WorldWideScience

Sample records for bacterial deoxyribonucleoside kinases

  1. Dictyostelium discoideum salvages purine deoxyribonucleosides by highly specific bacterial-like deoxyribonucleoside kinases

    DEFF Research Database (Denmark)

    Sandrini, Michael; Soderbom, F.; Mikkelsen, N.E.;

    2007-01-01

    The salvage of deoxyribonucleosides in the social amoeba Dictyostelium discoideum, which has an extremely A + T-rich genome, was investigated. All native deoxyribonucleosides were phosphorylated by D. discoideum cell extracts and we subcloned three deoxyribonucleoside kinase (dNK) encoding genes....

  2. Nucleoside analogues are activated by bacterial deoxyribonucleoside kinases in a species-specific manner

    DEFF Research Database (Denmark)

    Sandrini, Michael; Clausen, Anders; On, Stephen L. W.

    2007-01-01

    bactericidal activity against several clinical bacterial isolates and type strains. We identified and subcloned the genes coding for putative deoxyribonucleoside kinases in Escherichia coli, Pasteurella multocida, Salmonella enterica, Yersinia enterocolitica, Bacillus cereus, Clostridium perfringens...

  3. Non-Viral Deoxyribonucleoside Kinases

    DEFF Research Database (Denmark)

    Christiansen, Louise Slot; Munch-Petersen, Birgitte; Knecht, Wolfgang

    2015-01-01

    Deoxyribonucleoside kinases (dNKs) phosphorylate deoxyribonucleosides to their corresponding monophosphate compounds. dNks also phosphorylate deoxyribonucleoside analogues that are used in the treatment of cancer or viral infections. The study of the mammalian dNKs has therefore always been of gr...

  4. Structural basis for feedback inhibition of the deoxyribonucleoside salvage pathway: Studies of the Drosophila deoxyribonucleoside kinase

    DEFF Research Database (Denmark)

    Mikkelsen, N.E.; Johansson, K.; Karlsson, A.

    2003-01-01

    Deoxyribonucleoside kinases are feedback inhibited by the final products of the salvage pathway, the deoxyribonucleoside triphosphates. In the present study, the mechanism of feedback inhibition is presented based on the crystal structure of a complex between the fruit fly deoxyribonucleoside...

  5. A multisubstrate deoxyribonucleoside kinase from plants

    DEFF Research Database (Denmark)

    Clausen, Anders R.; Girandon, Lenart; Knecht, Wolfgang;

    2008-01-01

    and biochemical properties suggest that this deoxyribonucleoside kinase represents a living fossil resembling the progenitor of the modern animal deoxycytidine, deoxyguanosine and thymidine 2 kinases. The broad substrate specificity makes this enzyme an interesting candidate to be evaluated as a suicide gene...

  6. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    DEFF Research Database (Denmark)

    Knecht, Wolfgang; Mikkelsen, N.E.; Clausen, A.R.

    2009-01-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 angstrom resolution s...

  7. Non-Viral Deoxyribonucleoside Kinases--Diversity and Practical Use

    DEFF Research Database (Denmark)

    Christiansen, Louise Slot; Munch-Petersen, Birgitte; Knecht, Wolfgang

    2015-01-01

    Deoxyribonucleoside kinases (dNKs) phosphorylate deoxyribonucleosides to their corresponding monophosphate compounds. dNks also phosphorylate deoxyribonucleoside analogues that are used in the treatment of cancer or viral infections. The study of the mammalian dNKs has therefore always been of gr...

  8. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    Energy Technology Data Exchange (ETDEWEB)

    Knecht, Wolfgang [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Mikkelsen, Nils Egil [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Clausen, Anders Ranegaard [Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden); Willer, Mette [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Eklund, Hans [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Gojkovic, Zoran [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Piskur, Jure, E-mail: Jure.Piskur@cob.lu.se [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden)

    2009-05-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 A resolution structure of Dm-dNK in complex with gemcitabine shows that the residues Tyr70 and Arg105 play a crucial role in the firm positioning of gemcitabine by extra interactions made by the fluoride atoms. This explains why gemcitabine is a good substrate for Dm-dNK.

  9. Deoxyribonucleoside kinases: two enzyme families catalyze the same reaction

    DEFF Research Database (Denmark)

    Sandrini, Michael; Piskur, Jure

    2005-01-01

    Mammals have four deoxyribonucleoside kinases, the cytoplasmic (TK1) and mitochondrial (TK2) thymidine kinases, and the deoxycytidine (dCK) and deoxyguanosine (dGK) kinases, which salvage the precursors for nucleic acids synthesis. In addition to the native deoxyribonucleoside substrates, the kin......, the kinases can phosphorylate and thereby activate a variety of anti-cancer and antiviral prodrugs. Recently, the crystal structure of human TK1 has been solved and has revealed that enzymes with fundamentally different origins and folds catalyze similar, crucial cellular reactions....

  10. Mosquito has a single multisubstrate deoxyribonucleoside kinase characterized by unique substrate specificity

    DEFF Research Database (Denmark)

    Knecht, Wolfgang; Petersen, G.E.; Sandrini, Michael

    2003-01-01

    deoxyribonucleosides than the fruit fly multisubstrate deoxyribonucleoside kinase (EC 2.7.1.145). In addition, Ag-dNK could also phosphorylate some medically interesting nucleoside analogs, like stavudine (D4T), 2-chloro-deoxyadenosine (CdA) and 5-bromo-vinyl-deoxyuridine (BVDU). Although the biological significance...

  11. Structural basis for the changed substrate specificity of Drosophila melanogaster deoxyribonucleoside kinase mutant N64D

    DEFF Research Database (Denmark)

    Welin, M.; Skovgaard, T.; Knecht, Wolfgang

    2005-01-01

    The Drosophila melanogaster deoxyribonucleoside kinase (Dm-dNK) double mutant N45D/N64D was identified during a previous directed evolution study. This mutant enzyme had a decreased activity towards the natural substrates and decreased feedback inhibition with dTTP, whereas the activity with 3...

  12. Structural studies of nucleoside analog and feedback inhibitor binding to Drosophila melanogaster multisubstrate deoxyribonucleoside kinase

    DEFF Research Database (Denmark)

    Mikkelsen, Niels Egil; Munch-Petersen, Birgitte; Eklund, Hans

    2008-01-01

    The Drosophila Melanogaster multisubstrate deoxyribonucleoside kinase (dNK) has a high turnover rate and a wide substrate range that makes it a very good candidate for gene therapy. This concept is based on introducing a suicide gene into malignant cells in order to activate a pro...

  13. Deoxyribonucleoside kinases in two aquatic bacteria with high specificity for thymidine and deoxyadenosine

    DEFF Research Database (Denmark)

    Tinta, Tinkara; Christiansen, Louise Slot; Konrad, Anke

    2012-01-01

    Deoxyribonucleoside kinases (dNKs) are essential in the mammalian cell but their 'importance' in bacteria, especially aquatic ones, is less clear. We studied two aquatic bacteria, Gram-negative Flavobacterium psychrophilum JIP02/86 and Polaribacter sp. MED152, for their ability to salvage......, these two bacteria are missing this activity. When tens of available aquatic bacteria genomes were examined for the presence of dNKs, a majority had at least a TK1-like gene, but several lacked any dNKs. Apparently, among aquatic bacteria, the role of the dN salvage varies....

  14. Deoxyribonucleoside kinases activate nucleoside antibiotics in severely pathogenic bacteria

    DEFF Research Database (Denmark)

    Sandrini, Michael; Shannon, O.; Clausen, A.R.;

    2007-01-01

    Common bacterial pathogens are becoming progressively more resistant to traditional antibiotics, representing a major public-health crisis. Therefore, there is a need for a variety of antibiotics with alternative modes of action. In our study, several nucleoside analogs were tested against...... alternative for combating pathogenic bacteria....

  15. Isolation of a novel protein, P12-from adult Drosophila melanogaster that inhibits deoxyribonucleoside and protein kinase activities and activates 3'-5'- exonuclease activity

    DEFF Research Database (Denmark)

    Christiansen, Louise Slot; Zanten, Gabriella van; Berenstein, Dvora;

    2016-01-01

    We have previously found that Drosophila melanogaster only has one deoxyribonucleoside kinase, Dm-dNK, however, capable to phosphorylate all four natural deoxyribonucleosides. Dm-dNK was originally isolated from an embryonic cell line. We wanted to study the expression of Dm-dNK during development......-dNK, also inhibited the two protein kinases to the same degree. Furthermore, testing P12 in a DNA polymerase based assay we found that the 3'-5'-exonuclease part of the DNA polymerase (Klenow polymerase) was activated....

  16. Deoxyribonucleoside phosphoramidites.

    Science.gov (United States)

    Wilk, A; Grajkowski, A; Chmielewski, M K; Beaucage, S L; Phillips, L R

    2001-05-01

    The detailed preparation of deoxyribonucleoside phosphoramidites bearing a 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl group for P(III) protection is presented. The use of this group circumvents nucleobase alkylation during oligonucleotide deprotection. Two syntheses of phosphoramidites starting from either a phosphordichloridite precursor or a bis-(N,N-diisopropylamino)chlorophosphine intermediate are described for the phosphinylation of suitably protected deoxyribonucleosides.

  17. Animal deoxyribonucleoside kinases: 'forward' and 'retrograde' evolution of their substrate specificity

    DEFF Research Database (Denmark)

    Piskur, Jure; Sandrini, Michael; Knecht, Wolfgang;

    2004-01-01

    specificity. Recent studies suggest that in the animal lineage one of the brogenitor kinases, the so-called dCK/dGK/TK2-like gene, was duplicated prior to separation of the insect and mammalian lineages. Thereafter, insects lost all but one kinase, dNK (EC 2.7.1.145), which subsequently, through remodelling...

  18. Structure-function analysis of a bacterial deoxyadenosine kinase reveals the basis for substrate specificity.

    Science.gov (United States)

    Welin, Martin; Wang, Liya; Eriksson, Staffan; Eklund, Hans

    2007-03-01

    Deoxyribonucleoside kinases (dNKs) catalyze the transfer of a phosphoryl group from ATP to a deoxyribonucleoside (dN), a key step in DNA precursor synthesis. Recently structural information concerning dNKs has been obtained, but no structure of a bacterial dCK/dGK enzyme is known. Here we report the structure of such an enzyme, represented by deoxyadenosine kinase from Mycoplasma mycoides subsp. mycoides small colony type (Mm-dAK). Superposition of Mm-dAK with its human counterpart's deoxyguanosine kinase (dGK) and deoxycytidine kinase (dCK) reveals that the overall structures are very similar with a few amino acid alterations in the proximity of the active site. To investigate the substrate specificity, Mm-dAK has been crystallized in complex with dATP and dCTP, as well as the products dCMP and dCDP. Both dATP and dCTP bind to the enzyme in a feedback-inhibitory manner with the dN part in the deoxyribonucleoside binding site and the triphosphates in the P-loop. Substrate specificity studies with clinically important nucleoside analogs as well as several phosphate donors were performed. Thus, in this study we combine structural and kinetic data to gain a better understanding of the substrate specificity of the dCK/dGK family of enzymes. The structure of Mm-dAK provides a starting point for making new anti bacterial agents against pathogenic bacteria.

  19. Gene duplications and losses among vertebrate deoxyribonucleoside kinases of the non-TK1 Family

    DEFF Research Database (Denmark)

    Mutahir, Zeeshan; Christiansen, Louise Slot; Clausen, Anders R.;

    2016-01-01

    , among vertebrates only four mammalian dNKs have been studied for their substrate specificity and kinetic properties. However, some vertebrates, such as fish, frogs, and birds, apparently possess a duplicated homolog of deoxycytidine kinase (dCK). In this study, we characterized a family of d......CK/deoxyguanosine kinase (dGK)-like enzymes from a frog Xenopus laevis and a bird Gallus gallus. We showed that X. laevis has a duplicated dCK gene and a dGK gene, whereas G. gallus has a duplicated dCK gene but has lost the dGK gene. We cloned, expressed, purified, and subsequently determined the kinetic parameters...

  20. Bacterial Protein-Tyrosine Kinases

    DEFF Research Database (Denmark)

    Shi, Lei; Kobir, Ahasanul; Jers, Carsten

    2010-01-01

    phosphorylation. Protein-tyrosine phosphorylation in bacteria is particular with respect to very low occupancy of phosphorylation sites in vivo; this has represented a major challenge for detection techniques. Only the recent breakthroughs in gel-free high resolution mass spectrometry allowed the systematic...... and highlighted their importance in bacterial physiology. Having no orthologues in Eukarya, BY-kinases are receiving a growing attention from the biomedical field, since they represent a particularly promising target for anti-bacterial drug design....

  1. Isolation of a novel protein, P12-from adult Drosophila melanogaster that inhibits deoxyribonucleoside and protein kinase activities and activates 3'-5'- exonuclease activity

    DEFF Research Database (Denmark)

    Christiansen, Louise Slot; Zanten, Gabriella van; Berenstein, Dvora;

    2016-01-01

    Dm-dNK, however, capable to phosphorylate all four natural deoxyribonucleosides. Dm-dNK was originally isolated from an embryonic cell line. We wanted to study the expression of Dm-dNK during development from embryonic cells to adult flies and found declining Dm-dNK activity during development...... polymerase based assay we found that the 3'-5'-exonuclease part of the DNA polymerase (Klenow polymerase) was activated....

  2. Discovery of inhibitors of bacterial histidine kinases

    NARCIS (Netherlands)

    Velikova, N.R.

    2014-01-01

    Discovery of Inhibitors of Bacterial Histidine Kinases

    Summary

    The thesis is on novel antibacterial drug discovery (http://youtu.be/NRMWOGgeysM). Using structure-based and fragment-based dru

  3. Bacterial Histidine Kinases as Novel Antibacterial Drug Targets

    NARCIS (Netherlands)

    Bem, A.E.; Velikova, N.R.; Pellicer, M.T.; Baarlen, van P.; Marina, A.; Wells, J.M.

    2015-01-01

    Bacterial histidine kinases (HKs) are promising targets for novel antibacterials. Bacterial HKs are part of bacterial two-component systems (TCSs), the main signal transduction pathways in bacteria, regulating various processes including virulence, secretion systems and antibiotic resistance. In thi

  4. Thymidine kinases in archaea

    DEFF Research Database (Denmark)

    Clausen, A.R.; Matakos, A.; Sandrini, Michael;

    2006-01-01

    Twenty-six fully sequenced archaeal genomes were searched for genes coding for putative deoxyribonucleoside kinases (dNKs). We identified only 5 human-like thymidine kinase 1 genes (TK1s) and none for non-TK1 kinases. Four TK1s were identified in the Euryarchaea and one was found in the Crenarchaea...... that a functional deoxyribonucleoside salvage pathway is not crucial for the archaeal cell....

  5. Cross-phosphorylation of bacterial serine/threonine and tyrosine protein kinases on key regulatory residues

    Directory of Open Access Journals (Sweden)

    Lei eShi

    2014-09-01

    Full Text Available Bacteria possess protein serine/threonine and tyrosine kinases which resemble eukaryal kinases in their capacity to phosphorylate multiple substrates. We hypothesized that the analogy might extend further, and bacterial kinases may also undergo mutual phosphorylation and activation, which is currently considered as a hallmark of eukaryal kinase networks. In order to test this hypothesis, we explored the capacity of all members of four different classes of serine/threonine and tyrosine kinases present in the firmicute model organism Bacillus subtilis to phosphorylate each other in vitro and interact with each other in vivo. The interactomics data suggested a high degree of connectivity among all types of kinases, while phosphorylation assays revealed equally wide-spread cross-phosphorylation events. Our findings suggest that the Hanks-type kinases PrkC, PrkD and YabT exhibit the highest capacity to phosphorylate other B. subtilis kinases, while the BY-kinase PtkA and the two-component-like kinases RsbW and SpoIIAB show the highest propensity to be phosphorylated by other kinases. Analysis of phosphorylated residues on several selected recipient kinases suggests that most cross-phosphorylation events concern key regulatory residues. Therefore, cross-phosphorylation events are very likely to influence the capacity of recipient kinases to phosphorylate substrates downstream in the signal transduction cascade. We therefore conclude that bacterial serine/threonine and tyrosine kinases probably engage in a network-type behavior previously described only in eukaryal cells.

  6. Syntheses of aliphatic polycarbonates from 2'-deoxyribonucleosides.

    Science.gov (United States)

    Suzuki, Masato; Sekido, Toyokazu; Matsuoka, Shin-ichi; Takagi, Koji

    2011-05-01

    Poly(2'-deoxyadenosine) and poly(thymidine) constructed of carbonate linkages were synthesized by polycondensation between silyl ether and carbonylimidazolide at the 3'- and 5'-positions of the 2'-deoxyribonucleoside monomers. The N-benzoyl-2'-deoxyadenosine monomer afforded the corresponding polycarbonate together with the cyclic oligomers. However, the deprotection of the N-benzoyl group resulted in the scission of the polymer main chain. Thus, the N-unprotected 2'-deoxyadenosine monomers were examined for polycondensation. However, there was involved the undesired reaction between the adenine amino group and the carbonylimidazolide to form the carbamate linkage. In order to exclude this unfavorable reaction, dynamic protection was employed. Strong hydrogen bonding was used in place of the usual covalent bonding for reducing the nucleophilicity of the adenine amino group. Herein, 3',5'-O-diacylthymidines that form the complementary hydrogen bonding with the adenine amino group were added to the polymerization system of the N-unprotected 2'-deoxyadenosine monomer. Consequently, although the oligomers (M(n) = 1000-1500) were produced, the contents of the carbamate group were greatly reduced. The dynamic protection reagents were easily and quantitatively recovered as the MeOH soluble parts from the polymerization mixtures. In the polycondensation of the thymidine monomer, there tended to be involved another unfavorable reaction of carbonate exchange, which consequently formed the irregular carbonate linkages at not only the 3'-5' but also the 3'-3' and 5'-5' positions. Employing the well-designed monomer suppressed the carbonate exchange reaction to produce poly(thymidine) with the almost regular 3'-5'carbonate linkages.

  7. Structures of thymidine kinase 1 of human and mycoplasma origin

    DEFF Research Database (Denmark)

    Welin, Martin; Kosinska, Urszula; Mikkelsen, Nils-Egil;

    2004-01-01

    -structures at the root of a beta-ribbon that forms a stem that widens to a lasso type loop. The thymidine of dTTP is hydrogen bonded to main-chain atoms predominantly coming from the lasso loop. This is in contrast to other deoxyribonucleoside kinases where specific interactions occur with side chains. The TK1 structure...... differs fundamentally from the structures of the other deoxyribonucleoside kinases indicating a different evolutionary origin....

  8. Human biodistribution and radiation dosimetry of novel PET probes targeting the deoxyribonucleoside salvage pathway

    Energy Technology Data Exchange (ETDEWEB)

    Schwarzenberg, Johannes [David Geffen School of Medicine, University of California, Department of Molecular and Medical Pharmacology, Ahmanson Biological Imaging Division, Los Angeles, CA (United States); Medical University of Vienna, Department of Pediatrics, Vienna (Austria); Radu, Caius G.; Tran, Andrew Q.; Phelps, Michael E.; Satyamurthy, Nagichettiar [David Geffen School of Medicine, University of California, Department of Molecular and Medical Pharmacology, Crump Institute for Molecular Imaging, Los Angeles, CA (United States); Benz, Matthias; Fueger, Barbara; Czernin, Johannes; Schiepers, Christiaan [David Geffen School of Medicine, University of California, Department of Molecular and Medical Pharmacology, Ahmanson Biological Imaging Division, Los Angeles, CA (United States); Witte, Owen N. [David Geffen School of Medicine, University of California, Howard Hughes Medical Institute and Department of Microbiology, Immunology, and Molecular Genetics, Los Angeles, CA (United States)

    2011-04-15

    Deoxycytidine kinase (dCK) is a rate-limiting enzyme in deoxyribonucleoside salvage, a metabolic pathway involved in the production and maintenance of a balanced pool of deoxyribonucleoside triphosphates (dNTPs) for DNA synthesis. dCK phosphorylates and therefore activates nucleoside analogs such as cytarabine, gemcitabine, decitabine, cladribine, and clofarabine that are used routinely in cancer therapy. Imaging probes that target dCK might allow stratifying patients into likely responders and nonresponders with dCK-dependent prodrugs. Here we present the biodistribution and radiation dosimetry of three fluorinated dCK substrates, {sup 18}F-FAC, L-{sup 18}F-FAC, and L-{sup 18}F-FMAC, developed for positron emission tomography (PET) imaging of dCK activity in vivo. PET studies were performed in nine healthy human volunteers, three for each probe. After a transmission scan, the radiopharmaceutical was injected intravenously and three sequential emission scans acquired from the base of the skull to mid-thigh. Regions of interest encompassing visible organs were drawn on the first PET scan and copied to the subsequent scans. Activity in target organs was determined and absorbed dose estimated with OLINDA/EXM. The standardized uptake value was calculated for various organs at different times. Renal excretion was common to all three probes. Bone marrow had higher uptake for L-{sup 18}F-FAC and L-{sup 18}F-FMAC than {sup 18}F-FAC. Prominent liver uptake was seen in L-{sup 18}F-FMAC and L-{sup 18}F-FAC, whereas splenic activity was highest for {sup 18}F-FAC. Muscle uptake was also highest for {sup 18}F-FAC. The critical organ was the bladder wall for all three probes. The effective dose was 0.00524, 0.00755, and 0.00910 mSv/MBq for {sup 18}F-FAC, L-{sup 18}F-FAC, and L-{sup 18}F-FMAC, respectively. The biodistribution of {sup 18}F-FAC, L-{sup 18}F-FAC, and L-{sup 18}F-FMAC in humans reveals similarities and differences. Differences may be explained by different probe

  9. Role of eukaryotic-like serine/threonine kinases in bacterial cell division and morphogenesis.

    Science.gov (United States)

    Manuse, Sylvie; Fleurie, Aurore; Zucchini, Laure; Lesterlin, Christian; Grangeasse, Christophe

    2016-01-01

    Bacteria possess a repertoire of versatile protein kinases modulating diverse aspects of their physiology by phosphorylating proteins on various amino acids including histidine, cysteine, aspartic acid, arginine, serine, threonine and tyrosine. One class of membrane serine/threonine protein kinases possesses a catalytic domain sharing a common fold with eukaryotic protein kinases and an extracellular mosaic domain found in bacteria only, named PASTA for 'Penicillin binding proteins And Serine/Threonine kinase Associated'. Over the last decade, evidence has been accumulating that these protein kinases are involved in cell division, morphogenesis and developmental processes in Firmicutes and Actinobacteria. However, observations differ from one species to another suggesting that a general mechanism of activation of their kinase activity is unlikely and that species-specific regulation of cell division is at play. In this review, we survey the latest research on the structural aspects and the cellular functions of bacterial serine/threonine kinases with PASTA motifs to illustrate the diversity of the regulatory mechanisms controlling bacterial cell division and morphogenesis.

  10. Genomics, evolution, and crystal structure of a new family of bacterial spore kinases

    OpenAIRE

    2009-01-01

    Bacterial spore formation is a complex process of fundamental relevance to biology and human disease. The spore coat structure is complex and poorly understood, and the roles of many of the protein components remain unclear. We describe a new family of spore coat proteins, the bacterial spore kinases (BSKs), and the first crystal structure of a BSK, YtaA (CotI) from Bacillus subtilis. BSKs are widely distributed in spore-forming Bacillus and Clostridium species, and have a dynamic evolutionar...

  11. Cell fate regulation governed by a repurposed bacterial histidine kinase.

    Directory of Open Access Journals (Sweden)

    W Seth Childers

    2014-10-01

    Full Text Available One of the simplest organisms to divide asymmetrically is the bacterium Caulobacter crescentus. The DivL pseudo-histidine kinase, positioned at one cell pole, regulates cell-fate by controlling the activation of the global transcription factor CtrA via an interaction with the response regulator (RR DivK. DivL uniquely contains a tyrosine at the histidine phosphorylation site, and can achieve these regulatory functions in vivo without kinase activity. Determination of the DivL crystal structure and biochemical analysis of wild-type and site-specific DivL mutants revealed that the DivL PAS domains regulate binding specificity for DivK∼P over DivK, which is modulated by an allosteric intramolecular interaction between adjacent domains. We discovered that DivL's catalytic domains have been repurposed as a phosphospecific RR input sensor, thereby reversing the flow of information observed in conventional histidine kinase (HK-RR systems and coupling a complex network of signaling proteins for cell-fate regulation.

  12. Chemical phosphorylation of deoxyribonucleosides and thermolytic DNA oligonucleotides.

    Science.gov (United States)

    Ausín, Cristina; Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L

    2006-10-01

    The phosphorylating reagent bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite is prepared in three steps from commercial methyl thioglycolate and diisopropylphosphoramidous dichloride. The phosphorylating reagent has been used successfully in the solid-phase synthesis of deoxyribonucleoside 5'-/3'-phosphate or -thiophosphate monoesters and oligonucleotide 5'-phosphate/-thiophosphate monoesters. Bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite has also been employed in the construction of a thermolytic dinucleotide prodrug model to evaluate the ability of the reagent to produce thermosentive oligonucleotide prodrugs under mild temperature conditions ( approximately 25 degrees C) for potential therapeutic applications.

  13. A novel quantitative kinase assay using bacterial surface display and flow cytometry.

    Directory of Open Access Journals (Sweden)

    Sónia Troeira Henriques

    Full Text Available The inhibition of tyrosine kinases is a successful approach for the treatment of cancers and the discovery of kinase inhibitor drugs is the focus of numerous academic and pharmaceutical laboratories. With this goal in mind, several strategies have been developed to measure kinase activity and to screen novel tyrosine kinase inhibitors. Nevertheless, a general non-radioactive and inexpensive approach, easy to implement and adapt to a range of applications, is still missing. Herein, using Bcr-Abl tyrosine kinase, an oncogenic target and a model protein for cancer studies, we describe a novel cost-effective high-throughput screening kinase assay. In this approach, named the BacKin assay, substrates displayed on a Bacterial cell surface are incubated with Kinase and their phosphorylation is examined and quantified by flow cytometry. This approach has several advantages over existing approaches, as using bacteria (i.e. Escherichia coli to display peptide substrates provides a self renewing solid support that does not require laborious chemical strategies. Here we show that the BacKin approach can be used for kinetic and mechanistic studies, as well as a platform to characterize and identify small-molecule or peptide-based kinase inhibitors with potential applications in drug development.

  14. Jun N-Terminal Protein Kinase Enhances Middle Ear Mucosal Proliferation during Bacterial Otitis Media▿

    Science.gov (United States)

    Furukawa, Masayuki; Ebmeyer, Jörg; Pak, Kwang; Austin, Darrell A.; Melhus, Åsa; Webster, Nicholas J. G.; Ryan, Allen F.

    2007-01-01

    Mucosal hyperplasia is a characteristic component of otitis media. The present study investigated the participation of signaling via the Jun N-terminal protein kinase (JNK) mitogen-activated protein kinase in middle ear mucosal hyperplasia in animal models of bacterial otitis media. Otitis media was induced by the inoculation of nontypeable Haemophilus influenzae into the middle ear cavity. Western blotting revealed that phosphorylation of JNK isoforms in the middle ear mucosa preceded but paralleled mucosal hyperplasia in this in vivo rat model. Nuclear JNK phosphorylation was observed in many cells of both the mucosal epithelium and stroma by immunohistochemistry. In an in vitro model of primary rat middle ear mucosal explants, bacterially induced mucosal growth was blocked by the Rac/Cdc42 inhibitor Clostridium difficile toxin B, the mixed-lineage kinase inhibitor CEP11004, and the JNK inhibitor SP600125. Finally, the JNK inhibitor SP600125 significantly inhibited mucosal hyperplasia during in vivo bacterial otitis media in guinea pigs. Inhibition of JNK in vivo resulted in a diminished proliferative response, as shown by a local decrease in proliferating cell nuclear antigen protein expression by immunohistochemistry. We conclude that activation of JNK is a critical pathway for bacterially induced mucosal hyperplasia during otitis media, influencing tissue proliferation. PMID:17325051

  15. Thermolytic carbonates for potential 5'-hydroxyl protection of deoxyribonucleosides.

    Science.gov (United States)

    Chmielewski, Marcin K; Marchán, Vicente; Cieślak, Jacek; Grajkowski, Andrzej; Livengood, Victor; Münch, Ursula; Wilk, Andrzej; Beaucage, Serge L

    2003-12-26

    Thermolytic groups structurally related to well-studied heat-sensitive phosphate/thiophosphate protecting groups have been evaluated for 5'-hydroxyl protection of deoxyribonucleosides as carbonates and for potential use in solid-phase oligonucleotide synthesis. The spatial arrangement of selected functional groups forming an asymmetric nucleosidic 5'-O-carbonic acid ester has been designed to enable heat-induced cyclodecarbonation reactions, which would result in the release of carbon dioxide and the generation of a nucleosidic 5'-hydroxyl group. The nucleosidic 5'-O-carbonates 3-8, 10-15, and 19-21 were prepared and were isolated in yields ranging from 45 to 83%. Thermolytic deprotection of these carbonates is preferably performed in aqueous organic solvent at 90 degrees C under near neutral conditions. The rates of carbonate deprotection are dependent on the nucleophilicity of the functional group involved in the postulated cyclodecarbonation reaction and on solvent polarity. Deprotection kinetics increase according to the following order: 4 < 5 < 10 < 6 < 12 < 7 < 13 < 8 < 14 congruent with 19-21 and CCl4 < dioxane < MeCN < t-BuOH < MeCN:phosphate buffer (3:1 v/v, pH 7.0) < EtOH:phosphate buffer (1:1 v/v, pH 7.0). Complete thermolytic deprotection of carbonates 7, 8, 13, and 14 is achieved within 20 min to 2 h under optimal conditions in phosphate buffer-MeCN. The 2-(2-pyridyl)amino-1-phenylethyl and 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups are particularly promising for 5'-hydroxyl protection of deoxyribonucleosides as thermolytic carbonates.

  16. Autophosphorylation of the Bacterial Tyrosine-Kinase CpsD Connects Capsule Synthesis with the Cell Cycle in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Nourikyan, Julien; Kjos, Morten; Mercy, Chryslène; Cluzel, Caroline; Morlot, Cécile; Noirot-Gros, Marie-Francoise; Guiral, Sébastien; Lavergne, Jean-Pierre; Veening, Jan-Willem; Grangeasse, Christophe

    2015-01-01

    Bacterial capsular polysaccharides (CPS) are produced by a multi-protein membrane complex, in which a particular type of tyrosine-autokinases named BY-kinases, regulate their polymerization and export. However, our understanding of the role of BY-kinases in these processes remains incomplete. In the

  17. Genomics, evolution, and crystal structure of a new family of bacterial spore kinases.

    Science.gov (United States)

    Scheeff, Eric D; Axelrod, Herbert L; Miller, Mitchell D; Chiu, Hsiu-Ju; Deacon, Ashley M; Wilson, Ian A; Manning, Gerard

    2010-05-01

    Bacterial spore formation is a complex process of fundamental relevance to biology and human disease. The spore coat structure is complex and poorly understood, and the roles of many of the protein components remain unclear. We describe a new family of spore coat proteins, the bacterial spore kinases (BSKs), and the first crystal structure of a BSK, YtaA (CotI) from Bacillus subtilis. BSKs are widely distributed in spore-forming Bacillus and Clostridium species, and have a dynamic evolutionary history. Sequence and structure analyses indicate that the BSKs are CAKs, a prevalent group of small molecule kinases in bacteria that is distantly related to the eukaryotic protein kinases. YtaA has substantial structural similarity to CAKs, but also displays distinctive features that broaden our understanding of the CAK group. Evolutionary constraint analysis of the protein surfaces indicates that members of the BSK family have distinct clade-conserved patterns in the substrate binding region, and probably bind and phosphorylate distinct targets. Several classes of BSKs have apparently independently lost catalytic activity to become pseudokinases, indicating that the family also has a major noncatalytic function.

  18. The assembly of a GTPase–kinase signalling complex by a bacterial catalytic scaffold

    Science.gov (United States)

    Selyunin, Andrey S.; Sutton, Sarah E.; Weigele, Bethany A.; Reddick, L. Evan; Orchard, Robert C.; Bresson, Stefan M.; Tomchick, Diana R.; Alto, Neal M.

    2011-01-01

    The fidelity and specificity of information flow within a cell is controlled by scaffolding proteins that assemble and link enzymes into signalling circuits1,2. These circuits can be inhibited by bacterial effector proteins that post-translationally modify individual pathway components3–6. However, there is emerging evidence that pathogens directly organize higher-order signalling networks through enzyme scaffolding7,8, and the identity of the effectors and their mechanisms of action are poorly understood. Here we identify the enterohaemorrhagic Escherichia coli O157:H7 type III effector EspG as a regulator of endomembrane trafficking using a functional screen, and report ADP-ribosylation factor (ARF) GTPases and p21-activated kinases (PAKs) as its relevant host substrates. The 2.5 Å crystal structure of EspG in complex with ARF6 shows how EspG blocks GTPase-activating-protein-assisted GTP hydrolysis, revealing a potent mechanism of GTPase signalling inhibition at organelle membranes. In addition, the 2.8 Å crystal structure of EspG in complex with the autoinhibitory Iα3-helix of PAK2 defines a previously unknown catalytic site in EspG and provides an allosteric mechanism of kinase activation by a bacterial effector. Unexpectedly, ARF and PAKs are organized on adjacent surfaces of EspG, indicating its role as a ‘catalytic scaffold’ that effectively reprograms cellular events through the functional assembly of GTPase-kinase signalling complex. PMID:21170023

  19. Structure of Arabidopsis thaliana 5-methylthioribose Kinase Reveals a More Occluded Active Site Than its Bacterial Homolog

    Energy Technology Data Exchange (ETDEWEB)

    Ku,S.; Cornell, K.; Howell, P.

    2007-01-01

    Metabolic variations exist between the methionine salvage pathway of humans and a number of plants and microbial pathogens. 5-Methylthioribose (MTR) kinase is a key enzyme required for methionine salvage in plants and many bacteria. The absence of a mammalian homolog suggests that MTR kinase is a good target for the design of specific herbicides or antibiotics. The structure of Arabidopsis thaliana MTR kinase co-crystallized with ATP?S and MTR has been determined at 1.9 Angstroms resolution. The structure is similar to B. subtilis MTR kinase and has the same protein kinase fold observed in other evolutionarily related protein kinase-like phosphotransferases. The active site is comparable between the two enzymes with the DXE-motif coordinating the nucleotide-Mg, the D238 of the HGD catalytic loop polarizing the MTR O1 oxygen, and the RR-motif interacting with the substrate MTR. Unlike its bacterial homolog, however, the Gly-rich loop (G-loop) of A. thaliana MTR kinase has an extended conformation, which shields most of the active site from solvent, a feature that resembles eukaryotic protein kinases more than the bacterial enzyme. The G- and W-loops of A. thaliana and B. subtilis MTR kinase adopt different conformations despite high sequence similarity. The ATP?S analog was hydrolyzed during the co-crystallization procedure, resulting in ADP in the active site. This suggests that the A. thaliana enzyme, like its bacterial homolog, may have significant ATPase activity in the absence of MTR. The structure of A. thaliana MTR kinase provides a template for structure-based design of agrochemicals, particularly herbicides whose effectiveness could be regulated by nutrient levels. Features of the MTR binding site offer an opportunity for a simple organic salt of an MTR analog to specifically inhibit MTR kinase.

  20. 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.

    Science.gov (United States)

    Marchán, Vicente; Cieślak, Jacek; Livengood, Victor; Beaucage, Serge L

    2004-08-11

    Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.

  1. Receptor interacting protein kinase-2 inhibition by CYLD impairs anti-bacterial immune responses in macrophages

    Directory of Open Access Journals (Sweden)

    Katharina eWex

    2016-01-01

    Full Text Available Upon infection with intracellular bacteria, nucleotide oligomerization domain protein 2 (NOD2 recognizes bacterial muramyl dipeptide and binds, subsequently, to receptor-interacting serine/threonine kinase 2 (RIPK2. RIPK2 mediates the activation of immune responses via the nuclear factor-κB (NF-κB and extracellular-signal regulated kinase (ERK pathways. Previously, it has been shown that RIPK2 activation dependens on its K63-ubiquitination by the E3 ligases pellino-3 and ITCH, whereas the deubiquitinating enzyme A20 counter-regulates RIPK2 activity by cleaving K63-polyubiquitin chains from RIPK2. Here, we newly identify the deubiquitinating enzyme CYLD as a new interacting partner and inhibitor of RIPK2. We show that CYLD binds to and removes K63-polyubiquitin chains from RIPK2 in Listeria monocytogenes (Lm infected bone-marrow-derived macrophages (BMDM. CYLD-mediated K63-deubiquitination of RIPK2 resulted in an impaired activation of both NF-κB and ERK1/2 pathways, reduced production of proinflammatory cytokines (IL-6, IL-12, anti-listerial ROS and NO, and, finally, impaired pathogen control. In turn, RIPK2 inhibition by siRNA prevented activation of NF-κB and ERK1/2 and completely abolished the protective effect of CYLD-deficiency with respect to the production of IL-6, NO, ROS and pathogen control. Noteworthy, CYLD also inhibited autophagy of Listeria in a RIPK2-ERK1/2 dependent manner.The protective function of CYLD-deficiency was dependent on IFN-γ pre-stimulation of infected macrophages. Interestingly, the reduced NF-κB activation in CYLD-expressing macrophages limited the protective effect of IFN-γ by reducing NF-κB-dependent STAT1 activation. Taken together, our study identifies CYLD as an important inhibitor of RIPK2-dependent anti-bacterial immune responses in macrophages.

  2. Elevation of serum thymidine kinase 1 in a bacterial infection: canine pyometra.

    Science.gov (United States)

    Sharif, H; Hagman, R; Wang, L; Eriksson, S

    2013-01-01

    Pyometra is a bacterial infection of the uterus that is common in dogs and is potentially life-threatening if delayed in diagnosis and/or treatment. Thymidine kinase 1 (TK1) is a cytosolic enzyme involved in DNA precursor synthesis, and it is also present in serum from patients with malignant diseases. TK1 has been used as a cell proliferation biomarker for many years in human medicine and recently in dogs. However, little is known regarding serum TK1 levels in individuals with bacterial infection. The objective of this study was to determine the activity of serum TK1 in dogs with pyometra and compare it with hematologic and biochemical parameters, e.g., acute phase proteins and inflammatory mediators such as C-reactive protein and Prostaglandin F(2α). Serum and plasma TK1 activity of 40 healthy female dogs and 54 dogs with pyometra were analyzed using an optimized [(3)H]-thymidine phosphorylation assay. TK1 activities in serum or plasma were significantly higher in dogs with pyometra as compared with healthy female dogs (mean ± SD: 4.0 ± 7.3 pmol/min/mL in the pyometra group and 1.07 ± 0.34 pmol/min/mL in healthy control group). However, there was no difference in TK1 activity between systemic inflammatory response syndrome (SIRS) positive (n = 38) and SIRS negative (n = 16) pyometra cases. Furthermore, the plasma TK1 activity decreased in six and increased in one pyometra patients (n = 10), 24 h after ovariohysterectomy. No significant correlations (P > 0.05) were found between TK1 activity and hematological or other biochemical parameters. In conclusion, the TK1 activity was significantly elevated in dogs with pyometra. Further studies are needed to evaluate the mechanism and role of serum TK1 activity in bacterial infections and its possible diagnostic or prognostic value.

  3. One-pot microbial synthesis of 2'-deoxyribonucleoside from glucose, acetaldehyde, and a nucleobase.

    Science.gov (United States)

    Horinouchi, Nobuyuki; Ogawa, Jun; Kawano, Takako; Sakai, Takafumi; Saito, Kyota; Matsumoto, Seiichiro; Sasaki, Mie; Mikami, Yoichi; Shimizu, Sakayu

    2006-06-01

    A one-pot enzymatic synthesis of 2'-deoxyribonucleoside from glucose, acetaldehyde, and a nucleobase was established. Glycolysis by baker's yeast (Saccharomyces cerevisiae) generated ATP which was used to produce D: -glyceraldehyde 3-phosphate production from glucose via fructose 1,6-diphosphate. The D: -glyceraldehyde 3-phosphate produced was transformed to 2'-deoxyribonucleoside via 2-deoxyribose 5-phosphate and then 2-deoxyribose 1-phosphate in the presence of acetaldehyde and a nucleobase by deoxyriboaldolase, phosphopentomutase expressed in Escherichia coli, and a commercial nucleoside phosphorylase. About 33 mM 2'-deoxyinosine was produced from 600 mM glucose, 333 mM acetaldehyde and 100 mM adenine in 24 h. 2'-Deoxyinosine was produced from adenine due to the adenosine deaminase activity of E. coli transformants.

  4. An efficient reagent for the phosphorylation of deoxyribonucleosides, DNA oligonucleotides, and their thermolytic analogues.

    Science.gov (United States)

    Ausín, Cristina; Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L

    2005-09-15

    [reaction: see text] The phosphoramidite 11 was prepared in three steps from methyl 2-mercaptoacetate and demonstrated efficiency in the synthesis of conventional 5'-/3'-phosphate/thiophosphate monoester derivatives of 2'-deoxyribonucleosides and DNA oligonucleotides. Moreover, the use of 11 has enabled the preparation of the dinucleoside phosphorothioate analogue 26 in high yields (>95%) with minimal cleavage (<2%) of the thermolytic thiophosphate protecting group.

  5. Opa+ Neisseria gonorrhoeae exhibits reduced survival in human neutrophils via Src family kinase-mediated bacterial trafficking into mature phagolysosomes.

    Science.gov (United States)

    Johnson, M Brittany; Ball, Louise M; Daily, Kylene P; Martin, Jennifer N; Columbus, Linda; Criss, Alison K

    2015-05-01

    During gonorrhoeal infection, there is a heterogeneous population of Neisseria gonorrhoeae (Gc) varied in their expression of opacity-associated (Opa) proteins. While Opa proteins are important for bacterial attachment and invasion of epithelial cells, Opa+ Gc has a survival defect after exposure to neutrophils. Here, we use constitutively Opa- and OpaD+ Gc in strain background FA1090 to show that Opa+ Gc is more sensitive to killing inside adherent, chemokine-treated primary human neutrophils due to increased bacterial residence in mature, degradative phagolysosomes that contain primary and secondary granule antimicrobial contents. Although Opa+ Gc stimulates a potent oxidative burst, neutrophil killing of Opa+ Gc was instead attributable to non-oxidative components, particularly neutrophil proteases and the bactericidal/permeability-increasing protein. Blocking interaction of Opa+ Gc with carcinoembryonic antigen-related cell adhesion molecules (CEACAMs) or inhibiting Src family kinase signalling, which is downstream of CEACAM activation, enhanced the survival of Opa+ Gc in neutrophils. Src family kinase signalling was required for fusion of Gc phagosomes with primary granules to generate mature phagolysosomes. Conversely, ectopic activation of Src family kinases or coinfection with Opa+ Gc resulted in decreased survival of Opa- Gc in neutrophils. From these results, we conclude that Opa protein expression is an important modulator of Gc survival characteristics in neutrophils by influencing phagosome dynamics and thus bacterial exposure to neutrophils' full antimicrobial arsenal.

  6. Mutation Study of Two Thymidine Kinases 

    DEFF Research Database (Denmark)

    Skovgaard, Tine; Munch-Petersen, Birgitte; Eklund, Hans

    that phosphorylates all the natural deoxyribonucleosides and like insects, C. elegans only contains a single deoxyribonucleoside kinase-like gene. In contrast to the insects, however, the protein encoded by the elegans gene is 46 % identical to human TK1 (HuTK1) and have no homology to the insect kinase. Like HuTK1...... the C. elegans kinase (CeTK1) has thymidine as the preferred substrate, but it also displays activity with deoxyguanosine, though with high Km. A number of point mutations have been introduced in the active site of both the human and elegans TK's in order to change the substrate specificity away from...... not phosphorylate the anticancer analog 1-β-D-arabinofuranosylcytosine (AraC), however. The HuTK1 mutant has been crystallized, and azidothymidine monophosphate has been modelled into the active site....

  7. Drosophila deoxyribonucleoside kinase mutants with enhanced ability to phosphorylate purine analogs

    DEFF Research Database (Denmark)

    Knecht, Wolfgang; Rozpedowska, E.; Le Breton, C.;

    2007-01-01

    ability to phosphorylate pyrimidines, while the ability to phosphorylate purine analogs was relatively similar to the wild-type enzyme. We selected two mutants, for expression in the osteosarcoma 143B, the glioblastoma U-87M-G and the breast cancer MCF7 cell lines. The sensitivities of the transduced cell...

  8. Gene duplications and losses among vertebrate deoxyribonucleoside kinases of the non-TK1 Family

    DEFF Research Database (Denmark)

    Mutahir, Zeeshan; Christiansen, Louise Slot; Clausen, Anders R.;

    2016-01-01

    of the dCK/dGK enzymes encoded by these genes. The two dCK enzymes in G. gallus have broader substrate specificity than their human or X. laevis counterparts. Additionally, the duplicated dCK enzyme in G. gallus might have become mitochondria. Based on our study we postulate that changing and adapting...... substrate specificities and subcellular localization are likely the drivers behind the evolution of vertebrate dNKs...

  9. Comparative active-site mutation study of human and Caenorhabditis elegans thymidine kinase 1

    DEFF Research Database (Denmark)

    Skovgaard, Tine; Uhlin, Ulla; Munch-Petersen, Birgitte

    2012-01-01

    The first step for the intracellular retention of several anticancer or antiviral nucleoside analogues is the addition of a phosphate group catalysed by a deoxyribonucleoside kinase such as thymidine kinase 1 (TK1). Recently, human TK1 (HuTK1) has been crystallized and characterized using different...... surrounding the substrate base. In CeTK1, some of these mutations led to increased activity with deoxycytidine and deoxyguanosine, two unusual substrates for TK1-like kinases. In HuTK1, mutation of T163 to S resulted in a kinase with a 140-fold lower K(m) for the antiviral nucleoside analogue 3'-azido-3...

  10. Autophosphorylation of the Bacterial Tyrosine-Kinase CpsD Connects Capsule Synthesis with the Cell Cycle in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Julien Nourikyan

    2015-09-01

    Full Text Available Bacterial capsular polysaccharides (CPS are produced by a multi-protein membrane complex, in which a particular type of tyrosine-autokinases named BY-kinases, regulate their polymerization and export. However, our understanding of the role of BY-kinases in these processes remains incomplete. In the human pathogen Streptococcus pneumoniae, the BY-kinase CpsD localizes at the division site and participates in the proper assembly of the capsule. In this study, we show that the cytoplasmic C-terminal end of the transmembrane protein CpsC is required for CpsD autophosphorylation and localization at mid-cell. Importantly, we demonstrate that the CpsC/CpsD complex captures the polysaccharide polymerase CpsH at the division site. Together with the finding that capsule is not produced at the division site in cpsD and cpsC mutants, these data show that CPS production occurs exclusively at mid-cell and is tightly dependent on CpsD interaction with CpsC. Next, we have analyzed the impact of CpsD phosphorylation on CPS production. We show that dephosphorylation of CpsD induces defective capsule production at the septum together with aberrant cell elongation and nucleoid defects. We observe that the cell division protein FtsZ assembles and localizes properly although cell constriction is impaired. DAPI staining together with localization of the histone-like protein HlpA further show that chromosome replication and/or segregation is defective suggesting that CpsD autophosphorylation interferes with these processes thus resulting in cell constriction defects and cell elongation. We show that CpsD shares structural homology with ParA-like ATPases and that it interacts with the chromosome partitioning protein ParB. Total internal reflection fluorescence microscopy imaging demonstrates that CpsD phosphorylation modulates the mobility of ParB. These data support a model in which phosphorylation of CpsD acts as a signaling system coordinating CPS synthesis with

  11. Synthesis of 2,6-disubstituted pyridin-3-yl C-2'-deoxyribonucleosides through chemoselective transformations of bromo-chloropyridine C-nucleosides.

    Science.gov (United States)

    Kubelka, Tomáš; Slavětínská, Lenka; Eigner, Václav; Hocek, Michal

    2013-07-28

    2-Bromo-6-chloro- and 6-bromo-2-chloropyridin-3-yl deoxyribonucleosides were prepared by the Heck coupling of bromo-chloro-iodopyridines with TBS-protected deoxyribose glycal. Some of their Pd-catalyzed cross-coupling reactions proceeded chemoselectively at the position of the bromine, whereas nucleophilic substitutions were unselective and gave mixtures of products. The mono-substituted intermediates were used for another coupling or nucleophilic substitution giving rise to a small library of title 2,6-disubstituted pyridine C-deoxyribonucleosides. The title nucleosides did not exert antiviral or cytostatic effects.

  12. Identification of a Potent Allosteric Inhibitor of Human Protein Kinase CK2 by Bacterial Surface Display Library Screening.

    Science.gov (United States)

    Nienberg, Christian; Garmann, Claudia; Gratz, Andreas; Bollacke, Andre; Götz, Claudia; Jose, Joachim

    2017-01-05

    Human protein kinase CK2 has emerged as promising target for the treatment of neoplastic diseases. The vast majority of kinase inhibitors known today target the ATP binding site, which is highly conserved among kinases and hence leads to limited selectivity. In order to identify non-ATP competitive inhibitors, a 12-mer peptide library of 6 × 10⁵ variants was displayed on the surface of E. coli by autodisplay. Screening of this peptide library on variants with affinity to CK2 was performed by fluorophore-conjugated CK2 and subsequent flow cytometry. Single cell sorting of CK2-bound E. coli yielded new peptide variants, which were tested on inhibition of CK2 by a CE-based assay. Peptide B2 (DCRGLIVMIKLH) was the most potent inhibitor of both, CK2 holoenzyme and the catalytic CK2α subunit (IC50 = 0.8 µM). Using different ATP concentrations and different substrate concentrations for IC50 determination, B2 was shown to be neither ATP- nor substrate competitive. By microscale thermophoresis (MST) the KD value of B2 with CK2α was determined to be 2.16 µM, whereas no binding of B2 to CK2β-subunit was detectable. To our surprise, besides inhibition of enzymatic activity, B2 also disturbed the interaction of CK2α with CK2β at higher concentrations (≥25 µM).

  13. Identification of a Potent Allosteric Inhibitor of Human Protein Kinase CK2 by Bacterial Surface Display Library Screening

    Directory of Open Access Journals (Sweden)

    Christian Nienberg

    2017-01-01

    Full Text Available Human protein kinase CK2 has emerged as promising target for the treatment of neoplastic diseases. The vast majority of kinase inhibitors known today target the ATP binding site, which is highly conserved among kinases and hence leads to limited selectivity. In order to identify non-ATP competitive inhibitors, a 12-mer peptide library of 6 × 105 variants was displayed on the surface of E. coli by autodisplay. Screening of this peptide library on variants with affinity to CK2 was performed by fluorophore-conjugated CK2 and subsequent flow cytometry. Single cell sorting of CK2-bound E. coli yielded new peptide variants, which were tested on inhibition of CK2 by a CE-based assay. Peptide B2 (DCRGLIVMIKLH was the most potent inhibitor of both, CK2 holoenzyme and the catalytic CK2α subunit (IC50 = 0.8 µM. Using different ATP concentrations and different substrate concentrations for IC50 determination, B2 was shown to be neither ATP- nor substrate competitive. By microscale thermophoresis (MST the KD value of B2 with CK2α was determined to be 2.16 µM, whereas no binding of B2 to CK2β-subunit was detectable. To our surprise, besides inhibition of enzymatic activity, B2 also disturbed the interaction of CK2α with CK2β at higher concentrations (≥25 µM.

  14. 7-Methylbenz(a)anthracene deoxyribonucleoside products isolated from DNA after metabolism of the carcinogen by rat liver microsomes in the presence of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, M.H.; Osborne, M.R.; King, H.W.S.; Brookes, P.

    1976-07-01

    Metabolism of 7-methylbenz(a)anthracene (7MeBA) by 3-methylcholanthrene-induced rat liver microsomes in the presence of added native or denatured DNA resulted in covalent binding of the hydrocarbon to the nucleic acid. Enzymatic degradation and column chromatographic fractionation showed that the hydrocarbon-deoxyribonucleoside products were separable from the products similarly obtained from DNA having 7MeBA bound following treatment of mouse embryo cells in culture with this hydrocarbon. Comparison of the microsome catalyzed hydrocarbon-deoxyribonucleoside products with those obtained by reaction with DNA of 7MeBA-5,6-oxide suggested that this K-region epoxide made a significant contribution to the liver microsome-induced DNA binding.

  15. Binding of Mn-deoxyribonucleoside Triphosphates to the Active Site of the DNA Polymerase of Bacteriophage T7

    Energy Technology Data Exchange (ETDEWEB)

    B Akabayov; C Richardson

    2011-12-31

    Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstrate that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.

  16. Co-expression of bacterial aspartate kinase and adenylylsulfate reductase genes substantially increases sulfur amino acid levels in transgenic alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Tong, Zongyong; Xie, Can; Ma, Lei; Liu, Liping; Jin, Yongsheng; Dong, Jiangli; Wang, Tao

    2014-01-01

    Alfalfa (Medicago sativa L.) is one of the most important forage crops used to feed livestock, such as cattle and sheep, and the sulfur amino acid (SAA) content of alfalfa is used as an index of its nutritional value. Aspartate kinase (AK) catalyzes the phosphorylation of aspartate to Asp-phosphate, the first step in the aspartate family biosynthesis pathway, and adenylylsulfate reductase (APR) catalyzes the conversion of activated sulfate to sulfite, providing reduced sulfur for the synthesis of cysteine, methionine, and other essential metabolites and secondary compounds. To reduce the feedback inhibition of other metabolites, we cloned bacterial AK and APR genes, modified AK, and introduced them into alfalfa. Compared to the wild-type alfalfa, the content of cysteine increased by 30% and that of methionine increased substantially by 60%. In addition, a substantial increase in the abundance of essential amino acids (EAAs), such as aspartate and lysine, was found. The results also indicated a close connection between amino acid metabolism and the tricarboxylic acid (TCA) cycle. The total amino acid content and the forage biomass tested showed no significant changes in the transgenic plants. This approach provides a new method for increasing SAAs and allows for the development of new genetically modified crops with enhanced nutritional value.

  17. Functional role of pyruvate kinase from Lactobacillus bulgaricus in acid tolerance and identification of its transcription factor by bacterial one-hybrid.

    Science.gov (United States)

    Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling

    2015-11-19

    Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5'-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5'-TGTAAGCCCTAACA-3') upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network.

  18. Anti-bacterial and Anti-biofilm Evaluation of Thiazolopyrimidinone Derivatives Targeting the Histidine Kinase YycG Protein of Staphylococcus epidermidis

    Science.gov (United States)

    Lv, Zhihui; Zhao, Dan; Chang, Jun; Liu, Huayong; Wang, Xiaofei; Zheng, Jinxin; Huang, Renzheng; Lin, Zhiwei; Shang, Yongpeng; Ye, Lina; Wu, Yang; Han, Shiqing; Qu, Di

    2017-01-01

    Staphylococcus epidermidis is one of the most important opportunistic pathogens in nosocomial infections. The main pathogenicity associated with S. epidermidis involves the formation of biofilms on implanted medical devices, biofilms dramatically decrease the efficacy of conventional antibiotics and the host immune system. This emphasizes the urgent need for designing novel anti-staphylococcal biofilm agents. Based on the findings that compound 5, targeting the histidine kinase domain of S. epidermidis YycG, possessed bactericidal activity against staphylococci, 39 derivatives of compound 5 with intact thiazolopyrimidinone core structures were newly designed, 7 derivatives were further screened to explore their anti-bacterial and anti-biofilm activities. The seven derivatives strongly inhibited the growth of S. epidermidis and Staphylococcus aureus in the minimal inhibitory concentration range of 1.56–6.25 μM. All the derivatives reduced the proportion of viable cells in mature biofilms. They all displayed low cytotoxicity on mammalian cells and were not hemolytic to human erythrocytes. The biofilm inhibition activities of four derivatives (H5-32, H5-33, H5-34, and H5-35) were further investigated under shearing forces, they all led to significant decreases in the biofilm formation of S. epidermidis. These results were suggestive that the seven derivatives of compound 5 have the potential to be developed into agents for eradicating biofilm-associated infections.

  19. Direct assignment of the absolute configuration of a distinct class of deoxyribonucleoside cyclic N-acylphosphoramidites at phosphorus by M-GOESY nuclear magnetic resonance spectroscopy.

    Science.gov (United States)

    Wilk, Andrzej; Grajkowski, Andrzej; Bull, Thomas E; Dixon, Ann M; Freedberg, Darón I; Beaucage, Serge L

    2002-02-20

    The determination of the absolute configuration of deoxyribonucleoside cyclic N-acylphosphoramidites at phosphorus toward the synthesis of P-stereodifined phosphorothioated oligodeoxyribonucleotides is easily accomplished with computer-assisted molecular modeling and M-GOESY NMR spectroscopy. Specifically, computer-modeling diasteromeric phosphoramidite 3 has identifed a proximal (2.55 A) through-space interaction between benzylic H-5 and sugar H-2' ', which can predictably be detected by M-GOESY NMR in SP-3 but not in RP-3 because of being too distant (5.85 A). Consistent with computer-assisted modeling predictions, M-GOESY NMR spectra of SP-3 and RP-3 revealed NOE signals generated from nuclei near the selectively excited H-2' ' that are common to both SP-3 and RP-3, namely those of H-2', H-4', H-3', and H-1'. In addition, a diagnostic NOE signal at 5.5 ppm (benzylic H-5) is, as predicted, only detected in SP-3 and thus provides an unequivocal assessment of the configuration of the diastereomer at phosphorus. M-GOESY NMR data also confirm that the condensation of deoxyribonucleoside cyclic N-acylphosphoramidites with base-activated nucleosidic or nucleotidic 5'-hydroxyls proceeds via a single nucleophilic event.

  20. RpkA, a highly conserved GPCR with a lipid kinase domain, has a role in phagocytosis and anti-bacterial defense.

    Directory of Open Access Journals (Sweden)

    Tanja Y Riyahi

    Full Text Available RpkA (Receptor phosphatidylinositol kinase A is an unusual seven-helix transmembrane protein of Dictyostelium discoideum with a G protein coupled receptor (GPCR signature and a C-terminal lipid kinase domain (GPCR-PIPK predicted as a phosphatidylinositol-4-phosphate 5-kinase. RpkA-homologs are present in all so far sequenced Dictyostelidae as well as in several other lower eukaryotes like the oomycete Phytophthora, and in the Legionella host Acanthamoeba castellani. Here we show by immunofluorescence that RpkA localizes to endosomal membranes and is specifically recruited to phagosomes. RpkA interacts with the phagosomal protein complex V-ATPase as proteins of this complex co-precipitate with RpkA-GFP as well as with the GST-tagged PIPK domain of RpkA. Loss of RpkA leads to a defect in phagocytosis as measured by yeast particle uptake. The uptake of the pathogenic bacterium Legionella pneumophila was however unaltered whereas its intra-cellular replication was significantly enhanced in rpkA(-. The difference between wild type and rpkA(- was even more prominent when L. hackeliae was used. When we investigated the reason for the enhanced susceptibility for L. pneumophila of rpkA(- we could not detect a difference in endosomal pH but rpkA(- showed depletion of phosphoinositides (PIP and PIP(2 when we compared metabolically labeled phosphoinositides from wild type and rpkA(-. Furthermore rpkA(- exhibited reduced nitrogen starvation tolerance, an indicator for a reduced autophagy rate. Our results indicate that RpkA is a component of the defense system of D. discoideum as well as other lower eukaryotes.

  1. The immune receptor NOD1 and kinase RIP2 interact with bacterial peptidoglycan on early endosomes to promote autophagy and inflammatory signaling.

    Science.gov (United States)

    Irving, Aaron T; Mimuro, Hitomi; Kufer, Thomas A; Lo, Camden; Wheeler, Richard; Turner, Lorinda J; Thomas, Belinda J; Malosse, Christian; Gantier, Michael P; Casillas, Linda N; Votta, Bartholomew J; Bertin, John; Boneca, Ivo G; Sasakawa, Chihiro; Philpott, Dana J; Ferrero, Richard L; Kaparakis-Liaskos, Maria

    2014-05-14

    The intracellular innate immune receptor NOD1 detects Gram-negative bacterial peptidoglycan (PG) to induce autophagy and inflammatory responses in host cells. To date, the intracellular compartment in which PG is detected by NOD1 and whether NOD1 directly interacts with PG are two questions that remain to be resolved. To address this, we used outer membrane vesicles (OMVs) from pathogenic bacteria as a physiological mechanism to deliver PG into the host cell cytosol. We report that OMVs induced autophagosome formation and inflammatory IL-8 responses in epithelial cells in a NOD1- and RIP2-dependent manner. PG contained within OMVs colocalized with both NOD1 and RIP2 in EEA1-positive early endosomes. Further, we provide evidence for direct interactions between NOD1 and PG. Collectively, these findings demonstrate that NOD1 detects PG within early endosomes, thereby promoting RIP2-dependent autophagy and inflammatory signaling in response to bacterial infection.

  2. Phosphorylation of bacterial-type phosphoenolpyruvate carboxylase by a Ca2+-dependent protein kinase suggests a link between Ca2+ signalling and anaplerotic pathway control in developing castor oil seeds.

    Science.gov (United States)

    Hill, Allyson T; Ying, Sheng; Plaxton, William C

    2014-02-15

    The aim of the present study was to characterize the native protein kinase [BTPC (bacterial-type phosphoenolpyruvate carboxylase)-K (BTPC Ser451 kinase)] that in vivo phosphorylates Ser451 of the BTPC subunits of an unusual Class-2 PEP (phosphoenolpyruvate) carboxylase hetero-octameric complex of developing COS (castor oil seeds). COS BTPC-K was highly purified by PEG fractionation and hydrophobic size-exclusion anion-exchange and affinity chromatographies. BTPC-K phosphorylated BTPC strictly at Ser451 (Km=1.0 μM; pH optimum=7.3), a conserved target residue occurring within an intrinsically disordered region, as well as the protein histone III-S (Km=1.7 μM), but not a COS plant-type PEP carboxylase or sucrose synthase or α-casein. Its activity was Ca2+- (K0.5=2.7 μM) and ATP- (Km=6.6 μM) dependent, and markedly inhibited by trifluoperazine, 3-phosphoglycerate and PEP, but insensitive to calmodulin or 14-3-3 proteins. BTPC-K exhibited a native molecular mass of ~63 kDa and was soluble rather than membrane-bound. Inactivation and reactivation occurred upon BTPC-K's incubation with GSSG and then DTT respectively. Ser451 phosphorylation by BTPC-K inhibited BTPC activity by ~50% when assayed under suboptimal conditions (pH 7.3, 1 mM PEP and 10 mM L-malate). Our collective results indicate a possible link between cytosolic Ca2+ signalling and anaplerotic flux control in developing COS.

  3. Substrate Specificity of the Bacillus subtilis BY-Kinase PtkA Is Controlled by Alternative Activators: TkmA and SalA

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Shi, Lei; Kalantari, Aida;

    2016-01-01

    Bacterial protein-tyrosine kinases (BY-kinases) are known to regulate different aspects of bacterial physiology, by phosphorylating cellular protein substrates. Physiological cues that trigger BY-kinases activity are largely unexplored. In Proteobacteria, BY-kinases contain a cytosol-exposed cata...

  4. Thymidine kinase diversity in bacteria

    DEFF Research Database (Denmark)

    Sandrini, Michael; Clausen, A.R.; Munch-Petersen, B.

    2006-01-01

    Thymidine kinases (TKs) appear to be almost ubiquitous and are found in nearly all prokaryotes, eukaryotes, and several viruses. They are the key enzymes in thymidine salvage and activation of several anti-cancer and antiviral drugs. We show that bacterial TKs can be subdivided into 2 groups. The....... The TKs from Gram-positive bacteria are more closely related to the eukaryotic TK1 enzymes than are TKs from Gram-negative bacteria....

  5. Casein kinases

    DEFF Research Database (Denmark)

    Issinger, O G

    1993-01-01

    subunits are highly conserved during evolution. The relationship between CK-2 alpha from humans and plants is still 73%. Similar relationships are reported for the beta-subunit. Chromosomal assignment of CK-2 alpha shows two gene loci, one of which is a pseudogene. They are located on different chromosomes......, no genetic changes are necessarily involved; the observed changes may be entirely due to a signal transduction pathway where CK-2 could be phosphorylated by another kinase(s). CK-2 cDNAs from various organisms have been isolated and characterized. From the deduced amino acid sequence it turns out that CK-2......-subunit affecting: (i) stability, (ii) enzyme specificity and (iii) enzyme activity. The question where CK-2 and its subunits are located throughout the cell cycle has also been addressed, mainly because of the large discrepancies that still exist between results obtained by different investigators. Tissue...

  6. Bacterial Vaginosis

    Science.gov (United States)

    ... Issues > Conditions > Sexually Transmitted > Bacterial Vaginosis Health Issues Listen Español Text Size Email Print Share Bacterial Vaginosis Page Content Bacterial vaginosis (BV) is the most common vaginal infection in sexually active teenaged girls . It appears to be caused by ...

