WorldWideScience

Sample records for bacterial 23s rrna

  1. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... ribosomes. Nucleotide C2498 is situated within a highly conserved and heavily modified rRNA sequence, and YgdE's activity is influenced by other modification enzymes that target this region. Phylogenetically, YgdE is placed in the cluster of orthologous groups COG2933 together with S...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation at...

  2. Long PCR-RFLP of 16S-ITS-23S rRNA genes: a high-resolution molecular tool for bacterial genotyping

    Czech Academy of Sciences Publication Activity Database

    Zeng, Yonghui; Koblížek, Michal; Li, Y. X.; Liu, Y. P.; Feng, F. Y.; Ji, J. D.; Jian, J. C.; Wu, Z. H.

    2013-01-01

    Roč. 114, č. 2 (2013), s. 433-447. ISSN 1364-5072 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0110 Institutional support: RVO:61388971 Keywords : 16S-ITS-23S * bacterial genome * computer simulation Subject RIV: EE - Microbiology, Virology Impact factor: 2.386, year: 2013

  3. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    DEFF Research Database (Denmark)

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all...... with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin-fixed......, paraffin-embedded tissue from experimentally infected mice or from animals with a history of clinical salmonellosis. In these tissue sections the probe hybridized specifically to Salmonella serovars, allowing for the detection of single bacterial cells. The development of a fluorescence-labelled specific...

  4. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    DEFF Research Database (Denmark)

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all...... oligonucleotide probe makes the FISH technique a promising tool for the rapid identification of S. enterica in bacterial smears, as well as for the detection of S. enterica in histological tissue sections....... of the S. enterica subspecies and S. bongori, an 18-mer oligonucleotide probe was selected. The specificity of the probe was tested by in situ hybridization to bacterial cell smears of pur cultures. Forty-nine of 55 tested Salmonella serovars belonging to subspecies I, II, IIIb, IV, and VI hybridized...... with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin...

  5. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes

    OpenAIRE

    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.

    2000-01-01

    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  6. Functional interactions within 23S rRNA involving the peptidyltransferase center.

    OpenAIRE

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  7. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  8. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  9. Functional interactions within 23S rRNA involving the peptidyltransferase center

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  10. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  11. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.; Bujnicki, J. M.; Vester, B.; Long, Katherine

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  12. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T;

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  13. Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae

    OpenAIRE

    Pronk, Loes M; Sanderson, Kenneth E.

    2001-01-01

    Intervening sequences (IVSs) in the rrl genes for 23S rRNA are transcribed but later removed by RNase III without religation during RNA processing, leading to fragmented rRNA. We examined about 240 strains of the family Enterobacteriaceae for presence of IVSs using PCR. No IVSs were detected in strains belonging to Escherichia, Shigella, Enterobacter, Erwinia, Ewingella, Hafnia, Kluyvera, Morganella, Pantoea, or Serratia. Previously unreported IVSs were detected in Klebsiella oxytoca, Citroba...

  14. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.

    Science.gov (United States)

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B

    2016-04-01

    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  15. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  16. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    Science.gov (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  17. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Kaminska, Katarzyna H; Purta, Elzbieta; Hansen, Lykke H; Bujnicki, Janusz M; Vester, Birte; Long, Katherine S

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension...

  18. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    OpenAIRE

    wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative s...

  19. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P;

    2000-01-01

    Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification is...

  20. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B;

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  1. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    Institute of Scientific and Technical Information of China (English)

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  2. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Douthwaite, S

    1994-01-01

    enzyme efficiently modifies 23S rRNA in vitro. Removal of most of the 23S rRNA structure, so that only domain V (nucleotides 2000 to 2624) remains, does not affect the efficiency of modification by the methyltransferase. In addition, modification still occurs after the rRNA tertiary structure has been......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  3. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...... effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair by...... introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents and...

  4. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...... important exception, however, occurred at nucleotide A1067 within a terminal loop where thiostrepton protected the N-1 position while micrococcin rendered it more reactive. This difference correlates with the opposite effects of the two antibiotics on GTPase activity....... differ in their effects on GTP hydrolysis, which is inhibited by thiostrepton and stimulated by micrococcin. The interaction sites of both drugs were shown to occur within the nucleotide sequences A1067-A1098 within the protein L11 binding site on 23S RNA. This region of the ribosome structure is......A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site but...

  5. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    Science.gov (United States)

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  6. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    Directory of Open Access Journals (Sweden)

    Maiväli Ülo

    2005-07-01

    Full Text Available Abstract Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes.

  7. New mutation points in 23S rRNA gene associated with Helicobacter Pylori resistance to clarithromycin in northeast China

    Institute of Scientific and Technical Information of China (English)

    Qing Hao; Yan Li; Zhi-Jie Zhang; Yong Liu; Hong Gao

    2004-01-01

    AIM: To investigate the resistance rate of Helicobacter pylori (Hpylori) to clarithromycin, metronidazole, amoxicillin and tetracycline to guide clinical practice, and to study the mechanism of H pyloriresistant to clarithromycin.METHODS: Thirty H pyloristrains were isolated from the mucosa of peptic ulcer, gastric tumor and chronic gastritis patients, then the minimal inhibitory concentration (MIC) to clarithromycin, metronidazole, amoxicillin and tetracycline was evaluated by E-test method. The sequence analysis of PCR fragments was conducted in 23S rRNA gene of H pylori resistant to clarithromycin to get the resistance mechanism of the bacteria.RESULTS: Among 30 H pyloristrains, 7 cases were resistant to clarithromycin, 12 to metronidazole, 2 to tetracycline and no strain was found to be resistant to amoxicillin. The resistance rates were 23.3%, 40%, 6.7% and 0%,respectively. Three new mutation points were found to be related to the clarithromycin resistance in H pyloriisolates,which were G2224A, C2245T and T2289C.CONCLUSION: In northeast China, H pylorishows high resistance to metronidazole, while sensitive to amoxicillin.The mechanism of resistance to clarithromycin may be related to the mutation of G2224A, C2245T and T2289C in the 23S rRNA gene.

  8. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1999-01-01

    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  9. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    DEFF Research Database (Denmark)

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller;

    2011-01-01

    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in...

  10. 116S-23S rRNA Gene Intergenic Spacer Region Variability Helps Resolve Closely Related Sphingomonads

    Directory of Open Access Journals (Sweden)

    Sima eTokajian

    2016-02-01

    Full Text Available Sphingomonads comprise a physiologically versatile group many of which appear to be adapted to oligotrophic environments, but several also had features in their genomes indicative of host associations. In this study, the extent variability of the 16S-23S rDNA intergenic spacer (ITS sequences of 14 ATCC reference sphingomonad strains and 23 isolates recovered from drinking water was investigated through PCR amplification and sequencing. Sequencing analysis of the 16S-23S rRNA gene ITS region revealed that the ITS sizes for all studied isolates varied between 415 to 849 bp, while their G+C content was 42.2 mol% to 57.9 mol%. Five distinct ITS types were identified: ITSnone (without tRNA genes, ITSAla(TGC, ITSAla (TGC+Ile (GAT, ITSIle (GAT+Ala (TGC and ITS Ile (GAT+Pseudo. All of the identified tRNAAla (TGC molecules consisted of 73 bases, and all of the tRNAIle (GAT molecules consisted of 74 bases. We also detected striking variability in the size of the ITS region among the various examined isolates. Highest variability was detected within the ITS-2.

  11. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2008-01-01

    . However, YccW does not methylate assembled 50S subunits, and this is somewhat surprising as the published crystal structures show nucleotide C1962 to be fully accessible at the subunit interface. YccW-directed methylation at nucleotide C1962 is conserved in bacteria, and loss of this methylation in E....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  12. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    DEFF Research Database (Denmark)

    Xiong, L; Kloss, P; Douthwaite, S; Andersen, N M; Swaney, S; Shinabarger, D L; Mankin, A S

    2000-01-01

    resistance mutations were clustered in the vicinity of the central loop of domain V of 23S rRNA, suggesting that this rRNA region plays a major role in the interaction of the drug with the ribosome. Although the central loop of domain V is an essential integral component of the ribosomal peptidyl transferase......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis in...... the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized...

  13. YbeA is the m3Psi methyltransferase RlmH that targets nucleotide 1915 in 23S rRNA

    DEFF Research Database (Denmark)

    Purta, Elzbieta; Kaminska, Katarzyna H; Kasprzak, Joanna M;

    2008-01-01

    Pseudouridines in the stable RNAs of Bacteria are seldom subjected to further modification. There are 11 pseudouridine (Psi) sites in Escherichia coli rRNA, and further modification is found only at Psi1915 in 23S rRNA, where the N-3 position of the base becomes methylated. Here, we report the...... identity of the E. coli methyltransferase that specifically catalyzes methyl group addition to form m(3)Psi1915. Analyses of E. coli rRNAs using MALDI mass spectrometry showed that inactivation of the ybeA gene leads to loss of methylation at nucleotide Psi1915. Methylation is restored by complementing the...... knockout strain with a plasmid-encoded copy of ybeA. Homologs of the ybeA gene, and thus presumably the ensuing methylation at nucleotide m(3)Psi1915, are present in most bacterial lineages but are essentially absent in the Archaea and Eukaryota. Loss of ybeA function in E. coli causes a slight slowing of...

  14. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J;

    1999-01-01

    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within the...... functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift in the...... latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop that...

  15. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    OpenAIRE

    Ma Junling; Feng Guoshuang; Gu Liankun; Zhou Jing; Zhang Baozhen; Li Qiang; Shen Lin; Zhang Lian; Shen Jing; Liu Zhuoqi; You Wei-Cheng; Deng Dajun

    2008-01-01

    Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR) resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA) and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC) in 2000. DNA was extracted from fa...

  16. Acquired macrolide resistance in the human intestinal strain Lactobacillus rhamnosus E41 associated with a transition mutation in 23S rRNA genes

    OpenAIRE

    Flórez García, Ana Belén; Ladero Losada, Víctor Manuel; Álvarez Martín, Pablo; Ammor, Mohammed Salim; Álvarez González, Miguel Ángel; Mayo Pérez, Baltasar

    2007-01-01

    Restriction fragment length polymorphism and DNA sequencing of polymerase chain reaction (PCR) products showed that a Lactobacillus rhamnosus strain of human origin resistant to macrolides, from which no resistance determinants have been detected by specific PCR and microarray screening, contained a heterozygous A → G transition mutation at position 2058 (Escherichia coli numbering) of its 23S rRNA genes.

  17. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    Science.gov (United States)

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  18. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Directory of Open Access Journals (Sweden)

    Ma Junling

    2008-05-01

    Full Text Available Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC in 2000. DNA was extracted from fasting gastric juice at the end of the intervention trial in 2003. H. pylori infection was determined by H. pylori-specific 23S rRNA PCR, ELISA, and13C-urea breath test assays. Mutations of the 23S rRNA gene were detected by RFLP assays. Results The presence of 23S rRNA due to H. pylori infection in the OA group remained lower than that in the placebo group 7.3 yrs after OA-therapy [51.1% (157/307 vs. 83.9% (260/310, p = 0.0000]. In the OAC group, the 23S rRNA detection rate was 26.8% (41/153 three yrs after OAC-treatment. The A2143G mutation rate among the 23S rRNA-positive subjects in the OAC group [31.7% (13/41] was significantly higher than that in the OA group [10.2% (16/157] and the placebo group [13.8% (36/260]. The frequency of the AAGGG → CTTCA (2222–2226 and AACC → GAAG (2081–2084 sequence alterations in the OAC group was also significantly higher than those in the OA group and the placebo group. Conclusion Primary prevalence of the A2143G mutation was 10~14% among Chinese population without history of CLR therapy. Administration of CLR to eliminate H. pylori infection increased the prevalence of the A2143G mutation in Chinese subjects (32% significantly.

