-01-01

    Full Text Available Researchers at the University of Amsterdam, the Netherlands, evaluated the occurrence, treatment, and outcome of subdural empyema as a complication of community-acquired bacterial meningitis in 28 (2.7% adults.

  1. Arsenic uptake in bacterial calcite

    Energy Technology Data Exchange (ETDEWEB)

    Catelani, Tiziano; Perito, Brunella; Bellucci, Francesco; Lee, Sang Soo; Fenter, Paul; Newville, Matthew G.; Rimondi, Valentina; Pratesi, Giovanni; Costagliola, Pilario

    2018-02-01

    Bio-mediated processes for arsenic (As) uptake in calcite were investigated by means of X-ray Diffraction (XRD) and Xray Absorption Spectroscopy (XAS) coupled with X-ray Fluorescence measurements. The environmental bacterial strain Bacillus licheniformis BD5, sampled at the Bullicame Hot Springs (Viterbo, Central Italy), was used to synthesize calcite from As-enriched growth media. Both liquid and solid cultures were applied to simulate planktonic and biofilm community environments, respectively. Bacterial calcite samples cultured in liquid media had an As enrichment factor (Kd) 50 times higher than that from solid media. The XRD analysis revealed an elongation of the crystal lattice along the c axis (by 0.03Å) for biogenic calcite, which likely resulted from the substitution of larger arsenate for carbonate in the crystal. The XAS data also showed a clear difference in the oxidation state of sorbed As between bacterial and abiotic calcite. Abiotic chemical processes yielded predominantly As(V) uptake whereas bacterial precipitation processes led to the uptake of both As(III) and As(V). The presence of As(III) in bacterial calcite is proposed to result from subsequent reduction of arsenate to arsenite by bacterial activities. To the best of our knowledge, this is the first experimental observation of the incorporation of As(III) in the calcite crystal lattice, revealing a critical role of biochemical processes for the As cycling in nature.

  2. Arsenic uptake in bacterial calcite

    Science.gov (United States)

    Catelani, Tiziano; Perito, Brunella; Bellucci, Francesco; Lee, Sang Soo; Fenter, Paul; Newville, Matthew; Rimondi, Valentina; Pratesi, Giovanni; Costagliola, Pilario

    2018-02-01

    Bio-mediated processes for arsenic (As) uptake in calcite were investigated by means of X-ray Diffraction (XRD) and X-ray Absorption Spectroscopy (XAS) coupled with X-ray Fluorescence measurements. The environmental bacterial strain Bacillus licheniformis BD5, sampled at the Bullicame Hot Springs (Viterbo, Central Italy), was used to synthesize calcite from As-enriched growth media. Both liquid and solid cultures were applied to simulate planktonic and biofilm community environments, respectively. Bacterial calcite samples cultured in liquid media had an As enrichment factor (Kd) 50 times higher than that from solid media. The XRD analysis revealed an elongation of the crystal lattice along the c axis (by 0.03 Å) for biogenic calcite, which likely resulted from the substitution of larger arsenate for carbonate in the crystal. The XAS data also showed a clear difference in the oxidation state of sorbed As between bacterial and abiotic calcite. Abiotic chemical processes yielded predominantly As(V) uptake whereas bacterial precipitation processes led to the uptake of both As(III) and As(V). The presence of As(III) in bacterial calcite is proposed to result from subsequent reduction of arsenate to arsenite by bacterial activities. To the best of our knowledge, this is the first experimental observation of the incorporation of As(III) in the calcite crystal lattice, revealing a critical role of biochemical processes for the As cycling in nature.

  3. Current knowledge of bacterial vaginosis

    Directory of Open Access Journals (Sweden)

    Đukić Slobodanka

    2011-01-01

    Full Text Available Bacterial vaginosis, earlier termed nonspecific vaginitis (anaerobic vaginosis because of the absence of recognized pathogens, is most common vaginal syndrome of women of childbearing age affecting 15-30%. This syndrome, whose aetiology and pathogenesis remains unknown, is characterized by significant changes in the vaginal ecosystem. These changes consist of a decrease in the number of lactobacilli and a large increase in the number of anaerobic organisms. The bacteria adhere to desquamated epithelial cells with a distinctive appearance of clue cells The main complaints of women with symptomatic bacterial vaginosis include vaginal discharge and odour. However, a significant number of all women who have bacterial vaginosis deny symptoms. Bacterial vaginosis is associated with a number of gynaecologic and obstetric complications including cervicitis, cervical neoplasia, pelvic inflammatory disease, postoperative infections, and preterm labour. The diagnosis is most frequently made based on vaginal smear stained according to Gram (Nugent scoring method. Metronidazole and clindamycin are the drugs of choice for treatment of women with bacterial vaginosis. Which women should undergo treatment? According to the prevailing attitude, it should include women with symptoms. Symptomatic women with frequent relapses of bacterial vaginosisas, as a rule, have poor response to the applied therapy. To achieve better efficiency in the treatment of such women, it is necessary to have more extensive understanding of all factors in the pathogenesis of the syndrome.

  4. Utility of in vivo transcription profiling for identifying Pseudomonas aeruginosa genes needed for gastrointestinal colonization and dissemination

    DEFF Research Database (Denmark)

    Koh, Andrew Y; Mikkelsen, Per J; Smith, Roger S

    2010-01-01

    Microarray analysis of Pseudomonas aeruginosa mRNA transcripts expressed in vivo during animal infection has not been previously used to investigate potential virulence factors needed in this setting. We compared mRNA expression in bacterial cells recovered from the gastrointestinal (GI) tracts o...

  5. Bacterial Internalization, Localization, and Effectors Shape the Epithelial Immune Response during Shigella flexneri Infection.

    Science.gov (United States)

    Lippmann, Juliane; Gwinner, Frederik; Rey, Camille; Tamir, Uyanga; Law, Helen K W; Schwikowski, Benno; Enninga, Jost

    2015-09-01

    Intracellular pathogens are differentially sensed by the compartmentalized host immune system. Nevertheless, gene expression studies of infected cells commonly average the immune responses, neglecting the precise pathogen localization. To overcome this limitation, we dissected the transcriptional immune response to Shigella flexneri across different infection stages in bulk and single cells. This identified six distinct transcriptional profiles characterizing the dynamic, multilayered host response in both bystander and infected cells. These profiles were regulated by external and internal danger signals, as well as whether bacteria were membrane bound or cytosolic. We found that bacterial internalization triggers a complex, effector-independent response in bystander cells, possibly to compensate for the undermined host gene expression in infected cells caused by bacterial effectors, particularly OspF. Single-cell analysis revealed an important bacterial strategy to subvert host responses in infected cells, demonstrating that OspF disrupts concomitant gene expression of proinflammatory, apoptosis, and stress pathways within cells. This study points to novel mechanisms through which bacterial internalization, localization, and injected effectors orchestrate immune response transcriptional signatures. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. The Csr system regulates genome-wide mRNA stability and transcription and thus gene expression in Escherichia coli.

    Science.gov (United States)

    Esquerré, Thomas; Bouvier, Marie; Turlan, Catherine; Carpousis, Agamemnon J; Girbal, Laurence; Cocaign-Bousquet, Muriel

    2016-04-26

    Bacterial adaptation requires large-scale regulation of gene expression. We have performed a genome-wide analysis of the Csr system, which regulates many important cellular functions. The Csr system is involved in post-transcriptional regulation, but a role in transcriptional regulation has also been suggested. Two proteins, an RNA-binding protein CsrA and an atypical signaling protein CsrD, participate in the Csr system. Genome-wide transcript stabilities and levels were compared in wildtype E. coli (MG1655) and isogenic mutant strains deficient in CsrA or CsrD activity demonstrating for the first time that CsrA and CsrD are global negative and positive regulators of transcription, respectively. The role of CsrA in transcription regulation may be indirect due to the 4.6-fold increase in csrD mRNA concentration in the CsrA deficient strain. Transcriptional action of CsrA and CsrD on a few genes was validated by transcriptional fusions. In addition to an effect on transcription, CsrA stabilizes thousands of mRNAs. This is the first demonstration that CsrA is a global positive regulator of mRNA stability. For one hundred genes, we predict that direct control of mRNA stability by CsrA might contribute to metabolic adaptation by regulating expression of genes involved in carbon metabolism and transport independently of transcriptional regulation.

  7. Alternative staffing services. Contract transcription.

    Science.gov (United States)

    Tessier, C

    1992-03-01

    Contract medical transcription services can be of great assistance in meeting the demands for transcription, without jeopardizing patient, physician, or institutional confidentiality. You simply must require the contract service to provide at least the same degree of protection and preservation of confidentiality that you should require inhouse. To achieve this you must make these requirements explicit, comprehensive, comprehensible, believable, and enforceable. Discuss the requirements with prospective contractors. Review them at least annually with existing contractors and when contracts are due for renewal. Be sure to specify the consequence of breaching confidentiality, and if there are breaches, enforce the terms of the contract. Consult your institution's legal counsel both in developing the contract and in enforcing its provisions. Take into consideration your department's and institution's policies, AHIMA's statement on confidentiality, as well as local, state, and federal laws. Above all, never lose sight of the patient. Ultimately, it is not patient information that you are obligated to protect. It is the patient.

  8. Bacterial Prostatitis: Bacterial Virulence, Clinical Outcomes, and New Directions.

    Science.gov (United States)

    Krieger, John N; Thumbikat, Praveen

    2016-02-01

    Four prostatitis syndromes are recognized clinically: acute bacterial prostatitis, chronic bacterial prostatitis, chronic prostatitis/chronic pelvic pain syndrome, and asymptomatic prostatitis. Because Escherichia coli represents the most common cause of bacterial prostatitis, we investigated the importance of bacterial virulence factors and antimicrobial resistance in E. coli strains causing prostatitis and the potential association of these characteristics with clinical outcomes. A structured literature review revealed that we have limited understanding of the virulence-associated characteristics of E. coli causing acute prostatitis. Therefore, we completed a comprehensive microbiological and molecular investigation of a unique strain collection isolated from healthy young men. We also considered new data from an animal model system suggesting certain E. coli might prove important in the etiology of chronic prostatitis/chronic pelvic pain syndrome. Our human data suggest that E. coli needs multiple pathogenicity-associated traits to overcome anatomic and immune responses in healthy young men without urological risk factors. The phylogenetic background and accumulation of an exceptional repertoire of extraintestinal pathogenic virulence-associated genes indicate that these E. coli strains belong to a highly virulent subset of uropathogenic variants. In contrast, antibiotic resistance confers little added advantage to E. coli strains in these healthy outpatients. Our animal model data also suggest that certain pathogenic E. coli may be important in the etiology of chronic prostatitis/chronic pelvic pain syndrome through mechanisms that are dependent on the host genetic background and the virulence of the bacterial strain.

  9. Transcriptional control of t lymphocyte differentiation

    NARCIS (Netherlands)

    F.J.T. Staal (Frank); F. Weerkamp (Floor); A.W. Langerak (Anton); R.W. Hendriks (Rudi); H.C. Clevers (Hans)

    2001-01-01

    textabstractInitiation of gene transcription by transcription factors (TFs) is an important regulatory step in many developmental processes. The differentiation of T cell progenitors in the thymus is tightly controlled by signaling molecules, ultimately activating

  10. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    Energy Technology Data Exchange (ETDEWEB)

    Tennyson, C.N.; Worton, R.G. [Univ. of Toronto and the Hospital for Sick Children, Ontario (Canada)

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  11. H-NS silences gfp, the green fluorescent protein gene: gfpTCD is a genetically Remastered gfp gene with reduced susceptibility to H-NS-mediated transcription silencing and with enhanced translation.

    Science.gov (United States)

    Corcoran, Colin P; Cameron, Andrew D S; Dorman, Charles J

    2010-09-01

    The bacterial nucleoid-associated protein H-NS, which preferentially targets and silences A+T-rich genes, binds the ubiquitous reporter gene gfp and dramatically reduces local transcription. We have redesigned gfp to reduce H-NS-mediated transcription silencing and simultaneously improve translation in vivo without altering the amino acid sequence of the GFP protein.

  12. The Human Vaginal Bacterial Biota and Bacterial Vaginosis

    Directory of Open Access Journals (Sweden)

    Sujatha Srinivasan

    2008-01-01

    Full Text Available The bacterial biota of the human vagina can have a profound impact on the health of women and their neonates. Changes in the vaginal microbiota have been associated with several adverse health outcomes including premature birth, pelvic inflammatory disease, and acquisition of HIV infection. Cultivation-independent molecular methods have provided new insights regarding bacterial diversity in this important niche, particularly in women with the common condition bacterial vaginosis (BV. PCR methods have shown that women with BV have complex communities of vaginal bacteria that include many fastidious species, particularly from the phyla Bacteroidetes and Actinobacteria. Healthy women are mostly colonized with lactobacilli such as Lactobacillus crispatus, Lactobacillus jensenii, and Lactobacillus iners, though a variety of other bacteria may be present. The microbiology of BV is heterogeneous. The presence of Gardnerella vaginalis and Atopobium vaginae coating the vaginal epithelium in some subjects with BV suggests that biofilms may contribute to this condition.

  13. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    Directory of Open Access Journals (Sweden)

    Anam eYousaf

    2015-09-01

    Full Text Available Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS. In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four SS genes (i.e. SSA, SS1, SS2 and SS3, the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43% and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  14. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    Science.gov (United States)

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  15. Bacterial contamination of blood products.

    Science.gov (United States)

    Palavecino, Elizabeth; Jacobs, Michael; Yomtovian, Roslyn

    2004-11-01

    The occurrence of a septic reaction resulting from bacterial contamination of blood products, particularly with room-temperature stored platelets, is the most common transfusion-associated infectious risk in the United States. Bacterial contamination of blood products was first identified more than 60 years ago; yet, strategies to resolve this problem have proved daunting despite ongoing awareness and increasing concern especially in the last few years. With the recent US Food and Drug Administration (FDA) approval of culture methods for quality control testing of platelet units and the promulgation of accreditation standards by the College of American Pathologists and American Association of Blood Banks to detect bacterially contaminated platelet units and to prevent transfusion of these units, blood banks and transfusion services have finally started to address this problem, in a more standardized manner. Furthermore, as new methods of interdicting, inactivating and detecting bacterially contaminated blood products emerge, it is hoped that the problem of bacterial contamination of blood products will be overcome.

  16. Community-acquired bacterial meningitis.

    Science.gov (United States)

    Costerus, Joost M; Brouwer, Matthijs C; Bijlsma, Merijn W; van de Beek, Diederik

    2017-02-01

    Bacterial meningitis is a medical emergency and is associated with a high disease burden. We reviewed recent progress in the management of patients with community-acquired bacterial meningitis. The worldwide burden of disease of bacterial meningitis remains high, despite the decreasing incidence following introduction of routine vaccination campaigns. Delay in diagnosis and treatment remain major concerns in the management of acute bacterial meningitis. European Society of Clinical Microbiology and Infectious Diseases guidelines strive for a door-to-antibiotic-time less than 1 h. Polymerase chain reaction (PCR) has emerged as an important diagnostic tool to identify the causative organism. Point-of-care tests using fast multiplex PCR have been developed, but additional value has not been proven. Although anecdotal observations advocate pressure-based management, a randomized controlled trial will need to be performed first to determine efficacy and safety of such an aggressive treatment approach. Adjunctive dexamethasone remains the only adjunctive therapy with proven efficacy. The incidence of bacterial meningitis has been decreasing after the implementation of effective vaccines. Treatment should be administered as soon as possible and time to treatment should not exceed 1 h.

  17. A transcript cleavage factor of Mycobacterium tuberculosis important for its survival.

    Directory of Open Access Journals (Sweden)

    Arnab China

    Full Text Available After initiation of transcription, a number of proteins participate during elongation and termination modifying the properties of the RNA polymerase (RNAP. Gre factors are one such group conserved across bacteria. They regulate transcription by projecting their N-terminal coiled-coil domain into the active center of RNAP through the secondary channel and stimulating hydrolysis of the newly synthesized RNA in backtracked elongation complexes. Rv1080c is a putative gre factor (MtbGre in the genome of Mycobacterium tuberculosis. The protein enhanced the efficiency of promoter clearance by lowering abortive transcription and also rescued arrested and paused elongation complexes on the GC rich mycobacterial template. Although MtbGre is similar in domain organization and shares key residues for catalysis and RNAP interaction with the Gre factors of Escherichia coli, it could not complement an E. coli gre deficient strain. Moreover, MtbGre failed to rescue E. coli RNAP stalled elongation complexes, indicating the importance of specific protein-protein interactions for transcript cleavage. Decrease in the level of MtbGre reduced the bacterial survival by several fold indicating its essential role in mycobacteria. Another Gre homolog, Rv3788 was not functional in transcript cleavage activity indicating that a single Gre is sufficient for efficient transcription of the M. tuberculosis genome.

  18. The global regulatory architecture of transcription during the Caulobacter cell cycle.

    Directory of Open Access Journals (Sweden)

    Bo Zhou

    2015-01-01

    Full Text Available Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.

  19. Abdominal radiation causes bacterial translocation

    International Nuclear Information System (INIS)

    Guzman-Stein, G.; Bonsack, M.; Liberty, J.; Delaney, J.P.

    1989-01-01

    The purpose of this study was to determine if a single dose of radiation to the rat abdomen leads to bacterial translocation into the mesenteric lymph nodes (MLN). A second issue addressed was whether translocation correlates with anatomic damage to the mucosa. The radiated group (1100 cGy) which received anesthesia also was compared with a control group and a third group which received anesthesia alone but no abdominal radiation. Abdominal radiation lead to 100% positive cultures of MLN between 12 hr and 4 days postradiation. Bacterial translocation was almost nonexistent in the control and anesthesia group. Signs of inflammation and ulceration of the intestinal mucosa were not seen until Day 3 postradiation. Mucosal damage was maximal by Day 4. Bacterial translocation onto the MLN after a single dose of abdominal radiation was not apparently dependent on anatomical, histologic damage of the mucosa

  20. Bacterial Degradation of Aromatic Compounds

    Directory of Open Access Journals (Sweden)

    Qing X. Li

    2009-01-01

    Full Text Available Aromatic compounds are among the most prevalent and persistent pollutants in the environment. Petroleum-contaminated soil and sediment commonly contain a mixture of polycyclic aromatic hydrocarbons (PAHs and heterocyclic aromatics. Aromatics derived from industrial activities often have functional groups such as alkyls, halogens and nitro groups. Biodegradation is a major mechanism of removal of organic pollutants from a contaminated site. This review focuses on bacterial degradation pathways of selected aromatic compounds. Catabolic pathways of naphthalene, fluorene, phenanthrene, fluoranthene, pyrene, and benzo[a]pyrene are described in detail. Bacterial catabolism of the heterocycles dibenzofuran, carbazole, dibenzothiophene, and dibenzodioxin is discussed. Bacterial catabolism of alkylated PAHs is summarized, followed by a brief discussion of proteomics and metabolomics as powerful tools for elucidation of biodegradation mechanisms.

  1. Bacterial computing with engineered populations.

    Science.gov (United States)

    Amos, Martyn; Axmann, Ilka Maria; Blüthgen, Nils; de la Cruz, Fernando; Jaramillo, Alfonso; Rodriguez-Paton, Alfonso; Simmel, Friedrich

    2015-07-28

    We describe strategies for the construction of bacterial computing platforms by describing a number of results from the recently completed bacterial computing with engineered populations project. In general, the implementation of such systems requires a framework containing various components such as intracellular circuits, single cell input/output and cell-cell interfacing, as well as extensive analysis. In this overview paper, we describe our approach to each of these, and suggest possible areas for future research. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  2. Transcriptional regulators of legume-rhizobia symbiosis: nuclear factors Ys and GRAS are two for tango.

    Science.gov (United States)

    Rípodas, Carolina; Clúa, Joaquín; Battaglia, Marina; Baudin, Maël; Niebel, Andreas; Zanetti, María Eugenia; Blanco, Flavio

    2014-01-01

    Transcription factors are DNA binding proteins that regulate gene expression. The nitrogen fixing symbiosis established between legume plants and soil bacteria is a complex interaction, in which plants need to integrate signals derived from the symbiont and the surrounding environment to initiate the developmental program of nodule organogenesis and the infection process. Several transcription factors that play critical roles in these processes have been reported in the past decade, including proteins of the GRAS and NF-Y families. Recently, we reported the characterization of a new GRAS domain containing-protein that interacts with a member of the C subunit of the NF-Y family, which plays an important role in nodule development and the progression of bacterial infection during the symbiotic interaction. The connection between transcription factors of these families highlights the significance of multimeric complexes in the fabulous capacity of plants to integrate and respond to multiple environmental stimuli.

  3. The Journey of a Transcription Factor

    DEFF Research Database (Denmark)

    Pireyre, Marie

    in their regulation at multiple steps of their activation. Plant signaling in connection with transcription factor regulation is an exciting field, allowing research on multiple regulatory mechanisms. This thesis shed light on the importance of integrating all steps of transcription factor activation in a regulatory......Plants have developed astonishing networks regulating their metabolism to adapt to their environment. The complexity of these networks is illustrated by the expansion of families of regulators such as transcription factors in the plant kingdom. Transcription factors specifically impact...... MYBs to activate transcription of GLS biosynthetic genes. A lot is known about transcriptional regulation of these nine GLS regulators. This thesis aimed at identifying regulatory mechanisms at the protein level, allowing rapid and specific regulation of transcription factors using GLS as a model...

  4. A novel in vivo inducible expression system in Edwardsiella tarda for potential application in bacterial polyvalence vaccine.

    Science.gov (United States)

    Mu, Wei; Guan, Lingyu; Yan, Yijian; Liu, Qin; Zhang, Yuanxing

    2011-12-01

    Recombinant bacterial vector vaccine is an attractive vaccination strategy to induce the immune response to a carried protective antigen, and the main concern of bacterial vector vaccine is to establish a stable antigen expression system in vector bacteria. Edwardsiella tarda is an important facultative intracellular pathogen of both animals and humans, and its attenuated derivates are excellent bacterial vectors for use in recombinant vaccine design. In this study, we design an in vivo inducible expression system in E. tarda and establish potential recombinant E. tarda vector vaccines. With wild type strain E. tarda EIB202 as a vector, 53 different bacteria-originated promoters were examined for iron-responsive transcription in vitro, and the promoters P(dps) and P(yncE) showed high transcription activity. The transcription profiles in vivo of two promoters were further assayed, and P(dps) revealed an enhanced in vivo inducible transcription in macrophage, larvae and adult zebra fish. The gapA34 gene, encoding the protective antigen GAPDH from the fish pathogen Aeromonas hydrophila LSA34, was introduced into the P(dps)-based protein expression system, and transformed into attenuated E. tarda strains. The resultant recombinant vector vaccine WED/pUTDgap was evaluated in turbot (Scophtalmus maximus). Over 60% of the vaccinated fish survived under the challenge with A. hydrophila LSA34 and E. tarda EIB202, suggesting that the P(dps)-based antigen delivery system had great potential in bacterial vector vaccine application. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Base Flipping in Open Complex Formation at Bacterial Promoters

    Directory of Open Access Journals (Sweden)

    Mary E. Karpen

    2015-04-01

    Full Text Available In the process of transcription initiation, the bacterial RNA polymerase binds double-stranded (ds promoter DNA and subsequently effects strand separation of 12 to 14 base pairs (bp, including the start site of transcription, to form the so-called “open complex” (also referred to as RPo. This complex is competent to initiate RNA synthesis. Here we will review the role of σ70 and its homologs in the strand separation process, and evidence that strand separation is initiated at the −11A (the A of the non-template strand that is 11 bp upstream from the transcription start site of the promoter. By using the fluorescent adenine analog, 2-aminopurine, it was demonstrated that the −11A on the non-template strand flips out of the DNA helix and into a hydrophobic pocket where it stacks with tyrosine 430 of σ70. Open complexes are remarkably stable, even though in vivo, and under most experimental conditions in vitro, dsDNA is much more stable than its strand-separated form. Subsequent structural studies of other researchers have confirmed that in the open complex the −11A has flipped into a hydrophobic pocket of σ70. It was also revealed that RPo was stabilized by three additional bases of the non-template strand being flipped out of the helix and into hydrophobic pockets, further preventing re-annealing of the two complementary DNA strands.

  6. Initiation of mtDNA transcription is followed by pausing, and diverges across human cell types and during evolution.

    Science.gov (United States)

    Blumberg, Amit; Rice, Edward J; Kundaje, Anshul; Danko, Charles G; Mishmar, Dan

    2017-03-01

    Mitochondrial DNA (mtDNA) genes are long known to be cotranscribed in polycistrones, yet it remains impossible to study nascent mtDNA transcripts quantitatively in vivo using existing tools. To this end, we used deep sequencing (GRO-seq and PRO-seq) and analyzed nascent mtDNA-encoded RNA transcripts in diverse human cell lines and metazoan organisms. Surprisingly, accurate detection of human mtDNA transcription initiation sites (TISs) in the heavy and light strands revealed a novel conserved transcription pausing site near the light-strand TIS. This pausing site correlated with the presence of a bacterial pausing sequence motif, with reduced SNP density, and with a DNase footprinting signal in all tested cells. Its location within conserved sequence block 3 (CSBIII), just upstream of the known transcription-replication transition point, suggests involvement in such transition. Analysis of nonhuman organisms enabled de novo mtDNA sequence assembly, as well as detection of previously unknown mtDNA TIS, pausing, and transcription termination sites with unprecedented accuracy. Whereas mammals ( Pan troglodytes , Macaca mulatta , Rattus norvegicus , and Mus musculus ) showed a human-like mtDNA transcription pattern, the invertebrate pattern ( Drosophila melanogaster and Caenorhabditis elegans ) profoundly diverged. Our approach paves the path toward in vivo, quantitative, reference sequence-free analysis of mtDNA transcription in all eukaryotes. © 2017 Blumberg et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Comparative study between transcriptionally- and translationally-acting adenine riboswitches reveals key differences in riboswitch regulatory mechanisms.

    Directory of Open Access Journals (Sweden)

    Jean-François Lemay

    2011-01-01

    Full Text Available Many bacterial mRNAs are regulated at the transcriptional or translational level by ligand-binding elements called riboswitches. Although they both bind adenine, the adenine riboswitches of Bacillus subtilis and Vibrio vulnificus differ by controlling transcription and translation, respectively. Here, we demonstrate that, beyond the obvious difference in transcriptional and translational modulation, both adenine riboswitches exhibit different ligand binding properties and appear to operate under different regulation regimes (kinetic versus thermodynamic. While the B. subtilis pbuE riboswitch fully depends on co-transcriptional binding of adenine to function, the V. vulnificus add riboswitch can bind to adenine after transcription is completed and still perform translation regulation. Further investigation demonstrates that the rate of transcription is critical for the B. subtilis pbuE riboswitch to perform efficiently, which is in agreement with a co-transcriptional regulation. Our results suggest that the nature of gene regulation control, that is transcription or translation, may have a high importance in riboswitch regulatory mechanisms.

  8. Genetic and Physiological Activation of Osmosensitive Gene Expression Mimics Transcriptional Signatures of Pathogen Infection in C. elegans

    Science.gov (United States)

    Rohlfing, Anne-Katrin; Miteva, Yana; Hannenhalli, Sridhar; Lamitina, Todd

    2010-01-01

    The soil-dwelling nematode C. elegans is a powerful system for comparative molecular analyses of environmental stress response mechanisms. Infection of worms with bacterial and fungal pathogens causes the activation of well-characterized innate immune transcriptional programs in pathogen-exposed hypodermal and intestinal tissues. However, the pathophysiological events that drive such transcriptional responses are not understood. Here, we show that infection-activated transcriptional responses are, in large part, recapitulated by either physiological or genetic activation of the osmotic stress response. Microarray profiling of wild type worms exposed to non-lethal hypertonicity identified a suite of genes that were also regulated by infection. Expression profiles of five different osmotic stress resistant (osr) mutants under isotonic conditions reiterated the wild type transcriptional response to osmotic stress and also showed substantial similarity to infection-induced gene expression under isotonic conditions. Computational, transgenic, and functional approaches revealed that two GATA transcription factors previously implicated in infection-induced transcriptional responses, elt-2 and elt-3, are also essential for coordinated tissue-specific activation of osmosensitive gene expression and promote survival under osmotically stressful conditions. Together, our data suggest infection and osmotic adaptation share previously unappreciated transcriptional similarities which might be controlled via regulation of tissue-specific GATA transcription factors. PMID:20126308

  9. Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, I.; Krásný, Libor; Hocek, Michal

    2016-01-01

    Roč. 44, č. 7 (2016), s. 3000-3012 ISSN 0305-1048 R&D Projects: GA ČR GA14-04289S Institutional support: RVO:61388963 ; RVO:61388971 Keywords : Escherichia coli RNA * Bacillus subtilis * restriction endonucleases Subject RIV: CC - Organic Chemistry; EE - Microbiology, Virology (MBU-M) Impact factor: 10.162, year: 2016 http://nar.oxfordjournals.org/content/44/7/3000.full

  10. Serine/threonine/tyrosine phosphorylation regulates DNA binding of bacterial transcriptional regulators

    DEFF Research Database (Denmark)

    Kalantari, Aida; Derouiche, Abderahmane; Shi, Lei

    2015-01-01

    of residue, i.e. serine, threonine, tyrosine and cysteine, is also quite common. The phosphorylation of the ester type (phospho-serine/threonine/tyrosine) is more stable than the aspartate phosphorylation of TCSs. The kinases which catalyse these phosphorylation events (Hanks-type serine/threonine protein...

  11. Gene transcription and electromagnetic fields

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, A.S.

    1992-01-01

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  12. Self-splicing of a group IIC intron: 5? exon recognition and alternative 5? splicing events implicate the stem?loop motif of a transcriptional terminator

    OpenAIRE

    Toor, Navtej; Robart, Aaron R.; Christianson, Joshua; Zimmerly, Steven

    2006-01-01

    Bacterial IIC introns are a newly recognized subclass of group II introns whose ribozyme properties have not been characterized in detail. IIC introns are typically located downstream of transcriptional terminator motifs (inverted repeat followed by T's) or other inverted repeats in bacterial genomes. Here we have characterized the self-splicing activity of a IIC intron, B.h.I1, from Bacillus halodurans. B.h.I1 self-splices in vitro through hydrolysis to produce linear intron, but interesting...

  13. Biotechnological applications of bacterial cellulases

    Czech Academy of Sciences Publication Activity Database

    Menéndez, E.; García-Fraile, Paula; Rivas, R.

    2015-01-01

    Roč. 2, č. 3 (2015), s. 163-182 ISSN 2306-5354 R&D Projects: GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Biotechnological applications * Bacterial cellulases * Cellulose degradation Subject RIV: EE - Microbiology, Virology

  14. Disease notes - Bacterial root rot

    Science.gov (United States)

    Bacterial root rot initiated by lactic acid bacteria, particularly Leuconostoc, occurs every year in Idaho sugarbeet fields. Hot fall weather seems to make the problem worse. Although Leuconostoc initiates the rot, other bacteria and yeast frequently invade the tissue as well. The acetic acid bac...

  15. Metagenomic Diagnosis of Bacterial Infections

    Science.gov (United States)

    Nakamura, Shota; Maeda, Norihiro; Miron, Ionut Mihai; Yoh, Myonsun; Izutsu, Kaori; Kataoka, Chidoh; Honda, Takeshi; Yasunaga, Teruo; Nakaya, Takaaki; Kawai, Jun; Hayashizaki, Yoshihide; Horii, Toshihiro

    2008-01-01

    To test the ability of high-throughput DNA sequencing to detect bacterial pathogens, we used it on DNA from a patient’s feces during and after diarrheal illness. Sequences showing best matches for Campylobacter jejuni were detected only in the illness sample. Various bacteria may be detectable with this metagenomic approach. PMID:18976571

  16. bacterial flora and antibiotic sensitivity

    African Journals Online (AJOL)

    Purulent pelvic collections are common pathologies observed in contemporary gynaecological practice. They may originate from chronic pelvic inflammatory disease, from abortions or following normal deliveries. This study was designed to compare the bacterial flora in purulent pelvic collections obtained from HIV infected ...

  17. Community-acquired bacterial meningitis

    NARCIS (Netherlands)

    van de Beek, Diederik; Brouwer, Matthijs; Hasbun, Rodrigo; Koedel, Uwe; Whitney, Cynthia G.; Wijdicks, Eelco

    2016-01-01

    Meningitis is an inflammation of the meninges and subarachnoid space that can also involve the brain cortex and parenchyma. It can be acquired spontaneously in the community - community-acquired bacterial meningitis - or in the hospital as a complication of invasive procedures or head trauma

  18. Molecular mechanisms underlying bacterial persisters

    DEFF Research Database (Denmark)

    Maisonneuve, Etienne; Gerdes, Kenn

    2014-01-01

    All bacteria form persisters, cells that are multidrug tolerant and therefore able to survive antibiotic treatment. Due to the low frequencies of persisters in growing bacterial cultures and the complex underlying molecular mechanisms, the phenomenon has been challenging to study. However, recent...