  7. New Variants of Tomato Thymidine Kinase 1 Selected for Increased Sensitivity of E. coli KY895 towards Azidothymidine

    Energy Technology Data Exchange (ETDEWEB)

    Slot Christiansen, Louise [Department of Biology, Lund University, Lund 22362 (Sweden); Lund Protein Production Platform, Lund University, Lund 22362 (Sweden); Egeblad, Louise [Lund Protein Production Platform, Lund University, Lund 22362 (Sweden); Munch-Petersen, Birgitte [Department of Science, Systems and Models, Roskilde University, Roskilde 4000 (Denmark); Piškur, Jure [Department of Biology, Lund University, Lund 22362 (Sweden); Knecht, Wolfgang, E-mail: Louise.Slot_Christiansen@biol.lu.se [Department of Biology, Lund University, Lund 22362 (Sweden); Lund Protein Production Platform, Lund University, Lund 22362 (Sweden)

    2015-06-08

    Nucleoside analogues (NA) are prodrugs that are phosphorylated by deoxyribonucleoside kinases (dNKs) as the first step towards a compound toxic to the cell. During the last 20 years, research around dNKs has gone into new organisms other than mammals and viruses. Newly discovered dNKs have been tested as enzymes for suicide gene therapy. The tomato thymidine kinase 1 (ToTK1) is a dNK that has been selected for its in vitro kinetic properties and then successfully been tested in vivo for the treatment of malignant glioma. We present the selection of two improved variants of ToTK1 generated by random protein engineering for suicide gene therapy with the NA azidothymidine (AZT). We describe their selection, recombinant production and a subsequent kinetic and biochemical characterization. Their improved performance in killing of E. coli KY895 is accompanied by an increase in specificity for the NA AZT over the natural substrate thymidine as well as a decrease in inhibition by dTTP, the end product of the nucleoside salvage pathway for thymidine. The understanding of the enzymatic properties improving the variants efficacy is instrumental to further develop dNKs for use in suicide gene therapy.

  8. Regulation of tomato Prf by Pto-like protein kinases.

    Science.gov (United States)

    Mucyn, Tatiana S; Wu, Ai-Jiuan; Balmuth, Alexi L; Arasteh, Julia Maryam; Rathjen, John P

    2009-04-01

    Tomato Prf encodes a nucleotide-binding domain shared by Apaf-1, certain R proteins, and CED-4 fused to C-terminal leucine-rich repeats (NBARC-LRR) protein that is required for bacterial immunity to Pseudomonas syringae and sensitivity to the organophosphate fenthion. The signaling pathways involve two highly related protein kinases. Pto kinase mediates direct recognition of the bacterial effector proteins AvrPto or AvrPtoB. Fen kinase is required for fenthion sensitivity and recognition of bacterial effectors related to AvrPtoB. The role of Pto and its association with Prf has been characterized but Fen is poorly described. We show that, similar to Pto, Fen requires N-myristoylation and kinase activity for signaling and interacts with the N-terminal domain of Prf. Thus, the mechanisms of activation of Prf by the respective protein kinases are similar. Prf-Fen interaction is underlined by coregulatory mechanisms in which Prf negatively regulates Fen, most likely by controlling kinase activity. We further characterized negative regulation of Prf by Pto, and show that regulation is mediated by the previously described negative regulatory patch. Remarkably, the effectors released negative regulation of Prf in a manner dependent on Pto kinase activity. The data suggest a model in which Prf associates generally with Pto-like kinases in tightly regulated complexes, which are activated by effector-mediated disruption of negative regulation. Release of negative regulation may be a general feature of activation of NBARC-LRR proteins by cognate effectors.

  9. Bacterial gastroenteritis

    Science.gov (United States)

    Bacterial gastroenteritis is present when bacteria cause an infection of the stomach and intestines ... has not been treated Many different types of bacteria can cause ... Campylobacter jejuni E coli Salmonella Shigella Staphylococcus ...

  10. Significance of Creatine Kinase Brain Isoenzyme Concentration in Cerebrospinal Fluid with bacterial meningitis%小儿神经系统感染中测定激酸磷酸激酶的意义

    Institute of Scientific and Technical Information of China (English)

    熊顺军; 王红玲; 张渝侯

    2001-01-01

    测定了怀疑为中枢神经系统感染的85例患儿脑脊液中CK-BB浓度。其中,经确诊无中枢神经系统感染患儿17例,病毒性脑膜脑炎患儿36例,细菌性脑膜炎患儿32例。以上病例均常规作脑脊液检查,同时留取3毫升脑脊液作CK-BB浓度测定。结果显示,脑脊液中CK-BB可作为鉴别细菌性脑膜炎和病毒性脑膜脑炎的一项可靠指标。%Activity of CK-BB in cerebrospinal was determined in 85 children as soon as CNS infection was suspected. 17 cases was normal 36 cases with viral meningitis was diagnosed 32 cases was diagnosed with bacterial meningitis. Routine analysis of CSF was performed. When 3ml CSF was available for analysis of CK-BB activity. The data suggest the possibility of utilizing CSF CK-BB activity to differentiate between bacterial and viral meningitis in situations where a routine CSF examination is inconclusive.

  11. Using bacteria to determine protein kinase specificity and predict target substrates.

    Directory of Open Access Journals (Sweden)

    Michael F Chou

    Full Text Available The identification of protein kinase targets remains a significant bottleneck for our understanding of signal transduction in normal and diseased cellular states. Kinases recognize their substrates in part through sequence motifs on substrate proteins, which, to date, have most effectively been elucidated using combinatorial peptide library approaches. Here, we present and demonstrate the ProPeL method for easy and accurate discovery of kinase specificity motifs through the use of native bacterial proteomes that serve as in vivo libraries for thousands of simultaneous phosphorylation reactions. Using recombinant kinases expressed in E. coli followed by mass spectrometry, the approach accurately recapitulated the well-established motif preferences of human basophilic (Protein Kinase A and acidophilic (Casein Kinase II kinases. These motifs, derived for PKA and CK II using only bacterial sequence data, were then further validated by utilizing them in conjunction with the scan-x software program to computationally predict known human phosphorylation sites with high confidence.

  12. CMP kinase from Escherichia coli is structurally related to other nucleoside monophosphate kinases.

    Science.gov (United States)

    Bucurenci, N; Sakamoto, H; Briozzo, P; Palibroda, N; Serina, L; Sarfati, R S; Labesse, G; Briand, G; Danchin, A; Bărzu, O; Gilles, A M

    1996-02-02

    CMP kinase from Escherichia coli is a monomeric protein of 225 amino acid residues. The protein exhibits little overall sequence similarities with other known NMP kinases. However, residues involved in binding of substrates and/or in catalysis were found conserved, and sequence comparison suggested conservation of the global fold found in adenylate kinases or in several CMP/UMP kinases. The enzyme was purified to homogeneity, crystallized, and analyzed for its structural and catalytic properties. The crystals belong to the hexagonal space group P6(3), have unit cell parameters a = b = 82.3 A and c = 60.7 A, and diffract x-rays to a 1.9 A resolution. The bacterial enzyme exhibits a fluorescence emission spectrum with maximum at 328 nm upon excitation at 295 nm, which suggests that the single tryptophan residue (Trp30) is located in a hydrophobic environment. Substrate specificity studies showed that CMP kinase from E. coli is active with ATP, dATP, or GTP as donors and with CMP, dCMP, and arabinofuranosyl-CMP as acceptors. This is in contrast with CMP/UMP kinase from Dictyostelium discoideum, an enzyme active on CMP or UMP but much less active on the corresponding deoxynucleotides. Binding of CMP enhanced the affinity of E. coli CMP kinase for ATP or ADP, a particularity never described in this family of proteins that might explain inhibition of enzyme activity by excess of nucleoside monophosphate.

  13. Biological phosphorylation of an Unnatural Base Pair (UBP) using a Drosophila melanogaster deoxynucleoside kinase (DmdNK) mutant

    Science.gov (United States)

    Daugherty, Ashley B.; Yang, Zunyi; Shaw, Ryan; Dong, Mengxing; Lutz, Stefan; Benner, Steven A.

    2017-01-01

    One research goal for unnatural base pair (UBP) is to replicate, transcribe and translate them in vivo. Accordingly, the corresponding unnatural nucleoside triphosphates must be available at sufficient concentrations within the cell. To achieve this goal, the unnatural nucleoside analogues must be phosphorylated to the corresponding nucleoside triphosphates by a cascade of three kinases. The first step is the monophosphorylation of unnatural deoxynucleoside catalyzed by deoxynucleoside kinases (dNK), which is generally considered the rate limiting step because of the high specificity of dNKs. Here, we applied a Drosophila melanogaster deoxyribonucleoside kinase (DmdNK) to the phosphorylation of an UBP (a pyrimidine analogue (6-amino-5-nitro-3-(1’-b-d-2’-deoxyribofuranosyl)-2(1H)-pyridone, Z) and its complementary purine analogue (2-amino-8-(1’-b-d-2’-deoxyribofuranosyl)-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one, P). The results showed that DmdNK could efficiently phosphorylate only the dP nucleoside. To improve the catalytic efficiency, a DmdNK-Q81E mutant was created based on rational design and structural analyses. This mutant could efficiently phosphorylate both dZ and dP nucleoside. Structural modeling indicated that the increased efficiency of dZ phosphorylation by the DmdNK-Q81E mutant might be related to the three additional hydrogen bonds formed between E81 and the dZ base. Overall, this study provides a groundwork for the biological phosphorylation and synthesis of unnatural base pair in vivo. PMID:28323896

  14. Bacterial Adhesion & Blocking Bacterial Adhesion

    DEFF Research Database (Denmark)

    Vejborg, Rebecca Munk

    2008-01-01

    tract to the microbial flocs in waste water treatment facilities. Microbial biofilms may however also cause a wide range of industrial and medical problems, and have been implicated in a wide range of persistent infectious diseases, including implantassociated microbial infections. Bacterial adhesion...... is the first committing step in biofilm formation, and has therefore been intensely scrutinized. Much however, still remains elusive. Bacterial adhesion is a highly complex process, which is influenced by a variety of factors. In this thesis, a range of physico-chemical, molecular and environmental parameters......, which influence the transition from a planktonic lifestyle to a sessile lifestyle, have been studied. Protein conditioning film formation was found to influence bacterial adhesion and subsequent biofilm formation considerable, and an aqueous extract of fish muscle tissue was shown to significantly...

  15. Bacterial lipases

    NARCIS (Netherlands)

    Jaeger, Karl-Erich; Ransac, Stéphane; Dijkstra, Bauke W.; Colson, Charles; Heuvel, Margreet van; Misset, Onno

    1994-01-01

    Many different bacterial species produce lipases which hydrolyze esters of glycerol with preferably long-chain fatty acids. They act at the interface generated by a hydrophobic lipid substrate in a hydrophilic aqueous medium. A characteristic property of lipases is called interfacial activation, mea

  16. Bacterial Ecology

    DEFF Research Database (Denmark)

    Fenchel, Tom

    2011-01-01

    Bacterial ecology is concerned with the interactions between bacteria and their biological and nonbiological environments and with the role of bacteria in biogeochemical element cycling. Many fundamental properties of bacteria are consequences of their small size. Thus, they can efficiently exploit...

  17. [Bacterial vaginosis].

    Science.gov (United States)

    Romero Herrero, Daniel; Andreu Domingo, Antonia

    2016-07-01

    Bacterial vaginosis (BV) is the main cause of vaginal dysbacteriosis in the women during the reproductive age. It is an entity in which many studies have focused for years and which is still open for discussion topics. This is due to the diversity of microorganisms that cause it and therefore, its difficult treatment. Bacterial vaginosis is probably the result of vaginal colonization by complex bacterial communities, many of them non-cultivable and with interdependent metabolism where anaerobic populations most likely play an important role in its pathogenesis. The main symptoms are an increase of vaginal discharge and the unpleasant smell of it. It can lead to serious consequences for women, such as an increased risk of contracting sexually transmitted infections including human immunodeficiency virus and upper genital tract and pregnancy complications. Gram stain is the gold standard for microbiological diagnosis of BV, but can also be diagnosed using the Amsel clinical criteria. It should not be considered a sexually transmitted disease but it is highly related to sex. Recurrence is the main problem of medical treatment. Apart from BV, there are other dysbacteriosis less characterized like aerobic vaginitis of which further studies are coming slowly but are achieving more attention and consensus among specialists.

  18. Muscle phosphorylase kinase deficiency

    DEFF Research Database (Denmark)

    Preisler, N; Orngreen, M C; Echaniz-Laguna, A;

    2012-01-01

    To examine metabolism during exercise in 2 patients with muscle phosphorylase kinase (PHK) deficiency and to further define the phenotype of this rare glycogen storage disease (GSD).......To examine metabolism during exercise in 2 patients with muscle phosphorylase kinase (PHK) deficiency and to further define the phenotype of this rare glycogen storage disease (GSD)....

  19. Kinome profiling of Arabidopsis using arrays of kinase consensus substrates

    Directory of Open Access Journals (Sweden)

    Pieterse Corné MJ

    2007-02-01

    Full Text Available Abstract Background Kinome profiling aims at the parallel analysis of kinase activities in a cell. Novel developed arrays containing consensus substrates for kinases are used to assess those kinase activities. The arrays described in this paper were already used to determine kinase activities in mammalian systems, but since substrates from many organisms are present we decided to test these arrays for the determination of kinase activities in the model plant species Arabidopsis thaliana. Results Kinome profiling using Arabidopsis cell extracts resulted in the labelling of many consensus peptides by kinases from the plant, indicating the usefulness of this kinome profiling tool for plants. Method development showed that fresh and frozen plant material could be used to make cell lysates containing active kinases. Dilution of the plant extract increased the signal to noise ratio and non-radioactive ATP enhances full development of spot intensities. Upon infection of Arabidopsis with an avirulent strain of the bacterial pathogen Pseudomonas syringae pv. tomato, we could detect differential kinase activities by measuring phosphorylation of consensus peptides. Conclusion We show that kinome profiling on arrays with consensus substrates can be used to monitor kinase activities in plants. In a case study we show that upon infection with avirulent P. syringae differential kinase activities can be found. The PepChip can for example be used to purify (unknown kinases that play a role in P. syringae infection. This paper shows that kinome profiling using arrays of consensus peptides is a valuable new tool to study signal-transduction in plants. It complements the available methods for genomics and proteomics research.

  20. Creatine kinase in the serum of patients with acute infections of the central nervous system

    DEFF Research Database (Denmark)

    Peterslund, N A; Heinsvig, E M; Christensen, K D

    1985-01-01

    Serum creatine kinase was assessed in 94 consecutive patients without convulsions admitted to hospital due to suspicion of infection of the central nervous system. No reliable discrimination between patients with aseptic and those with bacterial meningitis was obtained. Patients with bacterial...

  1. Bacterial hydrodynamics

    CERN Document Server

    Lauga, Eric

    2015-01-01

    Bacteria predate plants and animals by billions of years. Today, they are the world's smallest cells yet they represent the bulk of the world's biomass, and the main reservoir of nutrients for higher organisms. Most bacteria can move on their own, and the majority of motile bacteria are able to swim in viscous fluids using slender helical appendages called flagella. Low-Reynolds-number hydrodynamics is at the heart of the ability of flagella to generate propulsion at the micron scale. In fact, fluid dynamic forces impact many aspects of bacteriology, ranging from the ability of cells to reorient and search their surroundings to their interactions within mechanically and chemically-complex environments. Using hydrodynamics as an organizing framework, we review the biomechanics of bacterial motility and look ahead to future challenges.

  2. Mutational analysis of UMP kinase from Escherichia coli.

    Science.gov (United States)

    Bucurenci, N; Serina, L; Zaharia, C; Landais, S; Danchin, A; Bârzu, O

    1998-02-01

    UMP kinase from Escherichia coli is one of the four regulatory enzymes involved in the de novo biosynthetic pathway of pyrimidine nucleotides. This homohexamer, with no counterpart in eukarya, might serve as a target for new antibacterial drugs. Although the bacterial enzyme does not show sequence similarity with any other known nucleoside monophosphate kinase, two segments between amino acids 35 to 78 and 145 to 194 exhibit 28% identity with phosphoglycerate kinase and 30% identity with aspartokinase, respectively. Based on these similarities, a number of residues of E. coli UMP kinase were selected for site-directed mutagenesis experiments. Biochemical, kinetic, and spectroscopic analysis of the modified proteins identified residues essential for catalysis (Asp146), binding of UMP (Asp174), and interaction with the allosteric effectors, GTP and UTP (Arg62 and Asp77).

  3. Studying Kinetochore Kinases

    NARCIS (Netherlands)

    Saurin, Adrian T; Kops, Geert J P L

    2016-01-01

    Mitotic kinetochores are signaling network hubs that regulate chromosome movements, attachment error-correction, and the spindle assembly checkpoint. Key switches in these networks are kinases and phosphatases that enable rapid responses to changing conditions. Describing the mechanisms and dynamics

  4. Multiple host kinases contribute to Akt activation during Salmonella infection.

    Science.gov (United States)

    Roppenser, Bernhard; Kwon, Hyunwoo; Canadien, Veronica; Xu, Risheng; Devreotes, Peter N; Grinstein, Sergio; Brumell, John H

    2013-01-01

    SopB is a type 3 secreted effector with phosphatase activity that Salmonella employs to manipulate host cellular processes, allowing the bacteria to establish their intracellular niche. One important function of SopB is activation of the pro-survival kinase Akt/protein kinase B in the infected host cell. Here, we examine the mechanism of Akt activation by SopB during Salmonella infection. We show that SopB-mediated Akt activation is only partially sensitive to PI3-kinase inhibitors LY294002 and wortmannin in HeLa cells, suggesting that Class I PI3-kinases play only a minor role in this process. However, depletion of PI(3,4) P2/PI(3-5) P3 by expression of the phosphoinositide 3-phosphatase PTEN inhibits Akt activation during Salmonella invasion. Therefore, production of PI(3,4) P2/PI(3-5) P3 appears to be a necessary event for Akt activation by SopB and suggests that non-canonical kinases mediate production of these phosphoinositides during Salmonella infection. We report that Class II PI3-kinase beta isoform, IPMK and other kinases identified from a kinase screen all contribute to Akt activation during Salmonella infection. In addition, the kinases required for SopB-mediated activation of Akt vary depending on the type of infected host cell. Together, our data suggest that Salmonella has evolved to use a single effector, SopB, to manipulate a remarkably large repertoire of host kinases to activate Akt for the purpose of optimizing bacterial replication in its host.

  5. Multiple host kinases contribute to Akt activation during Salmonella infection.

    Directory of Open Access Journals (Sweden)

    Bernhard Roppenser

    Full Text Available SopB is a type 3 secreted effector with phosphatase activity that Salmonella employs to manipulate host cellular processes, allowing the bacteria to establish their intracellular niche. One important function of SopB is activation of the pro-survival kinase Akt/protein kinase B in the infected host cell. Here, we examine the mechanism of Akt activation by SopB during Salmonella infection. We show that SopB-mediated Akt activation is only partially sensitive to PI3-kinase inhibitors LY294002 and wortmannin in HeLa cells, suggesting that Class I PI3-kinases play only a minor role in this process. However, depletion of PI(3,4 P2/PI(3-5 P3 by expression of the phosphoinositide 3-phosphatase PTEN inhibits Akt activation during Salmonella invasion. Therefore, production of PI(3,4 P2/PI(3-5 P3 appears to be a necessary event for Akt activation by SopB and suggests that non-canonical kinases mediate production of these phosphoinositides during Salmonella infection. We report that Class II PI3-kinase beta isoform, IPMK and other kinases identified from a kinase screen all contribute to Akt activation during Salmonella infection. In addition, the kinases required for SopB-mediated activation of Akt vary depending on the type of infected host cell. Together, our data suggest that Salmonella has evolved to use a single effector, SopB, to manipulate a remarkably large repertoire of host kinases to activate Akt for the purpose of optimizing bacterial replication in its host.

  6. Bacterial vaginosis -- aftercare

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000687.htm Bacterial vaginosis - aftercare To use the sharing features on this ... to back after you use the bathroom. Preventing Bacterial Vaginosis You can help prevent bacterial vaginosis by: Not ...

  7. Pregnancy Complications: Bacterial Vaginosis

    Science.gov (United States)

    ... Complications & Loss > Pregnancy complications > Bacterial vaginosis and pregnancy Bacterial vaginosis and pregnancy E-mail to a friend Please ... this page It's been added to your dashboard . Bacterial vaginosis (also called BV or vaginitis) is an infection ...

  8. Wzy-dependent bacterial capsules as potential drug targets.

    Science.gov (United States)

    Ericsson, Daniel J; Standish, Alistair; Kobe, Bostjan; Morona, Renato

    2012-10-01

    The bacterial capsule is a recognized virulence factor in pathogenic bacteria. It likely works as an antiphagocytic barrier by minimizing complement deposition on the bacterial surface. With the continual rise of bacterial pathogens resistant to multiple antibiotics, there is an increasing need for novel drugs. In the Wzy-dependent pathway, the biosynthesis of capsular polysaccharide (CPS) is regulated by a phosphoregulatory system, whose main components consist of bacterial-tyrosine kinases (BY-kinases) and their cognate phosphatases. The ability to regulate capsule biosynthesis has been shown to be vital for pathogenicity, because different stages of infection require a shift in capsule thickness, making the phosphoregulatory proteins suitable as drug targets. Here, we review the role of regulatory proteins focusing on Streptococcus pneumoniae, Staphylococcus aureus, and Escherichia coli and discuss their suitability as targets in structure-based drug design.

  9. Enterococcus faecalis phosphomevalonate kinase.

    Science.gov (United States)

    Doun, Stephanie S; Burgner, John W; Briggs, Scott D; Rodwell, Victor W

    2005-05-01

    The six enzymes of the mevalonate pathway of isopentenyl diphosphate biosynthesis represent potential for addressing a pressing human health concern, the development of antibiotics against resistant strains of the Gram-positive streptococci. We previously characterized the first four of the mevalonate pathway enzymes of Enterococcus faecalis, and here characterize the fifth, phosphomevalonate kinase (E.C. 2.7.4.2). E. faecalis genomic DNA and the polymerase chain reaction were used to clone DNA thought to encode phosphomevalonate kinase into pET28b(+). Double-stranded DNA sequencing verified the sequence of the recombinant gene. The encoded N-terminal hexahistidine-tagged protein was expressed in Escherichia coli with induction by isopropylthiogalactoside and purified by Ni(++) affinity chromatography, yield 20 mg protein per liter. Analysis of the purified protein by MALDI-TOF mass spectrometry established it as E. faecalis phosphomevalonate kinase. Analytical ultracentrifugation revealed that the kinase exists in solution primarily as a dimer. Assay for phosphomevalonate kinase activity used pyruvate kinase and lactate dehydrogenase to couple the formation of ADP to the oxidation of NADH. Optimal activity occurred at pH 8.0 and at 37 degrees C. The activation energy was approximately 5.6 kcal/mol. Activity with Mn(++), the preferred cation, was optimal at about 4 mM. Relative rates using different phosphoryl donors were 100 (ATP), 3.6 (GTP), 1.6 (TTP), and 0.4 (CTP). K(m) values were 0.17 mM for ATP and 0.19 mM for (R,S)-5-phosphomevalonate. The specific activity of the purified enzyme was 3.9 micromol substrate converted per minute per milligram protein. Applications to an immobilized enzyme bioreactor and to drug screening and design are discussed.

  10. CK (Creatine Kinase) Test

    Science.gov (United States)

    ... Infections – viral (such as influenza and HIV ), bacterial , fungal , and parasitic (such as malaria ) Connective tissue disorders (e.g. lupus , rheumatoid arthritis ) Celiac disease Renal failure In critically ill patients ...

  11. Plant phosphatidylinositol 3-kinase

    NARCIS (Netherlands)

    Lee, Y.; Munnik, T.; Munnik, T.

    2010-01-01

    Phosphatidylinositol 3-kinase (PI3K) phosphorylates the D-3 position of phosphoinositides. In Arabidopsis, only one PI3K exists, which belongs to the class-III PI3K subfamily which makes phosphatidylinositol 3-phosphate (PtdIns3P). The single AtPI3K gene is essential for survival, since loss of its

  12. Selective pharmacologic inhibition of a PASTA kinase increases Listeria monocytogenes susceptibility to β-lactam antibiotics.

    Science.gov (United States)

    Pensinger, Daniel A; Aliota, Matthew T; Schaenzer, Adam J; Boldon, Kyle M; Ansari, Israr-ul H; Vincent, William J B; Knight, Benjamin; Reniere, Michelle L; Striker, Rob; Sauer, John-Demian

    2014-08-01

    While β-lactam antibiotics are a critical part of the antimicrobial arsenal, they are frequently compromised by various resistance mechanisms, including changes in penicillin binding proteins of the bacterial cell wall. Genetic deletion of the penicillin binding protein and serine/threonine kinase-associated protein (PASTA) kinase in methicillin-resistant Staphylococcus aureus (MRSA) has been shown to restore β-lactam susceptibility. However, the mechanism remains unclear, and whether pharmacologic inhibition would have the same effect is unknown. In this study, we found that deletion or pharmacologic inhibition of the PASTA kinase in Listeria monocytogenes by the nonselective kinase inhibitor staurosporine results in enhanced susceptibility to both aminopenicillin and cephalosporin antibiotics. Resistance to vancomycin, another class of cell wall synthesis inhibitors, or antibiotics that inhibit protein synthesis was unaffected by staurosporine treatment. Phosphorylation assays with purified kinases revealed that staurosporine selectively inhibited the PASTA kinase of L. monocytogenes (PrkA). Importantly, staurosporine did not inhibit a L. monocytogenes kinase without a PASTA domain (Lmo0618) or the PASTA kinase from MRSA (Stk1). Finally, inhibition of PrkA with a more selective kinase inhibitor, AZD5438, similarly led to sensitization of L. monocytogenes to β-lactam antibiotics. Overall, these results suggest that pharmacologic targeting of PASTA kinases can increase the efficacy of β-lactam antibiotics.

  13. Tyrosine kinases in rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Kobayashi Akiko

    2011-08-01

    Full Text Available Abstract Rheumatoid arthritis (RA is an inflammatory, polyarticular joint disease. A number of cellular responses are involved in the pathogenesis of rheumatoid arthritis, including activation of inflammatory cells and cytokine expression. The cellular responses involved in each of these processes depends on the specific signaling pathways that are activated; many of which include protein tyrosine kinases. These pathways include the mitogen-activated protein kinase pathway, Janus kinases/signal transducers and activators transcription pathway, spleen tyrosine kinase signaling, and the nuclear factor κ-light-chain-enhancer of activated B cells pathway. Many drugs are in development to target tyrosine kinases for the treatment of RA. Based on the number of recently published studies, this manuscript reviews the role of tyrosine kinases in the pathogenesis of RA and the potential role of kinase inhibitors as new therapeutic strategies of RA.

  14. Enterococcus faecalis phosphomevalonate kinase

    OpenAIRE

    Doun, Stephanie S.; Burgner, John W.; Briggs, Scott D.; Rodwell, Victor W.

    2005-01-01

    The six enzymes of the mevalonate pathway of isopentenyl diphosphate biosynthesis represent potential for addressing a pressing human health concern, the development of antibiotics against resistant strains of the Gram-positive streptococci. We previously characterized the first four of the mevalonate pathway enzymes of Enterococcus faecalis, and here characterize the fifth, phosphomevalonate kinase (E.C. 2.7.4.2). E. faecalis genomic DNA and the polymerase chain reaction were used to clone D...

  15. Oncoprotein protein kinase

    Energy Technology Data Exchange (ETDEWEB)

    Karin, Michael (San Diego, CA); Hibi, Masahiko (San Diego, CA); Lin, Anning (La Jolla, CA); Davis, Roger (Princeton, MA); Derijard, Benoit (Shrewsbury, MA)

    2003-02-04

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  16. Regulation of Autophagy by Kinases

    Energy Technology Data Exchange (ETDEWEB)

    Sridharan, Savitha; Jain, Kirti; Basu, Alakananda, E-mail: alakananda.basu@unthsc.edu [Department of Molecular Biology and Immunology, Institute for Cancer Research, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States)

    2011-06-09

    Autophagy is a process of self-degradation that maintains cellular viability during periods of metabolic stress. Although autophagy is considered a survival mechanism when faced with cellular stress, extensive autophagy can also lead to cell death. Aberrations in autophagy are associated with several diseases, including cancer. Therapeutic exploitation of this process requires a clear understanding of its regulation. Although the core molecular components involved in the execution of autophagy are well studied there is limited information on how cellular signaling pathways, particularly kinases, regulate this complex process. Protein kinases are integral to the autophagy process. Atg1, the first autophagy-related protein identified, is a serine/threonine kinase and it is regulated by another serine/threonine kinase mTOR. Emerging studies suggest the participation of many different kinases in regulating various components/steps of this catabolic process. This review focuses on the regulation of autophagy by several kinases with particular emphasis on serine/threonine protein kinases such as mTOR, AMP-activated protein kinase, Akt, mitogen-activated protein kinase (ERK, p38 and JNK) and protein kinase C that are often deregulated in cancer and are important therapeutic targets.

  17. Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Michalska, Karolina [Midwest Center for Structural Genomics, Biosciences Division, Argonne National Laboratory (United States); Cuff, Marianne E. [Midwest Center for Structural Genomics, Biosciences Division, Argonne National Laboratory (United States); Structural Biology Center, Biosciences Division, Argonne National Laboratory (United States); Tesar, Christine; Feldmann, Brian [Midwest Center for Structural Genomics, Biosciences Division, Argonne National Laboratory (United States); Joachimiak, Andrzej, E-mail: andrzejj@anl.gov [Midwest Center for Structural Genomics, Biosciences Division, Argonne National Laboratory (United States); Structural Biology Center, Biosciences Division, Argonne National Laboratory (United States); Department of Biochemistry and Molecular Biology, University of Chicago (United States)

    2011-08-01

    The crystal structure of 2-oxo-3-deoxygalactonate kinase from the De Ley–Doudoroff pathway of galactose metabolism has been determined at 2.1 Å resolution. In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De Ley–Doudoroff pathway, d-galactose is metabolized into pyruvate and d-glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1 Å resolution is reported, the first structure of an enzyme from the De Ley–Doudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two α/β domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein.

  18. Prevention of bacterial adhesion

    DEFF Research Database (Denmark)

    Klemm, Per; Vejborg, Rebecca Munk; Hancock, Viktoria

    2010-01-01

    Management of bacterial infections is becoming increasingly difficult due to the emergence and increasing prevalence of bacterial pathogens that are resistant to available antibiotics. Conventional antibiotics generally kill bacteria by interfering with vital cellular functions, an approach...... that imposes selection pressure for resistant bacteria. New approaches are urgently needed. Targeting bacterial virulence functions directly is an attractive alternative. An obvious target is bacterial adhesion. Bacterial adhesion to surfaces is the first step in colonization, invasion, and biofilm formation....... As such, adhesion represents the Achilles heel of crucial pathogenic functions. It follows that interference with adhesion can reduce bacterial virulence. Here, we illustrate this important topic with examples of techniques being developed that can inhibit bacterial adhesion. Some of these will become...

  19. MAP Kinase Cascades in Plant Innate Immunity

    Directory of Open Access Journals (Sweden)

    Magnus Wohlfahrt Rasmussen

    2012-07-01

    Full Text Available Plant mitogen-activated protein kinase (MAPK cascades generally transduce extracellular stimuli into cellular responses. These stimuli include the perception of pathogen-associated molecular patterns (PAMPs by host transmembrane pattern recognition receptors (PRRs which trigger MAPK-dependent innate immune responses. In the model Arabidopsis, molecular genetic evidence implicates a number of MAPK cascade components in PAMP signaling, and in responses to immunity-related phytohormones such as ethylene, jasmonate and salicylate. In a few cases, cascade components have been directly linked to the transcription of target genes or to the regulation of phytohormone synthesis. Thus MAPKs are obvious targets for bacterial effector proteins and are likely guardees of resistance (R proteins, which mediate defense signaling in response to the action of effectors, or effector-triggered immunity (ETI. This mini-review discusses recent progress in this field with a focus on the Arabidopsis MAPKs MPK3, 4, 6 and 11 in their apparent pathways.

  20. Pyruvate kinase is necessary for Brucella abortus full virulence in BALB/c mouse

    OpenAIRE

    2016-01-01

    International audience; AbstractBrucellosis, caused by a facultative intracellular pathogen Brucella, is one of the most prevalent zoonosis worldwide. Host infection relies on several uncanonical virulence factors. A recent research hotpot is the links between carbon metabolism and bacterial virulence. In this study, we found that a carbon metabolism-related pyruvate kinase (Pyk) encoded by pyk gene (locus tag BAB_RS24320) was associated with Brucella virulence. Determination of bacterial gro...

  1. A study of bacterial gene regulatory mechanisms

    DEFF Research Database (Denmark)

    Hansen, Sabine

    the different regulatory mechanisms affect system dynamics. We have designed a synthetic gene regulatory network (GRN) in bacterial cells that enables us to study the dynamics of GRNs. The results presented in this PhD thesis show that model equations based on the established mechanisms of action of each...... of a particular type of regulatory mechanism. The synthetic system presented in this thesis is, to our knowledge, the first of its kind to allow a direct comparison of the dynamic behaviors of gene regulatory networks that employ different mechanisms of regulation. In addition to studying the dynamic behavior...... of GRNs this thesis also provided the first evidence of the sensor histidine kinase VC1831 being an additional player in the Vibrio cholerae quorum sensing (QS) GRN. Bacteria use a process of cell-cell communication called QS which enable the bacterial cells to collectively control their gene expression...

  2. Phosphatidylinositol 3-kinase in myogenesis.

    Science.gov (United States)

    Kaliman, P; Zorzano, A

    1997-08-01

    Phosphatidylinositol 3-kinase (PI 3-kinase) has been cloned and characterized in a wide range of organisms. PI 3-kinases are activated by a diversity of extracellular stimuli and are involved in multiple cell processes such as cell proliferation, protein trafficking, cell motility, differentiation, regulation of cytoskeletal structure, and apoptosis. It has recently been shown that PI 3-kinase is a crucial second messenger in the signaling of myogenesis. Two structurally unrelated highly specific inhibitors of PI 3-kinase-wortmannin and LY294002-block the morphological and biochemical differentiation program of different skeletal-muscle cell models. Moreover, L6E9 myoblasts overexpressing a dominant-negative mutant of PI 3-kinase p85 regulatory subunit (Δp85) are unable to differentiate. Furthermore, PI 3-kinase is specifically involved in the insulinlike growth factor (IGF)-dependent myogenic pathway. Indeed, the ability of IGF-I, des-1,3-IGF-I, and IGF-II to promote cell fusion and muscle-specific protein expression is impaired after treatment with PI 3-kinase inhibitors or in cells overexpressing Δp85. The identification of additional key downstream elements of the IGF/PI 3-kinase myogenic cascade is crucial to a detailed understanding of the process of muscle differentiation and may generate new tools for skeletal and cardiac muscle regeneration therapies. (Trends Cardiovasc Med 1997;7:198-202). © 1997, Elsevier Science Inc.

  3. X-ray structural studies of the entire extra-cellular region of the Ser/Thr kinase PrkC from Staphylococcus aureus

    OpenAIRE

    Ruggiero, Alessia; Squeglia, Flavia; Marasco, Daniela; Marchetti, Roberta; Molinaro, Antonio; Berisio, Rita

    2011-01-01

    Abstract Bacterial Ser/Thr kinases modulate a wide number of cellular processes. PrkC kinase from human pathogen Staphylococcus aureus was also shown to induce germination of Bacillus subtilis spores, in response to cell-wall muropeptides. The presence of muropeptides in the bacterial extra-cellular milieu is a strong signal that growing conditions are promising. We report here the x-ray structure of the entire extra-cellular region of PrkC from Staphylococcus aureus. This structur...

  4. Evaluation of localized bacterial infection using radioisotope-labeled nucleosides imaging modality

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Su Jin; Kang, Joo Hyun; Lee, Yong Jin; Lee, Tae Sup; Kim, Kwang Il; Lee, Kyo Chul; An, Gwang II; Cheon, Gi Jeong; Lim, Sang Moo [KIRAMS, Seoul (Korea, Republic of); Lim, Sang Yong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2011-10-15

    Conventional diagnostic methods for infections are difficult to distinguish localized bacterial infections from sites of sterile inflammation. For this reason, the importance of developing methods to image bacterial infections is widely recognized. In this study to acquire bacterial infection imaging with radiolabeled nucleosides, in vitro bacterial thymidine kinase (tk) activities of Salmonella typhimurium with [{sup 18}F]FLT and [{sup 125}I]IVDU were measured and localized infections model in BALB/c mice was imaged with [{sup 18}F]FLT or [{sup 125}I]FIAU

  5. Peritonitis - spontaneous bacterial

    Science.gov (United States)

    Spontaneous bacterial peritonitis (SBP); Ascites - peritonitis; Cirrhosis - peritonitis ... who are on peritoneal dialysis for kidney failure. Peritonitis may have other causes . These include infection from ...

  6. Structural basis for the regulation mechanism of the tyrosine kinase CapB from Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Vanesa Olivares-Illana

    2008-06-01

    Full Text Available Bacteria were thought to be devoid of tyrosine-phosphorylating enzymes. However, several tyrosine kinases without similarity to their eukaryotic counterparts have recently been identified in bacteria. They are involved in many physiological processes, but their accurate functions remain poorly understood due to slow progress in their structural characterization. They have been best characterized as copolymerases involved in the synthesis and export of extracellular polysaccharides. These compounds play critical roles in the virulence of pathogenic bacteria, and bacterial tyrosine kinases can thus be considered as potential therapeutic targets. Here, we present the crystal structures of the phosphorylated and unphosphorylated states of the tyrosine kinase CapB from the human pathogen Staphylococcus aureus together with the activator domain of its cognate transmembrane modulator CapA. This first high-resolution structure of a bacterial tyrosine kinase reveals a 230-kDa ring-shaped octamer that dissociates upon intermolecular autophosphorylation. These observations provide a molecular basis for the regulation mechanism of the bacterial tyrosine kinases and give insights into their copolymerase function.

  7. Structural basis for the regulation mechanism of the tyrosine kinase CapB from Staphylococcus aureus

    DEFF Research Database (Denmark)

    Olivares-Illana, Vanesa; Meyer, Philippe; Bechet, Emmanuelle

    2008-01-01

    understood due to slow progress in their structural characterization. They have been best characterized as copolymerases involved in the synthesis and export of extracellular polysaccharides. These compounds play critical roles in the virulence of pathogenic bacteria, and bacterial tyrosine kinases can thus...

  8. TBK1 protects vacuolar integrity during intracellular bacterial infection.

    Directory of Open Access Journals (Sweden)

    Andrea L Radtke

    2007-03-01

    Full Text Available TANK-binding kinase-1 (TBK1 is an integral component of Type I interferon induction by microbial infection. The importance of TBK1 and Type I interferon in antiviral immunity is well established, but the function of TBK1 in bacterial infection is unclear. Upon infection of murine embryonic fibroblasts with Salmonella enterica serovar Typhimurium (Salmonella, more extensive bacterial proliferation was observed in tbk1(-/- than tbk1(+/+ cells. TBK1 kinase activity was required for restriction of bacterial infection, but interferon regulatory factor-3 or Type I interferon did not contribute to this TBK1-dependent function. In tbk1(-/-cells, Salmonella, enteropathogenic Escherichia coli, and Streptococcus pyogenes escaped from vacuoles into the cytosol where increased replication occurred, which suggests that TBK1 regulates the integrity of pathogen-containing vacuoles. Knockdown of tbk1 in macrophages and epithelial cells also resulted in increased bacterial localization in the cytosol, indicating that the role of TBK1 in maintaining vacuolar integrity is relevant in different cell types. Taken together, these data demonstrate a requirement for TBK1 in control of bacterial infection distinct from its established role in antiviral immunity.

  9. ERK kinases modulate the activation of PI3 kinase related kinases (PIKKs) in DNA damage response.

    Science.gov (United States)

    Lin, Xiaozeng; Yan, Judy; Tang, Damu

    2013-12-01

    DNA damage response (DDR) is the critical surveillance mechanism in maintaining genome integrity. The mechanism activates checkpoints to prevent cell cycle progression in the presence of DNA lesions, and mediates lesion repair. DDR is coordinated by three apical PI3 kinase related kinases (PIKKs), including ataxia-telangiectasia mutated (ATM), ATM- and Rad3-related (ATR), and DNA-PKcs (the catalytic subunit of the DNA dependent protein kinase). These kinases are activated in response to specific DNA damage or lesions, resulting in checkpoint activation and DNA lesion repair. While it is clear that the pathways of ATM, ATR, and DNA-PK are the core components of DDR, there is accumulating evidence revealing the involvement of other cellular pathways in regulating DDR; this is in line with the concept that in addition to being a nuclear event DDR is also a cellular process. One of these pathways is the extracellular signal-regulated kinase (ERK) MAPK (mitogen-activated protein kinase) pathway. ERK is a converging point of multiple signal transduction pathways involved in cell proliferation, differentiation, and apoptosis. Adding to this list of pathways is the recent development of ERK in DDR. The ERK kinases (ERK1 and ERK2) contribute to the proper execution of DDR in terms of checkpoint activation and the repair of DNA lesions. This review summarizes the contributions of ERK to DDR with emphasis on the relationship of ERK kinases with the activation of ATM, ATR, and DNA-PKcs.

  10. Prevention of bacterial adhesion

    DEFF Research Database (Denmark)

    Klemm, Per; Vejborg, Rebecca Munk; Hancock, Viktoria

    2010-01-01

    Management of bacterial infections is becoming increasingly difficult due to the emergence and increasing prevalence of bacterial pathogens that are resistant to available antibiotics. Conventional antibiotics generally kill bacteria by interfering with vital cellular functions, an approach that ...... valuable weapons for preventing pathogen contamination and fighting infectious diseases in the future....

  11. Vimentin in Bacterial Infections

    DEFF Research Database (Denmark)

    Mak, Tim N; Brüggemann, Holger

    2016-01-01

    Despite well-studied bacterial strategies to target actin to subvert the host cell cytoskeleton, thus promoting bacterial survival, replication, and dissemination, relatively little is known about the bacterial interaction with other components of the host cell cytoskeleton, including intermediate...... filaments (IFs). IFs have not only roles in maintaining the structural integrity of the cell, but they are also involved in many cellular processes including cell adhesion, immune signaling, and autophagy, processes that are important in the context of bacterial infections. Here, we summarize the knowledge...... about the role of IFs in bacterial infections, focusing on the type III IF protein vimentin. Recent studies have revealed the involvement of vimentin in host cell defenses, acting as ligand for several pattern recognition receptors of the innate immune system. Two main aspects of bacteria...

  12. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    YongliangZhang; ChenDong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses. Cellular & Molecular Immunology. 2005;2(1):20-27.

  13. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    Yongliang Zhang; Chen Dong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses.

  14. Structural analysis of Staphylococcus aureus serine/threonine kinase PknB.

    Directory of Open Access Journals (Sweden)

    Sonja Rakette

    Full Text Available Effective treatment of infections caused by the bacterium Staphylococcus aureus remains a worldwide challenge, in part due to the constant emergence of new strains that are resistant to antibiotics. The serine/threonine kinase PknB is of particular relevance to the life cycle of S. aureus as it is involved in the regulation of purine biosynthesis, autolysis, and other central metabolic processes of the bacterium. We have determined the crystal structure of the kinase domain of PknB in complex with a non-hydrolyzable analog of the substrate ATP at 3.0 Å resolution. Although the purified PknB kinase is active in solution, it crystallized in an inactive, autoinhibited state. Comparison with other bacterial kinases provides insights into the determinants of catalysis, interactions of PknB with ligands, and the pathway of activation.

  15. Structural analysis of Staphylococcus aureus serine/threonine kinase PknB.

    Science.gov (United States)

    Rakette, Sonja; Donat, Stefanie; Ohlsen, Knut; Stehle, Thilo

    2012-01-01

    Effective treatment of infections caused by the bacterium Staphylococcus aureus remains a worldwide challenge, in part due to the constant emergence of new strains that are resistant to antibiotics. The serine/threonine kinase PknB is of particular relevance to the life cycle of S. aureus as it is involved in the regulation of purine biosynthesis, autolysis, and other central metabolic processes of the bacterium. We have determined the crystal structure of the kinase domain of PknB in complex with a non-hydrolyzable analog of the substrate ATP at 3.0 Å resolution. Although the purified PknB kinase is active in solution, it crystallized in an inactive, autoinhibited state. Comparison with other bacterial kinases provides insights into the determinants of catalysis, interactions of PknB with ligands, and the pathway of activation.

  16. Interfering with bacterial gossip

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Tolker-Nielsen, Tim; Givskov, Michael

    2011-01-01

    defense. Antibiotics exhibit a rather limited effect on biofilms. Furthermore, antibiotics have an ‘inherent obsolescence’ because they select for development of resistance. Bacterial infections with origin in bacterial biofilms have become a serious threat in developed countries. Pseudomonas aeruginosa...... that appropriately target bacteria in their relevant habitat with the aim of mitigating their destructive impact on patients. In this review we describe molecular mechanisms involved in “bacterial gossip” (more scientifically referred to as quorum sensing (QS) and c-di-GMP signaling), virulence, biofilm formation......, resistance and QS inhibition as future antimicrobial targets, in particular those that would work to minimize selection pressures for the development of resistant bacteria....

  17. The tomato Prf complex is a molecular trap for bacterial effectors based on Pto transphosphorylation.

    Directory of Open Access Journals (Sweden)

    Vardis Ntoukakis

    2013-01-01

    Full Text Available The major virulence strategy of phytopathogenic bacteria is to secrete effector proteins into the host cell to target the immune machinery. AvrPto and AvrPtoB are two such effectors from Pseudomonas syringae, which disable an overlapping range of kinases in Arabidopsis and Tomato. Both effectors target surface-localized receptor-kinases to avoid bacterial recognition. In turn, tomato has evolved an intracellular effector-recognition complex composed of the NB-LRR protein Prf and the Pto kinase. Structural analyses have shown that the most important interaction surface for AvrPto and AvrPtoB is the Pto P+1 loop. AvrPto is an inhibitor of Pto kinase activity, but paradoxically, this kinase activity is a prerequisite for defense activation by AvrPto. Here using biochemical approaches we show that disruption of Pto P+1 loop stimulates phosphorylation in trans, which is possible because the Pto/Prf complex is oligomeric. Both P+1 loop disruption and transphosphorylation are necessary for signalling. Thus, effector perturbation of one kinase molecule in the complex activates another. Hence, the Pto/Prf complex is a sophisticated molecular trap for effectors that target protein kinases, an essential aspect of the pathogen's virulence strategy. The data presented here give a clear view of why bacterial virulence and host recognition mechanisms are so often related and how the slowly evolving host is able to keep pace with the faster-evolving pathogen.

  18. The tomato Prf complex is a molecular trap for bacterial effectors based on Pto transphosphorylation.

    Science.gov (United States)

    Ntoukakis, Vardis; Balmuth, Alexi L; Mucyn, Tatiana S; Gutierrez, Jose R; Jones, Alexandra M E; Rathjen, John P

    2013-01-01

    The major virulence strategy of phytopathogenic bacteria is to secrete effector proteins into the host cell to target the immune machinery. AvrPto and AvrPtoB are two such effectors from Pseudomonas syringae, which disable an overlapping range of kinases in Arabidopsis and Tomato. Both effectors target surface-localized receptor-kinases to avoid bacterial recognition. In turn, tomato has evolved an intracellular effector-recognition complex composed of the NB-LRR protein Prf and the Pto kinase. Structural analyses have shown that the most important interaction surface for AvrPto and AvrPtoB is the Pto P+1 loop. AvrPto is an inhibitor of Pto kinase activity, but paradoxically, this kinase activity is a prerequisite for defense activation by AvrPto. Here using biochemical approaches we show that disruption of Pto P+1 loop stimulates phosphorylation in trans, which is possible because the Pto/Prf complex is oligomeric. Both P+1 loop disruption and transphosphorylation are necessary for signalling. Thus, effector perturbation of one kinase molecule in the complex activates another. Hence, the Pto/Prf complex is a sophisticated molecular trap for effectors that target protein kinases, an essential aspect of the pathogen's virulence strategy. The data presented here give a clear view of why bacterial virulence and host recognition mechanisms are so often related and how the slowly evolving host is able to keep pace with the faster-evolving pathogen.

  19. RNA interference screen identifies Abl kinase and PDGFR signaling in Chlamydia trachomatis entry.

    Directory of Open Access Journals (Sweden)

    Cherilyn A Elwell

    2008-03-01

    Full Text Available The strain designated Chlamydia trachomatis serovar L2 that was used for experiments in this paper is Chlamydia muridarum, a species closely related to C. trachomatis (and formerly termed the Mouse Pneumonitis strain of C. trachomatis. This conclusion was verified by deep sequencing and by PCR using species-specific primers. All data presented in the results section that refer to C. trachomatis should be interpreted as referring to C. muridarum. Since C. muridarum TARP lacks the consensus tyrosine repeats present in C. trachomatis TARP, we cannot make any conclusions about the role of TARP phosphorylation and C. muridarum entry. However, the conclusion that C. trachomatis L2 TARP is a target of Abl kinase is still valid as these experiments were performed with C. trachomatis L2 TARP [corrected]. To elucidate the mechanisms involved in early events in Chlamydia trachomatis infection, we conducted a large scale unbiased RNA interference screen in Drosophila melanogaster S2 cells. This allowed identification of candidate host factors in a simple non-redundant, genetically tractable system. From a library of 7,216 double stranded RNAs (dsRNA, we identified approximately 226 host genes, including two tyrosine kinases, Abelson (Abl kinase and PDGF- and VEGF-receptor related (Pvr, a homolog of the Platelet-derived growth factor receptor (PDGFR. We further examined the role of these two kinases in C. trachomatis binding and internalization into mammalian cells. Both kinases are phosphorylated upon infection and recruited to the site of bacterial attachment, but their roles in the infectious process are distinct. We provide evidence that PDGFRbeta may function as a receptor, as inhibition of PDGFRbeta by RNA interference or by PDGFRbeta neutralizing antibodies significantly reduces bacterial binding, whereas depletion of Abl kinase has no effect on binding. Bacterial internalization can occur through activation of PDGFRbeta or through independent

  20. Bacterial intermediate filaments

    DEFF Research Database (Denmark)

    Charbon, Godefroid; Cabeen, M.; Jacobs-Wagner, C.

    2009-01-01

    Crescentin, which is the founding member of a rapidly growing family of bacterial cytoskeletal proteins, was previously proposed to resemble eukaryotic intermediate filament (IF) proteins based on structural prediction and in vitro polymerization properties. Here, we demonstrate that crescentin...

  1. Bacterial Wound Culture

    Science.gov (United States)

    ... Home Visit Global Sites Search Help? Bacterial Wound Culture Share this page: Was this page helpful? Also known as: Aerobic Wound Culture; Anaerobic Wound Culture Formal name: Culture, wound Related ...

  2. Bacterial surface adaptation

    Science.gov (United States)

    Utada, Andrew

    2014-03-01

    Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.

  3. Bacterial Meningitis in Infants

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2004-04-01

    Full Text Available A retrospective study of 80 infantile patients (ages 30-365 days; 47 male, 33 female with culture-proven bacterial meningitis seen over a 16 year period (1986-2001 is reported from Taiwan.

  4. Development of a cell-based, high-throughput screening assay for ATM kinase inhibitors.

    Science.gov (United States)

    Guo, Kexiao; Shelat, Anang A; Guy, R Kiplin; Kastan, Michael B

    2014-04-01

    The ATM (ataxia-telangiectasia, mutated) protein kinase is a major regulator of cellular responses to DNA double-strand breaks (DSBs), DNA lesions that can be caused by ionizing irradiation (IR), oxidative damage, or exposure to certain chemical agents. In response to DSBs, the ATM kinase is activated and subsequently phosphorylates numerous downstream substrates, including p53, Chk2, BRCA1, and KAP1, which affect processes such as cell cycle progression and DNA repair. Numerous studies have demonstrated that loss of ATM function results in enhanced sensitivity to ionizing irradiation in clinically relevant dose ranges, suggesting that ATM kinase is an attractive therapeutic target for enhancing tumor cell kill with radiotherapy. Previously identified small-molecule ATM kinase inhibitors, such as CP466722 and Ku55933, were identified using in vitro kinase assays carried out with recombinant ATM kinase isolated from mammalian cells. Since it has not been feasible to express full-length recombinant ATM in bacterial or baculovirus systems, a robust in vitro screening tool has been lacking. We have developed a cell-based assay that is robust, straightforward, and sensitive. Using this high-throughput assay, we screened more than 7000 compounds and discovered additional small molecules that inhibit the ATM kinase and further validated these hits by secondary assays.

  5. Restricted distribution of the butyrate kinase pathway among butyrate-producing bacteria from the human colon.

    Science.gov (United States)

    Louis, Petra; Duncan, Sylvia H; McCrae, Sheila I; Millar, Jacqueline; Jackson, Michelle S; Flint, Harry J

    2004-04-01

    The final steps in butyrate synthesis by anaerobic bacteria can occur via butyrate kinase and phosphotransbutyrylase or via butyryl-coenzyme A (CoA):acetate CoA-transferase. Degenerate PCR and enzymatic assays were used to assess the presence of butyrate kinase among 38 anaerobic butyrate-producing bacterial isolates from human feces that represent three different clostridial clusters (IV, XIVa, and XVI). Only four strains were found to possess detectable butyrate kinase activity. These were also the only strains to give PCR products (verifiable by sequencing) with degenerate primer pairs designed within the butyrate kinase gene or between the linked butyrate kinase/phosphotransbutyrylase genes. Further analysis of the butyrate kinase/phosphotransbutyrylase genes of one isolate, L2-50, revealed similar organization to that described previously from different groups of clostridia, along with differences in flanking sequences and phylogenetic relationships. Butyryl-CoA:acetate CoA-transferase activity was detected in all 38 strains examined, suggesting that it, rather than butyrate kinase, provides the dominant route for butyrate formation in the human colonic ecosystem that contains a constantly high concentration of acetate.

  6. Bacterial proteases and virulence

    DEFF Research Database (Denmark)

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing....... These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host....

  7. [Diagnosis of bacterial vaginosis].

    Science.gov (United States)

    Djukić, Slobodanka; Ćirković, Ivana; Arsić, Biljana; Garalejić, Eliana

    2013-01-01

    Bacterial vaginosis is a common, complex clinical syndrome characterized by alterations in the normal vaginal flora. When symptomatic, it is associated with a malodorous vaginal discharge and on occasion vaginal burning or itching. Under normal conditions, lactobacilli constitute 95% of the bacteria in the vagina. Bacterial vaginosis is associated with severe reduction or absence of the normal H2O2-producing lactobacilli and overgrowth of anaerobic bacteria and Gardnerella vaginalis, Atopobium vaginae, Mycoplasma hominis and Mobiluncus species. Most types of infectious disease are diagnosed by culture, by isolating an antigen or RNA/DNA from the microbe, or by serodiagnosis to determine the presence of antibodies to the microbe. Therefore, demonstration of the presence of an infectious agent is often a necessary criterion for the diagnosis of the disease. This is not the case for bacterial vaginosis, since the ultimate cause of the disease is not yet known. There are a variety of methods for the diagnosis of bacterial vaginosis but no method can at present be regarded as the best. Diagnosing bacterial vaginosis has long been based on the clinical criteria of Amsel, whereby three of four defined criteria must be satisfied. Nugent's scoring system has been further developed and includes validation of the categories of observable bacteria structures. Up-to-date molecular tests are introduced, and better understanding of vaginal microbiome, a clear definition for bacterial vaginosis, and short-term and long-term fluctuations in vaginal microflora will help to better define molecular tests within the broader clinical context.

  8. The bacterial lipocalins.

    Science.gov (United States)

    Bishop, R E

    2000-10-18

    The lipocalins were once regarded as a eukaryotic protein family, but new members have been recently discovered in bacteria. The first bacterial lipocalin (Blc) was identified in Escherichia coli as an outer membrane lipoprotein expressed under conditions of environmental stress. Blc is distinguished from most lipocalins by the absence of intramolecular disulfide bonds, but the presence of a membrane anchor is shared with two of its closest homologues, apolipoprotein D and lazarillo. Several common features of the membrane-anchored lipocalins suggest that each may play an important role in membrane biogenesis and repair. Additionally, Blc proteins are implicated in the dissemination of antibiotic resistance genes and in the activation of immunity. Recent genome sequencing efforts reveal the existence of at least 20 bacterial lipocalins. The lipocalins appear to have originated in Gram-negative bacteria and were probably transferred horizontally to eukaryotes from the endosymbiotic alpha-proteobacterial ancestor of the mitochondrion. The genome sequences also reveal that some bacterial lipocalins exhibit disulfide bonds and alternative modes of subcellular localization, which include targeting to the periplasmic space, the cytoplasmic membrane, and the cytosol. The relationships between bacterial lipocalin structure and function further illuminate the common biochemistry of bacterial and eukaryotic cells.

  9. Mechanistic insights into the LsrK kinase required for autoinducer-2 quorum sensing activation

    OpenAIRE

    Zhu, Jie; Hixon, Mark S.; Globisch, Daniel; Kaufmann, Gunnar F.; Janda, Kim D.

    2013-01-01

    In enteric bacteria, the kinase LsrK catalyzes the phosphorylation of the C5-hydroxyl group in the linear form of 4,5-dihydroxy-2,3-pentanedione (DPD), the precursor of the type II bacterial quorum sensing molecule (AI-2). This phosphorylation is required for AI-2 sequestration in the cytoplasm and subsequent derepression of AI-2 related genes necessary for quorum development. While LsrK is a critical enzyme within the DPD quorum sensing relay system, kinetic details of this kinase have yet t...

  10. Bacterial proteins and peptides in cancer therapy

    Science.gov (United States)

    Chakrabarty, Ananda M; Bernardes, Nuno; Fialho, Arsenio M

    2014-01-01

    Cancer is one of the most deadly diseases worldwide. In the last three decades many efforts have been made focused on understanding how cancer grows and responds to drugs. The dominant drug-development paradigm has been the “one drug, one target.” Based on that, the two main targeted therapies developed to combat cancer include the use of tyrosine kinase inhibitors and monoclonal antibodies. Development of drug resistance and side effects represent the major limiting factors for their use in cancer treatment. Nowadays, a new paradigm for cancer drug discovery is emerging wherein multi-targeted approaches gain ground in cancer therapy. Therefore, to overcome resistance to therapy, it is clear that a new generation of drugs is urgently needed. Here, regarding the concept of multi-targeted therapy, we discuss the challenges of using bacterial proteins and peptides as a new generation of effective anti-cancer drugs. PMID:24875003

  11. Identification of mycobacterial GarA as a substrate of protein kinase G from M. tuberculosis using a KESTREL-based proteome wide approach.

    Science.gov (United States)

    Mueller, Philipp; Pieters, Jean

    2017-05-01

    Signal transduction in bacteria is generally mediated via two-component systems. These systems depend on the transfer of a phosphate molecule from a donor to an acceptor by histidine kinases, thereby activating the acceptor to allow downstream signaling/activation. Several bacterial genomes, including the genome of M. tuberculosis, were shown to encode eukaryotic-like kinases. To better understand the function of these kinases and the regulatory networks within which they operate, identification of downstream targets is essential. We here present a straightforward approach for the identification of bacterial Ser/Thr-kinase substrates. This approach is based on the KESTREL (Kinase Tracking and Substrate Elucidation) procedure combined with reversed-phase chromatography and two-dimensional gel electrophoresis. Using this method, GarA was identified as one potential substrate for the mycobacterial Ser/Thr-protein kinase G (PknG). These results show that the modified KESTREL approach can be successfully employed for the identification of substrates for bacterial Ser/Thr-kinases.

  12. Bacterial glycosyltransferase toxins.

    Science.gov (United States)

    Jank, Thomas; Belyi, Yury; Aktories, Klaus

    2015-12-01

    Mono-glycosylation of host proteins is a common mechanism by which bacterial protein toxins manipulate cellular functions of eukaryotic target host cells. Prototypic for this group of glycosyltransferase toxins are Clostridium difficile toxins A and B, which modify guanine nucleotide-binding proteins of the Rho family. However, toxin-induced glycosylation is not restricted to the Clostridia. Various types of bacterial pathogens including Escherichia coli, Yersinia, Photorhabdus and Legionella species produce glycosyltransferase toxins. Recent studies discovered novel unexpected variations in host protein targets and amino acid acceptors of toxin-catalysed glycosylation. These findings open new perspectives in toxin as well as in carbohydrate research.

  13. Reciprocal regulation of protein kinase and pyruvate kinase activities of pyruvate kinase M2 by growth signals.

    Science.gov (United States)

    Gao, Xueliang; Wang, Haizhen; Yang, Jenny J; Chen, Jing; Jie, Jiang; Li, Liangwei; Zhang, Yinwei; Liu, Zhi-Ren

    2013-05-31

    Pyruvate kinase isoform M2 (PKM2) is an enzyme-catalyzing conversion of phosphoenolpyruvate to pyruvate in the glycolysis pathway. It was demonstrated that PKM2 interacts with tyrosine phosphopeptide, and the interaction with the tyrosine phosphopeptide affects the pyruvate kinase activity of PKM2. Our experiments suggest that PKM2 is also an active protein kinase (Gao, X., Wang, H., Yang, J. J., Liu, X., and Liu, Z. R. (2012) Mol. Cell 45, 598-609). We report here that growth signals reciprocally regulate the pyruvate kinase and protein kinase activities of PKM2 by different mechanisms. On the one hand, growth signals induce protein tyrosine phosphorylations. The tyrosine-phosphorylated protein(s) regulates the conversion of pyruvate kinase and protein kinase of PKM2 by directly interacting with PKM2. Binding of the tyrosyl-phosphorylated proteins at the fructose 1,6-bisphosphate-binding site converts the tetrameric PKM2 to a dimer. On the other hand, growth stimulations also lead to PKM2 phosphorylation, which consequently regulates the conversion of protein kinase and pyruvate kinase activities. Growth factor stimulations significantly increase the dimer/tetramer PKM2 ratio in cells and consequently activate the protein kinase activity of PKM2. Our study suggests that the conversion between the pyruvate kinase and protein kinase activities of PKM2 may be an important mechanism mediating the effects of growth signals in promoting cell proliferation.

  14. Anticancer Alkaloid Lamellarins Inhibit Protein Kinases

    Directory of Open Access Journals (Sweden)

    Laurent Meijer

    2008-10-01

    Full Text Available Lamellarins, a family of hexacyclic pyrrole alkaloids originally isolated from marine invertebrates, display promising anti-tumor activity. They induce apoptotic cell death through multi-target mechanisms, including inhibition of topoisomerase I, interaction with DNA and direct effects on mitochondria. We here report that lamellarins inhibit several protein kinases relevant to cancer such as cyclin-dependent kinases, dualspecificity tyrosine phosphorylation activated kinase 1A, casein kinase 1, glycogen synthase kinase-3 and PIM-1. A good correlation is observed between the effects of lamellarins on protein kinases and their action on cell death, suggesting that inhibition of specific kinases may contribute to the cytotoxicity of lamellarins. Structure/activity relationship suggests several paths for the optimization of lamellarins as kinase inhibitors.

  15. Inhibitors of protein kinase C

    Institute of Scientific and Technical Information of China (English)

    LIU Shiying; JIANG Yuyang; CAO Jian; LIU Feng; MA Li; ZHAO Yufen

    2005-01-01

    Protein kinase catalyzes the transfer of the γ-phosphoryl group from ATP to the hydroxyl groups of protein side chains, which plays critical roles in signal transduction pathways by transmitting extracellular signals across the plasma membrane and nuclear membrane to the destination sites in the cytoplasm and the nucleus. Protein kinase C (PKC) is a superfamily of phospholipid-dependent Ser/Thr kinase. There are at least 12 isozymes in PKC family. They are distributed in different tissues and play different roles in physiological processes. On account of their concern with a variety of pathophysiologic states, such as cancer, inflammatory conditions, autoimmune disorder, and cardiac diseases, the inhibitors, which can inhibit the activity of PKC and the interaction of cytokine with receptor, and interfere signal transduction pathway, may be candidates of therapeutic drugs. Therefore, intense efforts have been made to develop specific protein kinase inhibitors as biological tools and therapeutic agents. This article reviews the recent development of some of PKC inhibitors based on their interaction with different conserved domains and different inhibition mechanisms.

  16. Deferasirox in pyruvate kinase deficiency

    OpenAIRE

    Deeren, Dries

    2008-01-01

    Deferasirox in pyruvate kinase deficiency phone: +32-51-237437 (Deeren, Dries) (Deeren, Dries) Department of Haematology, Heilig-Hartziekenhuis Roeselare-Menen vzw - Wilgenstraat 2 - B-8800 - Roeselare - BELGIUM (Deeren, Dries) BELGIUM Registration: 2008-09-10 Received: 2008-09-05 Accepted: 2008-09-10 ePublished: 2008-09-23

  17. Renal targeting of kinase inhibitors

    NARCIS (Netherlands)

    Dolman, M. E. M.; Fretz, M. M.; Segers, Gj. W.; Lacombe, M.; Prakash, J.; Storm, G.; Hennink, W. E.; Kok, R. J.

    2008-01-01

    Activation of proximal tubular cells by fibrotic and inflammatory mediators is an important hallmark of chronic kidney disease. We have developed a novel strategy to intervene in renal fibrosis, by means of locally delivered kinase inhibitors. Such compounds will display enhanced activity within tub

  18. Seizures Complicating Bacterial Meningitis

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2004-09-01

    Full Text Available The clinical data of 116 patients, 1 month to <5 years of age, admitted for bacterial meningitis, and grouped according to those with and without seizures during hospitalization, were compared in a study at Buddhist Dalin Tzu Chi General Hospital, Chang Gung Memorial Hospital and other centers in Taiwan.

  19. Monoclonal Antibodies Against Xenopus Greatwall Kinase

    OpenAIRE

    WANG Ling; Fisher, Laura A.; Wahl, James K.; Peng, Aimin

    2011-01-01

    Mitosis is known to be regulated by protein kinases, including MPF, Plk1, Aurora kinases, and so on, which become active in M-phase and phosphorylate a wide range of substrates to control multiple aspects of mitotic entry, progression, and exit. Mechanistic investigations of these kinases not only provide key insights into cell cycle regulation, but also hold great promise for cancer therapy. Recent studies, largely in Xenopus, characterized a new mitotic kinase named Greatwall (Gwl) that pla...