  19. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  20. 奇异变形杆菌分离株23S rRNA序列分析%Sequence analysis of 23S rRNA genes of Proteus mirabilis

    Institute of Scientific and Technical Information of China (English)

    王慧; 朱瑞良; 朱明华; 谭燕玲; 孙振红; 魏凯; 盛鹏程; 王新建

    2011-01-01

    通过PCR反应扩增7株鸡奇异变形杆菌和1株兔奇异变形杆菌的23SrRNA基因片段(1 045bp),经克隆测序,用DNAStar分析软件将所获得的序列与GenBank中收录的奇异变形杆菌、普通变形杆菌以及其他相近属的23S rRNA基因序列进行同源性比较,并由此构建奇异变形杆菌系统进化发生树.结果表示,本实验室保存的7株鸡奇异变形杆菌核苷酸序列与GenBank中收录的奇异变形杆菌核苷酸序列同源性为99.4%~99.8%,与兔奇异变形杆菌核苷酸序列同源性为98.8%~99.3%,与普通变形杆茵的核苷酸序列同源性为95.4%~96.2%,而与其他相近属同源性只有92.9%~93.4%.结果表明,23S rRNA基因序列分析可以作为鉴定奇异变形杆茵的一种快速、简便的方法.%To assess the evolution of Proteus mirabilis by 23S rRNA genes,To establish the sequence analysis of 23S rRNA of Proteus mirabilis was analyzed. The fragments (1 045 bp) of 23S rRNA genes of seven chicken Proteus mirabilis strains and one rabbit Proteus mirabilis strain were amplified by PCR and were sequenced. The sequences obtained in this paper were compared with the Proteus mirabilis 23S rRNA sequence reported in GenBank and other similar generas by the software of DNAStar analyses. The phylogenetic tree of Proteus mirabilis strains was established. Results showed the homologies between seven chicken Proteus mirabilis strains and the reported one strain in GenBank were 99.4%-99.8% ,and were 98.8%-99.3% identical to the rabbit Proteus mirabilis strains,were 95.4 %-96.2% identical to Proteus vulgaris, were 92. 9%-93.4 % identical to other similar generas. The result shown that 23S rRNA sequence analyses may be a reliable and rapid way for identification of Proteus mirabilis.

  1. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    OpenAIRE

    Neumann Elisabeth; Teixeira Santuza MR; Horta Maria F; Mota Rodrigo M; Moreira João; Nicoli Jacques R.; Nunes Álvaro C

    2005-01-01

    Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA i...

  2. Use of 16S-23S rRNA Intergenic Spacer Region PCR and Repetitive Extragenic Palindromic PCR Analyses of Escherichia coli Isolates To Identify Nonpoint Fecal Sources

    OpenAIRE

    Seurinck, Sylvie; Verstraete, Willy; Siciliano, Steven D.

    2003-01-01

    Despite efforts to minimize fecal input into waterways, this kind of pollution continues to be a problem due to an inability to reliably identify nonpoint sources. Our objective was to find candidate source-specific Escherichia coli fingerprints as potential genotypic markers for raw sewage, horses, dogs, gulls, and cows. We evaluated 16S-23S rRNA intergenic spacer region (ISR)-PCR and repetitive extragenic palindromic (rep)-PCR analyses of E. coli isolates as tools to identify nonpoint fecal...

  3. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    Science.gov (United States)

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected. PMID:27100771

  4. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Energy Technology Data Exchange (ETDEWEB)

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  5. Cleavage of the sarcin–ricin loop of 23S rRNA differentially affects EF-G and EF-Tu binding

    OpenAIRE

    García-Ortega, Lucía; Álvarez-García, Elisa; Gavilanes, José G.; Martínez-del-Pozo, Álvaro; Joseph, Simpson

    2010-01-01

    Ribotoxins are potent inhibitors of protein biosynthesis and inactivate ribosomes from a variety of organisms. The ribotoxin α-sarcin cleaves the large 23S ribosomal RNA (rRNA) at the universally conserved sarcin–ricin loop (SRL) leading to complete inactivation of the ribosome and cellular death. The SRL interacts with translation factors that hydrolyze GTP, and it is important for their binding to the ribosome, but its precise role is not yet understood. We studied the effect of α-sarcin on...

  6. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    Science.gov (United States)

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  7. VapC20 of Mycobacterium tuberculosis cleaves the Sarcin-Ricin loop of 23S rRNA

    OpenAIRE

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K.; Gerdes, Kenn

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin–antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits translation by cleavage of the Sarcin–Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression ...

  8. VapC20 of Mycobacterium tuberculosis Cleaves the Sarcin Ricin Loop of 23S rRNA

    DEFF Research Database (Denmark)

    Winther, Kristoffer Skovbo; Brodersen, Ditlev E.; Brown, Alistair K;

    2013-01-01

    exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing that the...... translation by cleavage of the Sarcin–Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression of the antitoxin, thereby raising the possibility that vapC20 contributes to the extreme persistence...... structure rather than the exact sequence of the SRL is important for this activity...

  9. Purification, crystallization and preliminary X-ray diffraction analysis of the 23S rRNA methyltransferase RlmJ from Escherichia coli

    International Nuclear Information System (INIS)

    The 23S rRNA methyltransferase RlmJ from E. coli has been cloned, expressed, purified and crystallized. X-ray diffraction data to 1.85 Å resolution have been collected from the apo RlmJ crystals. Methyltransferase RlmJ uses the cofactor S-adenosylmethionine to methylate the exocyclic nitrogen N6 of nucleotide A2030 in 23S rRNA during ribosome assembly in Escherichia coli. RlmJ with a C-terminal hexahistidine tag was overexpressed in E. coli and purified as a monomer using Ni2+-affinity and size-exclusion chromatography. The recombinant RlmJ was crystallized using the sitting-drop vapour-diffusion method and a full data set was collected to 1.85 Å resolution from a single apo crystal. The crystals belonged to space group P21, with unit-cell parameters a = 46.9, b = 77.8, c = 82.5 Å, β = 104°. Data analysis suggested two molecules per asymmetric unit and a Matthews coefficient of 2.20 Å3 Da−1

  10. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    Science.gov (United States)

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  11. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    DEFF Research Database (Denmark)

    Douthwaite, S; Aagaard, C

    1993-01-01

    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  12. VapC20 of Mycobacterium tuberculosis cleaves the sarcin-ricin loop of 23S rRNA.

    Science.gov (United States)

    Winther, Kristoffer S; Brodersen, Ditlev E; Brown, Alistair K; Gerdes, Kenn

    2013-01-01

    The highly persistent and often lethal human pathogen, Mycobacterium tuberculosis contains at least 88 toxin-antitoxin genes. More than half of these encode VapC PIN domain endoribonucleases that inhibit cell growth by unknown mechanisms. Here we show that VapC20 of M. tuberculosis inhibits translation by cleavage of the Sarcin-Ricin loop (SRL) of 23S ribosomal RNA at the same position where Sarcin and other eukaryotic ribotoxins cleave. Toxin-inhibited cells can be rescued by the expression of the antitoxin, thereby raising the possibility that vapC20 contributes to the extreme persistence exhibited by M. tuberculosis. VapC20 cleavage is inhibited by mutations in the SRL that flank the cleavage site but not by changes elsewhere in the loop. Disruption of the SRL stem abolishes cleavage; however, further mutations that restore the SRL stem structure restore cleavage, revealing that the structure rather than the exact sequence of the SRL is important for this activity. PMID:24225902

  13. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea;

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  14. Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling

    Directory of Open Access Journals (Sweden)

    Neumann Elisabeth

    2005-03-01

    Full Text Available Abstract Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS, were typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR products. The set of enzymes chosen differentiates most species of Lactobacillus genus and also co-isolated bacteria such as Enterococcus, Streptococcus, Weissella, Staphylococcus, and Escherichia species. The in silico predictions of restriction patterns generated by the Lactobacillus shorter spacers digested with 11 restriction enzymes with 6 bp specificities allowed us to distinguish almost all isolates at the species level but not at the subspecies one. Simultaneous theoretical digestions of the three spacers (long, medium and short with the same set of enzymes provided more complex patterns and allowed us to distinguish the species without purifying and cloning of PCR products. Conclusion Lactobacillus isolates and several other strains of bacteria co-isolated on MRS medium from gastrointestinal ecosystem and fermented food products could be identified using DNA fingerprints generated by restriction endonucleases. The methodology based on amplified ribosomal DNA restriction analysis (ARDRA is easier, faster and more accurate than the current methodologies based on fermentation profiles, used in most laboratories for the purpose of identification of these bacteria in different prospecting studies.

  15. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. PMID:26800847

  16. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  17. Identification and phyletic evolution analysis of Proteus mirabilis strains by PCR and restriction fragment length polymorphism of 16S-23S rRNA gene intergenic spacer region%16S-23S rRNA基因间隔序列PCR及RFLP对奇异变形杆菌分离株的鉴别与系统发育分析

    Institute of Scientific and Technical Information of China (English)

    崔国林; 朱瑞良; 左雪梅; 钟世勋; 杨世发; 梁漫飞; 孙婧; 刘静静

    2013-01-01

    根据临床常见致病菌16S-23S rRNA基因间隔序列(ISR)两端的16S及23S rRNA保守序列设计PCR扩增的通用引物,对9株奇异变形杆菌和6株相近菌株应用通用引物PCR扩增16S-23S rRNA ISR序列.通过PCR长度多态性比较、RFLP分析以及部分序列测序比较,分析鉴别奇异变形杆菌.结果显示,PCR长度多态性可以将奇异变形杆菌同其余菌种进行区分;RFLP分析可以将所有试验菌种进行区分;部分序列测序可以对奇异变形杆菌进行分型.由此表明,16S 23S rRNA ISR序列PCR及RFLP分析可以简单、快速、准确的鉴定奇异变形杆菌.%To establish a new method to identify Proteus mirabilis strains, according to the conserved sequences of 16S and 23S which located on both ends of the clinical common pathogenic bacteria 16S-23S rRNA gene intergenic spacer region (ISR),a pair of universal primers was designed. Nine Proteus mirabilis strains and six similar bacteria strains were amplified by PCR and identified by the PCR length polymorphism comparison,restriction fragment length polymorphism (RFLP) analysis and partial sequences sequencing. The result showed that Proteus mirabilis strains could be discriminated from other similar bacteria strains by PCR length polymorphism comparison,all of test organism could be discriminated by RFLP and Proteus mirabilis strains could be typed by partial sequences sequencing. The result indicated that the identification method based on the 16S-23S rRNA ISR, using PCR and PCR-RFLP,is very suitable for the rapid low-cost identification and discrimination of Proteus mirabilis strains from other phylogenetically related bacteria strains.

  18. The unusual 23S rRNA gene of Coxiella burnetii: two self-splicing group I introns flank a 34-base-pair exon, and one element lacks the canonical omegaG.

    Science.gov (United States)

    Raghavan, Rahul; Miller, Scott R; Hicks, Linda D; Minnick, Michael F

    2007-09-01

    We describe the presence and characteristics of two self-splicing group I introns in the sole 23S rRNA gene of Coxiella burnetii. The two group I introns, Cbu.L1917 and Cbu.L1951, are inserted at sites 1917 and 1951 (Escherichia coli numbering), respectively, in the 23S rRNA gene of C. burnetii. Both introns were found to be self-splicing in vivo and in vitro even though the terminal nucleotide of Cbu.L1917 is adenine and not the canonical conserved guanine, termed OmegaG, found in Cbu.L1951 and all other group I introns described to date. Predicted secondary structures for both introns were constructed and revealed that Cbu.L1917 and Cbu.L1951 were group IB2 and group IA3 introns, respectively. We analyzed strains belonging to eight genomic groups of C. burnetii to determine sequence variation and the presence or absence of the elements and found both introns to be highly conserved (>/=99%) among them. Although phylogenetic analysis did not identify the specific identities of donors, it indicates that the introns were likely acquired independently; Cbu.L1917 was acquired from other bacteria like Thermotoga subterranea and Cbu.L1951 from lower eukaryotes like Acanthamoeba castellanii. We also confirmed the fragmented nature of mature 23S rRNA in C. burnetii due to the presence of an intervening sequence. The presence of three selfish elements in C. burnetii's 23S rRNA gene is very unusual for an obligate intracellular bacterium and suggests a recent shift to its current lifestyle from a previous niche with greater opportunities for lateral gene transfer. PMID:17644584

  19. 山羊奇异变形杆菌分离鉴定及其16S-23S rRNA ISR序列RFLP分析%Isolation and Identification of Proteus mirabilis from Goat and the Analysis of Its 16S-23S rRNA ISR Sequence by RFLP

    Institute of Scientific and Technical Information of China (English)

    崔国林; 钟世勋; 杨世发; 左雪梅; 朱瑞良

    2013-01-01

    2012年初,山东菏泽某羊场的羊群发病,从发病羊器官分离到2株病原细菌.对病原细菌进行鉴定,并对其与已知同种异源菌株相似性差异进行分析.从患病山羊内脏器官分离细菌,经形态特征、培养特性、生化试验、血清学试验及致病性试验进行鉴定;再通过设计通用引物扩增16S-23S rRNA ISR (intergenie spacer region)序列,将PCR产物经HinfⅠ单酶切获得3条可视条带,同时对扩增条带中的主带测序并进行系统发育分析.结果表明,分离菌株为奇异变形杆菌;分离菌株同本实验室保存的兔源与鸡源奇异变形杆菌PCR-RFLP结果一致;分离菌株PCR产物同GenBank收录的HI4320株奇异变形杆菌及本实验室保存的兔源与鸡源奇异变形杆菌进行序列比较,分离羊源菌株与兔源菌株相似性为94.8%、与鸡源菌株相似性为96.0%~98.2%,与人源HI4320株相似性为96.9%.研究证实发病羊致病病原为奇异变形杆菌,其与鸡源、兔源和人源奇异变形杆菌的亲缘关系较近.%At the beginning of 2012,a disease occurred in a goat farm in Heze City and two strains of pathogen were isolated from the infected goats.In order to identify the infected bacteria and analyze the homology between isolated strains and heterologous strains,bacteria were isolated from infected goats internal organs and were identified by morphologic characteristics,cultural characteristic,biochemistry test,serologic test and pathogenicity test; A pair of universal primers was designed to amplify 16S-23S rRNA ISR (intergenic spacer region) gene.and three visible straps were observed when PCR products were cut by Hinf Ⅰ,at the same time the main strap of PCR straps was sequenced and analyzed by phyletic evolution.The results showed that isolated strains were Proteus mirabilis ; the result of PCR-RFLP of isolated strains and Proteus mirabilis from rabbit and chicken was the same; The homology was 94.8% between

  20. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-ribosome complexes. It is concluded that the antibiotics perturb the relative positioning of the 3' end of the P/P'-site-bound tRNA and the peptidyl transferase loop region of 23S rRNA....