  19. Biotechnological applications of bacterial cellulases

    Directory of Open Access Journals (Sweden)

    Esther Menendez

    2015-08-01

    Full Text Available Cellulases have numerous applications in several industries, including biofuel production, food and feed industry, brewing, pulp and paper, textile, laundry, and agriculture.Cellulose-degrading bacteria are widely spread in nature, being isolated from quite different environments. Cellulose degradation is the result of a synergic process between an endoglucanase, an exoglucanase and a,β-glucosidase. Bacterial endoglucanases degrade ß-1,4-glucan linkages of cellulose amorphous zones, meanwhile exoglucanases cleave the remaining oligosaccharide chains, originating cellobiose, which is hydrolyzed by ß-glucanases. Bacterial cellulases (EC 3.2.1.4 are comprised in fourteen Glycosil Hydrolase families. Several advantages, such as higher growth rates and genetic versatility, emphasize the suitability and advantages of bacterial cellulases over other sources for this group of enzymes. This review summarizes the main known cellulolytic bacteria and the best strategies to optimize their cellulase production, focusing on endoglucanases, as well as it reviews the main biotechnological applications of bacterial cellulases in several industries, medicine and agriculture.

  20. Mitotic Transcriptional Activation: Clearance of Actively Engaged Pol II via Transcriptional Elongation Control in Mitosis.

    Science.gov (United States)

    Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali

    2015-11-05

    Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Towards identifying host cell-type specific response patterns to bacterial endosymbiosis

    DEFF Research Database (Denmark)

    Gavrilovic, Srdjan

    the evolutionary success of the interaction. Precise spatial and temporal coordination of the expression of numerous genes is necessary to develop and maintain such a complex interaction. Many gene expression studies have been conducted to gain insight into bacterial root endosymbiosis. From a historical point......, and whole plant transformants were regenerated. These will form a basis for isolating transcriptionally active mRNA fractions associated with ribosomes and 21 nt long small RNAs from targeted cell populations....

  2. Bacterial cells with improved tolerance to polyamines

    DEFF Research Database (Denmark)

    2017-01-01

    Provided are bacterial cells genetically modified to improve their tolerance to certain commodity chemicals, such as polyamines, and methods of preparing and using such bacterial cells for production of polyamines and other compounds....

  3. Bacterial cells with improved tolerance to polyols

    DEFF Research Database (Denmark)

    2017-01-01

    The present invention relates to bacterial cells genetically modified to improve their tolerance to certain commodity chemicals, such as diols and other polyols, and to methods of preparing and using such bacterial cells for production of polyols and other compounds....

  4. Adjunctive Corticosteroids in Adults with Bacterial Meningitis

    NARCIS (Netherlands)

    van de Beek, Diederik; de Gans, Jan

    2005-01-01

    Bacterial meningitis is a complex disorder in which neurologic injury is caused, in part, by the causative organism and, in part, by the host's own inflammatory response. In studies of experimental bacterial meningitis, adjuvant treatment with corticosteroids, specifically dexamethasone, has

  5. Endocarditis in adults with bacterial meningitis

    NARCIS (Netherlands)

    Lucas, Marjolein J.; Brouwer, Matthijs C.; van der Ende, Arie; van de Beek, Diederik

    2013-01-01

    Endocarditis may precede or complicate bacterial meningitis, but the incidence and impact of endocarditis in bacterial meningitis are unknown. We assessed the incidence and clinical characteristics of patients with meningitis and endocarditis from a nationwide cohort study of adults with

  6. Dexamethasone in adults with bacterial meningitis

    NARCIS (Netherlands)

    de Gans, Jan; van de Beek, Diederik

    2002-01-01

    Background: Mortality and morbidity rates are high among adults with acute bacterial meningitis, especially those with pneumococcal meningitis. In studies of bacterial meningitis in animals, adjuvant treatment with corticosteroids has beneficial effects. Methods: We conducted a prospective,

  7. Cognitive outcome in adults after bacterial meningitis

    NARCIS (Netherlands)

    Hoogman, Martine; van de Beek, Diederik; Weisfelt, Martijn; de Gans, Jan; Schmand, Ben

    2007-01-01

    OBJECTIVE: To evaluate cognitive outcome in adult survivors of bacterial meningitis. METHODS: Data from three prospective multicentre studies were pooled and reanalysed, involving 155 adults surviving bacterial meningitis (79 after pneumococcal and 76 after meningococcal meningitis) and 72 healthy

  8. Cognitive outcome in adults after bacterial meningitis.

    NARCIS (Netherlands)

    Hoogman, M.; Beek, D. van de; Weisfelt, M.; Gans, J. de; Schmand, B.A.

    2007-01-01

    OBJECTIVE: To evaluate cognitive outcome in adult survivors of bacterial meningitis. METHODS: Data from three prospective multicentre studies were pooled and reanalysed, involving 155 adults surviving bacterial meningitis (79 after pneumococcal and 76 after meningococcal meningitis) and 72 healthy

  9. Antimicrobial susceptibility in community-acquired bacterial ...

    African Journals Online (AJOL)

    Objectives: To determine the antimicrobial susceptibility patterns of Streptococcus pneumoniae and Haemophilus influenzae, two bacterial pathogens commonly associated with communityacquired pneumonia. Design: Cross-sectional study. Setting: Bacterial isolates were obtained from adults suspected to have ...

  10. (PCR) in the diagnosis of bacterial infections

    African Journals Online (AJOL)

    ... bacterial infections that can be diagnosed using the technique which include among others; Tuberculosis (TB), whooping cough, brain abscesses and spinal infection, otitis media with effusion, Mycoplasmal pneumonia, endophthalmitis and bacterial meningitis. Keywords: Polymerase chain reaction, Diagnosis, Bacteria, ...

  11. Specificity and robustness in transcription control networks.

    Science.gov (United States)

    Sengupta, Anirvan M; Djordjevic, Marko; Shraiman, Boris I

    2002-02-19

    Recognition by transcription factors of the regulatory DNA elements upstream of genes is the fundamental step in controlling gene expression. How does the necessity to provide stability with respect to mutation constrain the organization of transcription control networks? We examine the mutation load of a transcription factor interacting with a set of n regulatory response elements as a function of the factor/DNA binding specificity and conclude on theoretical grounds that the optimal specificity decreases with n. The predicted correlation between variability of binding sites (for a given transcription factor) and their number is supported by the genomic data for Escherichia coli. The analysis of E. coli genomic data was carried out using an algorithm suggested by the biophysical model of transcription factor/DNA binding. Complete results of the search for candidate transcription factor binding sites are available at http://www.physics.rockefeller.edu/~boris/public/search_ecoli.

  12. How deep is deep enough for RNA-Seq profiling of bacterial transcriptomes?

    Directory of Open Access Journals (Sweden)

    Haas Brian J

    2012-12-01

    Full Text Available Abstract Background High-throughput sequencing of cDNA libraries (RNA-Seq has proven to be a highly effective approach for studying bacterial transcriptomes. A central challenge in designing RNA-Seq-based experiments is estimating a priori the number of reads per sample needed to detect and quantify thousands of individual transcripts with a large dynamic range of abundance. Results We have conducted a systematic examination of how changes in the number of RNA-Seq reads per sample influences both profiling of a single bacterial transcriptome and the comparison of gene expression among samples. Our findings suggest that the number of reads typically produced in a single lane of the Illumina HiSeq sequencer far exceeds the number needed to saturate the annotated transcriptomes of diverse bacteria growing in monoculture. Moreover, as sequencing depth increases, so too does the detection of cDNAs that likely correspond to spurious transcripts or genomic DNA contamination. Finally, even when dozens of barcoded individual cDNA libraries are sequenced in a single lane, the vast majority of transcripts in each sample can be detected and numerous genes differentially expressed between samples can be identified. Conclusions Our analysis provides a guide for the many researchers seeking to determine the appropriate sequencing depth for RNA-Seq-based studies of diverse bacterial species.

  13. Transcription factors: Time to deliver.

    Science.gov (United States)

    Ulasov, Alexey V; Rosenkranz, Andrey A; Sobolev, Alexander S

    2018-01-10

    Transcription factors (TFs) are at the center of the broad regulatory network orchestrating gene expression programs that elicit different biological responses. For a long time, TFs have been considered as potent drug targets due to their implications in the pathogenesis of a variety of diseases. At the same time, TFs, located at convergence points of cellular regulatory pathways, are powerful tools providing opportunities both for cell type change and for managing the state of cells. This task formulation requires the TF modulation problem to come to the fore. We review several ways to manage TF activity (small molecules, transfection, nanocarriers, protein-based approaches), analyzing their limitations and the possibilities to overcome them. Delivery of TFs could revolutionize the biomedical field. Whether this forecast comes true will depend on the ability to develop convenient technologies for targeted delivery of TFs. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Transcriptional regulation by cyclic AMP.

    Science.gov (United States)

    Montminy, M

    1997-01-01

    A number of hormones and growth factors have been shown to stimulate target cells via second messenger pathways that in turn regulate the phosphorylation of specific nuclear factors. The second messenger cyclic AMP, for example, regulates a striking number of physiologic processes, including intermediary metabolism, cellular proliferation, and neuronal signaling, by altering basic patterns of gene expression. Our understanding of cyclic AMP signaling in the nucleus has expanded considerably over the past decade, owing in large part to the characterization of cyclic AMP-responsive promoter elements, transcription factors that bind them, and signal-dependent coactivators that mediate target gene induction. More importantly, these studies have revealed new insights into biological problems as diverse as biological clocks and long-term memory. The purpose of this review is to describe the components of the cyclic AMP response unit and to analyze how these components cooperate to induce target gene expression in response to hormonal stimulation.

  15. Comparative Transcriptional Analyses of Francisella tularensis and Francisella novicida.

    Directory of Open Access Journals (Sweden)

    Siva T Sarva

    Full Text Available Francisella tularensis is composed of a number of subspecies with varied geographic distribution, host ranges, and virulence. In view of these marked differences, comparative functional genomics may elucidate some of the molecular mechanism(s behind these differences. In this study a shared probe microarray was designed that could be used to compare the transcriptomes of Francisella tularensis subsp. tularensis Schu S4 (Ftt, Francisella tularensis subsp. holarctica OR960246 (Fth, Francisella tularensis subsp. holarctica LVS (LVS, and Francisella novicida U112 (Fn. To gain insight into expression differences that may be related to the differences in virulence of these subspecies, transcriptomes were measured from each strain grown in vitro under identical conditions, utilizing a shared probe microarray. The human avirulent Fn strain exhibited high levels of transcription of genes involved in general metabolism, which are pseudogenes in the human virulent Ftt and Fth strains, consistent with the process of genome decay in the virulent strains. Genes encoding an efflux system (emrA2 cluster of genes, siderophore (fsl operon, acid phosphatase, LPS synthesis, polyamine synthesis, and citrulline ureidase were all highly expressed in Ftt when compared to Fn, suggesting that some of these may contribute to the relative high virulence of Ftt. Genes expressed at a higher level in Ftt when compared to the relatively less virulent Fth included genes encoding isochorismatases, cholylglycine hydrolase, polyamine synthesis, citrulline ureidase, Type IV pilus subunit, and the Francisella Pathogenicity Island protein PdpD. Fth and LVS had very few expression differences, consistent with the derivation of LVS from Fth. This study demonstrated that a shared probe microarray designed to detect transcripts in multiple species/subspecies of Francisella enabled comparative transcriptional analyses that may highlight critical differences that underlie the relative

  16. The Bacterial Sequential Markov Coalescent.

    Science.gov (United States)

    De Maio, Nicola; Wilson, Daniel J

    2017-05-01

    Bacteria can exchange and acquire new genetic material from other organisms directly and via the environment. This process, known as bacterial recombination, has a strong impact on the evolution of bacteria, for example, leading to the spread of antibiotic resistance across clades and species, and to the avoidance of clonal interference. Recombination hinders phylogenetic and transmission inference because it creates patterns of substitutions (homoplasies) inconsistent with the hypothesis of a single evolutionary tree. Bacterial recombination is typically modeled as statistically akin to gene conversion in eukaryotes, i.e. , using the coalescent with gene conversion (CGC). However, this model can be very computationally demanding as it needs to account for the correlations of evolutionary histories of even distant loci. So, with the increasing popularity of whole genome sequencing, the need has emerged for a faster approach to model and simulate bacterial genome evolution. We present a new model that approximates the coalescent with gene conversion: the bacterial sequential Markov coalescent (BSMC). Our approach is based on a similar idea to the sequential Markov coalescent (SMC)-an approximation of the coalescent with crossover recombination. However, bacterial recombination poses hurdles to a sequential Markov approximation, as it leads to strong correlations and linkage disequilibrium across very distant sites in the genome. Our BSMC overcomes these difficulties, and shows a considerable reduction in computational demand compared to the exact CGC, and very similar patterns in simulated data. We implemented our BSMC model within new simulation software FastSimBac. In addition to the decreased computational demand compared to previous bacterial genome evolution simulators, FastSimBac provides more general options for evolutionary scenarios, allowing population structure with migration, speciation, population size changes, and recombination hotspots. FastSimBac is

  17. Bacterial reproductive pathogens of cats and dogs.

    Science.gov (United States)

    Graham, Elizabeth M; Taylor, David J

    2012-05-01

    With the notable exception of Brucella canis, exogenous bacterial pathogens are uncommon causes of reproductive disease in cats and dogs. Most bacterial reproductive infections are endogenous, and predisposing factors for infection are important. This article reviews the etiology, pathogenesis, clinical presentation, diagnosis, treatment, and public health significance of bacterial reproductive pathogens in cats and dogs.

  18. Transcription of Byzantine Chant - Problems, Possibilities, Formats

    DEFF Research Database (Denmark)

    Troelsgård, Christian

    2007-01-01

    Discusses the problems and possibilities for transsription of Byzantine chant on the basis of medieval musical manuscripts. A relatively 'neutral' style of transcription is suggested for musicological purposes....

  19. Transcriptional networks and chromatin remodeling controlling adipogenesis

    DEFF Research Database (Denmark)

    Siersbæk, Rasmus; Nielsen, Ronni; Mandrup, Susanne

    2012-01-01

    Adipocyte differentiation is tightly controlled by a transcriptional cascade, which directs the extensive reprogramming of gene expression required to convert fibroblast-like precursor cells into mature lipid-laden adipocytes. Recent global analyses of transcription factor binding and chromatin...... remodeling have revealed 'snapshots' of this cascade and the chromatin landscape at specific time-points of differentiation. These studies demonstrate that multiple adipogenic transcription factors co-occupy hotspots characterized by an open chromatin structure and specific epigenetic modifications....... Such transcription factor hotspots are likely to represent key signaling nodes which integrate multiple adipogenic signals at specific chromatin sites, thereby facilitating coordinated action on gene expression....

  20. Assembly of Active Bacterial and Fungal Communities Along a Natural Environmental Gradient.

    Science.gov (United States)

    Mueller, Rebecca C; Gallegos-Graves, Laverne; Zak, Donald R; Kuske, Cheryl R

    2016-01-01

    Dormancy is thought to promote biodiversity within microbial communities, but how assembly of the active community responds to changes in environmental conditions is unclear. To measure the active and dormant communities of bacteria and fungi colonizing decomposing litter in maple forests, we targeted ribosomal genes and transcripts across a natural environmental gradient. Within bacterial and fungal communities, the active and dormant communities were phylogenetically distinct, but patterns of phylogenetic clustering varied. For bacteria, active communities were significantly more clustered than dormant communities, while the reverse was found for fungi. The proportion of operational taxonomic units (OTUs) classified as active and the degree of phylogenetic clustering of the active bacterial communities declined with increasing pH and decreasing C/N. No significant correlations were found for the fungal community. The opposing pattern of phylogenetic clustering in dormant and active communities and the differential response of active communities to environmental gradients suggest that dormancy differentially structures bacterial and fungal communities.

  1. Subversion of innate immune responses by bacterial hindrance of NF-κB pathway.

    Science.gov (United States)

    Le Negrate, Gaëlle

    2012-02-01

    Bacterial infections cause substantial mortality and burden of disease globally. Induction of a strong innate inflammatory response is the first common host mechanism required for elimination of the invading pathogens. The host transcription factor, nuclear factor kappa B (NF-κB) is essential for immune activation. Conversely, bacterial pathogens have evolved strategies to interfere directly with host cell signalling by regulating or mimicking host proteins. Given the key role of NF-κB in the host inflammatory response, bacteria have expectedly developed virulence effectors interfering with NF-κB signalling pathways. In this review, we explore the bacterial mechanisms utilized to prevent effective NF-κB signalling, which in turn usurp the host inflammatory response. © 2011 Blackwell Publishing Ltd.

  2. Dynamics of bacterial gene regulation

    Science.gov (United States)

    Narang, Atul

    2009-03-01

    The phenomenon of diauxic growth is a classical problem of bacterial gene regulation. The most well studied example of this phenomenon is the glucose-lactose diauxie, which occurs because the expression of the lac operon is strongly repressed in the presence of glucose. This repression is often explained by appealing to molecular mechanisms such as cAMP activation and inducer exclusion. I will begin by analyzing data showing that these molecular mechanisms cannot explain the strong lac repression because they exert a relatively weak effect. I will then present a minimal model accounting only for enzyme induction and dilution, which yields strong repression despite the absence of catabolite repression and inducer exclusion. The model also explains the growth patterns observed in batch and continuous cultures of various bacterial strains and substrate mixtures. The talk will conclude with a discussion of the experimental evidence regarding positive feedback, the key component of the minimal model.

  3. Bacterial cheating limits antibiotic resistance

    Science.gov (United States)

    Xiao Chao, Hui; Yurtsev, Eugene; Datta, Manoshi; Artemova, Tanya; Gore, Jeff

    2012-02-01

    The widespread use of antibiotics has led to the evolution of resistance in bacteria. Bacteria can gain resistance to the antibiotic ampicillin by acquiring a plasmid carrying the gene beta-lactamase, which inactivates the antibiotic. This inactivation may represent a cooperative behavior, as the entire bacterial population benefits from removing the antibiotic. The cooperative nature of this growth suggests that a cheater strain---which does not contribute to breaking down the antibiotic---may be able to take advantage of cells cooperatively inactivating the antibiotic. Here we find experimentally that a ``sensitive'' bacterial strain lacking the plasmid conferring resistance can invade a population of resistant bacteria, even in antibiotic concentrations that should kill the sensitive strain. We observe stable coexistence between the two strains and find that a simple model successfully explains the behavior as a function of antibiotic concentration and cell density. We anticipate that our results will provide insight into the evolutionary origin of phenotypic diversity and cooperative behaviors.

  4. Bacterial streamers in curved microchannels

    Science.gov (United States)

    Rusconi, Roberto; Lecuyer, Sigolene; Guglielmini, Laura; Stone, Howard

    2009-11-01

    Biofilms, generally identified as microbial communities embedded in a self-produced matrix of extracellular polymeric substances, are involved in a wide variety of health-related problems ranging from implant-associated infections to disease transmissions and dental plaque. The usual picture of these bacterial films is that they grow and develop on surfaces. However, suspended biofilm structures, or streamers, have been found in natural environments (e.g., rivers, acid mines, hydrothermal hot springs) and are always suggested to stem from a turbulent flow. We report the formation of bacterial streamers in curved microfluidic channels. By using confocal laser microscopy we are able to directly image and characterize the spatial and temporal evolution of these filamentous structures. Such streamers, which always connect the inner corners of opposite sides of the channel, are always located in the middle plane. Numerical simulations of the flow provide evidences for an underlying hydrodynamic mechanism behind the formation of the streamers.

  5. Transcriptional changes are involved in phenotype switching in Streptococcus equi subspecies equi.

    Science.gov (United States)

    Steward, Karen F; Robinson, Carl; Waller, Andrew S

    2016-04-01

    Phenotypic heterogeneity within a population of bacteria, through genetic or transcriptional variation, enables survival and persistence in challenging and changing environments. We report here that a recent clinical isolate of S. equi, strain 1691 (Se1691), yielded a mixture of reduced capsule and mucoid colonies on primary isolation when grown on colistin-oxolinic acid blood agar (COBA) streptococcal selective plates. Passaging colonies of Se1691, with a reduced capsule phenotype maintained this mixed phenotype. In contrast, passaging mucoid colonies fixed the mucoid phenotype, suggesting adaptive genetic or transcriptional changes in response to growth on artificial media. However, despite obvious phenotypic and transcriptional differences, there were no apparent differences in the genome sequences of Se1691 recovered from colonies with a mucoid or reduced capsule phenotype. We identified 105 differentially transcribed genes in the transcriptomes of reduced capsule and mucoid colonies. The reduced capsule phenotype was associated with a significant reduction in transcription of the has locus (SEQ_0269 Q = 0.0015, SEQ_0270 Q = 0.0015, SEQ_0271 Q = 0.0285) and the amount of hyaluronic acid on the surface of S. equi recovered from non-mucoid colonies (P = 0.017). Significant differences in the transcription of 21 surface and secreted proteins were also observed. Our data show that changes in the bacterial transcriptome are linked to the mixed colony phenotype of Se1691.

  6. Pesticide side effects in an agricultural soil ecosystem as measured by amoA expression quantification and bacterial diversity changes

    DEFF Research Database (Denmark)

    Feld, Louise; Hjort Hjelmsø, Mathis; Schostag, Morten

    2015-01-01

    of specific microbial genes or as changes in diversity. To assess the impact of pesticides on gene expression, we focused on the amoA gene, which is involved in ammonia oxidation. We hypothesized that the amount of amoA transcript decreases upon pesticide application, and to test this hypothesis, we used...... reverse-transcription qPCR. We also hypothesized that bacterial diversity is affected by pesticides. This hypothesis was investigated via 454 sequencing and diversity analysis of the 16S ribosomal RNA and RNA genes, representing the active and total soil bacterial communities, respectively. We prepared...

  7. Bacterial antagonist mediated protein molecules

    OpenAIRE

    Urbizu, Lucia Paola; Sparo, Mónica Delfina; Sanchez Bruni, Sergio Fabian

    2016-01-01

    Bacterial antagonism mediated by ribosomally synthesised peptides has gained considerable attention in recent years because of its potential applications in the control of undesirable microbiota. These peptides, generally referred to as bacteriocins, are defined as a heterogeneous group of ribosomally synthesised, proteinaceous substances (with or without further modifications) extracellularly secreted by many Gram-positive and some Gram-negative bacteria. Their mode of activity is primarily ...

  8. Bacterial Biofilms in Jones Tubes.

    Science.gov (United States)

    Ahn, Eric S; Hauck, Matthew J; Kirk Harris, Jonathan; Robertson, Charles E; Dailey, Roger A

    To investigate the presence and microbiology of bacterial biofilms on Jones tubes (JTs) by direct visualization with scanning electron microscopy and polymerase chain reaction (PCR) of representative JTs, and to correlate these findings with inflammation and/or infection related to the JT. In this study, prospective case series were performed. JTs were recovered from consecutive patients presenting to clinic for routine cleaning or recurrent irritation/infection. Four tubes were processed for scanning electron microscopy alone to visualize evidence of biofilms. Two tubes underwent PCR alone for bacterial quantification. One tube was divided in half and sent for scanning electron microscopy and PCR. Symptoms related to the JTs were recorded at the time of recovery. Seven tubes were obtained. Five underwent SEM, and 3 out of 5 showed evidence of biofilms (60%). Two of the 3 biofilms demonstrated cocci and the third revealed rods. Three tubes underwent PCR. The predominant bacteria identified were Pseudomonadales (39%), Pseudomonas (16%), and Staphylococcus (14%). Three of the 7 patients (43%) reported irritation and discharge at presentation. Two symptomatic patients, whose tubes were imaged only, revealed biofilms. The third symptomatic patient's tube underwent PCR only, showing predominantly Staphylococcus (56%) and Haemophilus (36%) species. Two of the 4 asymptomatic patients also showed biofilms. All symptomatic patients improved rapidly after tube exchange and steroid antibiotic drops. Bacterial biofilms were variably present on JTs, and did not always correlate with patients' symptoms. Nevertheless, routine JT cleaning is recommended to treat and possibly prevent inflammation caused by biofilms.

  9. Bacterial sex in dental plaque

    Directory of Open Access Journals (Sweden)

    Ingar Olsen

    2013-06-01

    Full Text Available Genes are transferred between bacteria in dental plaque by transduction, conjugation, and transformation. Membrane vesicles can also provide a mechanism for horizontal gene transfer. DNA transfer is considered bacterial sex, but the transfer is not parallel to processes that we associate with sex in higher organisms. Several examples of bacterial gene transfer in the oral cavity are given in this review. How frequently this occurs in dental plaque is not clear, but evidence suggests that it affects a number of the major genera present. It has been estimated that new sequences in genomes established through horizontal gene transfer can constitute up to 30% of bacterial genomes. Gene transfer can be both inter- and intrageneric, and it can also affect transient organisms. The transferred DNA can be integrated or recombined in the recipient's chromosome or remain as an extrachromosomal inheritable element. This can make dental plaque a reservoir for antimicrobial resistance genes. The ability to transfer DNA is important for bacteria, making them better adapted to the harsh environment of the human mouth, and promoting their survival, virulence, and pathogenicity.

  10. Polymorphism in Bacterial Flagella Suspensions

    Science.gov (United States)

    Schwenger, Walter J.

    Bacterial flagella are a type of biological polymer studied for its role in bacterial motility and the polymorphic transitions undertaken to facilitate the run and tumble behavior. The naturally rigid, helical shape of flagella gives rise to novel colloidal dynamics and material properties. This thesis studies methods in which the shape of bacterial flagella can be controlled using in vitro methods and the changes the shape of the flagella have on both single particle dynamics and bulk material properties. We observe individual flagellum in both the dilute and semidilute regimes to observe the effects of solvent condition on the shape of the filament as well as the effect the filament morphology has on reptation through a network of flagella. In addition, we present rheological measurements showing how the shape of filaments effects the bulk material properties of flagellar suspensions. We find that the individual particle dynamics in suspensions of flagella can vary with geometry from needing to reptate linearly via rotation for helical filaments to the prevention of long range diffusion for block copolymer filaments. Similarly, for bulk material properties of flagella suspensions, helical geometries show a dramatic enhancement in elasticity over straight filaments while block copolymers form an elastic gel without the aid of crosslinking agents.

  11. Detergent-compatible bacterial amylases.

    Science.gov (United States)

    Niyonzima, Francois N; More, Sunil S

    2014-10-01

    Proteases, lipases, amylases, and cellulases are enzymes used in detergent formulation to improve the detergency. The amylases are specifically supplemented to the detergent to digest starchy stains. Most of the solid and liquid detergents that are currently manufactured contain alkaline enzymes. The advantages of using alkaline enzymes in the detergent formulation are that they aid in removing tough stains and the process is environmentally friendly since they reduce the use of toxic detergent ingredients. Amylases active at low temperature are preferred as the energy consumption gets reduced, and the whole process becomes cost-effective. Most microbial alkaline amylases are used as detergent ingredients. Various reviews report on the production, purification, characterization, and application of amylases in different industry sectors, but there is no specific review on bacterial or fungal alkaline amylases or detergent-compatible amylases. In this mini-review, an overview on the production and property studies of the detergent bacterial amylases is given, and the stability and compatibility of the alkaline bacterial amylases in the presence of the detergents and the detergent components are highlighted.

  12. Diversity of aquatic bacterial populations

    International Nuclear Information System (INIS)

    Teska, J.D.

    1988-01-01

    A study was designed to evaluate the feasibility of adapting the automated Quantum II for the identification of bacterial fish pathogens. Optimal incubation conditions were determined for each of the species used, and, by using a Chi-square goodness of fit test, it was shown that isolates could be sorted into like-species groups with a Ward's hierarchical cluster analysis technique. In a second study, population profiles, growth kinetics, and transformation kinetics were evaluated for bacteria isolated from 4 aquatic environments located in the southeastern United States. Gradual long-term accumulation of organic acids in the waters of the Okefenokee Swamp, located in southeast Georgia and northeast Florida, has resulted in acidic water ranging from pH 3.5 to 4.5. A study was designed to evaluate the metabolic efficiency of surface-water gram-negative nonfermentative bacteria and ascertain whether aquatic bacterial populations exhibit adaptation to the low pH conditions. Using the computerized AMBIS the uptake and incorporation of 35 S-methionine into bacterial proteins under 5 levels of pH was quantitated for each of the test organisms

  13. Bacterial biofilm and associated infections

    Directory of Open Access Journals (Sweden)

    Muhsin Jamal

    2018-01-01

    Full Text Available Microscopic entities, microorganisms that drastically affect human health need to be thoroughly investigated. A biofilm is an architectural colony of microorganisms, within a matrix of extracellular polymeric substance that they produce. Biofilm contains microbial cells adherent to one-another and to a static surface (living or non-living. Bacterial biofilms are usually pathogenic in nature and can cause nosocomial infections. The National Institutes of Health (NIH revealed that among all microbial and chronic infections, 65% and 80%, respectively, are associated with biofilm formation. The process of biofilm formation consists of many steps, starting with attachment to a living or non-living surface that will lead to formation of micro-colony, giving rise to three-dimensional structures and ending up, after maturation, with detachment. During formation of biofilm several species of bacteria communicate with one another, employing quorum sensing. In general, bacterial biofilms show resistance against human immune system, as well as against antibiotics. Health related concerns speak loud due to the biofilm potential to cause diseases, utilizing both device-related and non-device-related infections. In summary, the understanding of bacterial biofilm is important to manage and/or to eradicate biofilm-related diseases. The current review is, therefore, an effort to encompass the current concepts in biofilm formation and its implications in human health and disease.

  14. Dialkylresorcinols as bacterial signaling molecules.

    Science.gov (United States)

    Brameyer, Sophie; Kresovic, Darko; Bode, Helge B; Heermann, Ralf

    2015-01-13

    It is well recognized that bacteria communicate via small diffusible molecules, a process termed quorum sensing. The best understood quorum sensing systems are those that use acylated homoserine lactones (AHLs) for communication. The prototype of those systems consists of a LuxI-like AHL synthase and a cognate LuxR receptor that detects the signal. However, many proteobacteria possess LuxR receptors, yet lack any LuxI-type synthase, and thus these receptors are referred to as LuxR orphans or solos. In addition to the well-known AHLs, little is known about the signaling molecules that are sensed by LuxR solos. Here, we describe a novel cell-cell communication system in the insect and human pathogen Photorhabdus asymbiotica. We identified the LuxR homolog PauR to sense dialkylresorcinols (DARs) and cyclohexanediones (CHDs) instead of AHLs as signals. The DarABC synthesis pathway produces the molecules, and the entire system emerged as important for virulence. Moreover, we have analyzed more than 90 different Photorhabdus strains by HPLC/MS and showed that these DARs and CHDs are specific to the human pathogen P. asymbiotica. On the basis of genomic evidence, 116 other bacterial species are putative DAR producers, among them many human pathogens. Therefore, we discuss the possibility of DARs as novel and widespread bacterial signaling molecules and show that bacterial cell-cell communication goes far beyond AHL signaling in nature.

  15. Acute bacterial meningitis in adults.

    Science.gov (United States)

    McGill, Fiona; Heyderman, Robert S; Panagiotou, Stavros; Tunkel, Allan R; Solomon, Tom

    2016-12-17

    Over the past several decades, the incidence of bacterial meningitis in children has decreased but there remains a significant burden of disease in adults, with a mortality of up to 30%. Although the pathogenesis of bacterial meningitis is not completely understood, knowledge of bacterial invasion and entry into the CNS is improving. Clinical features alone cannot determine whether meningitis is present and analysis of cerebrospinal fluid is essential for diagnosis. Newer technologies, such as multiplex PCR, and novel diagnostic platforms that incorporate proteomics and genetic sequencing, might help provide a quicker and more accurate diagnosis. Even with appropriate antimicrobial therapy, mortality is high and so attention has focused on adjunctive therapies; adjunctive corticosteroids are beneficial in certain circumstances. Any further improvements in outcome are likely to come from either modulation of the host response or novel approaches to therapy, rather than new antibiotics. Ultimately, the best hope to reduce the disease burden is with broadly protective vaccines. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Bacterial Carriers for Glioblastoma Therapy

    Directory of Open Access Journals (Sweden)

    Nalini Mehta

    2017-03-01

    Full Text Available Treatment of aggressive glioblastoma brain tumors is challenging, largely due to diffusion barriers preventing efficient drug dosing to tumors. To overcome these barriers, bacterial carriers that are actively motile and programmed to migrate and localize to tumor zones were designed. These carriers can induce apoptosis via hypoxia-controlled expression of a tumor suppressor protein p53 and a pro-apoptotic drug, Azurin. In a xenograft model of human glioblastoma in rats, bacterial carrier therapy conferred a significant survival benefit with 19% overall long-term survival of >100 days in treated animals relative to a median survival of 26 days in control untreated animals. Histological and proteomic analyses were performed to elucidate the safety and efficacy of these carriers, showing an absence of systemic toxicity and a restored neural environment in treated responders. In the treated non-responders, proteomic analysis revealed competing mechanisms of pro-apoptotic and drug-resistant activity. This bacterial carrier opens a versatile avenue to overcome diffusion barriers in glioblastoma by virtue of its active motility in extracellular space and can lead to tailored therapies via tumor-specific expression of tumoricidal proteins.