  20. SLAM is a microbial sensor that regulates bacterial phagosome functions in macrophages.

    Science.gov (United States)

    Berger, Scott B; Romero, Xavier; Ma, Chunyan; Wang, Guoxing; Faubion, William A; Liao, Gongxian; Compeer, Ewoud; Keszei, Marton; Rameh, Lucia; Wang, Ninghai; Boes, Marianne; Regueiro, Jose R; Reinecker, Hans-Christian; Terhorst, Cox

    2010-10-01

    Phagocytosis is a pivotal process by which macrophages eliminate microorganisms after recognition by pathogen sensors. Here we unexpectedly found that the self ligand and cell surface receptor SLAM functioned not only as a costimulatory molecule but also as a microbial sensor that controlled the killing of gram-negative bacteria by macrophages. SLAM regulated activity of the NADPH oxidase NOX2 complex and phagolysosomal maturation after entering the phagosome, following interaction with the bacterial outer membrane proteins OmpC and OmpF. SLAM recruited a complex containing the intracellular class III phosphatidylinositol kinase Vps34, its regulatory protein kinase Vps15 and the autophagy-associated molecule beclin-1 to the phagosome, which was responsible for inducing the accumulation of phosphatidylinositol-3-phosphate, a regulator of both NOX2 function and phagosomal or endosomal fusion. Thus, SLAM connects the gram-negative bacterial phagosome to ubiquitous cellular machinery responsible for the control of bacterial killing.

  1. Cardiac protein kinases: the cardiomyocyte kinome and differential kinase expression in human failing hearts

    OpenAIRE

    Fuller, Stephen J.; Osborne, Sally A.; Leonard, Sam J.; Hardyman, Michelle A.; Vaniotis, George; Allen, Bruce G.; Sugden, Peter H.; Clerk, Angela

    2015-01-01

    Aims. Protein kinases are potential therapeutic targets for heart failure, but most studies of cardiac protein kinases derive from other systems, an approach that fails to account for specific kinases expressed in the heart and the contractile cardiomyocytes. We aimed to define the cardiomyocyte kinome (i.e. the protein kinases expressed in cardiomyocytes) and identify kinases with altered expression in human failing hearts. Methods and Results. Expression profiling (Affymetrix microarrays) d...

  2. A class of selective antibacterials derived from a protein kinase inhibitor pharmacophore.

    Science.gov (United States)

    Miller, J Richard; Dunham, Steve; Mochalkin, Igor; Banotai, Craig; Bowman, Matthew; Buist, Susan; Dunkle, Bill; Hanna, Debra; Harwood, H James; Huband, Michael D; Karnovsky, Alla; Kuhn, Michael; Limberakis, Chris; Liu, Jia Y; Mehrens, Shawn; Mueller, W Thomas; Narasimhan, Lakshmi; Ogden, Adam; Ohren, Jeff; Prasad, J V N Vara; Shelly, John A; Skerlos, Laura; Sulavik, Mark; Thomas, V Hayden; VanderRoest, Steve; Wang, LiAnn; Wang, Zhigang; Whitton, Amy; Zhu, Tong; Stover, C Kendall

    2009-02-10

    As the need for novel antibiotic classes to combat bacterial drug resistance increases, the paucity of leads resulting from target-based antibacterial screening of pharmaceutical compound libraries is of major concern. One explanation for this lack of success is that antibacterial screening efforts have not leveraged the eukaryotic bias resulting from more extensive chemistry efforts targeting eukaryotic gene families such as G protein-coupled receptors and protein kinases. Consistent with a focus on antibacterial target space resembling these eukaryotic targets, we used whole-cell screening to identify a series of antibacterial pyridopyrimidines derived from a protein kinase inhibitor pharmacophore. In bacteria, the pyridopyrimidines target the ATP-binding site of biotin carboxylase (BC), which catalyzes the first enzymatic step of fatty acid biosynthesis. These inhibitors are effective in vitro and in vivo against fastidious gram-negative pathogens including Haemophilus influenzae. Although the BC active site has architectural similarity to those of eukaryotic protein kinases, inhibitor binding to the BC ATP-binding site is distinct from the protein kinase-binding mode, such that the inhibitors are selective for bacterial BC. In summary, we have discovered a promising class of potent antibacterials with a previously undescribed mechanism of action. In consideration of the eukaryotic bias of pharmaceutical libraries, our findings also suggest that pursuit of a novel inhibitor leads for antibacterial targets with active-site structural similarity to known human targets will likely be more fruitful than the traditional focus on unique bacterial target space, particularly when structure-based and computational methodologies are applied to ensure bacterial selectivity.

  3. A class of selective antibacterials derived from a protein kinase inhibitor pharmacophore

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J. Richard; Dunham, Steve; Mochalkin, Igor; Banotai, Craig; Bowman, Matthew; Buist, Susan; Dunkle, Bill; Hanna, Debra; Harwood, H. James; Huband, Michael D.; Karnovsky, Alla; Kuhn, Michael; Limberakis, Chris; Liu, Jia Y.; Mehrens, Shawn; Mueller, W. Thomas; Narasimhan, Lakshmi; Ogden, Adam; Ohren, Jeff; Prasad, J.V.N. Vara; Shelly, John A.; Skerlos, Laura; Sulavik, Mark; Thomas, V. Hayden; VanderRoest, Steve; Wang, LiAnn; Wang, Zhigang; Whitton, Amy; Zhu, Tong; Stover, C. Kendall; (Pfizer)

    2009-06-25

    As the need for novel antibiotic classes to combat bacterial drug resistance increases, the paucity of leads resulting from target-based antibacterial screening of pharmaceutical compound libraries is of major concern. One explanation for this lack of success is that antibacterial screening efforts have not leveraged the eukaryotic bias resulting from more extensive chemistry efforts targeting eukaryotic gene families such as G protein-coupled receptors and protein kinases. Consistent with a focus on antibacterial target space resembling these eukaryotic targets, we used whole-cell screening to identify a series of antibacterial pyridopyrimidines derived from a protein kinase inhibitor pharmacophore. In bacteria, the pyridopyrimidines target the ATP-binding site of biotin carboxylase (BC), which catalyzes the first enzymatic step of fatty acid biosynthesis. These inhibitors are effective in vitro and in vivo against fastidious Gram-negative pathogens including Haemophilus influenzae. Although the BC active site has architectural similarity to those of eukaryotic protein kinases, inhibitor binding to the BC ATP-binding site is distinct from the protein kinase-binding mode, such that the inhibitors are selective for bacterial BC. In summary, we have discovered a promising class of potent antibacterials with a previously undescribed mechanism of action. In consideration of the eukaryotic bias of pharmaceutical libraries, our findings also suggest that pursuit of a novel inhibitor leads for antibacterial targets with active-site structural similarity to known human targets will likely be more fruitful than the traditional focus on unique bacterial target space, particularly when structure-based and computational methodologies are applied to ensure bacterial selectivity.

  4. A bacterial tyrosine phosphatase inhibits plant pattern recognition receptor activation.

    Science.gov (United States)

    Macho, Alberto P; Schwessinger, Benjamin; Ntoukakis, Vardis; Brutus, Alexandre; Segonzac, Cécile; Roy, Sonali; Kadota, Yasuhiro; Oh, Man-Ho; Sklenar, Jan; Derbyshire, Paul; Lozano-Durán, Rosa; Malinovsky, Frederikke Gro; Monaghan, Jacqueline; Menke, Frank L; Huber, Steven C; He, Sheng Yang; Zipfel, Cyril

    2014-03-28

    Innate immunity relies on the perception of pathogen-associated molecular patterns (PAMPs) by pattern-recognition receptors (PRRs) located on the host cell's surface. Many plant PRRs are kinases. Here, we report that the Arabidopsis receptor kinase EF-TU RECEPTOR (EFR), which perceives the elf18 peptide derived from bacterial elongation factor Tu, is activated upon ligand binding by phosphorylation on its tyrosine residues. Phosphorylation of a single tyrosine residue, Y836, is required for activation of EFR and downstream immunity to the phytopathogenic bacterium Pseudomonas syringae. A tyrosine phosphatase, HopAO1, secreted by P. syringae, reduces EFR phosphorylation and prevents subsequent immune responses. Thus, host and pathogen compete to take control of PRR tyrosine phosphorylation used to initiate antibacterial immunity.

  5. 大肠杆菌双杂交系统筛选与AMPKα2相互作用的蛋白质%Identification of AMP-activated protein kinase α2 interacting proteins by bacterial two-hybrid screening

    Institute of Scientific and Technical Information of China (English)

    符庆瑛; 高钰琪; 刘昕

    2007-01-01

    目的 利用大肠杆菌双杂交系统筛选脑组织中与大鼠AMP激活的蛋白激酶α2(AMP-activated protein kinase α2,AMPKα2)相互作用的蛋白质,以期进一步探讨AMPKα2在脑内的生物学功能及调节机制.方法 以重组质粒pBT-AMPKα2作为诱饵,应用大肠杆菌双杂交系统筛选大鼠胎脑cDNA文库,并对结果进行生物信息学分析.结果 筛选出与AMPKα2结合的蛋白7个,包括聚合泛素、热休克蛋白8(heat shock protein 8, HSP8)、磷酸果糖激酶、细胞色素C氧化酶亚基Ⅰ(cytochrome C oxidase subunit Ⅰ, COXⅠ)、人类白细胞抗原B关联性转录物3 (HLA-B-associated transcript 3,BAT3)异构体1、蛋白酪氨酸磷酸酶受体型D(protein tyrosine phosphatase receptor type D, Ptprd)、岛-脑蛋白1(islet-brain1,IB1).结论 寻找到了脑内与AMPKα2相互作用的7种蛋白:聚合泛素、HSP8、磷酸果糖激酶、COXⅠ、BAT3异构体1、Ptprd、IB1.

  6. Cooperative Bacterial Foraging Optimization

    Directory of Open Access Journals (Sweden)

    Hanning Chen

    2009-01-01

    Full Text Available Bacterial Foraging Optimization (BFO is a novel optimization algorithm based on the social foraging behavior of E. coli bacteria. This paper presents a variation on the original BFO algorithm, namely, the Cooperative Bacterial Foraging Optimization (CBFO, which significantly improve the original BFO in solving complex optimization problems. This significant improvement is achieved by applying two cooperative approaches to the original BFO, namely, the serial heterogeneous cooperation on the implicit space decomposition level and the serial heterogeneous cooperation on the hybrid space decomposition level. The experiments compare the performance of two CBFO variants with the original BFO, the standard PSO and a real-coded GA on four widely used benchmark functions. The new method shows a marked improvement in performance over the original BFO and appears to be comparable with the PSO and GA.

  7. Bacterial Colony Optimization

    Directory of Open Access Journals (Sweden)

    Ben Niu

    2012-01-01

    Full Text Available This paper investigates the behaviors at different developmental stages in Escherichia coli (E. coli lifecycle and developing a new biologically inspired optimization algorithm named bacterial colony optimization (BCO. BCO is based on a lifecycle model that simulates some typical behaviors of E. coli bacteria during their whole lifecycle, including chemotaxis, communication, elimination, reproduction, and migration. A newly created chemotaxis strategy combined with communication mechanism is developed to simplify the bacterial optimization, which is spread over the whole optimization process. However, the other behaviors such as elimination, reproduction, and migration are implemented only when the given conditions are satisfied. Two types of interactive communication schemas: individuals exchange schema and group exchange schema are designed to improve the optimization efficiency. In the simulation studies, a set of 12 benchmark functions belonging to three classes (unimodal, multimodal, and rotated problems are performed, and the performances of the proposed algorithms are compared with five recent evolutionary algorithms to demonstrate the superiority of BCO.

  8. Bacterial assays for recombinagens.

    Science.gov (United States)

    Hoffmann, G R

    1992-12-01

    Two principal strategies have been used for studying recombinagenic effects of chemicals and radiation in bacteria: (1) measurement of homologous recombination involving defined alleles in a partially diploid strain, and (2) measurement of the formation and loss of genetic duplications in the bacterial chromosome. In the former category, most methods involve one allele in the bacterial chromosome and another in a plasmid, but it is also possible to detect recombination between two chromosomal alleles or between two extrachromosomal alleles. This review summarizes methods that use each of these approaches for detecting recombination and tabulates data on agents that have been found to be recombinagenic in bacteria. The assays are discussed with respect to their effectiveness in testing for recombinagens and their potential for elucidating mechanisms underlying recombinagenic effects.

  9. Bacterial transformation of terpenoids

    Science.gov (United States)

    Grishko, V. V.; Nogovitsina, Y. M.; Ivshina, I. B.

    2014-04-01

    Data on the bacterial transformation of terpenoids published in the literature in the past decade are analyzed. Possible pathways for chemo-, regio- and stereoselective modifications of terpenoids are discussed. Considerable attention is given to new technological approaches to the synthesis of terpenoid derivatives suitable for the use in the perfume and food industry and promising as drugs and chiral intermediates for fine organic synthesis. The bibliography includes 246 references.

  10. Spontaneous bacterial peritonitis

    OpenAIRE

    Al Amri Saleh

    1995-01-01

    Spontaneous bacterial peritonitis (SBP) is an infection of the ascitic fluid without obvious intra-abdominal source of sepsis; usually complicates advanced liver disease. The pathogenesis of the disease is multifactorial: low ascitic protein-content, which reflects defi-cient ascitic fluid complement and hence, reduced opsonic activity is thought to be the most important pathogenic factor. Frequent and prolonged bacteremia has been considered as another pertinent cause of SBP. This disease is...

  11. Modelling bacterial speciation

    OpenAIRE

    2006-01-01

    A central problem in understanding bacterial speciation is how clusters of closely related strains emerge and persist in the face of recombination. We use a neutral Fisher–Wright model in which genotypes, defined by the alleles at 140 house-keeping loci, change in each generation by mutation or recombination, and examine conditions in which an initially uniform population gives rise to resolved clusters. Where recombination occurs at equal frequency between all members of the population, we o...

  12. Receptor tyrosine kinases in carcinogenesis.

    Science.gov (United States)

    Zhang, Xiao-Ying; Zhang, Pei-Ying

    2016-11-01

    Receptor tyrosine kinases (RTKs) are cell surface glycoproteins with enzymatic activity involved in the regulation of various important functions. In all-important physiological functions including differentiation, cell-cell interactions, survival, proliferation, metabolism, migration and signaling these receptors are the key players of regulation. Additionally, mutations of RTKs or their overexpression have been described in many human cancers and are being explored as a novel avenue for a new therapeutic approach. Some of the deregulated RTKs observed to be significantly affected in cancers included vascular endothelial growth factor receptor, epidermal growth factor receptor, fibroblast growth factor receptor, RTK-like orphan receptor 1 (ROR1) and the platelet-derived growth factor receptor. These deregulated RTKs offer attractive possibilities for the new anticancer therapeutic approach involving specific targeting by monoclonal antibodies as well as kinase. The present review aimed to highlight recent perspectives of RTK ROR1 in cancer.

  13. Endocytosis of Receptor Tyrosine Kinases

    Science.gov (United States)

    Goh, Lai Kuan

    2013-01-01

    Endocytosis is the major regulator of signaling from receptor tyrosine kinases (RTKs). The canonical model of RTK endocytosis involves rapid internalization of an RTK activated by ligand binding at the cell surface and subsequent sorting of internalized ligand-RTK complexes to lysosomes for degradation. Activation of the intrinsic tyrosine kinase activity of RTKs results in autophosphorylation, which is mechanistically coupled to the recruitment of adaptor proteins and conjugation of ubiquitin to RTKs. Ubiquitination serves to mediate interactions of RTKs with sorting machineries both at the cell surface and on endosomes. The pathways and kinetics of RTK endocytic trafficking, molecular mechanisms underlying sorting processes, and examples of deviations from the standard trafficking itinerary in the RTK family are discussed in this work. PMID:23637288

  14. DMPD: Bruton's tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signalling? [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15081522 Bruton's tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signall...ruton's tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signalling? PubmedID 15081522 Title Bruton...'s tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signalling? Authors

  15. Adaptive Bacterial Foraging Optimization

    Directory of Open Access Journals (Sweden)

    Hanning Chen

    2011-01-01

    Full Text Available Bacterial Foraging Optimization (BFO is a recently developed nature-inspired optimization algorithm, which is based on the foraging behavior of E. coli bacteria. Up to now, BFO has been applied successfully to some engineering problems due to its simplicity and ease of implementation. However, BFO possesses a poor convergence behavior over complex optimization problems as compared to other nature-inspired optimization techniques. This paper first analyzes how the run-length unit parameter of BFO controls the exploration of the whole search space and the exploitation of the promising areas. Then it presents a variation on the original BFO, called the adaptive bacterial foraging optimization (ABFO, employing the adaptive foraging strategies to improve the performance of the original BFO. This improvement is achieved by enabling the bacterial foraging algorithm to adjust the run-length unit parameter dynamically during algorithm execution in order to balance the exploration/exploitation tradeoff. The experiments compare the performance of two versions of ABFO with the original BFO, the standard particle swarm optimization (PSO and a real-coded genetic algorithm (GA on four widely-used benchmark functions. The proposed ABFO shows a marked improvement in performance over the original BFO and appears to be comparable with the PSO and GA.

  16. Neglected bacterial zoonoses.

    Science.gov (United States)

    Chikeka, I; Dumler, J S

    2015-05-01

    Bacterial zoonoses comprise a group of diseases in humans or animals acquired by direct contact with or by oral consumption of contaminated animal materials, or via arthropod vectors. Among neglected infections, bacterial zoonoses are among the most neglected given emerging data on incidence and prevalence as causes of acute febrile illness, even in areas where recognized neglected tropical diseases occur frequently. Although many other bacterial infections could also be considered in this neglected category, five distinct infections stand out because they are globally distributed, are acute febrile diseases, have high rates of morbidity and case fatality, and are reported as commonly as malaria, typhoid or dengue virus infections in carefully designed studies in which broad-spectrum diagnoses are actively sought. This review will focus attention on leptospirosis, relapsing fever borreliosis and rickettsioses, including scrub typhus, murine typhus and spotted fever group rickettsiosis. Of greatest interest is the lack of distinguishing clinical features among these infections when in humans, which confounds diagnosis where laboratory confirmation is lacking, and in regions where clinical diagnosis is often attributed to one of several perceived more common threats. As diseases such as malaria come under improved control, the real impact of these common and under-recognized infections will become evident, as will the requirement for the strategies and allocation of resources for their control.

  17. Oncoprotein protein kinase antibody kit

    Science.gov (United States)

    Karin, Michael; Hibi, Masahiko; Lin, Anning

    2008-12-23

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  18. RIP Kinases Initiate Programmed Necrosis

    Institute of Scientific and Technical Information of China (English)

    Lorenzo Galluzzi; Oliver Kepp; Guido Kroemer

    2009-01-01

    Some lethal stimuli can induce either apoptosis or necrosis, depending on the cell type and/or experimental setting. Until recently,the molecular bases of this phenomenon were largely unknown. Now, two members of the receptor-interacting serine-threonine kinase (RIP) family, RIP1 and RIP3, have been demonstrated to control the switch between apoptotic and necrotic cell death.Some mechanistic details, however, remain controversial.

  19. Regulation and function of TPL-2,an IκB kinase-regulated MAP kinase kinase kinase

    Institute of Scientific and Technical Information of China (English)

    Thorsten Gantke; Srividya Sriskantharajah; Steven C Ley

    2011-01-01

    The IκB kinase(IKK)complex plays a well-documented role in innate and adaptive immunity.This function has been widely attributed to its role as the central activator of the NF-κB family of transcription factors.However,another important consequence of IKK activation is the regulation of TPL-2,a MEK kinase that is required for activation of ERK-1/2 MAP kinases in myeioid cells following Toll-like receptor and TNF receptor stimulation.In unstimulated cells,TPL-2 is stoichiometrically complexed with the NF-κB inhibitory protein NF-κB1 p105,which blocks TPL-2 access to its substrate MEK,and the ubiquitin-binding protein ABIN-2(A20-binding inhibitor of NF-κB 2),both of which are required to maintain TPL-2 protein stability.Following agonist stimulation,the IKK complex phosphorylates p105,triggering its K48-1inked ubiquitination and degradation by the proteasome.This releases TPL-2 from p105-mediated inhibition,facilitating activation of MEK,in addition to modulating NF-κB activation by liberating associated Rel subunits for translocation into the nucleus.IKK-induced proteolysis of 0105,therefore,can directly regulate both NF-κB and ERK MAP kinase activation via NF-κB1 p105.TPL-2 is critical for production of the proinflammatory cytokine TNF during inflammatory responses.Consequently,there has been considerable interest in the pharmaceutical industry to develop selective TPL-2 inhibitors as drugs for the treatment of TNF-dependent inflammatory,diseases,such as rheumatoid arthritis and inflammatory bowel disease.This review summarizes our current understanding of the regulation of TPL-2 signaling function,and also the complex positive and negative roles of TPL-2 in immune and inflammatory responses.

  20. Oxidized Form of Creatine Kinase

    Institute of Scientific and Technical Information of China (English)

    王希成; 王帆; 邹晓明; 周海梦

    1994-01-01

    The purified rabbit muscle creatine kinase (R-CK) was previously considered homogeneousand without disulfide bonds.By the method of NR/R two-dimensional diagonal SDS-PAGE,two forms of R-CK,designated respectively "oxidized form" of creatine kinase which contained intrachain disulfide bondsand "reduced form" of creatine kinase which did not have any —S—S— bridges,were for the first time sepa-rated.They were found to be the same in amino acid composition,in subunit molecular Weight and in isoelec-tric point,and were almost identical in enzyme activities.Thus it is hard to isolate one from the other bycommon biochemical methods.More extensive studies show that the oxidized form of CK also contains a pair of reactive thiol groupswhich are essential to the enzyme activity,and it has one intrachain disulfide bond per subunit.In the nativestate,this —S—S— bond cannot be reduced by DTT,but by treating the reduced form of CK with some ox-idants,these —S—S— bonds can be formed in vitro.Thus it is presumed that the disulfide bonds are cross-linked through the oxidization of two shallowly buried —SH groups.

  1. A proteomic approach for comprehensively screening substrates of protein kinases such as Rho-kinase.

    Directory of Open Access Journals (Sweden)

    Mutsuki Amano

    Full Text Available BACKGROUND: Protein kinases are major components of signal transduction pathways in multiple cellular processes. Kinases directly interact with and phosphorylate downstream substrates, thus modulating their functions. Despite the importance of identifying substrates in order to more fully understand the signaling network of respective kinases, efficient methods to search for substrates remain poorly explored. METHODOLOGY/PRINCIPAL FINDINGS: We combined mass spectrometry and affinity column chromatography of the catalytic domain of protein kinases to screen potential substrates. Using the active catalytic fragment of Rho-kinase/ROCK/ROK as the model bait, we obtained about 300 interacting proteins from the rat brain cytosol fraction, which included the proteins previously reported as Rho-kinase substrates. Several novel interacting proteins, including doublecortin, were phosphorylated by Rho-kinase both in vitro and in vivo. CONCLUSIONS/SIGNIFICANCE: This method would enable identification of novel specific substrates for kinases such as Rho-kinase with high sensitivity.

  2. Association of protein kinase Cmu with type II phosphatidylinositol 4-kinase and type I phosphatidylinositol-4-phosphate 5-kinase.

    Science.gov (United States)

    Nishikawa, K; Toker, A; Wong, K; Marignani, P A; Johannes, F J; Cantley, L C

    1998-09-04

    Protein kinase Cmu (PKCmu), also named protein kinase D, is an unusual member of the PKC family that has a putative transmembrane domain and pleckstrin homology domain. This enzyme has a substrate specificity distinct from other PKC isoforms (Nishikawa, K., Toker, A., Johannes, F. J., Songyang, Z., and Cantley, L. C. (1997) J. Biol. Chem. 272, 952-960), and its mechanism of regulation is not yet clear. Here we show that PKCmu forms a complex in vivo with a phosphatidylinositol 4-kinase and a phosphatidylinositol-4-phosphate 5-kinase. A region of PKCmu between the amino-terminal transmembrane domain and the pleckstrin homology domain is shown to be involved in the association with the lipid kinases. Interestingly, a kinase-dead point mutant of PKCmu failed to associate with either lipid kinase activity, indicating that autophosphorylation may be required to expose the lipid kinase interaction domain. Furthermore, the subcellular distribution of the PKCmu-associated lipid kinases to the particulate fraction depends on the presence of the amino-terminal region of PKCmu including the predicted transmembrane region. These results suggest a novel model in which the non-catalytic region of PKCmu acts as a scaffold for assembly of enzymes involved in phosphoinositide synthesis at specific membrane locations.

  3. Adenylate kinase-independent thiamine triphosphate accumulation under severe energy stress in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Wins Pierre

    2008-01-01

    Full Text Available Abstract Background Thiamine triphosphate (ThTP exists in most organisms and might play a role in cellular stress responses. In E. coli, ThTP is accumulated in response to amino acid starvation but the mechanism of its synthesis is still a matter of controversy. It has been suggested that ThTP is synthesized by an ATP-dependent specific thiamine diphosphate kinase. However, it is also known that vertebrate adenylate kinase 1 catalyzes ThTP synthesis at a very low rate and it has been postulated that this enzyme is responsible for ThTP synthesis in vivo. Results Here we show that bacterial, as vertebrate adenylate kinases are able to catalyze ThTP synthesis, but at a rate more than 106-fold lower than ATP synthesis. This activity is too low to explain the high rate of ThTP accumulation observed in E. coli during amino acid starvation. Moreover, bacteria from the heat-sensitive CV2 strain accumulate high amounts of ThTP (>50% of total thiamine at 37°C despite complete inactivation of adenylate kinase and a subsequent drop in cellular ATP. Conclusion These results clearly demonstrate that adenylate kinase is not responsible for ThTP synthesis in vivo. Furthermore, they show that E. coli accumulate large amounts of ThTP under severe energy stress when ATP levels are very low, an observation not in favor of an ATP-dependent mechanisms for ThTP synthesis.

  4. Bacterial chromosome segregation.

    Science.gov (United States)

    Possoz, Christophe; Junier, Ivan; Espeli, Olivier

    2012-01-01

    Dividing cells have mechanisms to ensure that their genomes are faithfully segregated into daughter cells. In bacteria, the description of these mechanisms has been considerably improved in the recent years. This review focuses on the different aspects of bacterial chromosome segregation that can be understood thanks to the studies performed with model organisms: Escherichia coli, Bacillus subtilis, Caulobacter crescentus and Vibrio cholerae. We describe the global positionning of the nucleoid in the cell and the specific localization and dynamics of different chromosomal loci, kinetic and biophysic aspects of chromosome segregation are presented. Finally, a presentation of the key proteins involved in the chromosome segregation is made.

  5. Bacterial Degradation of Pesticides

    DEFF Research Database (Denmark)

    Knudsen, Berith Elkær

    This PhD project was carried out as part of the Microbial Remediation of Contaminated Soil and Water Resources (MIRESOWA) project, funded by the Danish Council for Strategic Research (grant number 2104-08-0012). The environment is contaminated with various xenobiotic compounds e.g. pesticides......D student, to construct fungal-bacterial consortia in order to potentially stimulate pesticide degradation thereby increasing the chance of successful bioaugmentation. The results of the project are reported in three article manuscripts, included in this thesis. In manuscript I, the mineralization of 2...

  6. Spontaneous bacterial peritonitis

    Directory of Open Access Journals (Sweden)

    Al Amri Saleh

    1995-01-01

    Full Text Available Spontaneous bacterial peritonitis (SBP is an infection of the ascitic fluid without obvious intra-abdominal source of sepsis; usually complicates advanced liver disease. The pathogenesis of the disease is multifactorial: low ascitic protein-content, which reflects defi-cient ascitic fluid complement and hence, reduced opsonic activity is thought to be the most important pathogenic factor. Frequent and prolonged bacteremia has been considered as another pertinent cause of SBP. This disease is associated with high mortality and recurrence. Therefore, orompt recognition and institution of therapy and plan of prophylaxis is vital.

  7. Bacterial mitotic machineries

    DEFF Research Database (Denmark)

    Gerdes, Kenn; Møller-Jensen, Jakob; Ebersbach, Gitte;

    2004-01-01

    Here, we review recent progress that yields fundamental new insight into the molecular mechanisms behind plasmid and chromosome segregation in prokaryotic cells. In particular, we describe how prokaryotic actin homologs form mitotic machineries that segregate DNA before cell division. Thus, the Par......M protein of plasmid R1 forms F actin-like filaments that separate and move plasmid DNA from mid-cell to the cell poles. Evidence from three different laboratories indicate that the morphogenetic MreB protein may be involved in segregation of the bacterial chromosome....

  8. Protein kinase CK2 structure-function relationship

    DEFF Research Database (Denmark)

    Boldyreff, B; Meggio, F; Pinna, L A

    1994-01-01

    Protein kinase CK2 subunits alpha and beta were expressed either separately or together in a bacterial expression system (pT7-7/BL21(DE3)) and purified to homogeneity. After mixing the subunits, a CK2 holoenzyme (alpha 2 beta 2) was spontaneously reconstituted, which displays identical features...... inactivated through urea, protease, and heat treatment. In contrast, the holoenzyme, either reconstituted or native, is much more stable when similar negative insults prevail. The beta subunit has at least three functions: (a) it is necessary for maximum activity of the enzyme under physiological salt...... conditions, (b) it protects the alpha subunit against denaturing agents or conditions, and (c) it alters the substrate specificity of the alpha subunit. By site-directed mutagenesis, certain functions of the beta subunit could be assigned to specific amino acids or domains. Twenty one mutants of the beta...

  9. Protein Kinase D family kinases: roads start to segregate.

    Science.gov (United States)

    Wille, Christoph; Seufferlein, Thomas; Eiseler, Tim

    2014-01-01

    Highly invasive pancreatic tumors are often recognized in late stages due to a lack of clear symptoms and pose major challenges for treatment and disease management. Broad-band Protein Kinase D (PKD) inhibitors have recently been proposed as additional treatment option for this disease. PKDs are implicated in the control of cancer cell motility, angiogenesis, proliferation and metastasis. In particular, PKD2 expression is elevated in pancreatic cancer, whereas PKD1 expression is comparably lower. In our recent study we report that both kinases control PDAC cell invasive properties in an isoform-specific, but opposing manner. PKD1 selectively mediates anti-migratory/anti-invasive features by preferential regulation of the actin-regulatory Cofilin-phosphatase Slingshot1L (SSH1L). PKD2, on the other hand enhances invasion and angiogenesis of PDAC cells in 3D-ECM cultures and chorioallantois tumor models by stimulating expression and secretion of matrix-metalloproteinase 7 and 9 (MMP7/9). MMP9 also enhances PKD2-mediated tumor angiogenesis releasing extracellular matrix-bound VEGF-A. We thus suggest high PKD2 expression and loss of PKD1 may be beneficial for tumor cells to enhance their matrix-invading abilities. In our recent study we demonstrate for the first time PKD1 and 2 isoform-selective effects on pancreatic cancer cell invasion, in-vitro and in-vivo, defining isoform-specific regulation of PKDs as a major future issue.

  10. Comprehensive Characterization of AMP-Activated Protein Kinase Catalytic Domain by Top-Down Mass Spectrometry

    Science.gov (United States)

    Yu, Deyang; Peng, Ying; Ayaz-Guner, Serife; Gregorich, Zachery R.; Ge, Ying

    2016-02-01

    AMP-activated protein kinase (AMPK) is a serine/threonine protein kinase that is essential in regulating energy metabolism in all eukaryotic cells. It is a heterotrimeric protein complex composed of a catalytic subunit (α) and two regulatory subunits (β and γ). C-terminal truncation of AMPKα at residue 312 yielded a protein that is active upon phosphorylation of Thr172 in the absence of β and γ subunits, which is refered to as the AMPK catalytic domain and commonly used to substitute for the AMPK heterotrimeric complex in in vitro kinase assays. However, a comprehensive characterization of the AMPK catalytic domain is lacking. Herein, we expressed a His-tagged human AMPK catalytic domin (denoted as AMPKΔ) in E. coli, comprehensively characterized AMPKΔ in its basal state and after in vitro phosphorylation using top-down mass spectrometry (MS), and assessed how phosphorylation of AMPKΔ affects its activity. Unexpectedly, we found that bacterially-expressed AMPKΔ was basally phosphorylated and localized the phosphorylation site to the His-tag. We found that AMPKΔ had noticeable basal activity and was capable of phosphorylating itself and its substrates without activating phosphorylation at Thr172. Moreover, our data suggested that Thr172 is the only site phosphorylated by its upstream kinase, liver kinase B1, and that this phosphorylation dramatically increases the kinase activity of AMPKΔ. Importantly, we demonstrated that top-down MS in conjunction with in vitro phosphorylation assay is a powerful approach for monitoring phosphorylation reaction and determining sequential order of phosphorylation events in kinase-substrate systems.

  11. MAP kinases and histone modification

    Institute of Scientific and Technical Information of China (English)

    Tamaki Suganuma; Jerry L. Workman

    2012-01-01

    Signal transduction pathways alter the gene expression program in response to extracellular or intracellular cues.Mitogen-activated protein kinases (MAPKs) govern numerous cellular processes including cell growth,stress response,apoptosis,and differentiation.In the past decade,MAPKs have been shown to regulate the transcription machinery and associate with chromatin-modifying complexes.Moreover,recent studies demonstrate that several MAPKs bind directly to chromatin at target genes.This review highlights the recent discoveries of MAPK signaling in regard to histone modifications and chromatin regulation.Evidence suggesting that further unknown mechanisms integrate signal transduction with chromatin biology is discussed.

  12. Assessing protein kinase target similarity

    DEFF Research Database (Denmark)

    Gani, Osman A; Thakkar, Balmukund; Narayanan, Dilip

    2015-01-01

    : focussed chemical libraries, drug repurposing, polypharmacological design, to name a few. Protein kinase target similarity is easily quantified by sequence, and its relevance to ligand design includes broad classification by key binding sites, evaluation of resistance mutations, and the use of surrogate......" of sequence and crystal structure information, with statistical methods able to identify key correlates to activity but also here, "the devil is in the details." Examples from specific repurposing and polypharmacology applications illustrate these points. This article is part of a Special Issue entitled...

  13. Spontaneous bacterial peritonitis

    Institute of Scientific and Technical Information of China (English)

    Anastasios Koulaouzidis; Shivaram Bhat; Athar A Saeed

    2009-01-01

    Since its initial description in 1964, research has transformed spontaneous bacterial peritonitis (SBP) from a feared disease (with reported mortality of 90%) to a treatable complication of decompensated cirrhosis,albeit with steady prevalence and a high recurrence rate. Bacterial translocation, the key mechanism in the pathogenesis of SBP, is only possible because of the concurrent failure of defensive mechanisms in cirrhosis.Variants of SBP should be treated. Leucocyte esterase reagent strips have managed to shorten the 'tap-toshot' time, while future studies should look into their combined use with ascitic fluid pH. Third generation cephalosporins are the antibiotic of choice because they have a number of advantages. Renal dysfunction has been shown to be an independent predictor of mortality in patients with SBP. Albumin is felt to reduce the risk of renal impairment by improving effective intravascular volume, and by helping to bind proinflammatory molecules. Following a single episode of SBP, patients should have long-term antibiotic prophylaxis and be considered for liver transplantation.

  14. MST kinases in development and disease

    OpenAIRE

    Thompson, Barry J.; Sahai, Erik

    2015-01-01

    The mammalian MST kinase family, which is related to the Hippo kinase in Drosophila melanogaster, includes five related proteins: MST1 (also called STK4), MST2 (also called STK3), MST3 (also called STK24), MST4, and YSK1 (also called STK25 or SOK1). MST kinases are emerging as key signaling molecules that influence cell proliferation, organ size, cell migration, and cell polarity. Here we review the regulation and function of these kinases in normal physiology and pathologies, including cance...

  15. MST kinases in development and disease.

    Science.gov (United States)

    Thompson, Barry J; Sahai, Erik

    2015-09-14

    The mammalian MST kinase family, which is related to the Hippo kinase in Drosophila melanogaster, includes five related proteins: MST1 (also called STK4), MST2 (also called STK3), MST3 (also called STK24), MST4, and YSK1 (also called STK25 or SOK1). MST kinases are emerging as key signaling molecules that influence cell proliferation, organ size, cell migration, and cell polarity. Here we review the regulation and function of these kinases in normal physiology and pathologies, including cancer, endothelial malformations, and autoimmune disease.

  16. Antimicrobials for bacterial bioterrorism agents.

    Science.gov (United States)

    Sarkar-Tyson, Mitali; Atkins, Helen S

    2011-06-01

    The limitations of current antimicrobials for highly virulent pathogens considered as potential bioterrorism agents drives the requirement for new antimicrobials that are suitable for use in populations in the event of a deliberate release. Strategies targeting bacterial virulence offer the potential for new countermeasures to combat bacterial bioterrorism agents, including those active against a broad spectrum of pathogens. Although early in the development of antivirulence approaches, inhibitors of bacterial type III secretion systems and cell division mechanisms show promise for the future.

  17. The Arabidopsis kinase-associated protein phosphatase controls internalization of the somatic embryogenesis receptor kinase 1

    NARCIS (Netherlands)

    Shah, K.; Russinova, E.; Gadella, T.W.J.; Willemse, J.; Vries, de S.C.

    2002-01-01

    The AtSERK1 protein is a plasma membrane-located LRR receptor-like serine threonine kinase that is transiently expressed during plant embryogenesis. Our results show that AtSERK1 interacts with the kinase-associated protein phosphatase (KAPP) in vitro. The kinase interaction (KI) domain of KAPP does

  18. Comparison of Peptide Array Substrate Phosphorylation of c-Raf and Mitogen Activated Protein Kinase Kinase Kinase 8

    NARCIS (Netherlands)

    Parikh, Kaushal; Diks, Sander H.; Tuynman, Jurriaan H. B.; Verhaar, Auke; Lowenberg, Mark; Hommes, Daan W.; Joore, Jos; Pandey, Akhilesh; Peppelenbosch, Maikel P.

    2009-01-01

    Kinases are pivotal regulators of cellular physiology. The human genome contains more than 500 putative kinases, which exert their action via the phosphorylation of specific substrates. The determinants of this specificity are still only partly understood and as a consequence it is difficult to pred

  19. Novel Library of Selenocompounds as Kinase Modulators

    Directory of Open Access Journals (Sweden)

    Carmen Sanmartín

    2011-07-01

    Full Text Available Although the causes of cancer lie in mutations or epigenic changes at the genetic level, their molecular manifestation is the dysfunction of biochemical pathways at the protein level. The 518 protein kinases encoded by the human genome play a central role in various diseases, a fact that has encouraged extensive investigations on their biological function and three dimensional structures. Selenium (Se is an important nutritional trace element involved in different physiological functions with antioxidative, antitumoral and chemopreventive properties. The mechanisms of action for selenocompounds as anticancer agents are not fully understood, but kinase modulation seems to be a possible pathway. Various organosulfur compounds have shown antitumoral and kinase inhibition effects but, in many cases, the replacement of sulfur by selenium improves the antitumoral effect of compounds. Although Se atom possesses a larger atomic volume and nucleophilic character than sulfur, Se can also formed interactions with aminoacids of the catalytic centers of proteins. So, we propose a novel chemical library that includes organoselenium compounds as kinase modulators. In this study thirteen selenocompounds have been evaluated at a concentration of 3 or 10 µM in a 24 kinase panel using a Caliper LabChip 3000 Drug Discover Platform. Several receptor (EGFR, IGFR1, FGFR1… and non-receptor (Abl kinases have been selected, as well as serine/threonine/lipid kinases (AurA, Akt, CDKs, MAPKs… implicated in main cancer pathways: cell cycle regulation, signal transduction, angiogenesis regulation among them. The obtained results showed that two compounds presented inhibition values higher than 50% in at least four kinases and seven derivatives selectively inhibited one or two kinases. Furthermore, three compounds selectively activated IGF-1R kinase with values ranging from −98% to −211%. In conclusion, we propose that the replacement of sulfur by selenium seems to be

  20. [Characterization of a putative S locus encoded receptor protein kinase and its role in self-incompatibility

    Energy Technology Data Exchange (ETDEWEB)

    1993-01-01

    The serine/threonine protein kinase (SRK) protein was predicted to be similar to the growth factor receptor tyrosine kinases in animals but its amino acid sequence of the catalytic domain is more similar to that of the catalytic domains of protein serine/threonine kinases than to protein tyrosine kinases. We have shown that the SRK protein has intrinsic scrine/threonine kinase activity. We subcloned the protein kinase-homologous domain of the SRK[sub 6] cDNA into the bacterial expression vector pGEX-3X and we have constructed a second plasmid identical to the first except that it carried a conservative mutation that substituted Arg for the Lys[sup 524] codon of SRK6 This lysine corresponds to the ATP-binding site, is essential in protein kinases, and is a common target for site-directed mutagenesis as a means to obtain kinase-defective proteins. Cultures bearing the wild-type and mutant SRK catalytic domains each produced an approximately 64 kD protein that reacted with anti-SRK6 antibodies. Following pulse-labeling with [sup 32]P we found that the wild-type SRK6 protein but not the mutant form was detectably phosphorylated. Phosphoamino acid analysis of the affinity purified [sup 32]p-labeled GST-SRK6 fusion protein demonstrated that SRK was phosphorylated predominantly on semine and to a lesser extent on threonine, but not on tyrosine. Thus, SRK6 is a functional serine/threonine protein kinase.

  1. Escherichia coli UMP-kinase, a member of the aspartokinase family, is a hexamer regulated by guanine nucleotides and UTP.

    Science.gov (United States)

    Serina, L; Blondin, C; Krin, E; Sismeiro, O; Danchin, A; Sakamoto, H; Gilles, A M; Bârzu, O

    1995-04-18

    The pyrH gene, encoding UMP-kinase from Escherichia coli, was cloned using as a genetic probe the property of the carAB operon to be controlled for its expression by the concentration of cytoplasmic UTP. The open reading frame of the pyrH gene of 723 bp was found to be identical to that of the smbA gene [Yamanaka, K., et al. (1992) J. Bacteriol. 174, 7517-7526], previously described as being involved in chromosome partitioning in E. coli. The bacterial UMP-kinase did not display significant sequence similarity to known nucleoside monophosphate kinases. On the contrary, it exhibited similarity with three families of enzymes including aspartokinases, glutamate kinases, and Pseudomonas aeruginosa carbamate kinase. UMP-kinase overproduced in E. coli was purified to homogeneity and analyzed for its structural and catalytic properties. The protein consists of six identical subunits, each of 240 amino acid residues (the N-terminal methionine residue is missing in the expressed protein). Upon excitation at 295 nm, the bacterial enzyme exhibits a fluorescence emission spectrum with maximum at 332 nm which indicates that the single tryptophan residue of the protein (Trp119) is located in a hydrophobic environment. Like other enzymes involved in the de novo synthesis of pyrimidine nucleotides, UMP-kinase of E. coli is subject to regulation by nucleotides: GTP is an allosteric activator, whereas UTP serves as an allosteric inhibitor. UTP and UDP, but none of the other nucleotides tested such as GTP, ATP, and UMP, enhanced the fluorescence of the protein. The sigmoidal shape of the dose-response curve indicated cooperativity in binding of UTP and UDP.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Epigenetics and bacterial infections.

    Science.gov (United States)

    Bierne, Hélène; Hamon, Mélanie; Cossart, Pascale

    2012-12-01

    Epigenetic mechanisms regulate expression of the genome to generate various cell types during development or orchestrate cellular responses to external stimuli. Recent studies highlight that bacteria can affect the chromatin structure and transcriptional program of host cells by influencing diverse epigenetic factors (i.e., histone modifications, DNA methylation, chromatin-associated complexes, noncoding RNAs, and RNA splicing factors). In this article, we first review the molecular bases of the epigenetic language and then describe the current state of research regarding how bacteria can alter epigenetic marks and machineries. Bacterial-induced epigenetic deregulations may affect host cell function either to promote host defense or to allow pathogen persistence. Thus, pathogenic bacteria can be considered as potential epimutagens able to reshape the epigenome. Their effects might generate specific, long-lasting imprints on host cells, leading to a memory of infection that influences immunity and might be at the origin of unexplained diseases.

  3. Bacterial polyhydroxyalkanoates: Still fabulous?

    Science.gov (United States)

    Możejko-Ciesielska, Justyna; Kiewisz, Robert

    2016-11-01

    Bacterial polyhydroxyalkanoates (PHA) are polyesters accumulated as carbon and energy storage materials under limited growth conditions in the presence of excess carbon sources. They have been developed as biomaterials with unique properties for the past many years being considered as a potential substitute for conventional non-degradable plastics. Due to the increasing concern towards global climate change, depleting petroleum resource and problems with an utilization of a growing number of synthetic plastics, PHAs have gained much more attention from industry and research. These environmentally friendly microbial polymers have great potential in biomedical, agricultural, and industrial applications. However, their production on a large scale is still limited. This paper describes the backgrounds of PHAs and discussed the current state of knowledge on the polyhydroxyalkanoates. Ability of bacteria to convert different carbon sources to PHAs, the opportunities and challenges of their introduction to global market as valuable renewable products have been also discussed.

  4. Measuring the Activity of Leucine-Rich Repeat Kinase 2: A Kinase Involved in Parkinson's Disease

    Science.gov (United States)

    Lee, Byoung Dae; Li, Xiaojie; Dawson, Ted M.; Dawson, Valina L.

    2015-01-01

    Mutations in the LRRK2 (Leucine-Rich Repeat Kinase 2) gene are the most common cause of autosomal dominant Parkinson's disease. LRRK2 has multiple functional domains including a kinase domain. The kinase activity of LRRK2 is implicated in the pathogenesis of Parkinson's disease. Developing an assay to understand the mechanisms of LRRK2 kinase activity is important for the development of pharmacologic and therapeutic applications. Here, we describe how to measure in vitro LRRK2 kinase activity and its inhibition. PMID:21960214

  5. Mutational profiling of kinases in glioblastoma

    NARCIS (Netherlands)

    F.E. Bleeker (Fonnet); S. Lamba (Simona); C. Zanon (Carlo); R.J. Molenaar (Remco J.); T. Hulsebos (Theo); D. Troost (Dirk); A.A.G. van Tilborg (Angela); W.P. Vandertop (Peter); S. Leenstra (Sieger); C.J.F. van Noorden (Cornelis); A. Bardelli (Alberto)

    2014-01-01

    textabstractBackground: Glioblastoma is a highly malignant brain tumor for which no cure is available. To identify new therapeutic targets, we performed a mutation analysis of kinase genes in glioblastoma.Methods: Database mining and a literature search identified 76 kinases that have been found to

  6. Regulation of the interaction between protein kinase C-related protein kinase 2 (PRK2) and its upstream kinase, 3-phosphoinositide-dependent protein kinase 1 (PDK1)

    DEFF Research Database (Denmark)

    Dettori, Rosalia; Sonzogni, Silvina; Meyer, Lucas;

    2009-01-01

    The members of the AGC kinase family frequently exhibit three conserved phosphorylation sites: the activation loop, the hydrophobic motif (HM), and the zipper (Z)/turn-motif (TM) phosphorylation site. 3-Phosphoinositide-dependent protein kinase 1 (PDK1) phosphorylates the activation loop of numer...

  7. TYROSINE KINASE INHIBITORS AND PREGNANCY

    Directory of Open Access Journals (Sweden)

    Elisabetta Abruzzese

    2014-04-01

    Full Text Available The management of patients with chronic myeloid leukemia (CML during pregnancy has became recently a matter of continuous debate.  The introduction of the Tyrosine Kinase Inhibitors (TKIs in clinical practice has dramatically changed the prognosis of CML patients.  Patients diagnosed in chronic phase can reasonably expect many years of excellent disease control and good quality of life, as well as a normal life expectancy.  This fact has come the necessity to address issues relating to fertility and pregnancy. Physicians are not infrequently being asked for advice regarding the need for, and or the appropriateness of, stopping treatment in order to conceive. In this report we will review the data published in terms of fertility, conception, pregnancy, pregnancy outcome and illness control for all the approved TKIs, as well as suggest how to manage a planned and/or unplanned pregnancy.

  8. Activation of AMPK enhances neutrophil chemotaxis and bacterial killing.

    Science.gov (United States)

    Park, Dae Won; Jiang, Shaoning; Tadie, Jean-Marc; Stigler, William S; Gao, Yong; Deshane, Jessy; Abraham, Edward; Zmijewski, Jaroslaw W

    2013-11-08

    An inability of neutrophils to eliminate invading microorganisms is frequently associated with severe infection and may contribute to the high mortality rates associated with sepsis. In the present studies, we examined whether metformin and other 5' adenosine monophosphate-activated protein kinase (AMPK) activators affect neutrophil motility, phagocytosis and bacterial killing. We found that activation of AMPK enhanced neutrophil chemotaxis in vitro and in vivo, and also counteracted the inhibition of chemotaxis induced by exposure of neutrophils to lipopolysaccharide (LPS). In contrast, small interfering RNA (siRNA)-mediated knockdown of AMPKα1 or blockade of AMPK activation through treatment of neutrophils with the AMPK inhibitor compound C diminished neutrophil chemotaxis. In addition to their effects on chemotaxis, treatment of neutrophils with metformin or aminoimidazole carboxamide ribonucleotide (AICAR) improved phagocytosis and bacterial killing, including more efficient eradication of bacteria in a mouse model of peritonitis-induced sepsis. Immunocytochemistry showed that, in contrast to LPS, metformin or AICAR induced robust actin polymerization and distinct formation of neutrophil leading edges. Although LPS diminished AMPK phosphorylation, metformin or AICAR was able to partially decrease the effects of LPS/toll-like receptor 4 (TLR4) engagement on downstream signaling events, particularly LPS-induced IκBα degradation. The IκB kinase (IKK) inhibitor PS-1145 diminished IκBα degradation and also prevented LPS-induced inhibition of chemotaxis. These results suggest that AMPK activation with clinically approved agents, such as metformin, may facilitate bacterial eradication in sepsis and other inflammatory conditions associated with inhibition of neutrophil activation and chemotaxis.

  9. Bacterial degradation of aminopyrine.

    Science.gov (United States)

    Blecher, H; Blecher, R; Wegst, W; Eberspaecher, J; Lingens, F

    1981-11-01

    1. Four strains of bacteria growing with aminopyrine as sole source of carbon were isolated from soil and were identified as strains of Phenylobacterium immobilis. 2. Strain M13 and strain E, the type species of Phenylobacterium immobilis (DSM 1986), which had been isolated by enrichment with chloridazon (5-amino-4-chloro-2-phenyl-2H-pyridazin-3-one) were used to investigate the bacterial degradation of aminopyrine. 3. Three metabolites were isolated and identified as: 4-(dimethylamino)-1,2-dihydro-1,5-dimethyl-2-(2,3-dihydro-2,3-dihydroxy-4,6-cyc lohexadien-1-yl)-3H-pyrazol-3-one, 4-(dimethylamino)-1,2-dihydro-1,5-dimethyl-2-(2,3-dihydroxyphenyl)-3H-pyrazol-3 -one and 4-(dimethylamino)-1,2-dihydro-1,5-dimethyl-3H-pyrazol-3-one. 4. An enzyme extract from cells of strain m13 was shown to further metabolize the catechol derivative of aminopyrine, with the formation of 2-pyrone-6-carboxylic acid. 5. Results indicate that the benzene ring of aminopyrine is the principal site of microbial metabolism.

  10. Electromagnetism of Bacterial Growth

    Science.gov (United States)

    Ainiwaer, Ailiyasi

    2011-10-01

    There has been increasing concern from the public about personal health due to the significant rise in the daily use of electrical devices such as cell phones, radios, computers, GPS, video games and television. All of these devices create electromagnetic (EM) fields, which are simply magnetic and electric fields surrounding the appliances that simultaneously affect the human bio-system. Although these can affect the human system, obstacles can easily shield or weaken the electrical fields; however, magnetic fields cannot be weakened and can pass through walls, human bodies and most other objects. The present study was conducted to examine the possible effects of bacteria when exposed to magnetic fields. The results indicate that a strong causal relationship is not clear, since different magnetic fields affect the bacteria differently, with some causing an increase in bacterial cells, and others causing a decrease in the same cells. This phenomenon has yet to be explained, but the current study attempts to offer a mathematical explanation for this occurrence. The researchers added cultures to the magnetic fields to examine any effects to ion transportation. Researchers discovered ions such as potassium and sodium are affected by the magnetic field. A formula is presented in the analysis section to explain this effect.

  11. Evolution of Bacterial Suicide

    Science.gov (United States)

    Tchernookov, Martin; Nemenman, Ilya

    2013-03-01

    While active, controlled cellular suicide (autolysis) in bacteria is commonly observed, it has been hard to argue that autolysis can be beneficial to an individual who commits it. We propose a theoretical model that predicts that bacterial autolysis is evolutionarily advantageous to an individualand would fixate in physically structured environments for stationary phase colonies. We perform spatially resolved agent-based simulations of the model, which predict that lower mixing in the environment results in fixation of a higher autolysis rate from a single mutated cell, regardless of the colony's genetic diversity. We argue that quorum sensing will fixate as well, even if initially rare, if it is coupled to controlling the autolysis rate. The model does not predict a strong additional competitive advantage for cells where autolysis is controlled by quorum sensing systems that distinguish self from nonself. These predictions are broadly supported by recent experimental results in B. subtilisand S. pneumoniae. Research partially supported by the James S McDonnell Foundation grant No. 220020321 and by HFSP grant No. RGY0084/2011.

  12. Bacterial endocarditis prophylaxis.

    Science.gov (United States)

    Blanco-Carrión, Andrés

    2004-01-01

    Bacterial endocarditis (BE) is a disease resulting from the association of morphological alterations of the heart and bacteraemia originating from different sources that at times can be indiscernible (infectious endocarditis). It is classified on the basis of the morphological alteration involved, depending on the clinical manifestations and course of illness, which varies according to the causative microorganism and host conditions (for example, it is characteristic in I.V. drug users). The most common microorganisms involved are: Streptococcus viridans (55%), Staphylococcus aureus (30%), Enterococcus (6%) and HACEK bacteria (corresponding to the initials: Haemophilus, Actinobacillus, Cardiobacterium, Eikenella and Kingella), although on occasions it can also be caused by fungi. The oral microbiological flora plays a very important role in the aetiopathogenesis of BE, given that the condition may be of oral or dental origin. This paper will deal with the prevention of said bacteraemia. Prophylaxis will be undertaken using amoxicillin or clindamycin according to action protocols, with special emphasis placed on oral hygiene in patients with structural defects of the heart.

  13. Physiological roles of mitogen-activated-protein-kinase-activated p38-regulated/activated protein kinase

    Institute of Scientific and Technical Information of China (English)

    Sergiy; Kostenko; Gianina; Dumitriu; Kari; Jenssen; Lgreid; Ugo; Moens

    2011-01-01

    Mitogen-activated protein kinases(MAPKs)are a family of proteins that constitute signaling pathways involved in processes that control gene expression,cell division, cell survival,apoptosis,metabolism,differentiation and motility.The MAPK pathways can be divided into conventional and atypical MAPK pathways.The first group converts a signal into a cellular response through a relay of three consecutive phosphorylation events exerted by MAPK kinase kinases,MAPK kinase,and MAPK.Atypical MAPK pathways are not organized into this three-tiered cascade.MAPK that belongs to both conventional and atypical MAPK pathways can phosphorylate both non-protein kinase substrates and other protein kinases.The latter are referred to as MAPK-activated protein kinases.This review focuses on one such MAPK-activated protein kinase,MAPK-activated protein kinase 5(MK5)or p38-regulated/activated protein kinase(PRAK).This protein is highly conserved throughout the animal kingdom and seems to be the target of both conventional and atypical MAPK pathways.Recent findings on the regulation of the activity and subcellular localization,bona fide interaction partners and physiological roles of MK5/PRAK are discussed.

  14. The mechanism of protein kinase C regulation

    Institute of Scientific and Technical Information of China (English)

    Julhash U. KAZI

    2011-01-01

    Protein kinase C (PKC) is a family ofserine/threonine protein kinases that plays a central role in transducing extracellular signals into a variety of intracellular responses ranging from cell proliferation to apoptosis.Nine PKC genes have been identified in the human genome,which encode 10 proteins.Each member of this protein kinase family displays distinct biochemical characteristics and is enriched in different cellular and subcellular locations.Activation of PKC has been implicated in the regulation of cell growth and differentiation.This review summarizes works of the past years in the field of PKC biochemistry that covers regulation and activation mechanism of different PKC isoforms.

  15. Functional analysis of anomeric sugar kinases.

    Science.gov (United States)

    Conway, Louis P; Voglmeir, Josef

    2016-09-02

    Anomeric sugar kinases perform fundamental roles in the metabolism of carbohydrates. Under- or overexpression of these enzymes, or mutations causing functional impairments can give rise to diseases such as galactosaemia and so the study of this class of kinase is of critical importance. In addition, anomeric sugar kinases which are naturally promiscuous, or have been artificially made so, may find application in the synthesis of libraries of drug candidates (for example, antibiotics), and natural or unnatural oligosaccharides and glycoconjugates. In this review, we provide an overview of the biological functions of these enzymes, the tools which have been developed to investigate them, and the current frontiers in their study.

  16. Cloning, Expression, and Purification of Nucleoside Diphosphate Kinase from Acinetobacter baumannii

    Directory of Open Access Journals (Sweden)

    Juhi Sikarwar

    2013-01-01

    Full Text Available Acinetobacter baumannii is a multidrug resistant pathogenic bacteria associated with hospital acquired infections. This bacterium possesses a variety of resistance mechanisms which makes it more difficult to control the bacterium with conventional drugs, and, so far no effective drug treatment is available against it. Nucleoside diphosphate kinase is an important enzyme, which maintains the total nucleotide triphosphate pool inside the cell by the transfer of γ-phosphate from NTPs to NDPs. The role of nucleoside diphosphate kinase (Ndk has also been observed in pathogenesis in other organisms. However, intensive studies are needed to decipher its other putative roles in Acinetobacter baumannii. In the present study, we have successfully cloned the gene encoding Ndk and achieved overexpression in bacterial host BL-21 (DE3. The overexpressed protein is further purified by nickel-nitrilotriacetic acid (Ni-NTA chromatography.

  17. Cloning, Expression, and Purification of Nucleoside Diphosphate Kinase from Acinetobacter baumannii

    Science.gov (United States)

    Sikarwar, Juhi; Kaushik, Sanket; Sinha, Mau; Kaur, Punit; Sharma, Sujata; Singh, Tej P.

    2013-01-01

    Acinetobacter baumannii is a multidrug resistant pathogenic bacteria associated with hospital acquired infections. This bacterium possesses a variety of resistance mechanisms which makes it more difficult to control the bacterium with conventional drugs, and, so far no effective drug treatment is available against it. Nucleoside diphosphate kinase is an important enzyme, which maintains the total nucleotide triphosphate pool inside the cell by the transfer of γ-phosphate from NTPs to NDPs. The role of nucleoside diphosphate kinase (Ndk) has also been observed in pathogenesis in other organisms. However, intensive studies are needed to decipher its other putative roles in Acinetobacter baumannii. In the present study, we have successfully cloned the gene encoding Ndk and achieved overexpression in bacterial host BL-21 (DE3). The overexpressed protein is further purified by nickel-nitrilotriacetic acid (Ni-NTA) chromatography. PMID:23662205

  18. Meningitis bacteriana Bacterial meningitis

    Directory of Open Access Journals (Sweden)

    Ana Teresa Alvarado Guevara

    2006-03-01

    causales son virales lo cual conlleva a las diferentes sub-clasificaciones. También en ciertos casos puede ser ocasionada por hongos, bacterias atípicas, micobacterias y parásitos.In Costa Rica the bacterial meningitis had turn into a high-priority subject in which to monitoring epidemiologist. It had been talked about in the last months, to dice an increase in the attention is published of this subject, due to this phenomenon it becomes necessary to make a revision of topic. Meningitis is an inflammation of leptomeninges and colonization of the subarachnoid cerebrospinal fluid (LCR due to different agents, which produces meningeal symptoms (ex. migraine, neck rigidity, and photophobia and pleocytosis in LCR. De pending on the variables to take into account is possible to group it in different classifications, taking into account the time of evolution are possible to be divided in acute or chronic, to first with few hours or days of beginning of the symptoms, whereas the chronicle also presents a silence course but of the disease of approximately 4 weeks of instauration. There is a difference according to its etiologic agent; they can be infectious and non-infectious. Examples of common non-infectious causes include medications (ex, nonsteroidal anti-inflammatory drugs, and antibiotics and carcinomatosis. A classification exists as well according to the causal agent. The acute bacterial meningitis remarks a bacterial origin of the syndrome, which characterizes by the by an acute onset of meningeal symptoms and neutrophilic pleocytosis. Each one of the bacteriological agents, parasitic or fungus finishes by characterizing the different presentations of the clinical features (ex, meningocóccica meningitis, Cryptococcus meningitis. Finally, there is also the aseptic meningitis, denominated in this form because it’s nonpyogenic cellular response caused by many types of agents. The patients show an acute beginning of symptoms, fever and lymphocytic pleocytosis. After

  19. Bacterial Communities: Interactions to Scale

    Directory of Open Access Journals (Sweden)

    Reed M. Stubbendieck

    2016-08-01

    Full Text Available In the environment, bacteria live in complex multispecies communities. These communities span in scale from small, multicellular aggregates to billions or trillions of cells within the gastrointestinal tract of animals. The dynamics of bacterial communities are determined by pairwise interactions that occur between different species in the community. Though interactions occur between a few cells at a time, the outcomes of these interchanges have ramifications that ripple through many orders of magnitude, and ultimately affect the macroscopic world including the health of host organisms. In this review we cover how bacterial competition influences the structures of bacterial communities. We also emphasize methods and insights garnered from culture-dependent pairwise interaction studies, metagenomic analyses, and modeling experiments. Finally, we argue that the integration of multiple approaches will be instrumental to future understanding of the underlying dynamics of bacterial communities.

  20. A novel nucleoside kinase from Burkholderia thailandensis: a member of the phosphofructokinase B-type family of enzymes.

    Science.gov (United States)

    Ota, Hiroko; Sakasegawa, Shin-Ichi; Yasuda, Yuko; Imamura, Shigeyuki; Tamura, Tomohiro

    2008-12-01

    The genome of the mesophilic Gram-negative bacterium Burkholderia thailandensis contains an open reading frame (i.e. the Bth_I1158 gene) that has been annotated as a putative ribokinase and PFK-B family member. Notably, although the deduced amino acid sequence of the gene showed only 29% similarity to the recently identified nucleoside kinase from hyperthermophilic archaea Methanocaldococcus jannaschii, 15 of 17 residues reportedly involved in the catalytic activity of M. jannaschii nucleoside kinase were conserved. The gene was cloned and functionally overexpressed in Rhodococcus erythropolis, and the purified enzyme was characterized biochemically. The substrate specificity of the enzyme was unusually broad for a bacterial PFK-B protein, and the specificity extended not only to purine and purine-analog nucleosides but also to uridine. Inosine was the most effective phosphoryl acceptor, with the highest k(cat)/K(m) value (80 s(-1).mm(-1)) being achieved when ATP served as the phosphoryl donor. By contrast, this enzyme exhibited no activity toward ribose, indicating that the recombinant enzyme was a nucleoside kinase rather than a ribokinase. To our knowledge, this is the first detailed analysis of a bacterial nucleoside kinase in the PFK-B family.

  1. Rac-1 and Raf-1 kinases, components of distinct signaling pathways, activate myotonic dystrophy protein kinase

    Science.gov (United States)

    Shimizu, M.; Wang, W.; Walch, E. T.; Dunne, P. W.; Epstein, H. F.

    2000-01-01

    Myotonic dystrophy protein kinase (DMPK) is a serine-threonine protein kinase encoded by the myotonic dystrophy (DM) locus on human chromosome 19q13.3. It is a close relative of other kinases that interact with members of the Rho family of small GTPases. We show here that the actin cytoskeleton-linked GTPase Rac-1 binds to DMPK, and coexpression of Rac-1 and DMPK activates its transphosphorylation activity in a GTP-sensitive manner. DMPK can also bind Raf-1 kinase, the Ras-activated molecule of the MAP kinase pathway. Purified Raf-1 kinase phosphorylates and activates DMPK. The interaction of DMPK with these distinct signals suggests that it may play a role as a nexus for cross-talk between their respective pathways and may partially explain the remarkable pleiotropy of DM.

  2. Bacterial Chromosome Organization and Segregation

    OpenAIRE

    Toro, Esteban; Shapiro, Lucy

    2010-01-01

    Bacterial chromosomes are generally ∼1000 times longer than the cells in which they reside, and concurrent replication, segregation, and transcription/translation of this crowded mass of DNA poses a challenging organizational problem. Recent advances in cell-imaging technology with subdiffraction resolution have revealed that the bacterial nucleoid is reliably oriented and highly organized within the cell. Such organization is transmitted from one generation to the next by progressive segrega...

  3. Surface micropattern limits bacterial contamination

    OpenAIRE

    Mann, Ethan E.; Manna, Dipankar; Mettetal, Michael R; May, Rhea M.; Dannemiller, Elisa M; Chung, Kenneth K.; Brennan, Anthony B; Reddy, Shravanthi T

    2014-01-01

    Background Bacterial surface contamination contributes to transmission of nosocomial infections. Chemical cleansers used to control surface contamination are often toxic and incorrectly implemented. Additional non-toxic strategies should be combined with regular cleanings to mitigate risks of human error and further decrease rates of nosocomial infections. The Sharklet micropattern (MP), inspired by shark skin, is an effective tool for reducing bacterial load on surfaces without toxic additiv...