  1. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    International Nuclear Information System (INIS)

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  2. The donor substrate site within the peptidyl transferase loop of 23 S rRNA and its putative interactions with the CCA-end of N-blocked aminoacyl-tRNA(Phe)

    DEFF Research Database (Denmark)

    Porse, B T; Thi-Ngoc, H P; Garrett, R A

    1996-01-01

    An RNA region associated with the donor substrate site, located at the base of the peptidyl transferase loop of 23 S rRNA, was subjected to a comprehensive single-site mutational study. Growth phenotypes of Escherichia coli cells were characterized on induction of synthesis of the mutated rRNAs and...... the mutated ribosomes were tested, selectively, for their capacity to generate peptide bonds under the conditions of the "fragment" assay. Most of the mutants exhibited dominant or recessive lethal growth phenotypes and, in general, defective growth correlated with low activities in peptide bond...... approach was employed to test for Watson-Crick base-pairing interactions between the -CCA end of the P-site bound tRNA(Phe) and this region of the peptidyl-transferase loop. Single nucleotide substitutions were introduced into the -CCA end of tRNA(Phe) and the ability of the 3'-terminal pentanucleotide...

  3. Multicentre surveillance of prevalence of the 23S rRNA A2058G and A2059G point mutations and molecular subtypes of Treponema pallidum in Taiwan, 2009-2013.

    Science.gov (United States)

    Wu, B-R; Yang, C-J; Tsai, M-S; Lee, K-Y; Lee, N-Y; Huang, W-C; Wu, H; Lee, C-H; Chen, T-C; Ko, W-C; Lin, H-H; Lu, P-L; Chen, Y-H; Liu, W-C; Yang, S-P; Wu, P-Y; Su, Y-C; Hung, C-C; Chang, S-Y

    2014-08-01

    Resistance mutations A2058G and A2059G, within the 23S rRNA gene of Treponema pallidum, have been reported to cause treatment failures in patients receiving azithromycin for syphilis. Genotyping of T. pallidum strains sequentially isolated from patients with recurrent syphilis is rarely performed. From September 2009 to August 2013, we collected 658 clinical specimens from 375 patients who presented with syphilis for genotyping to examine the number of 60-bp repeats in the acidic repeat protein (arp) gene, T. pallidum repeat (tpr) polymorphism, and tp0548 gene, and to detect A2058G and A2059G point mutations by restriction fragment length polymorphism. Treponemal DNA was identified in 45.2% (n = 298) of the specimens that were collected from 216 (57.6%) patients; 268 (40.7%) specimens tested positive for the 23S rRNA gene, and were examined for macrolide resistance. Two isolates (0.7%) harboured the A2058G mutation, and no A2059G mutation was identified. A total of 14 strains of T. pallidum were identified, with 14f/f (57.5%) and 14b/c (10.0%) being the two predominant strains. Forty patients who presented with recurrent episodes of syphilis had T. pallidum DNA identified from the initial and subsequent episodes, with five cases showing strain discrepancies. One patient had two strains identified from different clinical specimens collected in the same episode. Our findings show that 14f/f is the most common T. pallidum strain in Taiwan, where the prevalence of T. pallidum strains that show A2058G or A2059G mutation remains low. Different genotypes of T. pallidum can be identified in patients with recurrent episodes of syphilis. PMID:24438059

  4. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    Science.gov (United States)

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis. PMID:26038763

  5. Molecular phylogenetic analysis of Vibrio cholerae O1 El Tor strains isolated before, during and after the O139 outbreak based on the intergenomic heterogeneity of the 16S-23S rRNA intergenic spacer regions

    Indian Academy of Sciences (India)

    Atreyi Ghatak; Anasuya Majumdar; Ranajit K Ghosh

    2005-12-01

    We have cloned, sequenced and analysed all the five classes of the intergenic (16S-23S rRNA) spacer region (ISR) associated with the eight rrn operons (rrna-rrnh) of Vibrio cholerae serogroup O1 El Tor strains isolated before, during and after the O139 outbreak. ISR classes ‘a’ and ‘g’ were found to be invariant, ISR-B (ISRb and ISRe) exhibited very little variation, whereas ISR-C (ISRc, ISRd, and ISRf) and ISRh showed the maximum variation. Phylogenetic analysis conducted with all three ISR classes (ISR-B, ISR-C and ISRh) showed that the pre-O139 serogroup and post-O139 serogroup O1 El Tor strains arose out of two independent clones, which was congruent with the observation made by earlier workers suggesting that analyses of ISR-C and ISR-h, instead of all five ISR classes, could be successfully used to study phylogeny in this organism.

  6. Detection of the A2058G and A2059G 23S rRNA Gene Point Mutations Associated with Azithromycin Resistance in Treponema pallidum by Use of a TaqMan Real-Time Multiplex PCR Assay

    Science.gov (United States)

    Chi, Kai-Hua; Pillay, Allan; Nachamkin, Eli; Su, John R.; Ballard, Ronald C.

    2013-01-01

    Macrolide treatment failure in syphilis patients is associated with a single point mutation (either A2058G or A2059G) in both copies of the 23S rRNA gene in Treponema pallidum strains. The conventional method for the detection of both point mutations uses nested PCR combined with restriction enzyme digestions, which is laborious and time-consuming. We initially developed a TaqMan-based real-time duplex PCR assay for detection of the A2058G mutation, and upon discovery of the A2059G mutation, we modified the assay into a triplex format to simultaneously detect both mutations. The point mutations detected by the real-time triplex PCR were confirmed by pyrosequencing. A total of 129 specimens PCR positive for T. pallidum that were obtained from an azithromycin resistance surveillance study conducted in the United States were analyzed. Sixty-six (51.2%) of the 129 samples with the A2058G mutation were identified by both real-time PCR assays. Of the remaining 63 samples that were identified as having a macrolide-susceptible genotype by the duplex PCR assay, 17 (27%) were found to contain the A2059G mutation by the triplex PCR. The proportions of macrolide-susceptible versus -resistant genotypes harboring either the A2058G or the A2059G mutation among the T. pallidum strains were 35.6, 51.2, and 13.2%, respectively. None of the T. pallidum strains examined had both point mutations. The TaqMan-based real-time triplex PCR assay offers an alternative to conventional nested PCR and restriction fragment length polymorphism analyses for the rapid detection of both point mutations associated with macrolide resistance in T. pallidum. PMID:23284026

  7. Comparison of multiple genes and 16S-23S rRNA intergenic space region for their capacity in high resolution melt curve analysis to differentiate Mycoplasma gallisepticum vaccine strain ts-11 from field strains.

    Science.gov (United States)

    Ghorashi, Seyed A; Bradbury, Janet M; Ferguson-Noel, Naola M; Noormohammadi, Amir H

    2013-12-27

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses in the global poultry industry. In an attempt to compare and evaluate existing genotyping methods for differentiation of MG strains/isolates, high resolution melt (HRM) curve analysis was applied to 5 different PCR methods targeting vlhA, pvpA, gapA, mgc2 genes and 16S-23S rRNA intergenic space region (IGSR). To assess the discriminatory power of PCR-HRM of examined genes and IGSR, MG strains ts-11, F, 6/85 and S6, and, initially, 8 field isolates were tested. All MG strains/isolates were differentiated using PCR-HRM curve analysis and genotype confidence percentage (GCP) values of vlhA and pvpA genes, while only 0, 3 and 4 out of 12 MG strains/isolates were differentiated using gapA, mgc2 genes and IGSR, respectively. The HRM curve analysis of vlhA and pvpA genes was found to be highly correlated with the genetic diversity of the targeted genes confirmed by sequence analysis of amplicons generated from MG strains. The potential of the vlhA and pvpA genes was also demonstrated for genotyping of 12 additional MG strains from Europe and the USA. Results from this study provide a direct comparison between genes previously used in sequencing-based genotyping methods for MG strain identification and highlight the usefulness of vlhA and pvpA HRM curve analyses as rapid and reliable tools specially for diagnosis and differentiation of MG strains used here. PMID:24238667

  8. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Science.gov (United States)

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  9. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  10. Molecular genetic monitoring of bacterial communities in manzala lake, egypt, based on 16S rRNA gene analysis

    OpenAIRE

    El Saied, H.E.

    2007-01-01

    A first molecular genetic study on the diversity of bacterial communities at Manzala Lake, Egypt, was determined by culture-independent 16S rRNA gene analysis. Bulk DNAs were extracted from water and sediment at two different sampling sites namely; Bashtir and Genka, in the lake. The 16S rRNA gene was positively amplified by polymerase chain reaction (PCR) from bulk DNA of each sample, cloned and sequenced. The sequence analysis of one hundred clones from each clone library obtained number of...

  11. A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

    DEFF Research Database (Denmark)

    Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien;

    2011-01-01

    , YefA that is a COG2265 member. A recombinant version of YefA functions in an E. coli m(5)U-null mutant adding the same two rRNA methylations. The findings suggest that during evolution, COG2265 enzymes have undergone a series of changes in target specificity and that YefA is closer to an archetypical...

  12. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    OpenAIRE

    Mu Peng; Xiaoxue Zi; Qiuyu Wang

    2015-01-01

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacte...

  13. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Czech Academy of Sciences Publication Activity Database

    Krásný, Libor; Gourse, Richard. L.

    2004-01-01

    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  14. Application of the Sequences Analysis of the 16S rRNA Gene and ITS of 16S-23S rRNA to the Systematic Study of the Genus Arthrospira and Spirulina%16S rRNA基因与16S-23S rRNA转录单元内间隔区序列分析及其在节旋藻和螺旋藻分类鉴定中的应用

    Institute of Scientific and Technical Information of China (English)

    茅云翔; 杨官品; 张宝红; 张学成

    2001-01-01

    测定了节旋藻属3个品系和螺旋藻属1个品系的全长16S rRNA基因和16S-23S rRNA转录单元内间隔区序列(ITS),分析了已知的节旋藻、螺旋藻和相关品系的相应序列的同源性,构建了系统发生树,并评价了这两段DNA序列在节旋藻、螺旋藻种属分类和种质鉴定中的意义.结果表明:(1)16S rRNA基因序列和ITS序列均可用于节旋藻属和螺旋藻属的属间分类,以两序列为基础的系统学分析结果一致;(2)ITS序列变异程度高于16S rDNA序列,适用于节旋藻和螺旋藻属内品系或种质鉴定;(3)节旋藻属可明确界定,16S rRNA基因序列相似性大于98%,ITS序列相似性大于88%;(4)螺旋藻属某些品系间16S rDNA序列和ITS序列相似性较低,与不同属间的序列相似性程度为同一水平.

  15. Analysis of the cystic fibrosis lung microbiota via serial Illumina sequencing of bacterial 16S rRNA hypervariable regions.