  17. Expression, processing and transcriptional regulation of granulysin in short-term activated human lymphocytes

    Directory of Open Access Journals (Sweden)

    Groscurth Peter

    2007-06-01

    Full Text Available Abstract Background Granulysin, a cytotoxic protein expressed in human natural killer cells and activated T lymphocytes, exhibits cytolytic activity against a variety of intracellular microbes. Expression and transcription have been partially characterised in vitro and four transcripts (NKG5, 519, 520, and 522 were identified. However, only a single protein product of 15 kDa was found, which is subsequently processed to an active 9 kDa protein. Results In this study we investigated generation of granulysin in lymphokine activated killer (LAK cells and antigen (Listeria specific T-cells. Semiquantitative RT-PCR revealed NKG5 to be the most prominent transcript. It was found to be up-regulated in a time-dependent manner in LAK cells and antigen specific T-cells and their subsets. Two isoforms of 519 mRNA were up-regulated under IL-2 and antigen stimulation. Moreover, two novel transcripts, without any known function, comprising solely parts of the 5 prime region of the primary transcript, were detected. A significant increase of granulysin expressing LAK cells as well as antigen specific T-cells was shown by fluorescence microscopy. On the subset level, increase in CD4+ granulysin expressing cells was found only under antigen stimulation. Immunoblotting showed the 15 kDa form of granulysin to be present in the first week of stimulation either with IL-2 or with bacterial antigen. Substantial processing to the 9 kDa form was detected during the first week in LAK cells and in the second week in antigen specific T-cells. Conclusion This first comprehensive study of granulysin gene regulation in primary cultured human lymphocytes shows that the regulation of granulysin synthesis in response to IL-2 or bacterial antigen stimulation occurs at several levels: RNA expression, extensive alternative splicing and posttranslational processing.

  18. Genome-wide effects of selenium and translational uncoupling on transcription in the termite gut symbiont Treponema primitia.

    Science.gov (United States)

    Matson, Eric G; Rosenthal, Adam Z; Zhang, Xinning; Leadbetter, Jared R

    2013-11-12

    When prokaryotic cells acquire mutations, encounter translation-inhibiting substances, or experience adverse environmental conditions that limit their ability to synthesize proteins, transcription can become uncoupled from translation. Such uncoupling is known to suppress transcription of protein-encoding genes in bacteria. Here we show that the trace element selenium controls transcription of the gene for the selenocysteine-utilizing enzyme formate dehydrogenase (fdhFSec) through a translation-coupled mechanism in the termite gut symbiont Treponema primitia, a member of the bacterial phylum Spirochaetes. We also evaluated changes in genome-wide transcriptional patterns caused by selenium limitation and by generally uncoupling translation from transcription via antibiotic-mediated inhibition of protein synthesis. We observed that inhibiting protein synthesis in T. primitia influences transcriptional patterns in unexpected ways. In addition to suppressing transcription of certain genes, the expected consequence of inhibiting protein synthesis, we found numerous examples in which transcription of genes and operons is truncated far downstream from putative promoters, is unchanged, or is even stimulated overall. These results indicate that gene regulation in bacteria allows for specific post-initiation transcriptional responses during periods of limited protein synthesis, which may depend both on translational coupling and on unclassified intrinsic elements of protein-encoding genes. A large body of literature demonstrates that the coupling of transcription and translation is a general and essential method by which bacteria regulate gene expression levels. However, the potential role of noncanonical amino acids in regulating transcriptional output via translational control remains, for the most part, undefined. Furthermore, the genome-wide transcriptional state in response to translational decoupling is not well quantified. The results presented here suggest that the

  19. Regulation of transcription in hyperthermophilic archaea

    NARCIS (Netherlands)

    Brinkman, A.B.

    2002-01-01

    The aim of the research presented here was to insight in the mechanisms by which transcription in hyperthermophilic archaea is regulated. To accomplish this, we have aimed (I) to identify transcriptional regulatory proteins from hyperthermophilic archaea, (II) to characterize these

  20. 40 CFR 179.94 - Transcripts.

    Science.gov (United States)

    2010-07-01

    ... of particular oral testimony first becomes available to propose corrections in the transcript of that testimony. Corrections are permitted only for transcription errors. The presiding officer shall promptly... have all oral testimony stenographically reported or recorded and transcribed, with evidence that is...

  1. Transcription Through Chromatin - Dynamic Organization of Genes

    Indian Academy of Sciences (India)

    Remodeling of chromatin confers it the ability for dynamic change. Remodeling is essential for transcriptional regulation, the first step of gene expression. Chromatin Structure and Gene Expression. Transcription is the first step of gene expression in which RNA synthesis occurs from the DNA (gene) template in a series of.

  2. Overlapping transcription structure of human cytomegalovirus ...

    Indian Academy of Sciences (India)

    2013-01-21

    Jan 21, 2013 ... Transcription of human cytomegalovirus UL/b′ region has been studied extensively for some genes. In this study, transcripts of the UL140 and UL141, two of the UL/b′ genes, were identified in late RNAs of three HCMV isolates using Northern blot hybridization, cDNA library screening and RACE-PCR.

  3. NAC transcription factors: structurally distinct, functionally diverse

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi A; Leggio, Leila Lo

    2005-01-01

    level and localization, and to the first indications of NAC participation in transcription factor networks. The recent determination of the DNA and protein binding NAC domain structure offers insight into the molecular functions of the protein family. Research into NAC transcription factors has...

  4. Transcription Through Chromatin - Dynamic Organization of Genes

    Indian Academy of Sciences (India)

    In this article, we discuss the dynamic organization of eukaryotic genes into chromatin. Remodeling of chromatin confers it the ability for dynamic change. Remodeling is essential for transcriptional regulation, the first step of gene expression. Chromatin Structure and Gene Expression. Transcription is the first step of gene ...

  5. Overlapping transcription structure of human cytomegalovirus ...

    Indian Academy of Sciences (India)

    Transcription of human cytomegalovirus UL/b′ region has been studied extensively for some genes. In this study, transcripts of the UL140 and UL141, two of the UL/b′ genes, were identified in late RNAs of three HCMV isolates using Northern blot hybridization, cDNA library screening and RACE-PCR. At least three ...

  6. Transcription-associated mutation of lasR in Pseudomonas aeruginosa.

    Science.gov (United States)

    Wang, Chao; McPherson, John R; Zhang, Lian-Hui; Rozen, Steve; Sabapathy, Kanaga

    2016-10-01

    Pseudomonas aeruginosa is an opportunistic pathogen which infects cystic fibrosis and cancer patients with compromised immune systems. LasR is a master regulator which controls the virulence of P. aeruginosa in response to bacterial cell-density and host signals. During infection, lasR is frequently mutated, conferring P. aeruginosa a growth advantage in hosts and enhances resistance to widely used antibiotics. However, the mechanistic basis of lasR mutation is not well understood. We have tested here the hypothesis that transcription strength is a contributory determinant of lasR mutagenesis. P. aeruginosa strains with different lasR transcription strengths were therefore engineered and the lasR mutations were monitored unbiasedly using next-generation sequencing technology. Our results suggest that the strength of transcription could be one of the deterministic factors that drive the mutagenesis of lasR in P. aeruginosa, shedding new insights into bacterial infection and antibiotic resistance. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi, E-mail: shilpi@dbeb.iitd.ac.in

    2015-06-30

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture.

  8. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    International Nuclear Information System (INIS)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi

    2015-01-01

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture

  9. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  10. Elucidation of operon structures across closely related bacterial genomes.

    Science.gov (United States)

    Zhou, Chuan; Ma, Qin; Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components.

  11. A third mode of surface‐associated growth: immobilization of Salmonella enterica serovar Typhimurium modulates the RpoS‐directed transcriptional programme

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Nielsen, Maj‐Britt; Grassby, Terri

    2012-01-01

    environments in both food products and the GI tract. This immobilized mode of growth has not been widely studied. To develop our understanding of the effects of immobilization upon a food‐borne bacterial pathogen, we used the IFR Gel Cassette model. The transcriptional programme and metabolomic profile...

  12. Transcription-dependent degradation controls the stability of the SREBP family of transcription factors.

    Science.gov (United States)

    Sundqvist, Anders; Ericsson, Johan

    2003-11-25

    Cholesterol metabolism is tightly controlled by members of the sterol regulatory element-binding protein (SREBP) family of transcription factors. Here we demonstrate that the ubiquitination and degradation of SREBPs depend on their transcriptional activity. Mutations in the transactivation or DNA-binding domains of SREBPs inhibit their transcriptional activity and stabilize the proteins. The transcriptional activity and degradation of these mutants are restored when fused to heterologous transactivation or DNA-binding domains. When SREBP1a was fused to the DBD of Gal4, the ubiquitination and degradation of the fusion protein depended on coexpression of a promoter-reporter gene containing Gal4-binding sites. In addition, disruption of the interaction between WT SREBP and endogenous p300/CBP resulted in inhibition of SREBP-dependent transcription and stabilization of SREBP. Chemical inhibitors of transcription reduced the degradation of transcriptionally active SREBP1a, whereas they had no effect on the stability of transcriptionally inactive mutants, demonstrating that transcriptional activation plays an important role in the degradation of SREBPs. Thus, transcription-dependent degradation of SREBP constitutes a feedback mechanism to regulate the expression of genes involved in cholesterol metabolism and may represent a general mechanism to regulate the duration of transcriptional responses.

  13. Global Transcriptional Responses to Osmotic, Oxidative, and Imipenem Stress Conditions in Pseudomonas putida.

    Science.gov (United States)

    Bojanovič, Klara; D'Arrigo, Isotta; Long, Katherine S

    2017-04-01

    Bacteria cope with and adapt to stress by modulating gene expression in response to specific environmental cues. In this study, the transcriptional response of Pseudomonas putida KT2440 to osmotic, oxidative, and imipenem stress conditions at two time points was investigated via identification of differentially expressed mRNAs and small RNAs (sRNAs). A total of 440 sRNA transcripts were detected, of which 10% correspond to previously annotated sRNAs, 40% to novel intergenic transcripts, and 50% to novel transcripts antisense to annotated genes. Each stress elicits a unique response as far as the extent and dynamics of the transcriptional changes. Nearly 200 protein-encoding genes exhibited significant changes in all stress types, implicating their participation in a general stress response. Almost half of the sRNA transcripts were differentially expressed under at least one condition, suggesting possible functional roles in the cellular response to stress conditions. The data show a larger fraction of differentially expressed sRNAs than of mRNAs with >5-fold expression changes. The work provides detailed insights into the mechanisms through which P. putida responds to different stress conditions and increases understanding of bacterial adaptation in natural and industrial settings. IMPORTANCE This study maps the complete transcriptional response of P. putida KT2440 to osmotic, oxidative, and imipenem stress conditions at short and long exposure times. Over 400 sRNA transcripts, consisting of both intergenic and antisense transcripts, were detected, increasing the number of identified sRNA transcripts in the strain by a factor of 10. Unique responses to each type of stress are documented, including both the extent and dynamics of the gene expression changes. The work adds rich detail to previous knowledge of stress response mechanisms due to the depth of the RNA sequencing data. Almost half of the sRNAs exhibit significant expression changes under at least one

  14. Colon cancer associated transcripts in human cancers.

    Science.gov (United States)

    Chen, Yincong; Xie, Haibiao; Gao, Qunjun; Zhan, Hengji; Xiao, Huizhong; Zou, Yifan; Zhang, Fuyou; Liu, Yuchen; Li, Jianfa

    2017-10-01

    Long non-coding RNAs serve as important regulators in complicated cellular activities, including cell differentiation, proliferation and death. Dysregulation of long non-coding RNAs occurs in the formation and progression of cancers. The family of colon cancer associated transcripts, long non-coding RNAs colon cancer associated transcript-1 and colon cancer associated transcript-2 are known as oncogenes involved in various cancers. Colon cancer associated transcript-1 is a novel lncRNA located in 8q24.2, and colon cancer associated transcript-2 maps to the 8q24.21 region encompassing rs6983267. Colon cancer associated transcripts have close associations with clinical characteristics, such as lymph node metastasis, high TNM stage and short overall survival. Knockdown of them can reverse the malignant phenotypes of cancer cells, including proliferation, migration, invasion and apoptosis. Moreover, they can increase the expression level of c-MYC and oncogenic microRNAs via activating a series of complex mechanisms. In brief, the family of colon cancer associated transcripts may serve as potential biomarkers or therapeutic targets for human cancers. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  15. Identification of a novel bacterial sequence associated with Crohn's disease.

    Science.gov (United States)

    Sutton, C L; Kim, J; Yamane, A; Dalwadi, H; Wei, B; Landers, C; Targan, S R; Braun, J

    2000-07-01

    Enteric microorganisms are implicated in the pathogenesis of Crohn's disease (CD), but no clear bacterial or viral species has been identified. In this study, representational difference analysis (RDA) was used to isolate DNA segments preferentially abundant in lamina propria mononuclear cells of lesional mucosa vs. adjacent uninvolved mucosa. Two RDA-derived microbial sequences were isolated (I1 and I2) and identified as novel homologues of the ptxR and tetR bacterial transcription-factor families. Quantitative competitive polymerase chain reaction of paraffin-embedded intestinal specimens from 212 patients showed that I2 DNA was present in many CD colonic lesions (43%), but was infrequent in other colonic specimens (9% of ulcerative colitis lesions and 5% of non-inflammatory bowel disease diseases; Pfusion protein showed frequent immunoglobulin A seroreactivity in CD (54% of patients), but infrequent seroreactivity in patients with ulcerative colitis, other inflammatory enteric diseases, or normals (10%, 19%, and 4%, respectively; Pmicroorganism expressing the I2 gene product may be related to CD pathogenesis.

  16. Bacterial and fungal microflora in surgically removed lung cancer samples

    Directory of Open Access Journals (Sweden)

    Toloudi Maria

    2011-10-01

    Full Text Available Abstract Background Clinical and experimental data suggest an association between the presence of bacterial and/or fungal infection and the development of different types of cancer, independently of chemotherapy-induced leukopenia. This has also been postulated for the development of lung cancer, however the prevalence and the exact species of the bacteria and fungi implicated, have not yet been described. Aim To determine the presence of bacterial and fungal microflora in surgically extracted samples of patients with lung cancer. Materials and methods In this single-center prospective, observational study, tissue samples were surgically extracted from 32 consecutive patients with lung cancer, and reverse-transcription polymerase chain reaction (RT-PCR was used to identify the presence of bacteria and fungi strains. Results The analysis of the electrophoresis data pointed out diversity between the samples and the strains that were identified. Mycoplasma strains were identified in all samples. Strains that appeared more often were Staphylococcus epidermidis, Streptococcus mitis and Bacillus strains, followed in descending frequency by Chlamydia, Candida, Listeria, and Haemophilus influenza. In individual patients Legionella pneumophila and Candida tropicalis were detected. Conclusions A diversity of pathogens could be identified in surgically extracted tissue samples of patients with lung cancer, with mycoplasma strains being present in all samples. These results point to an etiologic role for chronic infection in lung carcinogenesis. Confirmation of these observations and additional studies are needed to further characterize the etiologic role of inflammation in lung carcinogenesis.

  17. Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

    Energy Technology Data Exchange (ETDEWEB)

    Jansson, Janet; Edlund, Anna; Hardeman, Fredrik; Jansson, Janet K.; Sjoling, Sara

    2008-05-15

    Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities were most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.

  18. CRISPR/Cas systems: new players in gene regulation and bacterial physiology

    Directory of Open Access Journals (Sweden)

    David eWeiss

    2014-04-01

    Full Text Available CRISPR-Cas systems are bacterial defenses against foreign nucleic acids derived from bacteriophages, plasmids or other sources. These systems are targeted in an RNA-dependent, sequence-specific manner, and are also adaptive, providing protection against previously encountered foreign elements. In addition to their canonical function in defense against foreign nucleic acid, their roles in various aspects of bacterial physiology are now being uncovered. We recently revealed a role for a Cas9-based Type II CRISPR-Cas system in the control of endogenous gene expression, a novel form of prokaryotic gene regulation. Cas9 functions in association with two small RNAs to target and alter the stability of an endogenous transcript encoding a bacterial lipoprotein (BLP. Since BLPs are recognized by the host innate immune protein Toll-like Receptor 2 (TLR2, CRISPR-Cas-mediated repression of BLP expression facilitates evasion of TLR2 by the intracellular bacterial pathogen Francisella novicida, and is essential for its virulence. Here we describe the Cas9 regulatory system in detail, as well as data on its role in controlling virulence traits of Neisseria meningitidis and Campylobacter jejuni. We also discuss potential roles of CRISPR-Cas systems in the response to envelope stress and other aspects of bacterial physiology. Since ~45% of bacteria and ~83% of Archaea encode these machineries, the newly appreciated regulatory functions of CRISPR-Cas systems are likely to play broad roles in controlling the pathogenesis and physiology of diverse prokaryotes.

  19. Interplay in the selection of fluoroquinolone resistance and bacterial fitness.

    Directory of Open Access Journals (Sweden)

    Linda L Marcusson

    2009-08-01

    Full Text Available Fluoroquinolones are antibacterial drugs that inhibit DNA Gyrase and Topoisomerase IV. These essential enzymes facilitate chromosome replication and RNA transcription by regulating chromosome supercoiling. High-level resistance to fluoroquinolones in E. coli requires the accumulation of multiple mutations, including those that alter target genes and genes regulating drug efflux. Previous studies have shown some drug-resistance mutations reduce bacterial fitness, leading to the selection of fitness-compensatory mutations. The impact of fluoroquinolone-resistance on bacterial fitness was analyzed in constructed isogenic strains carrying up to 5 resistance mutations. Some mutations significantly decreased bacterial fitness both in vitro and in vivo. We identified low-fitness triple-mutants where the acquisition of a fourth resistance mutation significantly increased fitness in vitro and in vivo while at the same time dramatically decreasing drug susceptibility. The largest effect occurred with the addition of a parC mutation (Topoisomerase IV to a low-fitness strain carrying resistance mutations in gyrA (DNA Gyrase and marR (drug efflux regulation. Increased fitness was accompanied by a significant change in the level of gyrA promoter activity as measured in an assay of DNA supercoiling. In selection and competition experiments made in the absence of drug, parC mutants that improved fitness and reduced susceptibility were selected. These data suggest that natural selection for improved growth in bacteria with low-level resistance to fluoroquinolones could in some cases select for further reductions in drug susceptibility. Thus, increased resistance to fluoroquinolones could be selected even in the absence of further exposure to the drug.

  20. Interplay in the selection of fluoroquinolone resistance and bacterial fitness.

    Science.gov (United States)

    Marcusson, Linda L; Frimodt-Møller, Niels; Hughes, Diarmaid

    2009-08-01

    Fluoroquinolones are antibacterial drugs that inhibit DNA Gyrase and Topoisomerase IV. These essential enzymes facilitate chromosome replication and RNA transcription by regulating chromosome supercoiling. High-level resistance to fluoroquinolones in E. coli requires the accumulation of multiple mutations, including those that alter target genes and genes regulating drug efflux. Previous studies have shown some drug-resistance mutations reduce bacterial fitness, leading to the selection of fitness-compensatory mutations. The impact of fluoroquinolone-resistance on bacterial fitness was analyzed in constructed isogenic strains carrying up to 5 resistance mutations. Some mutations significantly decreased bacterial fitness both in vitro and in vivo. We identified low-fitness triple-mutants where the acquisition of a fourth resistance mutation significantly increased fitness in vitro and in vivo while at the same time dramatically decreasing drug susceptibility. The largest effect occurred with the addition of a parC mutation (Topoisomerase IV) to a low-fitness strain carrying resistance mutations in gyrA (DNA Gyrase) and marR (drug efflux regulation). Increased fitness was accompanied by a significant change in the level of gyrA promoter activity as measured in an assay of DNA supercoiling. In selection and competition experiments made in the absence of drug, parC mutants that improved fitness and reduced susceptibility were selected. These data suggest that natural selection for improved growth in bacteria with low-level resistance to fluoroquinolones could in some cases select for further reductions in drug susceptibility. Thus, increased resistance to fluoroquinolones could be selected even in the absence of further exposure to the drug.

  1. Increased Sleep Promotes Survival during a Bacterial Infection in Drosophila

    Science.gov (United States)

    Kuo, Tzu-Hsing; Williams, Julie A.

    2014-01-01

    Study Objectives: The relationship between sleep and immune function is not well understood at a functional or molecular level. We therefore used a genetic approach in Drosophila to manipulate sleep and evaluated effects on the ability of flies to fight bacterial infection. Setting: Laboratory. Participants: Drosophila melanogaster. Methods and Results: We used a genetic approach to transiently alter neuronal excitability in the mushroom body, a region in the central brain that is known to regulate sleep. Flies with increased sleep for up to two days prior to a bacterial infection showed increased resistance to the infection and improved survival. These flies also had increased expression levels of a subset of anti-microbial peptide mRNA prior to infection, as well as increased NFκB activity during infection as indicated by in vivo luciferase reporter activity. In contrast, flies that experienced reduced sleep for up to two days prior to infection had no effect on survival or on NFκB activity during infection. However, flies with reduced sleep showed an altered defense mechanism, such that resistance to infection was increased, but at the expense of reduced tolerance. This effect was dependent on environmental condition. Conclusions: Increasing sleep enhanced activity of an NFκB transcription factor, increased resistance to infection, and strongly promoted survival. Together, these findings support the hypothesis that sleep is beneficial to the host by maintaining a robust immune system. Citation: Kuo TH, Williams JA. Increased sleep promotes survival during a bacterial infection in Drosophila. SLEEP 2014;37(6):1077-1086. PMID:24882902

  2. Optogenetic control of transcription in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hongtao Liu

    Full Text Available Light inducible protein-protein interactions are powerful tools to manipulate biological processes. Genetically encoded light-gated proteins for controlling precise cellular behavior are a new and promising technology, called optogenetics. Here we exploited the blue light-induced transcription system in yeast and zebrafish, based on the blue light dependent interaction between two plant proteins, blue light photoreceptor Cryptochrome 2 (CRY2 and the bHLH transcription factor CIB1 (CRY-interacting bHLH 1. We demonstrate the utility of this system by inducing rapid transcription suppression and activation in zebrafish.

  3. Transcriptional mapping of rabies virus in vivo

    International Nuclear Information System (INIS)

    Flamand, A.; Delagneau, J.F.

    1978-01-01

    Synthesis of the proteins of rabies virus was studied in hamster cell infected with uv-irradiated virus. The uv target size of genes L, N, M 1 , and M 2 was measured during primary transcription. Except for N, the target size of the remaining genes was considerably larger than that of their physical sizes. The data fit the hypothesis that four genes occupy a single transcriptional unit and that transcription of rabies virus proceeds in the order N, M 1 , M 2 , and L

  4. Enhancer RNAs: the new molecules of transcription.

    Science.gov (United States)

    Lai, Fan; Shiekhattar, Ramin

    2014-04-01

    In the past few years, technological advances in nucleotide sequencing have culminated in a greater understanding of the complexity of the human transcriptome. Notably, the discovery that distal regulatory elements known as enhancers are transcribed and such enhancer-derived transcripts (eRNAs) serve a critical function in transcriptional activation has added a new dimension to transcriptional regulation. Here we review recent insights into the tissue-specific and temporal-specific gene regulation brought about by the discovery of eRNAs. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Klebsiella pneumoniae Siderophores Induce Inflammation, Bacterial Dissemination, and HIF-1α Stabilization during Pneumonia.

    Science.gov (United States)

    Holden, Victoria I; Breen, Paul; Houle, Sébastien; Dozois, Charles M; Bachman, Michael A

    2016-09-13

    Klebsiella pneumoniae is a Gram-negative pathogen responsible for a wide range of infections, including pneumonia and bacteremia, and is rapidly acquiring antibiotic resistance. K. pneumoniae requires secretion of siderophores, low-molecular-weight, high-affinity iron chelators, for bacterial replication and full virulence. The specific combination of siderophores secreted by K. pneumoniae during infection can impact tissue localization, systemic dissemination, and host survival. However, the effect of these potent iron chelators on the host during infection is unknown. In vitro, siderophores deplete epithelial cell iron, induce cytokine secretion, and activate the master transcription factor hypoxia inducible factor-1α (HIF-1α) protein that controls vascular permeability and inflammatory gene expression. Therefore, we hypothesized that siderophore secretion by K. pneumoniae directly contributes to inflammation and bacterial dissemination during pneumonia. To examine the effects of siderophore secretion independently of bacterial growth, we performed infections with tonB mutants that persist in vivo but are deficient in siderophore import. Using a murine model of pneumonia, we found that siderophore secretion by K. pneumoniae induces the secretion of interleukin-6 (IL-6), CXCL1, and CXCL2, as well as bacterial dissemination to the spleen, compared to siderophore-negative mutants at an equivalent bacterial number. Furthermore, we determined that siderophore-secreting K. pneumoniae stabilized HIF-1α in vivo and that bacterial dissemination to the spleen required alveolar epithelial HIF-1α. Our results indicate that siderophores act directly on the host to induce inflammatory cytokines and bacterial dissemination and that HIF-1α is a susceptibility factor for bacterial invasion during pneumonia. Klebsiella pneumoniae causes a wide range of bacterial diseases, including pneumonia, urinary tract infections, and sepsis. To cause infection, K. pneumoniae steals

  6. Molecular Basis of Bacterial Longevity

    Directory of Open Access Journals (Sweden)

    Kieran B. Pechter

    2017-11-01

    Full Text Available It is well known that many bacteria can survive in a growth-arrested state for long periods of time, on the order of months or even years, without forming dormant structures like spores or cysts. How is such longevity possible? What is the molecular basis of such longevity? Here we used the Gram-negative phototrophic alphaproteobacterium Rhodopseudomonas palustris to identify molecular determinants of bacterial longevity. R. palustris maintained viability for over a month after growth arrest due to nutrient depletion when it was provided with light as a source of energy. In transposon sequencing (Tn-seq experiments, we identified 117 genes that were required for long-term viability of nongrowing R. palustris cells. Genes in this longevity gene set are annotated to play roles in a number of cellular processes, including DNA repair, tRNA modification, and the fidelity of protein synthesis. These genes are critically important only when cells are not growing. Three genes annotated to affect translation or posttranslational modifications were validated as bona fide longevity genes by mutagenesis and complementation experiments. These genes and others in the longevity gene set are broadly conserved in bacteria. This raises the possibility that it will be possible to define a core set of longevity genes common to many bacterial species.

  7. Phenotypic signatures arising from unbalanced bacterial growth.

    Science.gov (United States)

    Tan, Cheemeng; Smith, Robert Phillip; Tsai, Ming-Chi; Schwartz, Russell; You, Lingchong

    2014-08-01

    Fluctuations in the growth rate of a bacterial culture during unbalanced growth are generally considered undesirable in quantitative studies of bacterial physiology. Under well-controlled experimental conditions, however, these fluctuations are not random but instead reflect the interplay between intra-cellular networks underlying bacterial growth and the growth environment. Therefore, these fluctuations could be considered quantitative phenotypes of the bacteria under a specific growth condition. Here, we present a method to identify "phenotypic signatures" by time-frequency analysis of unbalanced growth curves measured with high temporal resolution. The signatures are then applied to differentiate amongst different bacterial strains or the same strain under different growth conditions, and to identify the essential architecture of the gene network underlying the observed growth dynamics. Our method has implications for both basic understanding of bacterial physiology and for the classification of bacterial strains.

  8. Interaction between resource identity and bacterial community composition regulates bacterial respiration in aquatic ecosystems

    Directory of Open Access Journals (Sweden)

    A. P. F. Pires

    Full Text Available Abstract Resource identity and composition structure bacterial community, which in turn determines the magnitude of bacterial processes and ecological services. However, the complex interaction between resource identity and bacterial community composition (BCC has been poorly understood so far. Using aquatic microcosms, we tested whether and how resource identity interacts with BCC in regulating bacterial respiration and bacterial functional diversity. Different aquatic macrophyte leachates were used as different carbon resources while BCC was manipulated through successional changes of bacterial populations in batch cultures. We observed that the same BCC treatment respired differently on each carbon resource; these resources also supported different amounts of bacterial functional diversity. There was no clear linear pattern of bacterial respiration in relation to time succession of bacterial communities in all leachates, i.e. differences on bacterial respiration between different BCC were rather idiosyncratic. Resource identity regulated the magnitude of respiration of each BCC, e.g. Ultricularia foliosa leachate sustained the greatest bacterial functional diversity and lowest rates of bacterial respiration in all BCC. We conclude that both resource identity and the BCC interact affecting the pattern and the magnitude of bacterial respiration in aquatic ecosystems.

  9. Diagnosis and prevalence of bacterial vaginosis.

    Directory of Open Access Journals (Sweden)

    Saharan S

    1993-04-01

    Full Text Available A prospective study of 80 women was undertaken to estimate the prevalence of bacterial vaginosis, and to compare two methods of diagnosing the condition. Bacterial Vaginosis was detected by both Gram stain and compound criteria in 30 women. The prevalence was 37.5%. Gram stain provides a simple and inexpensive method for laboratory confirmation of bacterial vaginosis where facilities for using the compound criteria are not available.

  10. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Science.gov (United States)

    Furuse, Yuki; Finethy, Ryan; Saka, Hector A; Xet-Mull, Ana M; Sisk, Dana M; Smith, Kristen L Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H; Tobin, David M; Cullen, Bryan R

    2014-01-01

    MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  11. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  12. Type III effectors orchestrate a complex interplay between transcriptional networks to modify basal defence responses during pathogenesis and resistance.

    Science.gov (United States)

    Truman, William; de Zabala, Marta Torres; Grant, Murray

    2006-04-01

    To successfully infect a plant, bacterial pathogens inject a collection of Type III effector proteins (TTEs) directly into the plant cell that function to overcome basal defences and redirect host metabolism for nutrition and growth. We examined (i) the transcriptional dynamics of basal defence responses between Arabidopsis thaliana and Pseudomonas syringae and (ii) how basal defence is subsequently modulated by virulence factors during compatible interactions. A set of 96 genes displaying an early, sustained induction during basal defence was identified. These were also universally co-regulated following other bacterial basal resistance and non-host responses or following elicitor challenges. Eight hundred and eighty genes were conservatively identified as being modulated by TTEs within 12 h post-inoculation (hpi), 20% of which represented transcripts previously induced by the bacteria at 2 hpi. Significant over-representation of co-regulated transcripts encoding leucine rich repeat receptor proteins and protein phosphatases were, respectively, suppressed and induced 12 hpi. These data support a model in which the pathogen avoids detection through diminution of extracellular receptors and attenuation of kinase signalling pathways. Transcripts associated with several metabolic pathways, particularly plastid based primary carbon metabolism, pigment biosynthesis and aromatic amino acid metabolism, were significantly modified by the bacterial challenge at 12 hpi. Superimposed upon this basal response, virulence factors (most likely TTEs) targeted genes involved in phenylpropanoid biosynthesis, consistent with the abrogation of lignin deposition and other wall modifications likely to restrict the passage of nutrients and water to the invading bacteria. In contrast, some pathways associated with stress tolerance are transcriptionally induced at 12 hpi by TTEs.

  13. In silico and wet lab approaches to study transcriptional regulation

    NARCIS (Netherlands)

    Hestand, Matthew Scott

    2010-01-01

    Gene expression is a complicated process with multiple types of regulation, including binding of proteins termed transcription factors. This thesis looks at transcription factors and transcription factor binding site discovery through computational predictions and wet lab work to better elucidate

  14. Identification of a Transcription Factor That Regulates Host Cell Exit and Virulence of Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Lalitha Srinivasan

    2016-05-01

    Full Text Available The interaction of Mycobacterium tuberculosis (Mtb with host cell death signaling pathways is characterized by an initial anti-apoptotic phase followed by a pro-necrotic phase to allow for host cell exit of the bacteria. The bacterial modulators regulating necrosis induction are poorly understood. Here we describe the identification of a transcriptional repressor, Rv3167c responsible for regulating the escape of Mtb from the phagosome. Increased cytosolic localization of MtbΔRv3167c was accompanied by elevated levels of mitochondrial reactive oxygen species and reduced activation of the protein kinase Akt, and these events were critical for the induction of host cell necrosis and macroautophagy. The increase in necrosis led to an increase in bacterial virulence as reflected in higher bacterial burden and reduced survival of mice infected with MtbΔRv3167c. The regulon of Rv3167c thus contains the bacterial mediators involved in escape from the phagosome and host cell necrosis induction, both of which are crucial steps in the intracellular lifecycle and virulence of Mtb.

  15. Balance of bacterial species in the gut

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Balance of bacterial species in the gut. Protective. Lactobacillus species. Bifidobacterium species. Selected E. coli. Saccharomyces boulardii. Clostridium butyricum.

  16. n-Butyrate inhibits Jun NH(2)-terminal kinase activation and cytokine transcription in mast cells

    International Nuclear Information System (INIS)

    Diakos, Christos; Prieschl, Eva E.; Saeemann, Marcus D.; Boehmig, Georg A.; Csonga, Robert; Sobanov, Yury; Baumruker, Thomas; Zlabinger, Gerhard J.

    2006-01-01

    Mast cells are well known to contribute to type I allergic conditions but only recently have been brought in association with chronic relapsing/remitting autoimmune diseases such as celiac disease and ulcerative colitis. Since the bacterial metabolite n-butyrate is considered to counteract intestinal inflammation we investigated the effects of this short chain fatty acid on mast cell activation. Using RNAse protection assays and reporter gene technology we show that n-butyrate downregulates TNF-α transcription. This correlates with an impaired activation of the Jun NH(2)-terminal kinase (JNK) but not other MAP kinases such as ERK and p38 that are largely unaffected by n-butyrate. As a consequence, we observed a decreased nuclear activity of AP-1 and NF-AT transcription factors. These results indicate that n-butyrate inhibits critical inflammatory mediators in mast cells by relatively selectively targeting the JNK signalling

  17. n-Butyrate inhibits Jun NH(2)-terminal kinase activation and cytokine transcription in mast cells.