  4. Bacterial cellulose/boehmite composites

    Energy Technology Data Exchange (ETDEWEB)

    Salvi, Denise T.B. de; Barud, Hernane S.; Messaddeq, Younes; Ribeiro, Sidney J.L. [Universidade Estadual Paulista Julio de Mesquita Filho. UNESP. Instituto de Quimica de Araraquara, SP (Brazil); Caiut, Jose Mauricio A. [Universidade de Sao Paulo. Departamento de Quimica - FFCLRP/USP, Ribeirao Preto, SP (Brazil)

    2011-07-01

    Composites based on bacterial cellulose membranes and boehmite were obtained. SEM results indicate that the bacterial cellulose (BC) membranes are totally covered by boehmite and obtained XRD patterns suggest structural changes due to this boehmite addition. Thermal stability is accessed through TG curves and is dependent on boehmite content. Transparency is high comparing to pure BC as can be seen through UV-vis absorption spectroscopy. (author)

  5. The Crystal Structure of Cancer Osaka Thyroid Kinase Reveals an Unexpected Kinase Domain Fold*

    Science.gov (United States)

    Gutmann, Sascha; Hinniger, Alexandra; Fendrich, Gabriele; Drückes, Peter; Antz, Sylvie; Mattes, Henri; Möbitz, Henrik; Ofner, Silvio; Schmiedeberg, Niko; Stojanovic, Aleksandar; Rieffel, Sebastien; Strauss, André; Troxler, Thomas; Glatthar, Ralf; Sparrer, Helmut

    2015-01-01

    Macrophages are important cellular effectors in innate immune responses and play a major role in autoimmune diseases such as rheumatoid arthritis. Cancer Osaka thyroid (COT) kinase, also known as mitogen-activated protein kinase kinase kinase 8 (MAP3K8) and tumor progression locus 2 (Tpl-2), is a serine-threonine (ST) kinase and is a key regulator in the production of pro-inflammatory cytokines in macrophages. Due to its pivotal role in immune biology, COT kinase has been identified as an attractive target for pharmaceutical research that is directed at the discovery of orally available, selective, and potent inhibitors for the treatment of autoimmune disorders and cancer. The production of monomeric, recombinant COT kinase has proven to be very difficult, and issues with solubility and stability of the enzyme have hampered the discovery and optimization of potent and selective inhibitors. We developed a protocol for the production of recombinant human COT kinase that yields pure and highly active enzyme in sufficient yields for biochemical and structural studies. The quality of the enzyme allowed us to establish a robust in vitro phosphorylation assay for the efficient biochemical characterization of COT kinase inhibitors and to determine the x-ray co-crystal structures of the COT kinase domain in complex with two ATP-binding site inhibitors. The structures presented in this study reveal two distinct ligand binding modes and a unique kinase domain architecture that has not been observed previously. The structurally versatile active site significantly impacts the design of potent, low molecular weight COT kinase inhibitors. PMID:25918157

  6. MAP kinase cascades in Arabidopsis innate immunity

    DEFF Research Database (Denmark)

    Rasmussen, Magnus Wohlfahrt; Roux, Milena Edna; Petersen, Morten

    2012-01-01

    Plant mitogen-activated protein kinase (MAPK) cascades generally transduce extracellular stimuli into cellular responses. These stimuli include the perception of pathogen-associated molecular patterns (PAMPs) by host transmembrane pattern recognition receptors which trigger MAPK-dependent innate ...

  7. Isoprenoid biosynthesis and mevalonate kinase deficiency

    NARCIS (Netherlands)

    Henneman, L.

    2011-01-01

    Mevalonaat Kinase Deficiëntie (MKD) is een aangeboren ziekte geassocieerd met heftige koortsaanvallen die drie tot vier dagen aanhouden en gepaard gaan met koude rillingen, gewrichtsklachten, huiduitslag, hoofdpijn, duizeligheid, buikpijn, braken en diarree. De koortsaanvallen treden gemiddeld eens

  8. MAP kinase meets mitosis: A role for Raf Kinase Inhibitory Protein in spindle checkpoint regulation

    Directory of Open Access Journals (Sweden)

    Rosner Marsha

    2007-01-01

    Full Text Available Abstract Raf Kinase Inhibitory Protein (RKIP is an evolutionarily conserved protein that functions as a modulator of signaling by the MAP kinase cascade. Implicated as a metastasis suppressor, Raf Kinase Inhibitory Protein depletion correlates with poor prognosis for breast, prostate and melanoma tumors but the mechanism is unknown. Recent evidence indicates that Raf Kinase Inhibitory Protein regulates the mitotic spindle assembly checkpoint by controlling Aurora B Kinase activity, and the mechanism involves Raf/MEK/ERK signaling. In contrast to elevated MAP kinase signaling during the G1, S or G2 phases of the cell cycle that activates checkpoints and induces arrest or senescence, loss of RKIP during M phase leads to bypass of the spindle assembly checkpoint and the generation of chromosomal abnormalities. These results reveal a role for Raf Kinase Inhibitory Protein and the MAP kinase cascade in ensuring the fidelity of chromosome segregation prior to cell division. Furthermore, these data highlight the need for precise titration of the MAP kinase signal to ensure the integrity of the spindle assembly process and provide a mechanism for generating genomic instability in tumors. Finally, these results raise the possibility that RKIP status in tumors could influence the efficacy of treatments such as poisons that stimulate the Aurora B-dependent spindle assembly checkpoint.

  9. A Molecular Brake in the Kinase Hinge Region Regulates the Activity of Receptor Tyrosine Kinases

    Energy Technology Data Exchange (ETDEWEB)

    Chen,H.; Ma, J.; Li, W.; Eliseenkova, A.; Xu, C.; Neubert, T.; Miller, W.; Mohammadi, M.

    2007-01-01

    Activating mutations in the tyrosine kinase domain of receptor tyrosine kinases (RTKs) cause cancer and skeletal disorders. Comparison of the crystal structures of unphosphorylated and phosphorylated wild-type FGFR2 kinase domains with those of seven unphosphorylated pathogenic mutants reveals an autoinhibitory 'molecular brake' mediated by a triad of residues in the kinase hinge region of all FGFRs. Structural analysis shows that many other RTKs, including PDGFRs, VEGFRs, KIT, CSF1R, FLT3, TEK, and TIE, are also subject to regulation by this brake. Pathogenic mutations activate FGFRs and other RTKs by disengaging the brake either directly or indirectly.

  10. Activation of AMP-activated kinase as a strategy for managing autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    McCarty, Mark F; Barroso-Aranda, Jorge; Contreras, Francisco

    2009-12-01

    There is evidence that overactivity of both mammalian target of rapamycin (mTOR) and cystic fibrosis transmembrane conductance regulator (CFTR) contributes importantly to the progressive expansion of renal cysts in autosomal dominant polycystic kidney disease (ADPKD). Recent research has established that AMP-activated kinase (AMPK) can suppress the activity of each of these proteins. Clinical AMPK activators such as metformin and berberine may thus have potential in the clinical management of ADPKD. The traditional use of berberine in diarrhea associated with bacterial infections may reflect, in part, the inhibitory impact of AMPK on chloride extrusion by small intestinal enterocytes.

  11. Fibronectin phosphorylation by ecto-protein kinase

    Energy Technology Data Exchange (ETDEWEB)

    Imada, Sumi; Sugiyama, Yayoi; Imada, Masaru (Meiji Institute of Health Science, Odawara (Japan))

    1988-12-01

    The presence of membrane-associated, extracellular protein kinase (ecto-protein kinase) and its substrate proteins was examined with serum-free cultures of Swiss 3T3 fibroblast. When cells were incubated with ({gamma}-{sup 32})ATP for 10 min at 37{degree}C, four proteins with apparent molecular weights between 150 and 220 kDa were prominently phosphorylated. These proteins were also radiolabeled by lactoperoxidase catalyzed iodination and were sensitive to mild tryptic digestion, suggesting that they localized on the cell surface or in the extracellular matrix. Phosphorylation of extracellular proteins with ({gamma}-{sup 32}P)ATP in intact cell culture is consistent with the existence of ecto-protein kinase. Anti-fibronectin antibody immunoprecipitated one of the phosphoproteins which comigrated with a monomer and a dimer form of fibronectin under reducing and nonreducing conditions of electrophoresis, respectively. The protein had affinity for gelatin as demonstrated by retention with gelatin-conjugated agarose. This protein substrate of ecto-protein kinase was thus concluded to be fibronectin. The sites of phosphorylation by ecto-protein kinase were compared with those of intracellularly phosphorylated fibronectin by the analysis of radiolabeled amino acids and peptides. Ecto-protein kinase phosphorylated fibronectin at serine and threonine residues which were distinct from the sites of intracellular fibronectin phosphorylation.

  12. Isolation and characterization of recombinant human casein kinase II subunits alpha and beta from bacteria

    DEFF Research Database (Denmark)

    Grankowski, N; Boldyreff, B; Issinger, O G

    1991-01-01

    cDNA encoding the casein kinase II (CKII) subunits alpha and beta of human origin were expressed in Escherichia coli using expression vector pT7-7. Significant expression was obtained with E. coli BL21(DE3). The CKII subunits accounted for approximately 30% of the bacterial protein; however, most...... of the expressed proteins were produced in an insoluble form. The recombinant CKII alpha subunit was purified by DEAE-cellulose chromatography, followed by phosphocellulose and heparin-agarose chromatography. The recombinant CKII beta subunit was extracted from the insoluble pellet and purified in a single step...... on phosphocellulose. From 10 g bacterial cells, the yield of soluble protein was 12 mg alpha subunit and 5 mg beta subunit. SDS/PAGE analysis of the purified recombinant proteins indicated molecular masses of 42 kDa and 26 kDa for the alpha and beta subunits, respectively, in agreement with the molecular masses...

  13. Identification of a kinase profile that predicts chromosome damage induced by small molecule kinase inhibitors.

    Directory of Open Access Journals (Sweden)

    Andrew J Olaharski

    2009-07-01

    Full Text Available Kinases are heavily pursued pharmaceutical targets because of their mechanistic role in many diseases. Small molecule kinase inhibitors (SMKIs are a compound class that includes marketed drugs and compounds in various stages of drug development. While effective, many SMKIs have been associated with toxicity including chromosomal damage. Screening for kinase-mediated toxicity as early as possible is crucial, as is a better understanding of how off-target kinase inhibition may give rise to chromosomal damage. To that end, we employed a competitive binding assay and an analytical method to predict the toxicity of SMKIs. Specifically, we developed a model based on the binding affinity of SMKIs to a panel of kinases to predict whether a compound tests positive for chromosome damage. As training data, we used the binding affinity of 113 SMKIs against a representative subset of all kinases (290 kinases, yielding a 113x290 data matrix. Additionally, these 113 SMKIs were tested for genotoxicity in an in vitro micronucleus test (MNT. Among a variety of models from our analytical toolbox, we selected using cross-validation a combination of feature selection and pattern recognition techniques: Kolmogorov-Smirnov/T-test hybrid as a univariate filter, followed by Random Forests for feature selection and Support Vector Machines (SVM for pattern recognition. Feature selection identified 21 kinases predictive of MNT. Using the corresponding binding affinities, the SVM could accurately predict MNT results with 85% accuracy (68% sensitivity, 91% specificity. This indicates that kinase inhibition profiles are predictive of SMKI genotoxicity. While in vitro testing is required for regulatory review, our analysis identified a fast and cost-efficient method for screening out compounds earlier in drug development. Equally important, by identifying a panel of kinases predictive of genotoxicity, we provide medicinal chemists a set of kinases to avoid when designing

  14. The Human Vaginal Bacterial Biota and Bacterial Vaginosis

    Directory of Open Access Journals (Sweden)

    Sujatha Srinivasan

    2008-01-01

    Full Text Available The bacterial biota of the human vagina can have a profound impact on the health of women and their neonates. Changes in the vaginal microbiota have been associated with several adverse health outcomes including premature birth, pelvic inflammatory disease, and acquisition of HIV infection. Cultivation-independent molecular methods have provided new insights regarding bacterial diversity in this important niche, particularly in women with the common condition bacterial vaginosis (BV. PCR methods have shown that women with BV have complex communities of vaginal bacteria that include many fastidious species, particularly from the phyla Bacteroidetes and Actinobacteria. Healthy women are mostly colonized with lactobacilli such as Lactobacillus crispatus, Lactobacillus jensenii, and Lactobacillus iners, though a variety of other bacteria may be present. The microbiology of BV is heterogeneous. The presence of Gardnerella vaginalis and Atopobium vaginae coating the vaginal epithelium in some subjects with BV suggests that biofilms may contribute to this condition.

  15. New Treatments for Bacterial Keratitis

    Directory of Open Access Journals (Sweden)

    Raymond L. M. Wong

    2012-01-01

    Full Text Available Purpose. To review the newer treatments for bacterial keratitis. Data Sources. PubMed literature search up to April 2012. Study Selection. Key words used for literature search: “infectious keratitis”, “microbial keratitis”, “infective keratitis”, “new treatments for infectious keratitis”, “fourth generation fluoroquinolones”, “moxifloxacin”, “gatifloxacin”, “collagen cross-linking”, and “photodynamic therapy”. Data Extraction. Over 2400 articles were retrieved. Large scale studies or publications at more recent dates were selected. Data Synthesis. Broad spectrum antibiotics have been the main stay of treatment for bacterial keratitis but with the emergence of bacterial resistance; there is a need for newer antimicrobial agents and treatment methods. Fourth-generation fluoroquinolones and corneal collagen cross-linking are amongst the new treatments. In vitro studies and prospective clinical trials have shown that fourth-generation fluoroquinolones are better than the older generation fluoroquinolones and are as potent as combined fortified antibiotics against common pathogens that cause bacterial keratitis. Collagen cross-linking was shown to improve healing of infectious corneal ulcer in treatment-resistant cases or as an adjunct to antibiotics treatment. Conclusion. Fourth-generation fluoroquinolones are good alternatives to standard treatment of bacterial keratitis using combined fortified topical antibiotics. Collagen cross-linking may be considered in treatment-resistant infectious keratitis or as an adjunct to antibiotics therapy.

  16. Bacterial carbonatogenesis; La carbonatogenese bacterienne

    Energy Technology Data Exchange (ETDEWEB)

    Castanier, S. [Angers Univ., 49 (France). Faculte des Sciences; Le Metayer-Levrel, G.; Perthuisot, J.P. [Nantes Univ., 44 (France). Laboratoire de Biogeologie, Faculte des Sciences et des Techniques

    1998-12-31

    Several series of experiments in the laboratory as well as in natural conditions teach that the production of carbonate particles by heterotrophic bacteria follows different ways. The `passive` carbonatogenesis is generated by modifications of the medium that lead to the accumulation of carbonate and bicarbonate ions and to the precipitation of solid particles. The `active` carbonatogenesis is independent of the metabolic pathways. The carbonate particles are produced by ionic exchanges through the cell membrane following still poorly known mechanisms. Carbonatogenesis appears to be the response of heterotrophic bacterial communities to an enrichment of the milieu in organic matter. The active carbonatogenesis seems to start first. It is followed by the passive one which induces the growth of initially produced particles. The yield of heterotrophic bacterial carbonatogenesis and the amounts of solid carbonates production by bacteria are potentially very high as compared to autotrophic or chemical sedimentation from marine, paralic or continental waters. Furthermore, the bacterial processes are environmentally very ubiquitous; they just require organic matter enrichment. Thus, apart from purely evaporite and autotrophic ones, all Ca and/or Mg carbonates must be considered as from heterotrophic bacterial origin. By the way, the carbon of carbonates comes from primary organic matter. Such considerations ask questions about some interpretations from isotopic data on carbonates. Finally, bacterial heterotrophic carbonatogenesis appears as a fundamental phase in the relationships between atmosphere and lithosphere and in the geo-biological evolution of Earth. (author) 43 refs.

  17. Arabidopsis lysin-motif proteins LYM1 LYM3 CERK1 mediate bacterial peptidoglycan sensing and immunity to bacterial infection

    Science.gov (United States)

    Willmann, Roland; Lajunen, Heini M.; Erbs, Gitte; Newman, Mari-Anne; Kolb, Dagmar; Tsuda, Kenichi; Katagiri, Fumiaki; Fliegmann, Judith; Bono, Jean-Jacques; Cullimore, Julie V.; Jehle, Anna K.; Götz, Friedrich; Kulik, Andreas; Molinaro, Antonio; Lipka, Volker; Gust, Andrea A.; Nürnberger, Thorsten

    2011-01-01

    Recognition of microbial patterns by host pattern recognition receptors is a key step in immune activation in multicellular eukaryotes. Peptidoglycans (PGNs) are major components of bacterial cell walls that possess immunity-stimulating activities in metazoans and plants. Here we show that PGN sensing and immunity to bacterial infection in Arabidopsis thaliana requires three lysin-motif (LysM) domain proteins. LYM1 and LYM3 are plasma membrane proteins that physically interact with PGNs and mediate Arabidopsis sensitivity to structurally different PGNs from Gram-negative and Gram-positive bacteria. lym1 and lym3 mutants lack PGN-induced changes in transcriptome activity patterns, but respond to fungus-derived chitin, a pattern structurally related to PGNs, in a wild-type manner. Notably, lym1, lym3, and lym3 lym1 mutant genotypes exhibit supersusceptibility to infection with virulent Pseudomonas syringae pathovar tomato DC3000. Defects in basal immunity in lym3 lym1 double mutants resemble those observed in lym1 and lym3 single mutants, suggesting that both proteins are part of the same recognition system. We further show that deletion of CERK1, a LysM receptor kinase that had previously been implicated in chitin perception and immunity to fungal infection in Arabidopsis, phenocopies defects observed in lym1 and lym3 mutants, such as peptidoglycan insensitivity and enhanced susceptibility to bacterial infection. Altogether, our findings suggest that plants share with metazoans the ability to recognize bacterial PGNs. However, as Arabidopsis LysM domain proteins LYM1, LYM3, and CERK1 form a PGN recognition system that is unrelated to metazoan PGN receptors, we propose that lineage-specific PGN perception systems have arisen through convergent evolution. PMID:22106285

  18. Non-degradative Ubiquitination of Protein Kinases.

    Directory of Open Access Journals (Sweden)

    K Aurelia Ball

    2016-06-01

    Full Text Available Growing evidence supports other regulatory roles for protein ubiquitination in addition to serving as a tag for proteasomal degradation. In contrast to other common post-translational modifications, such as phosphorylation, little is known about how non-degradative ubiquitination modulates protein structure, dynamics, and function. Due to the wealth of knowledge concerning protein kinase structure and regulation, we examined kinase ubiquitination using ubiquitin remnant immunoaffinity enrichment and quantitative mass spectrometry to identify ubiquitinated kinases and the sites of ubiquitination in Jurkat and HEK293 cells. We find that, unlike phosphorylation, ubiquitination most commonly occurs in structured domains, and on the kinase domain, ubiquitination is concentrated in regions known to be important for regulating activity. We hypothesized that ubiquitination, like other post-translational modifications, may alter the conformational equilibrium of the modified protein. We chose one human kinase, ZAP-70, to simulate using molecular dynamics with and without a monoubiquitin modification. In Jurkat cells, ZAP-70 is ubiquitinated at several sites that are not sensitive to proteasome inhibition and thus may have other regulatory roles. Our simulations show that ubiquitination influences the conformational ensemble of ZAP-70 in a site-dependent manner. When monoubiquitinated at K377, near the C-helix, the active conformation of the ZAP-70 C-helix is disrupted. In contrast, when monoubiquitinated at K476, near the kinase hinge region, an active-like ZAP-70 C-helix conformation is stabilized. These results lead to testable hypotheses that ubiquitination directly modulates kinase activity, and that ubiquitination is likely to alter structure, dynamics, and function in other protein classes as well.

  19. Crystal structure of Cryptosporidium parvum pyruvate kinase.

    Directory of Open Access Journals (Sweden)

    William J Cook

    Full Text Available Pyruvate kinase plays a critical role in cellular metabolism of glucose by serving as a major regulator of glycolysis. This tetrameric enzyme is allosterically regulated by different effector molecules, mainly phosphosugars. In response to binding of effector molecules and substrates, significant structural changes have been identified in various pyruvate kinase structures. Pyruvate kinase of Cryptosporidium parvum is exceptional among known enzymes of protozoan origin in that it exhibits no allosteric property in the presence of commonly known effector molecules. The crystal structure of pyruvate kinase from C. parvum has been solved by molecular replacement techniques and refined to 2.5 Å resolution. In the active site a glycerol molecule is located near the γ-phosphate site of ATP, and the protein structure displays a partially closed active site. However, unlike other structures where the active site is closed, the α6' helix in C. parvum pyruvate kinase unwinds and assumes an extended conformation. In the crystal structure a sulfate ion is found at a site that is occupied by a phosphate of the effector molecule in many pyruvate kinase structures. A new feature of the C. parvum pyruvate kinase structure is the presence of a disulfide bond cross-linking the two monomers in the asymmetric unit. The disulfide bond is formed between cysteine residue 26 in the short N-helix of one monomer with cysteine residue 312 in a long helix (residues 303-320 of the second monomer at the interface of these monomers. Both cysteine residues are unique to C. parvum, and the disulfide bond remained intact in a reduced environment. However, the significance of this bond, if any, remains unknown at this time.

  20. Non-degradative Ubiquitination of Protein Kinases.

    Science.gov (United States)

    Ball, K Aurelia; Johnson, Jeffrey R; Lewinski, Mary K; Guatelli, John; Verschueren, Erik; Krogan, Nevan J; Jacobson, Matthew P

    2016-06-01

    Growing evidence supports other regulatory roles for protein ubiquitination in addition to serving as a tag for proteasomal degradation. In contrast to other common post-translational modifications, such as phosphorylation, little is known about how non-degradative ubiquitination modulates protein structure, dynamics, and function. Due to the wealth of knowledge concerning protein kinase structure and regulation, we examined kinase ubiquitination using ubiquitin remnant immunoaffinity enrichment and quantitative mass spectrometry to identify ubiquitinated kinases and the sites of ubiquitination in Jurkat and HEK293 cells. We find that, unlike phosphorylation, ubiquitination most commonly occurs in structured domains, and on the kinase domain, ubiquitination is concentrated in regions known to be important for regulating activity. We hypothesized that ubiquitination, like other post-translational modifications, may alter the conformational equilibrium of the modified protein. We chose one human kinase, ZAP-70, to simulate using molecular dynamics with and without a monoubiquitin modification. In Jurkat cells, ZAP-70 is ubiquitinated at several sites that are not sensitive to proteasome inhibition and thus may have other regulatory roles. Our simulations show that ubiquitination influences the conformational ensemble of ZAP-70 in a site-dependent manner. When monoubiquitinated at K377, near the C-helix, the active conformation of the ZAP-70 C-helix is disrupted. In contrast, when monoubiquitinated at K476, near the kinase hinge region, an active-like ZAP-70 C-helix conformation is stabilized. These results lead to testable hypotheses that ubiquitination directly modulates kinase activity, and that ubiquitination is likely to alter structure, dynamics, and function in other protein classes as well.

  1. A systematic evaluation of protein kinase A-A-kinase anchoring protein interaction motifs

    NARCIS (Netherlands)

    Burgers, Pepijn P; van der Heyden, MAG; Kok, Bart; Heck, Albert J R; Scholten, Arjen

    2015-01-01

    Protein kinase A (PKA) in vertebrates is localized to specific locations in the cell via A-kinase anchoring proteins (AKAPs). The regulatory subunits of the four PKA isoforms (RIα, RIβ, RIIα, and RIIβ) each form a homodimer, and their dimerization domain interacts with a small helical region present

  2. Phosphorylation of nm23/nucleoside diphosphate kinase by casein kinase 2 in vitro

    DEFF Research Database (Denmark)

    Engel, M; Issinger, O G; Lascu, I;

    1994-01-01

    We have investigated phosphorylation of human nucleoside diphosphate kinase (NDPK) and of homologous NDPK from different species by human casein kinase 2 (CK-2). The human NDPK isotypes A and B were phosphorylated by CK-2 in vitro both when the purified proteins and total lysate of HL-60 leukemia...

  3. Homo- and heterodimerization of ROCO kinases: LRRK2 kinase inhibition by the LRRK2 ROCO fragment.

    Science.gov (United States)

    Klein, Christian L; Rovelli, Giorgio; Springer, Wolfdieter; Schall, Christoph; Gasser, Thomas; Kahle, Philipp J

    2009-11-01

    Mutations in the gene encoding leucine-rich repeat kinase 2 (LRRK2) are the most common cause of autosomal-dominant familial and late-onset sporadic Parkinson's disease (PD). LRRK2 is a large multi-domain protein featuring a GTP-binding C-terminal of Ras of complex proteins (ROC) (ROCO) domain combination unique for the ROCO protein family, directly followed by a kinase domain. Dimerization is a well-established phenomenon among protein kinases. Here, we confirm LRRK2 self-interaction, and provide evidence for general homo- and heterodimerization potential among the ROCO kinase family (LRRK2, LRRK1, and death-associated protein kinase 1). The ROCO domain was critically, though not exclusively involved in dimerization, as a LRRK2 deletion mutant lacking the ROCO domain retained dimeric properties. GTP binding did not appear to influence ROCO(LRRK2) self-interaction. Interestingly, ROCO(LRRK2) fragments exerted an inhibitory effect on both wild-type and the elevated G2019S LRRK2 autophosphorylation activity. Insertion of PD mutations into ROCO(LRRK2) reduced self-interaction and led to a reduction of LRRK2 kinase inhibition. Collectively, these results suggest a functional link between ROCO interactions and kinase activity of wild-type and mutant LRRK2. Importantly, our finding of ROCO(LRRK2) fragment-mediated LRRK2 kinase inhibition offers a novel lead for drug design and thus might have important implications for new therapeutic avenues in PD.

  4. Functional analysis of the BRI1 receptor kinase by Thr-for-Ser substitution in a regulatory autophosphorylation site

    Directory of Open Access Journals (Sweden)

    Man-Ho eOh

    2015-07-01

    Full Text Available BRI1 becomes highly phosphorylated in vivo upon perception of the ligand, brassinolide, as a result of autophosphorylation and transphosphorylation by its co-receptor kinase, BAK1. Important autophosphorylation sites include those involved in activation of kinase activity and those that are inhibitory, such as Ser-891. The inhibitory sites are autophosphorylated after kinase activation has been achieved and are postulated to contribute to deactivation of the kinase. The function of phosphosites is usually tested by substituting a non-phosphorylatable residue or an acidic residue that can act as a phosphomimetic. What has typically not been examined is substitution of a Thr for a Ser phosphosite (or vice versa but given that Thr and Ser are not equivalent amino acids this type of substitution may represent a new approach to engineer regulatory phosphorylation. In the present study with BRI1, we substituted Thr at the Ser-891 phosphosite to generate the S891T directed mutant. The recombinant Flag-BRI1 (S891T cytoplasmic domain protein (the S891T protein was catalytically active and phosphorylation occurred at the engineered Thr-891 site. However, the S891T recombinant protein autophosphorylated more slowly than the wild type protein during expression in E. coli. As a result, activation of peptide kinase activity (measured in vitro was delayed as was transphosphorylation of bacterial proteins in situ. Stable transgenic expression of BRI1 (S891T-Flag in Arabidopsis bri1-5 plants did not fully rescue the brassinosteroid (BR phenotype indicating that BR signaling was constrained. Our working model is that restricted signaling in the S891T plants occurs as a result of the reduced rate of activation of the mutant BRI1 kinase by autophosphorylation. These results provide the platform for future studies to critically test this new model in vivo and establish Ser-Thr substitutions at phosphosites as an interesting approach to consider with other protein

  5. Bacterial Degradation of Aromatic Compounds

    Directory of Open Access Journals (Sweden)

    Qing X. Li

    2009-01-01

    Full Text Available Aromatic compounds are among the most prevalent and persistent pollutants in the environment. Petroleum-contaminated soil and sediment commonly contain a mixture of polycyclic aromatic hydrocarbons (PAHs and heterocyclic aromatics. Aromatics derived from industrial activities often have functional groups such as alkyls, halogens and nitro groups. Biodegradation is a major mechanism of removal of organic pollutants from a contaminated site. This review focuses on bacterial degradation pathways of selected aromatic compounds. Catabolic pathways of naphthalene, fluorene, phenanthrene, fluoranthene, pyrene, and benzo[a]pyrene are described in detail. Bacterial catabolism of the heterocycles dibenzofuran, carbazole, dibenzothiophene, and dibenzodioxin is discussed. Bacterial catabolism of alkylated PAHs is summarized, followed by a brief discussion of proteomics and metabolomics as powerful tools for elucidation of biodegradation mechanisms.

  6. Tyrosine kinase BMX phosphorylates phosphotyrosine-primed motif mediating the activation of multiple receptor tyrosine kinases.

    Science.gov (United States)

    Chen, Sen; Jiang, Xinnong; Gewinner, Christina A; Asara, John M; Simon, Nicholas I; Cai, Changmeng; Cantley, Lewis C; Balk, Steven P

    2013-05-28

    The nonreceptor tyrosine kinase BMX (bone marrow tyrosine kinase gene on chromosome X) is abundant in various cell types and activated downstream of phosphatidylinositol-3 kinase (PI3K) and the kinase Src, but its substrates are unknown. Positional scanning peptide library screening revealed a marked preference for a priming phosphorylated tyrosine (pY) in the -1 position, indicating that BMX substrates may include multiple tyrosine kinases that are fully activated by pYpY sites in the kinase domain. BMX phosphorylated focal adhesion kinase (FAK) at Tyr⁵⁷⁷ subsequent to its Src-mediated phosphorylation at Tyr⁵⁷⁶. Loss of BMX by RNA interference or by genetic deletion in mouse embryonic fibroblasts (MEFs) markedly impaired FAK activity. Phosphorylation of the insulin receptor in the kinase domain at Tyr¹¹⁸⁹ and Tyr¹¹⁹⁰, as well as Tyr¹¹⁸⁵, and downstream phosphorylation of the kinase AKT at Thr³⁰⁸ were similarly impaired by BMX deficiency. However, insulin-induced phosphorylation of AKT at Ser⁴⁷³ was not impaired in Bmx knockout MEFs or liver tissue from Bmx knockout mice, which also showed increased insulin-stimulated glucose uptake, possibly because of decreased abundance of the phosphatase PHLPP (PH domain leucine-rich repeat protein phosphatase). Thus, by identifying the pYpY motif as a substrate for BMX, our findings suggest that BMX functions as a central regulator among multiple signaling pathways mediated by tyrosine kinases.

  7. SRC kinase regulation in progressively invasive cancer.

    Directory of Open Access Journals (Sweden)

    Weichen Xu

    Full Text Available Metastatic progression is a multistep process that involves tumor growth and survival, motility and invasion, and subsequent proliferation in an inappropriate environment. The Src protein tyrosine kinase has been implicated in many of the biochemical pathways that drive these behaviors. Although Src itself is only rarely mutated in human tumors, its aberrant activity has been noted in various cancers and suggested to serve as a barometer of metastatic potential. With these features in mind, we examined Src kinase regulation at the structural, enzymatic, and expression levels as a function of progressively invasive prostate cancer cell lines. Surprisingly, both total Src content and kinase activity decrease with increasing cell line aggressiveness, an observation that appears to be inconsistent with the well-documented role of Src in the signaling pathways that drive growth and invasion. However, we do observe a direct correlation between Src kinase specific activity (total Src kinase activity/total Src content and metastatic aggressiveness, possibly suggesting that in highly aggressive cell lines, key signaling enzymes are globally recruited to drive the cancerous phenotype. In addition, although the expected enhanced phosphorylation of Src at Tyr-416 (activation site is present in the most aggressive prostate cancer cell lines, unexpectedly high phosphorylation levels at the Tyr-527 inhibitory site are observed as well. The latter, rather than representative of inhibited enzyme, is more indicative of primed Src responsive to local phosphorylated binding partners.

  8. Therapeutic Innovations: Tyrosine Kinase Inhibitors in Cancer

    Directory of Open Access Journals (Sweden)

    Nikolaos Dervisis

    2016-01-01

    Full Text Available Conventional cytotoxic chemotherapy involving DNA-interacting agents and indiscriminate cell death is no longer the future of cancer management. While chemotherapy is not likely to completely disappear from the armamentarium; the use of targeted therapies in combination with conventional treatment is becoming the standard of care in human medicine. Tyrosine kinases are pivotal points of functional cellular pathways and have been implicated in malignancy, inflammatory, and immune-mediated diseases. Pharmaceutical interventions targeting aberrant tyrosine kinase signaling has exploded and is the second most important area of drug development. The “Valley of Death” between drug discovery and approval threatens to blunt the enormous strides in cancer management seen thus far. Kinase inhibitors, as targeted small molecules, hold promise in the treatment and diagnosis of cancer. However, there are still many unanswered questions regarding the use of kinase inhibitors in the interpretation and management of cancer. Comparative oncology has the potential to address restrictions and limitations in the advancement in kinase inhibitor therapy.

  9. Transgenic Rice Plants Harboring Genomic DNA from Zizania latifolia Confer Bacterial Blight Resistance

    Institute of Scientific and Technical Information of China (English)

    SHEN Wei-wei; SONG Cheng-li; CHEN Jie; Fu Ya-ping; Wu Jian-li; JIANG Shao-mei

    2011-01-01

    Based on the sequence of a resistance gene analog FZ14 derived from Zizania latifolia (Griseb.),a pair of specific PCR primers FZ14P1/FZ14P2 was designed to isolate candidate disease resistance gene.The pooled-PCR approach was adopted using the primer pair to screen a genomic transformation-competent artificial chromosome (TAC) library derived from Z.latifolia.A positive TAC clone (ZR1) was obtained and confirmed by sequence analysis.The results indicated that ZR1 consisted of conserved motifs similar to P-loop (kinase 1a),kinase 2,kinase 3a and GLPL (Gly-Leu-Pro-Leu),suggesting that it could be a portion of NBS-LRR type of resistance gene.Using Agrobacterium-mediated transformation of Nipponbare mature embryo,a total of 48 independent transgenic T0 plants were obtained.Among them,36 plants were highly resistant to the virulent bacterial blight strain P×O71.The results indicate that ZR1 contains at least one functional bacterial blight resistance gene.

  10. Protein Kinases and Parkinson’s Disease

    Science.gov (United States)

    Mehdi, Syed Jafar; Rosas-Hernandez, Hector; Cuevas, Elvis; Lantz, Susan M.; Barger, Steven W.; Sarkar, Sumit; Paule, Merle G.; Ali, Syed F.; Imam, Syed Z.

    2016-01-01

    Currently, the lack of new drug candidates for the treatment of major neurological disorders such as Parkinson’s disease has intensified the search for drugs that can be repurposed or repositioned for such treatment. Typically, the search focuses on drugs that have been approved and are used clinically for other indications. Kinase inhibitors represent a family of popular molecules for the treatment and prevention of various cancers, and have emerged as strong candidates for such repurposing because numerous serine/threonine and tyrosine kinases have been implicated in the pathobiology of Parkinson’s disease. This review focuses on various kinase-dependent pathways associated with the expression of Parkinson’s disease pathology, and evaluates how inhibitors of these pathways might play a major role as effective therapeutic molecules. PMID:27657053

  11. Crystal structure of human nicotinamide riboside kinase.

    Science.gov (United States)

    Khan, Javed A; Xiang, Song; Tong, Liang

    2007-08-01

    Nicotinamide riboside kinase (NRK) has an important role in the biosynthesis of NAD(+) as well as the activation of tiazofurin and other NR analogs for anticancer therapy. NRK belongs to the deoxynucleoside kinase and nucleoside monophosphate (NMP) kinase superfamily, although the degree of sequence conservation is very low. We report here the crystal structures of human NRK1 in a binary complex with the reaction product nicotinamide mononucleotide (NMN) at 1.5 A resolution and in a ternary complex with ADP and tiazofurin at 2.7 A resolution. The active site is located in a groove between the central parallel beta sheet core and the LID and NMP-binding domains. The hydroxyl groups on the ribose of NR are recognized by Asp56 and Arg129, and Asp36 is the general base of the enzyme. Mutation of residues in the active site can abolish the catalytic activity of the enzyme, confirming the structural observations.

  12. Crystal Structure of Human Nicotinamide Riboside Kinase

    Energy Technology Data Exchange (ETDEWEB)

    Khan,J.; Xiang, S.; Tong, L.

    2007-01-01

    Nicotinamide riboside kinase (NRK) has an important role in the biosynthesis of NAD{sup +} as well as the activation of tiazofurin and other NR analogs for anticancer therapy. NRK belongs to the deoxynucleoside kinase and nucleoside monophosphate (NMP) kinase superfamily, although the degree of sequence conservation is very low. We report here the crystal structures of human NRK1 in a binary complex with the reaction product nicotinamide mononucleotide (NMN) at 1.5 {angstrom} resolution and in a ternary complex with ADP and tiazofurin at 2.7 {angstrom} resolution. The active site is located in a groove between the central parallel {beta} sheet core and the LID and NMP-binding domains. The hydroxyl groups on the ribose of NR are recognized by Asp56 and Arg129, and Asp36 is the general base of the enzyme. Mutation of residues in the active site can abolish the catalytic activity of the enzyme, confirming the structural observations.

  13. Structures of pyruvate kinases display evolutionarily divergent allosteric strategies.

    Science.gov (United States)

    Morgan, Hugh P; Zhong, Wenhe; McNae, Iain W; Michels, Paul A M; Fothergill-Gilmore, Linda A; Walkinshaw, Malcolm D

    2014-09-01

    The transition between the inactive T-state (apoenzyme) and active R-state (effector bound enzyme) of Trypanosoma cruzi pyruvate kinase (PYK) is accompanied by a symmetrical 8° rigid body rocking motion of the A- and C-domain cores in each of the four subunits, coupled with the formation of additional salt bridges across two of the four subunit interfaces. These salt bridges provide increased tetramer stability correlated with an enhanced specificity constant (k cat/S 0.5). A detailed kinetic and structural comparison between the potential drug target PYKs from the pathogenic protists T. cruzi, T. brucei and Leishmania mexicana shows that their allosteric mechanism is conserved. By contrast, a structural comparison of trypanosomatid PYKs with the evolutionarily divergent PYKs of humans and of bacteria shows that they have adopted different allosteric strategies. The underlying principle in each case is to maximize (k cat/S 0.5) by stabilizing and rigidifying the tetramer in an active R-state conformation. However, bacterial and mammalian PYKs have evolved alternative ways of locking the tetramers together. In contrast to the divergent allosteric mechanisms, the PYK active sites are highly conserved across species. Selective disruption of the varied allosteric mechanisms may therefore provide a useful approach for the design of species-specific inhibitors.

  14. Inflammatory Bowel Diseases: When Natural Friends Turn into Enemies—The Importance of CpG Motifs of Bacterial DNA in Intestinal Homeostasis and Chronic Intestinal Inflammation

    Directory of Open Access Journals (Sweden)

    Florian Obermeier

    2010-01-01

    Full Text Available From numerous studies during the last years it became evident that bacteria and bacterial constituents play a decisive role both in the maintenance of intestinal immune homeostasis as well as in the development and perpetuation of chronic intestinal inflammation. In this review we focus on the role of bacterial DNA which is a potent immunomodulatory component of the bacterial flora. Bacterial DNA has been shown to be protective against experimental colitis. In contrast bacterial DNA essentially contributes to the perpetuation of an already established chronic intestinal inflammation in a Toll-like receptor (TLR9-dependent manner. This dichotomic action may be explained by a different activation status of essential regulators of TLR signaling like Glycogen synthase kinase 3- (GSK3- depending on the pre-activation status of the intestinal immune system. In this review we suggest that regulators of TLR signaling may be interesting therapeutic targets in IBD aiming at the restoration of intestinal immune homeostasis.

  15. [Characterization of a putative S locus encoded receptor protein kinase and its role in self-incompatibility]. Progress report, January 1993

    Energy Technology Data Exchange (ETDEWEB)

    1993-06-01

    The serine/threonine protein kinase (SRK) protein was predicted to be similar to the growth factor receptor tyrosine kinases in animals but its amino acid sequence of the catalytic domain is more similar to that of the catalytic domains of protein serine/threonine kinases than to protein tyrosine kinases. We have shown that the SRK protein has intrinsic scrine/threonine kinase activity. We subcloned the protein kinase-homologous domain of the SRK{sub 6} cDNA into the bacterial expression vector pGEX-3X and we have constructed a second plasmid identical to the first except that it carried a conservative mutation that substituted Arg for the Lys{sup 524} codon of SRK6 This lysine corresponds to the ATP-binding site, is essential in protein kinases, and is a common target for site-directed mutagenesis as a means to obtain kinase-defective proteins. Cultures bearing the wild-type and mutant SRK catalytic domains each produced an approximately 64 kD protein that reacted with anti-SRK6 antibodies. Following pulse-labeling with {sup 32}P we found that the wild-type SRK6 protein but not the mutant form was detectably phosphorylated. Phosphoamino acid analysis of the affinity purified {sup 32}p-labeled GST-SRK6 fusion protein demonstrated that SRK was phosphorylated predominantly on semine and to a lesser extent on threonine, but not on tyrosine. Thus, SRK6 is a functional serine/threonine protein kinase.

  16. Molecular mechanisms underlying bacterial persisters

    DEFF Research Database (Denmark)

    Maisonneuve, Etienne; Gerdes, Kenn

    2014-01-01

    All bacteria form persisters, cells that are multidrug tolerant and therefore able to survive antibiotic treatment. Due to the low frequencies of persisters in growing bacterial cultures and the complex underlying molecular mechanisms, the phenomenon has been challenging to study. However, recent...

  17. Bacterial Cytotoxins Target Rho GTPases

    Science.gov (United States)

    Schmidt, Gudula; Aktories, Klaus

    1998-06-01

    Low molecular mass GTPases of the Rho family, which are involved in the regulation of the actin cytoskeleton and in various signal transduction processes, are the eukaryotic targets of bacterial protein toxins. The toxins covalently modify Rho proteins by ADP ribosylation, glucosylation, and deamidation, thereby inactivating and activating the GTPases.

  18. Disease notes - Bacterial root rot

    Science.gov (United States)

    Bacterial root rot initiated by lactic acid bacteria, particularly Leuconostoc, occurs every year in Idaho sugarbeet fields. Hot fall weather seems to make the problem worse. Although Leuconostoc initiates the rot, other bacteria and yeast frequently invade the tissue as well. The acetic acid bac...

  19. Bacterial canker resistance in tomato

    NARCIS (Netherlands)

    Sen, Y.

    2014-01-01

    Clavibacter michiganensis subsp. michiganensis (Cmm) is the pathogen causing bacterial  canker in tomato. The disease was described for the first time in 1910 in Michigan, USA. Cmmis considered the most harmful bacteria threatening tomato. Disease transmission occurs via seed and symptoms becom

  20. Biotechnological applications of bacterial cellulases

    Directory of Open Access Journals (Sweden)

    Esther Menendez

    2015-08-01

    Full Text Available Cellulases have numerous applications in several industries, including biofuel production, food and feed industry, brewing, pulp and paper, textile, laundry, and agriculture.Cellulose-degrading bacteria are widely spread in nature, being isolated from quite different environments. Cellulose degradation is the result of a synergic process between an endoglucanase, an exoglucanase and a,β-glucosidase. Bacterial endoglucanases degrade ß-1,4-glucan linkages of cellulose amorphous zones, meanwhile exoglucanases cleave the remaining oligosaccharide chains, originating cellobiose, which is hydrolyzed by ß-glucanases. Bacterial cellulases (EC 3.2.1.4 are comprised in fourteen Glycosil Hydrolase families. Several advantages, such as higher growth rates and genetic versatility, emphasize the suitability and advantages of bacterial cellulases over other sources for this group of enzymes. This review summarizes the main known cellulolytic bacteria and the best strategies to optimize their cellulase production, focusing on endoglucanases, as well as it reviews the main biotechnological applications of bacterial cellulases in several industries, medicine and agriculture.

  1. Food irradiation and bacterial toxins

    Energy Technology Data Exchange (ETDEWEB)

    Tranter, H.S.; Modi, N.K.; Hambleton, P.; Melling, J.; Rose, S.; Stringer, M.F.

    1987-07-04

    The authors' findings indicate that irradiation confers no advantage over heat processing in respect of bacterial toxins (clostridium botulinum, neurotoxin A and staphylococcal enterotoxin A). It follows that irradiation at doses less than the ACINF recommended upper limit of 10 kGy could not be used to improve the ambient temperature shelf life on non-acid foods.

  2. Extracardiac manifestations of bacterial endocarditis.

    Science.gov (United States)

    Heffner, J E

    1979-08-01

    Bacterial endocarditis is an elusive disease that challenges clinicians' diagnostic capabilities. Because it can present with various combinations of extravalvular signs and symptoms, the underlying primary disease can go unnoticed.A review of the various extracardiac manifestations of bacterial endocarditis suggests three main patterns by which the valvular infection can be obscured. (1) A major clinical event may be so dramatic that subtle evidence of endocarditis is overlooked. The rupture of a mycotic aneurysm may simulate a subarachnoid hemorrhage from a congenital aneurysm. (2) The symptoms of bacterial endocarditis may be constitutional complaints easily attributable to a routine, trivial illness. Symptoms of low-grade fever, myalgias, back pain and anorexia may mimic a viral syndrome. (3) Endocarditis poses a difficult diagnostic dilemma when it generates constellations of findings that are classic for other disorders. Complaints of arthritis and arthralgias accompanied by hematuria and antinuclear antibody may suggest systemic lupus erythematosus; a renal biopsy study showing diffuse proliferative glomerulonephritis may support this diagnosis. The combination of fever, petechiae, altered mental status, thrombocytopenia, azotemia and anemia may promote the diagnosis of thrombotic thrombocytopenic purpura. When the protean guises of bacterial endocarditis create these clinical difficulties, errors in diagnosis occur and appropriate therapy is delayed. Keen awareness of the varied disease presentations will improve success in managing endocarditis by fostering rapid diagnosis and prompt therapy.

  3. Cloning and expression of the heterodimeric deoxyguanosine kinase/deoxyadenosine kinase of Lactobacillus acidophilus R-26.

    Science.gov (United States)

    Ma, G T; Hong, Y S; Ives, D H

    1995-03-24

    Two uniquely paired deoxynucleoside kinases, deoxycytidine kinase/deoxyadenosine kinase (dCK/dAK) and deoxyguanosine kinase/deoxyadenosine kinase (dGK/dAK) are required, together with thymidine kinase (TK), for deoxynucleotide synthesis in Lactobacillus acidophilus R-26. Using polymerase chain reaction-generated probes based on N-terminal amino acid sequences, we have cloned tandem genes for 25- and 26-kDa polypeptides, whose derived amino acid sequences and size correspond to wild-type Lactobacillus enzyme subunits. Expression in Escherichia coli uses a single endogenous promoter and yields active dGK/dAK (approximately 3% of extracted protein) closely resembling wild-type dGK/dAK in specificity, kinetics, heterotropic activation, and end product inhibition. Alignment of cloned genes reveals 65% identity in their DNA sequences and 61% identity in derived amino acid sequences. Comparison with herpes-viral TKs reveals three conserved regions: glycine- and arginine-rich ATP-binding motifs and a D/E-R-S/H motif at the putative TK deoxynucleoside site. Greater homology, however, is seen upon multiple alignment of dGK with mammalian deoxycytidine kinases, yielding the consensus sequence-D/E-R-S-I/V-Y-x-D-.dGK also shares a sequence (-Y-D-P-T-I/L-E-D-S/Y-Y-) required for GTP hydrolysis by p21ras.

  4. Purification and kinase assay of PKN.

    Science.gov (United States)

    Mukai, Hideyuki; Ono, Yoshitaka

    2006-01-01

    PKN is a serine/threonine protein kinase, which has a catalytic domain highly homologous to that of protein kinase C (PKC) in the carboxyl-terminal region and three repeats of the antiparallel coiled coil (ACC) domain in the amino-terminal region. Mammalian PKN has three isoforms each derived from different genes, PKN1 (PKNalpha/PRK1/PAK1), PKN2 (PRK2/PAK2/PKNgamma), and PKN3 (PKNbeta). PKN isoforms show different enzymatic properties and tissue distributions and have been implicated in various distinct cellular processes (reviewed in Mukai [2003]). This chapter discusses methods to prepare purified enzymes and to assay substrate phosphorylation activities.

  5. Rational design of protein kinase inhibitors

    Directory of Open Access Journals (Sweden)

    Yarmoluk S. M.

    2013-07-01

    Full Text Available Modern methodological approaches to rational design of low molecular weight compounds with specific activity in relation to predetermined biomolecular targets are considered by example of development of high effective protein kinase inhibitors. The application of new computational methods that allow to significantly improve the quality of computational experiments (in, particular, accuracy of low molecular weight compounds activity prediction without increase of computational and time costs are highlighted. The effectiveness of strategy of rational design is demonstrated by examples of several own investigations devoted to development of new inhibitors that are high effective and selective towards protein kinases CK2, FGFR1 and ASK1.

  6. Lipid activators of protein kinase C

    Energy Technology Data Exchange (ETDEWEB)

    Chauhan, V.P.S.; Chauhan, A.; Deshmukh, D.S.; Brockerhoff, H. (New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY (USA))

    1990-01-01

    Among the many reported lipid activators of protein kinase C only those of high affinity can be considered true physiological effectors, at present the tumor promoters, e.g., phorbol esters; 1,2-diacyl-sn-glycerols; and phosphatidylinositol 4,5-bisphosphate. Many other compounds (including arachidonic acid) are activators at high, unphysiological concentrations only, and they seem to be sterically unsuited for bonding to the enzyme. Such pseudoactivators possibly act by scrambling the structure of the regulatory moiety of the kinase.

  7. Purification and characterization of a casein kinase 2-type protein kinase from pea nuclei

    Science.gov (United States)

    Li, H.; Roux, S. J.

    1992-01-01

    Almost all the polyamine-stimulated protein kinase activity associated with the chromatin fraction of nuclei purified from etiolated pea (Pisum sativum L.) plumules is present in a single enzyme that can be extracted from chromatin by 0.35 molar NaCl. This protein kinase can be further purified over 2000-fold by salt fractionation and anion-exchange and casein-agarose column chromatography, after which it is more than 90% pure. The purified kinase has a specific activity of about 650 nanomoles per minute per milligram protein in the absence of polyamines, with either ATP or GTP as phosphoryl donor. Spermidine can stimulate its activity fourfold, with half-maximal activation at about 2 millimolar. Spermine and putrescine also stimulate activity, although somewhat less effectively. This kinase has a tetrameric alpha 2 beta 2 structure with a native molecular weight of 130,000, and subunit molecular weights of 36,000 for the catalytic subunit (alpha) and 29,000 for the regulatory subunit (beta). In western blot analyses, only the alpha subunit reacts strongly with polyclonal antibodies to a Drosophila casein kinase II. The pea kinase can use casein and phosvitin as artificial substrates, phosphorylating both the serine and threonine residues of casein. It has a pH optimum near 8.0, a Vmax of 1.5 micromoles per minute per milligram protein, and a Km for ATP of approximately 75 micromolar. Its activity can be almost completely inhibited by heparin at 5 micrograms per milliliter, but is relatively insensitive to concentrations of staurosporine, K252a, and chlorpromazine that strongly antagonize Ca(2+) -regulated protein kinases. These results are discussed in relation to recent findings that casein kinase 2-type kinases may phosphorylate trans-acting factors that bind to light-regulated promoters in plants.

  8. Contribution of casein kinase 2 and spleen tyrosine kinase to CFTR trafficking and protein kinase A-induced activity.

    Science.gov (United States)

    Luz, Simão; Kongsuphol, Patthara; Mendes, Ana Isabel; Romeiras, Francisco; Sousa, Marisa; Schreiber, Rainer; Matos, Paulo; Jordan, Peter; Mehta, Anil; Amaral, Margarida D; Kunzelmann, Karl; Farinha, Carlos M

    2011-11-01

    Previously, the pleiotropic "master kinase" casein kinase 2 (CK2) was shown to interact with CFTR, the protein responsible for cystic fibrosis (CF). Moreover, CK2 inhibition abolished CFTR conductance in cell-attached membrane patches, native epithelial ducts, and Xenopus oocytes. CFTR possesses two CK2 phosphorylation sites (S422 and T1471), with unclear impact on its processing and trafficking. Here, we investigated the effects of mutating these CK2 sites on CFTR abundance, maturation, and degradation coupled to effects on ion channel activity and surface expression. We report that CK2 inhibition significantly decreased processing of wild-type (wt) CFTR, with no effect on F508del CFTR. Eliminating phosphorylation at S422 and T1471 revealed antagonistic roles in CFTR trafficking: S422 activation versus T1471 inhibition, as evidenced by a severe trafficking defect for the T1471D mutant. Notably, mutation of Y512, a consensus sequence for the spleen tyrosine kinase (SYK) possibly acting in a CK2 context adjacent to the common CF-causing defect F508del, had a strong effect on both maturation and CFTR currents, allowing the identification of this kinase as a novel regulator of CFTR. These results reinforce the importance of CK2 and the S422 and T1471 residues for regulation of CFTR and uncover a novel regulation of CFTR by SYK, a recognized controller of inflammation.

  9. Adenylate kinase from Streptococcus pneumoniae is essential for growth through its catalytic activity

    Directory of Open Access Journals (Sweden)

    Trung Thanh Thach

    2014-01-01

    Full Text Available Streptococcus pneumoniae (pneumococcus infection causes more than 1.6 million deaths worldwide. Pneumococcal growth is a prerequisite for its virulence and requires an appropriate supply of cellular energy. Adenylate kinases constitute a major family of enzymes that regulate cellular ATP levels. Some bacterial adenylate kinases (AdKs are known to be critical for growth, but the physiological effects of AdKs in pneumococci have been poorly understood at the molecular level. Here, by crystallographic and functional studies, we report that the catalytic activity of adenylate kinase from S. pneumoniae (SpAdK serotype 2 D39 is essential for growth. We determined the crystal structure of SpAdK in two conformations: ligand-free open form and closed in complex with a two-substrate mimic inhibitor adenosine pentaphosphate (Ap5A. Crystallographic analysis of SpAdK reveals Arg-89 as a key active site residue. We generated a conditional expression mutant of pneumococcus in which the expression of the adk gene is tightly regulated by fucose. The expression level of adk correlates with growth rate. Expression of the wild-type adk gene in fucose-inducible strains rescued a growth defect, but expression of the Arg-89 mutation did not. SpAdK increased total cellular ATP levels. Furthermore, lack of functional SpAdK caused a growth defect in vivo. Taken together, our results demonstrate that SpAdK is essential for pneumococcal growth in vitro and in vivo.

  10. Ethylene Controls Autophosphorylation of the Histidine Kinase Domain in Ethylene Receptor ETR1

    Institute of Scientific and Technical Information of China (English)

    Jan Voet-van-Vormizeele; Georg Groth

    2008-01-01

    Perception of the phytohormone ethylene is accomplished by a small family of integral membrane receptors.In Arabidopsis,five ethylene receptor proteins are known,including ethylene resistant 1 (ETR1).The hydrophobic aminoterminal domain of these receptors contains the ethylene-binding site while the carboxyl-terminal part consists of a histidine kinase domain and a response regulator domain,which are well known elements found in bacterial two-component signaling.The soluble membrane-extrinsic carboxyl-terminal part of the receptor,which is likely to play an important role in signal transduction,showed intrinsic kinase activity when expressed and purified on its own.However,a correlation between signal input and autokinase activity was not established in these studies,as receptors were missing the transmembrane amino-terminal sensor domain.Thus,it is still unclear whether autophosphorylation occurs in response to perception of the ethylene signal.Here,we report on autophosphorylation studies of purified full-length ETR1.Autokinase activity of the purified receptor is controlled by ethylene or by ethylene agonists like the π-acceptor compound cyanide.In fact,both signal molecules were able to completely turn off the intrinsic kinase activity.Furthermore,the observed inhibition of autophosphorylation in ETR1 by both molecules could be prevented when the ethylene antagonist 1-methyl-cyclopropene (MCP) was applied.

  11. Mycobacterium tuberculosis Ser/Thr protein kinase B mediates an oxygen-dependent replication switch

    Energy Technology Data Exchange (ETDEWEB)

    Ortega, Corrie; Liao, Reiling; Anderson, Lindsey N.; Rustad, Tige; Ollodart, Anja R.; Wright, Aaron T.; Sherman, David R.; Grundner, Christoph

    2014-01-07

    In the majority of cases, Mycobacterium tuberculosis (Mtb) infections are clinically latent, characterized by little or no bacterial replication and drug tolerance. Low oxygen tension is a major host factor inducing bacteriostasis, but the molecular mechanisms driving oxygen-dependent replication are poorly understood. Mtb encodes eleven serine/threonine protein kinases, a family of signaling molecules known to regulate similar replicative adaptations in other bacteria. Here, we tested the role of serine/threonine phosphorylation in the Mtb response to altered oxygen status, using an in vitro model of latency (hypoxia) and reactivation (reaeration). Broad kinase inhibition compromised survival of Mtb in hypoxia. Activity-based protein profiling and genetic mutation identified PknB as the kinase critical for surviving hypoxia. Mtb replication was highly sensitive to changes in PknB levels in aerated culture, and even more so in hypoxia. A mutant overexpressing PknB specifically in hypoxia showed a 10-fold loss in viability in low oxygen conditions. In contrast, chemically reducing PknB activity during hypoxia specifically compromised resumption of growth during reaeration. These data support a model in which PknB activity is reduced to achieve bacteriostasis, and elevated when replication resumes. Together, these data show that phosphosignaling controls replicative transitions associated with latency and reactivation, that PknB is a major regulator of these transitions, and that PknB could provide a highly vulnerable therapeutic target at every step of the Mtb life cycle - active disease, latency, and reactivation.

  12. Characterization of mercury bioremediation by transgenic bacteria expressing metallothionein and polyphosphate kinase

    Directory of Open Access Journals (Sweden)

    Gonzalez-Ruiz Gloriene

    2011-08-01

    Full Text Available Abstract Background The use of transgenic bacteria has been proposed as a suitable alternative for mercury remediation. Ideally, mercury would be sequestered by metal-scavenging agents inside transgenic bacteria for subsequent retrieval. So far, this approach has produced limited protection and accumulation. We report here the development of a transgenic system that effectively expresses metallothionein (mt-1 and polyphosphate kinase (ppk genes in bacteria in order to provide high mercury resistance and accumulation. Results In this study, bacterial transformation with transcriptional and translational enhanced vectors designed for the expression of metallothionein and polyphosphate kinase provided high transgene transcript levels independent of the gene being expressed. Expression of polyphosphate kinase and metallothionein in transgenic bacteria provided high resistance to mercury, up to 80 μM and 120 μM, respectively. Here we show for the first time that metallothionein can be efficiently expressed in bacteria without being fused to a carrier protein to enhance mercury bioremediation. Cold vapor atomic absorption spectrometry analyzes revealed that the mt-1 transgenic bacteria accumulated up to 100.2 ± 17.6 μM of mercury from media containing 120 μM Hg. The extent of mercury remediation was such that the contaminated media remediated by the mt-1 transgenic bacteria supported the growth of untransformed bacteria. Cell aggregation, precipitation and color changes were visually observed in mt-1 and ppk transgenic bacteria when these cells were grown in high mercury concentrations. Conclusion The transgenic bacterial system described in this study presents a viable technology for mercury bioremediation from liquid matrices because it provides high mercury resistance and accumulation while inhibiting elemental mercury volatilization. This is the first report that shows that metallothionein expression provides mercury resistance and

  13. Prostatitis-bacterial - self-care

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000395.htm Prostatitis- bacterial - self-care To use the sharing features ... enable JavaScript. You have been diagnosed with bacterial prostatitis . This is an infection of the prostate gland. ...

  14. Cognitive outcome in adults after bacterial meningitis.

    NARCIS (Netherlands)

    Hoogman, M.; Beek, D. van de; Weisfelt, M.; Gans, J. de; Schmand, B.

    2007-01-01

    OBJECTIVE: To evaluate cognitive outcome in adult survivors of bacterial meningitis. METHODS: Data from three prospective multicentre studies were pooled and reanalysed, involving 155 adults surviving bacterial meningitis (79 after pneumococcal and 76 after meningococcal meningitis) and 72 healthy c

  15. The sensory histidine kinases TorS and EvgS tend to form clusters in Escherichia coli cells.

    Directory of Open Access Journals (Sweden)

    Erik Sommer

    Full Text Available Microorganisms use multiple two-component sensory systems to detect changes in their environment and elicit physiological responses. Despite their wide spread and importance, the intracellular organization of two-component sensory proteins in bacteria remains little investigated. A notable exception is the well-studied clustering of the chemoreceptor-kinase complexes that mediate chemotaxis behaviour. However, these chemosensory complexes differ fundamentally from other systems, both structurally and functionally. Therefore, studying the organization of typical sensory kinases in bacteria is essential for understanding the general role of receptor clustering in bacterial sensory signalling. Here, by studying mYFP-tagged sensory kinases in Escherichia coli, we show that the tagged TorS and EvgS sensors have a clear tendency for self-association and clustering. These sensors clustered even when expressed at a level of a few hundred copies per cell. Moreover, the mYFP-tagged response regulator TorR showed clear TorS-dependent clustering, indicating that untagged TorS sensors also tend to form clusters. We also provide evidence for the functionality of these tagged sensors. Experiments with truncated TorS or EvgS proteins suggested that clustering of EvgS sensors depends on the cytoplasmic part of the protein, whereas clustering of TorS sensors can be potentially mediated by the periplasmic/transmembrane domain. Overall, these findings support the notion that sensor clustering plays a role in bacterial sensory signalling beyond chemotaxis.

  16. Tannerella forsythia invasion in oral epithelial cells requires phosphoinositide 3-kinase activation and clathrin-mediated endocytosis.

    Science.gov (United States)

    Mishima, Elina; Sharma, Ashu

    2011-08-01

    Tannerella forsythia, a Gram-negative anaerobe implicated in periodontitis, has been detected within human buccal epithelial cells and shown to invade oral epithelial cells in vitro. We have previously shown that this bacterium triggers host tyrosine kinase-dependent phosphorylation and actin-dependent cytoskeleton reorganization for invasion. On the bacterial side, the leucine-rich repeat cell-surface BspA protein is important for entry. The present study was undertaken to identify host signalling molecules during T. forsythia entry into human oral and cervical epithelial cells. Specifically, the roles of phosphatidylinositol 3-kinase (PI3K), Rho-family GTPases, cholesterol-rich membrane microdomains and the endocytic protein clathrin were investigated. For this purpose, cell lines were pretreated with chemical inhibitors or small interfering RNAs (siRNAs) that target PI3Ks, Rho GTPases, clathrin and cholesterol (a critical component of 'lipid rafts'), and the resulting effects on T. forsythia uptake were determined. Our studies revealed that T. forsythia entry is dependent on host PI3K signalling, and that purified BspA protein causes activation of this lipid kinase. Bacterial entry also requires the cooperation of host Rac1 GTPase. Finally, our findings indicate an important role for clathrin and cholesterol-rich lipid microdomains in the internalization process.

  17. The bacterial lux reporter system: applications in bacterial localisation studies.

    Science.gov (United States)

    Gahan, Cormac G M

    2012-02-01

    Bacterial production of visible light is a natural phenomenon occurring in marine (Vibrio and Photobacterium) and terrestrial (Photorhabdus) species. The mechanism underpinning light production in these organisms is similar and involves the oxidation of an aldehyde substrate in a reaction catalysed by the bacterial luciferase enzyme. The genes encoding the luciferase and a fatty acid reductase complex which synthesizes the substrate are contained in a single operon (the lux operon). This provides a useful reporter system as cloning the operon into a recipient host bacterium will generate visible light without the requirement to add exogenous substrate. The light can be detected in vivo in the living animal using a sensitive detection system and is therefore ideally suited to bioluminescence imaging protocols. The system has therefore been widely used to track bacteria during infection or colonisation of the host. As bacteria are currently being examined as bactofection vectors for gene delivery, particularly to tumour tissue, the use of bioluminescence imaging offers a powerful means to investigate vector amplification in situ. The implications of this technology for bacterial localization, tumour targeting and gene transfer (bactofection) studies are discussed.

  18. 90-kDa ribosomal S6 kinase is phosphorylated and activated by 3-phosphoinositide-dependent protein kinase-1

    DEFF Research Database (Denmark)

    Jensen, Claus Antonio Juel; Buch, M B; Krag, T O;

    1999-01-01

    90-kDa ribosomal S6 kinase-2 (RSK2) belongs to a family of growth factor-activated serine/threonine kinases composed of two kinase domains connected by a regulatory linker region. The N-terminal kinase of RSK2 is involved in substrate phosphorylation. Its activation requires phosphorylation of th...... of Ser(227), Ser(369), and Ser(386). Our study extend recent findings which implicate PDK1 in the activation of protein kinases B and C and p70(S6K), suggesting that PDK1 controls several major growth factor-activated signal transduction pathways.......90-kDa ribosomal S6 kinase-2 (RSK2) belongs to a family of growth factor-activated serine/threonine kinases composed of two kinase domains connected by a regulatory linker region. The N-terminal kinase of RSK2 is involved in substrate phosphorylation. Its activation requires phosphorylation...... of the linker region at Ser(369), catalyzed by extracellular signal-regulated kinase (ERK), and at Ser(386), catalyzed by the C-terminal kinase, after its activation by ERK. In addition, the N-terminal kinase must be phosphorylated at Ser(227) in the activation loop by an as yet unidentified kinase. Here, we...

  19. Periodic fever and mevalonate kinase deficiency

    NARCIS (Netherlands)

    Frenkel, Joost

    2002-01-01

    Mevalonate kinase (MK) deficiency is an autosomal recessive disorder, caused by mutations in the MVK-gene on chromosome 12q24. The affected enzyme catalyzes an early step in isoprenoid biosynthesis, the pathway that produces cholesterol and several non-sterol isoprenoids. The clinical spectrum inclu

  20. Monoclonal Antibodies Against Xenopus Greatwall Kinase

    Science.gov (United States)

    Wang, Ling; Fisher, Laura A.; Wahl, James K.