    Directory of Open Access Journals (Sweden)

    Heather Maughan

    Full Text Available The characterization of bacterial communities using DNA sequencing has revolutionized our ability to study microbes in nature and discover the ways in which microbial communities affect ecosystem functioning and human health. Here we describe Serial Illumina Sequencing (SI-Seq: a method for deep sequencing of the bacterial 16S rRNA gene using next-generation sequencing technology. SI-Seq serially sequences portions of the V5, V6 and V7 hypervariable regions from barcoded 16S rRNA amplicons using an Illumina short-read genome analyzer. SI-Seq obtains taxonomic resolution similar to 454 pyrosequencing for a fraction of the cost, and can produce hundreds of thousands of reads per sample even with very high multiplexing. We validated SI-Seq using single species and mock community controls, and via a comparison to cystic fibrosis lung microbiota sequenced using 454 FLX Titanium. Our control runs show that SI-Seq has a dynamic range of at least five orders of magnitude, can classify >96% of sequences to the genus level, and performs just as well as 454 and paired-end Illumina methods in estimation of standard microbial ecology diversity measurements. We illustrate the utility of SI-Seq in a pilot sample of central airway secretion samples from cystic fibrosis patients.

  16. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    OpenAIRE

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  17. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mu Peng

    2015-09-01

    Full Text Available Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  18. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

    Science.gov (United States)

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

    2015-10-01

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future. PMID:26404329

  19. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA. Ev...

  20. Fluoroscence in situ hybridization of chicken intestinal samples with bacterial rRNA targeted oligonucleotide probes

    DEFF Research Database (Denmark)

    Olsen, Katja Nyholm; Francesch, M.; Christensen, Henrik

    2006-01-01

    338, Probe D and Non-EUB338 according to previous publications. Cultures of 38 bacterial strains representing type strains within the genera Bacillus, Listeria, Campylobacter, Bacteroides, Clostridium, Enterococcus, Streptococcus, Escherichia, Salmonella and Lactobacillus were used for optimization of......RNA of genera Lactobacillus, Bacillus, Enterococcus-Streptococcus, Enterobacteriaceae, Salmonella, Clostridium and Bacteriodes were around 1 ×108 bacterial cells per g of gut material. As for the EUB338 probe, huge variations were observed between the six different samples analysed even though each...... sample was obtained from a pool of six chickens allocated in the same cage. The technique will be used to investigate the effect of antimicrobials, feed additive, rearing conditions and Salmonella - and Campylobacter status on the bacterial composition of the chicken intestine....

  1. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing.

    Science.gov (United States)

    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree

    2016-03-01

    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans. PMID:26981367

  2. Bacterial community analysis of a gas-phase biotrickling filter for biogas mimics desulfurization through the rRNA approach.

    Science.gov (United States)

    Maestre, Juan P; Rovira, R; Alvarez-Hornos, F J; Fortuny, M; Lafuente, J; Gamisans, X; Gabriel, D

    2010-08-01

    The bacterial composition of a lab-scale biotrickling filter (BTF) treating high loads of H(2)S was investigated by the rRNA approach. Two 16S rRNA gene clone libraries were established 42 and 189 d after reactor startup, while fluorescent in-situ hybridization (FISH) with DNA probes was performed throughout 260d of reactor operation. Diversity, community structure and metamorphosis were studied from reactor startup to fully-established pseudo-steady state operation at near neutral pH and at an inlet H(2)S concentration of 2000 ppmv (load of 55.6g H(2)S m(-3)h(-1)). In addition, FISH was used for assessing the spatial distribution of sulfur-oxidizing bacteria (SOB) along the length of the reactor under pseudo-steady state operation. A major shift in the diversity of the community was observed with the operating time, from a well-diverse community at startup to pseudo-steady state operation with a majority of retrieved sequences affiliated to SOB of the sulfur cycle including Thiothrix spp., Thiobacillus spp., and Sulfurimonas denitrificans. Although aerobic species were predominant along the BTF, a vertical stratification was encountered, in which facultative anaerobes had a major relative abundance in the inlet part of the BTF, where the sulfide to oxygen ratio was higher. The observed changes were related to the trophic properties of the community, the DO concentration, the accumulation of elemental sulfur and the operation at neutral pH. PMID:20554311

  3. Uncultured bacterial diversity in a seawater recirculating aquaculture system revealed by 16S rRNA gene amplicon sequencing.

    Science.gov (United States)

    Lee, Da-Eun; Lee, Jinhwan; Kim, Young-Mog; Myeong, Jeong-In; Kim, Kyoung-Ho

    2016-04-01

    Bacterial diversity in a seawater recirculating aquaculture system (RAS) was investigated using 16S rRNA amplicon sequencing to understand the roles of bacterial communities in the system. The RAS was operated at nine different combinations of temperature (15°C, 20°C, and 25°C) and salinity (20‰, 25‰, and 32.5‰). Samples were collected from five or six RAS tanks (biofilters) for each condition. Fifty samples were analyzed. Proteobacteria and Bacteroidetes were most common (sum of both phyla: 67.2% to 99.4%) and were inversely proportional to each other. Bacteria that were present at an average of ≥ 1% included Actinobacteria (2.9%) Planctomycetes (2.0%), Nitrospirae (1.5%), and Acidobacteria (1.0%); they were preferentially present in packed bed biofilters, mesh biofilters, and maturation biofilters. The three biofilters showed higher diversity than other RAS tanks (aerated biofilters, floating bed biofilters, and fish tanks) from phylum to operational taxonomic unit (OTU) level. Samples were clustered into several groups based on the bacterial communities. Major taxonomic groups related to family Rhodobacteraceae and Flavobacteriaceae were distributed widely in the samples. Several taxonomic groups like [Saprospiraceae], Cytophagaceae, Octadecabacter, and Marivita showed a cluster-oriented distribution. Phaeobacter and Sediminicola-related reads were detected frequently and abundantly at low temperature. Nitrifying bacteria were detected frequently and abundantly in the three biofilters. Phylogenetic analysis of the nitrifying bacteria showed several similar OTUs were observed widely through the biofilters. The diverse bacterial communities and the minor taxonomic groups, except for Proteobacteria and Bacteroidetes, seemed to play important roles and seemed necessary for nitrifying activity in the RAS, especially in packed bed biofilters, mesh biofilters, and maturation biofilters. PMID:27033205

  4. 16S rRNA gene-based metagenomic analysis identifies a novel bacterial co-prevalence pattern in dental caries

    OpenAIRE

    Jagathrakshakan, Sri Nisha; Sethumadhava, Raghavendra Jayesh; Mehta, Dhaval Tushar; Ramanathan, Arvind

    2015-01-01

    Objective: To identify the prevalence of acidogenic and nonacidogenic bacteria in patients with polycaries lesions, and to ascertain caries specific bacterial prevalence in relation to noncaries controls. Materials and Methods: Total genomic DNA extracted from saliva of three adults and four children from the same family were subjected to 16S rRNA gene sequencing analysis on a next generation sequencer, the PGS-Ion Torrent. Those bacterial genera with read counts > 1000 were considered as sig...

  5. Identification of Bacterial Species Associated with the Sheep Scab Mite (Psoroptes ovis) by Using Amplified Genes Coding for 16S rRNA

    OpenAIRE

    Hogg, J.C.; Lehane, M. J.

    1999-01-01

    This was the first molecular study of the bacterial flora of the sheep scab mite (Psoroptes ovis). A sequence analysis of genes coding for 16S rRNA revealed that Serratia marcescens and bacteria closely related to Staphylococcus intermedius or Staphylococcus chromogens and Alloiococcus otitidis were present. These bacteria were associated with skin lesions, dermatitis, and otitis media caused by P. ovis.

  6. Variability in abundance of the Bacterial and Archaeal 16S rRNA and amoA genes in water columns of northern South China Sea

    Science.gov (United States)

    Liu, H.; Yang, C.; Chen, S.; Xie, W.; Wang, P.; Zhang, C. L.

    2014-12-01

    Recent advances in marine microbial ecology have shown that ammonia-oxidizing Archaea (AOA) are more abundant than ammonia-oxidizing bacteria (AOB), although total Bacteria are more abundant than total Archaea in marine environments. This study aimed to examine the spatial distribution and abundance of planktonic archaeal and bacterial 16S rRNA- and amoA genes in the northern South China Sea. Water samples were collected at different depths at six stations (maximum depth ranging from 1800 m to 3200 m)with four stations (B2, B3, B6, B7) located along a transect from the northeastern continental slope to the Bashi Strait and the other two (D3, D5) located southwest of this transect. Quantitative PCR of the 16S rRNA- and amoA genes was used to estimate the abundances of total Archaea, total Bacteria, and AOA and AOB, respectively. At the B series stations, the abundance of bacterial 16S rRNA gene was twofold to 36fold higher than that of the archaeal 16S rRNA gene while fivefold lower to sixfold higher at the two D stations, with both genes showing peak values slightly below sea surface (5-75 m depths) at all stations. The archaeal amoA gene had similar variations with the archaeal 16S rRNA gene, but was 1-4 orders of magnitude lower than the archaeal 16S rRNA gene at all stations. Bacterial amoA gene was below the detection at all stations. Our results also show the difference in depth profiles among these stations, which may be caused by the difference in water movement between these regions. The non-detection of bacterial amoA gene indicates that ammonia-oxidizing Archaea are the dominant group of microorganisms in nitrification of the South China Sea, which is consistent with observations in other oceans.

  7. Diversity, Dynamics and Activity of Bacterial Communities during Production of an Artisanal Sicilian Cheese as Evaluated by 16S rRNA Analysis

    OpenAIRE

    Randazzo, C.L.; Torriani, S.; Akkermans, A.D.L.; Vos, de, R.; Vaughan, E E

    2002-01-01

    The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene...

  8. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  9. Mineral Type and Solution Chemistry Affect the Structure and Composition of Actively Growing Bacterial Communities as Revealed by Bromodeoxyuridine Immunocapture and 16S rRNA Pyrosequencing.

    Science.gov (United States)

    Kelly, L C; Colin, Y; Turpault, M-P; Uroz, S

    2016-08-01

    Understanding how minerals affect bacterial communities and their in situ activities in relation to environmental conditions are central issues in soil microbial ecology, as minerals represent essential reservoirs of inorganic nutrients for the biosphere. To determine the impact of mineral type and solution chemistry on soil bacterial communities, we compared the diversity, composition, and functional abilities of a soil bacterial community incubated in presence/absence of different mineral types (apatite, biotite, obsidian). Microcosms were prepared containing different liquid culture media devoid of particular essential nutrients, the nutrients provided only in the introduced minerals and therefore only available to the microbial community through mineral dissolution by biotic and/or abiotic processes. By combining functional screening of bacterial isolates and community analysis by bromodeoxyuridine DNA immunocapture and 16S rRNA gene pyrosequencing, we demonstrated that bacterial communities were mainly impacted by the solution chemistry at the taxonomic level and by the mineral type at the functional level. Metabolically active bacterial communities varied with solution chemistry and mineral type. Burkholderia were significantly enriched in the obsidian treatment compared to the biotite treatment and were the most effective isolates at solubilizing phosphorous or mobilizing iron, in all the treatments. A detailed analysis revealed that the 16S rRNA gene sequences of the OTUs or isolated strains assigned as Burkholderia in our study showed high homology with effective mineral-weathering bacteria previously recovered from the same experimental site. PMID:27138048

  10. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jiemin [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Zhou, Xuemei; Li, Yuguang [101 Institute, Ministry of Civil Affairs, Beijing 100070 (China); Xing, Jianmin, E-mail: jmxing@ipe.ac.cn [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China)

    2015-09-15

    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities.

  11. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    International Nuclear Information System (INIS)

    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities

  12. Dual Priming Oligonucleotides for Broad-Range Amplification of the Bacterial 16S rRNA Gene Directly from Human Clinical Specimens

    OpenAIRE

    Kommedal, Øyvind; Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.

    2012-01-01

    Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or ne...

  13. Polynucleotide Probes That Target a Hypervariable Region of 16S rRNA Genes To Identify Bacterial Isolates Corresponding to Bands of Community Fingerprints

    OpenAIRE

    Heuer, Holger; Hartung, Kathrin; Wieland, Gabriele; Kramer, Ina; Smalla, Kornelia

    1999-01-01

    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in ...

  14. Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

    Science.gov (United States)

    Jiang, Xuexia; Jiao, Nianzhi

    2016-09-01

    Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis. PMID:27407295

  15. Ultradeep 16S rRNA sequencing analysis of geographically similar but diverse unexplored marine samples reveal varied bacterial community composition.