    Science.gov (United States)

    Diakos, Christos; Prieschl, Eva E; Säemann, Marcus D; Böhmig, Georg A; Csonga, Robert; Sobanov, Yury; Baumruker, Thomas; Zlabinger, Gerhard J

    2006-10-20

    Mast cells are well known to contribute to type I allergic conditions but only recently have been brought in association with chronic relapsing/remitting autoimmune diseases such as celiac disease and ulcerative colitis. Since the bacterial metabolite n-butyrate is considered to counteract intestinal inflammation we investigated the effects of this short chain fatty acid on mast cell activation. Using RNAse protection assays and reporter gene technology we show that n-butyrate downregulates TNF-alpha transcription. This correlates with an impaired activation of the Jun NH(2)-terminal kinase (JNK) but not other MAP kinases such as ERK and p38 that are largely unaffected by n-butyrate. As a consequence, we observed a decreased nuclear activity of AP-1 and NF-AT transcription factors. These results indicate that n-butyrate inhibits critical inflammatory mediators in mast cells by relatively selectively targeting the JNK signalling.

  18. Recovery from an acute infection in C. elegans requires the GATA transcription factor ELT-2.

    Science.gov (United States)

    Head, Brian; Aballay, Alejandro

    2014-10-01

    The mechanisms involved in the recognition of microbial pathogens and activation of the immune system have been extensively studied. However, the mechanisms involved in the recovery phase of an infection are incompletely characterized at both the cellular and physiological levels. Here, we establish a Caenorhabditis elegans-Salmonella enterica model of acute infection and antibiotic treatment for studying biological changes during the resolution phase of an infection. Using whole genome expression profiles of acutely infected animals, we found that genes that are markers of innate immunity are down-regulated upon recovery, while genes involved in xenobiotic detoxification, redox regulation, and cellular homeostasis are up-regulated. In silico analyses demonstrated that genes altered during recovery from infection were transcriptionally regulated by conserved transcription factors, including GATA/ELT-2, FOXO/DAF-16, and Nrf/SKN-1. Finally, we found that recovery from an acute bacterial infection is dependent on ELT-2 activity.

  19. A new regulatory mechanism for bacterial lipoic acid synthesis.

    Science.gov (United States)

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  20. High throughput assays for analyzing transcription factors.

    Science.gov (United States)

    Li, Xianqiang; Jiang, Xin; Yaoi, Takuro

    2006-06-01

    Transcription factors are a group of proteins that modulate the expression of genes involved in many biological processes, such as cell growth and differentiation. Alterations in transcription factor function are associated with many human diseases, and therefore these proteins are attractive potential drug targets. A key issue in the development of such therapeutics is the generation of effective tools that can be used for high throughput discovery of the critical transcription factors involved in human diseases, and the measurement of their activities in a variety of disease or compound-treated samples. Here, a number of innovative arrays and 96-well format assays for profiling and measuring the activities of transcription factors will be discussed.

  1. Characterization of BRCA2 Transcriptional Regulation

    National Research Council Canada - National Science Library

    Couch, Fergus

    1998-01-01

    .... Initially, reagents for transcriptional studies were generated. The promoter was cloned into luciferase reporter vectors, and expression constructs of BRCA2, BRCA1, p53, p21, p27 and a number of other cell cycle regulating genes were generated...

  2. Salmonella Typhimurium transcription profiles in space flight

    Data.gov (United States)

    National Aeronautics and Space Administration — Salmonella transcription profiles were obtained from samples flown on space shuttle mission STS-115 and compared to profiles from Salmonella grown under identical...

  3. Comparison of Transcription Factor Binding Site Models

    KAUST Repository

    Bhuyan, Sharifulislam

    2012-05-01

    Modeling of transcription factor binding sites (TFBSs) and TFBS prediction on genomic sequences are important steps to elucidate transcription regulatory mechanism. Dependency of transcription regulation on a great number of factors such as chemical specificity, molecular structure, genomic and epigenetic characteristics, long distance interaction, makes this a challenging problem. Different experimental procedures generate evidence that DNA-binding domains of transcription factors show considerable DNA sequence specificity. Probabilistic modeling of TFBSs has been moderately successful in identifying patterns from a family of sequences. In this study, we compare performances of different probabilistic models and try to estimate their efficacy over experimental TFBSs data. We build a pipeline to calculate sensitivity and specificity from aligned TFBS sequences for several probabilistic models, such as Markov chains, hidden Markov models, Bayesian networks. Our work, containing relevant statistics and evaluation for the models, can help researchers to choose the most appropriate model for the problem at hand.

  4. Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus

    Directory of Open Access Journals (Sweden)

    Kovaleva Galina

    2011-06-01

    Full Text Available Abstract Background Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. Results To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. Multiple variations in regulatory strategies between the Shewanella spp. and E. coli include regulon contraction and expansion (as in the case of PdhR, HexR, FadR, numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. PsrA for fatty acid degradation and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp. Conclusions We tentatively defined the first reference collection of ~100 transcriptional regulons in 16 Shewanella genomes. The resulting regulatory network contains ~600 regulated genes per genome that are mostly involved in metabolism of carbohydrates, amino acids, fatty acids, vitamins, metals, and stress responses. Several reconstructed regulons including NagR for N-acetylglucosamine catabolism were experimentally validated in S

  5. High-density transcriptional initiation signals underline genomic islands in bacteria.

    Directory of Open Access Journals (Sweden)

    Qianli Huang

    Full Text Available Genomic islands (GIs, frequently associated with the pathogenicity of bacteria and having a substantial influence on bacterial evolution, are groups of "alien" elements which probably undergo special temporal-spatial regulation in the host genome. Are there particular hallmark transcriptional signals for these "exotic" regions? We here explore the potential transcriptional signals that underline the GIs beyond the conventional views on basic sequence composition, such as codon usage and GC property bias. It showed that there is a significant enrichment of the transcription start positions (TSPs in the GI regions compared to the whole genome of Salmonella enterica and Escherichia coli. There was up to a four-fold increase for the 70% GIs, implying high-density TSPs profile can potentially differentiate the GI regions. Based on this feature, we developed a new sliding window method GIST, Genomic-island Identification by Signals of Transcription, to identify these regions. Subsequently, we compared the known GI-associated features of the GIs detected by GIST and by the existing method Islandviewer to those of the whole genome. Our method demonstrates high sensitivity in detecting GIs harboring genes with biased GI-like function, preferred subcellular localization, skewed GC property, shorter gene length and biased "non-optimal" codon usage. The special transcriptional signals discovered here may contribute to the coordinate expression regulation of foreign genes. Finally, by using GIST, we detected many interesting GIs in the 2011 German E. coli O104:H4 outbreak strain TY-2482, including the microcin H47 system and gene cluster ycgXEFZ-ymgABC that activates the production of biofilm matrix. The aforesaid findings highlight the power of GIST to predict GIs with distinct intrinsic features to the genome. The heterogeneity of cumulative TSPs profiles may not only be a better identity for "alien" regions, but also provide hints to the special

  6. Quantitative analysis of mutation and selection pressures on base composition skews in bacterial chromosomes

    Directory of Open Access Journals (Sweden)

    Chen Carton W

    2007-08-01

    Full Text Available Abstract Background Most bacterial chromosomes exhibit asymmetry of base composition with respect to leading vs. lagging strands (GC and AT skews. These skews reflect mainly those in protein coding sequences, which are driven by asymmetric mutation pressures during replication and transcription (notably asymmetric cytosine deamination plus subsequent selection for preferred structures, signals, amino acid or codons. The transcription-associated effects but not the replication-associated effects contribute to the overall skews through the uneven distribution of the coding sequences on the leading and lagging strands. Results Analysis of 185 representative bacterial chromosomes showed diverse and characteristic patterns of skews among different clades. The base composition skews in the coding sequences were used to derive quantitatively the effect of replication-driven mutation plus subsequent selection ('replication-associated pressure', RAP, and the effect of transcription-driven mutation plus subsequent selection at translation level ('transcription-associate pressure', TAP. While different clades exhibit distinct patterns of RAP and TAP, RAP is absent or nearly absent in some bacteria, but TAP is present in all. The selection pressure at the translation level is evident in all bacteria based on the analysis of the skews at the three codon positions. Contribution of asymmetric cytosine deamination was found to be weak to TAP in most phyla, and strong to RAP in all the Proteobacteria but weak in most of the Firmicutes. This possibly reflects the differences in their chromosomal replication machineries. A strong negative correlation between TAP and G+C content and between TAP and chromosomal size were also revealed. Conclusion The study reveals the diverse mutation and selection forces associated with replication and transcription in various groups of bacteria that shape the distinct patterns of base composition skews in the chromosomes during

  7. Transcriptional regulation by Ferric Uptake Regulator (Fur in pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Hosni M Hassan

    2013-10-01

    Full Text Available In the ancient anaerobic environment, ferrous iron (Fe2+ was one of the first metal cofactors. Oxygenation of the ancient world challenged bacteria to acquire the insoluble ferric iron (Fe3+ and later to defend against reactive oxygen species (ROS generated by the Fenton chemistry. To acquire Fe3+, bacteria produce low-molecular weight compounds, known as siderophores, which have extremely high affinity for Fe3+. However, during infection the host restricts iron from pathogens by producing iron- and siderophore-chelating proteins, by exporting iron from intracellular pathogen-containing compartments, and by limiting absorption of dietary iron. Ferric Uptake Regulator (Fur is a transcription factor which utilizes Fe2+ as a corepressor and represses siderophore synthesis in pathogens. Fur, directly or indirectly, controls expression of enzymes that protect against ROS damage. Thus, the challenges of iron homeostasis and defense against ROS are addressed via Fur. Although the role of Fur as a repressor is well documented, emerging evidence demonstrates that Fur can function as an activator. Fur activation can occur through three distinct mechanisms 1 indirectly via small RNAs, 2 binding at cis regulatory elements that enhance recruitment of the RNA polymerase holoenzyme (RNAP, and 3 functioning as an antirepressor by removing or blocking DNA binding of a repressor of transcription. In addition, Fur homologs control defense against peroxide stress (PerR and control uptake of other metals such as zinc (Zur and manganese (Mur in pathogenic bacteria. Fur family members are important for virulence within bacterial pathogens since mutants of fur, perR, or zur exhibit reduced virulence within numerous animal and plant models of infection. This review focuses on the breadth of Fur regulation in pathogenic bacteria.

  8. Transcriptional regulation by Ferric Uptake Regulator (Fur) in pathogenic bacteria.

    Science.gov (United States)

    Troxell, Bryan; Hassan, Hosni M

    2013-01-01

    In the ancient anaerobic environment, ferrous iron (Fe(2+)) was one of the first metal cofactors. Oxygenation of the ancient world challenged bacteria to acquire the insoluble ferric iron (Fe(3+)) and later to defend against reactive oxygen species (ROS) generated by the Fenton chemistry. To acquire Fe(3+), bacteria produce low-molecular weight compounds, known as siderophores, which have extremely high affinity for Fe(3+). However, during infection the host restricts iron from pathogens by producing iron- and siderophore-chelating proteins, by exporting iron from intracellular pathogen-containing compartments, and by limiting absorption of dietary iron. Ferric Uptake Regulator (Fur) is a transcription factor which utilizes Fe(2+) as a corepressor and represses siderophore synthesis in pathogens. Fur, directly or indirectly, controls expression of enzymes that protect against ROS damage. Thus, the challenges of iron homeostasis and defense against ROS are addressed via Fur. Although the role of Fur as a repressor is well-documented, emerging evidence demonstrates that Fur can function as an activator. Fur activation can occur through three distinct mechanisms (1) indirectly via small RNAs, (2) binding at cis regulatory elements that enhance recruitment of the RNA polymerase holoenzyme (RNAP), and (3) functioning as an antirepressor by removing or blocking DNA binding of a repressor of transcription. In addition, Fur homologs control defense against peroxide stress (PerR) and control uptake of other metals such as zinc (Zur) and manganese (Mur) in pathogenic bacteria. Fur family members are important for virulence within bacterial pathogens since mutants of fur, perR, or zur exhibit reduced virulence within numerous animal and plant models of infection. This review focuses on the breadth of Fur regulation in pathogenic bacteria.

  9. Biophysical models of transcription in cells

    Science.gov (United States)

    Choubey, Sandeep

    Cells constantly face environmental challenges and deal with them by changing their gene expression patterns. They make decisions regarding which genes to express and which genes not to express based on intra-cellular and environmental cues. These decisions are often made by regulating the process of transcription. While the identities of the different molecules that take part in regulating transcription have been determined for a number of different genes, their dynamics inside the cell are still poorly understood. One key feature of these regulatory dynamics is that the numbers of the bio-molecules involved is typically small, resulting in large temporal fluctuations in transcriptional outputs (mRNA and protein). In this thesis I show that measurements of the cell-to-cell variability of the distribution of transcribing RNA polymerases along a gene provide a previously unexplored method for deciphering the mechanism of its transcription in vivo. First, I propose a simple kinetic model of transcription initiation and elongation from which I calculate transcribing RNA polymerase copy-number fluctuations. I test my theory against published data obtained for yeast genes and propose a novel mechanism of transcription. Rather than transcription being initiated through a single rate-limiting step, as was previously proposed, my single-cell analysis reveals the presence of at least two rate limiting steps. Second, I compute the distribution of inter-polymerase distance distribution along a gene and propose a method for analyzing inter-polymerase distance distributions acquired in experiments. By applying this method to images of polymerases transcribing ribosomal genes in E.coli I show that one model of regulation of these genes is consistent with inter-polymerase distance data while a number of other models are not. The analytical framework described in this thesis can be used to extract quantitative information about the dynamics of transcription from single

  10. Specificity in ROS Signaling and Transcript Signatures

    OpenAIRE

    Vaahtera, Lauri; Brosché, Mikael; Wrzaczek, Michael; Kangasjärvi, Jaakko

    2014-01-01

    Significance: Reactive oxygen species (ROS), important signaling molecules in plants, are involved in developmental control and stress adaptation. ROS production can trigger broad transcriptional changes; however, it is not clear how specificity in transcriptional regulation is achieved. Recent Advances: A large collection of public transcriptome data from the model plant Arabidopsis thaliana is available for analysis. These data can be used for the analysis of biological processes that are a...

  11. Flexible Hinges in Bacterial Chemoreceptors.

    Science.gov (United States)

    Akkaladevi, Narahari; Bunyak, Filiz; Stalla, David; White, Tommi A; Hazelbauer, Gerald L

    2018-03-01

    Transmembrane bacterial chemoreceptors are extended, rod-shaped homodimers with ligand-binding sites at one end and interaction sites for signaling complex formation and histidine kinase control at the other. There are atomic-resolution structures of chemoreceptor fragments but not of intact, membrane-inserted receptors. Electron tomography of in vivo signaling complex arrays lack distinct densities for chemoreceptor rods away from the well-ordered base plate region, implying structural heterogeneity. We used negative staining, transmission electron microscopy, and image analysis to characterize the molecular shapes of intact homodimers of the Escherichia coli aspartate receptor Tar rendered functional by insertion into nanodisc-provided E. coli lipid bilayers. Single-particle analysis plus tomography of particles in a three-dimensional matrix revealed two bend loci in the chemoreceptor cytoplasmic domain, (i) a short, two-strand gap between the membrane-proximal, four-helix-bundle HAMP (histidine kinases, adenylyl cyclases, methyl-accepting chemoreceptors, and phosphatases) domain and the membrane-distal, four-helix coiled coil and (ii) aligned glycines in the extended, four-helix coiled coil, the position of a bend noted in the previous X-ray structure of a receptor fragment. Our images showed HAMP bends from 0° to ∼13° and glycine bends from 0° to ∼20°, suggesting that the loci are flexible hinges. Variable hinge bending explains indistinct densities for receptor rods outside the base plate region in subvolume averages of chemotaxis arrays. Bending at flexible hinges was not correlated with the chemoreceptor signaling state. However, our analyses showed that chemoreceptor bending avoided what would otherwise be steric clashes between neighboring receptors that would block the formation of core signaling complexes and chemoreceptor arrays. IMPORTANCE This work provides new information about the shape of transmembrane bacterial chemoreceptors, crucial

  12. Metabolic signatures of bacterial vaginosis.

    Science.gov (United States)

    Srinivasan, Sujatha; Morgan, Martin T; Fiedler, Tina L; Djukovic, Danijel; Hoffman, Noah G; Raftery, Daniel; Marrazzo, Jeanne M; Fredricks, David N

    2015-04-14

    Bacterial vaginosis (BV) is characterized by shifts in the vaginal microbiota from Lactobacillus dominant to a microbiota with diverse anaerobic bacteria. Few studies have linked specific metabolites with bacteria found in the human vagina. Here, we report dramatic differences in metabolite compositions and concentrations associated with BV using a global metabolomics approach. We further validated important metabolites using samples from a second cohort of women and a different platform to measure metabolites. In the primary study, we compared metabolite profiles in cervicovaginal lavage fluid from 40 women with BV and 20 women without BV. Vaginal bacterial representation was determined using broad-range PCR with pyrosequencing and concentrations of bacteria by quantitative PCR. We detected 279 named biochemicals; levels of 62% of metabolites were significantly different in women with BV. Unsupervised clustering of metabolites separated women with and without BV. Women with BV have metabolite profiles marked by lower concentrations of amino acids and dipeptides, concomitant with higher levels of amino acid catabolites and polyamines. Higher levels of the signaling eicosanoid 12-hydroxyeicosatetraenoic acid (12-HETE), a biomarker for inflammation, were noted in BV. Lactobacillus crispatus and Lactobacillus jensenii exhibited similar metabolite correlation patterns, which were distinct from correlation patterns exhibited by BV-associated bacteria. Several metabolites were significantly associated with clinical signs and symptoms (Amsel criteria) used to diagnose BV, and no metabolite was associated with all four clinical criteria. BV has strong metabolic signatures across multiple metabolic pathways, and these signatures are associated with the presence and concentrations of particular bacteria. Bacterial vaginosis (BV) is a common but highly enigmatic condition that is associated with adverse outcomes for women and their neonates. Small molecule metabolites in the

  13. InduciblespyTranscription Acts as a Sensor for Envelope Stress ofSalmonella typhimurium.

    Science.gov (United States)

    Jeong, Seon Mi; Lee, Hwa Jeong; Park, Yoon Mee; Kim, Jin Seok; Lee, Sang Dae; Bang, Iel Soo

    2017-01-01

    Salmonella enterica infects a broad range of host animals, and zoonostic infection threatens both public health and the livestock and meat processing industries. Many antimicrobials have been developed to target Salmonella envelope that performs essential bacterial functions; however, there are very few analytical methods that can be used to validate the efficacy of these antimicrobials. In this study, to develop a potential biosensor for Salmonella envelope stress, we examined the transcription of the S. enterica serovar typhimurium spy gene, the ortholog of which in Escherichia coli encodes Spy (spheroplast protein y). Spy is a chaperone protein expressed and localized in the periplasm of E. coli during spheroplast formation, or by exposure to protein denaturing conditions. spy expression in S. typhimurium was examined by constructing a spy-gfp transcriptional fusion. S. typhimurium spy transcription was strongly induced during spheroplast formation, and also when exposed to membrane-disrupting agents, including ethanol and the antimicrobial peptide polymyxin B. Moreover, spy induction required the activity of regulator proteins BaeR and CpxR, which are part of the major envelope stress response systems BaeS/BaeR and CpxA/CpxR, respectively. Results suggest that monitoring spy transcription may be useful to determine whether a molecule particularly cause envelope stress in Salmonella .

  14. Transcriptional control by two leucine-responsive regulatory proteins in Halobacterium salinarum R1

    Directory of Open Access Journals (Sweden)

    Tarasov Valery

    2010-05-01

    Full Text Available Abstract Background Archaea combine bacterial-as well as eukaryotic-like features to regulate cellular processes. Halobacterium salinarum R1 encodes eight leucine-responsive regulatory protein (Lrp-homologues. The function of two of them, Irp (OE3923F and lrpA1 (OE2621R, were analyzed by gene deletion and overexpression, including genome scale impacts using microarrays. Results It was shown that Lrp affects the transcription of multiple target genes, including those encoding enzymes involved in amino acid synthesis, central metabolism, transport processes and other regulators of transcription. In contrast, LrpA1 regulates transcription in a more specific manner. The aspB3 gene, coding for an aspartate transaminase, was repressed by LrpA1 in the presence of L-aspartate. Analytical DNA-affinity chromatography was adapted to high salt, and demonstrated binding of LrpA1 to its own promoter, as well as L-aspartate dependent binding to the aspB3 promoter. Conclusion The gene expression profiles of two archaeal Lrp-homologues report in detail their role in H. salinarum R1. LrpA1 and Lrp show similar functions to those already described in bacteria, but in addition they play a key role in regulatory networks, such as controlling the transcription of other regulators. In a more detailed analysis ligand dependent binding of LrpA1 was demonstrated to its target gene aspB3.

  15. A biophysical model for transcription factories

    International Nuclear Information System (INIS)

    Canals-Hamann, Ana Z; Neves, Ricardo Pires das; Reittie, Joyce E; Iñiguez, Carlos; Soneji, Shamit; Enver, Tariq; Buckle, Veronica J; Iborra, Francisco J

    2013-01-01

    Transcription factories are nuclear domains where gene transcription takes place although the molecular basis for their formation and maintenance are unknown. In this study, we explored how the properties of chromatin as a polymer may contribute to the structure of transcription factories. We found that transcriptional active chromatin contains modifications like histone H4 acetylated at Lysine 16 (H4K16ac). Single fibre analysis showed that this modification spans the entire body of the gene. Furthermore, H4K16ac genes cluster in regions up to 500 Kb alternating active and inactive chromatin. The introduction of H4K16ac in chromatin induces stiffness in the chromatin fibre. The result of this change in flexibility is that chromatin could behave like a multi-block copolymer with repetitions of stiff-flexible (active-inactive chromatin) components. Copolymers with such structure self-organize through spontaneous phase separation into microdomains. Consistent with such model H4K16ac chromatin form foci that associates with nascent transcripts. We propose that transcription factories are the result of the spontaneous concentration of H4K16ac chromatin that are in proximity, mainly in cis

  16. The regulation of transcriptional repression in hypoxia.

    Science.gov (United States)

    Cavadas, Miguel A S; Cheong, Alex; Taylor, Cormac T

    2017-07-15

    A sufficient supply molecular oxygen is essential for the maintenance of physiologic metabolism and bioenergetic homeostasis for most metazoans. For this reason, mechanisms have evolved for eukaryotic cells to adapt to conditions where oxygen demand exceeds supply (hypoxia). These mechanisms rely on the modification of pre-existing proteins, translational arrest and transcriptional changes. The hypoxia inducible factor (HIF; a master regulator of gene induction in response to hypoxia) is responsible for the majority of induced gene expression in hypoxia. However, much less is known about the mechanism(s) responsible for gene repression, an essential part of the adaptive transcriptional response. Hypoxia-induced gene repression leads to a reduction in energy demanding processes and the redirection of limited energetic resources to essential housekeeping functions. Recent developments have underscored the importance of transcriptional repressors in cellular adaptation to hypoxia. To date, at least ten distinct transcriptional repressors have been reported to demonstrate sensitivity to hypoxia. Central among these is the Repressor Element-1 Silencing Transcription factor (REST), which regulates over 200 genes. In this review, written to honor the memory and outstanding scientific legacy of Lorenz Poellinger, we provide an overview of our existing knowledge with respect to transcriptional repressors and their target genes in hypoxia. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Proofreading of misincorporated nucleotides in DNA transcription

    International Nuclear Information System (INIS)

    Voliotis, Margaritis; Liverpool, Tanniemola B; Cohen, Netta; Molina-París, Carmen

    2012-01-01

    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighbouring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction. (paper)

  18. The effects of cocaine on HIV transcription.

    Science.gov (United States)

    Tyagi, Mudit; Weber, Jaime; Bukrinsky, Michael; Simon, Gary L

    2016-06-01

    Illicit drug users are a high-risk population for infection with the human immunodeficiency virus (HIV). A strong correlation exists between prohibited drug use and an increased rate of HIV transmission. Cocaine stands out as one of the most frequently abused illicit drugs, and its use is correlated with HIV infection and disease progression. The central nervous system (CNS) is a common target for both drugs of abuse and HIV, and cocaine intake further accelerates neuronal injury in HIV patients. Although the high incidence of HIV infection in illicit drug abusers is primarily due to high-risk activities such as needle sharing and unprotected sex, several studies have demonstrated that cocaine enhances the rate of HIV gene expression and replication by activating various signal transduction pathways and downstream transcription factors. In order to generate mature HIV genomic transcript, HIV gene expression has to pass through both the initiation and elongation phases of transcription, which requires discrete transcription factors. In this review, we will provide a detailed analysis of the molecular mechanisms that regulate HIV transcription and discuss how cocaine modulates those mechanisms to upregulate HIV transcription and eventually HIV replication.

  19. Intrinsic terminators in Mycoplasma hyopneumoniae transcription.

    Science.gov (United States)

    Fritsch, Tiago Ebert; Siqueira, Franciele Maboni; Schrank, Irene Silveira

    2015-04-08

    Mycoplasma hyopneumoniae, an important pathogen of swine, exhibits a low guanine and cytosine (GC) content genome. M. hyopneumoniae genome is organised in long transcriptional units and promoter sequences have been mapped upstream of all transcription units. These analysis provided insights into the gene organisation and transcription initiation at the genome scale. However, the presence of transcriptional terminator sequences in the M. hyopneumoniae genome is poorly understood. In silico analyses demonstrated the presence of putative terminators in 82% of the 33 monocistronic units (mCs) and in 74% of the 116 polycistronic units (pCs) considering different classes of terminators. The functional activity of 23 intrinsic terminators was confirmed by RT-PCR and qPCR. Analysis of all terminators found by three software algorithms, combined with experimental results, allowed us to propose a pattern of RNA hairpin formation during the termination process and to predict the location of terminators in the M. hyopneumoniae genome sequence. The stem-loop structures of intrinsic terminators of mycoplasma diverge from the pattern of terminators found in other bacteria due the low content of guanine and cytosine. In M. hyopneumoniae, transcription can end after a transcriptional unit and before its terminator sequence and can also continue past the terminator sequence with RNA polymerases gradually releasing the RNA.

  20. Transcriptional tools: Small molecules for modulating CBP KIX-dependent transcriptional activators.

    Science.gov (United States)

    Bates, Caleb A; Pomerantz, William C; Mapp, Anna K

    2011-01-01

    Previously it was demonstrated that amphipathic isoxazolidines are able to functionally replace the transcriptional activation domains of endogenous transcriptional activators. In addition, in vitro binding studies suggested that a key binding partner of these molecules is the CREB Binding Protein (CBP), more specifically the KIX domain within this protein. Here we show that CBP plays an essential role in the ability of isoxazolidine transcriptional activation domains to activate transcription in cells. Consistent with this model, isoxazolidines are able to function as competitive inhibitors of the activators MLL and Jun, both of which utilize a binding interaction with KIX to up-regulate transcription. Further, modification of the N2 side chain produced three analogs with enhanced potency against Jun-mediated transcription, although increased cytotoxicity was also observed. Collectively these small KIX-binding molecules will be useful tools for dissecting the role of the KIX domain in a variety of pathological processes. 2010 Wiley Periodicals, Inc.

  1. MADS-box gene evolution - structure and transcription patterns

    DEFF Research Database (Denmark)

    Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin

    2002-01-01

    Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...

  2. Stimulation of host immune defenses by a small molecule protects C. elegans from bacterial infection.

    Science.gov (United States)

    Pukkila-Worley, Read; Feinbaum, Rhonda; Kirienko, Natalia V; Larkins-Ford, Jonah; Conery, Annie L; Ausubel, Frederick M

    2012-01-01

    The nematode Caenorhabditis elegans offers currently untapped potential for carrying out high-throughput, live-animal screens of low molecular weight compound libraries to identify molecules that target a variety of cellular processes. We previously used a bacterial infection assay in C. elegans to identify 119 compounds that affect host-microbe interactions among 37,214 tested. Here we show that one of these small molecules, RPW-24, protects C. elegans from bacterial infection by stimulating the host immune response of the nematode. Using transcriptome profiling, epistasis pathway analyses with C. elegans mutants, and an RNAi screen, we show that RPW-24 promotes resistance to Pseudomonas aeruginosa infection by inducing the transcription of a remarkably small number of C. elegans genes (∼1.3% of all genes) in a manner that partially depends on the evolutionarily-conserved p38 MAP kinase pathway and the transcription factor ATF-7. These data show that the immunostimulatory activity of RPW-24 is required for its efficacy and define a novel C. elegans-based strategy to identify compounds with activity against antibiotic-resistant bacterial pathogens.

  3. Stimulation of host immune defenses by a small molecule protects C. elegans from bacterial infection.

    Directory of Open Access Journals (Sweden)

    Read Pukkila-Worley

    Full Text Available The nematode Caenorhabditis elegans offers currently untapped potential for carrying out high-throughput, live-animal screens of low molecular weight compound libraries to identify molecules that target a variety of cellular processes. We previously used a bacterial infection assay in C. elegans to identify 119 compounds that affect host-microbe interactions among 37,214 tested. Here we show that one of these small molecules, RPW-24, protects C. elegans from bacterial infection by stimulating the host immune response of the nematode. Using transcriptome profiling, epistasis pathway analyses with C. elegans mutants, and an RNAi screen, we show that RPW-24 promotes resistance to Pseudomonas aeruginosa infection by inducing the transcription of a remarkably small number of C. elegans genes (∼1.3% of all genes in a manner that partially depends on the evolutionarily-conserved p38 MAP kinase pathway and the transcription factor ATF-7. These data show that the immunostimulatory activity of RPW-24 is required for its efficacy and define a novel C. elegans-based strategy to identify compounds with activity against antibiotic-resistant bacterial pathogens.

  4. Interaction between selected bacterial strains and Arabidopsis halleri modulates shoot proteome and cadmium and zinc accumulation

    Science.gov (United States)

    Panigati, Monica; Furini, Antonella

    2011-01-01

    The effects of plant–microbe interactions between the hyperaccumulator Arabidopsis halleri and eight bacterial strains, isolated from the rhizosphere of A. halleri plants grown in a cadmium- and zinc-contaminated site, were analysed for shoot metal accumulation, shoot proteome, and the transcription of genes involved in plant metal homeostasis and hyperaccumulation. Cadmium and zinc concentrations were lower in the shoots of plants cultivated in the presence of these metals plus the selected bacterial strains compared with plants grown solely with these metals or, as previously reported, with plants grown with these metals plus the autochthonous rhizosphere-derived microorganisms. The shoot proteome of plants cultivated in the presence of these selected bacterial strains plus metals, showed an increased abundance of photosynthesis- and abiotic stress-related proteins (e.g. subunits of the photosynthetic complexes, Rubisco, superoxide dismutase, and malate dehydrogenase) counteracted by a decreased amount of plant defence-related proteins (e.g. endochitinases, vegetative storage proteins, and β-glucosidase). The transcription of several homeostasis genes was modulated by the microbial communities and by Cd and Zn content in the shoot. Altogether these results highlight the importance of plant-microbe interactions in plant protein expression and metal accumulation and emphasize the possibility of exploiting microbial consortia for increasing or decreasing shoot metal content. PMID:21357773

  5. Musculoskeletal manifestations of bacterial endocarditis

    Directory of Open Access Journals (Sweden)

    Érika Bevilaqua Rangel

    2000-09-01

    Full Text Available CONTEXT: The incidence of staphylococcal infection has been increasing during the last 20 years. OBJECTIVE: Report a case of staphylococcal endocarditis preceded by musculoskeletal manifestations, which is a rare form of clinical presentation. DESIGN: Case report. CASE REPORT: A 45-year-old-man, without addictions and without known previous cardiopathy, was diagnosed as having definitive acute bacterial endocarditis due to Staphylococcus aureus. Its etiology was community-acquired, arising from a non-apparent primary focus. In addition, the musculoskeletal symptoms preceded the infective endocarditis (IE by about 1 month, which occurred together with other symptoms, e.g. mycotic aneurysms and petechiae. Later, the patient showed perforation of the mitral valve and moderate mitral insufficiency with clinical control.

  6. Bacterial biofilms and antibiotic resistance

    Directory of Open Access Journals (Sweden)

    Liliana Caldas-Arias

    2015-04-01

    Full Text Available Biofilms give to bacteria micro-environmental benefits; confers protection against antimicrobials. Bacteria have antibiotic resistance by conventional and unusual mechanisms leading to delayed wound healing, to increase recurrent chronic infections and nosocomial contamination of medical devices. Objective: This narrative review aims to introduce the characteristics of Bacteria-biofilms, antimicrobial resistance mechanisms and potential alternatives for prevention and control of its formation. Methods: Search strategy was performed on records: PubMed / Medline, Lilacs, Redalyc; with suppliers such as EBSCO and thesaurus MeSH and DeCS. Conclusions: Knowledge and research performance of biofilm bacteria are relevant in the search of technology for detection and measuring sensitivity to antibiotics. The identification of Bacterial-biofilms needs no-traditional microbiological diagnosis.

  7. Microconductometric Detection of Bacterial Contamination

    Directory of Open Access Journals (Sweden)

    Sarra EL ICHI

    2014-05-01

    Full Text Available Several approaches can be used for the electrochemical detection of bacterial contamination. Their performance can be assessed by the ability to detect bacteria at very low concentrations within a short-time response. We have already demonstrated that a conductometric biosensor based on interdigitated thin-film electrodes is adapted to detect bacteria in clinical samples like serum and compatible with microfluidic fabrication. The type of interdigitated microelectrodes influences the performance of the biosensor. This was shown by the results obtained in this work. A magnetic-nanoparticles based immunosensor was designed using gold screen-printed electrodes. The immunosensor was able to specifically detect E. coli in the range of 1-103 CFU mL-1. The new transducer offered a larger active sensing surface with a lower cost and a robust material. Accuracy of the conductance value was enhanced by differential measurements. The immunosensor is compatible with a microfluidic system.