    2011-01-01

    Mitosis is known to be regulated by protein kinases, including MPF, Plk1, Aurora kinases, and so on, which become active in M-phase and phosphorylate a wide range of substrates to control multiple aspects of mitotic entry, progression, and exit. Mechanistic investigations of these kinases not only provide key insights into cell cycle regulation, but also hold great promise for cancer therapy. Recent studies, largely in Xenopus, characterized a new mitotic kinase named Greatwall (Gwl) that plays essential roles in both mitotic entry and maintenance. In this study, we generated a panel of mouse monoclonal antibodies (MAbs) specific for Xenopus Gwl and characterized these antibodies for their utility in immunoblotting, immunoprecipitation, and immunodepletion in Xenopus egg extracts. Importantly, we generated an MAb that is capable of neutralizing endogenous Gwl. The addition of this antibody into M-phase extracts results in loss of mitotic phosphorylation of Gwl, Plk1, and Cdk1 substrates. These results illustrate a new tool to study loss-of-function of Gwl, and support its essential role in mitosis. Finally, we demonstrated the usefulness of the MAb against human Gwl/MASTL. PMID:22008075

  1. Allosteric small-molecule kinase inhibitors

    DEFF Research Database (Denmark)

    Wu, Peng; Clausen, Mads Hartvig; Nielsen, Thomas E.

    2015-01-01

    current barriers of kinase inhibitors, including poor selectivity and emergence of drug resistance. In spite of the small number of identified allosteric inhibitors in comparison with that of inhibitors targeting the ATP pocket, encouraging results, such as the FDA-approval of the first small...

  2. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  3. MAP kinases in inflammatory bowel disease

    DEFF Research Database (Denmark)

    Coskun, Mehmet; Olsen, Jørgen; Seidelin, Jakob Benedict;

    2011-01-01

    The mammalian family of mitogen-activated protein kinases (MAPKs) is activated by diverse extracellular and intracellular stimuli, and thereby they play an essential role in connecting cell-surface receptors to changes in transcriptional programs. The MAPK signaling pathways regulate a wide range...

  4. Statistical analysis of protein kinase specificity determinants

    DEFF Research Database (Denmark)

    Kreegipuu, Andres; Blom, Nikolaj; Brunak, Søren;

    1998-01-01

    The site and sequence specificity of protein kinase, as well as the role of the secondary structure and surface accessibility of the phosphorylation sites on substrate proteins, was statistically analyzed. The experimental data were collected from the literature and are available on the World Wide...

  5. The catalytic subunit of cAMP-dependent protein kinase induces expression of genes containing cAMP-responsive enhancer elements.

    Science.gov (United States)

    Riabowol, K T; Fink, J S; Gilman, M Z; Walsh, D A; Goodman, R H; Feramisco, J R

    1988-11-03

    Transcriptional regulation of eukaryotic genes by cyclic AMP requires a cAMP-dependent protein kinase (A kinase). Two hypotheses have been proposed to explain how the holoenzyme of the A kinase induces transcription. The regulatory subunits of the A kinase, which bind cAMP and DNA, and have amino-acid homology with the Escherichia coli catabolite activator protein could directly stimulate gene expression. Alternatively, phosphorylation by the catalytic subunits could induce transcription by activating proteins involved in gene transcription. To distinguish between these models, we microinjected purified preparations of the catalytic and regulatory subunits of A kinase into tissue culture cells and monitored expression of a stably integrated fusion gene containing a cAMP-responsive human promoter fused to a bacterial reporter gene, or of the endogenous c-fos gene. The catalytic subunit stimulated expression of these genes, whereas the regulatory subunit did not. These results indicate that the catalytic subunit of A kinase is sufficient to induce expression of two cAMP-responsive genes, without increasing levels of cAMP.

  6. Distribution of Triplet Separators in Bacterial Genomes

    Institute of Scientific and Technical Information of China (English)

    HU Rui; ZHENG Wei-Mou

    2001-01-01

    Distributions of triplet separator lengths for two bacterial complete genomes are analyzed. The theoretical distributions for the independent random sequence and the first-order Markov chain are derived and compared with the distributions of the bacterial genomes. A prominent double band structure, which does not exist in the theoretical distributions, is observed in the bacterial distributions for most triplets.``

  7. Pyrrolopyridine inhibitors of mitogen-activated protein kinase-activated protein kinase 2 (MK-2).

    Science.gov (United States)

    Anderson, David R; Meyers, Marvin J; Vernier, William F; Mahoney, Matthew W; Kurumbail, Ravi G; Caspers, Nicole; Poda, Gennadiy I; Schindler, John F; Reitz, David B; Mourey, Robert J

    2007-05-31

    A new class of potent kinase inhibitors selective for mitogen-activated protein kinase-activated protein kinase 2 (MAPKAP-K2 or MK-2) for the treatment of rheumatoid arthritis has been prepared and evaluated. These inhibitors have IC50 values as low as 10 nM against the target and have good selectivity profiles against a number of kinases including CDK2, ERK, JNK, and p38. These MK-2 inhibitors have been shown to suppress TNFalpha production in U397 cells and to be efficacious in an acute inflammation model. The structure-activity relationships of this series, the selectivity for MK-2 and their activity in both in vitro and in vivo models are discussed. The observed selectivity is discussed with the aid of an MK-2/inhibitor crystal structure.

  8. CK2: a protein kinase in need of control

    DEFF Research Database (Denmark)

    Guerra, B; Boldyreff, B; Sarno, S;

    1999-01-01

    Protein kinase CK2 is a heterotetrameric alpha2beta2 Ser/Thr protein kinase with some features unusual among the eukaryotic protein kinases: (1) CK2 recognizes phosphoacceptor sites specified by several acidic determinants; (2) CK2 can use both ATP and GTP as phosphoryl donors; and (3...... response to nucleotide analogs. The increasing knowledge of CK2 structure-function relationships will allow the design of highly selective inhibitors of this pleiotropic kinase with oncogenic potential....

  9. Kinase detection with gallium nitride based high electron mobility transistors.

    Science.gov (United States)

    Makowski, Matthew S; Bryan, Isaac; Sitar, Zlatko; Arellano, Consuelo; Xie, Jinqiao; Collazo, Ramon; Ivanisevic, Albena

    2013-07-01

    A label-free kinase detection system was fabricated by the adsorption of gold nanoparticles functionalized with kinase inhibitor onto AlGaN/GaN high electron mobility transistors (HEMTs). The HEMTs were operated near threshold voltage due to the greatest sensitivity in this operational region. The Au NP/HEMT biosensor system electrically detected 1 pM SRC kinase in ionic solutions. These results are pertinent to drug development applications associated with kinase sensing.

  10. Expression, purification, and bioactivity of GST-fused v-Src from a bacterial expression system

    Institute of Scientific and Technical Information of China (English)

    GONG Xing-guo; JI Jing; XIE Jie; ZHOU Yuan; ZHANG Jun-yan; ZHONG Wen-tao

    2006-01-01

    v-Src is a non-receptor protein tyrosine kinase involved in many signal transduction pathways and closely related to the activation and development of cancers. We present herethe expression, purification, and bioactivity of a GST (glutathione S-transferase)-fused v-Src from a bacterial expression system. Different culture conditions were examined in an isopropyl β-D-thiogalactopyranoside (IPTG)-regulated expression, and the fused protein was purified using GSH (glutathione) affinity chromatography. ELISA (enzyme-linked immunosorbent assay) was employed to determine the phosphorylation kinase activity of the GST-fused v-Src. This strategy seems to be more promising than the insect cell system or other eukaryotic systems employed in earlier Src expression.

  11. Structure-Function Similarities between a Plant Receptor-like Kinase and the Human Interleukin-1 Receptor-associated Kinase-4*

    OpenAIRE

    2011-01-01

    Phylogenetic analysis has previously shown that plant receptor-like kinases (RLKs) are monophyletic with respect to the kinase domain and share an evolutionary origin with the animal interleukin-1 receptor-associated kinase/Pelle-soluble kinases. The lysin motif domain-containing receptor-like kinase-3 (LYK3) of the legume Medicago truncatula shows 33% amino acid sequence identity with human IRAK-4 over the kinase domain. Using the structure of this animal kinase as a template, homology model...

  12. Antibiotic drugs targeting bacterial RNAs

    Directory of Open Access Journals (Sweden)

    Weiling Hong

    2014-08-01

    Full Text Available RNAs have diverse structures that include bulges and internal loops able to form tertiary contacts or serve as ligand binding sites. The recent increase in structural and functional information related to RNAs has put them in the limelight as a drug target for small molecule therapy. In addition, the recognition of the marked difference between prokaryotic and eukaryotic rRNA has led to the development of antibiotics that specifically target bacterial rRNA, reduce protein translation and thereby inhibit bacterial growth. To facilitate the development of new antibiotics targeting RNA, we here review the literature concerning such antibiotics, mRNA, riboswitch and tRNA and the key methodologies used for their screening.

  13. Electromagnetic Signals from Bacterial DNA

    CERN Document Server

    Widom, A; Srivastava, Y N; Sivasubramanian, S

    2011-01-01

    Chemical reactions can be induced at a distance due to the propagation of electromagnetic signals during intermediate chemical stages. Although is is well known at optical frequencies, e.g. photosynthetic reactions, electromagnetic signals hold true for muck lower frequencies. In E. coli bacteria such electromagnetic signals can be generated by electric transitions between energy levels describing electrons moving around DNA loops. The electromagnetic signals between different bacteria within a community is a "wireless" version of intercellular communication found in bacterial communities connected by "nanowires". The wireless broadcasts can in principle be of both the AM and FM variety due to the magnetic flux periodicity in electron energy spectra in bacterial DNA orbital motions.

  14. Bacterial survival in Martian conditions

    CERN Document Server

    D'Alessandro, Giuseppe Galletta; Giulio Bertoloni; Maurizio

    2010-01-01

    We shortly discuss the observable consequences of the two hypotheses about the origin of life on Earth and Mars: the Lithopanspermia (Mars to Earth or viceversa) and the origin from a unique progenitor, that for Earth is called LUCA (the LUCA hypothesis). To test the possibility that some lifeforms similar to the terrestrial ones may survive on Mars, we designed and built two simulators of Martian environments where to perform experiments with different bacterial strains: LISA and mini-LISA. Our LISA environmental chambers can reproduce the conditions of many Martian locations near the surface trough changes of temperature, pressure, UV fluence and atmospheric composition. Both simulators are open to collaboration with other laboratories interested in performing experiments on many kind of samples (biological, minerals, electronic) in situations similar to that of the red planet. Inside LISA we have studied the survival of several bacterial strains and endospores. We verified that the UV light is the major re...

  15. Bacterial streamers in curved microchannels

    Science.gov (United States)

    Rusconi, Roberto; Lecuyer, Sigolene; Guglielmini, Laura; Stone, Howard

    2009-11-01

    Biofilms, generally identified as microbial communities embedded in a self-produced matrix of extracellular polymeric substances, are involved in a wide variety of health-related problems ranging from implant-associated infections to disease transmissions and dental plaque. The usual picture of these bacterial films is that they grow and develop on surfaces. However, suspended biofilm structures, or streamers, have been found in natural environments (e.g., rivers, acid mines, hydrothermal hot springs) and are always suggested to stem from a turbulent flow. We report the formation of bacterial streamers in curved microfluidic channels. By using confocal laser microscopy we are able to directly image and characterize the spatial and temporal evolution of these filamentous structures. Such streamers, which always connect the inner corners of opposite sides of the channel, are always located in the middle plane. Numerical simulations of the flow provide evidences for an underlying hydrodynamic mechanism behind the formation of the streamers.

  16. Bacterial chromosome organization and segregation.

    Science.gov (United States)

    Badrinarayanan, Anjana; Le, Tung B K; Laub, Michael T

    2015-01-01

    If fully stretched out, a typical bacterial chromosome would be nearly 1 mm long, approximately 1,000 times the length of a cell. Not only must cells massively compact their genetic material, but they must also organize their DNA in a manner that is compatible with a range of cellular processes, including DNA replication, DNA repair, homologous recombination, and horizontal gene transfer. Recent work, driven in part by technological advances, has begun to reveal the general principles of chromosome organization in bacteria. Here, drawing on studies of many different organisms, we review the emerging picture of how bacterial chromosomes are structured at multiple length scales, highlighting the functions of various DNA-binding proteins and the impact of physical forces. Additionally, we discuss the spatial dynamics of chromosomes, particularly during their segregation to daughter cells. Although there has been tremendous progress, we also highlight gaps that remain in understanding chromosome organization and segregation.

  17. Dynamics of bacterial gene regulation

    Science.gov (United States)

    Narang, Atul

    2009-03-01

    The phenomenon of diauxic growth is a classical problem of bacterial gene regulation. The most well studied example of this phenomenon is the glucose-lactose diauxie, which occurs because the expression of the lac operon is strongly repressed in the presence of glucose. This repression is often explained by appealing to molecular mechanisms such as cAMP activation and inducer exclusion. I will begin by analyzing data showing that these molecular mechanisms cannot explain the strong lac repression because they exert a relatively weak effect. I will then present a minimal model accounting only for enzyme induction and dilution, which yields strong repression despite the absence of catabolite repression and inducer exclusion. The model also explains the growth patterns observed in batch and continuous cultures of various bacterial strains and substrate mixtures. The talk will conclude with a discussion of the experimental evidence regarding positive feedback, the key component of the minimal model.

  18. Collective Functionality through Bacterial Individuality

    Science.gov (United States)

    Ackermann, Martin

    According to the conventional view, the properties of an organism are a product of nature and nurture - of its genes and the environment it lives in. Recent experiments with unicellular organisms have challenged this view: several molecular mechanisms generate phenotypic variation independently of environmental signals, leading to variation in clonal groups. My presentation will focus on the causes and consequences of this microbial individuality. Using examples from bacterial genetic model systems, I will first discuss different molecular and cellular mechanisms that give rise to bacterial individuality. Then, I will discuss the consequences of individuality, and focus on how phenotypic variation in clonal populations of bacteria can promote interactions between individuals, lead to the division of labor, and allow clonal groups of bacteria to cope with environmental uncertainty. Variation between individuals thus provides clonal groups with collective functionality.

  19. Mnk kinase pathway: Cellular functions and biological outcomes

    Institute of Scientific and Technical Information of China (English)

    Sonali; Joshi; Leonidas; C; Platanias

    2014-01-01

    The mitogen-activated protein kinase(MAPK) interacting protein kinases 1 and 2(Mnk1 and Mnk2) play important roles in controlling signals involved in mRNA translation. In addition to the MAPKs(p38 or Erk), multiple studies suggest that the Mnk kinases can be regulated by other known kinases such as Pak2 and/or other unidentified kinases by phosphorylation of residues distinct from the sites phosphorylated by the MAPKs. Several studies have established multiple Mnk protein targets, including PSF, heterogenous nuclear ribonucleoprotein A1, Sprouty 2 and have lead to the identification of distinct biological functions and substrate specificity for the Mnk kinases. In this review we discuss the pathways regulating the Mnk kinases, their known substrates as well as the functional consequences of engagement of pathways controlled by Mnk kinases. These kinases play an important role in mRNA translation via their regulation of eukaryotic initiation factor 4E(eIF4E) and their functions have important implications in tumor biology as well as the regulation of drug resistance to anti-oncogenic therapies. Other studies have identified a role for the Mnk kinases in cap-independent mRNA translation, suggesting that the Mnk kinases can exert important functional effects independently of the phosphorylation of eIF4 E. The role of Mnk kinases in inflammation and inflammationinduced malignancies is also discussed.

  20. A Novel Mode of Protein Kinase Inhibition Exploiting Hydrophobic Motifs of Autoinhibited Kinases

    Energy Technology Data Exchange (ETDEWEB)

    S Eathiraj; R Palma; M Hirschi; E Volckova; E Nakuci; J Castro; C Chen; T Chan; D France; M Ashwell

    2011-12-31

    Protein kinase inhibitors with enhanced selectivity can be designed by optimizing binding interactions with less conserved inactive conformations because such inhibitors will be less likely to compete with ATP for binding and therefore may be less impacted by high intracellular concentrations of ATP. Analysis of the ATP-binding cleft in a number of inactive protein kinases, particularly in the autoinhibited conformation, led to the identification of a previously undisclosed non-polar region in this cleft. This ATP-incompatible hydrophobic region is distinct from the previously characterized hydrophobic allosteric back pocket, as well as the main pocket. Generalized hypothetical models of inactive kinases were constructed and, for the work described here, we selected the fibroblast growth factor receptor (FGFR) tyrosine kinase family as a case study. Initial optimization of a FGFR2 inhibitor identified from a library of commercial compounds was guided using structural information from the model. We describe the inhibitory characteristics of this compound in biophysical, biochemical, and cell-based assays, and have characterized the binding mode using x-ray crystallographic studies. The results demonstrate, as expected, that these inhibitors prevent activation of the autoinhibited conformation, retain full inhibitory potency in the presence of physiological concentrations of ATP, and have favorable inhibitory activity in cancer cells. Given the widespread regulation of kinases by autoinhibitory mechanisms, the approach described herein provides a new paradigm for the discovery of inhibitors by targeting inactive conformations of protein kinases.

  1. Asymmetric Tyrosine Kinase Arrangements in Activation or Autophosphorylation of Receptor Tyrosine Kinases

    Energy Technology Data Exchange (ETDEWEB)

    J Bae; J Schlessinger

    2011-12-31

    Receptor tyrosine kinases (RTKs) play important roles in the control of many cellular processes including cell proliferation, cell adhesion, angiogenesis, and apoptosis. Ligand-induced dimerization of RTKs leads to autophosphorylation and activation of RTKs. Structural studies have shown that while isolated ectodomains of several RTKs form symmetric dimers the isolated cytoplasmic kinase domains of epidermal growth factor receptor (EGFR) and fibroblast growth factor receptor (FGFR) form asymmetric dimers during their activation. Binding of one kinase molecule of EGFR to a second kinase molecule asymmetrically leads to stimulation of kinase activity and enhanced autophosphorylation. Furthermore, the structures of the kinase domain of FGFR1 and FGFR2 reveal the formation of asymmetric interfaces in the processes of autophosphorylation at their specific phosphotyrosine (pY) sites. Disruption of asymmetric dimer interface of EGFR leads to reduction in enzymatic activity and drastic reduction of autophosphorylation of FGFRs in ligandstimulated live cells. These studies demonstrate that asymmetric dimer formation is as a common phenomenon critical for activation and autophosphorylation of RTKs.

  2. Bacterial Interstitial Nephritis in Children

    OpenAIRE

    Bobadilla Chang, Fernando; Departamento de Ciencias Dinámicas Facultad de Medicina Universidad Nacional Mayor de San Marcos Lima, Perú; Villanueva, Dolores; Departamento de Ciencias Dinámicas Facultad de Medicina Universidad Nacional Mayor de San Marcos Lima, Perú

    2014-01-01

    OBJECTIVE: To assess the diagnosis approach to urinary tract infections in children. MATERIAL AND METHODS: Medical records from 103 children with diagnosis of interstitial bacterial nephritis were retrospectively reviewed. Diagnosis was supported by the dramatic involvement of renal parenquima, which is not addressed as "urinary tract infection". RESULTS: From all 103 patients, 49 were 2-years-old or younger, 33 were between 2 and 5-years-old, and 21 were between 6 to 10. Clinical picture inc...

  3. Bacterial canker resistance in tomato

    OpenAIRE

    Sen, Y.

    2014-01-01

    Clavibacter michiganensis subsp. michiganensis (Cmm) is the pathogen causing bacterial  canker in tomato. The disease was described for the first time in 1910 in Michigan, USA. Cmmis considered the most harmful bacteria threatening tomato. Disease transmission occurs via seed and symptoms become visible at least 20 days after infection. Due to its complex strategy and transmission, Cmm is under quarantine regulation in EU and other countries. There is no method to stop disease progress i...

  4. Small intestinal bacterial overgrowth syndrome

    Institute of Scientific and Technical Information of China (English)

    Jan; Bures; Jiri; Cyrany; Darina; Kohoutova; Miroslav; Frstl; Stanislav; Rejchrt; Jaroslav; Kvetina; Viktor; Vorisek; Marcela; Kopacova

    2010-01-01

    Human intestinal microbiota create a complex polymi-crobial ecology. This is characterised by its high population density, wide diversity and complexity of interaction. Any dysbalance of this complex intestinal microbiome, both qualitative and quantitative, might have serious health consequence for a macro-organism, including small intestinal bacterial overgrowth syndrome (SIBO).SIBO is defined as an increase in the number and/or alteration in the type of bacteria in the upper gastro-intestinal tract. There...

  5. Biotechnological applications of bacterial cellulases

    OpenAIRE

    Esther Menendez; Paula Garcia-Fraile; Raul Rivas

    2015-01-01

    Cellulases have numerous applications in several industries, including biofuel production, food and feed industry, brewing, pulp and paper, textile, laundry, and agriculture.Cellulose-degrading bacteria are widely spread in nature, being isolated from quite different environments. Cellulose degradation is the result of a synergic process between an endoglucanase, an exoglucanase and a,β-glucosidase. Bacterial endoglucanases degrade ß-1,4-glucan linkages of cellulose amorphous zones, mean...

  6. Bacterial motility on abiotic surfaces

    OpenAIRE

    Gibiansky, Maxsim

    2013-01-01

    Bacterial biofilms are structured microbial communities which are widespread both in nature and in clinical settings. When organized into a biofilm, bacteria are extremely resistant to many forms of stress, including a greatly heightened antibiotic resistance. In the early stages of biofilm formation on an abiotic surface, many bacteria make use of their motility to explore the surface, finding areas of high nutrition or other bacteria to form microcolonies. They use motility appendages, incl...

  7. Characterization of the RcsC sensor kinase from Erwinia amylovora and other Enterobacteria.

    Science.gov (United States)

    Wang, Dongping; Korban, Schuyler S; Pusey, P Lawrence; Zhao, Youfu

    2011-06-01

    RcsC is a hybrid sensor kinase which contains a sensor domain, a histidine kinase domain, and a receiver domain. We have previously demonstrated that, although the Erwinia amylovora rcsC mutant produces more amylovoran than the wild-type (WT) strain in vitro, the mutant remains nonpathogenic on both immature pear fruit and apple plants. In this study, we have comparatively characterized the Erwinia RcsC and its homologs from various enterobacteria. Results demonstrate that expression of the Erwinia rcsC gene suppresses amylovoran production in various amylovoran overproducing WT and mutant strains, thus suggesting the presence of a net phosphatase activity of Erwinia RcsC. Findings have also demonstrated that rcsC homologs from other enterobacteria could not rescue amylovoran production of the Erwinia rcsC mutant in vitro. However, virulence of the Erwinia rcsC mutant is partially restored by rcsC homologs from Pantoea stewartii, Yersinia pestis, and Salmonella enterica but not from Escherichia coli on apple shoots. Domain-swapping experiments have indicated that replacement of the E. coli RcsC sensor domain by those of Erwinia and Yersinia spp. partially restores virulence of the Erwinia rcsC mutant, whereas chimeric constructs containing the sensor domain of E. coli RcsC could not rescue virulence of the Erwinia rcsC mutant on apple. Interestingly, only chimeric constructs containing the histidine kinase and receiver domains of Erwinia RcsC are fully capable of rescuing amylovoran production. These results suggest that the sensor domain of RcsC may be important in regulating bacterial virulence, whereas the activity of the histidine kinase and receiver domains of Erwinia RcsC may be essential for amylovoran production in vitro.

  8. Cytochemical Differences in Bacterial Glycocalyx

    Science.gov (United States)

    Krautgartner, Wolf Dietrich; Vitkov, Ljubomir; Hannig, Matthias; Pelz, Klaus; Stoiber, Walter

    2005-02-01

    To examine new cytochemical aspects of the bacterial adhesion, a strain 41452/01 of the oral commensal Streptococcus sanguis and a wild strain of Staphylococcus aureus were grown with and without sucrose supplementation for 6 days. Osmiumtetraoxyde (OsO4), uranyl acetate (UA), ruthenium red (RR), cupromeronic blue (CB) staining with critical electrolytic concentrations (CECs), and the tannic acid-metal salt technique (TAMST) were applied for electron microscopy. Cytochemically, only RR-positive fimbriae in S. sanguis were visualized. By contrast, some types of fimbriae staining were observed in S. aureus glycocalyx: RR-positive, OsO4-positive, tannophilic and CB-positive with ceasing point at 0.3 M MgCl2. The CB staining with CEC, used for the first time for visualization of glycoproteins of bacterial glycocalyx, also reveals intacellular CB-positive substances-probably the monomeric molecules, that is, subunits forming the fimbriae via extracellular assembly. Thus, glycosylated components of the biofilm matrix can be reliably related to single cells. The visualization of intracellular components by CB with CEC enables clear distinction between S. aureus and other bacteria, which do not produce CB-positive substances. The small quantities of tannophilic substances found in S. aureus makes the use of TAMST for the same purpose difficult. The present work protocol enables, for the first time, a partial cytochemical differentiation of the bacterial glycocalyx.

  9. DIAGNOSTIC DIFFICULTIES IN BACTERIAL SPONDYLODISCITIS

    Directory of Open Access Journals (Sweden)

    Vinicius Orso

    2015-12-01

    Full Text Available Objective : To analyze aspects related to the diagnostic difficulty in patients with bacterial spondylodiscitis. Methods : Cross-sectional observational study with retrospective data collected in the period from March 2004 to January 2014.Twenty-one patients diagnosed with bacterial spondylodiscitis were analyzed. Results : Women were the most affected, as well as older individuals. Pain in the affected region was the initial symptom in 52% of patients, and 45.5% of the patients had low back pain, and those with dorsal discitis had back pain as the main complaint; the patients with thoracolumbar discitis had pain in that region, and only one patient had sacroiliac discitis. The average time between onset of symptoms and treatment was five months. The lumbar segment was the most affected with 11 cases (52%, followed by thoracolumbar in 24%, dorsal in 19% of cases and a case in the sacroiliac segment. Only seven patients had fever. Pain in the affected level was coincidentally the most common symptom. Conclusions : Early diagnosis of bacterial spondylodiscitis remains a challenge due to the nonspecific signs and symptoms reported by the patient and the wide variability of laboratory results and imaging. The basis for early diagnosis remains the clinical suspicion at the time of initial treatment.

  10. Detergent-compatible bacterial amylases.

    Science.gov (United States)

    Niyonzima, Francois N; More, Sunil S

    2014-10-01

    Proteases, lipases, amylases, and cellulases are enzymes used in detergent formulation to improve the detergency. The amylases are specifically supplemented to the detergent to digest starchy stains. Most of the solid and liquid detergents that are currently manufactured contain alkaline enzymes. The advantages of using alkaline enzymes in the detergent formulation are that they aid in removing tough stains and the process is environmentally friendly since they reduce the use of toxic detergent ingredients. Amylases active at low temperature are preferred as the energy consumption gets reduced, and the whole process becomes cost-effective. Most microbial alkaline amylases are used as detergent ingredients. Various reviews report on the production, purification, characterization, and application of amylases in different industry sectors, but there is no specific review on bacterial or fungal alkaline amylases or detergent-compatible amylases. In this mini-review, an overview on the production and property studies of the detergent bacterial amylases is given, and the stability and compatibility of the alkaline bacterial amylases in the presence of the detergents and the detergent components are highlighted.

  11. Kinase impact assessment in the landscape of fusion genes that retain kinase domains: a pan-cancer study.

    Science.gov (United States)

    Kim, Pora; Jia, Peilin; Zhao, Zhongming

    2016-12-24

    Assessing the impact of kinase in gene fusion is essential for both identifying driver fusion genes (FGs) and developing molecular targeted therapies. Kinase domain retention is a crucial factor in kinase fusion genes (KFGs), but such a systematic investigation has not been done yet. To this end, we analyzed kinase domain retention (KDR) status in chimeric protein sequences of 914 KFGs covering 312 kinases across 13 major cancer types. Based on 171 kinase domain-retained KFGs including 101 kinases, we studied their recurrence, kinase groups, fusion partners, exon-based expression depth, short DNA motifs around the break points and networks. Our results, such as more KDR than 5'-kinase fusion genes, combinatorial effects between 3'-KDR kinases and their 5'-partners and a signal transduction-specific DNA sequence motif in the break point intronic sequences, supported positive selection on 3'-kinase fusion genes in cancer. We introduced a degree-of-frequency (DoF) score to measure the possible number of KFGs of a kinase. Interestingly, kinases with high DoF scores tended to undergo strong gene expression alteration at the break points. Furthermore, our KDR gene fusion network analysis revealed six of the seven kinases with the highest DoF scores (ALK, BRAF, MET, NTRK1, NTRK3 and RET) were all observed in thyroid carcinoma. Finally, we summarized common features of 'effective' (highly recurrent) kinases in gene fusions such as expression alteration at break point, redundant usage in multiple cancer types and 3'-location tendency. Collectively, our findings are useful for prioritizing driver kinases and FGs and provided insights into KFGs' clinical implications.

  12. Site-Specific Labeling of Protein Kinase CK2: Combining Surface Display and Click Chemistry for Drug Discovery Applications.

    Science.gov (United States)

    Nienberg, Christian; Retterath, Anika; Becher, Kira-Sophie; Saenger, Thorsten; Mootz, Henning D; Jose, Joachim

    2016-06-27

    Human CK2 is a heterotetrameric constitutively active serine/threonine protein kinase and is an emerging target in current anti-cancer drug discovery. The kinase is composed of two catalytic CK2α subunits and two regulatory CK2β subunits. In order to establish an assay to identify protein-protein-interaction inhibitors (PPI) of the CK2α/CK2β interface, a bioorthogonal click reaction was used to modify the protein kinase α-subunit with a fluorophore. By expanding the genetic code, the unnatural amino acid para azidophenylalanine (pAzF) could be incorporated into CK2α. Performing the SPAAC click reaction (Strain-Promoted Azide-Alkyne Cycloaddition) by the use of a dibenzylcyclooctyne-fluorophore (DBCO-fluorophore) led to a specifically labeled human protein kinase CK2α. This site-specific labeling does not impair the phosphorylation activity of CK2, which was evaluated by capillary electrophoresis. Furthermore a dissociation constant (KD) of 631 ± 86.2 nM was determined for the substrate αS1-casein towards CK2α. This labeling strategy was also applied to CK2β subunit on Escherichia coli, indicating the site-specific modifications of proteins on the bacterial cell surface when displayed by Autodisplay.

  13. Site-Specific Labeling of Protein Kinase CK2: Combining Surface Display and Click Chemistry for Drug Discovery Applications †

    Science.gov (United States)

    Nienberg, Christian; Retterath, Anika; Becher, Kira-Sophie; Saenger, Thorsten; Mootz, Henning D.; Jose, Joachim

    2016-01-01

    Human CK2 is a heterotetrameric constitutively active serine/threonine protein kinase and is an emerging target in current anti-cancer drug discovery. The kinase is composed of two catalytic CK2α subunits and two regulatory CK2β subunits. In order to establish an assay to identify protein-protein-interaction inhibitors (PPI) of the CK2α/CK2β interface, a bioorthogonal click reaction was used to modify the protein kinase α-subunit with a fluorophore. By expanding the genetic code, the unnatural amino acid para azidophenylalanine (pAzF) could be incorporated into CK2α. Performing the SPAAC click reaction (Strain-Promoted Azide-Alkyne Cycloaddition) by the use of a dibenzylcyclooctyne-fluorophore (DBCO-fluorophore) led to a specifically labeled human protein kinase CK2α. This site-specific labeling does not impair the phosphorylation activity of CK2, which was evaluated by capillary electrophoresis. Furthermore a dissociation constant (KD) of 631 ± 86.2 nM was determined for the substrate αS1-casein towards CK2α. This labeling strategy was also applied to CK2β subunit on Escherichia coli, indicating the site-specific modifications of proteins on the bacterial cell surface when displayed by Autodisplay. PMID:27355959

  14. Site-Specific Labeling of Protein Kinase CK2: Combining Surface Display and Click Chemistry for Drug Discovery Applications

    Directory of Open Access Journals (Sweden)

    Christian Nienberg

    2016-06-01

    Full Text Available Human CK2 is a heterotetrameric constitutively active serine/threonine protein kinase and is an emerging target in current anti-cancer drug discovery. The kinase is composed of two catalytic CK2α subunits and two regulatory CK2β subunits. In order to establish an assay to identify protein-protein-interaction inhibitors (PPI of the CK2α/CK2β interface, a bioorthogonal click reaction was used to modify the protein kinase α-subunit with a fluorophore. By expanding the genetic code, the unnatural amino acid para azidophenylalanine (pAzF could be incorporated into CK2α. Performing the SPAAC click reaction (Strain-Promoted Azide-Alkyne Cycloaddition by the use of a dibenzylcyclooctyne-fluorophore (DBCO-fluorophore led to a specifically labeled human protein kinase CK2α. This site-specific labeling does not impair the phosphorylation activity of CK2, which was evaluated by capillary electrophoresis. Furthermore a dissociation constant (KD of 631 ± 86.2 nM was determined for the substrate αS1-casein towards CK2α. This labeling strategy was also applied to CK2β subunit on Escherichia coli, indicating the site-specific modifications of proteins on the bacterial cell surface when displayed by Autodisplay.

  15. Cyclic di-GMP mediates a histidine kinase/phosphatase switch by noncovalent domain cross-linking.

    Science.gov (United States)

    Dubey, Badri N; Lori, Christian; Ozaki, Shogo; Fucile, Geoffrey; Plaza-Menacho, Ivan; Jenal, Urs; Schirmer, Tilman

    2016-09-01

    Histidine kinases are key components of regulatory networks in bacteria. Although many of these enzymes are bifunctional, mediating both phosphorylation and dephosphorylation of downstream targets, the molecular details of this central regulatory switch are unclear. We showed recently that the universal second messenger cyclic di-guanosine monophosphate (c-di-GMP) drives Caulobacter crescentus cell cycle progression by forcing the cell cycle kinase CckA from its default kinase into phosphatase mode. We use a combination of structure determination, modeling, and functional analysis to demonstrate that c-di-GMP reciprocally regulates the two antagonistic CckA activities through noncovalent cross-linking of the catalytic domain with the dimerization histidine phosphotransfer (DHp) domain. We demonstrate that both c-di-GMP and ADP (adenosine diphosphate) promote phosphatase activity and propose that c-di-GMP stabilizes the ADP-bound quaternary structure, which allows the receiver domain to access the dimeric DHp stem for dephosphorylation. In silico analyses predict that c-di-GMP control is widespread among bacterial histidine kinases, arguing that it can replace or modulate canonical transmembrane signaling.

  16. Cyclic di-GMP mediates a histidine kinase/phosphatase switch by noncovalent domain cross-linking

    Science.gov (United States)

    Dubey, Badri N.; Lori, Christian; Ozaki, Shogo; Fucile, Geoffrey; Plaza-Menacho, Ivan; Jenal, Urs; Schirmer, Tilman

    2016-01-01

    Histidine kinases are key components of regulatory networks in bacteria. Although many of these enzymes are bifunctional, mediating both phosphorylation and dephosphorylation of downstream targets, the molecular details of this central regulatory switch are unclear. We showed recently that the universal second messenger cyclic di–guanosine monophosphate (c-di-GMP) drives Caulobacter crescentus cell cycle progression by forcing the cell cycle kinase CckA from its default kinase into phosphatase mode. We use a combination of structure determination, modeling, and functional analysis to demonstrate that c-di-GMP reciprocally regulates the two antagonistic CckA activities through noncovalent cross-linking of the catalytic domain with the dimerization histidine phosphotransfer (DHp) domain. We demonstrate that both c-di-GMP and ADP (adenosine diphosphate) promote phosphatase activity and propose that c-di-GMP stabilizes the ADP-bound quaternary structure, which allows the receiver domain to access the dimeric DHp stem for dephosphorylation. In silico analyses predict that c-di-GMP control is widespread among bacterial histidine kinases, arguing that it can replace or modulate canonical transmembrane signaling. PMID:27652341

  17. Balance between Coiled-Coil Stability and Dynamics Regulates Activity of BvgS Sensor Kinase in Bordetella

    Directory of Open Access Journals (Sweden)

    E. Lesne

    2016-03-01

    Full Text Available The two-component system BvgAS controls the expression of the virulence regulon of Bordetella pertussis. BvgS is a prototype of bacterial sensor kinases with extracytoplasmic Venus flytrap perception domains. Following its transmembrane segment, BvgS harbors a cytoplasmic Per-Arnt-Sim (PAS domain and then a predicted 2-helix coiled coil that precede the dimerization-histidine-phosphotransfer domain of the kinase. BvgS homologs have a similar domain organization, or they harbor only a predicted coiled coil between the transmembrane and the dimerization-histidine-phosphotransfer domains. Here, we show that the 2-helix coiled coil of BvgS regulates the enzymatic activity in a mechanical manner. Its marginally stable hydrophobic interface enables a switch between a state of great rotational dynamics in the kinase mode and a more rigid conformation in the phosphatase mode in response to signal perception by the periplasmic domains. We further show that the activity of BvgS is controlled in the same manner if its PAS domain is replaced with the natural α-helical sequences of PAS-less homologs. Clamshell motions of the Venus flytrap domains trigger the shift of the coiled coil’s dynamics. Thus, we have uncovered a general mechanism of regulation for the BvgS family of Venus flytrap-containing two-component sensor kinases.

  18. Bacterial adhesion and biofilms on surfaces

    Institute of Scientific and Technical Information of China (English)

    Trevor Roger Garrett; Manmohan Bhakoo; Zhibing Zhang

    2008-01-01

    Bacterial adhesion has become a significant problem in industry and in the domicile,and much research has been done for deeper understanding of the processes involved.A generic biological model of bacterial adhesion and population growth called the bacterial biofilm growth cycle,has been described and modified many times.The biofilm growth cycle encompasses bacterial adhesion at all levels,starting with the initial physical attraction of bacteria to a substrate,and ending with the eventual liberation of cell dusters from the biofilm matrix.When describing bacterial adhesion one is simply describing one or more stages of biofilm development,neglecting the fact that the population may not reach maturity.This article provides an overview of bacterial adhesion.cites examples of how bac-terial adhesion affects industry and summarises methods and instrumentation used to improve our understanding of the adhesive prop-erties of bacteria.

  19. Interaction of Medicago truncatula Lysin Motif Receptor-Like Kinases, NFP and LYK3, Produced in Nicotiana benthamiana Induces Defence-Like Responses

    OpenAIRE

    2013-01-01

    Receptor(-like) kinases with Lysin Motif (LysM) domains in their extracellular region play crucial roles during plant interactions with microorganisms; e.g. Arabidopsis thaliana CERK1 activates innate immunity upon perception of fungal chitin/chitooligosaccharides, whereas Medicago truncatula NFP and LYK3 mediate signalling upon perception of bacterial lipo-chitooligosaccharides, termed Nod factors, during the establishment of mutualism with nitrogen-fixing rhizobia. However, little is still ...

  20. A retroviral-derived peptide phosphorylates protein kinase D/protein kinase Cmu involving phospholipase C and protein kinase C.

    Science.gov (United States)

    Luangwedchakarn, Voravich; Day, Noorbibi K; Hitchcock, Remi; Brown, Pam G; Lerner, Danica L; Rucker, Rajivi P; Cianciolo, George J; Good, Robert A; Haraguchi, Soichi

    2003-05-01

    CKS-17, a synthetic peptide representing a unique amino acid motif which is highly conserved in retroviral transmembrane proteins and other immunoregulatory proteins, induces selective immunomodulatory functions, both in vitro and in vivo, and activates intracellular signaling molecules such as cAMP and extracellular signal-regulated kinases. In the present study, using Jurkat T-cells, we report that CKS-17 phosphorylates protein kinase D (PKD)/protein kinase C (PKC) mu. Total cell extracts from CKS-17-stimulated Jurkat cells were immunoblotted with an anti-phospho-PKCmu antibody. The results show that CKS-17 significantly phosphorylates PKD/PKCmu in a dose- and time-dependent manner. Treatment of cells with the PKC inhibitors GF 109203X and Ro 31-8220, which do not act directly on PKD/PKCmu, attenuates CKS-17-induced phosphorylation of PKD/PKCmu. In contrast, the selective protein kinase A inhibitor H-89 does not reverse the action of CKS-17. Furthermore, a phospholipase C (PLC) selective inhibitor, U-73122, completely blocks the phosphorylation of PKD/PKCmu by CKS-17 while a negative control U-73343 does not. In addition, substitution of lysine for arginine residues in the CKS-17 sequence completely abrogates the ability of CKS-17 to phosphorylate PKD/PKCmu. These results clearly indicate that CKS-17 phosphorylates PKD/PKCmu through a PLC- and PKC-dependent mechanism and that arginine residues play an essential role in this activity of CKS-17, presenting a novel modality of the retroviral peptide CKS-17 and molecular interaction of this compound with target cells.

  1. In silico analysis reveals 75 members of mitogen-activated protein kinase kinase kinase gene family in rice.

    Science.gov (United States)

    Rao, Kudupudi Prabhakara; Richa, Tambi; Kumar, Kundan; Raghuram, Badmi; Sinha, Alok Krishna

    2010-06-01

    Mitogen-Activated Protein Kinase Kinase Kinases (MAPKKKs) are important components of MAPK cascades, which are universal signal transduction modules and play important role in plant growth and development. In the sequenced Arabidopsis genome 80 MAPKKKs were identified and currently being analysed for its role in different stress. In rice, economically important monocot cereal crop only five MAPKKKs were identified so far. In this study using computational analysis of sequenced rice genome we have identified 75 MAPKKKs. EST hits and full-length cDNA sequences (from KOME or Genbank database) of 75 MAPKKKs supported their existence. Phylogenetic analyses of MAPKKKs from rice and Arabidopsis have classified them into three subgroups, which include Raf, ZIK and MEKK. Conserved motifs in the deduced amino acid sequences of rice MAPKKKs strongly supported their identity as members of Raf, ZIK and MEKK subfamilies. Further expression analysis of the MAPKKKs in MPSS database revealed that their transcripts were differentially regulated in various stress and tissue-specific libraries.

  2. Bacterial meningitis and diseases caused by bacterial toxins.

    Science.gov (United States)

    Rings, D M

    1987-03-01

    Bacterial meningitis most commonly occurs in young calves secondary to septicemia. Clinical signs of hyperirritability are usually seen. Meningitis can be confirmed by cerebrospinal fluid analysis and culture or by necropsy. Intoxications by the exotoxins of Clostridium perfringens types C and D, C. botulinum, and C. tetani are difficult to confirm. The clinical signs of these intoxications vary from flaccid paralysis (botulism) to muscular rigidity (tetanus). Treatment of affected cattle has been unrewarding in botulism and enterotoxemia, whereas early aggressive treatment of tetanus cases can often be successfully resolved. Botulism and enterotoxemia can be proved using mouse inoculation tests, whereas tetanus is diagnosed largely by ruling out other diseases.

  3. Bacterial and Fungal Pattern Recognition Receptors in Homologous Innate Signaling Pathways of Insects and Mammals

    Directory of Open Access Journals (Sweden)

    Bethany A Stokes

    2015-01-01

    Full Text Available In response to bacterial and fungal infections in insects and mammals, distinct families of innate immune pattern recognition receptors initiate highly complex intracellular signaling cascades. Those cascades induce a variety of immune functions that restrain the spread of microbes in the host. Insect and mammalian innate immune receptors include molecules that recognize conserved microbial molecular patterns. Innate immune recognition leads to the recruitment of adaptor molecules forming multi-protein complexes that include kinases, transcription factors and other regulatory molecules. Innate immune signaling cascades induce the expression of genes encoding antimicrobial peptides and other key factors that mount and regulate the immune response against microbial challenge. In this review, we summarize our current understanding of the bacterial and fungal pattern recognition receptors for homologous innate signaling pathways of insects and mammals in an effort to provide a framework for future studies.

  4. Entry into mitosis without Cdc2 kinase activation.

    Science.gov (United States)

    Gowdy, P M; Anderson, H J; Roberge, M

    1998-11-01

    Mouse FT210 cells at 39 degreesC cannot enter mitosis but arrest in G2 phase, because they lack Cdc2 kinase activity as a result of a temperature-sensitive lesion in the cdc2 gene. Incubation of arrested cells with the protein phosphatase 1 and 2A inhibitor okadaic acid induces morphologically normal chromosome condensation. We now show that okadaic acid also induces two other landmark events of early mitosis, nuclear lamina depolymerization and centrosome separation, in the absence of Cdc2 kinase activity. Okadaic acid-induced entry into mitosis is accompanied by partial activation of Cdc25C and may be prevented by tyrosine phosphatase inhibitors and by the protein kinase inhibitor staurosporine, suggesting that Cdc25C and kinases distinct from Cdc2 are required for these mitotic events. Using in-gel assays, we show that a 45-kDa protein kinase normally activated at mitosis is also activated by okadaic acid independently of Cdc2 kinase. The 45-kDa kinase can utilize GTP, is stimulated by spermine and is inhibited by heparin. These properties are characteristic of the kinase CK2, but immunoprecipitation studies indicate that it is not CK2. The data underline the importance of a tyrosine phosphatase, possibly Cdc25C, and of kinases other than Cdc2 in the structural changes the cell undergoes at mitosis, and indicate that entry into mitosis involves the activation of multiple kinases working in concert with Cdc2 kinase.

  5. Polyphosphate kinases modulate Campylobacter jejuni outer membrane constituents and alter its capacity to invade and survive in intestinal epithelial cells in vitro.

    Science.gov (United States)

    Pina-Mimbela, Ruby; Madrid, Jesús Arcos; Kumar, Anand; Torrelles, Jordi B; Rajashekara, Gireesh

    2015-12-30

    Campylobacter jejuni is the most prevalent cause of bacterial gastroenteritis worldwide. Polyphosphate kinases 1 and 2 (PPK1 and PPK2) regulate several cellular processes, including the biosynthesis of the bacterial cell wall. Despite their importance, whether PPK1 and PPK2 modulate the composition of C. jejuni outer membrane constituents (OMCs) and consequently impact its interaction with host cells remains unknown. Our comparative analysis between C. jejuni wild type, Δppk1, and Δppk2 strains showed qualitative and quantitative differences in the total OMC composition among these strains. Importantly, these OMC variations observed on the C. jejuni polyphosphate kinase mutants are directly related to their capacity to invade, survive, and alter the immune response of intestinal epithelial cells in vitro. Specifically, sub-fractionation of the C. jejuni OMC indicated that OMC proteins are uniquely associated with bacterial invasion, whereas C. jejuni OMC proteins, lipids, and lipoglycans are all associated with C. jejuni intracellular survival. This study provides new insights regarding the function of polyphosphate kinases and their role in C. jejuni infection.

  6. Crystal structure of pyridoxal kinase from the Escherichia coli pdxK gene: implications for the classification of pyridoxal kinases.

    Science.gov (United States)

    Safo, Martin K; Musayev, Faik N; di Salvo, Martino L; Hunt, Sharyn; Claude, Jean-Baptiste; Schirch, Verne

    2006-06-01

    The pdxK and pdxY genes have been found to code for pyridoxal kinases, enzymes involved in the pyridoxal phosphate salvage pathway. Two pyridoxal kinase structures have recently been published, including Escherichia coli pyridoxal kinase 2 (ePL kinase 2) and sheep pyridoxal kinase, products of the pdxY and pdxK genes, respectively. We now report the crystal structure of E. coli pyridoxal kinase 1 (ePL kinase 1), encoded by a pdxK gene, and an isoform of ePL kinase 2. The structures were determined in the unliganded and binary complexes with either MgATP or pyridoxal to 2.1-, 2.6-, and 3.2-A resolutions, respectively. The active site of ePL kinase 1 does not show significant conformational change upon binding of either pyridoxal or MgATP. Like sheep PL kinase, ePL kinase 1 exhibits a sequential random mechanism. Unlike sheep pyridoxal kinase, ePL kinase 1 may not tolerate wide variation in the size and chemical nature of the 4' substituent on the substrate. This is the result of differences in a key residue at position 59 on a loop (loop II) that partially forms the active site. Residue 59, which is His in ePL kinase 1, interacts with the formyl group at C-4' of pyridoxal and may also determine if residues from another loop (loop I) can fill the active site in the absence of the substrate. Both loop I and loop II are suggested to play significant roles in the functions of PL kinases.

  7. Differential effects of gram-positive and gram-negative bacterial products on morphine induced inhibition of phagocytosis.

    Science.gov (United States)

    Ninkovic, Jana; Jana, Ninkovic; Anand, Vidhu; Vidhu, Anand; Dutta, Raini; Raini, Dutta; Zhang, Li; Saluja, Anuj; Meng, Jingjing; Koodie, Lisa; Lisa, Koodie; Banerjee, Santanu; Santanu, Banerjee; Roy, Sabita; Sabita, Roy

    2016-02-19

    Opioid drug abusers have a greater susceptibility to gram positive (Gram (+)) bacterial infections. However, the mechanism underlying opioid modulation of Gram (+) versus Gram (-) bacterial clearance has not been investigated. In this study, we show that opioid treatment resulted in reduced phagocytosis of Gram (+), when compared to Gram (-) bacteria. We further established that LPS priming of chronic morphine treated macrophages leads to potentiated phagocytosis and killing of both Gram (+) and Gram (-) bacteria in a P-38 MAP kinase dependent signaling pathway. In contrast, LTA priming lead to inhibition of both phagocytosis and bacterial killing. This study demonstrates for the first time the differential effects of TLR4 and TLR2 agonists on morphine induced inhibition of phagocytosis. Our results suggest that the incidence and severity of secondary infections with Gram (+) bacteria would be higher in opioid abusers.

  8. Bisarylmaleimides & the Corresponding Indolocarbazoles as Kinase Inhibitors

    Institute of Scientific and Technical Information of China (English)

    Zhu Guoxin; Cathy Ogg; Bharvin Patel; Richard M. Schultz; Charles D. Spencer; Beverly Teicher; Scou A. Watkins; Scott E. Conner; Zhou Xun; Chuan Shih; Li Tiechao; Harold B. Brooks; Eileen Considine; Jack A. Dempsey; Margaret M. Faul

    2004-01-01

    Cyclin dependent kinases (CDKs) have recently raised considerable attention because of their central role in the regulation of cell cycle progression. A high incidence of genetic mutation of CDK substrates and deregulaton of CDK modulators were found in a number of disease states,particularly in cancer. A novel series of unsymmetrical substituted indolocarbazoles were synthesized and their kinase inhibitory capability was evaluated in vitro. 6-Substtuted indolocarbazoles were found to be highly potent and selective D1/CDK4 inhibitors. These indolocarbazoles exhibited ATP competitive D1/CDK4 activity and inhibited tumor cell growth,arrested tumor cell at G1 phase. These molecules demonstrated potent anti-tumor activity and inhibited pRb phosphorylation at S780 in the human lung carcinoma (Calu6) and non-small cell lung carcinoma (NCI-H460) xenograft models. The results indicate that these small molecules have potential as therapeutic agents in cancer chemotherapeutc agents.

  9. Targeting checkpoint kinase 1 in cancer therapeutics.

    Science.gov (United States)

    Tse, Archie N; Carvajal, Richard; Schwartz, Gary K

    2007-04-01

    Progression through the cell cycle is monitored by surveillance mechanisms known as cell cycle checkpoints. Our knowledge of the biochemical nature of checkpoint regulation during an unperturbed cell cycle and following DNA damage has expanded tremendously over the past decade. We now know that dysfunction in cell cycle checkpoints leads to genomic instability and contributes to tumor progression, and most agents used for cancer therapy, such as cytotoxic chemotherapy and ionizing radiation, also activate cell cycle checkpoints. Understanding how checkpoints are regulated is therefore important from the points of view of both tumorigenesis and cancer treatment. In this review, we present an overview of the molecular hierarchy of the checkpoint signaling network and the emerging role of checkpoint targets, especially checkpoint kinase 1, in cancer therapy. Further, we discuss the results of recent clinical trials involving the nonspecific checkpoint kinase 1 inhibitor, UCN-01, and the challenges we face with this new therapeutic approach.

  10. Phosphatidylinositol 4-kinases: Function, structure, and inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Boura, Evzen, E-mail: boura@uochb.cas.cz; Nencka, Radim, E-mail: nencka@uochb.cas.cz

    2015-10-01

    The phosphatidylinositol 4-kinases (PI4Ks) synthesize phosphatidylinositol 4-phosphate (PI4P), a key member of the phosphoinositide family. PI4P defines the membranes of Golgi and trans-Golgi network (TGN) and regulates trafficking to and from the Golgi. Humans have two type II PI4Ks (α and β) and two type III enzymes (α and β). Recently, the crystal structures were solved for both type II and type III kinase revealing atomic details of their function. Importantly, the type III PI4Ks are hijacked by +RNA viruses to create so-called membranous web, an extensively phosphorylated and modified membrane system dedicated to their replication. Therefore, selective and potent inhibitors of PI4Ks have been developed as potential antiviral agents. Here we focus on the structure and function of PI4Ks and their potential in human medicine.

  11. Molecular Imaging of the ATM Kinase Activity

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Terence M. [Department of Radiation Oncology, Ohio State University, Columbus, Ohio (United States); Nyati, Shyam [Department of Radiation Oncology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Center for Molecular Imaging, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Ross, Brian D. [Department of Radiation Oncology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Department of Radiology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Rehemtulla, Alnawaz, E-mail: alnawaz@umich.edu [Department of Radiation Oncology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Center for Molecular Imaging, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Department of Radiology, University of Michigan Medical Center, Ann Arbor, Michigan (United States)

    2013-08-01

    Purpose: Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA-damage response, including from DNA double-strand breaks. ATM activation results in the initiation of a complex cascade of events including DNA damage repair, cell cycle checkpoint control, and survival. We sought to create a bioluminescent reporter that dynamically and noninvasively measures ATM kinase activity in living cells and subjects. Methods and Materials: Using the split luciferase technology, we constructed a hybrid cDNA, ATM-reporter (ATMR), coding for a protein that quantitatively reports on changes in ATM kinase activity through changes in bioluminescence. Results: Treatment of ATMR-expressing cells with ATM inhibitors resulted in a dose-dependent increase in bioluminescence activity. In contrast, induction of ATM kinase activity upon irradiation resulted in a decrease in reporter activity that correlated with ATM and Chk2 activation by immunoblotting in a time-dependent fashion. Nuclear targeting improved ATMR sensitivity to both ATM inhibitors and radiation, whereas a mutant ATMR (lacking the target phosphorylation site) displayed a muted response. Treatment with ATM inhibitors and small interfering (si)RNA-targeted knockdown of ATM confirm the specificity of the reporter. Using reporter expressing xenografted tumors demonstrated the ability of ATMR to report in ATM activity in mouse models that correlated in a time-dependent fashion with changes in Chk2 activity. Conclusions: We describe the development and validation of a novel, specific, noninvasive bioluminescent reporter that enables monitoring of ATM activity in real time, in vitro and in vivo. Potential applications of this reporter include the identification and development of novel ATM inhibitors or ATM-interacting partners through high-throughput screens and in vivo pharmacokinetic/pharmacodynamic studies of ATM inhibitors in preclinical models.

  12. Tyrosine Kinase Display of Prostate Cancer Cells

    Science.gov (United States)

    2001-10-01

    Swanson, P.E., Ratliff, T.L., Vollmer, R.T., Day, M.L. (1995) HGF and its receptor c-met in prostatic carcinoma. Am. J. Pathol. 147:386-396. 4. Levitzki , A...alpha and erbB-3 receptor in human prostatic adenocarcinoma. Br. J. Urol. 79: 212-216. 78. Levitzki , A. and A. Gazit. 1995. Tyrosine kinase inhibition

  13. ABL Tyrosine Kinase Stimulates PUMA Protein Expression

    OpenAIRE

    Oon, Chet K

    2016-01-01

    ABL is an ubiquitously expressed non-receptor tyrosine kinase involved in multiple cellular functions including programmed cell death. Upon DNA damage, ABL has been shown to upregulate PUMA, p53 upregulated modulator of apoptosis, and causes downstream mitochondrial intrinsic apoptotic events. However, the mechanism by which ABL regulates PUMA expression remains unknown. We have shown that ABL does not change PUMA protein subcellular localization through immunofluorescence. Through protein an...

  14. Isoprenoid biosynthesis and mevalonate kinase deficiency

    OpenAIRE

    Henneman, L.

    2011-01-01

    Mevalonaat Kinase Deficiëntie (MKD) is een aangeboren ziekte geassocieerd met heftige koortsaanvallen die drie tot vier dagen aanhouden en gepaard gaan met koude rillingen, gewrichtsklachten, huiduitslag, hoofdpijn, duizeligheid, buikpijn, braken en diarree. De koortsaanvallen treden gemiddeld eens in de drie tot zes weken op zonder dat goed duidelijk is waarom. Linda Henneman toont aan dat door een tekort van bepaalde metabolieten specifieke signaaleiwitten op de verkeerde plek in de cel ter...

  15. Inhibitors of p21-activated kinases (PAKs).

    Science.gov (United States)

    Rudolph, Joachim; Crawford, James J; Hoeflich, Klaus P; Wang, Weiru

    2015-01-08

    The p21-activated kinase (PAK) family of serine/threonine protein kinases plays important roles in cytoskeletal organization, cellular morphogenesis, and survival, and members of this family have been implicated in many diseases including cancer, infectious diseases, and neurological disorders. Owing to their large and flexible ATP binding cleft, PAKs, particularly group I PAKs (PAK1, -2, and -3), are difficult to drug; hence, few PAK inhibitors with satisfactory kinase selectivity and druglike properties have been reported to date. Examples are a recently discovered group II PAK (PAK4, -5, -6) selective inhibitor series based on a benzimidazole core, a group I PAK selective series based on a pyrido[2,3-d]pyrimidine-7-one core, and an allosteric dibenzodiazepine PAK1 inhibitor series. Only one compound, an aminopyrazole based pan-PAK inhibitor, entered clinical trials but did not progress beyond phase I trials. Clinical proof of concept for pan-group I, pan-group II, or PAK isoform selective inhibition has yet to be demonstrated.

  16. Diacylglycerol Kinase Inhibition and Vascular Function.

    Science.gov (United States)

    Choi, Hyehun; Allahdadi, Kyan J; Tostes, Rita C A; Webb, R Clinton

    2009-01-01

    Diacylglycerol kinases (DGKs), a family of lipid kinases, convert diacylglycerol (DG) to phosphatidic acid (PA). Acting as a second messenger, DG activates protein kinase C (PKC). PA, a signaling lipid, regulates diverse functions involved in physiological responses. Since DGK modulates two lipid second messengers, DG and PA, regulation of DGK could induce related cellular responses. Currently, there are 10 mammalian isoforms of DGK that are categorized into five groups based on their structural features. These diverse isoforms of DGK are considered to activate distinct cellular functions according to extracellular stimuli. Each DGK isoform is thought to play various roles inside the cell, depending on its subcellular localization (nuclear, ER, Golgi complex or cytoplasm). In vascular smooth muscle, vasoconstrictors such as angiotensin II, endothelin-1 and norepinephrine stimulate contraction by increasing inositol trisphosphate (IP(3)), calcium, DG and PKC activity. Inhibition of DGK could increase DG availability and decrease PA levels, as well as alter intracellular responses, including calcium-mediated and PKC-mediated vascular contraction. The purpose of this review is to demonstrate a role of DGK in vascular function. Selective inhibition of DGK isoforms may represent a novel therapeutic approach in vascular dysfunction.

  17. Conservation and early expression of zebrafish tyrosine kinases support the utility of zebrafish as a model for tyrosine kinase biology.

    Science.gov (United States)

    Challa, Anil Kumar; Chatti, Kiranam

    2013-09-01

    Tyrosine kinases have significant roles in cell growth, apoptosis, development, and disease. To explore the use of zebrafish as a vertebrate model for tyrosine kinase signaling and to better understand their roles, we have identified all of the tyrosine kinases encoded in the zebrafish genome and quantified RNA expression of selected tyrosine kinases during early development. Using profile hidden Markov model analysis, we identified 122 zebrafish tyrosine kinase genes and proposed unambiguous gene names where needed. We found them to be organized into 39 nonreceptor and 83 receptor type, and 30 families consistent with human tyrosine kinase family assignments. We found five human tyrosine kinase genes (epha1, bmx, fgr, srm, and insrr) with no identifiable zebrafish ortholog, and one zebrafish gene (yrk) with no identifiable human ortholog. We also found that receptor tyrosine kinase genes were duplicated more often than nonreceptor tyrosine kinase genes in zebrafish. We profiled expression levels of 30 tyrosine kinases representing all families using direct digital detection at different stages during the first 24 hours of development. The profiling experiments clearly indicate regulated expression of tyrosine kinases in the zebrafish, suggesting their role during early embryonic development. In summary, our study has resulted in the first comprehensive description of the zebrafish tyrosine kinome.

  18. Phosphoinositide 3-kinase regulates crosstalk between Trk A tyrosine kinase and p75(NTR)-dependent sphingolipid signaling pathways.

    Science.gov (United States)

    Bilderback, T R; Gazula, V R; Dobrowsky, R T

    2001-03-01

    The mechanism of crosstalk between signaling pathways coupled to the Trk A and p75(NTR) neurotrophin receptors in PC12 cells was examined. In response to nerve growth factor (NGF), Trk A activation inhibited p75(NTR)-dependent sphingomyelin (SM) hydrolysis. The phosphoinositide 3-kinase (PI 3-kinase) inhibitor, LY294002, reversed this inhibition suggesting that Trk A activation of PI 3-kinase is necessary to inhibit sphingolipid signaling by p75(NTR). In contrast, SM hydrolysis induced by neurotrophin-3 (NT-3), which did not activate PI-3 kinase, was uneffected by LY294002. However, transient expression of a constituitively active PI 3-kinase inhibited p75(NTR)-dependent SM hydrolysis by both NGF and NT-3. Intriguingly, NGF induced an association of activated PI 3-kinase with acid sphingomyelinase (SMase). This interaction localized to caveolae-related domains and correlated with a 50% decrease in immunoprecipitated acid SMase activity. NGF-stimulated PI 3-kinase activity was necessary for inhibition of acid SMase but was not required for ligand-induced association of the p85 subunit of PI 3-kinase with the phospholipase. Finally, this interaction was specific for NGF since EGF did not induce an association of PI 3-kinase with acid SMase. In summary, our data suggest that PI 3-kinase regulates the inhibitory crosstalk between Trk A tyrosine kinase and p75(NTR)-dependent sphingolipid signaling pathways and that this interaction localizes to caveolae-related domains.

  19. Structural and Functional Studies Indicate That the EPEC Effector, EspG, Directly Binds p21-Activated Kinase

    Energy Technology Data Exchange (ETDEWEB)

    Germane, Katherine L.; Spiller, Benjamin W. (Vanderbilt)

    2011-09-20

    Bacterial pathogens secrete effectors into their hosts that subvert host defenses and redirect host processes. EspG is a type three secretion effector with a disputed function that is found in enteropathogenic Escherichia coli. Here we show that EspG is structurally similar to VirA, a Shigella virulence factor; EspG has a large, conserved pocket on its surface; EspG binds directly to the amino-terminal inhibitory domain of human p21-activated kinase (PAK); and mutations to conserved residues in the surface pocket disrupt the interaction with PAK.

  20. The extended conformation of the 2.9-Å crystal structure of the three-PASTA domain of a Ser/Thr kinase from the human pathogen Staphylococcus aureus.

    Science.gov (United States)

    Paracuellos, Patricia; Ballandras, Allison; Robert, Xavier; Kahn, Richard; Hervé, Mireille; Mengin-Lecreulx, Dominique; Cozzone, Alain J; Duclos, Bertrand; Gouet, Patrice

    2010-12-17

    PASTA (penicillin-binding protein and serine/threonine kinase associated) modules are found in penicillin-binding proteins and bacterial serine/threonine kinases mainly from Gram-positive Firmicutes and Actinobacteria. They may act as extracellular sensors by binding peptidoglycan fragments. We report here the first crystal structure of a multiple-PASTA domain from Ser/Thr kinase, that of the protein serine/threonine kinase 1 (Stk1) from the Firmicute Staphylococcus aureus. The extended conformation of the three PASTA subunits differs strongly from the compact conformation observed in the two-PASTA domain of penicillin-binding protein PBP2x, whereas linear conformations were also reported for two-subunit fragments of the four-PASTA domain of the Actinobacteria Mycobacterium tuberculosis studied by liquid NMR. Thus, a stretched organization appears to be the signature of modular PASTA domains in Ser/Thr kinases. Signal transduction to the kinase domain is supposed to occur via dimerization and ligand binding. A conserved X-shaped crystallographic dimer stabilized by intermolecular interactions between the second PASTA subunits of each monomer is observed in the two crystal forms of Stk1 that we managed to crystallize. Extracellular PASTA domains are composed of at least two subunits, and this molecular assembly is a plausible candidate for the biological dimer. We have also performed docking experiments, which predict that the hinge regions of the PASTA domain can accommodate peptidoglycan. Finally, a three-dimensional homology molecular model of full-length Stk1 was generated, suggesting an interaction between the kinase domain and the cytoplasmic face of the plasma membrane via a eukaryotic-like juxtamembrane domain. A comprehensive activation mechanism for bacterial Ser/Thr kinases is proposed with the support of these structural data.

  1. Genome-scale co-evolutionary inference identifies functions and clients of bacterial Hsp90.

    Directory of Open Access Journals (Sweden)

    Maximilian O Press

    Full Text Available The molecular chaperone Hsp90 is essential in eukaryotes, in which it facilitates the folding of developmental regulators and signal transduction proteins known as Hsp90 clients. In contrast, Hsp90 is not essential in bacteria, and a broad characterization of its molecular and organismal function is lacking. To enable such characterization, we used a genome-scale phylogenetic analysis to identify genes that co-evolve with bacterial Hsp90. We find that genes whose gain and loss were coordinated with Hsp90 throughout bacterial evolution tended to function in flagellar assembly, chemotaxis, and bacterial secretion, suggesting that Hsp90 may aid assembly of protein complexes. To add to the limited set of known bacterial Hsp90 clients, we further developed a statistical method to predict putative clients. We validated our predictions by demonstrating that the flagellar protein FliN and the chemotaxis kinase CheA behaved as Hsp90 clients in Escherichia coli, confirming the predicted role of Hsp90 in chemotaxis and flagellar assembly. Furthermore, normal Hsp90 function is important for wild-type motility and/or chemotaxis in E. coli. This novel function of bacterial Hsp90 agreed with our subsequent finding that Hsp90 is associated with a preference for multiple habitats and may therefore face a complex selection regime. Taken together, our results reveal previously unknown functions of bacterial Hsp90 and open avenues for future experimental exploration by implicating Hsp90 in the assembly of membrane protein complexes and adaptation to novel environments.