    Directory of Open Access Journals (Sweden)

    Chairmandurai Aravindraja

    Full Text Available BACKGROUND: Bacterial community composition in the marine environment differs from one geographical location to another. Reports that delineate the bacterial diversity of different marine samples from geographically similar location are limited. The present study aims to understand whether the bacterial community compositions from different marine samples harbour similar bacterial diversity since these are geographically related to each other. METHODS AND PRINCIPAL FINDINGS: In the present study, 16S rRNA deep sequencing analysis targeting V3 region was performed using Illumina bar coded sequencing. A total of 22.44 million paired end reads were obtained from the metagenomic DNA of Marine sediment, Rhizosphere sediment, Seawater and the epibacterial DNA of Seaweed and Seagrass. Diversity index analysis revealed that Marine sediment has the highest bacterial diversity and the least bacterial diversity was observed in Rhizosphere sediment. Proteobacteria, Actinobacteria and Bacteroidetes were the dominant taxa present in all the marine samples. Nearly 62-71% of rare species were identified in all the samples and most of these rare species were unique to a particular sample. Further taxonomic assignment at the phylum and genus level revealed that the bacterial community compositions differ among the samples. CONCLUSION: This is the first report that supports the fact that, bacterial community composition is specific for specific samples irrespective of its similar geographical location. Existence of specific bacterial community for each sample may drive overall difference in bacterial structural composition of each sample. Further studies like whole metagenomic sequencing will throw more insights to the key stone players and its interconnecting metabolic pathways. In addition, this is one of the very few reports that depicts the unexplored bacterial diversity of marine samples (Marine sediment, Rhizosphere sediment, Seawater and the host associated

  16. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan

    OpenAIRE

    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.

    2013-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  17. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Directory of Open Access Journals (Sweden)

    Sarah M. Boomer

    2009-12-01

    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  18. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Directory of Open Access Journals (Sweden)

    Bryan E. Dutton

    2002-12-01

    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  19. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    DEFF Research Database (Denmark)

    Møller, Annette; Søborg, Ditte Andreasen; Al-Soud, Waleed Abu;

    2013-01-01

    controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input......The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition...... of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers...

  20. ISOLATION AND CHARACTERIZATION OF HALOPHILIC BACTERIAL STRAINS FROM SALINE WATERS OF KHEWRA SALT MINES ON THE BASIS OF 16S rRNA GENE SEQUENCE

    Directory of Open Access Journals (Sweden)

    Muhammad Kaleem Sarwar

    2014-02-01

    Full Text Available Halophiles are salt loving microbes optimally growing at high concentrations of salt. Khewra salt mines of Pakistan provide extreme saline conditions where enormous halophilic microbial biota thrives. The present study aimed at isolation and molecular identification of bacterial strains from saline waters of Khewra salt mines. Using halophilic media, nine halophilic bacterial strains from saline water bodies were cultured and studied under optimized growth conditions (NaCl, pH and temperature. Bacterial growth at different NaCl concentrations was measured at 600nm wavelength, showing optimal growth at 1.5M NaCl. 769bp size 16S rRNA gene was amplified for molecular identification of bacterial strains. The amplified genes of the strains FA2.2 and FA3.3 were sequenced and their homology with other bacterial strains was analyzed. The results showed FA2.2 shared maximum homology with Bacillus anthracis strain while FA3.3 showed close resemblance with Staphylococcus saprophyticus subsp. bovis. Isolated halophilic bacterial strains possess potential for various biotechnological applications. They could be manipulated for synthesizing transgenic crops tolerating high salinity boosting the agricultural yield. Moreover extremozymes of these bacteria holds great industrial importance.

  1. Bacterial Community Composition in the Gut Content and Ambient Sediment of Sea Cucumber Apostichopus japonicus Revealed by 16S rRNA Gene Pyrosequencing

    OpenAIRE

    Fei Gao; Fenghui Li; Jie Tan; Jingping Yan; Huiling Sun

    2014-01-01

    The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs) were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±...

  2. Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonid fish, detected by nested reverse transcription-PCR of 16S rRNA sequences.

    Science.gov (United States)

    Magnússon, H B; Fridjónsson, O H; Andrésson, O S; Benediktsdóttir, E; Gudmundsdóttir, S; Andrésdóttir, V

    1994-12-01

    An assay based on reverse transcription and nested PCR amplification of hypervariable regions within the 16S rRNA sequence was used to specifically detect Renibacterium salmoninarum, the slowly growing causative agent of bacterial kidney disease in salmonid fish. This assay detected 1 to 10 bacteria per sample and took 1 to 2 days to perform. The assay was used to detect R. salmoninarum in ovarian fluid obtained from naturally infected fish. The assay was unreliable when it was used to examine kidney tissue. PMID:7529017

  3. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Science.gov (United States)

    2010-01-01

    Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

  4. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Directory of Open Access Journals (Sweden)

    Dawyndt Peter

    2010-01-01

    Full Text Available Abstract Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the

  5. Cloning of 16S rRNA genes amplified from normal and disturbed vaginal microflora suggests a strong association between Atopobium vaginae, Gardnerella vaginalis and bacterial vaginosis

    Directory of Open Access Journals (Sweden)

    De Ganck Catharine

    2004-04-01

    Full Text Available Abstract Background The pathogenesis of bacterial vaginosis remains largely elusive, although some microorganisms, including Gardnerella vaginalis, are suspected of playing a role in the etiology of this disorder. Recently culture-independent analysis of microbial ecosystems has proven its efficacy in characterizing the diversity of bacterial populations. Here, we report on the results obtained by combining culture and PCR-based methods to characterize the normal and disturbed vaginal microflora. Results A total of 150 vaginal swab samples from healthy women (115 pregnant and 35 non-pregnant were categorized on the basis of Gram stain of direct smear as grade I (n = 112, grade II (n = 26, grade III (n = 9 or grade IV (n = 3. The composition of the vaginal microbial community of eight of these vaginal swabs (three grade I, two grade II and three grade III, all from non-pregnant women, were studied by culture and by cloning of the 16S rRNA genes obtained after direct amplification. Forty-six cultured isolates were identified by tDNA-PCR, 854 cloned 16S rRNA gene fragments were analysed of which 156 by sequencing, yielding a total of 38 species, including 9 presumptively novel species with at least five species that have not been isolated previously from vaginal samples. Interestingly, cloning revealed that Atopobium vaginae was abundant in four out of the five non-grade I specimens. Finally, species specific PCR for A. vaginae and Gardnerella vaginalis pointed to a statistically significant co-occurrence of both species in the bacterial vaginosis samples. Conclusions Although historically the literature regarding bacterial vaginosis has largely focused on G. vaginalis in particular, several findings of this study – like the abundance of A. vaginae in disturbed vaginal microflora and the presence of several novel species – indicate that much is to be learned about the composition of the vaginal microflora and its relation to the etiology of BV.

  6. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    Directory of Open Access Journals (Sweden)

    Annette K. Møller

    2013-04-01

    Full Text Available The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers of chloroplasts were also observed. In the deepest snow layer, large percentages of Firmicutes and Fusobacteria were seen. In freshwater, Bacteroidetes, Actinobacteria and Verrucomicrobia were the most abundant phyla while relatively few Proteobacteria and Cyanobacteria were present. Possibly, light intensity controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input of organic carbon and nitrogen to the heterotrophic bacteria. Thus, differences in the physicochemical conditions may play an important role in the processes leading to distinctive bacterial community structures in High-Arctic snow and freshwater.

  7. Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins Efeito de polietilenoglicol e polivinilpirrolidona na extração e hibridização de rRNA bacteriano de células expostas a taninos

    OpenAIRE

    Pedro Braga Arcuri; Michael Larry Thonney; Peter Schofield; Alice Nelson Pell

    2003-01-01

    In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/...

  8. Bacterial community composition in the gut content and ambient sediment of sea cucumber Apostichopus japonicus revealed by 16S rRNA gene pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Fei Gao

    Full Text Available The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±6.5 phyla, respectively. The bacterial richness and Shannon diversity index were both higher in the ambient sediments than in the gut contents. Proteobacteria was the predominant phylum in both the gut contents and sediment samples. The predominant classes in the foregut, hindgut, and ambient sediment were Holophagae and Gammaproteobacteria, Deltaproteobacteria and Gammaproteobacteria, and Gammaproteobacteria and Deltaproteobacteria, respectively. The potential probiotics, including sequences related to Bacillus, lactic acid bacteria (Lactobacillus, Lactococcus, and Streptococcus and Pseudomonas were detected in the gut of A. japonicus. Principle component analysis and heatmap figure showed that the foregut, hindgut, and ambient sediment respectively harbored different characteristic bacterial communities. Selective feeding of A. japonicus may be the primary source of the different bacterial communities between the foregut contents and ambient sediments.

  9. Bacterial Community Composition in the Gut Content and Ambient Sediment of Sea Cucumber Apostichopus japonicus Revealed by 16S rRNA Gene Pyrosequencing

    Science.gov (United States)

    Gao, Fei; Li, Fenghui; Tan, Jie; Yan, Jingping; Sun, Huiling

    2014-01-01

    The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs) were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±6.5 phyla, respectively. The bacterial richness and Shannon diversity index were both higher in the ambient sediments than in the gut contents. Proteobacteria was the predominant phylum in both the gut contents and sediment samples. The predominant classes in the foregut, hindgut, and ambient sediment were Holophagae and Gammaproteobacteria, Deltaproteobacteria and Gammaproteobacteria, and Gammaproteobacteria and Deltaproteobacteria, respectively. The potential probiotics, including sequences related to Bacillus, lactic acid bacteria (Lactobacillus, Lactococcus, and Streptococcus) and Pseudomonas were detected in the gut of A. japonicus. Principle component analysis and heatmap figure showed that the foregut, hindgut, and ambient sediment respectively harbored different characteristic bacterial communities. Selective feeding of A. japonicus may be the primary source of the different bacterial communities between the foregut contents and ambient sediments. PMID:24967593

  10. Bacterial taxa associated with the hematophagous mite Dermanyssus gallinae detected by 16S rRNA PCR amplification and TTGE fingerprinting.

    Science.gov (United States)

    Valiente Moro, Claire; Thioulouse, Jean; Chauve, Claude; Normand, Philippe; Zenner, Lionel

    2009-01-01

    Dermanyssus gallinae (Arthropoda, Mesostigmata) is suspected to be involved in the transmission of a wide variety of pathogens, but nothing is known about its associated non-pathogenic bacterial community. To address this question, we examined the composition of bacterial communities in D. gallinae collected from standard poultry farms in Brittany, France. Genetic fingerprints of bacterial communities were generated by temporal temperature gradient gel electrophoresis (TTGE) separation of individual polymerase chain reaction (PCR)-amplified 16S rRNA gene fragments, followed by DNA sequence analysis. Most of the sequences belonged to the Proteobacteria and Firmicute phyla, with a majority of sequences corresponding to the Enterobacteriales order and the Staphylococcus genus. By using statistical analysis, we showed differences in biodiversity between poultry farms. We also determined the major phylotypes that compose the characteristic microbiota associated with D. gallinae. Saprophytes, opportunistic pathogens and pathogenic agents such as Pasteurella multocida, Erysipelothrix rhusiopathiae and sequences close to the genus Aerococcus were identified. Endosymbionts such as Schineria sp., Spiroplasma sp. Anistosticta, "Candidatus Cardinium hertigii" and Rickettsiella sp. were also present in the subdominant bacterial community. Identification of potential targets within the symbiont community may be considered in the future as a means of ectoparasite control. PMID:19027065

  11. Use of 16S rRNA sequencing and quantitative PCR to correlate venous leg ulcer bacterial bioburden dynamics with wound expansion, antibiotic therapy, and healing.