  8. Overview perspective of bacterial resistance.

    Science.gov (United States)

    Furtado, Guilherme H; Nicolau, David P

    2010-10-01

    The rapidly escalating prevalence of antimicrobial resistance is a global concern. This reduced susceptibility to currently available antimicrobial agents coupled with the progressive shortage of newly approved compounds is a worrisome situation. Major problems are encountered for a growing number of Gram-positive (i.e., Staphylococcus aureus, Streptococcus pneumoniae, Enterococcus spp.) and Gram-negative pathogens (i.e., Pseudomonas aeruginosa, Acinetobacter baumannii, Klebsiella pneumoniae). We provide an overview of bacterial resistance focusing on the most common pathogens responsible for infection in both the community and healthcare settings. In addition, several strategies to curb antimicrobial resistance are also discussed. It is increasingly evident that without the introduction of novel antimicrobial agents, a return to the clinical outcomes associated with the pre-antibiotic era are inevitable.

  9. Exometabolomic Profiling of Bacterial Cultures

    DEFF Research Database (Denmark)

    Honoré, Anders Hans

    as the application into other food matrices. The scope of the thesis was to develop and apply a chromatography mass spectrometry based metabolomic footprint workflow for the investigation of the mechanisms behind the antifungal properties of a co‐culture, consisting of Lactobacillus paracasei (LAB A...... chromatography/mass spectrometry (GC/MS). Data from the untargeted LC/MS analysis was processed using feature selection and subsequent multivariate data analysis. The antifungal properties of the co‐culture were composed of several components when fermented in the model system. The major contribution came from......Selected bacterial cultures are used on an industrial scale for biopreservation of fresh fermented dairy products. The selected cultures provide efficient inhibition of yeasts and molds and serve as an alternative to the use of purified or synthetic antimicrobials. Despite the fact that numerous...

  10. Antibiotic resistance of bacterial biofilms

    DEFF Research Database (Denmark)

    Hoiby, N.; Bjarnsholt, T.; Givskov, M.

    2010-01-01

    A biofilm is a structured consortium of bacteria embedded in a self-produced polymer matrix consisting of polysaccharide, protein and DNA. Bacterial biofilms cause chronic infections because they show increased tolerance to antibiotics and disinfectant chemicals as well as resisting phagocytosis...... to antibiotics. Biofilm growth is associated with an increased level of mutations as well as with quorum-sensing-regulated mechanisms. Conventional resistance mechanisms such as chromosomal beta-lactamase, upregulated efflux pumps and mutations in antibiotic target molecules in bacteria also contribute...... to the survival of biofilms. Biofilms can be prevented by early aggressive antibiotic prophylaxis or therapy and they can be treated by chronic suppressive therapy. A promising strategy may be the use of enzymes that can dissolve the biofilm matrix (e.g. DNase and alginate lyase) as well as quorum...

  11. Instability of expanding bacterial droplets.

    Science.gov (United States)

    Sokolov, Andrey; Rubio, Leonardo Dominguez; Brady, John F; Aranson, Igor S

    2018-04-03

    Suspensions of motile bacteria or synthetic microswimmers, termed active matter, manifest a remarkable propensity for self-organization, and formation of large-scale coherent structures. Most active matter research deals with almost homogeneous in space systems and little is known about the dynamics of strongly heterogeneous active matter. Here we report on experimental and theoretical studies on the expansion of highly concentrated bacterial droplets into an ambient bacteria-free fluid. The droplet is formed beneath a rapidly rotating solid macroscopic particle inserted in the suspension. We observe vigorous instability of the droplet reminiscent of a violent explosion. The phenomenon is explained in terms of continuum first-principle theory based on the swim pressure concept. Our findings provide insights into the dynamics of active matter with strong density gradients and significantly expand the scope of experimental and analytic tools for control and manipulation of active systems.

  12. Low Reynolds Number Bacterial Robots

    Science.gov (United States)

    Giesbrecht, Grant; Ni, Katha; Vock, Isaac; Rodenborn, Bruce

    The dynamics of prokaryotic motility in a fluid is important in a wide range of fields. Our experiment models the locomotion of bacteria with a robotic swimmer made using a computer controlled DC motor that drives a helical flagellum formed from welding wire. Because of its small size, a bacterium swimming in water is like our robot swimming in corn syrup. We compensate for the size difference by placing the robot in highly viscous silicone oil. Previous research measured helical propulsion of a swimmer far from a boundary. However proximity to a boundary strongly affects bacterial swimming. We have designed a system to precisely control the distance from the flagellum to the tank wall, and have made some of the first macroscopic measurements of boundary effects on helical propulsion.

  13. Corticosteroids for acute bacterial meningitis.

    Science.gov (United States)

    Brouwer, Matthijs C; McIntyre, Peter; Prasad, Kameshwar; van de Beek, Diederik

    2015-09-12

    In experimental studies, the outcome of bacterial meningitis has been related to the severity of inflammation in the subarachnoid space. Corticosteroids reduce this inflammatory response. To examine the effect of adjuvant corticosteroid therapy versus placebo on mortality, hearing loss and neurological sequelae in people of all ages with acute bacterial meningitis. We searched CENTRAL (2015, Issue 1), MEDLINE (1966 to January week 4, 2015), EMBASE (1974 to February 2015), Web of Science (2010 to February 2015), CINAHL (2010 to February 2015) and LILACS (2010 to February 2015). Randomised controlled trials (RCTs) of corticosteroids for acute bacterial meningitis. We scored RCTs for methodological quality. We collected outcomes and adverse effects. We performed subgroup analyses for children and adults, causative organisms, low-income versus high-income countries, time of steroid administration and study quality. We included 25 studies involving 4121 participants (2511 children and 1517 adults; 93 mixed population). Four studies were of high quality with no risk of bias, 14 of medium quality and seven of low quality, indicating a moderate risk of bias for the total analysis. Nine studies were performed in low-income countries and 16 in high-income countries.Corticosteroids were associated with a non-significant reduction in mortality (17.8% versus 19.9%; risk ratio (RR) 0.90, 95% confidence interval (CI) 0.80 to 1.01, P value = 0.07). A similar non-significant reduction in mortality was observed in adults receiving corticosteroids (RR 0.74, 95% CI 0.53 to 1.05, P value = 0.09). Corticosteroids were associated with lower rates of severe hearing loss (RR 0.67, 95% CI 0.51 to 0.88), any hearing loss (RR 0.74, 95% CI 0.63 to 0.87) and neurological sequelae (RR 0.83, 95% CI 0.69 to 1.00).Subgroup analyses for causative organisms showed that corticosteroids reduced mortality in Streptococcus pneumoniae (S. pneumoniae) meningitis (RR 0.84, 95% CI 0.72 to 0.98), but not in

  14. Autoproteolytic Activation of Bacterial Toxins

    Directory of Open Access Journals (Sweden)

    Aimee Shen

    2010-05-01

    Full Text Available Protease domains within toxins typically act as the primary effector domain within target cells. By contrast, the primary function of the cysteine protease domain (CPD in Multifunctional Autoprocessing RTX-like (MARTX and Clostridium sp. glucosylating toxin families is to proteolytically cleave the toxin and release its cognate effector domains. The CPD becomes activated upon binding to the eukaryotic-specific small molecule, inositol hexakisphosphate (InsP6, which is found abundantly in the eukaryotic cytosol. This property allows the CPD to spatially and temporally regulate toxin activation, making it a prime candidate for developing anti-toxin therapeutics. In this review, we summarize recent findings related to defining the regulation of toxin function by the CPD and the development of inhibitors to prevent CPD-mediated activation of bacterial toxins.

  15. Tuning of Recombinant Protein Expression in Escherichia coli by Manipulating Transcription, Translation Initiation Rates, and Incorporation of Noncanonical Amino Acids.

    Science.gov (United States)

    Schlesinger, Orr; Chemla, Yonatan; Heltberg, Mathias; Ozer, Eden; Marshall, Ryan; Noireaux, Vincent; Jensen, Mogens Høgh; Alfonta, Lital

    2017-06-16

    Protein synthesis in cells has been thoroughly investigated and characterized over the past 60 years. However, some fundamental issues remain unresolved, including the reasons for genetic code redundancy and codon bias. In this study, we changed the kinetics of the Eschrichia coli transcription and translation processes by mutating the promoter and ribosome binding domains and by using genetic code expansion. The results expose a counterintuitive phenomenon, whereby an increase in the initiation rates of transcription and translation lead to a decrease in protein expression. This effect can be rescued by introducing slow translating codons into the beginning of the gene, by shortening gene length or by reducing initiation rates. On the basis of the results, we developed a biophysical model, which suggests that the density of co-transcriptional-translation plays a role in bacterial protein synthesis. These findings indicate how cells use codon bias to tune translation speed and protein synthesis.

  16. Anaerobic bacterial meningitis in adults.

    Science.gov (United States)

    Lee, Jun-Jun; Lien, Chia-Yi; Chien, Chun-Chih; Huang, Chi-Ren; Tsai, Nai-Wen; Chang, Chiung-Chih; Lu, Cheng-Hsien; Chang, Wen-Neng

    2018-01-22

    Anaerobic infection is a very uncommon condition in adult bacterial meningitis (ABM), and its clinical characteristics have yet to be clarified. We enrolled 540 patients with culture-proven bacterial meningitis during a study period of 30 years (1986-2015), of whom 13 (2.4%) had anaerobic infections. These 13 patients were eight men and five women, aged 22-77 years. Among them, 53.8% (7/13) had a postneurosurgical state as the preceding event, and 79.6% (10/13) had underlying medical conditions including diabetes mellitus, malignancy, liver cirrhosis, cerebral infarct and alcoholism. Nosocomial and mixed infections were found in 15.5% (2/13) and 46.1% (6/13) of the patients, respectively. A total of 14 anaerobic strains were isolated from cerebrospinal fluid specimens, including nine Gram-negative (G(-)) strains: Fusobacterium nucleatum (3), Prevotella species (3) and Bacteroides fragilis (3), and five Gram-positive (G(+)) strains: Propionibacterium acnes (3) and Peptostreptococcus micros (also known as Parvimonas micra) (2). All of the implicated G(+) anaerobic bacteria were susceptible to penicillin, and no multiple drug-resistant strains were found among the implicated G(-) anaerobic bacteria. Despite treatment, 30.8% (4/13) of the patients died. Of the nine survivors, 22.2% (2/9) had a full recovery, while the other 77.8% (7/9) had varying degrees of neurological deficits. Compared with the good outcome group (n = 6, modified Rankin scale (mRS) scores: 0-2), the poor outcome group (n = 7, mRS scores ≧3) had higher incidence of seizure. These results may offer a preliminary view of the clinical characteristics of anaerobic ABM. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Dynamic analysis of stochastic transcription cycles.

    Directory of Open Access Journals (Sweden)

    Claire V Harper

    2011-04-01

    Full Text Available In individual mammalian cells the expression of some genes such as prolactin is highly variable over time and has been suggested to occur in stochastic pulses. To investigate the origins of this behavior and to understand its functional relevance, we quantitatively analyzed this variability using new mathematical tools that allowed us to reconstruct dynamic transcription rates of different reporter genes controlled by identical promoters in the same living cell. Quantitative microscopic analysis of two reporter genes, firefly luciferase and destabilized EGFP, was used to analyze the dynamics of prolactin promoter-directed gene expression in living individual clonal and primary pituitary cells over periods of up to 25 h. We quantified the time-dependence and cyclicity of the transcription pulses and estimated the length and variation of active and inactive transcription phases. We showed an average cycle period of approximately 11 h and demonstrated that while the measured time distribution of active phases agreed with commonly accepted models of transcription, the inactive phases were differently distributed and showed strong memory, with a refractory period of transcriptional inactivation close to 3 h. Cycles in transcription occurred at two distinct prolactin-promoter controlled reporter genes in the same individual clonal or primary cells. However, the timing of the cycles was independent and out-of-phase. For the first time, we have analyzed transcription dynamics from two equivalent loci in real-time in single cells. In unstimulated conditions, cells showed independent transcription dynamics at each locus. A key result from these analyses was the evidence for a minimum refractory period in the inactive-phase of transcription. The response to acute signals and the result of manipulation of histone acetylation was consistent with the hypothesis that this refractory period corresponded to a phase of chromatin remodeling which significantly

  18. High-Resolution Mapping and Dynamics of the Transcriptome, Transcription Factors, and Transcription Co-Factor Networks in Classically and Alternatively Activated Macrophages

    Directory of Open Access Journals (Sweden)

    Amitabh Das

    2018-01-01

    Full Text Available Macrophages are the prime innate immune cells of the inflammatory response, and the combination of multiple signaling inputs derived from the recognition of host factors [e.g., interferon-g (IFN-γ] and invading pathogen products (e.g., toll-like receptors (TLRs agonists are required to maintain essential macrophage function. The profound effects on biological outcomes of inflammation associated with IFN-γ pretreatment (“priming” and TLR4 ligand bacterial lipopolysaccharide (LPS-induced macrophage activation (M1 or classical activation have long been recognized, but the underlying mechanisms are not well defined. Therefore, we analyzed gene expression profiles of macrophages and identified genes, transcription factors (TFs, and transcription co-factors (TcoFs that are uniquely or highly expressed in IFN-γ-mediated TLR4 ligand LPS-inducible versus only TLR4 ligand LPS-inducible primary macrophages. This macrophage gene expression has not been observed in macrophage cell lines. We also showed that interleukin (IL-4 and IL-13 (M2 or alternative activation elicited the induction of a distinct subset of genes related to M2 macrophage polarization. Importantly, this macrophage gene expression was also associated with promoter conservation. In particular, our approach revealed novel roles for the TFs and TcoFs in response to inflammation. We believe that the systematic approach presented herein is an important framework to better understand the transcriptional machinery of different macrophage subtypes.

  19. Pituitary apoplexy initially mistaken for bacterial meningitis

    OpenAIRE

    Wong, Sui Hsien; Das, Kumar; Javadpour, Mohsen

    2013-01-01

    We presented a case of a 62-year-old man whose initial clinical picture was suggestive of bacterial meningitis, but instead had pituitary apoplexy. We highlighted how pituitary apoplexy can mimic bacterial meningitis, learning points on how clinical assessment can aid earlier diagnosis and the importance of considering this differential diagnosis, particularly with the associated morbidity and mortality if missed.

  20. neonatal bacterial meningitis in Cape Town children

    African Journals Online (AJOL)

    neonatal bacterial meningitis in Cape Town children. Bacterial meningitis is a major cause of childhood morbidity and mortality in South Africa. However, comprehensive regional or national epidemiological data, essential for rational public health interventions, are lacking. The purpose of this 1-year prospective study, from.

  1. Proteomic Analysis of Bacterial Expression Profiles Following ...

    African Journals Online (AJOL)

    Bacterial proteins were then extracted from the cell pellets and culture supernatants, using bacterial protein extraction reagent (Thermo Scientific) and ammonium sulfate precipitation. SDS-PAGE gel electrophoresis and protein sequence analysis. SDS-PAGE gel electrophoresis was performed using 12 % resolving gel [1.5 ...

  2. Use of Bacteriophages to control bacterial pathogens

    Science.gov (United States)

    Lytic bacteriophages can provide a natural method and an effective alternative to antibiotics to reduce bacterial pathogens in animals, foods, and other environments. Bacteriophages (phages) are viruses which infect bacterial cells and eventually kill them through lysis, and represent the most abun...

  3. Joshua Lederberg's Legacy to Bacterial Genetics

    Indian Academy of Sciences (India)

    Srimath

    team which developed the artificial intelligence software program DENDRAL. ... to clear up all the uncertainties and lay the firm foundations of modern bacterial genetics. In order to understand and appreciate. As far as bacterial genetics is concerned, even the very existence ... Do they exist before exposure to the selective.

  4. Bacterial biofilms: prokaryotic adventures in multicellularity

    DEFF Research Database (Denmark)

    Webb, J.S.; Givskov, Michael Christian; Kjelleberg, S.

    2003-01-01

    The development of bacterial biofilms includes both the initial social behavior of undifferentiated cells, as well as cell death and differentiation in the mature biofilm, and displays several striking similarities with higher organisms. Recent advances in the field provide new insight...... into differentiation and cell death events in bacterial biofilm development and propose that biofilms have an unexpected level of multicellularity....

  5. Corrosion, haemocompatibility and bacterial adhesion behaviour of ...

    Indian Academy of Sciences (India)

    Bacterial adhesion, haemocompatibility and corrosion behaviour of TiZrN coating were examined in order to evaluate the coating's compatibility for ideal implant. Results revealed that TiZrN coatings exhibited less bacterial attachment against Staphylococcus aureus and Escherichia coli bacteria, negligible platelets ...

  6. Periarrest intestinal bacterial translocation and resuscitation outcome.

    Science.gov (United States)

    Chalkias, Athanasios; Scheetz, Marc H; Gulati, Anil; Xanthos, Theodoros

    2016-02-01

    During the periarrest period, intestinal ischemia may result in barrier dysfunction and bacterial translocation, which has clear mechanistic links to inflammation and cascade stimulation, especially in patients who are treated with therapeutic hypothermia. Despite optimal management, periarrest bacterial translocation may worsen the outcome of cardiac arrest victims. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. 7 CFR 58.135 - Bacterial estimate.

    Science.gov (United States)

    2010-01-01

    ... Specifications for Dairy Plants Approved for USDA Inspection and Grading Service 1 Quality Specifications for Raw Milk § 58.135 Bacterial estimate. (a) Methods of Testing. Milk shall be tested for bacterial estimate... representative sample of each producer's milk at least once each month at irregular intervals. Samples shall be...

  8. Susceptibility of Some Bacterial Contaminants Recovered from ...

    African Journals Online (AJOL)

    Purpose: To investigate the susceptibility of bacterial contaminants recovered from cosmetics to preservatives and antibiotics. Methods: Nine bacterial isolates recovered from various brands of commercially available cosmetics marketed in Jordan were tested for their susceptibility pattern against two paraben esters and two ...

  9. Susceptibility of Some Bacterial Contaminants Recovered from ...

    African Journals Online (AJOL)

    Purpose: To investigate the susceptibility of bacterial contaminants recovered from cosmetics to preservatives and antibiotics. Methods: Nine bacterial isolates recovered from various brands of commercially available cosmetics marketed in Jordan were tested for their susceptibility pattern against two paraben esters and two.

  10. Dynamics of immune system gene expression upon bacterial challenge and wounding in a social insect (Bombus terrestris.

    Directory of Open Access Journals (Sweden)

    Silvio Erler

    2011-03-01

    Full Text Available The innate immune system which helps individuals to combat pathogens comprises a set of genes representing four immune system pathways (Toll, Imd, JNK and JAK/STAT. There is a lack of immune genes in social insects (e.g. honeybees when compared to Diptera. Potentially, this might be compensated by an advanced system of social immunity (synergistic action of several individuals. The bumble bee, Bombus terrestris, is a primitively eusocial species with an annual life cycle and colonies headed by a single queen. We used this key pollinator to study the temporal dynamics of immune system gene expression in response to wounding and bacterial challenge.Antimicrobial peptides (AMP (abaecin, defensin 1, hymenoptaecin were strongly up-regulated by wounding and bacterial challenge, the latter showing a higher impact on the gene expression level. Sterile wounding down-regulated TEP A, an effector gene of the JAK/STAT pathway, and bacterial infection influenced genes of the Imd (relish and JNK pathway (basket. Relish was up-regulated within the first hour after bacterial challenge, but decreased strongly afterwards. AMP expression following wounding and bacterial challenge correlates with the expression pattern of relish whereas correlated expression with dorsal was absent. Although expression of AMPs was high, continuous bacterial growth was observed throughout the experiment.Here we demonstrate for the first time the temporal dynamics of immune system gene expression in a social insect. Wounding and bacterial challenge affected the innate immune system significantly. Induction of AMP expression due to wounding might comprise a pre-adaptation to accompanying bacterial infections. Compared with solitary species this social insect exhibits reduced immune system efficiency, as bacterial growth could not be inhibited. A negative feedback loop regulating the Imd-pathway is suggested. AMPs, the end product of the Imd-pathway, inhibited the up-regulation of the

  11. Extraction of transcript diversity from scientific literature.

    Directory of Open Access Journals (Sweden)

    Parantu K Shah

    2005-06-01

    Full Text Available Transcript diversity generated by alternative splicing and associated mechanisms contributes heavily to the functional complexity of biological systems. The numerous examples of the mechanisms and functional implications of these events are scattered throughout the scientific literature. Thus, it is crucial to have a tool that can automatically extract the relevant facts and collect them in a knowledge base that can aid the interpretation of data from high-throughput methods. We have developed and applied a composite text-mining method for extracting information on transcript diversity from the entire MEDLINE database in order to create a database of genes with alternative transcripts. It contains information on tissue specificity, number of isoforms, causative mechanisms, functional implications, and experimental methods used for detection. We have mined this resource to identify 959 instances of tissue-specific splicing. Our results in combination with those from EST-based methods suggest that alternative splicing is the preferred mechanism for generating transcript diversity in the nervous system. We provide new annotations for 1,860 genes with the potential for generating transcript diversity. We assign the MeSH term "alternative splicing" to 1,536 additional abstracts in the MEDLINE database and suggest new MeSH terms for other events. We have successfully extracted information about transcript diversity and semiautomatically generated a database, LSAT, that can provide a quantitative understanding of the mechanisms behind tissue-specific gene expression. LSAT (Literature Support for Alternative Transcripts is publicly available at http://www.bork.embl.de/LSAT/.

  12. C-reactive protein and bacterial meningitis

    DEFF Research Database (Denmark)

    Gerdes, Lars Ulrik; Jørgensen, P E; Nexø, E

    1998-01-01

    The aim of the study was to review published articles on the diagnostic accuracy of C-reactive protein (CRP) tests with cerebrospinal fluid and serum in diagnosing bacterial meningitis. The literature from 1980 and onwards was searched using the electronic databases of MEDLINE, and we used summary...... measured in serum, and 4 in which it had been measured in both cerebrospinal fluid and serum. The odds ratio for bacterial meningitis versus aseptic meningitis for a positive CRP test with cerebrospinal fluid was estimated at 241 (95% confidence interval [CI]: 59-980), and the central tendencies.......06-0.08, respectively, the post-test probability of not having bacterial meningitis given a negative test is very high (> or = 97%), in the range of a pre-test probability (prevalence of bacterial meningitis) from 10 to 30%, whereas the post-test probability of bacterial meningitis given a positive test is considerably...

  13. Calcification and Diagenesis of Bacterial Colonies

    Directory of Open Access Journals (Sweden)

    Ninon Robin

    2015-07-01

    Full Text Available Evidencing ancient interspecific associations in the fossil record may be challenging, particularly when bacterial organisms have most likely been degraded during diagenesis. Yet, documenting ancient interspecific associations may provide valuable insights into paleoenvironmental conditions and paleocommunities. Here, we report the multiscale characterization of contemporary and fossilized calcifying bacterial colonies found on contemporary shrimps from Mexico (La Paz Bay and on 160-Ma old fossilized decapods (shrimps from the Lagerstätte of La Voulte-sur-Rhône (France, respectively. We document the fine scale morphology, the inorganic composition and the organic signatures of both the contemporary and fossilized structures formed by these bacterial colonies using a combination of electron microscopies and synchrotron-based scanning transmission X-ray microscopy. In addition to discussing the mechanisms of carbonate precipitation by such bacterial colonies, the present study illustrates the degradation of bacterial remains occurring during diagenesis.

  14. Bacterial Biofilm Control by Perturbation of Bacterial Signaling Processes

    Directory of Open Access Journals (Sweden)

    Tim Holm Jakobsen

    2017-09-01

    Full Text Available The development of effective strategies to combat biofilm infections by means of either mechanical or chemical approaches could dramatically change today’s treatment procedures for the benefit of thousands of patients. Remarkably, considering the increased focus on biofilms in general, there has still not been invented and/or developed any simple, efficient and reliable methods with which to “chemically” eradicate biofilm infections. This underlines the resilience of infective agents present as biofilms and it further emphasizes the insufficiency of today’s approaches used to combat chronic infections. A potential method for biofilm dismantling is chemical interception of regulatory processes that are specifically involved in the biofilm mode of life. In particular, bacterial cell to cell signaling called “Quorum Sensing” together with intracellular signaling by bis-(3′-5′-cyclic-dimeric guanosine monophosphate (cyclic-di-GMP have gained a lot of attention over the last two decades. More recently, regulatory processes governed by two component regulatory systems and small non-coding RNAs have been increasingly investigated. Here, we review novel findings and potentials of using small molecules to target and modulate these regulatory processes in the bacterium Pseudomonas aeruginosa to decrease its pathogenic potential.

  15. Oral bacterial DNA findings in pericardial fluid

    Directory of Open Access Journals (Sweden)

    Anne-Mari Louhelainen

    2014-11-01

    Full Text Available Background: We recently reported that large amounts of oral bacterial DNA can be found in thrombus aspirates of myocardial infarction patients. Some case reports describe bacterial findings in pericardial fluid, mostly done with conventional culturing and a few with PCR; in purulent pericarditis, nevertheless, bacterial PCR has not been used as a diagnostic method before. Objective: To find out whether bacterial DNA can be measured in the pericardial fluid and if it correlates with pathologic–anatomic findings linked to cardiovascular diseases. Methods: Twenty-two pericardial aspirates were collected aseptically prior to forensic autopsy at Tampere University Hospital during 2009–2010. Of the autopsies, 10 (45.5% were free of coronary artery disease (CAD, 7 (31.8% had mild and 5 (22.7% had severe CAD. Bacterial DNA amounts were determined using real-time quantitative PCR with specific primers and probes for all bacterial strains associated with endodontic disease (Streptococcus mitis group, Streptococcus anginosus group, Staphylococcus aureus/Staphylococcus epidermidis, Prevotella intermedia, Parvimonas micra and periodontal disease (Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Treponema denticola, Fusobacterium nucleatus, and Dialister pneumosintes. Results: Of 22 cases, 14 (63.6% were positive for endodontic and 8 (36.4% for periodontal-disease-associated bacteria. Only one case was positive for bacterial culturing. There was a statistically significant association between the relative amount of bacterial DNA in the pericardial fluid and the severity of CAD (p=0.035. Conclusions: Oral bacterial DNA was detectable in pericardial fluid and an association between the severity of CAD and the total amount of bacterial DNA in pericardial fluid was found, suggesting that this kind of measurement might be useful for clinical purposes.

  16. Vibrio elicits targeted transcriptional responses from copepod hosts.

    Science.gov (United States)

    Almada, Amalia A; Tarrant, Ann M

    2016-06-01

    Copepods are abundant crustaceans that harbor diverse bacterial communities, yet the nature of their interactions with microbiota are poorly understood. Here, we report that Vibrio elicits targeted transcriptional responses in the estuarine copepod Eurytemora affinis We pre-treated E. affinis with an antibiotic cocktail and exposed them to either a zooplankton specialist (Vibrio sp. F10 9ZB36) or a free-living species (Vibrio ordalii 12B09) for 24 h. We then identified via RNA-Seq a total of 78 genes that were differentially expressed following Vibrio exposure, including homologs of C-type lectins, chitin-binding proteins and saposins. The response differed between the two Vibrio treatments, with the greatest changes elicited upon inoculation with V. sp. F10 We suggest that these differentially regulated genes play important roles in cuticle integrity, the innate immune response, and general stress response, and that their expression may enable E. affinis to recognize and regulate symbiotic vibrios. We further report that V. sp. F10 culturability is specifically altered upon colonization of E. affinis These findings suggest that rather than acting as passive environmental vectors, copepods discriminately interact with vibrios, which may ultimately impact the abundance and activity of copepod-associated bacteria. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Transcriptional reprogramming in nonhuman primate (rhesus macaque tuberculosis granulomas.

    Directory of Open Access Journals (Sweden)

    Smriti Mehra

    2010-08-01

    Full Text Available In response to Mtb infection, the host remodels the infection foci into a dense mass of cells known as the granuloma. The key objective of the granuloma is to contain the spread of Mtb into uninfected regions of the lung. However, it appears that Mtb has evolved mechanisms to resist killing in the granuloma. Profiling granuloma transcriptome will identify key immune signaling pathways active during TB infection. Such studies are not possible in human granulomas, due to various confounding factors. Nonhuman Primates (NHPs infected with Mtb accurately reflect human TB in clinical and pathological contexts.We studied transcriptomics of granuloma lesions in the lungs of NHPs exhibiting active TB, during early and late stages of infection. Early TB lesions were characterized by a highly pro-inflammatory environment, expressing high levels of immune signaling pathways involving IFNgamma, TNFalpha, JAK, STAT and C-C/C-X-C chemokines. Late TB lesions, while morphologically similar to the early ones, exhibited an overwhelming silencing of the inflammatory response. Reprogramming of the granuloma transcriptome was highly significant. The expression of approximately two-thirds of all genes induced in early lesions was later repressed.The transcriptional characteristics of TB granulomas undergo drastic changes during the course of infection. The overwhelming reprogramming of the initial pro-inflammatory surge in late lesions may be a host strategy to limit immunopathology. We propose that these host profiles can predict changes in bacterial replication and physiology, perhaps serving as markers for latency and reactivation.

  18. Transcriptional features of genomic regulatory blocks.

    Science.gov (United States)

    Akalin, Altuna; Fredman, David; Arner, Erik; Dong, Xianjun; Bryne, Jan Christian; Suzuki, Harukazu; Daub, Carsten O; Hayashizaki, Yoshihide; Lenhard, Boris

    2009-01-01

    Genomic regulatory blocks (GRBs) are chromosomal regions spanned by highly conserved non-coding elements (HCNEs), most of which serve as regulatory inputs of one target gene in the region. The target genes are most often transcription factors involved in embryonic development and differentiation. GRBs often contain extensive gene deserts, as well as additional 'bystander' genes intertwined with HCNEs but whose expression and function are unrelated to those of the target gene. The tight regulation of target genes, complex arrangement of regulatory inputs, and the differential responsiveness of genes in the region call for the examination of fundamental rules governing transcriptional activity in GRBs. Here we use extensive CAGE tag mapping of transcription start sites across different human tissues and differentiation stages combined with expression data and a number of sequence and epigenetic features to discover these rules and patterns. We show evidence that GRB target genes have properties that set them apart from their bystanders as well as other genes in the genome: longer CpG islands, a higher number and wider spacing of alternative transcription start sites, and a distinct composition of transcription factor binding sites in their core/proximal promoters. Target gene expression correlates with the acetylation state of HCNEs in the region. Additionally, target gene promoters have a distinct combination of activating and repressing histone modifications in mouse embryonic stem cell lines. GRB targets are genes with a number of unique features that are the likely cause of their ability to respond to regulatory inputs from very long distances.

  19. Var transcription profiling of Plasmodium falciparum 3D7: assignment of cytoadherent phenotypes to dominant transcripts

    Directory of Open Access Journals (Sweden)

    Wunderlich Gerhard

    2008-01-01

    Full Text Available Abstract Background Cytoadherence of Plasmodium falciparum-infected red blood cells is mediated by var gene-encoded P. falciparum erythrocyte membrane protein-1 and host receptor preference depends in most cases on which of the 50–60 var genes per genome is expressed. Enrichment of phenotypically homogenous parasites by panning on receptor expressing cells is fundamental for the identification of the corresponding var transcript. Methods P. falciparum 3D7 parasites were panned on several transfected CHO-cell lines and their var transcripts analysed by i reverse transcription/PCR/cloning/sequencing using a universal DBLα specific oligonucleotide pair and ii by reverse transcription followed by quantitative PCR using 57 different oligonucleotide pairs. Results Each cytoadherence selected parasite line also adhered to untransfected CHO-745 cells and upregulation of the var gene PFD995/PFD1000c was consistently associated with cytoadherence to all but one CHO cell line. In addition, parasites panned on different CHO cell lines revealed candidate var genes which reproducibly associated to the respective cytoadherent phenotype. The transcription profile obtained by RT-PCR/cloning/sequencing differed significantly from that of RT-quantitative PCR. Conclusion Transfected CHO cell lines are of limited use for the creation of monophenotypic cytoadherent parasite lines. Nevertheless, 3D7 parasites can be reproducibly selected for the transcription of different determined var genes without genetic manipulation. Most importantly, var transcription analysis by RT-PCR/cloning/sequencing may lead to erroneous interpretation of var transcription profiles.

  20. The transcript release factor PTRF augments ribosomal gene transcription by facilitating reinitiation of RNA polymerase I

    Czech Academy of Sciences Publication Activity Database

    Jansa, Petr; Burek, C.; Sander, E. E.; Grummt, I.

    2001-01-01

    Roč. 29, č. 2 (2001), s. 423-429 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z5052915 Keywords : rDNA transcription * PTRF * transcription reinitiation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.373, year: 2001

  1. Transcription factor, promoter, and enhancer utilization in human myeloid cells

    NARCIS (Netherlands)

    Joshi, Anagha; Pooley, Christopher; Freeman, Tom C.; Lennartsson, Andreas; Babina, Magda; Schmidl, Christian; Geijtenbeek, Teunis; Michoel, Tom; Severin, Jessica; Itoh, Masayoshi; Lassmann, Timo; Kawaji, Hideya; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R. R.; Rehli, Michael; Hume, David A.

    2015-01-01

    The generation of myeloid cells from their progenitors is regulated at the level of transcription by combinatorial control of key transcription factors influencing cell-fate choice. To unravel the global dynamics of this process at the transcript level, we generated transcription profiles for 91

  2. Bacterial Histidine Kinases as Novel Antibacterial Drug Targets

    NARCIS (Netherlands)

    Bem, A.E.; Velikova, N.R.; Pellicer, M.T.; Baarlen, van P.; Marina, A.; Wells, J.M.