  2. Assembly of the transmembrane domain of E. coli PhoQ histidine kinase: implications for signal transduction from molecular simulations.

    Science.gov (United States)

    Lemmin, Thomas; Soto, Cinque S; Clinthorne, Graham; DeGrado, William F; Dal Peraro, Matteo

    2013-01-01

    The PhoQP two-component system is a signaling complex essential for bacterial virulence and cationic antimicrobial peptide resistance. PhoQ is the histidine kinase chemoreceptor of this tandem machine and assembles in a homodimer conformation spanning the bacterial inner membrane. Currently, a full understanding of the PhoQ signal transduction is hindered by the lack of a complete atomistic structure. In this study, an atomistic model of the key transmembrane (TM) domain is assembled by using molecular simulations, guided by experimental cross-linking data. The formation of a polar pocket involving Asn202 in the lumen of the tetrameric TM bundle is crucial for the assembly and solvation of the domain. Moreover, a concerted displacement of the TM helices at the periplasmic side is found to modulate a rotation at the cytoplasmic end, supporting the transduction of the chemical signal through a combination of scissoring and rotational movement of the TM helices.

  3. Assembly of the transmembrane domain of E. coli PhoQ histidine kinase: implications for signal transduction from molecular simulations.

    Directory of Open Access Journals (Sweden)

    Thomas Lemmin

    Full Text Available The PhoQP two-component system is a signaling complex essential for bacterial virulence and cationic antimicrobial peptide resistance. PhoQ is the histidine kinase chemoreceptor of this tandem machine and assembles in a homodimer conformation spanning the bacterial inner membrane. Currently, a full understanding of the PhoQ signal transduction is hindered by the lack of a complete atomistic structure. In this study, an atomistic model of the key transmembrane (TM domain is assembled by using molecular simulations, guided by experimental cross-linking data. The formation of a polar pocket involving Asn202 in the lumen of the tetrameric TM bundle is crucial for the assembly and solvation of the domain. Moreover, a concerted displacement of the TM helices at the periplasmic side is found to modulate a rotation at the cytoplasmic end, supporting the transduction of the chemical signal through a combination of scissoring and rotational movement of the TM helices.

  4. BACTERIAL DESEASES IN SEA FISH

    Directory of Open Access Journals (Sweden)

    Ivančica Strunjak-Perović

    1997-10-01

    Full Text Available With development of the fish culturing in the sea, the interest in their health also increased. The reason for this are diseases or rather mortality that occur in such controlled cultures and cause great economic losses. By growing large quantities of fish in rather small species, natural conditions are changed, so fish is more sensitive and prone to infection agents (viruses, bacteria, parasites. Besides, a large fish density in the cultural process accelerates spreading if the diseases, but also enables a better perception of them. In wild populations sick specimen very quickly become predator’s prey, witch makes it difficult to note any pathological changes in such fish. There are lots of articles on viral, bacterial and parasitic diseases nowdays, but this work deals exclusively with bacterial deseases that occur in the controlled sea cultures (vibriosis, furunculosis, pastherelosis, nocardiosis, mycobaceriosis, edwardsielosis, yersiniosis, deseases caused by bacteria of genera Flexibacter, Pseudomonas, Aeromonas, Streptococus and bacteria nephryithis. Yet, the knowledge of these deseases vary, depending on wether a fish species is being cultured for a longer period of time or is only being introduced in the controlled culture.

  5. Bacterial Culture of Neonatal Sepsis

    Directory of Open Access Journals (Sweden)

    AH Movahedian

    2006-08-01

    Full Text Available Neonatal bacterial sepsis is one of the major cause of morbidity and mortality in neonates. This retrospective study was performed to determine the incidence of bacterial sepsis with focus on Gram negative organisms in neonates admitted at Beheshti Hospital in Kashan, during a 3-yr period, from September 2002 to September 2005. Blood culture was performed on all neonates with risk factors or signs of suggestive sepsis. Blood samples were cultured using brain heart infusion (BHI broth according to standard method. From the 1680 neonates 36% had positive blood culture for Pseudomans aeruginosa, 20.7% for Coagulase negative Staphylococci, and 17% for Klebsiella spp. Gram-negative organisms accounted for 72.1% of all positive cultures. The overall mortality rate was 19.8% (22 /111 of whom 63.6% (14 /22 were preterm. Pseudomona aeruginosa and Klebsiella spp. showed a high degree of resistance to commonly used antibiotics (ampicillin, gentamicin as well as third generation cephalosporins. Continued local surveillance studies are urged to monitor emerging antimicrobial resistance and to guide interventions to minimize its occurrence.

  6. Periodontal diseases as bacterial infection

    Directory of Open Access Journals (Sweden)

    A. Bascones Martínez

    Full Text Available The periodontal disease is conformed by a group of illnesses affecting the gums and dental support structures. They are caused by certain bacteria found in the bacterial plaque. These bacteria are essential to the onset of illness; however, there are predisposing factors in both the host and the microorganisms that will have an effect on the pathogenesis of the illness. Periodontopathogenic bacterial microbiota is needed, but by itself, it is not enough to cause the illness, requiring the presence of a susceptible host. These diseases have been classified as gingivitis, when limited to the gums, and periodontitis, when they spread to deeper tissues. Classification of periodontal disease has varied over the years.The one used in this work was approved at the International Workshop for a Classification of Periodontal Diseases and Conditions, held in 1999. This study is an overview of the different periodontal disease syndromes. Later, the systematic use of antibiotic treatment consisting of amoxicillin, amoxicillinclavulanic acid, and metronidazole as first line coadjuvant treatment of these illnesses will be reviewed.

  7. Bioinformatic Comparison of Bacterial Secretomes

    Institute of Scientific and Technical Information of China (English)

    Catharine Song; Aseem Kumar; Mazen Saleh

    2009-01-01

    The rapid increasing number of completed bacterial genomes provides a good op-portunity to compare their proteomes. This study was undertaken to specifically compare and contrast their secretomes-the fraction of the proteome with pre-dicted N-terminal signal sequences, both type Ⅰ and type Ⅱ. A total of 176 theoreti-cal bacterial proteomes were examined using the ExProt program. Compared with the Gram-positives, the Gram-negative bacteria were found, on average, to con-tain a larger number of potential Sec-dependent sequences. In the Gram-negative bacteria but not in the others, there was a positive correlation between proteome size and secretome size, while there was no correlation between secretome size and pathogenicity. Within the Gram-negative bacteria, intracellular pathogens were found to have the smallest secretomes. However, the secretomes of certain bacte-ria did not fit into the observed pattern. Specifically, the secretome of Borrelia burgdoferi has an unusually large number of putative lipoproteins, and the signal peptides of mycoplasmas show closer sequence similarity to those of the Gram-negative bacteria. Our analysis also suggests that even for a theoretical minimal genome of 300 open reading frames, a fraction of this gene pool (up to a maximum of 20%) may code for proteins with Sec-dependent signal sequences.

  8. Bacterial pericarditis in a cat

    Directory of Open Access Journals (Sweden)

    Nicole LeBlanc

    2015-09-01

    Full Text Available Case summary A 4-year-old male neutered domestic shorthair cat was presented to the Oregon State University cardiology service for suspected pericardial effusion. Cardiac tamponade was documented and pericardiocentesis yielded purulent fluid with cytologic results supportive of bacterial pericarditis. The microbial population consisted of Pasteurella multocida, Actinomyces canis, Fusobacterium and Bacteroides species. Conservative management was elected consisting of intravenous antibiotic therapy with ampicillin sodium/sulbactam sodium and metronidazole for 48 h followed by 4 weeks of oral antibiotics. Re-examination 3 months after the initial incident indicated no recurrence of effusion and the cat remained free of clinical signs 2 years after presentation. Relevance and novel information Bacterial pericarditis is a rare cause of pericardial effusion in cats. Growth of P multocida, A canis, Fusobacterium and Bacteroides species has not previously been documented in feline septic pericarditis. Conservative management with broad-spectrum antibiotics may be considered when further diagnostic imaging or exploratory surgery to search for a primary nidus of infection is not feasible or elected.

  9. Protein kinase CK2 in health and disease: Protein kinase CK2: from structures to insights

    DEFF Research Database (Denmark)

    Niefind, K; Raaf, J; Issinger, Olaf-Georg

    2009-01-01

    Within the last decade, 40 crystal structures corresponding to protein kinase CK2 (former name 'casein kinase 2'), to its catalytic subunit CK2alpha and to its regulatory subunit CK2beta were published. Together they provide a valuable, yet by far not complete basis to rationalize the biochemical...... features of the enzyme, such as its constitutive activity, acidophilic substrate specificity, dual-cosubstrate specificity and its heterotetrameric quarternary structure. Comprehensive sets of structural superimpositions reveal that both CK2alpha and CK2beta are relatively rigid molecules. In CK2beta...... the critical region of CK2alpha recruitment is pre-formed in the unbound state. In CK2alpha the activation segment - a key element of protein kinase regulation - adapts invariably the typical conformation of the active enzymes. Recent structures of human CK2alpha revealed a surprising plasticity in the ATP...

  10. Tank binding kinase 1 is a centrosome-associated kinase necessary for microtubule dynamics and mitosis.

    Science.gov (United States)

    Pillai, Smitha; Nguyen, Jonathan; Johnson, Joseph; Haura, Eric; Coppola, Domenico; Chellappan, Srikumar

    2015-12-10

    TANK Binding Kinase 1 (TBK1) is a non-canonical IκB kinase that contributes to KRAS-driven lung cancer. Here we report that TBK1 plays essential roles in mammalian cell division. Specifically, levels of active phospho-TBK1 increase during mitosis and localize to centrosomes, mitotic spindles and midbody, and selective inhibition or silencing of TBK1 triggers defects in spindle assembly and prevents mitotic progression. TBK1 binds to the centrosomal protein CEP170 and to the mitotic apparatus protein NuMA, and both CEP170 and NuMA are TBK1 substrates. Further, TBK1 is necessary for CEP170 centrosomal localization and binding to the microtubule depolymerase Kif2b, and for NuMA binding to dynein. Finally, selective disruption of the TBK1-CEP170 complex augments microtubule stability and triggers defects in mitosis, suggesting that TBK1 functions as a mitotic kinase necessary for microtubule dynamics and mitosis.

  11. Interaction between resource identity and bacterial community composition regulates bacterial respiration in aquatic ecosystems

    Directory of Open Access Journals (Sweden)

    A. P. F. Pires

    Full Text Available Abstract Resource identity and composition structure bacterial community, which in turn determines the magnitude of bacterial processes and ecological services. However, the complex interaction between resource identity and bacterial community composition (BCC has been poorly understood so far. Using aquatic microcosms, we tested whether and how resource identity interacts with BCC in regulating bacterial respiration and bacterial functional diversity. Different aquatic macrophyte leachates were used as different carbon resources while BCC was manipulated through successional changes of bacterial populations in batch cultures. We observed that the same BCC treatment respired differently on each carbon resource; these resources also supported different amounts of bacterial functional diversity. There was no clear linear pattern of bacterial respiration in relation to time succession of bacterial communities in all leachates, i.e. differences on bacterial respiration between different BCC were rather idiosyncratic. Resource identity regulated the magnitude of respiration of each BCC, e.g. Ultricularia foliosa leachate sustained the greatest bacterial functional diversity and lowest rates of bacterial respiration in all BCC. We conclude that both resource identity and the BCC interact affecting the pattern and the magnitude of bacterial respiration in aquatic ecosystems.

  12. Forensic identification using skin bacterial communities

    OpenAIRE

    FIERER Noah; Lauber, Christian L.; Zhou, Nick; McDonald, Daniel; Costello, Elizabeth K.; Knight, Rob

    2010-01-01

    Recent work has demonstrated that the diversity of skin-associated bacterial communities is far higher than previously recognized, with a high degree of interindividual variability in the composition of bacterial communities. Given that skin bacterial communities are personalized, we hypothesized that we could use the residual skin bacteria left on objects for forensic identification, matching the bacteria on the object to the skin-associated bacteria of the individual who touched the object....

  13. Drag Reduction of Bacterial Cellulose Suspensions

    Directory of Open Access Journals (Sweden)

    Satoshi Ogata

    2011-01-01

    Full Text Available Drag reduction due to bacterial cellulose suspensions with small environmental loading was investigated. Experiments were carried out by measuring the pressure drop in pipe flow. It was found that bacterial cellulose suspensions give rise to drag reduction in the turbulent flow range. We observed a maximum drag reduction ratio of 11% and found that it increased with the concentration of the bacterial cellulose suspension. However, the drag reduction effect decreased in the presence of mechanical shear.

  14. In vivo bacterial morphogenetic protein interactions

    OpenAIRE

    van der Ploeg, R.; den Blaauwen, T.; Meghea, A.

    2012-01-01

    This chapter will discuss none-invasive techniques that are widely used to study protein-protein interactions. As an example, their application in exploring interactions between proteins involved in bacterial cell division will be evaluated. First, bacterial morphology and cell division of the rod-shaped bacterium Escherichia coli will be introduced. Next, three bacterial two-hybrid methods and three Förster resonance energy transfer detection methods that are frequently applied to detect int...

  15. Dimerization via tandem leucine zippers is essential for the activation of the mitogen-activated protein kinase kinase kinase, MLK-3.

    Science.gov (United States)

    Leung, I W; Lassam, N

    1998-12-04

    Mixed lineage kinase-3 (MLK-3) is a mitogen-activated kinase kinase kinase that mediates stress-activating protein kinase (SAPK)/c-Jun NH2-terminal kinase activation. MLK-3 and other MLK family kinases are characterized by the presence of multiple protein-protein interaction domains including a tandem leucine/isoleucine zipper (LZs) motif. Leucine zippers are known to mediate protein dimerization raising the possibility that the tandem leucine/isoleucine zippers may function as a dimerization motif of MLK-3. Using both co-immunoprecipitation and nonreducing SDS-polyacrylamide gel electrophoresis, we demonstrated that MLK-3 forms disulfide bridged homo-dimers and that the LZs motif is sufficient for MLK-3 homodimerization. We next asked whether MLK-3 utilizes a dimerization-based activation mechanism analogous to that of receptor tyrosine kinases. We found that dimerization via the LZs motif is a prerequisite for MLK-3 autophosphorylation. We then demonstrated that co-expression of Cdc42 lead to a substantial increase in MLK-3 dimerization, indicating that binding by this GTPase may induce MLK-3 dimerization. Moreover, the LZs minus form of MLK-3 failed to activate the downstream target SAPK, and expression of a MLK-3 LZs polypeptide was found to block SAPK activation by wild type MLK-3. Taken together, these findings indicate that dimerization plays a pivotal role in MLK-3 activation.

  16. Bacterial contamination of hospital physicians' stethoscopes.

    Science.gov (United States)

    Bernard, L; Kereveur, A; Durand, D; Gonot, J; Goldstein, F; Mainardi, J L; Acar, J; Carlet, J

    1999-09-01

    Because stethoscopes might be potential vectors of nosocomial infections, this study, conducted in a 450-bed general hospital, was devised to evaluate the bacterial contamination of stethoscopes; bacterial survival on stethoscope membranes; the kinetics of the bacterial load on stethoscope membranes during clinical use; and the efficacy of 70% alcohol or liquid soap for membrane disinfection. Among the 355 stethoscopes tested, 234 carried > or =2 different bacterial species; 31 carried potentially pathogenic bacteria. Although some bacteria deposited onto membranes could survive 6 to 18 hours, none survived after disinfection.

  17. Bacterial Nanocellulose as a Microbiological Derived Nanomaterial

    Directory of Open Access Journals (Sweden)

    Stanisławska A.

    2016-12-01

    Full Text Available Bacterial nanocellulose (BNC is a nanofibrilar polymer produced by strains such as Gluconacetobacter xylinus, one of the best bacterial species which given the highest efficiency in cellulose production. Bacterial cellulose is a biomaterial having unique properties such as: chemical purity, good mechanical strength, high flexibility, high absorbency, possibility of forming any shape and size and many others. Such a large number of advantages contributes to the widespread use of the BNC in food technology, paper, electronic industry, but also the architecture in use. However, the greatest hopes are using the BNC in medicine. This text contains information about bacterial nanocellulose, its specific mechanical and biological properties and current applications.

  18. Macro creatine kinase type 1: a cause of spuriously elevated serum creatine kinase associated with leukoencephalopathy in a child.

    Science.gov (United States)

    Bodensteiner, John B

    2014-07-01

    Macro creatine kinase type 1 is a complex formed by the creatine kinase isoenzyme BB and monoclonal IgG and occurs in about 1% of patients studied. First identified as a cause of spurious elevation of the total serum creatine kinase in patients suspected of myocardial infarction, the test has been largely replaced by the measurement of troponin levels. We present a child with delayed milestones and persistently elevated total serum creatine kinase measurements (∼ 1000-4000 IU) normal electromyogram and brisk myotatic reflexes. Creatine kinase isoenzymes and brain imaging showed the presence of macro creatine kinase type 1 and extensive signal abnormality of the cerebral white matter. Macro creatine kinase type 1 has been associated with several conditions though it has not been described in association with leukoencephalopathy or in patients this young. Macro creatine kinase type 1 can be a cause of elevated total creatine kinase in patients without primary muscle disease. The significance of the relationship of the macro creatine kinase to the leukoencephalopathy in this patient is unknown.

  19. Extended recombinant bacterial ghost system.

    Science.gov (United States)

    Lubitz, W; Witte, A; Eko, F O; Kamal, M; Jechlinger, W; Brand, E; Marchart, J; Haidinger, W; Huter, V; Felnerova, D; Stralis-Alves, N; Lechleitner, S; Melzer, H; Szostak, M P; Resch, S; Mader, H; Kuen, B; Mayr, B; Mayrhofer, P; Geretschläger, R; Haslberger, A; Hensel, A

    1999-08-20

    Controlled expression of cloned PhiX174 gene E in Gram-negative bacteria results in lysis of the bacteria by formation of an E-specific transmembrane tunnel structure built through the cell envelope complex. Bacterial ghosts from a variety of bacteria are used as non-living candidate vaccines. In the recombinant ghost system, foreign proteins are attached on the inside of the inner membrane as fusions with specific anchor sequences. Ghosts have a sealed periplasmic space and the export of proteins into this space vastly extends the capacity of ghosts or recombinant ghosts to function as carriers of foreign antigens. In addition, S-layer proteins forming shell-like self assembly structures can be expressed in candidate vaccine strains prior to E-mediated lysis. Such recombinant S-layer proteins carrying foreign epitopes further extend the possibilities of ghosts as carriers of foreign epitopes. As ghosts have inherent adjuvant properties, they can be used as adjuvants in combination with subunit vaccines. Subunits or other ligands can also be coupled to matrixes like dextran which are used to fill the internal lumen of ghosts. Oral, aerogenic or parenteral immunization of experimental animals with recombinant ghosts induced specific humoral and cellular immune responses against bacterial and target components including protective mucosal immunity. The most relevant advantage of recombinant bacterial ghosts as immunogens is that no inactivation procedures that denature relevant immunogenic determinants are employed in this production. This fact explains the superior quality of ghosts when compared to other inactivated vaccines. The endotoxic component of the outer membrane does not limit the use of ghosts as vaccine candidates but triggers the release of several potent immunoregulatory cytokines. As carriers, there is no limitation in the size of foreign antigens that can be inserted in the membrane and the capacity of all spaces including the membranes, peri

  20. Mutations of Bruton's tyrosine kinase gene in Brazilian patients with X-linked agammaglobulinemia.

    Science.gov (United States)

    Ramalho, V D; Oliveira Júnior, E B; Tani, S M; Roxo Júnior, P; Vilela, M M S

    2010-09-01

    Mutations in Bruton's tyrosine kinase (BTK) gene are responsible for X-linked agammaglobulinemia (XLA), which is characterized by recurrent bacterial infections, profound hypogammaglobulinemia, and decreased numbers of mature B cells in peripheral blood. We evaluated 5 male Brazilian patients, ranging from 3 to 10 years of age, from unrelated families, whose diagnosis was based on recurrent infections, markedly reduced levels of IgM, IgG and IgA, and circulating B cell numbers <2%. BTK gene analysis was carried out using PCR-SSCP followed by sequencing. We detected three novel (Ala347fsX55, I355T, and Thr324fsX24) and two previously reported mutations (Q196X and E441X). Flow cytometry revealed a reduced expression of BTK protein in patients and a mosaic pattern of BTK expression was obtained from mothers, indicating that they were XLA carriers.

  1. Mutations of Bruton's tyrosine kinase gene in Brazilian patients with X-linked agammaglobulinemia

    Directory of Open Access Journals (Sweden)

    V.D. Ramalho

    2010-09-01

    Full Text Available Mutations in Bruton's tyrosine kinase (BTK gene are responsible for X-linked agammaglobulinemia (XLA, which is characterized by recurrent bacterial infections, profound hypogammaglobulinemia, and decreased numbers of mature B cells in peripheral blood. We evaluated 5 male Brazilian patients, ranging from 3 to 10 years of age, from unrelated families, whose diagnosis was based on recurrent infections, markedly reduced levels of IgM, IgG and IgA, and circulating B cell numbers <2%. BTK gene analysis was carried out using PCR-SSCP followed by sequencing. We detected three novel (Ala347fsX55, I355T, and Thr324fsX24 and two previously reported mutations (Q196X and E441X. Flow cytometry revealed a reduced expression of BTK protein in patients and a mosaic pattern of BTK expression was obtained from mothers, indicating that they were XLA carriers.

  2. Further investigation of inhibitors of MRSA pyruvate kinase: Towards the conception of novel antimicrobial agents.

    Science.gov (United States)

    Labrière, Christophe; Gong, Huansheng; Finlay, B Brett; Reiner, Neil E; Young, Robert N

    2017-01-05

    Several novel series of compounds were synthesized and evaluated as inhibitors of methicillin-resistant Staphylococcus aureus (MRSA) pyruvate kinase (PK). PK has been identified as a highly interconnected essential 'hub' protein in MRSA, with structural features distinct from the human homologs which makes it a novel antimicrobial target. Several MRSA PK inhibitors (including the hydrazide 1) were identified using in silico screening combined with enzyme assays and were found to be selective for bacterial enzyme compared to human PK isoforms. Structure-activity relationship (SAR) studies were carried out on the replacement of the hydrazide linker with 3-atoms, 2-atoms and 0-atom linkers and led us to discover more potent compounds with enzyme inhibiting activities in the low nanomolar range and some were found to effectively inhibit bacteria growth in culture with minimum inhibitory concentrations (MIC) as low as 1 μg/mL.

  3. The secret life of kinases: functions beyond catalysis.

    LENUS (Irish Health Repository)

    Rauch, Jens

    2011-10-28

    Abstract Protein phosphorylation participates in the regulation of all fundamental biological processes, and protein kinases have been intensively studied. However, while the focus was on catalytic activities, accumulating evidence suggests that non-catalytic properties of protein kinases are essential, and in some cases even sufficient for their functions. These non-catalytic functions include the scaffolding of protein complexes, the competition for protein interactions, allosteric effects on other enzymes, subcellular targeting, and DNA binding. This rich repertoire often is used to coordinate phosphorylation events and enhance the specificity of substrate phosphorylation, but also can adopt functions that do not rely on kinase activity. Here, we discuss such kinase independent functions of protein and lipid kinases focussing on kinases that play a role in the regulation of cell proliferation, differentiation, apoptosis, and motility.

  4. The secret life of kinases: functions beyond catalysis

    Directory of Open Access Journals (Sweden)

    Romano David

    2011-10-01

    Full Text Available Abstract Protein phosphorylation participates in the regulation of all fundamental biological processes, and protein kinases have been intensively studied. However, while the focus was on catalytic activities, accumulating evidence suggests that non-catalytic properties of protein kinases are essential, and in some cases even sufficient for their functions. These non-catalytic functions include the scaffolding of protein complexes, the competition for protein interactions, allosteric effects on other enzymes, subcellular targeting, and DNA binding. This rich repertoire often is used to coordinate phosphorylation events and enhance the specificity of substrate phosphorylation, but also can adopt functions that do not rely on kinase activity. Here, we discuss such kinase independent functions of protein and lipid kinases focussing on kinases that play a role in the regulation of cell proliferation, differentiation, apoptosis, and motility.

  5. Bacterial Muramyl Dipeptide (MDP) Restricts Human Cytomegalovirus Replication via an IFN-β-Dependent Pathway.

    Science.gov (United States)

    Kapoor, Arun; Fan, Yi-Hsin; Arav-Boger, Ravit

    2016-02-02

    We recently reported that induction of NOD2 by human Cytomegalovirus (HCMV) resulted in virus inhibition and upregulation of antiviral and inflammatory cytokines. Here we investigated the effects of muramyl dipeptide (MDP), a bacterial cell wall component that activates NOD2, on HCMV replication and antiviral responses. HCMV infection of human foreskin fibroblasts induced NOD2, the downstream receptor-interacting serine/threonine-protein kinase 2 (RIPK2), resulting in phosphorylation of TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3). MDP treatment following infection at low multiplicity (MOI = 0.1 PFU/cell) inhibited HCMV in a dose-dependent manner and further induced phosphorylation of TBK1, IRF3 and expression of IFN-β. None of these effects of MDP were observed following infection at multiplicity of 1. In infected NOD2 knocked-down cells MDP did not induce IFN-β, irrespective of MOI. Treatment with MDP before infection also inhibited HCMV, an effect augmented with treatment duration. Treatment with an IFN-β receptor blocking antibody or knockdown of IFN-β significantly attenuated the inhibitory effect of MDP on HCMV. MDP treatment before or after infection with herpesvirus 1 did not inhibit its replication. Summarized, NOD2 activation exerts anti-HCMV activities predominantly via IFN-β. Since MDP is a bacterial cell wall component, ongoing microbial exposure may influence HCMV replication.

  6. Protein kinase A (PknA) of Mycobacterium tuberculosis is independently activated and is critical for growth in vitro and survival of the pathogen in the host.

    Science.gov (United States)

    Nagarajan, Sathya Narayanan; Upadhyay, Sandeep; Chawla, Yogesh; Khan, Shazia; Naz, Saba; Subramanian, Jayashree; Gandotra, Sheetal; Nandicoori, Vinay Kumar

    2015-04-10

    The essential mycobacterial protein kinases PknA and PknB play crucial roles in modulating cell shape and division. However, the precise in vivo functional aspects of PknA have not been investigated. This study aims to dissect the role of PknA in mediating cell survival in vitro as well as in vivo. We observed aberrant cell shape and severe growth defects when PknA was depleted. Using the mouse infection model, we observe that PknA is essential for survival of the pathogen in the host. Complementation studies affirm the importance of the kinase, juxtamembrane, and transmembrane domains of PknA. Surprisingly, the extracytoplasmic domain is dispensable for cell growth and survival in vitro. We find that phosphorylation of the activation loop at Thr(172) of PknA is critical for bacterial growth. PknB has been previously suggested to be the receptor kinase, which activates multiple kinases, including PknA, by trans-phosphorylating their activation loop residues. Using phospho-specific PknA antibodies and conditional pknB mutant, we find that PknA autophosphorylates its activation loop independent of PknB. Fluorescently tagged PknA and PknB show distinctive distribution patterns within the cell, suggesting that although both kinases are known to modulate cell shape and division, their modes of action are likely to be different. This is supported by our findings that expression of kinase-dead PknA versus kinase-dead PknB in mycobacterial cells leads to different cellular phenotypes. Data indicate that although PknA and PknB are expressed as part of the same operon, they appear to be regulating cellular processes through divergent signaling pathways.

  7. New pathways for bacterial polythioesters.

    Science.gov (United States)

    Wübbeler, Jan Hendrik; Steinbüchel, Alexander

    2014-10-01

    Polythioesters (PTE) contain sulfur in the backbone and represent persistent biopolymers, which are produced by certain chemical procedures as well as biotechnological in vitro and in vivo techniques. Different building blocks can be incorporated, resulting in PTE with variable features that could become interesting for special purposes. Particularly, the option to produce PTE in large-scale and in accordance with the methods of white biotechnology or green chemistry is valuable due to economical potentials and public environmental consciousness. This review is focused on the synthesis of PTE by the three established bacterial production strains Ralstonia eutropha, Escherichia coli and Advenella mimigardefordensis. In addition, an overview of the in vitro production and degradation of PTE is depicted.

  8. Cooperative Model of Bacterial Sensing

    CERN Document Server

    Shi, Y; Shi, Yu; Duke, Thomas

    1998-01-01

    Bacterial chemotaxis is controlled by the signalling of a cluster of receptors. A cooperative model is presented, in which coupling between neighbouring receptor dimers enhances the sensitivity with which stimuli can be detected, without diminishing the range of chemoeffector concentration over which chemotaxis can operate. Individual receptor dimers have two stable conformational states: one active, one inactive. Noise gives rise to a distribution between these states, with the probability influenced by ligand binding, and also by the conformational states of adjacent receptor dimers. The two-state model is solved, based on an equivalence with the Ising model in a randomly distributed magnetic field. The model has only two effective parameters, and unifies a number of experimental findings. According to the value of the parameter comparing coupling and noise, the signal can be arbitrarily sensitive to changes in the fraction of receptor dimers to which ligand is bound. The counteracting effect of a change of...

  9. Antigenic Variation in Bacterial Pathogens.

    Science.gov (United States)

    Palmer, Guy H; Bankhead, Troy; Seifert, H Steven

    2016-02-01

    Antigenic variation is a strategy used by a broad diversity of microbial pathogens to persist within the mammalian host. Whereas viruses make use of a minimal proofreading capacity combined with large amounts of progeny to use random mutation for variant generation, antigenically variant bacteria have evolved mechanisms which use a stable genome, which aids in protecting the fitness of the progeny. Here, three well-characterized and highly antigenically variant bacterial pathogens are discussed: Anaplasma, Borrelia, and Neisseria. These three pathogens display a variety of mechanisms used to create the structural and antigenic variation needed for immune escape and long-term persistence. Intrahost antigenic variation is the focus; however, the role of these immune escape mechanisms at the population level is also presented.

  10. Bacterial interactions in dental biofilm.

    Science.gov (United States)

    Huang, Ruijie; Li, Mingyun; Gregory, Richard L

    2011-01-01

    Biofilms are masses of microorganisms that bind to and multiply on a solid surface, typically with a fluid bathing the microbes. The microorganisms that are not attached but are free floating in an aqueous environment are termed planktonic cells. Traditionally, microbiology research has addressed results from planktonic bacterial cells. However, many recent studies have indicated that biofilms are the preferred form of growth of most microbes and particularly those of a pathogenic nature. Biofilms on animal hosts have significantly increased resistance to various antimicrobials compared to planktonic cells. These microbial communities form microcolonies that interact with each other using very sophisticated communication methods (i.e., quorum-sensing). The development of unique microbiological tools to detect and assess the various biofilms around us is a tremendously important focus of research in many laboratories. In the present review, we discuss the major biofilm mechanisms and the interactions among oral bacteria.

  11. Autoproteolytic Activation of Bacterial Toxins

    Directory of Open Access Journals (Sweden)

    Aimee Shen

    2010-05-01

    Full Text Available Protease domains within toxins typically act as the primary effector domain within target cells. By contrast, the primary function of the cysteine protease domain (CPD in Multifunctional Autoprocessing RTX-like (MARTX and Clostridium sp. glucosylating toxin families is to proteolytically cleave the toxin and release its cognate effector domains. The CPD becomes activated upon binding to the eukaryotic-specific small molecule, inositol hexakisphosphate (InsP6, which is found abundantly in the eukaryotic cytosol. This property allows the CPD to spatially and temporally regulate toxin activation, making it a prime candidate for developing anti-toxin therapeutics. In this review, we summarize recent findings related to defining the regulation of toxin function by the CPD and the development of inhibitors to prevent CPD-mediated activation of bacterial toxins.

  12. Bacterial Ice Crystal Controlling Proteins

    Directory of Open Access Journals (Sweden)

    Janet S. H. Lorv

    2014-01-01

    Full Text Available Across the world, many ice active bacteria utilize ice crystal controlling proteins for aid in freezing tolerance at subzero temperatures. Ice crystal controlling proteins include both antifreeze and ice nucleation proteins. Antifreeze proteins minimize freezing damage by inhibiting growth of large ice crystals, while ice nucleation proteins induce formation of embryonic ice crystals. Although both protein classes have differing functions, these proteins use the same ice binding mechanisms. Rather than direct binding, it is probable that these protein classes create an ice surface prior to ice crystal surface adsorption. Function is differentiated by molecular size of the protein. This paper reviews the similar and different aspects of bacterial antifreeze and ice nucleation proteins, the role of these proteins in freezing tolerance, prevalence of these proteins in psychrophiles, and current mechanisms of protein-ice interactions.

  13. Involvement of the MAP kinase cascade in Xenopus mesoderm induction.

    OpenAIRE

    Gotoh, Y.; Masuyama, N; Suzuki, A.; Ueno, N; Nishida, E

    1995-01-01

    Mitogen-activated protein kinase (MAPK) is activated by MAPK kinase (MAPKK) in a variety of signaling pathways. This kinase cascade has been shown to function in cell proliferation and differentiation, but its role in early vertebrate development remains to be investigated. During early vertebrate embryogenesis, the induction and patterning of mesoderm are thought to be determined by signals from intercellular factors such as members of the fibroblast growth factor (FGF) family and members of...

  14. Clinical stage EGFR inhibitors irreversibly alkylate Bmx kinase.

    Science.gov (United States)

    Hur, Wooyoung; Velentza, Anastasia; Kim, Sungjoon; Flatauer, Laura; Jiang, Xinnong; Valente, David; Mason, Daniel E; Suzuki, Melissa; Larson, Brad; Zhang, Jianming; Zagorska, Anna; Didonato, Michael; Nagle, Advait; Warmuth, Markus; Balk, Steven P; Peters, Eric C; Gray, Nathanael S

    2008-11-15

    Irreversible HER/erbB inhibitors selectively inhibit HER-family kinases by targeting a unique cysteine residue located within the ATP-binding pocket. Sequence alignment reveals that this rare cysteine is also present in ten other protein kinases including all five Tec-family members. We demonstrate that the Tec-family kinase Bmx is potently inhibited by irreversible modification at Cys496 by clinical stage EGFR inhibitors such as CI-1033. This cross-reactivity may have significant clinical implications.

  15. Protein kinases are potential targets to treat inflammatory bowel disease

    Institute of Scientific and Technical Information of China (English)

    Lei; Yang; Yutao; Yan

    2014-01-01

    Protein kinases play a crucial role in the pathogenesis of inflammatory bowel disease(IBD), the two main forms of which are ulcerative colitis and Crohn’s dis-ease. In this article, we will review the mechanisms of involvement of protein kinases in the pathogenesis of and intervention against IBD, in terms of their effects on genetics, microbiota, mucous layer and tight junc-tion, and the potential of protein kinases as therapeutic targets against IBD.

  16. Determination of aspartate kinase activity in maize tissues

    OpenAIRE

    Ferreira,Renato Rodrigues; Vendemiatti,Ariane; Gratão, Priscila Lupino; Lea, Peter John; Azevedo, Ricardo Antunes

    2005-01-01

    Lysine, threonine, methionine and isoleucine are synthesized from aspartate in a branched pathway in higher plants. Aspartate kinase plays a key role in the control of the aspartate pathway. The enzyme is very sensitive to manipulation and storage and the hydroxamate assay normally used to determine aspartate kinase activity has to be altered according to the plant species and tissue to be analyzed. We have optimized the assay for the determination of aspartate kinase in maize plants callus c...

  17. Conformation-specific inhibitors of Raf kinases.

    Science.gov (United States)

    Wang, Xiaolun; Schleicher, Kristin

    2013-01-01

    Since the discovery linking B-Raf mutations to human tumors in 2002, significant advances in the development of Raf inhibitors have been made, leading to the recent approval of two Raf inhibitor drugs. This chapter includes a brief introduction to B-Raf as a validated target and focuses on the three different binding modes observed with Raf small-molecule inhibitors. These various binding modes lock the Raf kinase in different conformations that impact the toxicity profiles of the inhibitors. Possible solutions to mitigate the side effects caused by inhibitor-induced dimerization are also discussed.

  18. Rho kinases in cardiovascular physiology and pathophysiology.

    Science.gov (United States)

    Loirand, Gervaise; Guérin, Patrice; Pacaud, Pierre

    2006-02-17

    Rho kinases (ROCKs) are the first and the best-characterized effectors of the small G-protein RhoA. In addition to their effect on actin organization, or through this effect, ROCKs have been found to regulate a wide range of fundamental cell functions such as contraction, motility, proliferation, and apoptosis. Abnormal activation of the RhoA/ROCK pathway has been observed in major cardiovascular disorders such as atherosclerosis, restenosis, hypertension, pulmonary hypertension, and cardiac hypertrophy. This review, based on recent molecular, cellular, and animal studies, focuses on the current understanding of ROCK signaling and its roles in cardiovascular physiology and pathophysiology.

  19. Virulence Effects and Signaling Partners Modulated by Brucella melitensis Light-sensing Histidine Kinase

    Science.gov (United States)

    Gourley, Christopher R.

    The facultative intracellular pathogen Brucella melitensis utilizes diverse virulence factors. A Brucella light sensing histidine kinase can influence in vitro virulence of the bacteria during intracellular infection. First, we demonstrated that the B. melitensis light sensing kinase (BM-LOV-HK) affects virulence in an IRF-1-/- mouse model of infection. Infection with a Δ BM-LOV-HK strain resulted in less bacterial colonization of IRF-1-/- spleens and extended survivorship compared to mice infected with wild type B. melitensis 16M. Second, using PCR arrays, we observed less expression of innate and adaptive immune system activation markers in ΔBM-LOV-HK infected mouse spleens than wild type B. melitensis 16M infected mouse spleens 6 days after infection. Third, we demonstrated by microarray analysis of B. melitensis that deletion of BM-LOV-HK alters bacterial gene expression. Downregulation of genes involved in control of the general stress response system included the alternative sigma factor RpoE1 and its anti-anti sigma factor PhyR. Conversely, genes involved in flagella production, quorum sensing, and the type IV secretion system (VirB operon) were upregulated in the Δ BM-LOV-HK strain compared to the wild type B. melitensis 16M. Analysis of genes differentially regulated in Δ BM-LOV-HK versus the wild type strain indicated an overlap of 110 genes with data from previous quorum sensing regulator studies of Δ vjbR and/ΔblxR(babR) strains. Also, several predicted RpoE1 binding sites located upstream of genes were differentially regulated in the ΔBM-LOV-HK strain. Our results suggest BM-LOV-HK is important for in vivo Brucella virulence, and reveals that BM-LOV-HK directly or indirect regulates members of the Brucella quorum sensing, type IV secretion, and general stress systems.

  20. Receptor Tyrosine Kinase and Tyrosine Kinase Inhibitors: New Hope for Success in Multiple Sclerosis Therapy.

    Science.gov (United States)

    Mirshafiey, Abbas; Ghalamfarsa, Ghasem; Asghari, Babak; Azizi, Gholamreza

    2014-07-01

    Receptor tyrosine kinases (RTKs) are essential components of signal transduction pathways that mediate cell-to-cell communication and their function as relay points for signaling pathways. They have a key role in numerous processes that control cellular proliferation and differentiation, regulate cell growth and cellular metabolism, and promote cell survival and apoptosis. Recently, the role of RTKs including TCR, FLT-3, c-Kit, c-Fms, PDGFR, ephrin, neurotrophin receptor, and TAM receptor in autoimmune disorder, especially rheumatoid arthritis and multiple sclerosis has been suggested. In multiple sclerosis pathogenesis, RTKs and their tyrosine kinase enzymes are selective important targets for tyrosine kinase inhibitor (TKI) agents. TKIs, compete with the ATP binding site of the catalytic domain of several tyrosine kinases, and act as small molecules that have a favorable safety profile in disease treatment. Up to now, the efficacy of TKIs in numerous animal models of MS has been demonstrated, but application of these drugs in human diseases should be tested in future clinical trials.

  1. Protein kinase C gamma mutations in spinocerebellar ataxia 14 increase kinase activity and alter membrane targeting

    NARCIS (Netherlands)

    Verbeek, D. S.; Knight, M. A.; Harmison, G. G.; Fischbeck, K. H.; Howell, B. W.

    2005-01-01

    The protein kinase C gamma (PKCgamma) gene is mutated in spinocerebellar ataxia type 14 (SCA14). In this study, we investigated the effects of two SCA14 missense mutations, G118D and C150F, on PKCgamma function. We found that these mutations increase the intrinsic activity of PKCgamma. Direct visual

  2. Distribution of protein kinase Mzeta and the complete protein kinase C isoform family in rat brain

    DEFF Research Database (Denmark)

    Naik, M U; Benedikz, Eirikur; Hernandez, I

    2000-01-01

    Protein kinase C (PKC) is a multigene family of at least ten isoforms, nine of which are expressed in brain (alpha, betaI, betaII, gamma, delta, straightepsilon, eta, zeta, iota/lambda). Our previous studies have shown that many of these PKCs participate in synaptic plasticity in the CA1 region o...

  3. p21-activated Kinase1(PAK1) can promote ERK activation in a kinase independent manner

    DEFF Research Database (Denmark)

    Wang, Zhipeng; Fu, Meng; Wang, Lifeng

    2013-01-01

    204) although phosphorylation of b-Raf (Ser445) and c-Raf (Ser 338) remained unchanged. Furthermore, increased activation of the PAK1 activator Rac1 induced the formation of a triple complex of Rac1, PAK1 and Mek1, independent of the kinase activity of PAK1. These data suggest that PAK1 can stimulate...

  4. Diacylglycerol kinase counteracts protein kinase C-mediated inactivation of the EGF receptor

    NARCIS (Netherlands)

    Baal, van J.; Widt, de J.; Divecha, N.; Blitterswijk, van W.J.

    2012-01-01

    Epidermal growth factor receptor (EGFR) activation is negatively regulated by protein kinase C (PKC)signaling. Stimulation of A431 cells with EGF, bradykinin or UTP increased EGFR phosphorylation at Thr654 in a PKC-dependent manner. Inhibition of PKC signaling enhanced EGFR activation, as assessed b

  5. Nonmuscle Myosin IIA Regulates Platelet Contractile Forces Through Rho Kinase and Myosin Light-Chain Kinase.

    Science.gov (United States)

    Feghhi, Shirin; Tooley, Wes W; Sniadecki, Nathan J

    2016-10-01

    Platelet contractile forces play a major role in clot retraction and help to hold hemostatic clots against the vessel wall. Platelet forces are produced by its cytoskeleton, which is composed of actin and nonmuscle myosin filaments. In this work, we studied the role of Rho kinase, myosin light-chain kinase, and myosin in the generation of contractile forces by using pharmacological inhibitors and arrays of flexible microposts to measure platelet forces. When platelets were seeded onto microposts, they formed aggregates on the tips of the microposts. Forces produced by the platelets in the aggregates were measured by quantifying the deflection of the microposts, which bent in proportion to the force of the platelets. Platelets were treated with small molecule inhibitors of myosin activity: Y-27632 to inhibit the Rho kinase (ROCK), ML-7 to inhibit myosin light-chain kinase (MLCK), and blebbistatin to inhibit myosin ATPase activity. ROCK inhibition reduced platelet forces, demonstrating the importance of the assembly of actin and myosin phosphorylation in generating contractile forces. Similarly, MLCK inhibition caused weaker platelet forces, which verifies that myosin phosphorylation is needed for force generation in platelets. Platelets treated with blebbistatin also had weaker forces, which indicates that myosin's ATPase activity is necessary for platelet forces. Our studies demonstrate that myosin ATPase activity and the regulation of actin-myosin assembly by ROCK and MLCK are needed for the generation of platelet forces. Our findings illustrate and explain the importance of myosin for clot compaction in hemostasis and thrombosis.

  6. Peptide substrates for Rho-associated kinase 2 (Rho-kinase 2/ROCK2).

    Science.gov (United States)

    Kang, Jeong-Hun; Asai, Daisuke; Tsuchiya, Akira; Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki

    2011-01-01

    Peptide substrates sensitive for a certain protein kinase could be important for new-drug development and to understand the mechanism of diseases. Rho-associated kinase (Rho-kinase/ROCK) is a serine/threonine kinase, and plays an important part in cardiovascular disease, migration and invasion of tumor cells, and in neurological disorders. The purpose of this study was to find substrates with high affinity and sensitivity for ROCK2. We synthesized 136 peptide substrates from protein substrates for ROCK2 with different lengths and charged peptides. Incorporation of (32)P [counts per minute (CPM)] for each peptide substrate was determined by the radiolabel assay using [γ-(32)P]ATP. When the top five peptide substrates showing high CPMs (R4, R22, R133, R134, and R135) were phosphorylated by other enzymes (PKA, PKCα, and ERK1), R22, R133, and R135 displayed the highest CPM level for ROCK2 compared with other enzymes, whereas R4 and R134 showed similar CPM levels for ROCK2 and PKCα. We hypothesize that R22, R133, and R135 can be useful peptide substrates for ROCK2.

  7. Structures of down syndrome kinases, DYRKs, reveal mechanisms of kinase activation and substrate recognition

    DEFF Research Database (Denmark)

    Soundararajan, M.; Roos, A.K.; Savitsky, P.

    2013-01-01

    subfamily: DYRK1A with an ATP-mimetic inhibitor and consensus peptide, and DYRK2 including NAPA and DH (DYRK homology) box regions. The current activation model suggests that DYRKs are Ser/Thr kinases that only autophosphorylate the second tyrosine of the activation loop YxY motif during protein translation...

  8. Peptide substrates for Rho-associated kinase 2 (Rho-kinase 2/ROCK2.

    Directory of Open Access Journals (Sweden)

    Jeong-Hun Kang

    Full Text Available Peptide substrates sensitive for a certain protein kinase could be important for new-drug development and to understand the mechanism of diseases. Rho-associated kinase (Rho-kinase/ROCK is a serine/threonine kinase, and plays an important part in cardiovascular disease, migration and invasion of tumor cells, and in neurological disorders. The purpose of this study was to find substrates with high affinity and sensitivity for ROCK2. We synthesized 136 peptide substrates from protein substrates for ROCK2 with different lengths and charged peptides. Incorporation of (32P [counts per minute (CPM] for each peptide substrate was determined by the radiolabel assay using [γ-(32P]ATP. When the top five peptide substrates showing high CPMs (R4, R22, R133, R134, and R135 were phosphorylated by other enzymes (PKA, PKCα, and ERK1, R22, R133, and R135 displayed the highest CPM level for ROCK2 compared with other enzymes, whereas R4 and R134 showed similar CPM levels for ROCK2 and PKCα. We hypothesize that R22, R133, and R135 can be useful peptide substrates for ROCK2.

  9. A-Raf kinase is a new interacting partner of protein kinase CK2 beta subunit

    DEFF Research Database (Denmark)

    Boldyreff, B; Issinger, O G

    1997-01-01

    In a search for protein kinase CK2 beta subunit binding proteins using the two-hybrid system, more than 1000 positive clones were isolated. Beside clones for the alpha' and beta subunit of CK2, there were clones coding for a so far unknown protein, whose partial cDNA sequence was already deposite...

  10. Tyrosine Kinase Inhibition: An Approach to Drug Development

    Science.gov (United States)

    Levitzki, Alexander; Gazit, Aviv

    1995-03-01

    Protein tyrosine kinases (PTKs) regulate cell proliferation, cell differentiation, and signaling processes in the cells of the immune system. Uncontrolled signaling from receptor tyrosine kinases and intracellular tyrosine kinases can lead to inflammatory responses and to diseases such as cancer, atherosclerosis, and psoriasis. Thus, inhibitors that block the activity of tyrosine kinases and the signaling pathways they activate may provide a useful basis for drug development. This article summarizes recent progress in the development of PTK inhibitors and demonstrates their potential use in the treatment of disease.

  11. Recent advances in designing substrate-competitive protein kinase inhibitors.

    Science.gov (United States)

    Han, Ki-Cheol; Kim, So Yeon; Yang, Eun Gyeong

    2012-01-01

    Protein kinases play central roles in cellular signaling pathways and their abnormal phosphorylation activity is inseparably linked with various human diseases. Therefore, modulation of kinase activity using potent inhibitors is an attractive strategy for the treatment of human disease. While most protein kinase inhibitors in clinical development are mainly targeted to the highly conserved ATP-binding sites and thus likely promiscuously inhibit multiple kinases including kinases unrelated to diseases, protein substrate-competitive inhibitors are more selective and expected to be promising therapeutic agents. Most substrate-competitive inhibitors mimic peptides derived from substrate proteins, or from inhibitory domains within kinases or inhibitor proteins. In addition, bisubstrate inhibitors are generated by conjugating substrate-competitive peptide inhibitors to ATP-competitive inhibitors to improve affinity and selectivity. Although structural information on protein kinases provides invaluable guidance in designing substrate-competitive inhibitors, other strategies including bioinformatics, computational modeling, and high-throughput screening are often employed for developing specific substrate-competitive kinase inhibitors. This review focuses on recent advances in the design and discovery of substrate-competitive inhibitors of protein kinases.

  12. A Broad Specificity Nucleoside Kinase from Thermoplasma acidophilum

    OpenAIRE

    Elkin, Sarah R.; Kumar, Abhinav; Price, Carol W.; Columbus, Linda

    2013-01-01

    The crystal structure of Ta0880, determined at 1.91 A resolution, from Thermoplasma acidophilum revealed a dimer with each monomer composed of an α/β /α sandwich domain and a smaller lid domain. The overall fold belongs to the PfkB family of carbohydrate kinases (a family member of the Ribokinase clan) which include ribokinases, 1-phosphofructokinases, 6-phosphofructo-2-kinase, inosine/guanosine kinases, frutokinases, adenosine kinases, and many more. Based on its general fold, Ta0880 had bee...

  13. The acetate kinase of Clostridum acetobutylicum strain P262.

    Science.gov (United States)

    Diez-Gonzalez, F; Russell, J B; Hunter, J B

    1996-12-01

    Clostridum acetobutylicum strain P262 fermented glucose, pyruvate, or lactate, and the butyrate production was substrate-dependent. Differences in butyrate yield could not be explained by changes in butyrate kinase activities, but the butyrate production was inversely related to acetate kinase activity. The acetate kinase had a pH optimum of 8.0, a Km for acetate of 160 mM, and a kcat of 16, 800 min-1. The enyzme had a native molecular mass of 78 kDa; the size of 42 kDa on SDS-PAGE indicated that the acetate kinase of strain P262 was a homodimer.

  14. Multiple bacterial species reside in chronic wounds

    DEFF Research Database (Denmark)

    Gjødsbøl, Kristine; Christensen, Jens Jørgen; Karlsmark, Tonny;

    2006-01-01

    The aim of the study was to investigate the bacterial profile of chronic venous leg ulcers and the importance of the profile to ulcer development. Patients with persisting venous leg ulcers were included and followed for 8 weeks. Every second week, ulcer samples were collected and the bacterial s...

  15. Bacterial biofilms: prokaryotic adventures in multicellularity

    DEFF Research Database (Denmark)

    Webb, J.S.; Givskov, Michael Christian; Kjelleberg, S.

    2003-01-01

    The development of bacterial biofilms includes both the initial social behavior of undifferentiated cells, as well as cell death and differentiation in the mature biofilm, and displays several striking similarities with higher organisms. Recent advances in the field provide new insight...... into differentiation and cell death events in bacterial biofilm development and propose that biofilms have an unexpected level of multicellularity....

  16. Bacterial Flora of the Female Genital Tract

    Directory of Open Access Journals (Sweden)

    Pongsakdi Chaisilwattana

    1995-01-01

    Full Text Available Objective: The purpose of this study was to analyze the ability of septicemic and nonsepticemic isolates of group B streptococci (GBS to inhibit in vitro the principal bacterial groups found in the normal bacterial flora of the female genital tract.

  17. Use of Bacteriophages to control bacterial pathogens

    Science.gov (United States)

    Lytic bacteriophages can provide a natural method and an effective alternative to antibiotics to reduce bacterial pathogens in animals, foods, and other environments. Bacteriophages (phages) are viruses which infect bacterial cells and eventually kill them through lysis, and represent the most abun...

  18. Cerebral infarction in childhood bacterial meningitis

    OpenAIRE

    Snyder, R.D.; Stovring, J; Cushing, A H; Davis, L. E.; Hardy, T. L.

    1981-01-01

    Forty-nine children with complicated bacterial meningitis were studied. Thirteen had abnormalities on computed tomography compatible with the diagnosis of brain infarction; one had a brain biopsy with the histological appearance of infarction. Factors exist in childhood bacterial meningitis which are associated with the development of brain infraction.

  19. In vivo bacterial morphogenetic protein interactions

    NARCIS (Netherlands)

    van der Ploeg, R.; den Blaauwen, T.; Meghea, A.

    2012-01-01

    This chapter will discuss none-invasive techniques that are widely used to study protein-protein interactions. As an example, their application in exploring interactions between proteins involved in bacterial cell division will be evaluated. First, bacterial morphology and cell division of the rod-s

  20. Molecular cloning and characterization of lymphocyte cell kinase from humphead snapper (Lutjanus sanguineus).

    Science.gov (United States)

    Huang, Y; Cai, J; Wang, B; Tang, J-F; Jian, J-C; Wu, Z-H; Gan, Z; Lu, Y-S

    2016-07-01

    Lymphocyte cell kinase (LCK) belongs to the Src family of tyrosine kinases, which involves in the proliferation control of lymphocytes. In this study, we cloned the LCK gene of humphead snapper (Lutjanus sanguineus) (designed as LsLCK). Sequence analysis showed that the full-length cDNA of LsLCK was 2279 bp, contained a 1506-bp open reading frame (ORF), encoding a polypeptide of 501 amino acids. The deduced amino acid possessed the typical structural features of known LCK proteins, including four Src homology (SH) domains arranged as the SH1 domain followed by a regulatory C-terminal tail (COOH-domain), SH2 and SH3 adapter domains and SH4 domain which required for membrane attachment and CD4/CD8 binding. Fluorescent quantitative real-time PCR analysis indicated that LsLCK transcripts were expressed mainly in thymus, spleen and head kidney in healthy fish. Moreover, the mRNA expressions in these tissues were significantly up-regulated after challenge with Vibrio harveyi. The results of immunohistochemistry showed that LsLCK protein localized distinctly in cytoplasm of cell in thymus, spleen and head kidney. Taken together, these findings indicated that LsLCK may play an important role in the immune response of humphead snapper against bacterial infection.

  1. Inflammatory Signaling by NOD-RIPK2 Is Inhibited by Clinically Relevant Type II Kinase Inhibitors.

    Science.gov (United States)

    Canning, Peter; Ruan, Qui; Schwerd, Tobias; Hrdinka, Matous; Maki, Jenny L; Saleh, Danish; Suebsuwong, Chalada; Ray, Soumya; Brennan, Paul E; Cuny, Gregory D; Uhlig, Holm H; Gyrd-Hansen, Mads; Degterev, Alexei; Bullock, Alex N

    2015-09-17

    RIPK2 mediates pro-inflammatory signaling from the bacterial sensors NOD1 and NOD2, and is an emerging therapeutic target in autoimmune and inflammatory diseases. We observed that cellular RIPK2 can be potently inhibited by type II inhibitors that displace the kinase activation segment, whereas ATP-competitive type I inhibition was only poorly effective. The most potent RIPK2 inhibitors were the US Food and Drug Administration-approved drugs ponatinib and regorafenib. Their mechanism of action was independent of NOD2 interaction and involved loss of downstream kinase activation as evidenced by lack of RIPK2 autophosphorylation. Notably, these molecules also blocked RIPK2 ubiquitination and, consequently, inflammatory nuclear factor κB signaling. In monocytes, the inhibitors selectively blocked NOD-dependent tumor necrosis factor production without affecting lipopolysaccharide-dependent pathways. We also determined the first crystal structure of RIPK2 bound to ponatinib, and identified an allosteric site for inhibitor development. These results highlight the potential for type II inhibitors to treat indications of RIPK2 activation as well as inflammation-associated cancers.

  2. Co-occurence of filamentation defects and impaired biofilms in Candida albicans protein kinase mutants.

    Science.gov (United States)

    Konstantinidou, Nina; Morrissey, John Patrick

    2015-12-01

    Pathogenicity of Candida albicans is linked with its developmental stages, notably the capacity switch from yeast-like to hyphal growth, and to form biofilms on surfaces. To better understand the cellular processes involved in C. albicans development, a collection of 63 C. albicans protein kinase mutants was screened for biofilm formation in a microtitre plate assay. Thirty-eight mutants displayed some degree of biofilm impairment, with 20 categorised as poor biofilm formers. All the poor biofilm formers were also defective in the switch from yeast to hyphae, establishing it as a primary defect. Five genes, VPS15, IME2, PKH3, PGA43 and CEX1, encode proteins not previously reported to influence hyphal development or biofilm formation. Network analysis established that individual components of some processes, most interestingly MAP kinase pathways, are not required for biofilm formation, most likely indicating functional redundancy. Mutants were also screened for their response to bacterial supernatants and it was found that Pseudomonas aeruginosa supernatants inhibited biofilm formation in all mutants, regardless of the presence of homoserine lactones (HSLs). In contrast, Candida morphology was only affected by supernatant containing HSLs. This confirms the distinct HSL-dependent inhibition of filamentation and the HSL-independent impairment of biofilm development by P. aeruginosa.

  3. Targeting phosphoinositide 3-kinase δ for the treatment of respiratory diseases.

    Science.gov (United States)

    Sriskantharajah, Srividya; Hamblin, Nicole; Worsley, Sally; Calver, Andrew R; Hessel, Edith M; Amour, Augustin

    2013-03-01

    Asthma and chronic obstructive pulmonary disease (COPD) are characterized in their pathogenesis by chronic inflammation in the airways. Phosphoinositide 3-kinase δ (PI3Kδ), a lipid kinase expressed predominantly in leukocytes, is thought to hold much promise as a therapeutic target for such inflammatory conditions. Of particular interest for the treatment of severe respiratory disease is the observation that inhibition of PI3Kδ may restore steroid effectiveness under conditions of oxidative stress. PI3Kδ inhibition may also prevent recruitment of inflammatory cells, including T lymphocytes and neutrophils, as well as the release of proinflammatory mediators, such as cytokines, chemokines, reactive oxygen species, and proteolytic enzymes. In addition, targeting the PI3Kδ pathway could reduce the incidence of pathogen-induced exacerbations by improving macrophage-mediated bacterial clearance. In this review, we discuss the potential and highlight the unknowns of targeting PI3Kδ for the treatment of respiratory disease, focusing on recent developments in the role of the PI3Kδ pathway in inflammatory cell types believed to be critical to the pathogenesis of COPD.

  4. Haemophilus ducreyi targets Src family protein tyrosine kinases to inhibit phagocytic signaling.

    Science.gov (United States)

    Mock, Jason R; Vakevainen, Merja; Deng, Kaiping; Latimer, Jo L; Young, Jennifer A; van Oers, Nicolai S C; Greenberg, Steven; Hansen, Eric J

    2005-12-01

    Haemophilus ducreyi, the etiologic agent of the sexually transmitted disease chancroid, has been shown to inhibit phagocytosis of both itself and secondary targets in vitro. Immunodepletion of LspA proteins from H. ducreyi culture supernatant fluid abolished this inhibitory effect, indicating that the LspA proteins are necessary for the inhibition of phagocytosis by H. ducreyi. Fluorescence microscopy revealed that macrophages incubated with wild-type H. ducreyi, but not with a lspA1 lspA2 mutant, were unable to complete development of the phagocytic cup around immunoglobulin G-opsonized targets. Examination of the phosphotyrosine protein profiles of these two sets of macrophages showed that those incubated with wild-type H. ducreyi had greatly reduced phosphorylation levels of proteins in the 50-to-60-kDa range. Subsequent experiments revealed reductions in the catalytic activities of both Lyn and Hck, two members of the Src family of protein tyrosine kinases that are known to be involved in the proximal signaling steps of Fcgamma receptor-mediated phagocytosis. Additional experiments confirmed reductions in the levels of both active Lyn and active Hck in three different immune cell lines, but not in HeLa cells, exposed to wild-type H. ducreyi. This is the first example of a bacterial pathogen that suppresses Src family protein tyrosine kinase activity to subvert phagocytic signaling in hostcells.

  5. An electrostatic selection mechanism controls sequential kinase signaling downstream of the T cell receptor

    Science.gov (United States)

    Shah, Neel H; Wang, Qi; Yan, Qingrong; Karandur, Deepti; Kadlecek, Theresa A; Fallahee, Ian R; Russ, William P; Ranganathan, Rama; Weiss, Arthur; Kuriyan, John

    2016-01-01

    The sequence of events that initiates T cell signaling is dictated by the specificities and order of activation of the tyrosine kinases that signal downstream of the T cell receptor. Using a platform that combines exhaustive point-mutagenesis of peptide substrates, bacterial surface-display, cell sorting, and deep sequencing, we have defined the specificities of the first two kinases in this pathway, Lck and ZAP-70, for the T cell receptor ζ chain and the scaffold proteins LAT and SLP-76. We find that ZAP-70 selects its substrates by utilizing an electrostatic mechanism that excludes substrates with positively-charged residues and favors LAT and SLP-76 phosphosites that are surrounded by negatively-charged residues. This mechanism prevents ZAP-70 from phosphorylating its own activation loop, thereby enforcing its strict dependence on Lck for activation. The sequence features in ZAP-70, LAT, and SLP-76 that underlie electrostatic selectivity likely contribute to the specific response of T cells to foreign antigens. DOI: http://dx.doi.org/10.7554/eLife.20105.001 PMID:27700984

  6. Regulatory mechanisms differ in UMP kinases from gram-negative and gram-positive bacteria.

    Science.gov (United States)

    Evrin, Cécile; Straut, Monica; Slavova-Azmanova, Neli; Bucurenci, Nadia; Onu, Adrian; Assairi, Liliane; Ionescu, Mihaela; Palibroda, Nicolae; Bârzu, Octavian; Gilles, Anne-Marie

    2007-03-09

    In this work, we examined the regulation by GTP and UTP of the UMP kinases from eight bacterial species. The enzyme from Gram-positive organisms exhibited cooperative kinetics with ATP as substrate. GTP decreased this cooperativity and increased the affinity for ATP. UTP had the opposite effect, as it decreased the enzyme affinity for ATP. The nucleotide analogs 5-bromo-UTP and 5-iodo-UTP were 5-10 times stronger inhibitors than the parent compound. On the other hand, UMP kinases from the Gram-negative organisms did not show cooperativity in substrate binding and catalysis. Activation by GTP resulted mainly from the reversal of inhibition caused by excess UMP, and inhibition by UTP was accompanied by a strong increase in the apparent K(m) for UMP. Altogether, these results indicate that, depending on the bacteria considered, GTP and UTP interact with different enzyme recognition sites. In Gram-positive bacteria, GTP and UTP bind to a single site or largely overlapping sites, shifting the T R equilibrium to either the R or T form, a scenario corresponding to almost all regulatory proteins, commonly called K systems. In Gram-negative organisms, the GTP-binding site corresponds to the unique allosteric site of the Gram-positive bacteria. In contrast, UTP interacts cooperatively with a site that overlaps the catalytic center, i.e. the UMP-binding site and part of the ATP-binding site. These characteristics make UTP an original regulator of UMP kinases from Gram-negative organisms, beyond the common scheme of allosteric control.

  7. Role of calcium, protein kinase C and MAP kinase in the activation of mast cells

    Directory of Open Access Journals (Sweden)

    Michael A. Beaven

    1996-01-01

    Full Text Available The mechanisms of activation of mast cells have been studied in most detail in rat RBL-2H3 cells. These cells respond to antigen via the IgE receptor (FceRI through sequential activation of the tyrosine kinases, Lyn and Syk, and to adenosine analogs via the adenosine A3 receptor (A3R and a pertussis toxin-sensitive G protein, most likely Gi-3. Other receptors, introduced through gene transfection, include the muscarinic ml receptor (mlR which acts via Gq/11. Stimulation of cells via FceRI, A3R or ml R leads to the activation of phospholipase (PL C, PLD and mitogen-activated protein (MAP kinase resulting in the generation of inositol phosphates and diglycerides, an increase of cytosolic Ca2+, the activation of protein kinase C (PKC and the phosphorylation of various proteins by PKC and MAP kinase. The extent and time course of these events varies for each receptor. These variations, as well as the effects of pharmacologic probes, gene transfection and reconstitution of responses in washed permeabilized cells, indicate how these events relate to functional responses. A modest but sustained elevation of cytosolic Ca2+ through an influx of extracellular Ca2+ and activation of PKCβ and PKCδ are sufficient for optimal release of preformed secretory granules. Phosphorylation of a cytosolic PLAj by AMP kinase (p42mapk and a modest increase in cytosolic Ca2+ are necessary for the activation of Pl^ and the binding of PLA2 to membranes, respectively. Finally, both de novo generation and secretion via Golgi-derived vesicles of certain cytokines are dependent on Ca2+ and PKC as well as additional signals most probably phosphorylation of proteins by Syk and p42mapk.

  8. Structural biology of bacterial RNA polymerase.

    Science.gov (United States)

    Murakami, Katsuhiko S

    2015-05-11

    Since its discovery and characterization in the early 1960s (Hurwitz, J. The discovery of RNA polymerase. J. Biol. Chem. 2005, 280, 42477-42485), an enormous amount of biochemical, biophysical and genetic data has been collected on bacterial RNA polymerase (RNAP). In the late 1990s, structural information pertaining to bacterial RNAP has emerged that provided unprecedented insights into the function and mechanism of RNA transcription. In this review, I list all structures related to bacterial RNAP (as determined by X-ray crystallography and NMR methods available from the Protein Data Bank), describe their contributions to bacterial transcription research and discuss the role that small molecules play in inhibiting bacterial RNA transcription.