    Science.gov (United States)

    Sprockett, Daniel D; Ammons, Christine G; Tuttle, Marie S

    2015-09-01

    Clinical diagnosis of infection in chronic wounds is currently limited to subjective clinical signs and culture-based methods that underestimate the complexity of wound microbial bioburden as revealed by DNA-based microbial identification methods. Here, we use 16S rRNA next generation sequencing and quantitative polymerase chain reaction to characterize weekly changes in bacterial load, community structure, and diversity associated with a chronic venous leg ulcer over the 15-week course of treatment and healing. Our DNA-based methods and detailed sampling scheme reveal that the bacterial bioburden of the wound is unexpectedly dynamic, including changes in the bacterial load and community structure that correlate with wound expansion, antibiotic therapy, and healing. We demonstrate that these multidimensional changes in bacterial bioburden can be summarized using swabs taken prior to debridement, and therefore, can be more easily collected serially than debridement or biopsy samples. Overall, this case illustrates the importance of detailed clinical indicators and longitudinal sampling to determine the pathogenic significance of chronic wound microbial dynamics and guide best use of antimicrobials for improvement of healing outcomes. PMID:25902876

  12. Horizon-Specific Bacterial Community Composition of German Grassland Soils, as Revealed by Pyrosequencing-Based Analysis of 16S rRNA Genes ▿ †

    Science.gov (United States)

    Will, Christiane; Thürmer, Andrea; Wollherr, Antje; Nacke, Heiko; Herold, Nadine; Schrumpf, Marion; Gutknecht, Jessica; Wubet, Tesfaye; Buscot, François; Daniel, Rolf

    2010-01-01

    The diversity of bacteria in soil is enormous, and soil bacterial communities can vary greatly in structure. Here, we employed a pyrosequencing-based analysis of the V2-V3 16S rRNA gene region to characterize the overall and horizon-specific (A and B horizons) bacterial community compositions in nine grassland soils, which covered three different land use types. The entire data set comprised 752,838 sequences, 600,544 of which could be classified below the domain level. The average number of sequences per horizon was 41,824. The dominant taxonomic groups present in all samples and horizons were the Acidobacteria, Betaproteobacteria, Actinobacteria, Gammaproteobacteria, Alphaproteobacteria, Deltaproteobacteria, Chloroflexi, Firmicutes, and Bacteroidetes. Despite these overarching dominant taxa, the abundance, diversity, and composition of bacterial communities were horizon specific. In almost all cases, the estimated bacterial diversity (H′) was higher in the A horizons than in the corresponding B horizons. In addition, the H′ was positively correlated with the organic carbon content, the total nitrogen content, and the C-to-N ratio, which decreased with soil depth. It appeared that lower land use intensity results in higher bacterial diversity. The majority of sequences affiliated with the Actinobacteria, Bacteroidetes, Cyanobacteria, Fibrobacteres, Firmicutes, Spirochaetes, Verrucomicrobia, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria were derived from A horizons, whereas the majority of the sequences related to Acidobacteria, Chloroflexi, Gemmatimonadetes, Nitrospira, TM7, and WS3 originated from B horizons. The distribution of some bacterial phylogenetic groups and subgroups in the different horizons correlated with soil properties such as organic carbon content, total nitrogen content, or microbial biomass. PMID:20729324

  13. Bacterial diversity in Philippine fermented mustard (burong mustasa) as revealed by 16S rRNA gene analysis.

    Science.gov (United States)

    Larcia, L L H; Estacio, R C; Dalmacio, L M M

    2011-12-01

    Previous studies on the bacterial profile of burong mustasa, a traditional Philippine fermented food, had been conducted using culture-dependent techniques. Since these methods may underestimate the total microbiota of a sample, a culture-independent study was done to determine the bacterial diversity in burong mustasa through molecular biology techniques. Bacterial DNA was isolated from fermented mustard samples at different stages of fermentation. The isolated genomic DNA was amplified by PCR using specific primers for the 16S ribosomal RNA gene (16S rDNA). The 1.5 kb amplicons obtained were subjected to nested PCR using primers for the internal variable region of the 16S rDNA. The 585 bp nested PCR amplicons were then subjected to denaturing gradient gel electrophoresis (DGGE) to separate the different bacteria present in each sample. Distinct and unique bands in the DGGE profile were excised, reamplified, purified and sequenced for bacterial identification. Molecular cloning of the 1.5 kb 16S rDNA was also performed using the pGEM-T Easy Vector System. The cloned gene was sequenced for bacterial identification. The identified microbiota in burong mustasa at different stages of fermentation include lactic acid bacteria and several uncultured bacteria (initial up to the final stages); acetic acid bacteria (middle stage); and Streptobacillus and Fusobacterium species (initial stage). The potential probiotic bacteria found in burong mustasa are Weissella and Lactobacillus. PMID:22146686

  14. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    OpenAIRE

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repeti...

  15. Bacterial communities of traditional salted and fermented seafoods from Jeju Island of Korea using 16S rRNA gene clone library analysis.

    Science.gov (United States)

    Kim, Min-Soo; Park, Eun-Jin

    2014-05-01

    Jeotgal, which is widely consumed as a nutritional supplement in Korea, is traditional type of preserved seafood that is prepared by salting and fermenting. Here, we report on the bacterial community structure and diversity of jeotgal obtained from the Korean island of Jeju, which has a subtropical climate. Two samples of Jeotgal were collected from Jeju, made from either damselfish (Chromis notata; jari-dom-jeot, J1 and J2) or silver-stripe round herring (Spratelloides gracilis; ggot-myulchi-jeot, K1 and K2). The physical characteristics (pH and salinity) were assessed and the bacterial communities characterized using 16S rRNA gene-clone library analysis and cultural isolation. No difference was found in the community composition between the J and K fermented seafoods. Both fermented seafoods had relatively high salinity (26% to 33%) and high pH values (pH 6.08 to 6.72). Based on the 16S rRNA gene sequences, the halophilic lactic-acid bacteria Tetragenococcus halophilus and T. muriaticus were observed to be dominant in the J and K fermented seafoods, accompanied by halophilic bacteria including Halanaerobium spp., Halomonas spp., and Chromohalobacter spp. When compared with 7 other types of fermented seafood from a previous study, the communities of the J and K fermented seafoods were separated by the most influential group, the genus Tetragenococcus. The results suggest that these 2 types of traditional salted fermented seafood from Jeju have distinct communities dominated by Tetragenococcus spp., which are derived from the raw ingredients and are dependent on the physical conditions. This may explain how the seafoods that are made in Jeju may differ from other jeotgals. PMID:24689962

  16. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides

    DEFF Research Database (Denmark)

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon;

    2015-01-01

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces...... activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken...... together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism....

  17. Phylotype-level 16S rRNA analysis reveals new bacterial indicators of health state in acute murine colitis

    OpenAIRE

    Berry, David; Schwab, Clarissa; Milinovich, Gabriel; Reichert, Jochen; Ben Mahfoudh, Karim; Decker, Thomas; Engel, Marion; Hai, Brigitte; Hainzl, Eva; Heider, Susanne; Kenner, Lukas; Müller, Mathias; Rauch, Isabella; Strobl, Birgit; Wagner, Michael

    2012-01-01

    Human inflammatory bowel disease and experimental colitis models in mice are associated with shifts in intestinal microbiota composition, but it is unclear at what taxonomic/phylogenetic level such microbiota dynamics can be indicative for health or disease. Here, we report that dextran sodium sulfate (DSS)-induced colitis is accompanied by major shifts in the composition and function of the intestinal microbiota of STAT1−/− and wild-type mice, as determined by 454 pyrosequencing of bacterial...

  18. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections.

    Directory of Open Access Journals (Sweden)

    Stephen J Salipante

    Full Text Available Classifying individual bacterial species comprising complex, polymicrobial patient specimens remains a challenge for culture-based and molecular microbiology techniques in common clinical use. We therefore adapted practices from metagenomics research to rapidly catalog the bacterial composition of clinical specimens directly from patients, without need for prior culture. We have combined a semiconductor deep sequencing protocol that produces reads spanning 16S ribosomal RNA gene variable regions 1 and 2 (∼360 bp with a de-noising pipeline that significantly improves the fraction of error-free sequences. The resulting sequences can be used to perform accurate genus- or species-level taxonomic assignment. We explore the microbial composition of challenging, heterogeneous clinical specimens by deep sequencing, culture-based strain typing, and Sanger sequencing of bulk PCR product. We report that deep sequencing can catalog bacterial species in mixed specimens from which usable data cannot be obtained by conventional clinical methods. Deep sequencing a collection of sputum samples from cystic fibrosis (CF patients reveals well-described CF pathogens in specimens where they were not detected by standard clinical culture methods, especially for low-prevalence or fastidious bacteria. We also found that sputa submitted for CF diagnostic workup can be divided into a limited number of groups based on the phylogenetic composition of the airway microbiota, suggesting that metagenomic profiling may prove useful as a clinical diagnostic strategy in the future. The described method is sufficiently rapid (theoretically compatible with same-day turnaround times and inexpensive for routine clinical use.

  19. Evaluation of bacterial communities by bacteriome analysis targeting 16S rRNA genes and quantitative analysis of ammonia monooxygenase gene in different types of compost.

    Science.gov (United States)

    Kitamura, Rika; Ishii, Kazuo; Maeda, Isamu; Kozaki, Toshinori; Iwabuchi, Kazunori; Saito, Takahiro

    2016-01-01

    Biofiltration technology based on microbial degradation and assimilation is used for the removal of malodorous compounds, such as ammonia. Microbes that degrade malodorous and/or organic substances are involved in composting and are retained after composting; therefore, mature composts can serve as an ideal candidate for a biofilter medium. In this study, we focused on different types of raw compost materials, as these are important factors determining the bacterial community profile and the chemical component of the compost. Therefore, bacterial community profiles, the abundance of the bacterial ammonia monooxygenase gene (amoA), and the quantities of chemical components were analyzed in composts produced from either food waste or cattle manure. The community profiles with the lowest beta diversity were obtained from single type of cattle manure compost. However, cattle manure composts showed greater alpha diversity, contained higher amounts of various rRNA gene fragments than those of food waste composts and contained the amoA gene by relative quantification, and Proteobacteria were abundantly found and nitrifying bacteria were detected in it. Nitrifying bacteria are responsible for ammonia oxidation and mainly belong to the Proteobacteria or Nitrospira phyla. The quantities of chemical components, such as salt, phosphorus, and nitrogen, differed between the cattle manure and food waste composts, indicating that the raw materials provided different fermentation environments that were crucial for the formation of different community profiles. The results also suggest that cattle manure might be a more suitable raw material for the production of composts to be used in the biofiltration of ammonia. PMID:26111599

  20. Bacterial diversity in typical Italian salami at different ripening stages as revealed by high-throughput sequencing of 16S rRNA amplicons.

    Science.gov (United States)

    Połka, Justyna; Rebecchi, Annalisa; Pisacane, Vincenza; Morelli, Lorenzo; Puglisi, Edoardo

    2015-04-01

    The bacterial diversity involved in food fermentations is one of the most important factors shaping the final characteristics of traditional foods. Knowledge about this diversity can be greatly improved by the application of high-throughput sequencing technologies (HTS) coupled to the PCR amplification of the 16S rRNA subunit. Here we investigated the bacterial diversity in batches of Salame Piacentino PDO (Protected Designation of Origin), a dry fermented sausage that is typical of a regional area of Northern Italy. Salami samples from 6 different local factories were analysed at 0, 21, 49 and 63 days of ripening; raw meat at time 0 and casing samples at 21 days of ripening where also analysed, and the effect of starter addition was included in the experimental set-up. Culture-based microbiological analyses and PCR-DGGE were carried out in order to be compared with HTS results. A total of 722,196 high quality sequences were obtained after trimming, paired-reads assembly and quality screening of raw reads obtained by Illumina MiSeq sequencing of the two bacterial 16S hypervariable regions V3 and V4; manual curation of 16S database allowed a correct taxonomical classification at the species for 99.5% of these reads. Results confirmed the presence of main bacterial species involved in the fermentation of salami as assessed by PCR-DGGE, but with a greater extent of resolution and quantitative assessments that are not possible by the mere analyses of gel banding patterns. Thirty-two different Staphylococcus and 33 Lactobacillus species where identified in the salami from different producers, while the whole data set obtained accounted for 13 main families and 98 rare ones, 23 of which were present in at least 10% of the investigated samples, with casings being the major sources of the observed diversity. Multivariate analyses also showed that batches from 6 local producers tend to cluster altogether after 21 days of ripening, thus indicating that HTS has the potential

  1. Survey of culture, goldengate assay, universal biosensor assay, and 16S rRNA Gene sequencing as alternative methods of bacterial pathogen detection.