    2015-01-01

    Bacterial histidine kinases (HKs) are promising targets for novel antibacterials. Bacterial HKs are part of bacterial two-component systems (TCSs), the main signal transduction pathways in bacteria, regulating various processes including virulence, secretion systems and antibiotic resistance. In

  3. Community-acquired bacterial meningitis in alcoholic patients

    NARCIS (Netherlands)

    Weisfelt, M.; de Gans, J.; van der Ende, A.; van de Beek, D.

    2010-01-01

    BACKGROUND: Alcoholism is associated with susceptibility to infectious disease, particularly bacterial pneumonia. In the present study we described characteristics in alcoholic patients with bacterial meningitis and delineate the differences with findings in non-alcoholic adults with bacterial

  4. Controllability analysis of transcriptional regulatory networks reveals circular control patterns among transcription factors

    DEFF Research Database (Denmark)

    Österlund, Tobias; Bordel, Sergio; Nielsen, Jens

    2015-01-01

    we analyze the topology and organization of nine transcriptional regulatory networks for E. coli, yeast, mouse and human, and we evaluate how the structure of these networks influences two of their key properties, namely controllability and stability. We calculate the controllability for each network......Transcriptional regulation is the most committed type of regulation in living cells where transcription factors (TFs) control the expression of their target genes and TF expression is controlled by other TFs forming complex transcriptional regulatory networks that can be highly interconnected. Here...... as a measure of the organization and interconnectivity of the network. We find that the number of driver nodes n(D) needed to control the whole network is 64% of the TFs in the E. coli transcriptional regulatory network in contrast to only 17% for the yeast network, 4% for the mouse network and 8...

  5. Transcriptional control of mitosis: deregulation and cancer

    Directory of Open Access Journals (Sweden)

    Somsubhra eNath

    2015-05-01

    Full Text Available Research over the past few decades has well established the molecular functioning of mitosis. Deregulation of these functions has also been attributed to the generation of aneuploidy in different tumor types. Numerous studies have given insight into the regulation of mitosis by cell cycle specific proteins. Optimum abundance of these proteins is pivotal to timely execution of mitosis. Aberrant expressions of these mitotic proteins have been reported in different cancer types. Several post-transcriptional mechanisms and their interplay have subsequently been identified that control the level of mitotic proteins. However, to date, infrequent incidences of cancer-associated mutations have been reported for the genes expressing these proteins. Therefore, altered expression of these mitotic regulators in tumor samples can largely be attributed to transcriptional deregulation. This review discusses the biology of transcriptional control for mitosis and evaluates its role in the generation of aneuploidy and tumorigenesis.

  6. Transcriptional control of the cell cycle.

    Science.gov (United States)

    Sánchez, I; Dynlacht, B D

    1996-06-01

    Although a significant amount of evidence has demonstrated that there are intimate connections between transcriptional controls and cell cycle regulation, the precise mechanisms underlying these connections remain largely obscure. A number of recent advances have helped to define how critical cell cycle regulators, such as the retinoblastoma family of tumor suppressor proteins and the cyclin-dependent kinases, might function on a biochemical level and how such mechanisms of action have been conserved not only in the regulation of transcription by all three RNA polymerases but also across species lines. In addition, the use of in vivo techniques has begun to explain how the activity of the E2F transcription factor family is tied to the cell cycle dependent expression of target genes.

  7. Runx transcription factors in neuronal development

    Directory of Open Access Journals (Sweden)

    Shiga Takashi

    2008-08-01

    Full Text Available Abstract Runt-related (Runx transcription factors control diverse aspects of embryonic development and are responsible for the pathogenesis of many human diseases. In recent years, the functions of this transcription factor family in the nervous system have just begun to be understood. In dorsal root ganglion neurons, Runx1 and Runx3 play pivotal roles in the development of nociceptive and proprioceptive sensory neurons, respectively. Runx appears to control the transcriptional regulation of neurotrophin receptors, numerous ion channels and neuropeptides. As a consequence, Runx contributes to diverse aspects of the sensory system in higher vertebrates. In this review, we summarize recent progress in determining the role of Runx in neuronal development.

  8. Battles and hijacks: Noncoding transcription in plants

    KAUST Repository

    Ariel, Federico

    2015-06-01

    Noncoding RNAs have emerged as major components of the eukaryotic transcriptome. Genome-wide analyses revealed the existence of thousands of long noncoding RNAs (lncRNAs) in several plant species. Plant lncRNAs are transcribed by the plant-specific RNA polymerases Pol IV and Pol V, leading to transcriptional gene silencing, as well as by Pol II. They are involved in a wide range of regulatory mechanisms impacting on gene expression, including chromatin remodeling, modulation of alternative splicing, fine-tuning of miRNA activity, and the control of mRNA translation or accumulation. Recently, dual noncoding transcription by alternative RNA polymerases was implicated in epigenetic and chromatin conformation dynamics. This review integrates the current knowledge on the regulatory mechanisms acting through plant noncoding transcription. © 2015 Elsevier Ltd.

  9. Deciphering the Innate Lymphoid Cell Transcriptional Program

    Directory of Open Access Journals (Sweden)

    Cyril Seillet

    2016-10-01

    Full Text Available Innate lymphoid cells (ILCs are enriched at mucosal surfaces, where they provide immune surveillance. All ILC subsets develop from a common progenitor that gives rise to pre-committed progenitors for each of the ILC lineages. Currently, the temporal control of gene expression that guides the emergence of these progenitors is poorly understood. We used global transcriptional mapping to analyze gene expression in different ILC progenitors. We identified PD-1 to be specifically expressed in PLZF+ ILCp and revealed that the timing and order of expression of the transcription factors NFIL3, ID2, and TCF-1 was critical. Importantly, induction of ILC lineage commitment required only transient expression of NFIL3 prior to ID2 and TCF-1 expression. These findings highlight the importance of the temporal program that permits commitment of progenitors to the ILC lineage, and they expand our understanding of the core transcriptional program by identifying potential regulators of ILC development.

  10. Transcriptional inhibition by the retinoblastoma protein

    DEFF Research Database (Denmark)

    Fattaey, A; Helin, K; Harlow, E

    1993-01-01

    The retinoblastoma protein, pRB, appears to play a key role in coordinating the regulation of cell cycle position and transcriptional events. pRB undergoes specific cell-cycle-dependent phosphorylation, being underphosphorylated in G1 and heavily phosphorylated in S, G2, and M. The underphosphory......The retinoblastoma protein, pRB, appears to play a key role in coordinating the regulation of cell cycle position and transcriptional events. pRB undergoes specific cell-cycle-dependent phosphorylation, being underphosphorylated in G1 and heavily phosphorylated in S, G2, and M......-mediated transcription would be lost by mutation in the retinoblastoma gene in human tumours, by pRB's interaction with DNA tumour virus oncoproteins, or by phosphorylation during the cell cycle....

  11. Transcription regulatory networks analysis using CAGE

    KAUST Repository

    Tegnér, Jesper N.

    2009-10-01

    Mapping out cellular networks in general and transcriptional networks in particular has proved to be a bottle-neck hampering our understanding of biological processes. Integrative approaches fusing computational and experimental technologies for decoding transcriptional networks at a high level of resolution is therefore of uttermost importance. Yet, this is challenging since the control of gene expression in eukaryotes is a complex multi-level process influenced by several epigenetic factors and the fine interplay between regulatory proteins and the promoter structure governing the combinatorial regulation of gene expression. In this chapter we review how the CAGE data can be integrated with other measurements such as expression, physical interactions and computational prediction of regulatory motifs, which together can provide a genome-wide picture of eukaryotic transcriptional regulatory networks at a new level of resolution. © 2010 by Pan Stanford Publishing Pte. Ltd. All rights reserved.

  12. Crowdsourcing for quantifying transcripts: An exploratory study.

    Science.gov (United States)

    Azzam, Tarek; Harman, Elena

    2016-02-01

    This exploratory study attempts to demonstrate the potential utility of crowdsourcing as a supplemental technique for quantifying transcribed interviews. Crowdsourcing is the harnessing of the abilities of many people to complete a specific task or a set of tasks. In this study multiple samples of crowdsourced individuals were asked to rate and select supporting quotes from two different transcripts. The findings indicate that the different crowdsourced samples produced nearly identical ratings of the transcripts, and were able to consistently select the same supporting text from the transcripts. These findings suggest that crowdsourcing, with further development, can potentially be used as a mixed method tool to offer a supplemental perspective on transcribed interviews. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Radionuclide scintigraphy of bacterial nephritis

    Energy Technology Data Exchange (ETDEWEB)

    Conway, J.J.; Weiss, S.C.; Shkolnik, A.; Yogev, R.; Firlit, C.; Traisman, E.S.

    1984-01-01

    Pyelonephritis is a leading cause of renal failure and is expected to cost as much as three billion dollars in 1984. The diagnosis of urinary tract infection is usually not difficult. However, localization of the infection within the renal parenchyma as opposed to the collecting system is much more difficult. Flank pain, fever, bacteiuria and evidence of parenchymal involvement by intravenous urography may be absent or unrecognized particularly in the infant. Ultrasound and Nuclear Medicine are advocated as better methods to define parenchymal involvement. Such definition is important in the consideration of treatment since parenchymal involvement of the kidney carries a much more ominous potential outcome than infection restricted to within the collecting system. 38 children with a clinical diagnosis of urinary tract infection were studied. 26 of the patients demonstrated abnormal renal parenchymal findings with Gallium-67 Citrate or Tc-99m Glucoheptonate scintigraphy. Intravenous urography was notably ineffective with only 5 of the 20 interpreted as abnormal due to parenchymal disease or decreased function. 11 were entirely normal while only 5 demonstrated scars or hydronephrosis. Only 10 of 17 patients demonstrated intranvesicoureteral reflux on x-ray or nuclear cystography. Ultrasound depicted 6 of 20 patients as having parenchymal abnormalities. Seven were normal. Nonspecific findings such as dilitation of the renal pelvis or renal enlargement was noted in 11 of the 20 patients. Radionuclide Scintigraphy is the most efficacious modality to detect since acute bacterial nephritis.

  14. Gut bacterial microbiota and obesity.

    Science.gov (United States)

    Million, M; Lagier, J-C; Yahav, D; Paul, M

    2013-04-01

    Although probiotics and antibiotics have been used for decades as growth promoters in animals, attention has only recently been drawn to the association between the gut microbiota composition, its manipulation, and obesity. Studies in mice have associated the phylum Firmicutes with obesity and the phylum Bacteroidetes with weight loss. Proposed mechanisms linking the microbiota to fat content and weight include differential effects of bacteria on the efficiency of energy extraction from the diet, and changes in host metabolism of absorbed calories. The independent effect of the microbiota on fat accumulation has been demonstrated in mice, where transplantation of microbiota from obese mice or mice fed western diets to lean or germ-free mice produced fat accumulation among recipients. The microbiota can be manipulated by prebiotics, probiotics, and antibiotics. Probiotics affect the microbiota directly by modulating its bacterial content, and indirectly through bacteriocins produced by the probiotic bacteria. Interestingly, certain probiotics are associated with weight gain both in animals and in humans. The effects are dependent on the probiotic strain, the host, and specific host characteristics, such as age and baseline nutritional status. Attention has recently been drawn to the association between antibiotic use and weight gain in children and adults. We herein review the studies describing the associations between the microbiota composition, its manipulation, and obesity. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  15. Biosynthesis of bacterial aromatic polyketides.

    Science.gov (United States)

    Zhan, Jixun

    2009-01-01

    Aromatic polyketides represent important members of the family of polyketides, which have displayed a wide assortment of bioactive properties, such as antibacterial, antitumor, and antiviral activities. Bacterial aromatic polyketides are mainly synthesized by type II polyketide synthases (PKSs). Whereas malonyl-CoA is exclusively used as the extender unit, starter units can vary in different aromatic polyketide biosynthetic pathways, leading to a variety of polyketide backbones. Once the polyketide chains are elongated by the minimal PKSs to the full length, the immediate tailoring enzymes including ketoreductases, oxygenases and cyclases will work on the nascent chains to form aromatic structures, which will be further decorated by those late tailoring enzymes such as methyltransferases and glycosyltransferases. The mechanistic studies on the biosynthetic pathways of aromatic polyketides such as oxytetracycline and pradimicin A have been extensively carried out in recent years. Engineered biosynthesis of novel "unnatural" polyketides has been achieved in heterologous hosts such as Streptomyces coelicolor and Escherichia coli. This review covers the most recent advances in aromatic polyketide biosynthesis, which provide new enzymes or methods for building novel polyketide biosynthetic machinery.

  16. Inflammatory Biomarkers During Bacterial Acute Rhinosinusitis.

    Science.gov (United States)

    Autio, Timo J; Koskenkorva, Timo; Koivunen, Petri; Alho, Olli-Pekka

    2018-02-21

    Diagnosis of bacterial acute rhinosinusitis is difficult. Several attempts have been made to clarify the diagnostic criteria. Inflammatory biomarkers are easily obtainable variables that could shed light on both the pathophysiology and diagnosis of bacterial acute rhinosinusitis. The purpose of this review article is to assess literature concerning the course of inflammatory biomarkers during acute rhinosinusitis and the use of inflammatory biomarkers in diagnosing bacterial acute rhinosinusitis. We included C-reactive protein, erythrocyte sedimentation rate, white blood cell counts, procalcitonin, and nasal nitric oxide in this review and found that especially elevated C-reactive protein and erythrocyte sedimentation rate are related to a higher probability of a bacterial cause of acute rhinosinusitis. Still, normal levels of these two biomarkers are quite common as well, or the levels can be heightened even during viral respiratory infection without suspicion of bacterial involvement. Elevated levels of C-reactive protein or erythrocyte sedimentation rate support diagnosis of bacterial acute rhinosinusitis, but due to a lack of sensitivity, they should not be used to screen patients for bacterial acute rhinosinusitis.

  17. Bacterial carbon cycling in a subarctic fjord

    DEFF Research Database (Denmark)

    Middelboe, Mathias; Glud, Ronnie N.; Sejr, Mikael Kristian

    2012-01-01

    of viruses on bacterial mortality (4–36% of cell production) and carbon cycling. Heterotrophic bacterial consumption was closely coupled with autochthonous BDOC production, and the majority of the primary production was consumed by pelagic bacteria at all seasons. The relatively low measured BGE emphasized......In this seasonal study, we examined the environmental controls and quantitative importance of bacterial carbon consumption in the water column and the sediment in the subarctic Kobbefjord, Greenland. Depth-integrated bacterial production in the photic zone varied from 5.0 ± 2.7 mg C m−2 d−1...... in February to 42 ± 28 mg C m−2 d−1 in May and 34 ± 7 mg C m−2 d−1 in September, corresponding to a bacterial production to primary production ratio of 0.34 ± 0.14, 0.07 ± 0.04, and 0.08 ± 0.06, respectively. Based on measured bacterial growth efficiencies (BGEs) of 0.09–0.10, pelagic bacterial carbon...

  18. Zoonotic bacterial meningitis in human adults.

    Science.gov (United States)

    van Samkar, Anusha; Brouwer, Matthijs C; van der Ende, Arie; van de Beek, Diederik

    2016-09-13

    To describe the epidemiology, etiology, clinical characteristics, treatment, outcome, and prevention of zoonotic bacterial meningitis in human adults. We identified 16 zoonotic bacteria causing meningitis in adults. Zoonotic bacterial meningitis is uncommon compared to bacterial meningitis caused by human pathogens, and the incidence has a strong regional distribution. Zoonotic bacterial meningitis is mainly associated with animal contact, consumption of animal products, and an immunocompromised state of the patient. In a high proportion of zoonotic bacterial meningitis cases, CSF analysis showed only a mildly elevated leukocyte count. The recommended antibiotic therapy differs per pathogen, and the overall mortality is low. Zoonotic bacterial meningitis is uncommon but is associated with specific complications. The suspicion should be raised in patients with bacterial meningitis who have recreational or professional contact with animals and in patients living in regions endemic for specific zoonotic pathogens. An immunocompromised state is associated with a worse prognosis. Identification of risk factors and underlying disease is necessary to improve treatment. © 2016 American Academy of Neurology.

  19. Tissue Tropism in Host Transcriptional Response to Members of the Bovine Respiratory Disease Complex.

    Science.gov (United States)

    Behura, Susanta K; Tizioto, Polyana C; Kim, JaeWoo; Grupioni, Natalia V; Seabury, Christopher M; Schnabel, Robert D; Gershwin, Laurel J; Van Eenennaam, Alison L; Toaff-Rosenstein, Rachel; Neibergs, Holly L; Regitano, Luciana C A; Taylor, Jeremy F

    2017-12-20

    Bovine respiratory disease (BRD) is the most common infectious disease of beef and dairy cattle and is characterized by a complex infectious etiology that includes a variety of viral and bacterial pathogens. We examined the global changes in mRNA abundance in healthy lung and lung lesions and in the lymphoid tissues bronchial lymph node, retropharyngeal lymph node, nasopharyngeal lymph node and pharyngeal tonsil collected at the peak of clinical disease from beef cattle experimentally challenged with either bovine respiratory syncytial virus, infectious bovine rhinotracheitis, bovine viral diarrhea virus, Mannheimia haemolytica or Mycoplasma bovis. We identified signatures of tissue-specific transcriptional responses indicative of tropism in the coordination of host's immune tissue responses to infection by viral or bacterial infections. Furthermore, our study shows that this tissue tropism in host transcriptional response to BRD pathogens results in the activation of different networks of response genes. The differential crosstalk among genes expressed in lymphoid tissues was predicted to be orchestrated by specific immune genes that act as 'key players' within expression networks. The results of this study serve as a basis for the development of innovative therapeutic strategies and for the selection of cattle with enhanced resistance to BRD.

  20. Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Shan Goh

    Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.

  1. Exposure to West Nile Virus Increases Bacterial Diversity and Immune Gene Expression in Culex pipiens.

    Science.gov (United States)

    Zink, Steven D; Van Slyke, Greta A; Palumbo, Michael J; Kramer, Laura D; Ciota, Alexander T

    2015-10-27

    Complex interactions between microbial residents of mosquitoes and arboviruses are likely to influence many aspects of vectorial capacity and could potentially have profound effects on patterns of arbovirus transmission. Such interactions have not been well studied for West Nile virus (WNV; Flaviviridae, Flavivirus) and Culex spp. mosquitoes. We utilized next-generation sequencing of 16S ribosomal RNA bacterial genes derived from Culex pipiens Linnaeus following WNV exposure and/or infection and compared bacterial populations and broad immune responses to unexposed mosquitoes. Our results demonstrate that WNV infection increases the diversity of bacterial populations and is associated with up-regulation of classical invertebrate immune pathways including RNA interference (RNAi), Toll, and Jak-STAT (Janus kinase-Signal Transducer and Activator of Transcription). In addition, WNV exposure alone, without the establishment of infection, results in similar alterations to microbial and immune signatures, although to a lesser extent. Multiple bacterial genera were found in greater abundance inWNV-exposed and/or infected mosquitoes, yet the most consistent and notable was the genus Serratia.

  2. Coral transcriptome and bacterial community profiles reveal distinct Yellow Band Disease states in Orbicella faveolata

    KAUST Repository

    Closek, Collin J.

    2014-06-20

    Coral diseases impact reefs globally. Although we continue to describe diseases, little is known about the etiology or progression of even the most common cases. To examine a spectrum of coral health and determine factors of disease progression we examined Orbicella faveolata exhibiting signs of Yellow Band Disease (YBD), a widespread condition in the Caribbean. We used a novel combined approach to assess three members of the coral holobiont: the coral-host, associated Symbiodinium algae, and bacteria. We profiled three conditions: (1) healthy-appearing colonies (HH), (2) healthy-appearing tissue on diseased colonies (HD), and (3) diseased lesion (DD). Restriction fragment length polymorphism analysis revealed health state-specific diversity in Symbiodinium clade associations. 16S ribosomal RNA gene microarrays (PhyloChips) and O. faveolata complimentary DNA microarrays revealed the bacterial community structure and host transcriptional response, respectively. A distinct bacterial community structure marked each health state. Diseased samples were associated with two to three times more bacterial diversity. HD samples had the highest bacterial richness, which included components associated with HH and DD, as well as additional unique families. The host transcriptome under YBD revealed a reduced cellular expression of defense- and metabolism-related processes, while the neighboring HD condition exhibited an intermediate expression profile. Although HD tissue appeared visibly healthy, the microbial communities and gene expression profiles were distinct. HD should be regarded as an additional (intermediate) state of disease, which is important for understanding the progression of YBD. © 2014 International Society for Microbial Ecology. All rights reserved.

  3. SOCS Proteins as Regulators of Inflammatory Responses Induced by Bacterial Infections: A Review

    Directory of Open Access Journals (Sweden)

    Skyla A. Duncan

    2017-12-01

    Full Text Available Severe bacterial infections can lead to both acute and chronic inflammatory conditions. Innate immunity is the first defense mechanism employed against invading bacterial pathogens through the recognition of conserved molecular patterns on bacteria by pattern recognition receptors (PRRs, especially the toll-like receptors (TLRs. TLRs recognize distinct pathogen-associated molecular patterns (PAMPs that play a critical role in innate immune responses by inducing the expression of several inflammatory genes. Thus, activation of immune cells is regulated by cytokines that use the Janus kinase/signal transducers and activators of transcription (JAK/STAT signaling pathway and microbial recognition by TLRs. This system is tightly controlled by various endogenous molecules to allow for an appropriately regulated and safe host immune response to infections. Suppressor of cytokine signaling (SOCS family of proteins is one of the central regulators of microbial pathogen-induced signaling of cytokines, principally through the inhibition of the activation of JAK/STAT signaling cascades. This review provides recent knowledge regarding the role of SOCS proteins during bacterial infections, with an emphasis on the mechanisms involved in their induction and regulation of antibacterial immune responses. Furthermore, the implication of SOCS proteins in diverse processes of bacteria to escape host defenses and in the outcome of bacterial infections are discussed, as well as the possibilities offered by these proteins for future targeted antimicrobial therapies.

  4. The LIM Homeodomain Transcription Factor LHX6

    Science.gov (United States)

    Zhang, Zichao; Gutierrez, Diana; Li, Xiao; Bidlack, Felicitas; Cao, Huojun; Wang, Jianbo; Andrade, Kelsey; Margolis, Henry C.; Amendt, Brad A.

    2013-01-01

    LHX6 is a LIM-homeobox transcription factor expressed during embryogenesis; however, the molecular mechanisms regulating LHX6 transcriptional activities are unknown. LHX6 and the PITX2 homeodomain transcription factor have overlapping expression patterns during tooth and craniofacial development, and in this report, we demonstrate new transcriptional mechanisms for these factors. PITX2 and LHX6 are co-expressed in the oral and dental epithelium and epithelial cell lines. Lhx6 expression is increased in Pitx2c transgenic mice and decreased in Pitx2 null mice. PITX2 activates endogenous Lhx6 expression and the Lhx6 promoter, whereas LHX6 represses its promoter activity. Chromatin immunoprecipitation experiments reveal endogenous PITX2 binding to the Lhx6 promoter. LHX6 directly interacts with PITX2 to inhibit PITX2 transcriptional activities and activation of multiple promoters. Bimolecular fluorescence complementation assays reveal an LHX6·PITX2 nuclear interaction in living cells. LHX6 has a dominant repressive effect on the PITX2 synergistic activation with LEF-1 and β-catenin co-factors. Thus, LHX6 acts as a transcriptional repressor and represses the expression of several genes involved in odontogenesis. We have identified specific defects in incisor, molar, mandible, bone, and root development and late stage enamel formation in Lhx6 null mice. Amelogenin and ameloblastin expression is reduced and/or delayed in the Lhx6 null mice, potentially resulting from defects in dentin deposition and ameloblast differentiation. Our results demonstrate that LHX6 regulates cell proliferation in the cervical loop and promotes cell differentiation in the anterior region of the incisor. We demonstrate new molecular mechanisms for LHX6 and an interaction with PITX2 for normal craniofacial and tooth development. PMID:23229549

  5. Transcriptional landscape of the human cell cycle.

    Science.gov (United States)

    Liu, Yin; Chen, Sujun; Wang, Su; Soares, Fraser; Fischer, Martin; Meng, Feilong; Du, Zhou; Lin, Charles; Meyer, Clifford; DeCaprio, James A; Brown, Myles; Liu, X Shirley; He, Housheng Hansen

    2017-03-28

    Steady-state gene expression across the cell cycle has been studied extensively. However, transcriptional gene regulation and the dynamics of histone modification at different cell-cycle stages are largely unknown. By applying a combination of global nuclear run-on sequencing (GRO-seq), RNA sequencing (RNA-seq), and histone-modification Chip sequencing (ChIP-seq), we depicted a comprehensive transcriptional landscape at the G0/G1, G1/S, and M phases of breast cancer MCF-7 cells. Importantly, GRO-seq and RNA-seq analysis identified different cell-cycle-regulated genes, suggesting a lag between transcription and steady-state expression during the cell cycle. Interestingly, we identified genes actively transcribed at early M phase that are longer in length and have low expression and are accompanied by a global increase in active histone 3 lysine 4 methylation (H3K4me2) and histone 3 lysine 27 acetylation (H3K27ac) modifications. In addition, we identified 2,440 cell-cycle-regulated enhancer RNAs (eRNAs) that are strongly associated with differential active transcription but not with stable expression levels across the cell cycle. Motif analysis of dynamic eRNAs predicted Kruppel-like factor 4 (KLF4) as a key regulator of G1/S transition, and this identification was validated experimentally. Taken together, our combined analysis characterized the transcriptional and histone-modification profile of the human cell cycle and identified dynamic transcriptional signatures across the cell cycle.

  6. Mutagenesis of the bacterial RNA polymerase alpha subunit for improvement of complex phenotypes.

    Science.gov (United States)

    Klein-Marcuschamer, Daniel; Santos, Christine Nicole S; Yu, Huimin; Stephanopoulos, Gregory

    2009-05-01

    Combinatorial or random methods for strain engineering have been extensively used for the improvement of multigenic phenotypes and other traits for which the underlying mechanism is not fully understood. Although the preferred method has traditionally been mutagenesis and selection, our laboratory has successfully used mutant transcription factors, which direct the RNA polymerase (RNAP) during transcription, to engineer complex phenotypes in microbial cells. Here, we show that it is also possible to impart new phenotypes by altering the RNAP core enzyme itself, in particular through mutagenesis of the alpha subunit of the bacterial polymerase. We present the use of this tool for improving tolerance of Escherichia coli to butanol and other solvents and for increasing the titers of two commercially relevant products, L-tyrosine and hyaluronic acid. In addition, we explore the underlying physiological changes that give rise to the solvent-tolerant mutant.

  7. Commensal Streptococcus salivarius Modulates PPARγ Transcriptional Activity in Human Intestinal Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Benoît Couvigny

    Full Text Available The impact of commensal bacteria in eukaryotic transcriptional regulation has increasingly been demonstrated over the last decades. A multitude of studies have shown direct effects of commensal bacteria from local transcriptional activity to systemic impact. The commensal bacterium Streptococcus salivarius is one of the early bacteria colonizing the oral and gut mucosal surfaces. It has been shown to down-regulate nuclear transcription factor (NF-кB in human intestinal cells, a central regulator of the host mucosal immune system response to the microbiota. In order to evaluate its impact on a further important transcription factor shown to link metabolism and inflammation in the intestine, namely PPARγ (peroxisome proliferator-activated receptor, we used human intestinal epithelial cell-lines engineered to monitor PPARγ transcriptional activity in response to a wide range of S. salivarius strains. We demonstrated that different strains from this bacterial group share the property to inhibit PPARγ activation independently of the ligand used. First attempts to identify the nature of the active compounds showed that it is a low-molecular-weight, DNase-, proteases- and heat-resistant metabolite secreted by S. salivarius strains. Among PPARγ-targeted metabolic genes, I-FABP and Angptl4 expression levels were dramatically reduced in intestinal epithelial cells exposed to S. salivarius supernatant. Both gene products modulate lipid accumulation in cells and down-regulating their expression might consequently affect host health. Our study shows that species belonging to the salivarius group of streptococci impact both host inflammatory and metabolic regulation suggesting a possible role in the host homeostasis and health.

  8. RNA-guided Transcriptional Regulation in Plants via dCas9 Chimeric Proteins

    KAUST Repository

    Baazim, Hatoon

    2014-05-01

    Developing targeted genome regulation approaches holds much promise for accelerating trait discovery and development in agricultural biotechnology. Clustered Regularly Interspaced Palindromic Repeats (CRISPRs)/CRISPR associated (Cas) system provides bacteria and archaea with an adaptive molecular immunity mechanism against invading nucleic acids through phages and conjugative plasmids. The type II CRISPR/Cas system has been adapted for genome editing purposes across a variety of cell types and organisms. Recently, the catalytically inactive Cas9 (dCas9) protein combined with guide RNAs (gRNAs) were used as a DNA-targeting platform to modulate the expression patterns in bacterial, yeast and human cells. Here, we employed this DNA-targeting system for targeted transcriptional regulation in planta by developing chimeric dCas9-based activators and repressors. For example, we fused to the C-terminus of dCas9 with the activation domains of EDLL and TAL effectors, respectively, to generate transcriptional activators, and the SRDX repression domain to generate transcriptional repressor. Our data demonstrate that the dCas9:EDLL and dCas9:TAD activators, guided by gRNAs complementary to promoter elements, induce strong transcriptional activation on episomal targets in plant cells. Moreover, our data suggest that the dCas9:SRDX repressor and the dCas9:EDLL and dCas9:TAD activators are capable of markedly repressing or activating, respectively, the transcription of an endogenous genomic target. Our data indicate that the CRISPR/dCas9:TFs DNA targeting system can be used in plants as a functional genomic tool and for biotechnological applications.

  9. Transcriptional regulation of long-term potentiation.

    Science.gov (United States)

    Bliim, Nicola; Leshchyns'ka, Iryna; Sytnyk, Vladimir; Janitz, Michael

    2016-10-01

    Long-term potentiation (LTP), the persistent strengthening of synapses following high levels of stimulation, is a form of synaptic plasticity that has been studied extensively as a possible mechanism for learning and memory formation. The strengthening of the synapse that occurs during LTP requires cascades of complex molecular processes and the coordinated remodeling of pre-synaptic and post-synaptic neurons. Despite over four decades of research, our understanding of the transcriptional mechanisms and molecular processes underlying LTP remains incomplete. Identification of all the proteins and non-coding RNA transcripts expressed during LTP may provide greater insight into the molecular mechanisms involved in learning and memory formation.

  10. A Phase Separation Model for Transcriptional Control.

    Science.gov (United States)

    Hnisz, Denes; Shrinivas, Krishna; Young, Richard A; Chakraborty, Arup K; Sharp, Phillip A

    2017-03-23

    Phase-separated multi-molecular assemblies provide a general regulatory mechanism to compartmentalize biochemical reactions within cells. We propose that a phase separation model explains established and recently described features of transcriptional control. These features include the formation of super-enhancers, the sensitivity of super-enhancers to perturbation, the transcriptional bursting patterns of enhancers, and the ability of an enhancer to produce simultaneous activation at multiple genes. This model provides a conceptual framework to further explore principles of gene control in mammals. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Harnessing transcription for bioproduction in cyanobacteria

    DEFF Research Database (Denmark)

    Stensjö, Karin; Vavitsas, Konstantinos; Tyystjärvi, Taina

    2018-01-01

    Sustainable production of biofuels and other valuable compounds is one of our future challenges. One tempting possibility is to use photosynthetic cyanobacteria as production factories. Currently, tools for genetic engineering of cyanobacteria are yet not good enough to exploit the full potential...... of cyanobacteria. A wide variety of expression systems will be required to adjust both the expression of heterologous enzyme(s) and metabolic routes to the best possible balance, allowing the optimal production of a particular substance. In bacteria, transcription, especially the initiation of transcription, has...

  12. Quantitative analysis of tyrosinase transcripts in blood.

    Science.gov (United States)

    Johansson, M; Pisa, E K; Törmänen, V; Arstrand, K; Kågedal, B

    2000-07-01

    Tyrosinase is an enzyme unique to pigment-forming cells. Methods using this transcript for detection of melanoma cells in blood have given divergent results. Quantitative analytical procedures are therefore needed to study the analytical performance of the methods. Mononucleated cells were isolated by Percoll centrifugation. RNA was isolated by each of three methods: Ultraspec(TM)-II RNA isolation system, FastRNA(TM) GREEN Kit, and QIAamp RNA Blood Mini Kit. cDNA was synthesized using random hexamer primers. A tyrosinase-specific product of 207 bp was amplified by PCR. As an internal standard (and competitor) we used a 207-bp cDNA with a base sequence identical to the tyrosinase target except for a 20-bp probe-binding region. The PCR products were identified by 2, 4-dinitrophenol (DNP)-labeled probes specific for tyrosinase (5'DNP-GGGGAGCCTTGGGGTTCTGG-3') and internal standard (5'DNP-CGGAGCCCCGAAACCACATC-3') and quantified by ELISA. The calibration curves were linear and had a broad dynamic measuring range. A detection limit (2 SD above zero) of 48 transcripts/mL of blood was obtained from a low control. The analytical imprecision was 50% and 48% at concentrations of 1775 and 17 929 transcripts/mL (n = 12 and 14, respectively). With the cell line SK-Mel 28 added to blood and RNA extracted with the Ultraspec, Fast RNA, and QIAamp RNA methods, we found (mean +/- SD) 1716+/-1341, 2670+/-3174, and 24 320+/-5332 transcripts/mL of blood. Corresponding values were 527+/-497, 2497+/-1033, 14 930+/-1927 transcripts/mL of blood when the cell line JKM86-4 was added. One high-risk patient was followed by repeated analysis of tyrosinase transcripts in blood. The melanoma marker 5-S-cysteinyldopa in serum and urine was within reference values, but tyrosinase mRNA was slightly increased (120-168 transcripts/mL of blood). The tyrosinase mRNA increased to 1860 transcripts/mL concomitant with the increase in 5-S-cysteinyldopa; later a spleen metastasis was found. The results

  13. Complete Genomes of Classical Swine Fever Virus Cloned into Bacterial Artificial Chromosomes

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Reimann, I.; Uttenthal, Åse

    Complete genome amplification of viral RNA provides a new tool for the generation of modified pestiviruses. We have used our full-genome amplification strategy for generation of amplicons representing complete genomes of classical swine fever virus. The amplicons were cloned directly into a stable...... single-copy bacterial artificial chromosome (BAC) generating full-length pestivirus DNAs from which infectious RNA transcripts could be also derived. Our strategy allows construction of stable infectious BAC DNAs from a single full-length PCR product....