  9. Enzyme kinetics and distinct modulation of the protein kinase N family of kinases by lipid activators and small molecule inhibitors

    OpenAIRE

    Falk, Matthew D.; Liu, Wei; Bolaños, Ben; Unsal-Kacmaz, Keziban; Klippel, Anke; Grant, Stephan; Brooun, Alexei; Timofeevski, Sergei

    2014-01-01

    The PKN (protein kinase N) family of Ser/Thr protein kinases regulates a diverse set of cellular functions, such as cell migration and cytoskeletal organization. Inhibition of tumour PKN activity has been explored as an oncology therapeutic approach, with a PKN3-targeted RNAi (RNA interference)-derived therapeutic agent in Phase I clinical trials. To better understand this important family of kinases, we performed detailed enzymatic characterization, determining the kinetic mechanism and lipi...

  10. Stress kinase inhibition modulates acute experimental pancreatitis

    Institute of Scientific and Technical Information of China (English)

    F. Fleischer; R. Dabew; B. Goke; ACC Wagner

    2001-01-01

    AIM To examine the role of p38 during acute experimental cerulein pancreatitis.METHODS Rats were treated with cerulein with or without a specific JNK inhibitor (CEP1347)andy or a specific p38 inhbitor (SB203380) and pancreatic stress kinase activity wasdetermined. Parameters to assess pancreatitis included trypsin, amylase, lipase, pancreatic weight and histology.RESULTS JNK inhibition with CEP1347ameliorated pancreatitis, reducing pancreatic edema. In contrast, p38 inhibition with SB203580aggravated pancreatitis with higher trypsinlevels and, with induction of acinar necrosis not normally found after cerulein hyperstimulation.Simultaneous treatment with both CEP1347 and SB203580 mutually abolished the effects of either compound on cerulein pancreatitis.CONCLUSION Stress kinases modulatepancreatitis differentially. JNK seems to promote pancreatitis development, possibly by supporting inflammatory reactions such as edema formation while its inhibition ameliorates pancreatitis. In contrast, p38 may help reduce organ destruction while inhibition of p38 during induction of cerulein pancreatitis leads to the occurrence of acinar necrosis.

  11. Bimodal lipid substrate dependence of phosphatidylinositol kinase.

    Science.gov (United States)

    Ganong, B R

    1990-07-24

    Phosphatidylinositol (PI) kinase activity was solubilized from rat liver microsomes and partially purified by chromatography on hydroxyapatite and Reactive Green 19-Superose. Examination of the ATP dependence using a mixed micellar assay gave a Km of 120 microM. The dependence of reaction rate on PI was more complicated. PI kinase bound a large amount of Triton X-100, and as expected for a micelle-associated enzyme utilizing a micelle-associated lipid substrate, the reaction rate was dependent on the micellar mole fraction, PI/(PI + Triton X-100), with a Km of 0.02 (unitless). Activity showed an additional dependence on bulk PI concentration at high micelle dilution. These results demonstrated two kinetically distinguishable steps leading to formation of a productive PI/enzyme(/ATP) complex. The rate of the first step, which probably represents exchange of PI from the bulk micellar pool into enzyme-containing micelles, depends on bulk PI concentration. The rate of the second step, association of PI with enzyme within a single micelle, depends on the micellar mole fraction of PI. Depression of the apparent Vmax at low ionic strength suggested that electrostatic repulsion between negatively charged PI/Triton X-100 mixed micelles inhibits PI exchange, consistent with a model in which intermicellar PI exchange depends on micellar collisions.

  12. Ras, Raf, and MAP kinase in melanoma.

    Science.gov (United States)

    Solus, Jason F; Kraft, Stefan

    2013-07-01

    A growing understanding of the biology and molecular mechanisms of melanoma has led to the identification of a number of driver mutations for this aggressive tumor. The most common mutations affect signaling of the Ras/Raf/MAPK (mitogen-activated protein kinase) pathway. This review will focus on mutations in genes encoding proteins that play a role in the MAPK pathway and that have been implicated in melanoma biology, such as BRAF, NRAS, and MEK (MAPK kinase), and detail the current understanding of their role in melanoma progression from a molecular biology perspective. Furthermore, this review will also consider some additional mutations in genes such as KIT, GNAQ, and GNA11, which can be seen in certain subtypes of melanoma and whose gene products interact with the MAPK pathway. In addition, the association of these molecular changes with clinical and classical histopathologic characteristics of melanoma will be outlined and their role in diagnosis of melanocytic lesions discussed. Finally, a basic overview of the current targeted therapy landscape, as far as relevant to the pathologist, will be provided.

  13. Thermodynamic study of yeast phosphoglycerate kinase.

    Science.gov (United States)

    Hu, C Q; Sturtevant, J M

    1987-01-13

    Enthalpies of binding of MgADP, MgATP, and 3-phosphoglycerate to yeast phosphoglycerate kinase have been determined by flow calorimetry at 9.95-32.00 degrees C. Combination of these data with published dissociation constants [Scopes, R.K. (1978) Eur. J. Biochem. 91, 119-129] yielded the following thermodynamic parameters for the binding of 3-phosphoglycerate at 25 degrees C: delta Go = -6.76 +/- 0.11 kcal mol-1, delta H = 3.74 +/- 0.08 kcal mol-1, delta So = 35.2 +/- 0.6 cal K-1 mol-1, and delta Cp = 0.12 +/- 0.32 kcal K-1 mol-1. The thermal unfolding of phosphoglycerate kinase in the absence and presence of the ligands listed above was studied by differential scanning calorimetry. The temperature of half-completion, t 1/2, of the denaturation and the denaturational enthalpy are increased by the binding of the ligands, the increase in t 1/2 being a manifestation of Le Chatelier's principle and that in enthalpy reflecting the enthalpy of dissociation of the ligand. Only one denaturational peak was observed under all conditions, and in contrast with the case of yeast hexokinase [Takahashi, K., Casey, J.L., & Sturtevant, J.M. (1981) Biochemistry 20, 4693-4697], no definitive evidence for the unfolding of more than one domain was obtained.

  14. Targeting the Pim kinases in multiple myeloma.

    LENUS (Irish Health Repository)

    Keane, N A

    2015-07-17

    Multiple myeloma (MM) is a plasma cell malignancy that remains incurable. Novel treatment strategies to improve survival are urgently required. The Pims are a small family of serine\\/threonine kinases with increased expression across the hematological malignancies. Pim-2 shows highest expression in MM and constitutes a promising therapeutic target. It is upregulated by the bone marrow microenvironment to mediate proliferation and promote MM survival. Pim-2 also has a key role in the bone destruction typically seen in MM. Additional putative roles of the Pim kinases in MM include trafficking of malignant cells, promoting oncogenic signaling in the hypoxic bone marrow microenvironment and mediating resistance to therapy. A number of Pim inhibitors are now under development with lead compounds entering the clinic. The ATP-competitive Pim inhibitor LGH447 has recently been reported to have single agent activity in MM. It is anticipated that Pim inhibition will be of clinical benefit in combination with standard treatments and\\/or with novel drugs targeting other survival pathways in MM.

  15. Evolutionary hypothesis of the Mevalonate Kinase Deficiency.

    Science.gov (United States)

    Vuch, J; Marcuzzi, A; Bianco, A M; Tommasini, A; Zanin, V; Crovella, S

    2013-01-01

    Mevalonate Kinase Deficiency (MKD) is an autosomal-recessively inherited disorder of cholesterol biosynthesis with higher prevalence in the Netherlands and other North European countries. MKD is due to mutations in the second enzyme of mevalonate pathway (mevalonate kinase, MK/MVK) which results in reduced enzymatic activity and in the consequent shortage of downstream compounds. In most severe cases the deregulation of mevalonate pathway is associated with a decrease in serum cholesterol. More than 100 pathological mutations have been described in the MVK gene so far, and a founder effect has been hypothesized as responsible for the diffusion of the most frequent disease-associated mutations. In the acute phase of disease, patients affected with MKD present low cholesterol levels comparable to their basal physiologic conditions, already characterized by lower cholesterol levels when compared to healthy individuals. Low cholesterol levels are widely known to correlate with the reduction of cardiovascular events. We hypothesize a selective advantage for heterozygote carriers of the most frequent MVK mutations in those countries where the diet is characterized by high consumption of saturated animal fats rich in cholesterol. This could explain the maintenance in North European population of the main mutations leading to MKD and the distribution world-wide of these mutations that followed the migrations of North European populations.

  16. Oral bacterial DNA findings in pericardial fluid

    Directory of Open Access Journals (Sweden)

    Anne-Mari Louhelainen

    2014-11-01

    Full Text Available Background: We recently reported that large amounts of oral bacterial DNA can be found in thrombus aspirates of myocardial infarction patients. Some case reports describe bacterial findings in pericardial fluid, mostly done with conventional culturing and a few with PCR; in purulent pericarditis, nevertheless, bacterial PCR has not been used as a diagnostic method before. Objective: To find out whether bacterial DNA can be measured in the pericardial fluid and if it correlates with pathologic–anatomic findings linked to cardiovascular diseases. Methods: Twenty-two pericardial aspirates were collected aseptically prior to forensic autopsy at Tampere University Hospital during 2009–2010. Of the autopsies, 10 (45.5% were free of coronary artery disease (CAD, 7 (31.8% had mild and 5 (22.7% had severe CAD. Bacterial DNA amounts were determined using real-time quantitative PCR with specific primers and probes for all bacterial strains associated with endodontic disease (Streptococcus mitis group, Streptococcus anginosus group, Staphylococcus aureus/Staphylococcus epidermidis, Prevotella intermedia, Parvimonas micra and periodontal disease (Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Treponema denticola, Fusobacterium nucleatus, and Dialister pneumosintes. Results: Of 22 cases, 14 (63.6% were positive for endodontic and 8 (36.4% for periodontal-disease-associated bacteria. Only one case was positive for bacterial culturing. There was a statistically significant association between the relative amount of bacterial DNA in the pericardial fluid and the severity of CAD (p=0.035. Conclusions: Oral bacterial DNA was detectable in pericardial fluid and an association between the severity of CAD and the total amount of bacterial DNA in pericardial fluid was found, suggesting that this kind of measurement might be useful for clinical purposes.

  17. 14-3-3 proteins interact with specific MEK kinases.

    Science.gov (United States)

    Fanger, G R; Widmann, C; Porter, A C; Sather, S; Johnson, G L; Vaillancourt, R R

    1998-02-06

    MEK (mitogen-activated protein kinase/extracellular signal-regulated kinase kinase) kinases (MEKKs) regulate c-Jun N-terminal kinase and extracellular response kinase pathways. The 14-3-3zeta and 14-3-3epsilon isoforms were isolated in a two-hybrid screen for proteins interacting with the N-terminal regulatory domain of MEKK3. 14-3-3 proteins bound both the N-terminal regulatory and C-terminal kinase domains of MEKK3. The binding affinity of 14-3-3 for the MEKK3 N terminus was 90 nM, demonstrating a high affinity interaction. 14-3-3 proteins also interacted with MEKK1 and MEKK2, but not MEKK4. Endogenous 14-3-3 protein and MEKK1 and MEKK2 were similarly distributed in the cell, consistent with their in vitro interactions. MEKK1 and 14-3-3 proteins colocalized using two-color digital confocal immunofluorescence. Binding of 14-3-3 proteins mapped to the N-terminal 393 residues of 196-kDa MEKK1. Unlike MEKK2 and MEKK3, the C-terminal kinase domain of MEKK1 demonstrated little or no ability to interact with 14-3-3 proteins. MEKK1, but not MEKK2, -3 or -4, is a caspase-3 substrate that when cleaved releases the kinase domain from the N-terminal regulatory domain. Functionally, caspase-3 cleavage of MEKK1 releases the kinase domain from the N-terminal 14-3-3-binding region, demonstrating that caspases can selectively alter protein kinase interactions with regulatory proteins. With regard to MEKK1, -2 and -3, 14-3-3 proteins do not appear to directly influence activity, but rather function as "scaffolds" for protein-protein interactions.

  18. Induction of bacterial lipoprotein tolerance is associated with suppression of toll-like receptor 2 expression.

    LENUS (Irish Health Repository)

    Wang, Jiang Huai

    2012-02-03

    Tolerance to bacterial cell wall components including lipopolysaccharide (LPS) may represent an essential regulatory mechanism during bacterial infection. Two members of the Toll-like receptor (TLR) family, TLR2 and TLR4, recognize the specific pattern of bacterial cell wall components. TLR4 has been found to be responsible for LPS tolerance. However, the role of TLR2 in bacterial lipoprotein (BLP) tolerance and LPS tolerance is unclear. Pretreatment of human THP-1 monocytic cells with a synthetic bacterial lipopeptide induced tolerance to a second BLP challenge with diminished tumor necrosis factor-alpha and interleukin-6 production, termed BLP tolerance. Furthermore, BLP-tolerized THP-1 cells no longer responded to LPS stimulation, indicating a cross-tolerance to LPS. Induction of BLP tolerance was CD14-independent, as THP-1 cells that lack membrane-bound CD14 developed tolerance both in serum-free conditions and in the presence of a specific CD14 blocking monoclonal antibody (MEM-18). Pre-exposure of THP-1 cells to BLP suppressed mitogen-activated protein kinase phosphorylation and nuclear factor-kappaB activation in response to subsequent BLP and LPS stimulation, which is comparable with that found in LPS-tolerized cells, indicating that BLP tolerance and LPS tolerance may share similar intracellular pathways. However, BLP strongly enhanced TLR2 expression in non-tolerized THP-1 cells, whereas LPS stimulation had no effect. Furthermore, a specific TLR2 blocking monoclonal antibody (2392) attenuated BLP-induced, but not LPS-induced, tumor necrosis factor-alpha and interleukin-6 production, indicating BLP rather than LPS as a ligand for TLR2 engagement and activation. More importantly, pretreatment of THP-1 cells with BLP strongly inhibited TLR2 activation in response to subsequent BLP stimulation. In contrast, LPS tolerance did not prevent BLP-induced TLR2 overexpression. These results demonstrate that BLP tolerance develops through down-regulation of TLR2

  19. Genome-wide identification and analysis of expression profiles of maize mitogen-activated protein kinase kinase kinase.

    Science.gov (United States)

    Kong, Xiangpei; Lv, Wei; Zhang, Dan; Jiang, Shanshan; Zhang, Shizhong; Li, Dequan

    2013-01-01

    Mitogen-activated protein kinase (MAPK) cascades are highly conserved signal transduction model in animals, yeast and plants. Plant MAPK cascades have been implicated in development and stress responses. Although MAPKKKs have been investigated in several plant species including Arabidopsis and rice, no systematic analysis has been conducted in maize. In this study, we performed a bioinformatics analysis of the entire maize genome and identified 74 MAPKKK genes. Phylogenetic analyses of MAPKKKs from maize, rice and Arabidopsis have classified them into three subgroups, which included Raf, ZIK and MEKK. Evolutionary relationships within subfamilies were also supported by exon-intron organizations and the conserved protein motifs. Further expression analysis of the MAPKKKs in microarray databases revealed that MAPKKKs were involved in important signaling pathways in maize different organs and developmental stages. Our genomics analysis of maize MAPKKK genes provides important information for evolutionary and functional characterization of this family in maize.

  20. Genome-wide identification and analysis of expression profiles of maize mitogen-activated protein kinase kinase kinase.

    Directory of Open Access Journals (Sweden)

    Xiangpei Kong

    Full Text Available Mitogen-activated protein kinase (MAPK cascades are highly conserved signal transduction model in animals, yeast and plants. Plant MAPK cascades have been implicated in development and stress responses. Although MAPKKKs have been investigated in several plant species including Arabidopsis and rice, no systematic analysis has been conducted in maize. In this study, we performed a bioinformatics analysis of the entire maize genome and identified 74 MAPKKK genes. Phylogenetic analyses of MAPKKKs from maize, rice and Arabidopsis have classified them into three subgroups, which included Raf, ZIK and MEKK. Evolutionary relationships within subfamilies were also supported by exon-intron organizations and the conserved protein motifs. Further expression analysis of the MAPKKKs in microarray databases revealed that MAPKKKs were involved in important signaling pathways in maize different organs and developmental stages. Our genomics analysis of maize MAPKKK genes provides important information for evolutionary and functional characterization of this family in maize.

  1. Direct regulation of the NADPH oxidase RBOHD by the PRR-associated kinase BIK1 during plant immunity.

    Science.gov (United States)

    Kadota, Yasuhiro; Sklenar, Jan; Derbyshire, Paul; Stransfeld, Lena; Asai, Shuta; Ntoukakis, Vardis; Jones, Jonathan Dg; Shirasu, Ken; Menke, Frank; Jones, Alexandra; Zipfel, Cyril

    2014-04-10

    The rapid production of reactive oxygen species (ROS) burst is a conserved signaling output in immunity across kingdoms. In plants, perception of pathogen-associated molecular patterns (PAMPs) by surface-localized pattern recognition receptors (PRRs) activates the NADPH oxidase RBOHD by hitherto unknown mechanisms. Here, we show that RBOHD exists in complex with the receptor kinases EFR and FLS2, which are the PRRs for bacterial EF-Tu and flagellin, respectively. The plasma-membrane-associated kinase BIK1, which is a direct substrate of the PRR complex, directly interacts with and phosphorylates RBOHD upon PAMP perception. BIK1 phosphorylates different residues than calcium-dependent protein kinases, and both PAMP-induced BIK1 activation and BIK1-mediated phosphorylation of RBOHD are calcium independent. Importantly, phosphorylation of these residues is critical for the PAMP-induced ROS burst and antibacterial immunity. Our study reveals a rapid regulatory mechanism of a plant RBOH, which occurs in parallel with and is essential for its paradigmatic calcium-based regulation.

  2. Molecular mechanism and evolution of guanylate kinase regulation by (p)ppGpp.

    Science.gov (United States)

    Liu, Kuanqing; Myers, Angela R; Pisithkul, Tippapha; Claas, Kathy R; Satyshur, Kenneth A; Amador-Noguez, Daniel; Keck, James L; Wang, Jue D

    2015-02-19

    The nucleotide (p)ppGpp mediates bacterial stress responses, but its targets and underlying mechanisms of action vary among bacterial species and remain incompletely understood. Here, we characterize the molecular interaction between (p)ppGpp and guanylate kinase (GMK), revealing the importance of this interaction in adaptation to starvation. Combining structural and kinetic analyses, we show that (p)ppGpp binds the GMK active site and competitively inhibits the enzyme. The (p)ppGpp-GMK interaction prevents the conversion of GMP to GDP, resulting in GMP accumulation upon amino acid downshift. Abolishing this interaction leads to excess (p)ppGpp and defective adaptation to amino acid starvation. A survey of GMKs from phylogenetically diverse bacteria shows that the (p)ppGpp-GMK interaction is conserved in members of Firmicutes, Actinobacteria, and Deinococcus-Thermus, but not in Proteobacteria, where (p)ppGpp regulates RNA polymerase (RNAP). We propose that GMK is an ancestral (p)ppGpp target and RNAP evolved more recently as a direct target in Proteobacteria.

  3. Rho kinase acts as a downstream molecule to participate in protein kinase Cε regulation of vascular reactivity after hemorrhagic shock in rats.

    Science.gov (United States)

    Li, Tao; Zhu, Yu; Zang, Jia-tao; Peng, Xiao-yong; Lan, Dan; Yang, Guang-ming; Xu, Jing; Liu, Liang-ming

    2014-09-01

    Our previous study demonstrated that Rho kinase and protein kinase C (PKC) played important parts in the regulation of vascular reactivity after shock. Using superior mesenteric arteries (SMAs) from hemorrhagic shock rats and hypoxia-treated vascular smooth muscle cells (VSMCs), relationship of PKCε regulation of vascular reactivity to Rho kinase, as well as the signal transduction after shock, was investigated. The results showed that inhibition of Rho kinase with the Rho kinase-specific inhibitor Y-27632 antagonized the PKCε-specific agonist carbachol and highly expressed PKCε-induced increase of vascular reactivity in SMAs and VSMCs, whereas inhibition of PKCε with its specific inhibitory peptide did not antagonize the Rho kinase agonist (U-46619)-induced increase of vascular reactivity in SMAs and VSMCs. Activation of PKCε or highly expressed PKCε upregulated the activity of Rho kinase and the phosphorylation of PKC-dependent phosphatase inhibitor 17 (CPI-17), zipper interacting protein kinase (ZIPK), and integrin-linked kinase (ILK), whereas activation of Rho kinase increased only CPI-17 phosphorylation. The specific neutralization antibodies of ZIPK and ILK antagonized PKCε-induced increases in the activity of Rho kinase, but CPI-17 neutralization antibody did not antagonize this effect. These results suggested that Rho kinase takes part in the regulation of PKCε on vascular reactivity after shock. Rho kinase is downstream of PKCε. Protein kinase Cε activates Rho kinase via ZIPK and ILK; CPI-17 is downstream of Rho kinase.

  4. BIOSYNTHESIS OF BACTERIAL CELLULOSE BY МEDUSOMYCES GISEVII

    OpenAIRE

    E. K. Gladysheva; E. A. Skiba

    2015-01-01

    Summary: Bacterial cellulose is an organic material that is synthesized by microorganisms extracellularly. Bacterial cellulose can be used in various industries. Especially, bacterial cellulose has found its application basically in medicine. The production of bacterial cellulose is a complicated and long process. The principal criterion for the process to be successful is bacterial cellulose to be obtained in a higher yield. Russia is lacking an operating facility to produce bacterial cellul...

  5. Purine inhibitors of protein kinases, G proteins and polymerases

    Energy Technology Data Exchange (ETDEWEB)

    Gray, Nathanael S. (Berkeley, CA); Schultz, Peter (Oakland, CA); Kim, Sung-Hou (Moraga, CA); Meijer, Laurent (Roscoff, FR)

    2001-07-03

    The present invention relates to purine analogs that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such purine analogs to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.

  6. Roles of eEF-2 kinase in cancer

    Institute of Scientific and Technical Information of China (English)

    LIU Xiao-yuan; ZHANG Li; ZHANG Yi; YANG Jin-ming

    2012-01-01

    Objective To provide a summary of the relationship between the eEF-2/eEF-2 kinase pathway and each phase of malignant neoplasms.The specific importance of this relationship in understanding and treating cancer was also explored.Data sources The data used in this review were mainly obtained from the articles listed in HighWire and PubMed in English.The search terms were "eEF-2 kinase","oncogenesis",and "tumor progression".Study selection This review relates the observation that the overexpression of eEF-2 kinase is seen in cancer,and highlights that it has emerged as promoting the development of many malignant phenotypes when unregulated.This includes increasing the replicative potential of cells,angiogenesis,invasion and metastasis,and evasion of apoptosis.Results eEF-2 kinase is a structurally and functionally unique protein kinase.The increased activity of this protein in cancer cells is a protective mechanism to allow tumor growth and evolution,and resist cell death through the eEF-2/eEF-2 kinase pathway,but it also makes a potential target for therapy.Conclusion eEF-2 kinase fills critical niches in the life of a cancer cell and the eEF-2/eEF-2 kinase pathway is a key biochemical sensor.

  7. Tyrosine kinase blockers: new hope for successful cancer therapy.

    Science.gov (United States)

    Pytel, Dariusz; Sliwinski, Tomasz; Poplawski, Tomasz; Ferriola, Deborah; Majsterek, Ireneusz

    2009-01-01

    Tyrosine kinases (TKs) are attractive targets for cancer therapy, as quite often their abnormal signaling has been linked with tumor development and growth. Constitutive activated TKs stimulate multiple signaling pathways responsible for DNA repair, apoptosis, and cell proliferation. During the last few years, thorough analysis of the mechanism underlying tyrosine kinase's activity led to novel cancer therapy using TKs blockers. These drugs are remarkably effective in the treatment of various human tumors including head and neck, gastric, prostate and breast cancer and leukemias. The most successful example of kinase blockers is Imatinib (Imatinib mesylate, Gleevec, STI571), the inhibitor of Bcr/Abl oncoprotein, which has become a first-line therapy for chronic myelogenous leukemia. The introduction of STI571 for the treatment of leukemia in clinical oncology has had a dramatic impact on how this disease is currently managed. Others kinase inhibitors used recently in cancer therapy include Dasatinib (BMS-354825) specific for ABL non-receptor cytoplasmic kinase, Gefitinib (Iressa), Erlotinib (OSI-774, Tarceva) and Sunitinib (SU 11248, Sutent) specific for VEGF receptor kinase, AMN107 (Nilotinib) and INNO-406 (NS-187) specific for c-KIT kinase. The following TK blockers for treatment of various human tumors are in clinical development: Lapatinib (Lapatinib ditosylate, Tykerb, GW-572016), Canertinib (CI-1033), Zactima (ZD6474), Vatalanib (PTK787/ZK 222584), Sorafenib (Bay 43-9006, Nexavar), and Leflunomide (SU101, Arava). Herein, we discuss the chemistry, biological activity and clinical potential of new drugs with tyrosine kinase blockers for cancer treatment.

  8. Auto-phosphorylation Represses Protein Kinase R Activity

    Science.gov (United States)

    Wang, Die; de Weerd, Nicole A.; Willard, Belinda; Polekhina, Galina; Williams, Bryan R. G.; Sadler, Anthony J.

    2017-01-01

    The central role of protein kinases in controlling disease processes has spurred efforts to develop pharmaceutical regulators of their activity. A rational strategy to achieve this end is to determine intrinsic auto-regulatory processes, then selectively target these different states of kinases to repress their activation. Here we investigate auto-regulation of the innate immune effector protein kinase R, which phosphorylates the eukaryotic initiation factor 2α to inhibit global protein translation. We demonstrate that protein kinase R activity is controlled by auto-inhibition via an intra-molecular interaction. Part of this mechanism of control had previously been reported, but was then controverted. We account for the discrepancy and extend our understanding of the auto-inhibitory mechanism by identifying that auto-inhibition is paradoxically instigated by incipient auto-phosphorylation. Phosphor-residues at the amino-terminus instigate an intra-molecular interaction that enlists both of the N-terminal RNA-binding motifs of the protein with separate surfaces of the C-terminal kinase domain, to co-operatively inhibit kinase activation. These findings identify an innovative mechanism to control kinase activity, providing insight for strategies to better regulate kinase activity. PMID:28281686

  9. BACTERIAL FLORA IN DIABETIC ULCER

    Directory of Open Access Journals (Sweden)

    Anitha Lavanya

    2015-04-01

    Full Text Available BACKGROUND : Diabetic foot infections are one of the most feared complications of diabetes. This study was undertaken to determine the common etiological agents of diabetic foot infections and their in vitro antibiotic susceptibility. METHODS : A prospective study was p erformed over a period of two years in a tertiary care hospital. The aerobic and anaerobic bacterial agents were isolated and their antibiotic susceptibility pattern was determined . RESULTS : One hundred patients with Diabetic ulcer were studied, of which 6 5 were males and 35 were females. Majority of patients were in the age group of 51 to 60 years (37% and polymicrobial etiology was 64 % and monomicrobial etiology was 36%. A total of 187 organisms were isolated of which 165 were aerobic and 22 were anaero bic. Most frequently isolated aerobic organisms were Pseudomonas Sp., Klebsiella Sp., E coli Sp., and Staphylococcus aureus. The common anaerobic organisms isolated were Peptostreptococcus Sp. And Bacterioids Sp. CONCLUSION : High prevalence of multi - drug r esistant pathogens was observed. Amikacin, Imipenem were active against gram - negative bacilli, while vancomycin was found to be active against gram - positive bacteria.

  10. Initiation of bacterial spore germination.

    Science.gov (United States)

    Vary, J C; Halvorson, H O

    1968-04-01

    To investigate the problem of initiation in bacterial spore germination, we isolated, from extracts of dormant spores of Bacillus cereus strain T and B. licheniformis, a protein that initiated spore germination when added to a suspension of heat-activated spores. The optimal conditions for initiatory activity of this protein (the initiator) were 30 C in 0.01 to 0.04 m NaCl and 0.01 m tris(hydroxymethyl)aminomethane (pH 8.5). The initiator was inhibited by phosphate but required two co-factors, l-alanine (1/7 of K(m) for l-alanine-inhibited germination) and nicotinamide adenine dinucleotide (1.25 x 10(-4)m). In the crude extract, the initiator activity was increased 3.5-fold by heating the extract at 65 C for 10 min, but the partially purified initiator preparation was completely heat-sensitive (65 C for 5 min). Heat stability could be conferred on the purified initiator by adding 10(-3)m dipicolinic acid. A fractionation of this protein that excluded l-alanine dehydrogenase and adenosine deaminase from the initiator activity was developed. The molecular weight of the initiator was estimated as 7 x 10(4). The kinetics of germination in the presence of initiator were examined at various concentrations of l-alanine and nicotinamide adenine dinucleotide.

  11. Phenotypic plasticity in bacterial plasmids.

    Science.gov (United States)

    Turner, Paul E

    2004-01-01

    Plasmid pB15 was previously shown to evolve increased horizontal (infectious) transfer at the expense of reduced vertical (intergenerational) transfer and vice versa, a key trade-off assumed in theories of parasite virulence. Whereas the models predict that susceptible host abundance should determine which mode of transfer is selectively favored, host density failed to mediate the trade-off in pB15. One possibility is that the plasmid's transfer deviates from the assumption that horizontal spread (conjugation) occurs in direct proportion to cell density. I tested this hypothesis using Escherichia coli/pB15 associations in laboratory serial culture. Contrary to most models of plasmid transfer kinetics, my data show that pB15 invades static (nonshaking) bacterial cultures only at intermediate densities. The results can be explained by phenotypic plasticity in traits governing plasmid transfer. As cells become more numerous, the plasmid's conjugative transfer unexpectedly declines, while the trade-off between transmission routes causes vertical transfer to increase. Thus, at intermediate densities the plasmid's horizontal transfer can offset selection against plasmid-bearing cells, but at high densities pB15 conjugates so poorly that it cannot invade. I discuss adaptive vs. nonadaptive causes for the phenotypic plasticity, as well as potential mechanisms that may lead to complex transfer dynamics of plasmids in liquid environments. PMID:15166133

  12. Acute bacterial sinusitis in children.

    Science.gov (United States)

    DeMuri, Gregory; Wald, Ellen R

    2013-10-01

    On the basis of strong research evidence, the pathogenesis of sinusitis involves 3 key factors: sinusostia obstruction, ciliary dysfunction, and thickening of sinus secretions. On the basis of studies of the microbiology of otitis media, H influenzae is playing an increasingly important role in the etiology of sinusitis, exceeding that of S pneumoniae in some areas, and b-lactamase production by H influenzae is increasing in respiratory isolates in the United States. On the basis of some research evidence and consensus,the presentation of acute bacterial sinusitis conforms to 1 of 3 predicable patterns; persistent, severe, and worsening symptoms. On the basis of some research evidence and consensus,the diagnosis of sinusitis should be made by applying strict clinical criteria. This approach will select children with upper respiratory infection symptoms who are most likely to benefit from an antibiotic. On the basis of some research evidence and consensus,imaging is not indicated routinely in the diagnosis of sinusitis. Computed tomography or magnetic resonance imaging provides useful information when complications of sinusitis are suspected. On the basis of some research evidence and consensus,amoxicillin-clavulanate should be considered asa first-line agent for the treatment of sinusitis.

  13. Marine mesocosm bacterial colonisation of volcanic ash

    Science.gov (United States)

    Witt, Verena; Cimarelli, Corrado; Ayris, Paul; Kueppers, Ulrich; Erpenbeck, Dirk; Dingwell, Donald; Woerheide, Gert

    2015-04-01

    Volcanic eruptions regularly eject large quantities of ash particles into the atmosphere, which can be deposited via fallout into oceanic environments. Such fallout has the potential to alter pH, light and nutrient availability at local scales. Shallow-water coral reef ecosystems - "rainforests of the sea" - are highly sensitive to disturbances, such as ocean acidification, sedimentation and eutrophication. Therefore, wind-delivered volcanic ash may lead to burial and mortality of such reefs. Coral reef ecosystem resilience may depend on pioneer bacterial colonisation of the ash layer, supporting subsequent establishment of the micro- and ultimately the macro-community. However, which bacteria are involved in pioneer colonisation remain unknown. We hypothesize that physico-chemical properties (i.e., morphology, mineralogy) of the ash may dictate bacterial colonisation. The effect of substrate properties on bacterial colonisation was tested by exposing five substrates: i) quartz sand ii) crystalline ash (Sakurajima, Japan) iii) volcanic glass iv) carbonate reef sand and v) calcite sand of similar grain size, in controlled marine coral reef aquaria under low light conditions for six months. Bacterial communities were screened every month by Automated Ribosomal Intergenic Spacer Analysis of the 16S-23S rRNA Internal Transcribed Spacer region. Multivariate statistics revealed discrete groupings of bacterial communities on substrates of volcanic origin (ash and glass) and reef origin (three sands). Analysis of Similarity supported significantly different communities associated with all substrates (p=0.0001), only quartz did not differ from both carbonate and calcite sands. The ash substrate exhibited the most diverse bacterial community with the most substrate-specific bacterial operational taxonomic units. Our findings suggest that bacterial diversity and community composition during colonisation of volcanic ash in a coral reef-like environment is controlled by the

  14. Targeting the HER-kinase axis in cancer.

    Science.gov (United States)

    Gross, Mitchell E; Shazer, Ronald L; Agus, David B

    2004-02-01

    The human epidermal growth factor receptor (HER) family of receptor tyrosine kinases controls critical pathways involved in the differentiation, growth, division, and motility of normal epithelial cells. Most human solid tumors are of epithelial origin. The process of malignant transformation and progression in many cancers may depend on activation of ligands and receptors that function as part of the HER-kinase pathway. This signaling axis has earned increased attention because of the development of antibodies and small-molecule tyrosine kinase inhibitors that specifically target components of the HER-kinase axis for cancer therapy. This review focuses on the basic biology underlying HER-kinase pathway activation and the current state of development for agents that target this axis. In particular, the importance of pan-HER inhibitors is discussed.

  15. Rho-kinase inhibition in the therapy of cardiovascular disease.

    Science.gov (United States)

    Lai, Andrew; Frishman, William H

    2005-01-01

    Rho is a GTPase known to be a major mediator in the formation of stress fibers and focal adhesions, cell morphology, and smooth muscle contraction. Its role in smooth muscle contraction has led to exploration into the connection between Rho-mediated kinase activity and cardiovascular disease. The role of Rho-kinase in calcium sensitization for vascular smooth muscle contraction has recently been characterized. Inappropriate coronary artery vasoconstriction resulting from increased Rho-kinase in the vascular system is likely involved in the pathogenesis of exercise-induced myocardial ischemia, spontaneous coronary artery spasm, and hypertension. In clinical trials, Rho-kinase inhibitors such as fasudil and Y-27632 have demonstrated antiischemic, antivasospastic, and antihypertensive effects. These compounds have also exhibited the ability to blunt progression of cardiomyocyte hypertrophy and cardiac remodeling in heart failure. As such, Rho-kinase inhibition represents a potential novel therapeutic approach in cardiovascular disease.

  16. Structure of the kinase domain of Gilgamesh from Drosophila melanogaster.

    Science.gov (United States)

    Han, Ni; Chen, CuiCui; Shi, Zhubing; Cheng, Dianlin

    2014-04-01

    The CK1 family kinases regulate multiple cellular aspects and play important roles in Wnt/Wingless and Hedgehog signalling. The kinase domain of Drosophila Gilgamesh isoform I (Gilgamesh-I), a homologue of human CK1-γ, was purified and crystallized. Crystals of methylated Gilgamesh-I kinase domain with a D210A mutation diffracted to 2.85 Å resolution and belonged to space group P43212, with unit-cell parameters a = b = 52.025, c = 291.727 Å. The structure of Gilgamesh-I kinase domain, which was determined by molecular replacement, has conserved catalytic elements and an active conformation. Structural comparison indicates that an extended loop between the α1 helix and the β4 strand exists in the Gilgamesh-I kinase domain. This extended loop may regulate the activity and function of Gilgamesh-I.

  17. [The role of Gilgamesh protein kinase in Drosophila melanogaster spermatogenesis].

    Science.gov (United States)

    Nerusheva, O O; Dorogova, N V; Gubanova, N V; Omel'ianchuk, L V

    2008-09-01

    The cellular function of the gilgamesh mutation (89B9-12) of casein kinase gene in Drosophila spermatogenesis was studied. It was demonstrated that the sterility resulting from this mutation is connected with the abnormalities in spermatid individualization. A phylogenetic study of the protein sequences of casein kinases 1 from various organisms was conducted. The Gilgamesh protein was shown to be phylogenetically closer to the cytoplasmic casein kinase family, represented by the YCK3, YCK2, and YCK1 proteins of Saccharomyces cerevisiae and animal gamma-casein kinases. It is known that these yeast casein kinases are involved in vesicular trafficking, which, in turn, is related in its genetic control to the cell membrane remodeling during spermatid individualization. Thus, the data of phylogenetic analysis fit well the results obtained by studying the mutation phenotype.

  18. Bacterial binding to extracellular proteins - in vitro adhesion

    DEFF Research Database (Denmark)

    Schou, C.; Fiehn, N.-E.

    1999-01-01

    Viridans streptococci, bacterial adherence, extracellular matrix proteins, surface receptors, endocarditis......Viridans streptococci, bacterial adherence, extracellular matrix proteins, surface receptors, endocarditis...

  19. Tobacco use increases susceptibility to bacterial infection

    Directory of Open Access Journals (Sweden)

    Demuth Donald R

    2008-12-01

    Full Text Available Abstract Active smokers and those exposed to secondhand smoke are at increased risk of bacterial infection. Tobacco smoke exposure increases susceptibility to respiratory tract infections, including tuberculosis, pneumonia and Legionnaires disease; bacterial vaginosis and sexually transmitted diseases, such as chlamydia and gonorrhoea; Helicobacter pylori infection; periodontitis; meningitis; otitis media; and post-surgical and nosocomial infections. Tobacco smoke compromises the anti-bacterial function of leukocytes, including neutrophils, monocytes, T cells and B cells, providing a mechanistic explanation for increased infection risk. Further epidemiological, clinical and mechanistic research into this important area is warranted.

  20. Spontaneous Bacterial Peritonitis in Subclinical Hypothyroidism

    Directory of Open Access Journals (Sweden)

    Dalip Gupta

    2013-11-01

    Full Text Available Hypothyroidism is an uncommon cause of ascites. Here we describe a case of a 75 year-old female patient with spontaneous bacterial peritonitis and subclinical hypothyroidism that resolved with thyroid replacement and antibiotic therapy respectively. Ascitic fluid analysis revealed a gram-positive bacterium on gram staining. A review of the literature revealed just one other reported case of myxoedema ascites with concomitant spontaneous bacterial peritonitis and no case has till been reported of spontaneous bacterial peritonitis in subclinical hypothyroidism.

  1. Biochemistry of Bacterial Multidrug Efflux Pumps

    Directory of Open Access Journals (Sweden)

    Sanath Kumar

    2012-04-01

    Full Text Available Bacterial pathogens that are multi-drug resistant compromise the effectiveness of treatment when they are the causative agents of infectious disease. These multi-drug resistance mechanisms allow bacteria to survive in the presence of clinically useful antimicrobial agents, thus reducing the efficacy of chemotherapy towards infectious disease. Importantly, active multi-drug efflux is a major mechanism for bacterial pathogen drug resistance. Therefore, because of their overwhelming presence in bacterial pathogens, these active multi-drug efflux mechanisms remain a major area of intense study, so that ultimately measures may be discovered to inhibit these active multi-drug efflux pumps.

  2. Bacterial gasotransmitters: an innate defense against antibiotics.

    Science.gov (United States)

    Luhachack, Lyly; Nudler, Evgeny

    2014-10-01

    In recent decades, there has been growing interest in the field of gasotransmitters, endogenous gaseous signaling molecules (NO, H2S, and CO), as regulators of a multitude of biochemical pathways and physiological processes. Most of the concerted effort has been on eukaryotic gasotransmitters until the subsequent discovery of bacterial counterparts. While the fundamental aspects of bacterial gasotransmitters remain undefined and necessitate further research, we will discuss a known specific role they play in defense against antibiotics. Considering the current dilemma of multidrug-resistant bacteria we consider it particularly prudent to exploring novel targets and approaches, of which the bacterial gasotransmitters, nitric oxide and hydrogen sulfide represent.

  3. X-ray structural studies of the entire extracellular region of the serine/threonine kinase PrkC from Staphylococcus aureus.

    Science.gov (United States)

    Ruggiero, Alessia; Squeglia, Flavia; Marasco, Daniela; Marchetti, Roberta; Molinaro, Antonio; Berisio, Rita

    2011-04-01

    Bacterial serine/threonine kinases modulate a wide number of cellular processes. The serine/threonine kinase PrkC from the human pathogen Staphylococcus aureus was also shown to induce germination of Bacillus subtilis spores, in response to cell wall muropeptides. The presence of muropeptides in the bacterial extracellular milieu is a strong signal that the growing conditions are promising. In the present paper, we report the X-ray structure of the entire extracellular region of PrkC from S. aureus. This structure reveals that the extracellular region of PrkC, EC-PrkC, is a linear modular structure composed of three PASTA (penicillin binding-associated and serine/threonine kinase-associated) domains and an unpredicted C-terminal domain, which presents the typical features of adhesive proteins. Using several solution techniques, we also found that EC-PrkC shows no tendency to dimerize even in the presence of high concentrations of muropeptides. X-ray structural results obtained in the present study provide molecular clues into the mechanism of muropeptide-induced PrkC activation.

  4. Complexity of Receptor Tyrosine Kinase Signal Processing

    Science.gov (United States)

    Volinsky, Natalia; Kholodenko, Boris N.

    2013-01-01

    Our knowledge of molecular mechanisms of receptor tyrosine kinase (RTK) signaling advances with ever-increasing pace. Yet our understanding of how the spatiotemporal dynamics of RTK signaling control specific cellular outcomes has lagged behind. Systems-centered experimental and computational approaches can help reveal how overlapping networks of signal transducers downstream of RTKs orchestrate specific cell-fate decisions. We discuss how RTK network regulatory structures, which involve the immediate posttranslational and delayed transcriptional controls by multiple feed forward and feedback loops together with pathway cross talk, adapt cells to the combinatorial variety of external cues and conditions. This intricate network circuitry endows cells with emerging capabilities for RTK signal processing and decoding. We illustrate how mathematical modeling facilitates our understanding of RTK network behaviors by unraveling specific systems properties, including bistability, oscillations, excitable responses, and generation of intricate landscapes of signaling activities. PMID:23906711

  5. The versatile functions of ATM kinase

    Directory of Open Access Journals (Sweden)

    Rebecca J Boohaker

    2014-02-01

    Full Text Available Ataxia-telangiectasia mutated (ATM kinase, the mutation of which causes the autosomal recessive disease ataxia-telangiectasia, plays an essential role in the maintenance of genome stability. Extensive studies have revealed that activated ATM signals to a massive list of proteins to facilitate cell cycle checkpoints, DNA repair, and many other aspects of physiological responses in the event of DNA double-strand breaks. ATM also plays functional roles beyond the well-characterized DNA damage response (DDR. In this review article, we discuss the recent findings on the molecular mechanisms of ATM in DDR, the mitotic spindle checkpoint, as well as hyperactive ATM signaling in cancer invasion and metastasis.

  6. Animal models of antimuscle specific kinase myasthenia

    Science.gov (United States)

    Richman, David P.; Nishi, Kayoko; Ferns, Michael J.; Schnier, Joachim; Pytel, Peter; Maselli, Ricardo A.; Agius, Mark A.

    2014-01-01

    Antimuscle specific kinase (anti-MuSK) myasthenia (AMM) differs from antiacetylcholine receptor myasthenia gravis in exhibiting more focal muscle involvement (neck, shoulder, facial, and bulbar muscles) with wasting of the involved, primarily axial, muscles. AMM is not associated with thymic hyperplasia and responds poorly to anticholinesterase treatment. Animal models of AMM have been induced in rabbits, mice, and rats by immunization with purified xenogeneic MuSK ectodomain, and by passive transfer of large quantities of purified serum IgG from AMM patients into mice. The models have confirmed the pathogenic role of the MuSK antibodies in AMM and have demonstrated the involvement of both the presynaptic and postsynaptic components of the neuromuscular junction. The observations in this human disease and its animal models demonstrate the role of MuSK not only in the formation of this synapse but also in its maintenance. PMID:23252909

  7. Inherent formulation issues of kinase inhibitors.

    Science.gov (United States)

    Herbrink, M; Schellens, J H M; Beijnen, J H; Nuijen, B

    2016-10-10

    The small molecular Kinase Inhibitor (smKI) drug class is very promising and rapidly expanding. All of these drugs are administered orally. The clear relationship between structure and function has led to drugs with a general low intrinsic solubility. The majority of the commercial pharmaceutical formulations of the smKIs are physical mixtures that are limited by the low drug solubility of a salt form. This class of drugs is therefore characterized by an impaired and variable bioavailability rendering them costly and their therapies suboptimal. New formulations are sparingly being reported in literature and patents. The presented data suggests that continued research into formulation design can help to develop more efficient and cost-effective smKI formulation. Moreover, it may also be of help in the future design of the formulations of new smKIs.

  8. Pachastrissamine (jaspine B) and its stereoisomers inhibit sphingosine kinases and atypical protein kinase C.

    Science.gov (United States)

    Yoshimitsu, Yuji; Oishi, Shinya; Miyagaki, Jun; Inuki, Shinsuke; Ohno, Hiroaki; Fujii, Nobutaka

    2011-09-15

    Sphingosine kinases (SphKs) are oncogenic enzymes that regulate the critical balance between ceramide and sphingosine-1-phosphate. Much effort has been dedicated to develop inhibitors against these enzymes. Naturally occurring pachastrissamine (jaspine B) and all its stereoisomers were prepared and evaluated for their inhibitory effects against SphKs. All eight stereoisomers exhibited moderate to potent inhibitory activity against SphK1 and SphK2. Inhibitory effects were profiled against protein kinase C (PKC) isoforms by in vitro experiments. Atypical PKCs (PKCζ and PKCι) were inhibited by several pachastrissamine stereoisomers. The improved activity over N,N-dimethylsphingosine suggests that the cyclic scaffold in pachastrissamines facilitates potential favorable interactions with SphKs and PKCs.

  9. IκB Kinase ε Is an NFATc1 Kinase that Inhibits T Cell Immune Response

    Directory of Open Access Journals (Sweden)

    Junjie Zhang

    2016-07-01

    Full Text Available Activation of nuclear factor of activated T cells (NFAT is crucial for immune responses. IKKε is an IκB kinase (IKK-related kinase, and the function of IKKε remains obscure in T cells, despite its abundant expression. We report that IKKε inhibits NFAT activation and T cell responses by promoting NFATc1 phosphorylation. During T cell activation, IKKε was transiently activated to phosphorylate NFATc1. Loss of IKKε elevated T cell antitumor and antiviral immunity and, therefore, reduced tumor development and persistent viral infection. IKKε was activated in CD8+ T cells of mice bearing melanoma or persistently infected with a model herpesvirus. These results collectively show that IKKε promotes NFATc1 phosphorylation and inhibits T cell responses, identifying IKKε as a crucial negative regulator of T cell activation and a potential target for immunotherapy.

  10. Modulation of the MAP kinase signaling cascade by Raf kinase inhibitory protein

    Institute of Scientific and Technical Information of China (English)

    Nicholas TRAKUL; Marsha R. ROSNER

    2005-01-01

    Proteins like Raf kinase inhibitory protein (RKIP) that serve as modulators of signaling pathways, either by promoting or inhibiting the formation of productive signaling complexes through protein-protein interactions, have been demonstrated to play an increasingly important role in a number of cell types and organisms. These proteins have been implicated in development as well as the progression of cancer. RKIP is a particularly interesting regulator, as it is a highly conserved, ubiquitously expressed protein that has been shown to play a role in growth and differentiation in a number of organisms and can regulate multiple signaling pathways. RKIP is also the first MAP kinase signaling modulator to be identified as playing a role in cancer metastasis, and identification of the mechanism by which it regulates Raf-1 activation provides new targets for therapeutic intervention.

  11. Structural studies of Schistosoma mansoni adenylate kinases

    Energy Technology Data Exchange (ETDEWEB)

    Marques, I.A. [Universidade Federal de Goias (UFG), Goiania, GO (Brazil); Pereira, H.M.; Garrat, R.C. [Universidade de Sao Paulo (USP-SC), Sao Carlos, SP (Brazil)

    2012-07-01

    Full text: Parasitic diseases are a major cause of death in developing countries, however receive little or no attention from pharmaceutical companies for the development of novel therapies. In this respect, the Center for Structural Molecular Biology (CBME) of the Institute of Physics of Sao Carlos (IFSC / USP) has developed expertise in all stages of the development of active compounds against target enzymes from parasitic diseases. The present work focuses on the adenylate kinase enzymes (ADK's) from Schistosoma mansoni. These enzymes are widely distributed and catalyze the reaction of phosphoryl exchange between nucleotides in the reaction 2ADP to ATP + AMP, which is critical for the cells life cycle. Due to the particular property of the reaction catalyzed, the ADK's are recognized as reporters of the cells energetic state, translating small changes in the balance between ATP and ADP into a large change in concentration of AMP. The genome of S. mansoni was recently sequenced by the Sanger Center in England. On performing searches for genes encoding adenylate kinases we found two such genes. The corresponding gene products were named ADK1 (197 residues) and ADK2 (239 residues), and the two sequences share only 28 percent identity. Both have been cloned into the pET-28a(+)vector, expressed in E. coli and purified. Preliminary tests of activity have been performed only for ADK1 showing it to be catalytically active. Crystallization trials were performed for both proteins and thus far, crystals of ADK1 have been obtained which diffract to 2.05 at the LNLS beamline MX2 and the structure solved by molecular replacement. Understanding, at the atomic level, the function of these enzymes may help in the development of specific inhibitors and may provide tools for developing diagnostic tests for schistosomiasis. (author)

  12. Identification of pyruvate kinase in methicillin-resistant Staphylococcus aureus as a novel antimicrobial drug target.

    Science.gov (United States)

    Zoraghi, Roya; See, Raymond H; Axerio-Cilies, Peter; Kumar, Nag S; Gong, Huansheng; Moreau, Anne; Hsing, Michael; Kaur, Sukhbir; Swayze, Richard D; Worrall, Liam; Amandoron, Emily; Lian, Tian; Jackson, Linda; Jiang, Jihong; Thorson, Lisa; Labriere, Christophe; Foster, Leonard; Brunham, Robert C; McMaster, William R; Finlay, B Brett; Strynadka, Natalie C; Cherkasov, Artem; Young, Robert N; Reiner, Neil E

    2011-05-01

    Novel classes of antimicrobials are needed to address the challenge of multidrug-resistant bacteria such as methicillin-resistant Staphylococcus aureus (MRSA). Using the architecture of the MRSA interactome, we identified pyruvate kinase (PK) as a potential novel drug target based upon it being a highly connected, essential hub in the MRSA interactome. Structural modeling, including X-ray crystallography, revealed discrete features of PK in MRSA, which appeared suitable for the selective targeting of the bacterial enzyme. In silico library screening combined with functional enzymatic assays identified an acyl hydrazone-based compound (IS-130) as a potent MRSA PK inhibitor (50% inhibitory concentration [IC50] of 0.1 μM) with >1,000-fold selectivity over human PK isoforms. Medicinal chemistry around the IS-130 scaffold identified analogs that more potently and selectively inhibited MRSA PK enzymatic activity and S. aureus growth in vitro (MIC of 1 to 5 μg/ml). These novel anti-PK compounds were found to possess antistaphylococcal activity, including both MRSA and multidrug-resistant S. aureus (MDRSA) strains. These compounds also exhibited exceptional antibacterial activities against other Gram-positive genera, including enterococci and streptococci. PK lead compounds were found to be noncompetitive inhibitors and were bactericidal. In addition, mutants with significant increases in MICs were not isolated after 25 bacterial passages in culture, indicating that resistance may be slow to emerge. These findings validate the principles of network science as a powerful approach to identify novel antibacterial drug targets. They also provide a proof of principle, based upon PK in MRSA, for a research platform aimed at discovering and optimizing selective inhibitors of novel bacterial targets where human orthologs exist, as leads for anti-infective drug development.

  13. Venus kinase receptors: prospects in signaling and biological functions of these invertebrate kinases.

    Science.gov (United States)

    Dissous, Colette; Morel, Marion; Vanderstraete, Mathieu

    2014-01-01

    Venus kinase receptors (VKRs) form a family of invertebrate receptor tyrosine kinases (RTKs) initially discovered in the parasitic platyhelminth Schistosoma mansoni. VKRs are single transmembrane receptors that contain an extracellular venus fly trap structure similar to the ligand-binding domain of G protein-coupled receptors of class C, and an intracellular tyrosine kinase domain close to that of insulin receptors. VKRs are found in a large variety of invertebrates from cnidarians to echinoderms and are highly expressed in larval stages and in gonads, suggesting a role of these proteins in embryonic and larval development as well as in reproduction. VKR gene silencing could demonstrate the function of these receptors in oogenesis as well as in spermatogenesis in S. mansoni. VKRs are activated by amino acids and are highly responsive to arginine. As many other RTKs, they form dimers when activated by ligands and induce intracellular pathways involved in protein synthesis and cellular growth, such as MAPK and PI3K/Akt/S6K pathways. VKRs are not present in vertebrates or in some invertebrate species. Questions remain open about the origin of this little-known RTK family in evolution and its role in emergence and specialization of Metazoa. What is the meaning of maintenance or loss of VKR in some phyla or species in terms of development and physiological functions? The presence of VKRs in invertebrates of economical and medical importance, such as pests, vectors of pathogens, and platyhelminth parasites, and the implication of these RTKs in gametogenesis and reproduction processes are valuable reasons to consider VKRs as interesting targets in new programs for eradication/control of pests and infectious diseases, with the main advantage in the case of parasite targeting that VKR counterparts are absent from the vertebrate host kinase panel.

  14. Stress-induced activation of protein kinase CK2 by direct interaction with p38 mitogen-activated protein kinase

    DEFF Research Database (Denmark)

    Sayed, M; Kim, S O; Salh, B S

    2000-01-01

    in the human cervical carcinoma HeLa cells by up to 8-fold, and this could be blocked by the p38 MAP kinase inhibitor SB203580. We show that p38alpha MAP kinase, in a phosphorylation-dependent manner, can directly interact with the alpha and beta subunits of CK2 to activate the holoenzyme through what appears...

  15. The Bmx tyrosine kinase induces activation of the Stat signaling pathway, which is specifically inhibited by protein kinase Cdelta.

    Science.gov (United States)

    Saharinen, P; Ekman, N; Sarvas, K; Parker, P; Alitalo, K; Silvennoinen, O

    1997-12-01

    Members of the hematopoietically expressed Tec tyrosine kinase family have an important role in hematopoietic signal transduction, as exemplified by the crucial role of Btk for B-cell differentiation and activation. Although a variety of cell surface receptors have been found to activate Tec tyrosine kinases, the specific signaling pathways and substrate molecules used by Tec kinases are still largely unknown. In this study a Tec family kinase, Bmx, was found to induce activation of the Stat signaling pathway. Bmx induced the tyrosine phosphorylation and DNA binding activity of all the Stat factors tested, including Stat1, Stat3, and Stat5, both in mammalian and insect cells. Bmx also induced transcriptional activation of Stat1- and Stat5-dependent reporter genes. Other cytoplasmic tyrosine kinases, Syk, Fyn, and c-Src, showed no or only weak ability to activate Stat proteins. Expression of Bmx in mammalian cells was found to induce activation of endogenous Stat proteins without activation of endogenous Jak kinases. We further analyzed the Bmx-mediated activation of Stat1, which was found to be regulated by protein kinase C delta (PKCdelta) isoform, but not beta 1, epsilon, or zeta isoforms, leading to inhibition of Stat1 tyrosine phosphorylation. In conclusion, these studies show that Bmx, a Tec family kinase, can function as an activator of the Stat signaling pathway and identify a role for PKCdelta in the regulation of Bmx signaling.

  16. Creatine kinase and creatine kinase subunit-B in coronary sinus blood in pacing-induced angina pectoris

    DEFF Research Database (Denmark)

    Bagger, J P; Ingerslev, J; Heinsvig, E M

    1982-01-01

    In nine out of 10 patients with angiographic documented coronary artery disease, pacing-induced angina pectoris provoked myocardial production of lactate, whereas no significant release of either creatine kinase or creatine kinase subunit-B to coronary sinus and peripheral venous blood could...

  17. Prostaglandin E2 negatively regulates AMP-activated protein kinase via protein kinase A signaling pathway.

    Science.gov (United States)

    Funahashi, Koji; Cao, Xia; Yamauchi, Masako; Kozaki, Yasuko; Ishiguro, Naoki; Kambe, Fukushi

    2009-01-01

    We investigated possible involvement of prostaglandin (PG) E2 in regulation of AMP-activated protein kinase (AMPK). When osteoblastic MG63 cells were cultured in serum-deprived media, Thr-172 phosphorylation of AMPK alpha-subunit was markedly increased. Treatment of the cells with PGE2 significantly reduced the phosphorylation. Ser-79 phosphorylation of acetyl-CoA carboxylase, a direct target for AMPK, was also reduced by PGE2. On the other hand, PGE2 reciprocally increased Ser-485 phosphorylation of the alpha-subunit that could be associated with inhibition of AMPK activity. These effects of PGE2 were mimicked by PGE2 receptor EP2 and EP4 agonists and forskolin, but not by EP1 and EP3 agonists, and the effects were suppressed by an adenylate cyclase inhibitor SQ22536 and a protein kinase A inhibitor H89. Additionally, the PGE2 effects were duplicated in primary calvarial osteoblasts. Together, the present study demonstrates that PGE2 negatively regulates AMPK activity via activation of protein kinase A signaling pathway.

  18. Symbiotic rhizobia bacteria trigger a change in localization and dynamics of the Medicago truncatula receptor kinase LYK3.

    Science.gov (United States)

    Haney, Cara H; Riely, Brendan K; Tricoli, David M; Cook, Doug R; Ehrhardt, David W; Long, Sharon R

    2011-07-01

    To form nitrogen-fixing symbioses, legume plants recognize a bacterial signal, Nod Factor (NF). The legume Medicago truncatula has two predicted NF receptors that direct separate downstream responses to its symbiont Sinorhizobium meliloti. NOD FACTOR PERCEPTION encodes a putative low-stringency receptor that is responsible for calcium spiking and transcriptional responses. LYSIN MOTIF RECEPTOR-LIKE KINASE3 (LYK3) encodes a putative high-stringency receptor that mediates bacterial infection. We localized green fluorescent protein (GFP)-tagged LYK3 in M. truncatula and found that it has a punctate distribution at the cell periphery consistent with a plasma membrane or membrane-tethered vesicle localization. In buffer-treated control roots, LYK3:GFP puncta are dynamic. After inoculation with compatible S. meliloti, LYK3:GFP puncta are relatively stable. We show that increased LYK3:GFP stability depends on bacterial NF and NF structure but that NF is not sufficient for the change in LYK3:GFP dynamics. In uninoculated root hairs, LYK3:GFP has little codistribution with mCherry-tagged FLOTILLIN4 (FLOT4), another punctate plasma membrane-associated protein required for infection. In inoculated root hairs, we observed an increase in FLOT4:mCherry and LYK3:GFP colocalization; both proteins localize to positionally stable puncta. We also demonstrate that the localization of tagged FLOT4 is altered in plants carrying a mutation that inactivates the kinase domain of LYK3. Our work indicates that LYK3 protein localization and dynamics are altered in response to symbiotic bacteria.

  19. Mixed Lineage Kinase-c-Jun N-Terminal Kinase Axis: A Potential Therapeutic Target in Cancer.

    Science.gov (United States)

    Rana, Ajay; Rana, Basabi; Mishra, Rajakishore; Sondarva, Gautam; Rangasamy, Velusamy; Das, Subhasis; Viswakarma, Navin; Kanthasamy, Anumantha

    2013-09-01

    Mixed lineage kinases (MLKs) are members of the mitogen-activated protein kinase kinase kinase (MAP3K) family and are reported to activate MAP kinase pathways. There have been at least 9 members of the MLK family identified to date, although the physiological functions of all the family members are yet unknown. However, MLKs in general have been implicated in neurodegenerative diseases, including Parkinson and Alzheimer diseases. Recent reports suggest that some of the MLK members could play a role in cancer via modulating cell migration, invasion, cell cycle, and apoptosis. This review article will first describe the biology of MLK members and then discuss the current progress that relates to their functions in cancer.

  20. Positively regulated bacterial expression systems.

    Science.gov (United States)

    Brautaset, Trygve; Lale, Rahmi; Valla, Svein

    2009-01-01

    Regulated promoters are useful tools for many aspects related to recombinant gene expression in bacteria, including for high-level expression of heterologous proteins and for expression at physiological levels in metabolic engineering applications. In general, it is common to express the genes of interest from an inducible promoter controlled either by a positive regulator or by a repressor protein. In this review, we discuss established and potentially useful positively regulated bacterial promoter systems, with a particular emphasis on those that are controlled by the AraC-XylS family of transcriptional activators. The systems function in a wide range of microorganisms, including enterobacteria, soil bacteria, lactic bacteria and streptomycetes. The available systems that have been applied to express heterologous genes are regulated either by sugars (L-arabinose, L-rhamnose, xylose and sucrose), substituted benzenes, cyclohexanone-related compounds, ε-caprolactam, propionate, thiostrepton, alkanes or peptides. It is of applied interest that some of the inducers require the presence of transport systems, some are more prone than others to become metabolized by the host and some have been applied mainly in one or a limited number of species. Based on bioinformatics analyses, the AraC-XylS family of regulators contains a large number of different members (currently over 300), but only a small fraction of these, the XylS/Pm, AraC/P(BAD), RhaR-RhaS/rhaBAD, NitR/PnitA and ChnR/Pb regulator/promoter systems, have so far been explored for biotechnological applications.

  1. Endolymphatic sac involvement in bacterial meningitis

    DEFF Research Database (Denmark)

    Møller, Martin Nue; Brandt, Christian; Andersen, Christian Østergaard;

    2015-01-01

    The commonest sequelae of bacterial meningitis are related to the inner ear. Little is known about the inner ear immune defense. Evidence suggests that the endolymphatic sac provides some protection against infection. A potential involvement of the endolymphatic sac in bacterial meningitis......-inoculated. The rats were killed when reaching terminal illness or on day 7, followed by light microscopy preparation and PAS-Alcian blue staining. The endolymphatic sac was examined for bacterial invasion and leukocyte infiltration. Neither bacteria nor leukocytes infiltrated the endolymphatic sac during the first...... days. Bacteria invaded the inner ear through the cochlear aquaduct. On days 5-6, the bacteria invaded the endolymphatic sac through the endolymphatic duct subsequent to invasion of the vestibular endolymphatic compartment. No evidence of direct bacterial invasion of the sac through the meninges...

  2. Bacterial bioluminescence in marine pollution assessment

    Digital Repository Service at National Institute of Oceanography (India)

    Ramaiah, N.; Chandramohan, D.

    Warm water marine luminous bacterial species, particularly Vibrio harveyi, V. fischeri and Photobacterium leiognathi, are easy to isolate, maintain and handle in the laboratories without strict temperature requirements, which is an important...

  3. The bacterial microbiota in inflammatory lung diseases.

    Science.gov (United States)

    Huffnagle, Gary B; Dickson, Robert P

    2015-08-01

    Numerous lines of evidence, ranging from recent studies back to those in the 1920s, have demonstrated that the lungs are NOT bacteria-free during health. We have recently proposed that the entire respiratory tract should be considered a single ecosystem extending from the nasal and oral cavities to the alveoli, which includes gradients and niches that modulate microbiome dispersion, retention, survival and proliferation. Bacterial exposure and colonization of the lungs during health is most likely constant and transient, respectively. Host microanatomy, cell biology and innate defenses are altered during chronic lung disease, which in turn, alters the dynamics of bacterial turnover in the lungs and can lead to longer term bacterial colonization, as well as blooms of well-recognized respiratory bacterial pathogens. A few new respiratory colonizers have been identified by culture-independent methods, such as Pseudomonas fluorescens; however, the role of these bacteria in respiratory disease remains to be determined.

  4. Respiratory bacterial infections in cystic fibrosis

    DEFF Research Database (Denmark)

    Ciofu, Oana; Hansen, Christine R; Høiby, Niels

    2013-01-01

    Bacterial respiratory infections are the main cause of morbidity and mortality in patients with cystic fibrosis (CF). Pseudomonas aeruginosa remains the main pathogen in adults, but other Gram-negative bacteria such as Achromobacter xylosoxidans and Stenotrophomonas maltophilia as well...

  5. The Bacterial Microbiota in Inflammatory Lung Diseases

    Science.gov (United States)

    Huffnagle, Gary B.; Dickson, Robert P.

    2016-01-01

    Numerous lines of evidence, ranging from recent studies back to those in the 1920's, have demonstrated that the lungs are NOT bacteria-free during health. We have recently proposed that the entire respiratory tract should be considered a single ecosystem extending from the nasal and oral cavities to the alveoli, which includes gradients and niches that modulate microbiome dispersion, retention, survival and proliferation. Bacterial exposure and colonization of the lungs during health is most likely constant and transient, respectively. Host microanatomy, cell biology and innate defenses are altered during chronic lung disease, which in turn, alters the dynamics of bacterial turnover in the lungs and can lead to longer term bacterial colonization, as well as blooms of well-recognized respiratory bacterial pathogens. A few new respiratory colonizers have been identified by culture-independent methods, such as Pseudomonas fluorescens; however, the role of these bacteria in respiratory disease remains to be determined. PMID:26122174

  6. Plant growth-promoting bacterial endophytes.

    Science.gov (United States)

    Santoyo, Gustavo; Moreno-Hagelsieb, Gabriel; Orozco-Mosqueda, Ma del Carmen; Glick, Bernard R

    2016-02-01

    Bacterial endophytes ubiquitously colonize the internal tissues of plants, being found in nearly every plant worldwide. Some endophytes are able to promote the growth of plants. For those strains the mechanisms of plant growth-promotion known to be employed by bacterial endophytes are similar to the mechanisms used by rhizospheric bacteria, e.g., the acquisition of resources needed for plant growth and modulation of plant growth and development. Similar to rhizospheric plant growth-promoting bacteria, endophytic plant growth-promoting bacteria can act to facilitate plant growth in agriculture, horticulture and silviculture as well as in strategies for environmental cleanup (i.e., phytoremediation). Genome comparisons between bacterial endophytes and the genomes of rhizospheric plant growth-promoting bacteria are starting to unveil potential genetic factors involved in an endophytic lifestyle, which should facilitate a better understanding of the functioning of bacterial endophytes.