    Science.gov (United States)

    Lindsay, Brianna; Pop, Mihai; Antonio, Martin; Walker, Alan W; Mai, Volker; Ahmed, Dilruba; Oundo, Joseph; Tamboura, Boubou; Panchalingam, Sandra; Levine, Myron M; Kotloff, Karen; Li, Shan; Magder, Laurence S; Paulson, Joseph N; Liu, Bo; Ikumapayi, Usman; Ebruke, Chinelo; Dione, Michel; Adeyemi, Mitchell; Rance, Richard; Stares, Mark D; Ukhanova, Maria; Barnes, Bret; Lewis, Ian; Ahmed, Firoz; Alam, Meer Taifur; Amin, Ruhul; Siddiqui, Sabbir; Ochieng, John B; Ouma, Emmanuel; Juma, Jane; Mailu, Eunice; Omore, Richard; O'Reilly, Ciara E; Hannis, James; Manalili, Sheri; Deleon, Jonna; Yasuda, Irene; Blyn, Lawrence; Ranken, Raymond; Li, Feng; Housley, Roberta; Ecker, David J; Hossain, M Anowar; Breiman, Robert F; Morris, J Glenn; McDaniel, Timothy K; Parkhill, Julian; Saha, Debasish; Sampath, Rangarajan; Stine, O Colin; Nataro, James P

    2013-10-01

    Cultivation-based assays combined with PCR or enzyme-linked immunosorbent assay (ELISA)-based methods for finding virulence factors are standard methods for detecting bacterial pathogens in stools; however, with emerging molecular technologies, new methods have become available. The aim of this study was to compare four distinct detection technologies for the identification of pathogens in stools from children under 5 years of age in The Gambia, Mali, Kenya, and Bangladesh. The children were identified, using currently accepted clinical protocols, as either controls or cases with moderate to severe diarrhea. A total of 3,610 stool samples were tested by established clinical culture techniques: 3,179 DNA samples by the Universal Biosensor assay (Ibis Biosciences, Inc.), 1,466 DNA samples by the GoldenGate assay (Illumina), and 1,006 DNA samples by sequencing of 16S rRNA genes. Each method detected different proportions of samples testing positive for each of seven enteric pathogens, enteroaggregative Escherichia coli (EAEC), enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), Shigella spp., Campylobacter jejuni, Salmonella enterica, and Aeromonas spp. The comparisons among detection methods included the frequency of positive stool samples and kappa values for making pairwise comparisons. Overall, the standard culture methods detected Shigella spp., EPEC, ETEC, and EAEC in smaller proportions of the samples than either of the methods based on detection of the virulence genes from DNA in whole stools. The GoldenGate method revealed the greatest agreement with the other methods. The agreement among methods was higher in cases than in controls. The new molecular technologies have a high potential for highly sensitive identification of bacterial diarrheal pathogens. PMID:23884998

  2. Effects of DNA extraction and universal primers on 16S rRNA gene-based DGGE analysis of a bacterial community from fish farming water

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Among many reports investigating microbial diversity from environmental samples with denaturing gradient gel electrophoresis (DGGE), limited attention has been given to the effects of universal primers and DNA extraction on the outcome of DGGE analysis. In this study, these effects were tested with 16S rRNA gene-based DGGE on a bacterial community from farming water samples. The results indicate that the number of discernable bands in the DGGE fingerprint differed with the primer pairs used; the bands produced by 63f/518r, 341f/926r and 933f/1387r primer pairs were obviously fewer than those by 968f/1401r. Also, we found that each DNA extraction method resulted in different community profiles, reflected by the number and intensity of bands in the DGGE fingerprint. Furthermore,the main bands (theoretically representing dominant bacteria) differed with the extraction methods applied.It is therefore believed that the effects of universal primers and DNA extraction should be given more attention and carefully chosen before performing an investigation into a new environment with DGGE.

  3. Black Box Chimera Check (B2C2): a Windows-Based Software for Batch Depletion of Chimeras from Bacterial 16S rRNA Gene Datasets.

    Science.gov (United States)

    Gontcharova, Viktoria; Youn, Eunseog; Wolcott, Randall D; Hollister, Emily B; Gentry, Terry J; Dowd, Scot E

    2010-01-01

    The existing chimera detection programs are not specifically designed for "next generation" sequence data. Technologies like Roche 454 FLX and Titanium have been adapted over the past years especially with the introduction of bacterial tag-encoded FLX/Titanium amplicon pyrosequencing methodologies to produce over one million 250-600 bp 16S rRNA gene reads that need to be depleted of chimeras prior to downstream analysis. Meeting the needs of basic scientists who are venturing into high-throughput microbial diversity studies such as those based upon pyrosequencing and specifically providing a solution for Windows users, the B2C2 software is designed to be able to accept files containing large multi-FASTA formatted sequences and screen for possible chimeras in a high throughput fashion. The graphical user interface (GUI) is also able to batch process multiple files. When compared to popular chimera screening software the B2C2 performed as well or better while dramatically decreasing the amount of time required generating and screening results. Even average computer users are able to interact with the Windows .Net GUI-based application and define the stringency to which the analysis should be done. B2C2 may be downloaded from http://www.researchandtesting.com/B2C2. PMID:21339894

  4. Profiling the Succession of Bacterial Communities throughout the Life Stages of a Higher Termite Nasutitermes arborum (Termitidae, Nasutitermitinae Using 16S rRNA Gene Pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Michel Diouf

    Full Text Available Previous surveys of the gut microbiota of termites have been limited to the worker caste. Termite gut microbiota has been well documented over the last decades and consists mainly of lineages specific to the gut microbiome which are maintained across generations. Despite this intimate relationship, little is known of how symbionts are transmitted to each generation of the host, especially in higher termites where proctodeal feeding has never been reported. The bacterial succession across life stages of the wood-feeding higher termite Nasutitermes arborum was characterized by 16S rRNA gene deep sequencing. The microbial community in the eggs, mainly affiliated to Proteobacteria and Actinobacteria, was markedly different from the communities in the following developmental stages. In the first instar and last instar larvae and worker caste termites, Proteobacteria and Actinobacteria were less abundant than Firmicutes, Bacteroidetes, Spirochaetes, Fibrobacteres and the candidate phylum TG3 from the last instar larvae. Most of the representatives of these phyla (except Firmicutes were identified as termite-gut specific lineages, although their relative abundances differed. The most salient difference between last instar larvae and worker caste termites was the very high proportion of Spirochaetes, most of which were affiliated to the Treponema Ic, Ia and If subclusters, in workers. The results suggest that termite symbionts are not transmitted from mother to offspring but become established by a gradual process allowing the offspring to have access to the bulk of the microbiota prior to the emergence of workers, and, therefore, presumably through social exchanges with nursing workers.

  5. Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian patients with reactive and undifferentiated arthritis

    OpenAIRE

    Siala, Mariam; Gdoura, Radhouane; Fourati, Hela; Rihl, Markus; Jaulhac, Benoit; Younes, Mohamed; Sibilia, Jean; Baklouti, Sofien; Bargaoui, Naceur; Sellami, Slaheddine; Sghir, Abdelghani; Hammami, Adnane

    2009-01-01

    Introduction Broad-range rDNA PCR provides an alternative, cultivation-independent approach for identifying bacterial DNA in reactive and other form of arthritis. The aim of this study was to use broad-range rDNA PCR targeting the 16S rRNA gene in patients with reactive and other forms of arthritis and to screen for the presence of DNA from any given bacterial species in synovial fluid (SF) samples. Methods We examined the SF samples from a total of 27 patients consisting of patients with rea...

  6. Bacterial populations in samples of bioleached copper ore as revealed by analysis of DNA obtained before and after cultivation.

    OpenAIRE

    Pizarro, J.; Jedlicki, E; Orellana, O; J. Romero; Espejo, R T

    1996-01-01

    The composition of bacterial populations in copper bioleaching systems was investigated by analysis of DNA obtained either directly from ores or leaching solutions or after laboratory cultures. This analysis consisted of the characterization of the spacer regions between the 16 and 23S genes in the bacterial rRNA genetic loci after PCR amplification. The sizes of the spacer regions, amplified from DNAs obtained from samples, were compared with the sizes of those obtained from cultures of the ...

  7. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... in vitro, both drugs strongly protect 23S rRNA bases A2058 and A2451 from dimethyl sulphate and G2505 from kethoxal modification; G2061 is also weakly protected from kethoxal. The modification patterns differ in that A2059 is additionally protected by clindamycin but not by lincomycin. The affinity...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on...

  8. Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins Efeito de polietilenoglicol e polivinilpirrolidona na extração e hibridização de rRNA bacteriano de células expostas a taninos

    Directory of Open Access Journals (Sweden)

    Pedro Braga Arcuri

    2003-09-01

    Full Text Available In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG and polyvinylpirrolidone (PVP on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp. skin, Desmodium ovalifolium, red grape (Vitis vinifera skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (PA recuperação de RNA ribossômico (rRNA intacto é necessária para a detecção de flutuações na população microbiana ruminal decorrentes dos taninos de forrageiras, utilizando-se sondas para 16S rRNA. O objetivo deste trabalho foi avaliar o efeito de polietilenoglicol (PEG e polivinilpirrolidona (PVP na extração de rRNA bacteriano, em presença de taninos de leguminosas forrageiras tropicais e de outras fontes, que possa ser hibridizado com sondas de oligonucleotídeos. Culturas de Ruminococcus albus 8 foram expostas ou não a 8 g/L de ácido tânico ou a 1 g/L de taninos condensados, extraídos de Acacia angustissima, casca de banana (Musa sp., Desmodium ovalifolium, cascas de uvas vermelhas (Vitis vinifera e Inga edulis. As culturas foram lavadas com tampão Tris pH 7 contendo 8% PEG ou 6% PVP antes do rompimento das c

  9. Ultradeep 16S rRNA Sequencing Analysis of Geographically Similar but Diverse Unexplored Marine Samples Reveal Varied Bacterial Community Composition

    OpenAIRE

    Chairmandurai Aravindraja; Dharmaprakash Viszwapriya; Shunmugiah Karutha Pandian

    2013-01-01

    BACKGROUND: Bacterial community composition in the marine environment differs from one geographical location to another. Reports that delineate the bacterial diversity of different marine samples from geographically similar location are limited. The present study aims to understand whether the bacterial community compositions from different marine samples harbour similar bacterial diversity since these are geographically related to each other. METHODS AND PRINCIPAL FINDINGS: In the present st...

  10. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  11. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær;

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that...

  12. Amplification and direct sequence analysis of the 23S rRNA gene from thermophilic bacteria

    DEFF Research Database (Denmark)

    Ibrahim, Ashraf; Hofman-Bang, H. Jacob Peider; Ahring, Birgitte Kiær

    2001-01-01

    We present a simplified and fast method to obtain high-quality sequences directly from PCRs without the traditional gel purification. We also report on an improved method to obtain sequence-quality PCR products from microorganisms that are difficult to lyse with no need for DNA extraction. The...

  13. Diagnostic Utility of Broad Range Bacterial 16S rRNA Gene PCR with Degradation of Human and Free Bacterial DNA in Bloodstream Infection Is More Sensitive Than an In-House Developed PCR without Degradation of Human and Free Bacterial DNA

    Directory of Open Access Journals (Sweden)

    Petra Rogina

    2014-01-01

    Full Text Available We compared a commercial broad range 16S rRNA gene PCR assay (SepsiTest to an in-house developed assay (IHP. We assessed whether CD64 index, a biomarker of bacterial infection, can be used to exclude patients with a low probability of systemic bacterial infection. From January to March 2010, 23 patients with suspected sepsis were enrolled. CD64 index, procalcitonin, and C-reactive protein were measured on admission. Broad range 16S rRNA gene PCR was performed from whole blood (SepsiTest or blood plasma (IHP and compared to blood culture results. Blood samples spiked with Staphylococcus aureus were used to assess sensitivity of the molecular assays in vitro. CD64 index was lower in patients where possible sepsis was excluded than in patients with microbiologically confirmed sepsis (P=0.004. SepsiTest identified more relevant pathogens than blood cultures (P=0.008; in three patients (13% results from blood culture and SepsiTest were congruent, whereas in four cases (17.4% relevant pathogens were detected by SepsiTest only. In vitro spiking experiments suggested equal sensitivity of SepsiTest and IHP. A diagnostic algorithm using CD64 index as a decision maker to perform SepsiTest shows improved detection of pathogens in patients with suspected blood stream infection and may enable earlier targeted antibiotic therapy.

  14. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    Science.gov (United States)

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  15. Analysis of Diversity and Activity of Sulfate-Reducing Bacterial Communities in Sulfidogenic Bioreactors Using 16S rRNA and dsrB Genes as Molecular Markers▿

    OpenAIRE

    Dar, Shabir A.; Yao, Li; van Dongen, Udo; Kuenen, J. Gijs; Muyzer, Gerard

    2006-01-01

    Here we describe the diversity and activity of sulfate-reducing bacteria (SRB) in sulfidogenic bioreactors by using the simultaneous analysis of PCR products obtained from DNA and RNA of the 16S rRNA and dissimilatory sulfite reductase (dsrAB) genes. We subsequently analyzed the amplified gene fragments by using denaturing gradient gel electrophoresis (DGGE). We observed fewer bands in the RNA-based DGGE profiles than in the DNA-based profiles, indicating marked differences in the populations...

  16. Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip and 16S rRNA gene clone library sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.; Andersen, G.L.; Lu, S.-E.; Wang, N.