  14. claVision: Visual Automatic Piano Music Transcription

    OpenAIRE

    Akbari, Mohammad; Cheng, Howard

    2015-01-01

    One important problem in Musical Information Retrieval is Automatic Music Transcription, which is an automated conversion process from played music to a symbolic notation such as sheet music. Since the accuracy of previous audio-based transcription systems is not satisfactory, we propose an innovative visual-based automatic music transcription system named claVision to perform piano music transcription. Instead of processing the music audio, the system performs the transcription only from the...

  15. Peroxisome proliferator-activated receptor gamma recruits the positive transcription elongation factor b complex to activate transcription and promote adipogenesis

    DEFF Research Database (Denmark)

    Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien

    2006-01-01

    Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c-Myc...

  16. Acute Sleep Deprivation Enhances Post-Infection Sleep and Promotes Survival during Bacterial Infection in Drosophila

    Science.gov (United States)

    Kuo, Tzu-Hsing; Williams, Julie A.

    2014-01-01

    Study Objectives: Sleep is known to increase as an acute response to infection. However, the function of this behavioral response in host defense is not well understood. To address this problem, we evaluated the effect of acute sleep deprivation on post-infection sleep and immune function in Drosophila. Setting: Laboratory. Participants: Drosophila melanogaster. Methods and Results: Flies were subjected to sleep deprivation before (early DEP) or after (late DEP) bacterial infection. Relative to a non-deprived control, flies subjected to early DEP had enhanced sleep after infection as well as increased bacterial clearance and survival outcome. Flies subjected to late DEP experienced enhanced sleep following the deprivation period, and showed a modest improvement in survival outcome. Continuous DEP (early and late DEP) throughout infection also enhanced sleep later during infection and improved survival. However, improved survival in flies subjected to late or continuous DEP did not occur until after flies had experienced sleep. During infection, both early and late DEP enhanced NFκB transcriptional activity as measured by a luciferase reporter (κB-luc) in living flies. Early DEP also increased NFκB activity prior to infection. Flies that were deficient in expression of either the Relish or Dif NFκB transcription factors showed normal responses to early DEP. However, the effect of early DEP on post-infection sleep and survival was abolished in double mutants, which indicates that Relish and Dif have redundant roles in this process. Conclusions: Acute sleep deprivation elevated NFκB-dependent activity, increased post-infection sleep, and improved survival during bacterial infection. Citation: Kuo TH, Williams JA. Acute sleep deprivation enhances post-infection sleep and promotes survival during bacterial infection in Drosophila. SLEEP 2014;37(5):859-869. PMID:24790264

  17. Tobacco use increases susceptibility to bacterial infection

    Directory of Open Access Journals (Sweden)

    Demuth Donald R

    2008-12-01

    Full Text Available Abstract Active smokers and those exposed to secondhand smoke are at increased risk of bacterial infection. Tobacco smoke exposure increases susceptibility to respiratory tract infections, including tuberculosis, pneumonia and Legionnaires disease; bacterial vaginosis and sexually transmitted diseases, such as chlamydia and gonorrhoea; Helicobacter pylori infection; periodontitis; meningitis; otitis media; and post-surgical and nosocomial infections. Tobacco smoke compromises the anti-bacterial function of leukocytes, including neutrophils, monocytes, T cells and B cells, providing a mechanistic explanation for increased infection risk. Further epidemiological, clinical and mechanistic research into this important area is warranted.

  18. Spontaneous Bacterial Peritonitis in Subclinical Hypothyroidism

    Directory of Open Access Journals (Sweden)

    Dalip Gupta

    2013-11-01

    Full Text Available Hypothyroidism is an uncommon cause of ascites. Here we describe a case of a 75 year-old female patient with spontaneous bacterial peritonitis and subclinical hypothyroidism that resolved with thyroid replacement and antibiotic therapy respectively. Ascitic fluid analysis revealed a gram-positive bacterium on gram staining. A review of the literature revealed just one other reported case of myxoedema ascites with concomitant spontaneous bacterial peritonitis and no case has till been reported of spontaneous bacterial peritonitis in subclinical hypothyroidism.

  19. Bacterial leaching of uranium ores - a review

    International Nuclear Information System (INIS)

    Lowson, R.T.

    1975-11-01

    The bacterial leaching of uranium ores involves the bacterially catalysed oxidation of associated pyrite to sulphuric acid and Fe 3+ by autotrophic bacteria and the leaching of the uranium by the resulting acidic, oxidising solution. Industrial application has been limited to Thiobacillus thiooxidans and Thiobacillus ferrooxidans at pH 2 to 3, and examples of these are described. The bacterial catalysis can be improved with nutrients or prevented with poisons. The kinetics of leaching are controlled by the bed depth, particle size, percolation rate, mineralogy and temperature. Current work is aimed at quantitatively defining the parameters controlling the kinetics and extending the method to alkaline conditions with other autotrophic bacteria. (author)

  20. Bacterial binding to extracellular proteins - in vitro adhesion

    DEFF Research Database (Denmark)

    Schou, C.; Fiehn, N.-E.

    1999-01-01

    Viridans streptococci, bacterial adherence, extracellular matrix proteins, surface receptors, endocarditis......Viridans streptococci, bacterial adherence, extracellular matrix proteins, surface receptors, endocarditis...

  1. Transcriptional profiling of Actinobacillus pleuropneumoniae during the acute phase of a natural infection in pigs

    Directory of Open Access Journals (Sweden)

    Harel Josée

    2010-02-01

    Full Text Available Abstract Background Actinobacillus pleuropneumoniae is the etiological agent of porcine pleuropneumonia, a respiratory disease which causes great economic losses worldwide. Many virulence factors are involved in the pathogenesis, namely capsular polysaccharides, RTX toxins, LPS and many iron acquisition systems. In order to identify genes that are expressed in vivo during a natural infection, we undertook transcript profiling experiments with an A. pleuropneumoniae DNA microarray, after recovery of bacterial mRNAs from serotype 5b-infected porcine lungs. AppChip2 contains 2033 PCR amplicons based on the genomic sequence of App serotype 5b strain L20, representing more than 95% of ORFs greater than 160 bp in length. Results Transcriptional profiling of A. pleuropneumoniae recovered from the lung of a pig suffering from a natural infection or following growth of the bacterial isolate in BHI medium was performed. An RNA extraction protocol combining beadbeating and hot-acid-phenol was developed in order to maximize bacterial mRNA yields and quality following total RNA extraction from lung lesions. Nearly all A. pleuropneumoniae transcripts could be detected on our microarrays, and 150 genes were deemed differentially expressed in vivo during the acute phase of the infection. Our results indicate that, for example, gene apxIVA from an operon coding for RTX toxin ApxIV is highly up-regulated in vivo, and that two genes from the operon coding for type IV fimbriae (APL_0878 and APL_0879 were also up-regulated. These transcriptional profiling data, combined with previous comparative genomic hybridizations performed by our group, revealed that 66 out of the 72 up-regulated genes are conserved amongst all serotypes and that 3 of them code for products that are predicted outer membrane proteins (genes irp and APL_0959, predicted to code for a TonB-dependent receptor and a filamentous hemagglutinin/adhesin respectively or lipoproteins (gene APL_0920. Only 4

  2. Co-transcriptomic Analysis by RNA Sequencing to Simultaneously Measure Regulated Gene Expression in Host and Bacterial Pathogen

    KAUST Repository

    Ravasi, Timothy

    2016-01-24

    Intramacrophage pathogens subvert antimicrobial defence pathways using various mechanisms, including the targeting of host TLR-mediated transcriptional responses. Conversely, TLR-inducible host defence mechanisms subject intramacrophage pathogens to stress, thus altering pathogen gene expression programs. Important biological insights can thus be gained through the analysis of gene expression changes in both the host and the pathogen during an infection. Traditionally, research methods have involved the use of qPCR, microarrays and/or RNA sequencing to identify transcriptional changes in either the host or the pathogen. Here we describe the application of RNA sequencing using samples obtained from in vitro infection assays to simultaneously quantify both host and bacterial pathogen gene expression changes, as well as general approaches that can be undertaken to interpret the RNA sequencing data that is generated. These methods can be used to provide insights into host TLR-regulated transcriptional responses to microbial challenge, as well as pathogen subversion mechanisms against such responses.

  3. Characterization of the biocontrol activity of pseudomonas fluorescens strain X reveals novel genes regulated by glucose.

    Directory of Open Access Journals (Sweden)

    Gerasimos F Kremmydas

    Full Text Available Pseudomonas fluorescens strain X, a bacterial isolate from the rhizosphere of bean seedlings, has the ability to suppress damping-off caused by the oomycete Pythium ultimum. To determine the genes controlling the biocontrol activity of strain X, transposon mutagenesis, sequencing and complementation was performed. Results indicate that, biocontrol ability of this isolate is attributed to gcd gene encoding glucose dehydrogenase, genes encoding its co-enzyme pyrroloquinoline quinone (PQQ, and two genes (sup5 and sup6 which seem to be organized in a putative operon. This operon (named supX consists of five genes, one of which encodes a non-ribosomal peptide synthase. A unique binding site for a GntR-type transcriptional factor is localized upstream of the supX putative operon. Synteny comparison of the genes in supX revealed that they are common in the genus Pseudomonas, but with a low degree of similarity. supX shows high similarity only to the mangotoxin operon of Ps. syringae pv. syringae UMAF0158. Quantitative real-time PCR analysis indicated that transcription of supX is strongly reduced in the gcd and PQQ-minus mutants of Ps. fluorescens strain X. On the contrary, transcription of supX in the wild type is enhanced by glucose and transcription levels that appear to be higher during the stationary phase. Gcd, which uses PQQ as a cofactor, catalyses the oxidation of glucose to gluconic acid, which controls the activity of the GntR family of transcriptional factors. The genes in the supX putative operon have not been implicated before in the biocontrol of plant pathogens by pseudomonads. They are involved in the biosynthesis of an antimicrobial compound by Ps. fluorescens strain X and their transcription is controlled by glucose, possibly through the activity of a GntR-type transcriptional factor binding upstream of this putative operon.

  4. Characterization of Olkiluoto bacterial and archaeal communities by 454 pyrosequencing

    Energy Technology Data Exchange (ETDEWEB)

    Bomberg, M.; Nyyssoenen, M.; Itaevaara, M. [VTT Technical Research Centre of Finland, Espoo (Finland)

    2012-06-15

    Recent advancement in sequencing technologies, 'Next Generation Sequencing', such as FLX 454 pyrosequencing has made it possible to obtain large amounts of sequence data where previously only few sequences could be obtained. This technique is especially useful for the study of community composition of uncultured microbial populations in environmental samples. In this project, the FLX 454 pyrosequencing technique was used to obtain up to 20 000 16S rRNA sequences or 10 000 mRNA sequences from each sample for identification of the microbial species composition as well as for comparison of the microbial communities between different samples. This project focused on the characterization of active microbial communities in the groundwater at the final disposal site of high radioactive wastes in Olkiluoto by FLX 454 pyrosequencing of the bacterial and archaeal ribosomal RNA as well as of the mRNA transcripts of the dsrB gene and mcrA gene of sulphate reducing bacteria and methanogenic archaea, respectively. Specific emphasis was put on studying the relationship of active and latent sulphate reducers and methanogens by qPCR due to their important roles in deep geobiochemical processes connected to copper corrosion. Seven packered boreholes were sampled anaerobically in Olkiluoto during 2009-2010. Groundwater was pumped from specific depths and the microbial cells werecollected by filtration on a membrane. Active microbial communities were studied based on RNA extracted from the membranes and translated to copy DNA, followed by sequencing by 454 Tag pyrosequencing. A total of 27 different bacterial and 17 archaeal taxonomic groups were detected.

  5. Characterization of Olkiluoto bacterial and archaeal communities by 454 pyrosequencing

    International Nuclear Information System (INIS)

    Bomberg, M.; Nyyssoenen, M.; Itaevaara, M.

    2012-06-01

    Recent advancement in sequencing technologies, 'Next Generation Sequencing', such as FLX 454 pyrosequencing has made it possible to obtain large amounts of sequence data where previously only few sequences could be obtained. This technique is especially useful for the study of community composition of uncultured microbial populations in environmental samples. In this project, the FLX 454 pyrosequencing technique was used to obtain up to 20 000 16S rRNA sequences or 10 000 mRNA sequences from each sample for identification of the microbial species composition as well as for comparison of the microbial communities between different samples. This project focused on the characterization of active microbial communities in the groundwater at the final disposal site of high radioactive wastes in Olkiluoto by FLX 454 pyrosequencing of the bacterial and archaeal ribosomal RNA as well as of the mRNA transcripts of the dsrB gene and mcrA gene of sulphate reducing bacteria and methanogenic archaea, respectively. Specific emphasis was put on studying the relationship of active and latent sulphate reducers and methanogens by qPCR due to their important roles in deep geobiochemical processes connected to copper corrosion. Seven packered boreholes were sampled anaerobically in Olkiluoto during 2009-2010. Groundwater was pumped from specific depths and the microbial cells werecollected by filtration on a membrane. Active microbial communities were studied based on RNA extracted from the membranes and translated to copy DNA, followed by sequencing by 454 Tag pyrosequencing. A total of 27 different bacterial and 17 archaeal taxonomic groups were detected

  6. Theoretical analysis of transcription process with polymerase stalling

    Science.gov (United States)

    Li, Jingwei; Zhang, Yunxin

    2015-05-01

    Experimental evidence shows that in gene transcription RNA polymerase has the possibility to be stalled at a certain position of the transcription template. This may be due to the template damage or protein barriers. Once stalled, polymerase may backtrack along the template to the previous nucleotide to wait for the repair of the damaged site, simply bypass the barrier or damaged site and consequently synthesize an incorrect messenger RNA, or degrade and detach from the template. Thus, the effective transcription rate (the rate to synthesize correct product mRNA) and the transcription effectiveness (the ratio of the effective transcription rate to the effective transcription initiation rate) are both influenced by polymerase stalling events. So far, no theoretical model has been given to discuss the gene transcription process including polymerase stalling. In this study, based on the totally asymmetric simple exclusion process, the transcription process including polymerase stalling is analyzed theoretically. The dependence of the effective transcription rate, effective transcription initiation rate, and transcription effectiveness on the transcription initiation rate, termination rate, as well as the backtracking rate, bypass rate, and detachment (degradation) rate when stalling, are discussed in detail. The results showed that backtracking restart after polymerase stalling is an ideal mechanism to increase both the effective transcription rate and the transcription effectiveness. Without backtracking, detachment of stalled polymerase can also help to increase the effective transcription rate and transcription effectiveness. Generally, the increase of the bypass rate of the stalled polymerase will lead to the decrease of the effective transcription rate and transcription effectiveness. However, when both detachment rate and backtracking rate of the stalled polymerase vanish, the effective transcription rate may also be increased by the bypass mechanism.

  7. The physical size of transcription factors is key to transcriptional regulation in chromatin domains

    Science.gov (United States)

    Maeshima, Kazuhiro; Kaizu, Kazunari; Tamura, Sachiko; Nozaki, Tadasu; Kokubo, Tetsuro; Takahashi, Koichi

    2015-02-01

    Genetic information, which is stored in the long strand of genomic DNA as chromatin, must be scanned and read out by various transcription factors. First, gene-specific transcription factors, which are relatively small (˜50 kDa), scan the genome and bind regulatory elements. Such factors then recruit general transcription factors, Mediators, RNA polymerases, nucleosome remodellers, and histone modifiers, most of which are large protein complexes of 1-3 MDa in size. Here, we propose a new model for the functional significance of the size of transcription factors (or complexes) for gene regulation of chromatin domains. Recent findings suggest that chromatin consists of irregularly folded nucleosome fibres (10 nm fibres) and forms numerous condensed domains (e.g., topologically associating domains). Although the flexibility and dynamics of chromatin allow repositioning of genes within the condensed domains, the size exclusion effect of the domain may limit accessibility of DNA sequences by transcription factors. We used Monte Carlo computer simulations to determine the physical size limit of transcription factors that can enter condensed chromatin domains. Small gene-specific transcription factors can penetrate into the chromatin domains and search their target sequences, whereas large transcription complexes cannot enter the domain. Due to this property, once a large complex binds its target site via gene-specific factors it can act as a ‘buoy’ to keep the target region on the surface of the condensed domain and maintain transcriptional competency. This size-dependent specialization of target-scanning and surface-tethering functions could provide novel insight into the mechanisms of various DNA transactions, such as DNA replication and repair/recombination.

  8. Bacterial evolution: Resistance is a numbers game

    OpenAIRE

    Hall, J.P.J.; Harrison, E.

    2016-01-01

    Plasmids are well known for spreading antibiotic-resistance genes between bacterial strains. Recent experiments show that they can also act as catalysts for evolutionary innovation, promoting rapid evolution of novel antibiotic resistance.

  9. Plant growth-promoting bacterial endophytes.

    Science.gov (United States)

    Santoyo, Gustavo; Moreno-Hagelsieb, Gabriel; Orozco-Mosqueda, Ma del Carmen; Glick, Bernard R

    2016-02-01

    Bacterial endophytes ubiquitously colonize the internal tissues of plants, being found in nearly every plant worldwide. Some endophytes are able to promote the growth of plants. For those strains the mechanisms of plant growth-promotion known to be employed by bacterial endophytes are similar to the mechanisms used by rhizospheric bacteria, e.g., the acquisition of resources needed for plant growth and modulation of plant growth and development. Similar to rhizospheric plant growth-promoting bacteria, endophytic plant growth-promoting bacteria can act to facilitate plant growth in agriculture, horticulture and silviculture as well as in strategies for environmental cleanup (i.e., phytoremediation). Genome comparisons between bacterial endophytes and the genomes of rhizospheric plant growth-promoting bacteria are starting to unveil potential genetic factors involved in an endophytic lifestyle, which should facilitate a better understanding of the functioning of bacterial endophytes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  10. Bacterial Clearance and Endocarditis in American Opossums

    Science.gov (United States)

    Musher, Daniel M.; Richie, Yvonne

    1974-01-01

    The American opossum is the only experimental animal that regularly develops bacterial endocarditis spontaneously. There was no relation between the ability of opossums to clear bacteria from the bloodstream and the subsequent development of endocarditis. PMID:4208530

  11. Proteomic Analysis of Bacterial Expression Profiles Following ...

    African Journals Online (AJOL)

    mass spectrometry (GC-MS) were performed to determine the phytochemicals in the active fraction. Results: Five differentially expressed bacterial proteins (four from Escherichia coli and one from Staphylococcus aureus), were identified via ...

  12. Heterotrophic bacterial populations in tropical sandy beaches

    Digital Repository Service at National Institute of Oceanography (India)

    Nair, S.; LokaBharathi, P.A.

    Distribution pattern of heterotrophic bacterial flora of three sandy beaches of the west coast of India was studied. The population in these beaches was microbiologically different. Population peaks of halotolerant and limnotolerant forms were...

  13. Bacterial flora of the sigmoid neovagina

    NARCIS (Netherlands)

    T.A. Toolenaar; I. Freundt (Ingrid); J.H. Wagenvoort; F.J. Huikeshoven (Frans); M. Vogel; J. Jeekel (Hans); A.C. Drogendijk

    1993-01-01

    textabstractThe bacterial microbiota of 15 sigmoid neovaginas, created in patients with congenital vaginal aplasia or male transsexualism, was studied. No specimen was sterile, and only normal inhabitants of the colon were cultured. The total counts of bacteria were

  14. Bacterial strategies of resistance to antimicrobial peptides.

    Science.gov (United States)

    Joo, Hwang-Soo; Fu, Chih-Iung; Otto, Michael

    2016-05-26

    Antimicrobial peptides (AMPs) are a key component of the host's innate immune system, targeting invasive and colonizing bacteria. For successful survival and colonization of the host, bacteria have a series of mechanisms to interfere with AMP activity, and AMP resistance is intimately connected with the virulence potential of bacterial pathogens. In particular, because AMPs are considered as potential novel antimicrobial drugs, it is vital to understand bacterial AMP resistance mechanisms. This review gives a comparative overview of Gram-positive and Gram-negative bacterial strategies of resistance to various AMPs, such as repulsion or sequestration by bacterial surface structures, alteration of membrane charge or fluidity, degradation and removal by efflux pumps.This article is part of the themed issue 'Evolutionary ecology of arthropod antimicrobial peptides'. © 2016 The Author(s).

  15. Identification and Characterization of Novel Biocontrol Bacterial

    Directory of Open Access Journals (Sweden)

    Young Cheol Kim

    2014-09-01

    Full Text Available Because bacterial isolates from only a few genera have been developed commercially as biopesticides, discovery and characterization of novel bacterial strains will be a key to market expansion. Our previous screen using plant bioassays identified 24 novel biocontrol isolates representing 12 different genera. In this study, we characterized the 3 isolates showing the best biocontrol activities. The isolates were Pantoea dispersa WCU35, Proteus myxofaciens WCU244, and Exiguobacterium acetylicum WCU292 based on 16S rRNA sequence analysis. The isolates showed differential production of extracellular enzymes, antimicrobial activity against various fungal or bacterial plant pathogens, and induced systemic resistance activity against tomato gray mold disease caused by Botrytis cinerea. E. acetylicum WCU292 lacked strong in vitro antimicrobial activity against plant pathogens, but induced systemic resistance against tomato gray mold disease. These results confirm that the trait of biological control is found in a wide variety of bacterial genera

  16. Transcript variations, phylogenetic tree and chromosomal ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 1. Transcript variations, phylogenetic tree and chromosomal localization of porcine aryl hydrocarbon receptor (AhR) and AhR nuclear translocator (ARNT) genes. AGNIESZKA SADOWSKA LUKASZ PAUKSZTO ANNA NYNCA IZABELA SZCZERBAL KARINA ...

  17. Hydra constitutively expresses transcripts involved in vertebrate ...

    Indian Academy of Sciences (India)

    Unknown

    participate in axis and head formation in Hydra too. In the present study we have employed cross-hybridization to detect noggin-like transcripts in Pelmatohydra oligactis. Noggin is crucial for nervous system development in. Xenopus (Smith and Harland 1992), chick (Connolly et al. 1997) and mammals (Bachiller et al 2000) ...

  18. Regulation of the Ets transcription factor Tel

    NARCIS (Netherlands)

    Roukens, Mark Guido

    2010-01-01

    In this thesis we report novel studies on the molecular regulation of the transcriptional repressor Tel (Translocation Ets Leukemia). The work in this thesis is presented as follows: Chapter 1 is an introduction which summarizes the literature about Tel and its Drosophila orthologue Yan as it was

  19. HIV-1 transcription and latency: an update.

    Science.gov (United States)

    Van Lint, Carine; Bouchat, Sophie; Marcello, Alessandro

    2013-06-26

    Combination antiretroviral therapy, despite being potent and life-prolonging, is not curative and does not eradicate HIV-1 infection since interruption of treatment inevitably results in a rapid rebound of viremia. Reactivation of latently infected cells harboring transcriptionally silent but replication-competent proviruses is a potential source of persistent residual viremia in cART-treated patients. Although multiple reservoirs may exist, the persistence of resting CD4+ T cells carrying a latent infection represents a major barrier to eradication. In this review, we will discuss the latest reports on the molecular mechanisms that may regulate HIV-1 latency at the transcriptional level, including transcriptional interference, the role of cellular factors, chromatin organization and epigenetic modifications, the viral Tat trans-activator and its cellular cofactors. Since latency mechanisms may also operate at the post-transcriptional level, we will consider inhibition of nuclear RNA export and inhibition of translation by microRNAs as potential barriers to HIV-1 gene expression. Finally, we will review the therapeutic approaches and clinical studies aimed at achieving either a sterilizing cure or a functional cure of HIV-1 infection, with a special emphasis on the most recent pharmacological strategies to reactivate the latent viruses and decrease the pool of viral reservoirs.

  20. HIV-1 transcription and latency: an update

    Science.gov (United States)

    2013-01-01

    Combination antiretroviral therapy, despite being potent and life-prolonging, is not curative and does not eradicate HIV-1 infection since interruption of treatment inevitably results in a rapid rebound of viremia. Reactivation of latently infected cells harboring transcriptionally silent but replication-competent proviruses is a potential source of persistent residual viremia in cART-treated patients. Although multiple reservoirs may exist, the persistence of resting CD4+ T cells carrying a latent infection represents a major barrier to eradication. In this review, we will discuss the latest reports on the molecular mechanisms that may regulate HIV-1 latency at the transcriptional level, including transcriptional interference, the role of cellular factors, chromatin organization and epigenetic modifications, the viral Tat trans-activator and its cellular cofactors. Since latency mechanisms may also operate at the post-transcriptional level, we will consider inhibition of nuclear RNA export and inhibition of translation by microRNAs as potential barriers to HIV-1 gene expression. Finally, we will review the therapeutic approaches and clinical studies aimed at achieving either a sterilizing cure or a functional cure of HIV-1 infection, with a special emphasis on the most recent pharmacological strategies to reactivate the latent viruses and decrease the pool of viral reservoirs. PMID:23803414

  1. Identification of plant defence regulators through transcriptional ...

    Indian Academy of Sciences (India)

    Supplementary figure 2. Expression of PR1 gene after Psm inoculation. Transcript level of SA-signalling marker gene PR1 was determined at 0, 12, 24 and 48 hpi of Psm by quantitative real-time PCR in relative abundance with ACTIN2. Each bar represents mean ± standard deviation of 3 biological samples with 2 technical ...

  2. Identification of plant defence regulators through transcriptional ...

    Indian Academy of Sciences (India)

    2015-02-04

    Feb 4, 2015 ... [Swain S, Singh N and Nandi AK 2015 Identification of plant defence regulators through transcriptional profiling of Arabidopsis thaliana cdd1 mutant. J. Biosci ... Through gene expression profiling of cdd1, followed by screening of mutants ..... Ishikawa K, Yoshimura K, Harada K, Fukusaki E, Ogawa T, Tamoi.

  3. RNA Polymerase II–The Transcription Machine

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 3. RNA Polymerase II – The Transcription Machine - Nobel Prize in Chemistry 2006. Jiyoti Verma Aruna Naorem Anand Kumar Manimala Sen Parag Sadhale. General Article Volume 12 Issue 3 March 2007 pp 47-53 ...

  4. Mitochondrial transcription: How does it end

    Energy Technology Data Exchange (ETDEWEB)

    J Byrnes; M Garcia-Diaz

    2011-12-31

    The structure of the mitochondrial transcription termination factor (MTERF1) provides novel insight into the mechanism of binding, recognition of the termination sequence and the conformational changes involved in mediating termination. Besides its functional implications, this structure provides a framework to understand the consequences of numerous diseases associated with mitochondrial DNA mutations.

  5. Cross-Family Transcription Factor Interactions

    NARCIS (Netherlands)

    Bemer, Marian; Dijk, van Aalt-Jan; Immink, Richard G.H.; Angenent, Gerco C.

    2017-01-01

    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger

  6. Transcription profiling of sparkling wine second fermentation.

    Science.gov (United States)

    Penacho, Vanessa; Valero, Eva; Gonzalez, Ramon

    2012-02-01

    There is a specific set of stress factors that yeast cells must overcome under second fermentation conditions, during the production of sparkling wines by the traditional (Champenoise) method. Some of them are the same as those of the primary fermentation of still wines, although perhaps with a different intensity (high ethanol concentration, low pH, nitrogen starvation) while others are more specific to second fermentation (low temperature, CO(2) overpressure). The transcription profile of Saccharomyces cerevisiae during primary wine fermentation has been studied by several research groups, but this is the first report on yeast transcriptome under second fermentation conditions. Our results indicate that the main pathways affected by these particular conditions are related to aerobic respiration, but genes related to vacuolar and peroxisomal functions were also highlighted in this study. A parallelism between the transcription profile of wine yeast during primary and second fermentation is appreciated, with ethanol appearing as the main factor driving gene transcription during second fermentation. Low temperature seems to also influence yeast transcription profile under these particular winemaking conditions. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Polyphenol Compound as a Transcription Factor Inhibitor

    Directory of Open Access Journals (Sweden)

    Seyeon Park

    2015-10-01

    Full Text Available A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor–DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein–protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1, c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB and β-catenin/T cell factor (Tcf.

  8. RESISTANCE-RELATED GENE TRANSCRIPTION AND ...

    African Journals Online (AJOL)

    jdx

    2014-02-05

    Feb 5, 2014 ... and salicylic acid signaling is used to initiate apoptosis at the site of the pathogen's entry. The dying cells can, how- ever, support the growth of necrotrophic pathogens. (Doehlemannetal.,2008). .... independent reverse transcription (RT) reactions were pooled from each leaf processed (three biological ...

  9. Systematic clustering of transcription start site landscapes

    DEFF Research Database (Denmark)

    Zhao, Xiaobei; Valen, Eivind; Parker, Brian J

    2011-01-01

    Genome-wide, high-throughput methods for transcription start site (TSS) detection have shown that most promoters have an array of neighboring TSSs where some are used more than others, forming a distribution of initiation propensities. TSS distributions (TSSDs) vary widely between promoters...

  10. Transcriptional networks in epithelial-mesenchymal transition.

    Directory of Open Access Journals (Sweden)

    Christo Venkov

    Full Text Available Epithelial-mesenchymal transition (EMT changes polarized epithelial cells into migratory phenotypes associated with loss of cell-cell adhesion molecules and cytoskeletal rearrangements. This form of plasticity is seen in mesodermal development, fibroblast formation, and cancer metastasis.Here we identify prominent transcriptional networks active during three time points of this transitional process, as epithelial cells become fibroblasts. DNA microarray in cultured epithelia undergoing EMT, validated in vivo, were used to detect various patterns of gene expression. In particular, the promoter sequences of differentially expressed genes and their transcription factors were analyzed to identify potential binding sites and partners. The four most frequent cis-regulatory elements (CREs in up-regulated genes were SRY, FTS-1, Evi-1, and GC-Box, and RNA inhibition of the four transcription factors, Atf2, Klf10, Sox11, and SP1, most frequently binding these CREs, establish their importance in the initiation and propagation of EMT. Oligonucleotides that block the most frequent CREs restrain EMT at early and intermediate stages through apoptosis of the cells.Our results identify new transcriptional interactions with high frequency CREs that modulate the stability of cellular plasticity, and may serve as targets for modulating these transitional states in fibroblasts.

  11. Promoter proximal polyadenylation sites reduce transcription activity

    DEFF Research Database (Denmark)

    Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick

    2012-01-01

    , which in turn causes reduced transcription. Functional depletion of U1 snRNP in the context of the wild-type SD triggers the same CpA event accompanied by decreased RNA levels. Thus, in accordance with recent findings, U1 snRNP can shield premature pA sites. The negative impact of unshielded pA sites...

  12. Transcriptional regulation of xenobiotic detoxification in Drosophila

    Science.gov (United States)

    Misra, Jyoti R.; Horner, Michael A.; Lam, Geanette; Thummel, Carl S.

    2011-01-01

    Living organisms, from bacteria to humans, display a coordinated transcriptional response to xenobiotic exposure, inducing enzymes and transporters that facilitate detoxification. Several transcription factors have been identified in vertebrates that contribute to this regulatory response. In contrast, little is known about this pathway in insects. Here we show that the Drosophila Nrf2 (NF-E2-related factor 2) ortholog CncC (cap ‘n’ collar isoform-C) is a central regulator of xenobiotic detoxification responses. A binding site for CncC and its heterodimer partner Maf (muscle aponeurosis fibromatosis) is sufficient and necessary for robust transcriptional responses to three xenobiotic compounds: phenobarbital (PB), chlorpromazine, and caffeine. Genetic manipulations that alter the levels of CncC or its negative regulator, Keap1 (Kelch-like ECH-associated protein 1), lead to predictable changes in xenobiotic-inducible gene expression. Transcriptional profiling studies reveal that more than half of the genes regulated by PB are also controlled by CncC. Consistent with these effects on detoxification gene expression, activation of the CncC/Keap1 pathway in Drosophila is sufficient to confer resistance to the lethal effects of the pesticide malathion. These studies establish a molecular mechanism for the regulation of xenobiotic detoxification in Drosophila and have implications for controlling insect populations and the spread of insect-borne human diseases. PMID:21896655

  13. Transcript variations, phylogenetic tree and chromosomal ...

    Indian Academy of Sciences (India)

    AGNIESZKA SADOWSKA

    4Department of Genetics and Animal Breeding, Poznan University of Life Science, Wolynska 33, 60-637 Poznan, Poland. Abstract ... and Ciereszko R. E. 2017 Transcript variations, phylogenetic tree and chromosomal localization of porcine aryl hydrocarbon receptor (AhR) .... Assembling and mapping of the obtained con-.