  7. Structure of WbdD: a bifunctional kinase and methyltransferase that regulates the chain length of the O antigen in Escherichia coli O9a.

    Science.gov (United States)

    Hagelueken, Gregor; Huang, Hexian; Clarke, Bradley R; Lebl, Tomas; Whitfield, Chris; Naismith, James H

    2012-11-01

    The Escherichia coli serotype O9a O-antigen polysaccharide (O-PS) is a model for glycan biosynthesis and export by the ATP-binding cassette transporter-dependent pathway. The polymannose O9a O-PS is synthesized as a polyprenol-linked glycan by mannosyltransferase enzymes located at the cytoplasmic membrane. The chain length of the O9a O-PS is tightly regulated by the WbdD enzyme. WbdD first phosphorylates the terminal non-reducing mannose of the O-PS and then methylates the phosphate, stopping polymerization. The 2.2 Å resolution structure of WbdD reveals a bacterial methyltransferase domain joined to a eukaryotic kinase domain. The kinase domain is again fused to an extended C-terminal coiled-coil domain reminiscent of eukaryotic DMPK (Myotonic Dystrophy Protein Kinase) family kinases such as Rho-associated protein kinase (ROCK). WbdD phosphorylates 2-α-d-mannosyl-d-mannose (2α-MB), a short mimic of the O9a polymer. Mutagenesis identifies those residues important in catalysis and substrate recognition and the in vivo phenotypes of these mutants are used to dissect the termination reaction. We have determined the structures of co-complexes of WbdD with two known eukaryotic protein kinase inhibitors. Although these are potent inhibitors in vitro, they do not show any in vivo activity. The structures reveal new insight into O-PS chain-length regulation in this important model system.

  8. Structure of WbdD: a bifunctional kinase and methyltransferase that regulates the chain length of the O antigen in Escherichia coli O9a

    Science.gov (United States)

    Hagelueken, Gregor; Huang, Hexian; Clarke, Bradley R; Lebl, Tomas; Whitfield, Chris; Naismith, James H

    2012-01-01

    Summary The Escherichia coli serotype O9a O-antigen polysaccharide (O-PS) is a model for glycan biosynthesis and export by the ATP-binding cassette transporter-dependent pathway. The polymannose O9a O-PS is synthesized as a polyprenol-linked glycan by mannosyltransferase enzymes located at the cytoplasmic membrane. The chain length of the O9a O-PS is tightly regulated by the WbdD enzyme. WbdD first phosphorylates the terminal non-reducing mannose of the O-PS and then methylates the phosphate, stopping polymerization. The 2.2 Å resolution structure of WbdD reveals a bacterial methyltransferase domain joined to a eukaryotic kinase domain. The kinase domain is again fused to an extended C-terminal coiled-coil domain reminiscent of eukaryotic DMPK (Myotonic Dystrophy Protein Kinase) family kinases such as Rho-associated protein kinase (ROCK). WbdD phosphorylates 2-α-d-mannosyl-d-mannose (2α-MB), a short mimic of the O9a polymer. Mutagenesis identifies those residues important in catalysis and substrate recognition and the in vivo phenotypes of these mutants are used to dissect the termination reaction. We have determined the structures of co-complexes of WbdD with two known eukaryotic protein kinase inhibitors. Although these are potent inhibitors in vitro, they do not show any in vivo activity. The structures reveal new insight into O-PS chain-length regulation in this important model system. PMID:22970759

  9. [Combination therapy of chronic bacterial prostatitis].

    Science.gov (United States)

    Khryanin, A A; Reshetnikov, O V

    2016-08-01

    The article discusses the possible etiological factors in the development of chronic bacterial prostatitis. The authors presented a comparative long-term analysis of morbidity from non-viral sexually transmitted infections (STIs) in Russia. Against the background of general decline in STIs incidence, a significant percentage of them is made up by urogenital trichomoniasis. The findings substantiated the advantages of combination therapy (ornidazole and ofloxacin) for bacterial urinary tract infections.

  10. Jellyfish modulate bacterial dynamic and community structure.

    Science.gov (United States)

    Tinta, Tinkara; Kogovšek, Tjaša; Malej, Alenka; Turk, Valentina

    2012-01-01

    Jellyfish blooms have increased in coastal areas around the world and the outbreaks have become longer and more frequent over the past few decades. The Mediterranean Sea is among the heavily affected regions and the common bloom-forming taxa are scyphozoans Aurelia aurita s.l., Pelagia noctiluca, and Rhizostoma pulmo. Jellyfish have few natural predators, therefore their carcasses at the termination of a bloom represent an organic-rich substrate that supports rapid bacterial growth, and may have a large impact on the surrounding environment. The focus of this study was to explore whether jellyfish substrate have an impact on bacterial community phylotype selection. We conducted in situ jellyfish-enrichment experiment with three different jellyfish species. Bacterial dynamic together with nutrients were monitored to assess decaying jellyfish-bacteria dynamics. Our results show that jellyfish biomass is characterized by protein rich organic matter, which is highly bioavailable to 'jellyfish-associated' and 'free-living' bacteria, and triggers rapid shifts in bacterial population dynamics and composition. Based on 16S rRNA clone libraries and denaturing gradient gel electrophoresis (DGGE) analysis, we observed a rapid shift in community composition from unculturable Alphaproteobacteria to culturable species of Gammaproteobacteria and Flavobacteria. The results of sequence analyses of bacterial isolates and of total bacterial community determined by culture independent genetic analysis showed the dominance of the Pseudoalteromonadaceae and the Vibrionaceae families. Elevated levels of dissolved proteins, dissolved organic and inorganic nutrient release, bacterial abundance and carbon production as well as ammonium concentrations characterized the degradation process. The biochemical composition of jellyfish species may influence changes in the amount of accumulated dissolved organic and inorganic nutrients. Our results can contribute insights into possible changes in

  11. Jellyfish modulate bacterial dynamic and community structure.

    Directory of Open Access Journals (Sweden)

    Tinkara Tinta

    Full Text Available Jellyfish blooms have increased in coastal areas around the world and the outbreaks have become longer and more frequent over the past few decades. The Mediterranean Sea is among the heavily affected regions and the common bloom-forming taxa are scyphozoans Aurelia aurita s.l., Pelagia noctiluca, and Rhizostoma pulmo. Jellyfish have few natural predators, therefore their carcasses at the termination of a bloom represent an organic-rich substrate that supports rapid bacterial growth, and may have a large impact on the surrounding environment. The focus of this study was to explore whether jellyfish substrate have an impact on bacterial community phylotype selection. We conducted in situ jellyfish-enrichment experiment with three different jellyfish species. Bacterial dynamic together with nutrients were monitored to assess decaying jellyfish-bacteria dynamics. Our results show that jellyfish biomass is characterized by protein rich organic matter, which is highly bioavailable to 'jellyfish-associated' and 'free-living' bacteria, and triggers rapid shifts in bacterial population dynamics and composition. Based on 16S rRNA clone libraries and denaturing gradient gel electrophoresis (DGGE analysis, we observed a rapid shift in community composition from unculturable Alphaproteobacteria to culturable species of Gammaproteobacteria and Flavobacteria. The results of sequence analyses of bacterial isolates and of total bacterial community determined by culture independent genetic analysis showed the dominance of the Pseudoalteromonadaceae and the Vibrionaceae families. Elevated levels of dissolved proteins, dissolved organic and inorganic nutrient release, bacterial abundance and carbon production as well as ammonium concentrations characterized the degradation process. The biochemical composition of jellyfish species may influence changes in the amount of accumulated dissolved organic and inorganic nutrients. Our results can contribute insights into

  12. Pattern Formation in a Bacterial Colony Model

    Directory of Open Access Journals (Sweden)

    Xinze Lian

    2014-01-01

    Full Text Available We investigate the spatiotemporal dynamics of a bacterial colony model. Based on the stability analysis, we derive the conditions for Hopf and Turing bifurcations. Furthermore, we present novel numerical evidence of time evolution of patterns controlled by parameters in the model and find that the model dynamics exhibit a diffusion controlled formation growth to spots, holes and stripes pattern replication, which show that the bacterial colony model is useful in revealing the spatial predation dynamics in the real world.

  13. Asynchronous exponential growth of a bacterial population

    Directory of Open Access Journals (Sweden)

    Mohamed Boulanouar

    2014-01-01

    Full Text Available In this work, we complete a study started earlier in [1,2] wherein a model of growing bacterial population has been the matter of a mathematical analysis. We show that the full model is governed by a strongly continuous semigroup. Beside the positivity and the irreducibility of the generated semigroup, we describe its asymptotic behavior in the uniform topology which leads to the asynchronous exponential growth of the bacterial population.

  14. Volatiles in Inter-Specific Bacterial Interactions.

    Science.gov (United States)

    Tyc, Olaf; Zweers, Hans; de Boer, Wietse; Garbeva, Paolina

    2015-01-01

    The importance of volatile organic compounds for functioning of microbes is receiving increased research attention. However, to date very little is known on how inter-specific bacterial interactions effect volatiles production as most studies have been focused on volatiles produced by monocultures of well-described bacterial genera. In this study we aimed to understand how inter-specific bacterial interactions affect the composition, production and activity of volatiles. Four phylogenetically different bacterial species namely: Chryseobacterium, Dyella, Janthinobacterium, and Tsukamurella were selected. Earlier results had shown that pairwise combinations of these bacteria induced antimicrobial activity in agar media whereas this was not the case for monocultures. In the current study, we examined if these observations were also reflected by the production of antimicrobial volatiles. Thus, the identity and antimicrobial activity of volatiles produced by the bacteria were determined in monoculture as well in pairwise combinations. Antimicrobial activity of the volatiles was assessed against fungal, oomycetal, and bacterial model organisms. Our results revealed that inter-specific bacterial interactions affected volatiles blend composition. Fungi and oomycetes showed high sensitivity to bacterial volatiles whereas the effect of volatiles on bacteria varied between no effects, growth inhibition to growth promotion depending on the volatile blend composition. In total 35 volatile compounds were detected most of which were sulfur-containing compounds. Two commonly produced sulfur-containing volatile compounds (dimethyl disulfide and dimethyl trisulfide) were tested for their effect on three target bacteria. Here, we display the importance of inter-specific interactions on bacterial volatiles production and their antimicrobial activities.

  15. Rho-modifying bacterial protein toxins.

    Science.gov (United States)

    Aktories, Klaus

    2015-12-01

    Rho proteins are targets of numerous bacterial protein toxins, which manipulate the GTP-binding proteins by covalent modifications, including ADP ribosylation, glycosylation, adenylylation, proteolytic cleavage and deamidation. Bacterial toxins are important virulence factors but are also potent and efficient pharmacological tools to study the physiological functions of their eukaryotic targets. Recent studies indicate that amazing variations exist in the molecular mechanisms by which toxins attack Rho proteins, which are discussed here.

  16. Mechanistic investigations on six bacterial terpene cyclases

    Directory of Open Access Journals (Sweden)

    Patrick Rabe

    2016-08-01

    Full Text Available The products obtained by incubation of farnesyl diphosphate (FPP with six purified bacterial terpene cyclases were characterised by one- and two-dimensional NMR spectroscopic methods, allowing for a full structure elucidation. The absolute configurations of four terpenes were determined based on their optical rotary powers. Incubation experiments with 13C-labelled isotopomers of FPP in buffers containing water or deuterium oxide allowed for detailed insights into the cyclisation mechanisms of the bacterial terpene cyclases.

  17. Recombination and the nature of bacterial speciation

    OpenAIRE

    2007-01-01

    Genetic surveys are uncovering the diversity of bacteria, and are causing the species concepts used to categorize these to be questioned. One difficulty in defining bacterial species arises from the high rates of recombination that results in the transfer of DNA between relatively distantly related bacteria. Barriers to this process, which could be used to define species naturally, are not apparent. Here, we have reviewed conceptual models of bacterial speciation and simulate speciation in si...

  18. Soil carbon quality and nitrogen fertilization structure bacterial communities with predictable responses of major bacterial phyla

    OpenAIRE

    2014-01-01

    Agricultural practices affect the soil ecosystem in multiple ways and the soil microbial communities represent an integrated and dynamic measure of soil status. Our aim was to test whether the soil bacterial community and the relative abundance of major bacterial phyla responded predictably to long-term organic amendments representing different carbon qualities (peat and straw) in combination with nitrogen fertilization levels and if certain bacterial groups were indicative of specific treatm...

  19. Classical macrophage activation up-regulates several matrix metalloproteinases through mitogen activated protein kinases and nuclear factor-κB.

    Directory of Open Access Journals (Sweden)

    Wei-Chun Huang

    Full Text Available Remodelling of the extracellular matrix (ECM and cell surface by matrix metalloproteinases (MMPs is an important function of monocytes and macrophages. Recent work has emphasised the diverse roles of classically and alternatively activated macrophages but the consequent regulation of MMPs and their inhibitors has not been studied comprehensively. Classical activation of macrophages derived in vitro from un-fractionated CD16(+/- or negatively-selected CD16(- macrophages up-regulated MMP-1, -3, -7, -10, -12, -14 and -25 and decreased TIMP-3 steady-state mRNA levels. Bacterial lipopolysaccharide, IL-1 and TNFα were more effective than interferonγ except for the effects on MMP-25, and TIMP-3. By contrast, alternative activation decreased MMP-2, -8 and -19 but increased MMP -11, -12, -25 and TIMP-3 steady-state mRNA levels. Up-regulation of MMPs during classical activation depended on mitogen activated protein kinases, phosphoinositide-3-kinase and inhibitor of κB kinase-2. Effects of interferonγ depended on janus kinase-2. Where investigated, similar effects were seen on protein concentrations and collagenase activity. Moreover, activity of MMP-1 and -10 co-localised with markers of classical activation in human atherosclerotic plaques in vivo. In conclusion, classical macrophage activation selectively up-regulates several MMPs in vitro and in vivo and down-regulates TIMP-3, whereas alternative activation up-regulates a distinct group of MMPs and TIMP-3. The signalling pathways defined here suggest targets for selective modulation of MMP activity.

  20. Comprehensive phylogenetic analysis of bacterial reverse transcriptases.

    Directory of Open Access Journals (Sweden)

    Nicolás Toro

    Full Text Available Much less is known about reverse transcriptases (RTs in prokaryotes than in eukaryotes, with most prokaryotic enzymes still uncharacterized. Two surveys involving BLAST searches for RT genes in prokaryotic genomes revealed the presence of large numbers of diverse, uncharacterized RTs and RT-like sequences. Here, using consistent annotation across all sequenced bacterial species from GenBank and other sources via RAST, available from the PATRIC (Pathogenic Resource Integration Center platform, we have compiled the data for currently annotated reverse transcriptases from completely sequenced bacterial genomes. RT sequences are broadly distributed across bacterial phyla, but green sulfur bacteria and cyanobacteria have the highest levels of RT sequence diversity (≤85% identity per genome. By contrast, phylum Actinobacteria, for which a large number of genomes have been sequenced, was found to have a low RT sequence diversity. Phylogenetic analyses revealed that bacterial RTs could be classified into 17 main groups: group II introns, retrons/retron-like RTs, diversity-generating retroelements (DGRs, Abi-like RTs, CRISPR-Cas-associated RTs, group II-like RTs (G2L, and 11 other groups of RTs of unknown function. Proteobacteria had the highest potential functional diversity, as they possessed most of the RT groups. Group II introns and DGRs were the most widely distributed RTs in bacterial phyla. Our results provide insights into bacterial RT phylogeny and the basis for an update of annotation systems based on sequence/domain homology.

  1. Role of quorum sensing in bacterial infections

    Science.gov (United States)

    Castillo-Juárez, Israel; Maeda, Toshinari; Mandujano-Tinoco, Edna Ayerim; Tomás, María; Pérez-Eretza, Berenice; García-Contreras, Silvia Julieta; Wood, Thomas K; García-Contreras, Rodolfo

    2015-01-01

    Quorum sensing (QS) is cell communication that is widely used by bacterial pathogens to coordinate the expression of several collective traits, including the production of multiple virulence factors, biofilm formation, and swarming motility once a population threshold is reached. Several lines of evidence indicate that QS enhances virulence of bacterial pathogens in animal models as well as in human infections; however, its relative importance for bacterial pathogenesis is still incomplete. In this review, we discuss the present evidence from in vitro and in vivo experiments in animal models, as well as from clinical studies, that link QS systems with human infections. We focus on two major QS bacterial models, the opportunistic Gram negative bacteria Pseudomonas aeruginosa and the Gram positive Staphylococcus aureus, which are also two of the main agents responsible of nosocomial and wound infections. In addition, QS communication systems in other bacterial, eukaryotic pathogens, and even immune and cancer cells are also reviewed, and finally, the new approaches proposed to combat bacterial infections by the attenuation of their QS communication systems and virulence are also discussed. PMID:26244150

  2. Side-effects of protein kinase inhibitors on ion channels

    Indian Academy of Sciences (India)

    Youn Kyoung Son; Hongzoo Park; Amy L Firth; Won Sun Park

    2013-12-01

    Protein kinases are one of the largest gene families and have regulatory roles in all aspects of eukaryotic cell function. Modulation of protein kinase activity is a desirable therapeutic approach for a number of human diseases associated with aberrant kinase activity, including cancers, arthritis and cardiovascular disorders. Several strategies have been used to develop specific and selective protein kinase modulators, primarily via inhibition of phosphorylation and down-regulation of kinase gene expression. These strategies are effective at regulating intracellular signalling pathways, but are unfortunately associated with several undesirable effects, particularly those that modulate ion channel function. In fact, the side-effects have precluded these inhibitors from being both useful experimental tools and therapeutically viable. This review focuses on the ion channel side-effects of several protein kinase inhibitors and specifically on those modulating K+, Na+ and Ca2+ ion channels. It is hoped that the information provided with a detailed summary in this review will assist the future development of novel specific and selective compounds targeting protein kinases both for experimental tools and for therapeutic approaches.

  3. Structure of the intact ATM/Tel1 kinase.

    Science.gov (United States)

    Wang, Xuejuan; Chu, Huanyu; Lv, Mengjuan; Zhang, Zhihui; Qiu, Shuwan; Liu, Haiyan; Shen, Xuetong; Wang, Weiwu; Cai, Gang

    2016-05-27

    The ataxia-telangiectasia mutated (ATM) protein is an apical kinase that orchestrates the multifaceted DNA-damage response. Normally, ATM kinase is in an inactive, homodimer form and is transformed into monomers upon activation. Besides a conserved kinase domain at the C terminus, ATM contains three other structural modules, referred to as FAT, FATC and N-terminal helical solenoid. Here we report the first cryo-EM structure of ATM kinase, which is an intact homodimeric ATM/Tel1 from Schizosaccharomyces pombe. We show that two monomers directly contact head-to-head through the FAT and kinase domains. The tandem N-terminal helical solenoid tightly packs against the FAT and kinase domains. The structure suggests that ATM/Tel1 dimer interface and the consecutive HEAT repeats inhibit the binding of kinase substrates and regulators by steric hindrance. Our study provides a structural framework for understanding the mechanisms of ATM/Tel1 regulation as well as the development of new therapeutic agents.

  4. Kinase/phosphatase overexpression reveals pathways regulating hippocampal neuron morphology.

    Science.gov (United States)

    Buchser, William J; Slepak, Tatiana I; Gutierrez-Arenas, Omar; Bixby, John L; Lemmon, Vance P

    2010-07-01

    Development and regeneration of the nervous system requires the precise formation of axons and dendrites. Kinases and phosphatases are pervasive regulators of cellular function and have been implicated in controlling axodendritic development and regeneration. We undertook a gain-of-function analysis to determine the functions of kinases and phosphatases in the regulation of neuron morphology. Over 300 kinases and 124 esterases and phosphatases were studied by high-content analysis of rat hippocampal neurons. Proteins previously implicated in neurite growth, such as ERK1, GSK3, EphA8, FGFR, PI3K, PKC, p38, and PP1a, were confirmed to have effects in our functional assays. We also identified novel positive and negative neurite growth regulators. These include neuronal-developmentally regulated kinases such as the activin receptor, interferon regulatory factor 6 (IRF6) and neural leucine-rich repeat 1 (LRRN1). The protein kinase N2 (PKN2) and choline kinase alpha (CHKA) kinases, and the phosphatases PPEF2 and SMPD1, have little or no established functions in neuronal function, but were sufficient to promote neurite growth. In addition, pathway analysis revealed that members of signaling pathways involved in cancer progression and axis formation enhanced neurite outgrowth, whereas cytokine-related pathways significantly inhibited neurite formation.

  5. Conservation, variability and the modeling of active protein kinases.

    Directory of Open Access Journals (Sweden)

    James D R Knight

    Full Text Available The human proteome is rich with protein kinases, and this richness has made the kinase of crucial importance in initiating and maintaining cell behavior. Elucidating cell signaling networks and manipulating their components to understand and alter behavior require well designed inhibitors. These inhibitors are needed in culture to cause and study network perturbations, and the same compounds can be used as drugs to treat disease. Understanding the structural biology of protein kinases in detail, including their commonalities, differences and modes of substrate interaction, is necessary for designing high quality inhibitors that will be of true use for cell biology and disease therapy. To this end, we here report on a structural analysis of all available active-conformation protein kinases, discussing residue conservation, the novel features of such conservation, unique properties of atypical kinases and variability in the context of substrate binding. We also demonstrate how this information can be used for structure prediction. Our findings will be of use not only in understanding protein kinase function and evolution, but they highlight the flaws inherent in kinase drug design as commonly practiced and dictate an appropriate strategy for the sophisticated design of specific inhibitors for use in the laboratory and disease therapy.

  6. High throughput screens yield small molecule inhibitors of Leishmania CRK3:CYC6 cyclin-dependent kinase.

    Directory of Open Access Journals (Sweden)

    Roderick G Walker

    Full Text Available BACKGROUND: Leishmania species are parasitic protozoa that have a tightly controlled cell cycle, regulated by cyclin-dependent kinases (CDKs. Cdc2-related kinase 3 (CRK3, an essential CDK in Leishmania and functional orthologue of human CDK1, can form an active protein kinase complex with Leishmania cyclins CYCA and CYC6. Here we describe the identification and synthesis of specific small molecule inhibitors of bacterially expressed Leishmania CRK3:CYC6 using a high throughput screening assay and iterative chemistry. We also describe the biological activity of the molecules against Leishmania parasites. METHODOLOGY/PRINCIPAL FINDINGS: In order to obtain an active Leishmania CRK3:CYC6 protein kinase complex, we developed a co-expression and co-purification system for Leishmania CRK3 and CYC6 proteins. This active enzyme was used in a high throughput screening (HTS platform, utilising an IMAP fluorescence polarisation assay. We carried out two chemical library screens and identified specific inhibitors of CRK3:CYC6 that were inactive against the human cyclin-dependent kinase CDK2:CycA. Subsequently, the best inhibitors were tested against 11 other mammalian protein kinases. Twelve of the most potent hits had an azapurine core with structure activity relationship (SAR analysis identifying the functional groups on the 2 and 9 positions as essential for CRK3:CYC6 inhibition and specificity against CDK2:CycA. Iterative chemistry allowed synthesis of a number of azapurine derivatives with one, compound 17, demonstrating anti-parasitic activity against both promastigote and amastigote forms of L. major. Following the second HTS, 11 compounds with a thiazole core (active towards CRK3:CYC6 and inactive against CDK2:CycA were tested. Ten of these hits demonstrated anti-parasitic activity against promastigote L. major. CONCLUSIONS/SIGNIFICANCE: The pharmacophores identified from the high throughput screens, and the derivatives synthesised, selectively

  7. The chromosomal passenger complex activates Polo kinase at centromeres.

    Directory of Open Access Journals (Sweden)

    Mar Carmena

    2012-01-01

    Full Text Available The coordinated activities at centromeres of two key cell cycle kinases, Polo and Aurora B, are critical for ensuring that the two sister kinetochores of each chromosome are attached to microtubules from opposite spindle poles prior to chromosome segregation at anaphase. Initial attachments of chromosomes to the spindle involve random interactions between kinetochores and dynamic microtubules, and errors occur frequently during early stages of the process. The balance between microtubule binding and error correction (e.g., release of bound microtubules requires the activities of Polo and Aurora B kinases, with Polo promoting stable attachments and Aurora B promoting detachment. Our study concerns the coordination of the activities of these two kinases in vivo. We show that INCENP, a key scaffolding subunit of the chromosomal passenger complex (CPC, which consists of Aurora B kinase, INCENP, Survivin, and Borealin/Dasra B, also interacts with Polo kinase in Drosophila cells. It was known that Aurora A/Bora activates Polo at centrosomes during late G2. However, the kinase that activates Polo on chromosomes for its critical functions at kinetochores was not known. We show here that Aurora B kinase phosphorylates Polo on its activation loop at the centromere in early mitosis. This phosphorylation requires both INCENP and Aurora B activity (but not Aurora A activity and is critical for Polo function at kinetochores. Our results demonstrate clearly that Polo kinase is regulated differently at centrosomes and centromeres and suggest that INCENP acts as a platform for kinase crosstalk at the centromere. This crosstalk may enable Polo and Aurora B to achieve a balance wherein microtubule mis-attachments are corrected, but proper attachments are stabilized allowing proper chromosome segregation.

  8. The chromosomal passenger complex activates Polo kinase at centromeres.

    Science.gov (United States)

    Carmena, Mar; Pinson, Xavier; Platani, Melpi; Salloum, Zeina; Xu, Zhenjie; Clark, Anthony; Macisaac, Fiona; Ogawa, Hiromi; Eggert, Ulrike; Glover, David M; Archambault, Vincent; Earnshaw, William C

    2012-01-01

    The coordinated activities at centromeres of two key cell cycle kinases, Polo and Aurora B, are critical for ensuring that the two sister kinetochores of each chromosome are attached to microtubules from opposite spindle poles prior to chromosome segregation at anaphase. Initial attachments of chromosomes to the spindle involve random interactions between kinetochores and dynamic microtubules, and errors occur frequently during early stages of the process. The balance between microtubule binding and error correction (e.g., release of bound microtubules) requires the activities of Polo and Aurora B kinases, with Polo promoting stable attachments and Aurora B promoting detachment. Our study concerns the coordination of the activities of these two kinases in vivo. We show that INCENP, a key scaffolding subunit of the chromosomal passenger complex (CPC), which consists of Aurora B kinase, INCENP, Survivin, and Borealin/Dasra B, also interacts with Polo kinase in Drosophila cells. It was known that Aurora A/Bora activates Polo at centrosomes during late G2. However, the kinase that activates Polo on chromosomes for its critical functions at kinetochores was not known. We show here that Aurora B kinase phosphorylates Polo on its activation loop at the centromere in early mitosis. This phosphorylation requires both INCENP and Aurora B activity (but not Aurora A activity) and is critical for Polo function at kinetochores. Our results demonstrate clearly that Polo kinase is regulated differently at centrosomes and centromeres and suggest that INCENP acts as a platform for kinase crosstalk at the centromere. This crosstalk may enable Polo and Aurora B to achieve a balance wherein microtubule mis-attachments are corrected, but proper attachments are stabilized allowing proper chromosome segregation.

  9. Evolution and tinkering: what do a protein kinase, a transcriptional regulator and chromosome segregation/cell division proteins have in common?

    Science.gov (United States)

    Derouiche, Abderahmane; Shi, Lei; Kalantari, Aida; Mijakovic, Ivan

    2016-02-01

    In this study, we focus on functional interactions among multi-domain proteins which share a common evolutionary origin. The examples we develop are four Bacillus subtilis proteins, which all possess an ATP-binding Walker motif: the bacterial tyrosine kinase (BY-kinase) PtkA, the chromosome segregation protein Soj (ParA), the cell division protein MinD and a transcription regulator SalA. These proteins have arisen via duplication of the ancestral ATP-binding domain, which has undergone fusions with other functional domains in the process of divergent evolution. We point out that these four proteins, despite having very different physiological roles, engage in an unusually high number of binary functional interactions. Namely, MinD attracts Soj and PtkA to the cell pole, and in addition, activates the kinase function of PtkA. SalA also activates the kinase function of PtkA, and it gets phosphorylated by PtkA as well. The consequence of this phosphorylation is the activation of SalA as a transcriptional repressor. We hypothesize that these functional interactions remain preserved during divergent evolution and represent a constraint on the process of evolutionary "tinkering", brought about by fusions of different functional domains.

  10. Nucleolin (C23), a physiological substrate for casein kinase II

    DEFF Research Database (Denmark)

    Schneider, H R; Issinger, O G

    1988-01-01

    Nucleolin (C23), a 110 kDa phosphoprotein, which is mainly found in the nucleolus has been shown to be a physiological substrate for casein kinase II (CKII). Nucleolin was identified and characterized by immunodetection using an anti-nucleolin antibody. Phosphopeptide patterns from nucleolin...... phosphorylated by purified casein kinase II and of phosphorylated nucleolin which had been isolated from tumor cells grown in the presence of [32P]-o-phosphate, were identical. The partial tryptic digest revealed nine phosphopeptides. Nucleolin isolated from Krebs II mouse ascites cells was phosphorylated...... by purified casein kinase II with about two moles phosphate per one mole of nucleolin....

  11. Molecular properties,functions,and potential applications of NAD kinases

    Institute of Scientific and Technical Information of China (English)

    Feng Shi; Yongfu Li; Ye Li; Xiaoyuan Wang

    2009-01-01

    NAD kinase catalyzes the phosphorylation of NAD(H)to form NADP(H),using ATP as phosphoryl donor.It is the only key enzyme leading to the de novo NADP+/NADPH biosynthesis.Coenzymes such as NAD(H)and NADP(H)are known for their important functions.Recent studies have partially demonstrated that NAD kinase plays a crucial role in the regulation of NAD(H)/NADP(H)conversion.Here,the molecular properties,physiologic functions,and potential applications of NAD kinase are discussed.

  12. Crystal structures of human pyridoxal kinase in complex with the neurotoxins, ginkgotoxin and theophylline: insights into pyridoxal kinase inhibition.

    Directory of Open Access Journals (Sweden)

    Amit K Gandhi

    Full Text Available Several drugs and natural compounds are known to be highly neurotoxic, triggering epileptic convulsions or seizures, and causing headaches, agitations, as well as other neuronal symptoms. The neurotoxic effects of some of these compounds, including theophylline and ginkgotoxin, have been traced to their inhibitory activity against human pyridoxal kinase (hPL kinase, resulting in deficiency of the active cofactor form of vitamin B₆, pyridoxal 5'-phosphate (PLP. Pyridoxal (PL, an inactive form of vitamin B₆ is converted to PLP by PL kinase. PLP is the B₆ vitamer required as a cofactor for over 160 enzymatic activities essential in primary and secondary metabolism. We have performed structural and kinetic studies on hPL kinase with several potential inhibitors, including ginkgotoxin and theophylline. The structural studies show ginkgotoxin and theophylline bound at the substrate site, and are involved in similar protein interactions as the natural substrate, PL. Interestingly, the phosphorylated product of ginkgotoxin is also observed bound at the active site. This work provides insights into the molecular basis of hPL kinase inhibition and may provide a working hypothesis to quickly screen or identify neurotoxic drugs as potential hPL kinase inhibitors. Such adverse effects may be prevented by administration of an appropriate form of vitamin B₆, or provide clues of how to modify these drugs to help reduce their hPL kinase inhibitory effects.

  13. Detailed search for protein kinase(s) involved in plasma membrane H+-ATPase activity regulation of yeast cells.

    Science.gov (United States)

    Pereira, Renata R; Castanheira, Diogo; Teixeira, Janaina A; Bouillet, Leoneide E M; Ribeiro, Erica M C; Trópia, Maria M J; Alvarez, Florencia; Correa, Lygia F M; Mota, Bruno E F; Conceição, Luis Eduardo F R; Castro, Ieso M; Brandão, Rogelio L

    2015-03-01

    This study displays a screening using yeast strains deficient in protein kinases known to exist in Saccharomyces cerevisiae. From 95 viable single mutants, 20 mutants appear to be affected in the glucose-induced extracellular acidification. The mutants that are unaffected in calcium signaling were tested for their sensitivity to hygromycin B. Furthermore, we verified whether the remaining mutants produced enzymes that are appropriately incorporated at plasma membrane. Finally, we measure the kinetic properties of the enzyme in purified plasma membranes from glucose-starved as well as glucose-fermenting cells. We confirmed the kinase Ptk2 involvement in H(+)-ATPase regulation (increase of affinity for ATP). However, the identification of the kinase(s) responsible for phosphorylation that leads to an increase in Vmax appears to be more complex. Complementary experiments were performed to check how those protein kinases could be related to the control of the plasma membrane H(+)-ATPase and/or the potential membrane. In summary, our results did not permit us to identify the protein kinase(s) involved in regulating the catalytic efficiency of the plasma membrane H(+)-ATPase. Therefore, our results indicate that the current regulatory model based on the phosphorylation of two different sites located in the C-terminus tail of the enzyme could be inappropriate.

  14. Antibiotics promote aggregation within aquatic bacterial communities

    Directory of Open Access Journals (Sweden)

    Gianluca eCorno

    2014-07-01

    Full Text Available The release of antibiotics (AB into the environment poses several threats for human health due to potential development of ABresistant natural bacteria. Even though the use of low-dose antibiotics has been promoted in health care and farming, significant amounts of AB are observed in aquatic environments. Knowledge on the impact of AB on natural bacterial communities is missing both in terms of spread and evolution of resistance mechanisms, and of modifications of community composition and productivity. New approaches are required to study the response of microbial communities rather than individual resistance genes. In this study a chemostat-based experiment with 4 coexisting bacterial strains has been performed to mimicking the response of a freshwater bacterial community to the presence of antibiotics in low and high doses. Bacterial abundance rapidly decreased by 75% in the presence of AB, independently of their concentration, and remained constant until the end of the experiment. The bacterial community was mainly dominated by Aeromonas hydrophila and Brevundimonas intermedia while the other two strains, Micrococcus luteus and Rhodococcus sp. never exceed 10%. Interestingly, the bacterial strains, which were isolated at the end of the experiment, were not AB-resistant, while reassembled communities composed of the 4 strains, isolated from treatments under AB stress, significantly raised their performance (growth rate, abundance in the presence of AB compared to the communities reassembled with strains isolated from the treatment without AB. By investigating the phenotypic adaptations of the communities subjected to the different treatments, we found that the presence of AB significantly increased co-aggregation by 5-6 fold.These results represent the first observation of co-aggregation as a successful strategy of AB resistance based on phenotype in aquatic bacterial communities, and can represent a fundamental step in the understanding of

  15. Photoinactivation of major bacterial pathogens in aquaculture

    Directory of Open Access Journals (Sweden)

    Heyong Jin Roh

    2016-08-01

    Full Text Available Abstract Background Significant increases in the bacterial resistance to various antibiotics have been found in fish farms. Non-antibiotic therapies for infectious diseases in aquaculture are needed. In recent years, light-emitting diode technology has been applied to the inactivation of pathogens, especially those affecting humans. The purpose of this study was to assess the effect of blue light (wavelengths 405 and 465 nm on seven major bacterial pathogens that affect fish and shellfish important in aquaculture. Results We successfully demonstrate inactivation activity of a 405/465-nm LED on selected bacterial pathogens. Although some bacteria were not fully inactivated by the 465-nm light, the 405-nm light had a bactericidal effect against all seven pathogens, indicating that blue light can be effective without the addition of a photosensitizer. Photobacterium damselae, Vibrio anguillarum, and Edwardsiella tarda were the most susceptible to the 405-nm light (36.1, 41.2, and 68.4 J cm−2, respectively, produced one log reduction in the bacterial populations, whereas Streptococcus parauberis was the least susceptible (153.8 J cm−2 per one log reduction. In general, optical density (OD values indicated that higher bacterial densities were associated with lower inactivating efficacy, with the exception of P. damselae and Vibrio harveyi. In conclusion, growth of the bacterial fish and shellfish pathogens evaluated in this study was inactivated by exposure to either the 405- or 465-nm light. In addition, inactivation was dependent on exposure time. Conclusions This study presents that blue LED has potentially alternative therapy for treating fish and shellfish bacterial pathogens. It has great advantages in aspect of eco-friendly treating methods differed from antimicrobial methods.

  16. Kinase Inhibitor Screening Identifies Cyclin-Dependent Kinases and Glycogen Synthase Kinase 3 as Potential Modulators of TDP-43 Cytosolic Accumulation during Cell Stress.

    Science.gov (United States)

    Moujalled, Diane; James, Janine L; Parker, Sarah J; Lidgerwood, Grace E; Duncan, Clare; Meyerowitz, Jodi; Nonaka, Takashi; Hasegawa, Masato; Kanninen, Katja M; Grubman, Alexandra; Liddell, Jeffrey R; Crouch, Peter J; White, Anthony R

    2013-01-01

    Abnormal processing of TAR DNA binding protein 43 (TDP-43) has been identified as a major factor in neuronal degeneration during amyotrophic lateral sclerosis (ALS) or frontotemporal lobar degeneration (FTLD). It is unclear how changes to TDP-43, including nuclear to cytosolic translocation and subsequent accumulation, are controlled in these diseases. TDP-43 is a member of the heterogeneous ribonucleoprotein (hnRNP) RNA binding protein family and is known to associate with cytosolic RNA stress granule proteins in ALS and FTLD. hnRNP trafficking and accumulation is controlled by the action of specific kinases including members of the mitogen-activated protein kinase (MAPK) pathway. However, little is known about how kinase pathways control TDP-43 movement and accumulation. In this study, we used an in vitro model of TDP-43-positve stress granule formation to screen for the effect of kinase inhibitors on TDP-43 accumulation. We found that while a number of kinase inhibitors, particularly of the MAPK pathways modulated both TDP-43 and the global stress granule marker, human antigen R (HuR), multiple inhibitors were more specific to TDP-43 accumulation, including inhibitors of cyclin-dependent kinases (CDKs) and glycogen synthase kinase 3 (GSK3). Close correlation was observed between effects of these inhibitors on TDP-43, hnRNP K and TIAR, but often with different effects on HuR accumulation. This may indicate a potential interaction between TDP-43, hnRNP K and TIAR. CDK inhibitors were also found to reverse pre-formed TDP-43-positive stress granules and both CDK and GSK3 inhibitors abrogated the accumulation of C-terminal TDP-43 (219-414) in transfected cells. Further studies are required to confirm the specific kinases involved and whether their action is through phosphorylation of the TDP-43 binding partner hnRNP K. This knowledge provides a valuable insight into the mechanisms controlling abnormal cytoplasmic TDP-43 accumulation and may herald new opportunities

  17. Kinase Inhibitor Screening Identifies Cyclin-Dependent Kinases and Glycogen Synthase Kinase 3 as Potential Modulators of TDP-43 Cytosolic Accumulation during Cell Stress.

    Directory of Open Access Journals (Sweden)

    Diane Moujalled

    Full Text Available Abnormal processing of TAR DNA binding protein 43 (TDP-43 has been identified as a major factor in neuronal degeneration during amyotrophic lateral sclerosis (ALS or frontotemporal lobar degeneration (FTLD. It is unclear how changes to TDP-43, including nuclear to cytosolic translocation and subsequent accumulation, are controlled in these diseases. TDP-43 is a member of the heterogeneous ribonucleoprotein (hnRNP RNA binding protein family and is known to associate with cytosolic RNA stress granule proteins in ALS and FTLD. hnRNP trafficking and accumulation is controlled by the action of specific kinases including members of the mitogen-activated protein kinase (MAPK pathway. However, little is known about how kinase pathways control TDP-43 movement and accumulation. In this study, we used an in vitro model of TDP-43-positve stress granule formation to screen for the effect of kinase inhibitors on TDP-43 accumulation. We found that while a number of kinase inhibitors, particularly of the MAPK pathways modulated both TDP-43 and the global stress granule marker, human antigen R (HuR, multiple inhibitors were more specific to TDP-43 accumulation, including inhibitors of cyclin-dependent kinases (CDKs and glycogen synthase kinase 3 (GSK3. Close correlation was observed between effects of these inhibitors on TDP-43, hnRNP K and TIAR, but often with different effects on HuR accumulation. This may indicate a potential interaction between TDP-43, hnRNP K and TIAR. CDK inhibitors were also found to reverse pre-formed TDP-43-positive stress granules and both CDK and GSK3 inhibitors abrogated the accumulation of C-terminal TDP-43 (219-414 in transfected cells. Further studies are required to confirm the specific kinases involved and whether their action is through phosphorylation of the TDP-43 binding partner hnRNP K. This knowledge provides a valuable insight into the mechanisms controlling abnormal cytoplasmic TDP-43 accumulation and may herald new

  18. [Protein kinase C activation induces platelet apoptosis].

    Science.gov (United States)

    Zhao, Li-Li; Chen, Meng-Xing; Zhang, Ming-Yi; Dai, Ke-Sheng

    2013-10-01

    Platelet apoptosis elucidated by either physical or chemical compound or platelet storage occurs wildly, which might play important roles in controlling the numbers and functions of circulated platelets, or in the development of some platelet-related diseases. However, up to now, a little is known about the regulatory mechanisms of platelet apoptosis. Protein kinase C (PKC) is highly expressed in platelets and plays central roles in regulating platelet functions. Although there is evidence indicating that PKC is involved in the regulation of apoptosis of nucleated cells, it is still unclear whether PKC plays a role in platelet apoptosis. The aim of this study was to investigate the role of PKC in platelet apoptosis. The effects of PKC on mitochondrial membrane potential (ΔΨm), phosphatidylserine (PS) exposure, and caspase-3 activation of platelets were analyzed by flow cytometry and Western blot. The results showed that the ΔΨm depolarization in platelets was induced by PKC activator in time-dependent manner, and the caspase-3 activation in platelets was induced by PKC in concentration-dependent manner. However, the platelets incubated with PKC inhibitor did not results in ΔΨm depolarization and PS exposure. It is concluded that the PKC activation induces platelet apoptosis through influencing the mitochondrial functions and activating caspase 3. The finds suggest a novel mechanism for PKC in regulating platelet numbers and functions, which has important pathophysiological implications for thrombosis and hemostasis.

  19. Focal adhesion kinase - the reversible molecular mechanosensor

    CERN Document Server

    Bell, Samuel

    2016-01-01

    Sensors are the first element of the pathways that control the response of cells to their environment. After chemical, the next most important cue is mechanical, and protein complexes that produce or enable a chemical signal in response to a mechanical stimulus are called mechanosensors. There is a sharp distinction between sensing an external force or pressure/tension applied to the cell, and sensing the mechanical stiffness of the environment. We call the first mechanosensitivity of the 1st kind, and the latter mechanosensitivity of the 2nd kind. There are two variants of protein complexes that act as mechanosensors of the 2nd kind: producing the one-off or a reversible action. The latent complex of TGF-beta is an example of the one-off action: on the release of active TGF-beta signal, the complex is discarded and needs to be replaced. In contrast, the focal adhesion kinase (FAK) in a complex with integrin is a reversible mechanosensor, which initiates the chemical signal in its active phosphorylated confor...

  20. The flagellar adenylate kinases of Trypanosoma cruzi.

    Science.gov (United States)

    Camara, María de los Milagros; Bouvier, León A; Miranda, Mariana R; Pereira, Claudio A

    2015-01-01

    Adenylate kinases (ADK) are key enzymes involved in cell energy management. Trypanosomatids present the highest number of variants in a single cell in comparison with the rest of the living organisms. In this work, we characterized two flagellar ADKs from Trypanosoma cruzi, called TcADK1 and TcADK4, which are also located in the cell cytosol. Interestingly, TcADK1 presents a stage-specific expression. This variant was detected in epimastigotes cells, and was completely absent in trypomastigotes and amastigotes, while TcADK4 is present in the major life cycle stages of T. cruzi. Both variants are also regulated, in opposite ways, along the parasite growth curve suggesting that their expression depends on the intra- and extracellular conditions. Both, TcADK1 and TcADK4 present N-terminal extension that could be responsible for their subcellular localization. The presence of ADK variants in the flagellum would be critical for the provision of energy in a process of high ATP consumption such as cell motility.

  1. Casein kinase-2 structure-function relationship

    DEFF Research Database (Denmark)

    Boldyreff, B; Meggio, F; Pinna, L A

    1992-01-01

    Nine mutants of human casein kinase-2 beta subunit have been created and assayed for their ability to assemble with the catalytic alpha subunit to give, at a 1:1 molar ratio, a fully competent CK-2 holoenzyme as judged by the following criteria: 1) the generation of an active heterotetrameric form......, consequently, stimulation of activity. This indicates that residue(s) located in the 171-209 sequence is essential for reconstitution. Also a four residue's N-terminal deletion (removing the autophosphorylation site) and single to quintuple substitutions of alanine for the acidic residues clustered in the 55......-70 sequence give rise to mutants that still assemble with the alpha subunit to give a tetrameric holoenzyme. However, in the case of the mutants A57,59, A63,64, A59-61,63,64 in vitro assembly with the CK-2 alpha subunit was not complete. There were also intermediate complexes, free alpha-subunit and beta...

  2. Targeting PI3 kinase in cancer.

    Science.gov (United States)

    Bauer, Todd M; Patel, Manish R; Infante, Jeffrey R

    2015-02-01

    The PI3K/Akt/mTOR pathway is the most frequently known activated aberrant pathway in human cancers. Pathologic activation can occur at multiple levels along the signaling pathway by a variety of mechanisms, including point mutations, amplifications, and inactivation of tumor suppressor genes. This pathway is also a known resistance pathway, as it can be activated by both receptor tyrosine kinases and other oncogenes. mTOR inhibitors were the first targeted molecules in this pathway, and have already been FDA-approved in multiple indications. Because of the broad potential applications of inhibiting this pathway upstream of mTOR, multiple compounds targeting PI3K are in development. In this review, we discuss the clinical development of these inhibitors, including dual PI3K/mTOR inhibitors, pan-PI3K inhibitors, and isoform-selective PI3K inhibitors. Common adverse events, including rash, nausea, vomiting, diarrhea, and hyperglycemia, have created a narrow therapeutic window for all classes of PI3K inhibitors. Furthermore, single agent clinical activity has also been limited, with the exception of isoform-selective inhibitors, particularly the PI3Kδ and PI3Kγ inhibitors in hematologic malignancies. The future role of inhibitors of the PI3K/Akt/mTOR pathway in the clinical practice of oncology likely depends on the development of patient selection strategies and the results of combination trials that are currently ongoing.

  3. Putative modifier genes in mevalonate kinase deficiency.

    Science.gov (United States)

    Marcuzzi, Annalisa; Vozzi, Diego; Girardelli, Martina; Tricarico, Paola Maura; Knowles, Alessandra; Crovella, Sergio; Vuch, Josef; Tommasini, Alberto; Piscianz, Elisa; Bianco, Anna Monica

    2016-04-01

    Mevalonate kinase deficiency (MKD) is an autosomal recessive auto‑inflammatory disease, caused by impairment of the mevalonate pathway. Although the molecular mechanism remains to be elucidated, there is clinical evidence suggesting that other regulatory genes may be involved in determining the phenotype. The identification of novel target genes may explain non‑homogeneous genotype‑phenotype correlations, and provide evidence in support of the hypothesis that novel regulatory genes predispose or amplify deregulation of the mevalonate pathway in this orphan disease. In the present study, DNA samples were obtained from five patients with MKD, which were then analyzed using whole exome sequencing. A missense variation in the PEX11γ gene was observed in homozygosis in P2, possibly correlating with visual blurring. The UNG rare gene variant was detected in homozygosis in P5, without correlating with a specific clinical phenotype. A number of other variants were found in the five analyzed DNA samples from the MKD patients, however no correlation with the phenotype was established. The results of the presents study suggested that further analysis, using next generation sequencing approaches, is required on a larger sample size of patients with MKD, who share the same MVK mutations and exhibit 'extreme' clinical phenotypes. As MVK mutations may be associated with MKD, the identification of specific modifier genes may assist in providing an earlier diagnosis.

  4. Molecular diagnosis of bacterial vaginosis: Does adjustment for total bacterial load or human cellular content improve diagnostic performance?

    Science.gov (United States)

    Plummer, E L; Garland, S M; Bradshaw, C S; Law, M G; Vodstrcil, L A; Hocking, J S; Fairley, C K; Tabrizi, S N

    2017-02-01

    We investigated the utility of quantitative PCR assays for diagnosis of bacterial vaginosis and found that while the best model utilized bacterial copy number adjusted for total bacterial load (sensitivity=98%, specificity=93%, AUC=0.95[95%CI=0.93,0.97]), adjusting for total bacterial or human cell load did not consistently increase the diagnostic performance of the assays.

  5. Virulence regulation with Venus flytrap domains: structure and function of the periplasmic moiety of the sensor-kinase BvgS.

    Directory of Open Access Journals (Sweden)

    Elian Dupré

    2015-03-01

    Full Text Available Two-component systems (TCS represent major signal-transduction pathways for adaptation to environmental conditions, and regulate many aspects of bacterial physiology. In the whooping cough agent Bordetella pertussis, the TCS BvgAS controls the virulence regulon, and is therefore critical for pathogenicity. BvgS is a prototypical TCS sensor-kinase with tandem periplasmic Venus flytrap (VFT domains. VFT are bi-lobed domains that typically close around specific ligands using clamshell motions. We report the X-ray structure of the periplasmic moiety of BvgS, an intricate homodimer with a novel architecture. By combining site-directed mutagenesis, functional analyses and molecular modeling, we show that the conformation of the periplasmic moiety determines the state of BvgS activity. The intertwined structure of the periplasmic portion and the different conformation and dynamics of its mobile, membrane-distal VFT1 domains, and closed, membrane-proximal VFT2 domains, exert a conformational strain onto the transmembrane helices, which sets the cytoplasmic moiety in a kinase-on state by default corresponding to the virulent phase of the bacterium. Signaling the presence of negative signals perceived by the periplasmic domains implies a shift of BvgS to a distinct state of conformation and activity, corresponding to the avirulent phase. The response to negative modulation depends on the integrity of the periplasmic dimer, indicating that the shift to the kinase-off state implies a concerted conformational transition. This work lays the bases to understand virulence regulation in Bordetella. As homologous sensor-kinases control virulence features of diverse bacterial pathogens, the BvgS structure and mechanism may pave the way for new modes of targeted therapeutic interventions.

  6. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  7. Extending Thymidine Kinase Activity to the Catalytic Repertoire of Human Deoxycytidine Kinase

    Energy Technology Data Exchange (ETDEWEB)

    Hazra, Saugata; Sabini, Eliszbetta; Ort, Stephan; Konrad, Manfred; Lavie, Arnon; (UIC); (MXPL-G)

    2009-03-04

    Salvage of nucleosides in the cytosol of human cells is carried out by deoxycytidine kinase (dCK) and thymidine kinase 1 (TK1). Whereas TK1 is only responsible for thymidine phosphorylation, dCK is capable of converting dC, dA, and dG into their monophosphate forms. Using structural data on dCK, we predicted that select mutations at the active site would, in addition to making the enzyme faster, expand the catalytic repertoire of dCK to include thymidine. Specifically, we hypothesized that steric repulsion between the methyl group of the thymine base and Arg104 is the main factor preventing the phosphorylation of thymidine by wild-type dCK. Here we present kinetic data on several dCK variants where Arg104 has been replaced by select residues, all performed in combination with the mutation of Asp133 to an alanine. We show that several hydrophobic residues at position 104 endow dCK with thymidine kinase activity. Depending on the exact nature of the mutations, the enzyme's substrate preference is modified. The R104M-D133A double mutant is a pyrimidine-specific enzyme due to large K{sub m} values with purines. The crystal structure of the double mutant R104M-D133A in complex with the L-form of thymidine supplies a structural explanation for the ability of this variant to phosphorylate thymidine and thymidine analogs. The replacement of Arg104 by a smaller residue allows L-dT to bind deeper into the active site, making space for the C5-methyl group of the thymine base. The unique catalytic properties of several of the mutants make them good candidates for suicide-gene/protein-therapy applications.

  8. EGFR kinase-dependent and kinase-independent roles in clear cell renal cell carcinoma.

    Science.gov (United States)

    Cossu-Rocca, Paolo; Muroni, Maria R; Sanges, Francesca; Sotgiu, Giovanni; Asunis, Anna; Tanca, Luciana; Onnis, Daniela; Pira, Giovanna; Manca, Alessandra; Dore, Simone; Uras, Maria G; Ena, Sara; De Miglio, Maria R

    2016-01-01

    Epidermal growth factor receptor (EGFR) is associated with progression of many epithelial malignancies and represents a significant therapeutic target. Although clear cell renal cell carcinoma (CCRCC) has been widely investigated for EGFR molecular alterations, genetic evidences of EGFR gene activating mutations and/or gene amplification have been rarely confirmed in the literature. Therefore, until now EGFR-targeted therapies in clinical trials have been demonstrated unsuccessful. New evidence has been given about the interactions between EGFR and the sodium glucose co-transporter-1 (SGLT1) in maintaining the glucose basal intracellular level to favour cancer cell growth and survival; thus a new functional role may be attributed to EGFR, regardless of its kinase activity. To define the role of EGFR in CCRCC an extensive investigation of genetic changes and functional kinase activities was performed in a series of tumors by analyzing the EGFR mutational status and expression profile, together with the protein expression of downstream signaling pathways members. Furthermore, we investigated the co-expression of EGFR and SGLT1 proteins and their relationships with clinic-pathological features in CCRCC. EGFR protein expression was identified in 98.4% of CCRCC. Furthermore, it was described for the first time that SGLT1 is overexpressed in CCRCC (80.9%), and that co-expression with EGFR is appreciable in 79.4% of the tumours. Moreover, the activation of downstream EGFR pathways was found in about 79.4% of SGLT1-positive CCRCCs. The mutational status analysis of EGFR failed to demonstrate mutations on exons 18 to 24 and the presence of EGFR-variantIII (EGFRvIII) in all CCRCCs analyzed. FISH analysis revealed absence of EGFR amplification, and high polysomy of chromosome 7. Finally, the EGFR gene expression profile showed gene overexpression in 38.2% of CCRCCs. Our study contributes to define the complexity of EGFR role in CCRCC, identifying its bivalent kinase

  9. Engineering and Functional Analysis of Mitotic Kinases Through Chemical Genetics.

    Science.gov (United States)

    Jones, Mathew J K; Jallepalli, Prasad V

    2016-01-01

    During mitosis, multiple protein kinases transform the cytoskeleton and chromosomes into new and highly dynamic structures that mediate the faithful transmission of genetic information and cell division. However, the large number and strong conservation of mammalian kinases in general pose significant obstacles to interrogating them with small molecules, due to the difficulty in identifying and validating those which are truly selective. To overcome this problem, a steric complementation strategy has been developed, in which a bulky "gatekeeper" residue within the active site of the kinase of interest is replaced with a smaller amino acid, such as glycine or alanine. The enlarged catalytic pocket can then be targeted in an allele-specific manner with bulky purine analogs. This strategy provides a general framework for dissecting kinase function with high selectivity, rapid kinetics, and reversibility. In this chapter we discuss the principles and techniques needed to implement this chemical genetic approach in mammalian cells.

  10. Skin problems and EGFR-tyrosine kinase inhibitor.

    Science.gov (United States)

    Kozuki, Toshiyuki

    2016-04-01

    Epidermal growth factor receptor inhibition is a good target for the treatment of lung, colon, pancreatic and head and neck cancers. Epidermal growth factor receptor-tyrosine kinase inhibitor was first approved for the treatment of advanced lung cancer in 2002. Epidermal growth factor receptor-tyrosine kinase inhibitor plays an essential role in the treatment of cancer, especially for patients harbouring epidermal growth factor receptor activating mutation. Hence, skin toxicity is the most concerning issue for the epidermal growth factor receptor-tyrosine kinase inhibitor treatment. Skin toxicity is bothersome and sometimes affects the quality of life and treatment compliance. Thus, it is important for physicians to understand the background and how to manage epidermal growth factor receptor-tyrosine kinase inhibitor-associated skin toxicity. Here, the author reviewed the mechanism and upfront preventive and reactive treatments for epidermal growth factor receptor inhibitor-associated skin toxicities.

  11. Tumor progression and the different faces of the PERK kinase.

    Science.gov (United States)

    Pytel, D; Majsterek, I; Diehl, J A

    2016-03-10

    The serine/threonine endoplasmic reticulum (ER) kinase, protein kinase R (PKR)-like ER kinase (PERK), is a pro-adaptive protein kinase whose activity is regulated indirectly by protein misfolding within the ER. As the oxidative folding environment in the ER is sensitive to a variety of cellular stresses, many of which occur during neoplastic transformation and in the tumor microenvironment, there has been considerable interest in defining whether PERK positively contributes to tumor progression and whether it represents a significant therapeutic target. Herein, we review the current knowledge of PERK-dependent signaling pathways, the contribution of downstream substrates including recently characterized new PERK substrates transcription factors Forkhead box O protein and diacyglycerol a lipid signaling second messenger, and efforts to develop small molecule PERK inhibitors.

  12. Regulatory crosstalk by protein kinases on CFTR trafficking and activity

    Science.gov (United States)

    Farinha, Carlos Miguel; Swiatecka-Urban, Agnieszka; Brautigan, David; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e. channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease.

  13. Roles of MAP kinase signaling pathway in oocyte meiosis

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Mitogen-activated protein kinase (MAPK) is a family of Ser/Thr protein kinases expressed widely in eukaryotic cells. MAPK is activated by a cascade of protein kinase phosphorylation and plays pivotal roles in regulating meiosis process in oocytes. As an important physical substrate of MAPK, p90rsk mediates numerous MAPK functions. MAPK was activated at G2/M transition during meiosis. Its activity reached the peak at MⅠ stage and maintained at this level until the time before the pronuclear formation after fertilization. There is complex interplay between MAPK and MPF in the meiosis regulation. Furthermore, other intracellular signal transducers, such as cAMP, protein kinase C and protein phosphotase, ect., also regulated the activity of MAPK at different stages during meiosis in oocytes. In the present article, the roles of MAPK signaling pathway in oocyte meiosis are reviewed and discussed.

  14. Microbial Degradation of Aniline by Bacterial Consortium

    Institute of Scientific and Technical Information of China (English)

    JIAN-LONG WANG; ZE-YU MAO; WEI-ZHONG WU

    2003-01-01

    Objective To investigate the characteristics of microbial degradation of aniline by a stable bacterial consortium. Methods The bacterial consortium was isolated from activated sludge treating chemical wastewater using aniline as the sole source of carbon and nitrogen by enrichment and isolation technique. The biomass was measured as optical density (OD) at 510 nm using a spectrophotometer. Aniline concentrations were determined by spectrophotometer. The intermediates of aniline degradation were identified by GC/MS method. Results The bacterial consortium could grow at a range of aniline concentrations between 50 and 500 mg/L. The optimal pH and temperature for aniline degradation were determined to be 7.0 and 30, respectively. The presence of NH4NO3 as an additional nitrogen source (100-500 mg/L) had no adverse effect on bacterial growth and aniline degradation. The presence of heavy metal ions, such as Co2+, Zn2+, Ni2+, Mn2+ and Cu2+ had an inhibitory effect on aniline degradation. Conclusions The isolated bacterial consortium candegrade aniline up to 500 mg/L effectively and tolerate some heavy metal ions that commonly exist in chemical wastewater. It has a potential to be applied in the practical treatment of aniline-containingwastewater.

  15. Bacterial infections in patients with liver cirrhosis

    Directory of Open Access Journals (Sweden)

    Giacomo Zaccherini

    2011-07-01

    Full Text Available Bacterial infections represent a frequent complication of liver cirrhosis carrying a significantly greater risk of morbidity and mortality as compared to that observed in non-cirrhotic patients. Such unfavourable prognosis is related to the systemic complications (liver and renal failure, shock, coagulopathy, multiple organ failure induced by a series of pro-inflammatory and immunological systems which are activated by bacteria and their pathogenetic products.The epidemiology of bacterial infections in cirrhosis has changed in the last years with a marked increase of Gram+ infections and the emergence of multi-resistant bacteria.The severity of liver disease represents the major clinical factor predisposing to bacterial infections, which are asymptomatic or paucisymptomatic at presentation in almost half of the cases. Aim of this review is to summarise the clinical and therapeutic aspects of bacterial infections in cirrhotic patients. The most common sites of infection are the urinary tract, ascites, blood, lungs and soft tissues.Beside antibiotics, it has been proposed the administration of human albumin to prevent the development of renal failure in patients with spontaneous bacterial peritonitis and, more recently, the use of hydrocortisone to treat cirrhotic patients with septic shock.

  16. Bacterial coinfections in children with viral wheezing.

    Science.gov (United States)

    Lehtinen, P; Jartti, T; Virkki, R; Vuorinen, T; Leinonen, M; Peltola, V; Ruohola, A; Ruuskanen, O

    2006-07-01

    Bacterial coinfections occur in respiratory viral infections, but the attack rates and the clinical profile are not clear. The aim of this study was to determine bacterial coinfections in children hospitalized for acute expiratory wheezing with defined viral etiology. A total of 220 children aged 3 months to 16 years were investigated. The viral etiology of wheezing was confirmed by viral culture, antigen detection, serologic investigation, and/or PCR. Specific antibodies to common respiratory bacteria were measured from acute and convalescent serum samples. All children were examined clinically for acute otitis media, and subgroups of children were examined radiologically for sinusitis and pneumonia. Rhinovirus (32%), respiratory syncytial virus (31%), and enteroviruses (31%) were the most common causative viruses. Serologic evidence of bacterial coinfection was found in 18% of the children. Streptococcus pneumoniae (8%) and Mycoplasma pneumoniae (5%) were the most common causative bacteria. Acute otitis media was diagnosed in 44% of the children. Chest radiographs showed alveolar infiltrates in 10%, and paranasal radiographs and clinical signs showed sinusitis in 17% of the older children studied. Leukocyte counts and serum C-reactive protein levels were low in a great majority of patients. Viral lower respiratory tract infection in children is often associated with bacterial-type upper respiratory tract infections. However, coexisting bacterial lower respiratory tract infections that induce systemic inflammatory response are seldom detected.

  17. Bacterial communities associated with the lichen symbiosis.

    Science.gov (United States)

    Bates, Scott T; Cropsey, Garrett W G; Caporaso, J Gregory; Knight, Rob; Fierer, Noah

    2011-02-01

    Lichens are commonly described as a mutualistic symbiosis between fungi and "algae" (Chlorophyta or Cyanobacteria); however, they also have internal bacterial communities. Recent research suggests that lichen-associated microbes are an integral component of lichen thalli and that the classical view of this symbiotic relationship should be expanded to include bacteria. However, we still have a limited understanding of the phylogenetic structure of these communities and their variability across lichen species. To address these knowledge gaps, we used bar-coded pyrosequencing to survey the bacterial communities associated with lichens. Bacterial sequences obtained from four lichen species at multiple locations on rock outcrops suggested that each lichen species harbored a distinct community and that all communities were dominated by Alphaproteobacteria. Across all samples, we recovered numerous bacterial phylotypes that were closely related to sequences isolated from lichens in prior investigations, including those from a lichen-associated Rhizobiales lineage (LAR1; putative N(2) fixers). LAR1-related phylotypes were relatively abundant and were found in all four lichen species, and many sequences closely related to other known N(2) fixers (e.g., Azospirillum, Bradyrhizobium, and Frankia) were recovered. Our findings confirm the presence of highly structured bacterial communities within lichens and provide additional evidence that these bacteria may serve distinct functional roles within lichen symbioses.

  18. Emerging bacterial pathogens: the past and beyond.

    Science.gov (United States)

    Vouga, M; Greub, G

    2016-01-01

    Since the 1950s, medical communities have been facing with emerging and reemerging infectious diseases, and emerging pathogens are now considered to be a major microbiologic public health threat. In this review, we focus on bacterial emerging diseases and explore factors involved in their emergence as well as future challenges. We identified 26 major emerging and reemerging infectious diseases of bacterial origin; most of them originated either from an animal and are considered to be zoonoses or from water sources. Major contributing factors in the emergence of these bacterial infections are: (1) development of new diagnostic tools, such as improvements in culture methods, development of molecular techniques and implementation of mass spectrometry in microbiology; (2) increase in human exposure to bacterial pathogens as a result of sociodemographic and environmental changes; and (3) emergence of more virulent bacterial strains and opportunistic infections, especially affecting immunocompromised populations. A precise definition of their implications in human disease is challenging and requires the comprehensive integration of microbiological, clinical and epidemiologic aspects as well as the use of experimental models. It is now urgent to allocate financial resources to gather international data to provide a better understanding of the clinical relevance of these waterborne and zoonotic emerging diseases.

  19. Pkh-kinases control eisosome assembly and organization

    OpenAIRE

    Walther, TC; Aguilar, PS; Fröhlich, F.; Chu, F.; Moreira, K.; Burlingame, Al; WALTER, P.

    2007-01-01

    Eisosomes help sequester a subgroup of plasma membrane proteins into discrete membrane domains that colocalize with sites of endocytosis. Here we show that the major eisosome component Pil1 in vivo is a target of the long-chain base (LCB, the biosynthetic precursors to sphingolipids)-signaling pathway mediated by the Pkh-kinases. Eisosomes disassemble if Pil1 is hyperphosphorylated (i) upon overexpression of Pkh-kinases, (ii) upon reducing LCB concentrations by inhibiting serine-palmitoyl tra...

  20. Purine inhibitors of protein kinases, G proteins and polymerases

    Energy Technology Data Exchange (ETDEWEB)

    Gray, Nathanael S.; Schultz, Peter; Kim, Sung-Hou; Meijer, Laurent

    2004-10-12

    The present invention relates to 2-N-substituted 6-(4-methoxybenzylamino)-9-isopropylpurines that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such 2-N-substituted 6-(4-methoxybenzylamino)-9-isopropylpurines to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.