  14. 4 CFR 28.58 - Transcript.

    Science.gov (United States)

    2010-01-01

    ... requirement may be granted for good cause shown. A motion for an exception shall be made in writing and... good cause. Requests for copies of transcripts shall be directed to the Clerk of the Board. The Clerk... permitted only when errors of substance are involved and only upon approval of the administrative judge. The...

  15. Mitochondrial transcription factor A protects human retinal ...

    African Journals Online (AJOL)

    Purpose: To investigate the impact of mitochondrial transcription factor A (TFAM), as a modulator of NF-κB, on proliferation of hypoxia-induced human retinal endothelial cell (HREC), and the probable mechanism. Methods: After exposure to hypoxia (1 % O2) for 5 days, cell proliferation and cell cycle of HREC were ...

  16. Can We Just Say : Transcription Second?

    NARCIS (Netherlands)

    Krijger, Peter Hugo Lodewijk; de Laat, Wouter

    2017-01-01

    The striking correlation between genome topology and transcriptional activity has for decades made researchers revisit the question, "Does form follow function, or does function follow form?" In a new study, Hug et al. address this question by comparing the timing of zygotic genome activation to the

  17. Overlapping transcription structure of human cytomegalovirus ...

    Indian Academy of Sciences (India)

    2013-01-21

    Jan 21, 2013 ... [Ma Y, Li M, Zheng B, Wang N, Gao S, Wang L, Qi Y, Sun Z and Ruan Q 2013 Overlapping transcription structure of human cytomegalovirus .... Genome structure of the UL139–UL141 gene region of H strain (GenBank GQ981646). The blank arrows ..... The genetic organization of the virus may provide a.

  18. Regulation of host-pathogen interactions via the post-transcriptional Csr/Rsm system.

    Science.gov (United States)

    Kusmierek, Maria; Dersch, Petra

    2018-02-01

    A successful colonization of specific hosts requires a rapid and efficient adaptation of the virulence-relevant gene expression program by bacterial pathogens. An important element in this endeavor is the Csr/Rsm system. This multi-component, post-transcriptional control system forms a central hub within complex regulatory networks and coordinately adjusts virulence properties with metabolic and physiological attributes of the pathogen. A key function is elicited by the RNA-binding protein CsrA/RsmA. CsrA/RsmA interacts with numerous target mRNAs, many of which encode crucial virulence factors, and alters their translation, stability or elongation of transcription. Recent studies highlighted that important colonization factors, toxins, and bacterial secretion systems are under CsrA/RsmA control. CsrA/RsmA deficiency impairs host colonization and attenuates virulence, making this post-transcriptional regulator a suitable drug target. The CsrA/RsmA protein can be inactivated through sequestration by non-coding RNAs, or via binding to specific highly abundant mRNAs and interacting proteins. The wide range of interaction partners and RNA targets, as well as the overarching, interlinked genetic control circuits illustrate the complexity of this regulatory system in the different pathogens. Future work addressing spatio-temporal changes of Csr/Rsm-mediated control during the course of an infection will help us to understand how bacteria reprogram their expression profile to cope with continuous changes experienced in colonized niches. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Bacterial endophytes enhance competition by invasive plants.

    Science.gov (United States)

    Rout, Marnie E; Chrzanowski, Thomas H; Westlie, Tara K; DeLuca, Thomas H; Callaway, Ragan M; Holben, William E

    2013-09-01

    Invasive plants can alter soil microbial communities and profoundly alter ecosystem processes. In the invasive grass Sorghum halepense, these disruptions are consequences of rhizome-associated bacterial endophytes. We describe the effects of N2-fixing bacterial strains from S. halepense (Rout and Chrzanowski, 2009) on plant growth and show that bacteria interact with the plant to alter soil nutrient cycles, enabling persistence of the invasive. • We assessed fluxes in soil nutrients for ∼4 yr across a site invaded by S. halepense. We assayed the N2-fixing bacteria in vitro for phosphate solubilization, iron chelation, and production of the plant-growth hormone indole-3-acetic acid (IAA). We assessed the plant's ability to recruit bacterial partners from substrates and vertically transmit endophytes to seeds and used an antibiotic approach to inhibit bacterial activity in planta and assess microbial contributions to plant growth. • We found persistent alterations to eight biogeochemical cycles (including nitrogen, phosphorus, and iron) in soils invaded by S. halepense. In this context, three bacterial isolates solubilized phosphate, and all produced iron siderophores and IAA in vitro. In growth chamber experiments, bacteria were transmitted vertically, and molecular analysis of bacterial community fingerprints from rhizomes indicated that endophytes are also horizontally recruited. Inhibiting bacterial activity with antibiotics resulted in significant declines in plant growth rate and biomass, with pronounced rhizome reductions. • This work suggests a major role of endophytes on growth and resource allocation of an invasive plant. Indeed, bacterial isolate physiology is correlated with invader effects on biogeochemical cycles of nitrogen, phosphate, and iron.

  20. Heme Synthesis and Acquisition in Bacterial Pathogens

    OpenAIRE

    Choby, Jacob E.; Skaar, Eric P.

    2016-01-01

    Bacterial pathogens require the iron-containing cofactor heme to cause disease. Heme is essential to the function of hemoproteins, which are involved in energy generation by the electron transport chain, detoxification of host immune effectors, and other processes. During infection, bacterial pathogens must synthesize heme or acquire heme from the host; however, host heme is sequestered in high-affinity hemoproteins. Pathogens have evolved elaborate strategies to acquire heme from host source...

  1. BACTERIAL DESTRUCTION OF EPSILON-CAPROLACTAM,

    Science.gov (United States)

    Three bacterial strains capable of utilizing caprolactam (hexahydro azepin-2-one) as the only source of nitrogen, carbon and energy were isolated...from active silt of aerotanks used to purify waste water from Caprolactam production. They were identified as Pseudomonas dacunnae and Bacterium agile 1...and 2. The P. dacunnae strain is most active with respect to Caprolactam . Bacterial utilization of caprolactam has a marked adaptive character

  2. Volatiles in Inter-Specific Bacterial Interactions.

    Science.gov (United States)

    Tyc, Olaf; Zweers, Hans; de Boer, Wietse; Garbeva, Paolina

    2015-01-01

    The importance of volatile organic compounds for functioning of microbes is receiving increased research attention. However, to date very little is known on how inter-specific bacterial interactions effect volatiles production as most studies have been focused on volatiles produced by monocultures of well-described bacterial genera. In this study we aimed to understand how inter-specific bacterial interactions affect the composition, production and activity of volatiles. Four phylogenetically different bacterial species namely: Chryseobacterium, Dyella, Janthinobacterium, and Tsukamurella were selected. Earlier results had shown that pairwise combinations of these bacteria induced antimicrobial activity in agar media whereas this was not the case for monocultures. In the current study, we examined if these observations were also reflected by the production of antimicrobial volatiles. Thus, the identity and antimicrobial activity of volatiles produced by the bacteria were determined in monoculture as well in pairwise combinations. Antimicrobial activity of the volatiles was assessed against fungal, oomycetal, and bacterial model organisms. Our results revealed that inter-specific bacterial interactions affected volatiles blend composition. Fungi and oomycetes showed high sensitivity to bacterial volatiles whereas the effect of volatiles on bacteria varied between no effects, growth inhibition to growth promotion depending on the volatile blend composition. In total 35 volatile compounds were detected most of which were sulfur-containing compounds. Two commonly produced sulfur-containing volatile compounds (dimethyl disulfide and dimethyl trisulfide) were tested for their effect on three target bacteria. Here, we display the importance of inter-specific interactions on bacterial volatiles production and their antimicrobial activities.

  3. Volatiles in inter-specific bacterial interactions

    Directory of Open Access Journals (Sweden)

    Olaf eTyc

    2015-12-01

    Full Text Available The importance of volatile organic compounds for functioning of microbes is receiving increased research attention. However, to date very little is known on how inter-specific bacterial interactions effect volatiles production as most studies have been focused on volatiles produced by monocultures of well described bacterial genera. In this study we aimed to understand how inter-specific bacterial interactions affect the composition, production and activity of volatiles. Four phylogenetically different bacterial species namely: Chryseobacterium, Dyella, Janthinobacterium and Tsukamurella were selected. Earlier results had shown that pairwise combinations of these bacteria induced antimicrobial activity in agar media whereas this was not the case for monocultures. In the current study, we examined if these observations were also reflected by the production of antimicrobial volatiles. Thus, the identity and antimicrobial activity of volatiles produced by the bacteria were determined in monoculture as well in pairwise combinations. Antimicrobial activity of the volatiles was assessed against fungal, oomycetal and bacterial model organisms. Our results revealed that inter-specific bacterial interactions affected volatiles blend composition. Fungi and oomycetes showed high sensitivity to bacterial volatiles whereas the effect of volatiles on bacteria varied between no effects, growth inhibition to growth promotion depending on the volatile blend composition. In total 35 volatile compounds were detected most of which were sulfur-containing compounds. Two commonly produced sulfur-containing volatile compounds (dimethyl disulfide and dimethyl trisulfide were tested for their effect on three target bacteria. Here we display the importance of inter-specific interactions on bacterial volatiles production and their antimicrobial activities.

  4. Evaluation of reference genes for reverse transcription quantitative PCR analyses of fish-pathogenic Francisella strains exposed to different growth conditions.

    Science.gov (United States)

    Brudal, Espen; Winther-Larsen, Hanne Cecilie; Colquhoun, Duncan John; Duodu, Samuel

    2013-03-02

    Reverse transcription quantitative PCR has become a powerful technique to monitor mRNA transcription in response to different environmental conditions in many bacterial species. However, correct evaluation of data requires accurate and reliable use of reference genes whose transcription does not change during the course of the experiment. In the present study exposure to different growth conditions was used to validate the transcription stability of eight reference gene candidates in three strains from two subspecies of Francisella noatunensis, a pathogen causing disease in both warm and cold water fish species. Relative transcription levels for genes encoding DNA gyrase (gyrA), RNA polymerase beta subunit (rpoB), DNA polymerase I (polA), cell division protein (ftsZ), outer membrane protein (fopA), riboflavin biosynthesis protein (ribC), 16S ribosomal RNA (16S rRNA) and DNA helicases (uvrD) were quantified under exponential, stationary and iron-restricted growth conditions. The suitability of selected reference genes for reliable interpretation of gene expression data was tested using the virulence-associated intracellular growth locus subunit C (iglC) gene. Although the transcription stability of the reference genes was slightly different in the three strains studied, fopA, ftsZ and polA proved to be the most stable and suitable for normalization of gene transcription in Francisella noatunensis ssp.

  5. Endocarditis in adults with bacterial meningitis.

    Science.gov (United States)

    Lucas, Marjolein J; Brouwer, Matthijs C; van der Ende, Arie; van de Beek, Diederik

    2013-05-21

    Endocarditis may precede or complicate bacterial meningitis, but the incidence and impact of endocarditis in bacterial meningitis are unknown. We assessed the incidence and clinical characteristics of patients with meningitis and endocarditis from a nationwide cohort study of adults with community-acquired bacterial meningitis in the Netherlands from 2006 to 2012. Endocarditis was identified in 24 of 1025 episodes (2%) of bacterial meningitis. Cultures yielded Streptococcus pneumoniae in 13 patients, Staphylococcus aureus in 8 patients, and Streptococcus agalactiae, Streptococcus pyogenes, and Streptococcus salivarius in 1 patient each. Clues leading to the diagnosis of endocarditis were cardiac murmurs, persistent or recurrent fever, a history of heart valve disease, and S aureus as the causative pathogen of bacterial meningitis. Treatment consisted of prolonged antibiotic therapy in all patients and surgical valve replacement in 10 patients (42%). Two patients were treated with oral anticoagulants, and both developed life-threatening intracerebral hemorrhage. Systemic (70%) and neurological (54%) complications occurred frequently, leading to a high proportion of patients with unfavorable outcome (63%). Seven of 24 patients (29%) with meningitis and endocarditis died. Endocarditis is an uncommon coexisting condition in bacterial meningitis but is associated with a high rate of unfavorable outcome.

  6. The epidemiology of bacterial meningitis in Kosovo.

    Science.gov (United States)

    Namani, Sadie A; Koci, Remzie A; Qehaja-Buçaj, Emine; Ajazaj-Berisha, Lindita; Mehmeti, Murat

    2014-07-14

    The purpose of this study was to present the epidemiologic features of bacterial meningitis in the developing country of Kosovo. Data were collected from active surveillance of bacterial meningitis cases treated at the University Clinical Center of Kosovo in the years 2000 (first post-war year) and 2010. Meningitis cases in 2000 compared with 2010 showed a 35.5% decline in incidence (from 4.8 to 3.1 cases per 100,000 population) and a decrease in the case fatality rate from 10% to 5%. In children, there was a lower mortality rate (5% versus 2%) and a lower incidence of neurological complications (13% versus 16%) as compared to adults (32% versus 10% and 16% versus 35%, respectively). Neisseria meningitidis was the most common pathogen of bacterial meningitis in both study periods. Bacterial meningitis was most prevalent in the pediatric population, and showed an increase in the median age, from three years in 2000 to seven years in 2010. A steady number of bacterial meningitis cases in adults throughout last decade (around 20 cases per year) was recorded. During the last decade, gradual changes have been observed in the epidemiology of bacterial meningitis that are unrelated to the introduction of new vaccines, but are partly due to the improvement of living conditions.

  7. The intrinsic resistome of bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Jorge Andrés Olivares Pacheco

    2013-04-01

    Full Text Available Intrinsically resistant bacteria have emerged as a relevant health problem in the last years. Those bacterial species, several of them with an environmental origin, present naturally a low-level susceptibility to several drugs. It has been proposed that intrinsic resistance is mainly the consequence of the impermeability of cellular envelopes, the activity of multidrug efflux pumps or the lack of appropriate targets for a given family of drugs. However, recently published articles indicate that the characteristic phenotype of susceptibility to antibiotics of a given bacterial species depends on the concerted activity of several elements, what has been named as intrinsic resistome. These determinants comprise not just classical resistance genes. Other elements, several of them involved in basic bacterial metabolic processes, are of relevance for the intrinsic resistance of bacterial pathogens. In the present review we analyse recent publications on the intrinsic resistomes of Escherichia coli and Pseudomonas aeruginosa. We present as well information on the role that global regulators of bacterial metabolism, as Crc from P. aeruginosa, may have on modulating bacterial susceptibility to antibiotics. Finally, we discuss the possibility of searching inhibitors of the intrinsic resistome in the aim of improving the activity of drugs currently in use for clinical practice.

  8. Bacterial RNAs activate innate immunity in Arabidopsis.

    Science.gov (United States)

    Lee, Boyoung; Park, Yong-Soon; Lee, Soohyun; Song, Geun Cheol; Ryu, Choong-Min

    2016-01-01

    The common molecular patterns of microbes play a critical role in the regulation of plant innate immunity. However, little is known about the role of nucleic acids in this process in plants. We pre-infiltrated Arabidopsis leaves with total RNAs from Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) and subsequently inoculated these plants with the same bacterial cells. Total Pto DC3000 RNAs pre-infiltrated into Arabidopsis leaves elicited plant immune responses against Pto DC3000. However, sheared RNAs and RNase A application failed to induce immunity, suggesting that intact bacterial RNAs function in plant innate immunity. This notion was supported by the positive regulation of superoxide anion levels, callose deposition, two mitogen-activated protein kinases and defense-related genes observed in bacterial RNA-pre-treated leaves. Intriguingly, the Pto DC3000 population was not compromised in known pattern recognition receptor mutants for chitin, flagellin and elongation factor-Tu (EF-Tu). Plant defense-related mutant analyses further revealed that bacterial RNA-elicited innate immunity was normally required for salicylic and jasmonic acid signaling. Notably, among total RNAs, the abundant bacterial RNA species 16S and 23S ribosomal RNAs were the major determinants of this response. Our findings provide evidence that bacterial RNA serves as a microbe-associated molecular pattern in plants. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  9. Role of quorum sensing in bacterial infections

    Science.gov (United States)

    Castillo-Juárez, Israel; Maeda, Toshinari; Mandujano-Tinoco, Edna Ayerim; Tomás, María; Pérez-Eretza, Berenice; García-Contreras, Silvia Julieta; Wood, Thomas K; García-Contreras, Rodolfo

    2015-01-01

    Quorum sensing (QS) is cell communication that is widely used by bacterial pathogens to coordinate the expression of several collective traits, including the production of multiple virulence factors, biofilm formation, and swarming motility once a population threshold is reached. Several lines of evidence indicate that QS enhances virulence of bacterial pathogens in animal models as well as in human infections; however, its relative importance for bacterial pathogenesis is still incomplete. In this review, we discuss the present evidence from in vitro and in vivo experiments in animal models, as well as from clinical studies, that link QS systems with human infections. We focus on two major QS bacterial models, the opportunistic Gram negative bacteria Pseudomonas aeruginosa and the Gram positive Staphylococcus aureus, which are also two of the main agents responsible of nosocomial and wound infections. In addition, QS communication systems in other bacterial, eukaryotic pathogens, and even immune and cancer cells are also reviewed, and finally, the new approaches proposed to combat bacterial infections by the attenuation of their QS communication systems and virulence are also discussed. PMID:26244150

  10. Linking the transcriptional profiles and the physiological states of Mycobacterium tuberculosis during an extended intracellular infection.

    Directory of Open Access Journals (Sweden)

    Kyle H Rohde

    Full Text Available Intracellular pathogens such as Mycobacterium tuberculosis have evolved strategies for coping with the pressures encountered inside host cells. The ability to coordinate global gene expression in response to environmental and internal cues is one key to their success. Prolonged survival and replication within macrophages, a key virulence trait of M. tuberculosis, requires dynamic adaptation to diverse and changing conditions within its phagosomal niche. However, the physiological adaptations during the different phases of this infection process remain poorly understood. To address this knowledge gap, we have developed a multi-tiered approach to define the temporal patterns of gene expression in M. tuberculosis in a macrophage infection model that extends from infection, through intracellular adaptation, to the establishment of a productive infection. Using a clock plasmid to measure intracellular replication and death rates over a 14-day infection and electron microscopy to define bacterial integrity, we observed an initial period of rapid replication coupled with a high death rate. This was followed by period of slowed growth and enhanced intracellular survival, leading finally to an extended period of net growth. The transcriptional profiles of M. tuberculosis reflect these physiological transitions as the bacterium adapts to conditions within its host cell. Finally, analysis with a Transcriptional Regulatory Network model revealed linked genetic networks whereby M. tuberculosis coordinates global gene expression during intracellular survival. The integration of molecular and cellular biology together with transcriptional profiling and systems analysis offers unique insights into the host-driven responses of intracellular pathogens such as M. tuberculosis.

  11. Preliminary structural studies of the transcriptional regulator CmeR from Campylobacter jejuni

    Energy Technology Data Exchange (ETDEWEB)

    Su, Chih-Chia [Department of Biochemistry, Biophysics and Molecular Biology, Iowa State University, Ames, IA 50011 (United States); Shi, Feng [Department of Veterinary Microbiology, College of Veterinary Medicine, Iowa State University, Ames, IA 50011 (United States); Gu, Ruoyu; Li, Ming [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States); McDermott, Gerry [Department of Anatomy, School of Medicine, University of California, San Francisco, CA 94143 (United States); Yu, Edward W., E-mail: ewyu@iastate.edu [Department of Biochemistry, Biophysics and Molecular Biology, Iowa State University, Ames, IA 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States); Zhang, Qijing [Department of Veterinary Microbiology, College of Veterinary Medicine, Iowa State University, Ames, IA 50011 (United States); Department of Biochemistry, Biophysics and Molecular Biology, Iowa State University, Ames, IA 50011 (United States)

    2007-01-01

    The transcriptional regulator CmeR from C. jejuni has been purified and crystallized and X-ray diffraction data have been collected to a resolution of 2.2 Å. In Campylobacter jejuni, a Gram-negative bacterial pathogen causing gastroenteritis in humans, the CmeR regulatory protein controls transcription of the multidrug transporter gene operon cmeABC. CmeR belongs to the TetR family of transcriptional regulators. The 210-residue CmeR consists of two functional motifs: an N-terminal DNA-binding domain and a C-terminal ligand-binding domain. It is predicted that the DNA-binding domain interacts directly with target promoters, while the C-terminal motif interacts with inducing ligands (such as bile salts). As an initial step towards confirming this structural model, recombinant CmeR protein containing a 6×His tag at the N-terminus was crystallized. Crystals of ligand-free CmeR belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 37.4, b = 57.6, c = 93.3 Å. Diffraction was observed to at least 2.2 Å at 100 K. Analysis of the detailed CmeR structure is currently in progress.

  12. Tolerogenic Transcriptional Signatures of Steady-State and Pathogen-Induced Dendritic Cells.

    Science.gov (United States)

    Vendelova, Emilia; Ashour, Diyaaeldin; Blank, Patrick; Erhard, Florian; Saliba, Antoine-Emmanuel; Kalinke, Ulrich; Lutz, Manfred B

    2018-01-01

    Dendritic cells (DCs) are key directors of tolerogenic and immunogenic immune responses. During the steady state, DCs maintain T cell tolerance to self-antigens by multiple mechanisms including inducing anergy, deletion, and Treg activity. All of these mechanisms help to prevent autoimmune diseases or other hyperreactivities. Different DC subsets contribute to pathogen recognition by expression of different subsets of pattern recognition receptors, including Toll-like receptors or C-type lectins. In addition to the triggering of immune responses in infected hosts, most pathogens have evolved mechanisms for evasion of targeted responses. One such strategy is characterized by adopting the host's T cell tolerance mechanisms. Understanding these tolerogenic mechanisms is of utmost importance for therapeutic approaches to treat immune pathologies, tumors and infections. Transcriptional profiling has developed into a potent tool for DC subset identification. Here, we review and compile pathogen-induced tolerogenic transcriptional signatures from mRNA profiling data of currently available bacterial- or helminth-induced transcriptional signatures. We compare them with signatures of tolerogenic steady-state DC subtypes to identify common and divergent strategies of pathogen induced immune evasion. Candidate molecules are discussed in detail. Our analysis provides further insights into tolerogenic DC signatures and their exploitation by different pathogens.

  13. Genome conformation capture reveals that the Escherichia coli chromosome is organized by replication and transcription.

    Science.gov (United States)

    Cagliero, Cedric; Grand, Ralph S; Jones, M Beatrix; Jin, Ding J; O'Sullivan, Justin M

    2013-07-01

    To fit within the confines of the cell, bacterial chromosomes are highly condensed into a structure called the nucleoid. Despite the high degree of compaction in the nucleoid, the genome remains accessible to essential biological processes, such as replication and transcription. Here, we present the first high-resolution chromosome conformation capture-based molecular analysis of the spatial organization of the Escherichia coli nucleoid during rapid growth in rich medium and following an induced amino acid starvation that promotes the stringent response. Our analyses identify the presence of origin and terminus domains in exponentially growing cells. Moreover, we observe an increased number of interactions within the origin domain and significant clustering of SeqA-binding sequences, suggesting a role for SeqA in clustering of newly replicated chromosomes. By contrast, 'histone-like' protein (i.e. Fis, IHF and H-NS) -binding sites did not cluster, and their role in global nucleoid organization does not manifest through the mediation of chromosomal contacts. Finally, genes that were downregulated after induction of the stringent response were spatially clustered, indicating that transcription in E. coli occurs at transcription foci.

  14. Fortunella margarita transcriptional reprogramming triggered by Xanthomonas citri subsp. citri.

    Science.gov (United States)

    Khalaf, Abeer A; Gmitter, Frederick G; Conesa, Ana; Dopazo, Joaquin; Moore, Gloria A

    2011-11-11

    Citrus canker disease caused by the bacterial pathogen Xanthomonas citri subsp. citri (Xcc) has become endemic in areas where high temperature, rain, humidity, and windy conditions provide a favourable environment for the dissemination of the bacterium. Xcc is pathogenic on many commercial citrus varieties but appears to elicit an incompatible reaction on the citrus relative Fortunella margarita Swing (kumquat), in the form of a very distinct delayed necrotic response. We have developed subtractive libraries enriched in sequences expressed in kumquat leaves during both early and late stages of the disease. The isolated differentially expressed transcripts were subsequently sequenced. Our results demonstrate how the use of microarray expression profiling can help assign roles to previously uncharacterized genes and elucidate plant pathogenesis-response related mechanisms. This can be considered to be a case study in a citrus relative where high throughput technologies were utilized to understand defence mechanisms in Fortunella and citrus at the molecular level. cDNAs from sequenced kumquat libraries (ESTs) made from subtracted RNA populations, healthy vs. infected, were used to make this microarray. Of 2054 selected genes on a customized array, 317 were differentially expressed (P < 0.05) in Xcc challenged kumquat plants compared to mock-inoculated ones. This study identified components of the incompatible interaction such as reactive oxygen species (ROS) and programmed cell death (PCD). Common defence mechanisms and a number of resistance genes were also identified. In addition, there were a considerable number of differentially regulated genes that had no homologues in the databases. This could be an indication of either a specialized set of genes employed by kumquat in response to canker disease or new defence mechanisms in citrus. Functional categorization of kumquat Xcc-responsive genes revealed an enhanced defence-related metabolism as well as a number of

  15. Tumor suppressor QM-like gene from disk abalone (Haliotis discus discus): molecular characterization and transcriptional analysis upon immune challenge.

    Science.gov (United States)

    Oh, Chulhong; De Zoysa, Mahanama; Nikapitiya, Chamilani; Whang, Ilson; Kim, Yu Cheol; Kang, Do-Hyung; Heo, Soo-jin; Choi, Young-Ung; Choi, Cheol Young; Lee, Jae-Seong; Lee, Jehee

    2010-09-01

    We describe molecular characterization and transcriptional analysis of the gene encoding tumor suppressor QM-like protein, AbQM, in the disk abalone Haliotis discus discus. The full-length cDNA (765-bp) of AbQM was found to consist of a 654-bp ORF coding for a 218 amino acid protein of a 25 kDa molecular mass with a 10.2 isoelectric point. Analysis of AbQM sequence revealed the presence of characteristic motifs, including the ribosomal protein L10 signature, SH3-binding motif and two antibiotic binding sites. Phylogenetic analysis confirmed that AbQM is closely related to other mollusk QM proteins, and altogether they form a mollusk QM protein sub-family which displays evolutionary conservation from yeast to human. Tissue-specific expression and transcriptional regulation of AbQM was analyzed by quantitative real-time PCR in response to bacterial (Vibrio alginolyticus and Vibrio parahemolyticus, Listeria monocytogenes) and viral (viral hemorrhagic septicemia virus, VHSV) challenge. AbQM transcripts were found to be expressed ubiquitously in all examined tissues in a constitutive manner, as similar expression levels were detected in hemocytes, mantle, digestive tract and muscle. Upon bacterial and VHSV challenge, AbQM showed significant up-regulation in gills, but not in hemocytes. Taken together, these findings suggest that AbQM in abalone-like mollusks can respond to and facilitate a defensive effect against pathogenic infection. Copyright 2010 Elsevier Ltd. All rights reserved.

  16. The MogR Transcriptional Repressor Regulates Nonhierarchal Expression of Flagellar Motility Genes and Virulence in Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    2006-04-01

    Full Text Available Flagella are surface structures critical for motility and virulence of many bacterial species. In Listeria monocytogenes, MogR tightly represses expression of flagellin (FlaA during extracellular growth at 37 degrees C and during intracellular infection. MogR is also required for full virulence in a murine model of infection. Using in vitro and in vivo infection models, we determined that the severe virulence defect of MogR-negative bacteria is due to overexpression of FlaA. Specifically, overproduction of FlaA in MogR-negative bacteria caused pleiotropic defects in bacterial division (chaining phenotype, intracellular spread, and virulence in mice. DNA binding and microarray analyses revealed that MogR represses transcription of all known flagellar motility genes by binding directly to a minimum of two TTTT-N(5-AAAA recognition sites positioned within promoter regions such that RNA polymerase binding is occluded. Analysis of MogR protein levels demonstrated that modulation of MogR repression activity confers the temperature-specificity to flagellar motility gene expression. Epistasis analysis revealed that MogR repression of transcription is antagonized in a temperature-dependent manner by the DegU response regulator and that DegU further regulates FlaA levels through a posttranscriptional mechanism. These studies provide the first known example to our knowledge of a transcriptional repressor functioning as a master regulator controlling nonhierarchal expression of flagellar motility genes.

  17. Method to determine transcriptional regulation pathways in organisms

    Science.gov (United States)

    Gardner, Timothy S.; Collins, James J.; Hayete, Boris; Faith, Jeremiah

    2012-11-06

    The invention relates to computer-implemented methods and systems for identifying regulatory relationships between expressed regulating polypeptides and targets of the regulatory activities of such regulating polypeptides. More specifically, the invention provides a new method for identifying regulatory dependencies between biochemical species in a cell. In particular embodiments, provided are computer-implemented methods for identifying a regulatory interaction between a transcription factor and a gene target of the transcription factor, or between a transcription factor and a set of gene targets of the transcription factor. Further provided are genome-scale methods for predicting regulatory interactions between a set of transcription factors and a corresponding set of transcriptional target substrates thereof.

  18. RegPrecise 3.0--a resource for genome-scale exploration of transcriptional regulation in bacteria.

    Science.gov (United States)

    Novichkov, Pavel S; Kazakov, Alexey E; Ravcheev, Dmitry A; Leyn, Semen A; Kovaleva, Galina Y; Sutormin, Roman A; Kazanov, Marat D; Riehl, William; Arkin, Adam P; Dubchak, Inna; Rodionov, Dmitry A

    2013-11-01

    Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in prokaryotes is one of the critical tasks of modern genomics. Bacteria from different taxonomic groups, whose lifestyles and natural environments are substantially different, possess highly diverged transcriptional regulatory networks. The comparative genomics approaches are useful for in silico reconstruction of bacterial regulons and networks operated by both transcription factors (TFs) and RNA regulatory elements (riboswitches). RegPrecise (http://regprecise.lbl.gov) is a web resource for collection, visualization and analysis of transcriptional regulons reconstructed by comparative genomics. We significantly expanded a reference collection of manually curated regulons we introduced earlier. RegPrecise 3.0 provides access to inferred regulatory interactions organized by phylogenetic, structural and functional properties. Taxonomy-specific collections include 781 TF regulogs inferred in more than 160 genomes representing 14 taxonomic groups of Bacteria. TF-specific collections include regulogs for a selected subset of 40 TFs reconstructed across more than 30 taxonomic lineages. Novel collections of regulons operated by RNA regulatory elements (riboswitches) include near 400 regulogs inferred in 24 bacterial lineages. RegPrecise 3.0 provides four classifications of the reference regulons implemented as controlled vocabularies: 55 TF protein families; 43 RNA motif families; ~150 biological processes or metabolic pathways; and ~200 effectors or environmental signals. Genome-wide visualization of regulatory networks and metabolic pathways covered by the reference regulons are available for all studied genomes. A separate section of RegPrecise 3.0 contains draft regulatory networks in 640 genomes obtained by an conservative propagation of the reference regulons to closely related genomes. RegPrecise 3.0 gives access to the transcriptional regulons reconstructed in

  19. Exploring bacterial infections: theoretical and experimental studies of the bacterial population dynamics and antibiotic treatment

    Science.gov (United States)

    Shao, Xinxian

    Bacterial infections are very common in human society. Thus extensive research has been conducted to reveal the molecular mechanisms of the pathogenesis and to evaluate the antibiotics' efficacy against bacteria. Little is known, however, about the population dynamics of bacterial populations and their interactions with the host's immune system. In this dissertation, a stochatic model is developed featuring stochastic phenotypic switching of bacterial individuals to explain the single-variant bottleneck discovered in multi strain bacterial infections. I explored early events in a bacterial infection establishment using classical experiments of Moxon and Murphy on neonatal rats. I showed that the minimal model and its simple variants do not work. I proposed modifications to the model that could explain the data quantitatively. The bacterial infections are also commonly established in physical structures, as biofilms or 3-d colonies. In contrast, most research on antibiotic treatment of bacterial infections has been conducted in well-mixed liquid cultures. I explored the efficacy of antibiotics to treat such bacterial colonies, a broadly applicable method is designed and evaluated where discrete bacterial colonies on 2-d surfaces were exposed to antibiotics. I discuss possible explanations and hypotheses for the experimental results. To verify these hypotheses, we investigated the dynamics of bacterial population as 3-d colonies. We showed that a minimal mathematical model of bacterial colony growth in 3-d was able to account for the experimentally observed presence of a diffusion-limited regime. The model further revealed highly loose packing of the cells in 3-d colonies and smaller cell sizes in colonies than plancktonic cells in corresponding liquid culture. Further experimental tests of the model predictions have revealed that the ratio of the cell size in liquid culture to that in colony cultures was consistent with the model prediction, that the dead cells

  20. Transcriptional and post-transcriptional regulation of nucleotide excision repair genes in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Lefkofsky, Hailey B. [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Veloso, Artur [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Bioinformatics Program, Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI (United States); Ljungman, Mats, E-mail: ljungman@umich.edu [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Environmental Health Sciences, School of Public Health, University of Michigan, Ann Arbor, MI (United States)

    2015-06-15

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death.