    2009-03-01

    The bacterial diversity associated with citrus leaf midribs was characterized 1 from citrus groves that contained the Huanglongbing (HLB) pathogen, which has yet to be cultivated in vitro. We employed a combination of high-density phylogenetic 16S rDNA microarray and 16S rDNA clone library sequencing to determine the microbial community composition of symptomatic and asymptomatic citrus midribs. Our results revealed that citrus leaf midribs can support a diversity of microbes. PhyloChip analysis indicated that 47 orders of bacteria from 15 phyla were present in the citrus leaf midribs while 20 orders from phyla were observed with the cloning and sequencing method. PhyloChip arrays indicated that nine taxa were significantly more abundant in symptomatic midribs compared to asymptomatic midribs. Candidatus Liberibacter asiaticus (Las) was detected at a very low level in asymptomatic plants, but was over 200 times more abundant in symptomatic plants. The PhyloChip analysis was further verified by sequencing 16S rDNA clone libraries, which indicated the dominance of Las in symptomatic leaves. These data implicate Las as the pathogen responsible for HLB disease. Citrus is the most important commercial fruit crop in Florida. In recent years, citrus Huanglongbing (HLB), also called citrus greening, has severely affected Florida's citrus production and hence has drawn an enormous amount of attention. HLB is one of the most devastating diseases of citrus (6,13), characterized by blotchy mottling with green islands on leaves, as well as stunting, fruit decline, and small, lopsided fruits with poor coloration. The disease tends to be associated with a phloem-limited fastidious {alpha}-proteobacterium given a provisional Candidatus status (Candidatus Liberobacter spp. later changed to Candidatus Liberibacter spp.) in nomenclature (18,25,34). Previous studies indicate that HLB infection causes disorder in the phloem and severely impairs the translocation of assimilates in

  17. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers.

    Science.gov (United States)

    Myer, Phillip R; Kim, MinSeok; Freetly, Harvey C; Smith, Timothy P L

    2016-08-01

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplification primer selection, and read length, which can affect the apparent microbial community. In this study, we compared short read 16S rRNA variable regions, V1-V3, with that of near-full length 16S regions, V1-V8, using highly diverse steer rumen microbial communities, in order to examine the impact of technology selection on phylogenetic profiles. Short paired-end reads from the Illumina MiSeq platform were used to generate V1-V3 sequence, while long "circular consensus" reads from the Pacific Biosciences RSII instrument were used to generate V1-V8 data. The two platforms revealed similar microbial operational taxonomic units (OTUs), as well as similar species richness, Good's coverage, and Shannon diversity metrics. However, the V1-V8 amplified ruminal community resulted in significant increases in several orders of taxa, such as phyla Proteobacteria and Verrucomicrobia (P niche-specific database to use in analyzing data from shorter read technologies when budgetary constraints preclude use of near-full length 16S sequencing. PMID:27282101

  18. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  19. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1995-01-01

    within a hairpin loop (1068-1072), where the protein probably makes nucleotide contacts. Some of these mutations also interfere with binding of the r-protein complex L10.(L12)4 to an adjacent site on the rRNA. When added together to rRNA, proteins L10.(L12)4 and L11 bind cooperatively to overcome the......The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and...... numerous multiple mutations were generated. Expression of mutant 23S rRNAs in vivo shows that all the mutations detectably alter the phenotype, with effects ranging from a slight growth rate reduction to lack of viability. Temperature sensitivity is conferred by 1071G-->A and 1092C-->U substitutions. These...

  20. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Science.gov (United States)

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  1. Composition and Metabolic Activities of the Bacterial Community in Shrimp Sauce at the Flavor-Forming Stage of Fermentation As Revealed by Metatranscriptome and 16S rRNA Gene Sequencings.

    Science.gov (United States)

    Duan, Shan; Hu, Xiaoxi; Li, Mengru; Miao, Jianyin; Du, Jinghe; Wu, Rongli

    2016-03-30

    The bacterial community and the metabolic activities involved at the flavor-forming stage during the fermentation of shrimp sauce were investigated using metatranscriptome and 16S rRNA gene sequencings. Results showed that the abundance of Tetragenococcus was 95.1%. Tetragenococcus halophilus was identified in 520 of 588 transcripts annotated in the Nr database. Activation of the citrate cycle and oxidative phosphorylation, along with the absence of lactate dehydrogenase gene expression, in T. halophilus suggests that T. halophilus probably underwent aerobic metabolism during shrimp sauce fermentation. The metabolism of amino acids, production of peptidase, and degradation of limonene and pinene were very active in T. halophilus. Carnobacterium, Pseudomonas, Escherichia, Staphylococcus, Bacillus, and Clostridium were also metabolically active, although present in very small populations. Enterococcus, Abiotrophia, Streptococcus, and Lactobacillus were detected in metatranscriptome sequencing, but not in 16S rRNA gene sequencing. Many minor taxa showed no gene expression, suggesting that they were in dormant status. PMID:26978261

  2. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  3. Bacterial Community Dynamics during Production of Registered Designation of Origin Salers Cheese as Evaluated by 16S rRNA Gene Single-Strand Conformation Polymorphism Analysis

    OpenAIRE

    Duthoit, F.; Godon, Jean-Jacques; Montel, Marie-Christine

    2003-01-01

    Microbial dynamics during processing and ripening of traditional cheeses such as registered designation of origin Salers cheese, an artisanal cheese produced in France, play an important role in the elaboration of sensory qualities. The aim of the present study was to obtain a picture of the dynamics of the microbial ecosystem of RDO Salers cheese by using culture-independent methods. This included DNA extraction, PCR, and single-strand conformation polymorphism (SSCP) analysis. Bacterial and...

  4. Quantifying microbial utilization of petroleum hydrocarbons in salt-marsh sediments using the ^(13)C content of bacterial rRNA

    OpenAIRE

    Pearson, Ann; Kraunz, Kimberly S.; Sessions, Alex L.; Dekas, Anne E.; Leavitt, William R.; Edwards, Katrina J.

    2008-01-01

    Natural remediation of oil spills is catalyzed by complex microbial consortia. Here we take a whole-community approach to investigate bacterial incorporation of petroleum hydrocarbons from a simulated oil spill. We utilized the natural difference in carbon-isotopic abundance between a salt marsh ecosystem supported by the ^(13)C-enriched C4 grass, Spartina alterniflora, and the ^(13)C-depleted composition of petroleum to monitor changes in the ^(13)C content of biomass. Magnetic-bead capture ...

  5. Detection and identification of bacterial pathogens of fish in kidney tissue using terminal restriction fragment length polymorphism (T-RFLP) analysis of 16S rRNA genes.

    Science.gov (United States)

    Nilsson, William B; Strom, Mark S

    2002-04-01

    We report the application of a nucleic acid-based assay that enables direct detection and identification of bacterial pathogens in fish kidney tissue without the need for bacterial culture. The technique, known as terminal restriction fragment length polymorphism (T-RFLP), employs the polymerase chain reaction (PCR) using a primer pair that targets 2 highly conserved regions of the gene that encodes for the 16S small subunit of the bacterial ribosome. Each primer is 5' labeled with a different fluorescent dye, which results in each terminus of the resulting amplicon having a distinguishable fluorescent tag. The amplicon is then digested with a series of 6 restriction endonucleases, followed by size determination of the 2 labeled terminal fragments by capillary electrophoresis with laser-induced fluorescence detection. Comparison of the lengths of the full set of 12 terminal fragments with those predicted based on analyses of GenBank submissions of 16S sequences leads to presumptive identification of the pathogen to at least the genus, but more typically the species level. Results of T-RFLP analyses of genomic DNA from multiple strains of a number of fish bacterial pathogens are presented. The assay is further demonstrated on fish kidney tissue spiked with a known number of cells of Flavobacterium psychrophilum where a detection limit of ca. 30 CFU mg(-1) of tissue was estimated. A similar detection limit was observed for several other gram-negative pathogens. This procedure was also used to detect Aeromonas salmonicida and Renibacterium salmoninarum in the kidney tissue of 2 naturally infected salmonids. PMID:12033704

  6. Mutations in the bacterial ribosomal protein l3 and their association with antibiotic resistance

    DEFF Research Database (Denmark)

    Klitgaard, Rasmus N; Ntokou, Eleni; Nørgaard, Katrine;

    2015-01-01

    Different groups of antibiotics bind to the peptidyl transferase center (PTC) in the large subunit of the bacterial ribosome. Resistance to these groups of antibiotics has often been linked with mutations or methylations of the 23S rRNA. In recent years, there has been a rise in the number of...... studies where mutations have been found in the ribosomal protein L3 in bacterial strains resistant to PTC-targeting antibiotics but there is often no evidence that these mutations actually confer antibiotic resistance. In this study, a plasmid exchange system was used to replace plasmid-carried wild...

  7. Fragmentations of the large-subunit rRNA in the family Rhizobiaceae.

    OpenAIRE

    Selenska-Pobell, S; Evguenieva-Hackenberg, E

    1995-01-01

    A 130-nucleotide-long rRNA species corresponding to the 5' end of the 23S rRNA gene was found in 96 strains belonging to different Rhizobium, Bradyrhizobium, and Agrobacterium species. Additional fragmentation in the central region of the large-subunit rRNA occurred in all agrobacteria, except Agrobacterium vitis, and in most Rhizobium leguminosarum and Rhizobium etli strains but did not occur in any of the other rhizobia and bradyrhizobia studied.

  8. Analysis of bacterial community structure in Saba-Narezushi (Narezushi of Mackerel) by 16S rRNA gene clone library.

    Science.gov (United States)

    Matsui, Hiroki; Tsuchiya, Rie; Isobe, Yuka; Narita, Miyo

    2013-08-01

    Narezushi, a derivation of sushi, is a traditional Japanese food made by fermenting salted fish meat and cooked rice together. In this study, the microbial diversity of saba-narezushi (narezushi of mackerel, Scomber japonicus) was analyzed by the 16S ribosomal RNA gene clone library method. Chemical composition was also analyzed to compare with different kinds of narezushi. The chemical composition of the narezushi was similar to those obtained from samma-narezushi. Ninety-four clones were randomly selected and DNA sequences of cloned fragments (approx. 890 bp) were analyzed. The DNA sequences obtained were phylogenetically analyzed. The expected operational taxonomy units (OTUs) by Chao1 estimates and Shannon-Wiener index (H') at 97% identity threshold were 48 and 1.822, respectively. The sequence similarity of the cloned fragment was equal to or higher than 98% of the sequence of cultivated bacterial species in the public database. Most of the clones (85%) belonged to lactic acid bacteria (LAB). Lactobacillus curvatus was the most abundant species followed by Lactococcus piscium and Leuconostoc gasicomitatum, suggesting that these bacteria play important roles in the fermentation of saba-narezushi. PMID:24425983

  9. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  10. Designing PCR Primers from 16S-23S rDNA Intergenic Spacer Region for the Identification of Pasteurella multocida%以 16S-23S rDNA 间区序列为目的基因设计 PCR 引物鉴定多杀巴斯德氏菌

    Institute of Scientific and Technical Information of China (English)

    周浩; 刘寅; 陈一军; 郑泽军; 黄熙泰

    2008-01-01

    多杀巴斯德氏菌是养殖动物(鸡,猪,牛等)的重要致病菌.本研究以16S-23S rDNA间区序列为目的基因设计PCR引物鉴定多杀巴斯德氏菌.通过对多杀巴斯德氏菌ITS-IA(含有tDNA-Ile和tDNA-Ala的16S-23S rDNA间区序列)的测序和与GenBank中序列的BLAST,设计筛选了一对特异引物PS-F/PS-R.对引物的特异性和有效性,用PCR方法进行了验证.结果表明:所有的多杀巴斯德氏菌标准菌株和分离菌株都能被检出,而全部39株非多杀巴斯德氏菌都没有扩增出特异性条带.其检测灵敏度能达到102CFU/mL.研究结果表明,发展了的PCR鉴定方法是省时的和可靠的,整个过程只需要20 h,而传统的鉴定方法需要至少5 d的时间.%Pasteurella multocida is an important pathogen that infects many kinds of animals. In present study, a polymerase chain reaction (PCR) assay using primers derived from the 16S-23S rRNA intergenic spacer (ITS) of P. multocida was developed. One pairs of specific PCR primers were designed by sequencing the ITS-IA (ITS containing tDNA-Ile and tDNA-Ala) of P. multocida and BLAST of GenBank. The specificity and efficiency of the PCR methods were tested against a panel of numerous strains from 39 different bacterial strains. All of the P. multocida strains generated positive signal, and no cross-reaction was observed with non-P, multocida strains in the PCR detection. Sensitivity of the detection is 102 CFU/mL cultures. The newly developed PCR array procedures take only 20 hours for each time, whereas the conventional methods required at least five days. This study demonstrated that the PCR detection for P. multocida is time-saved and reliable.

  11. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    DEFF Research Database (Denmark)

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.

    2001-01-01

    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  12. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    Science.gov (United States)

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  13. Crystal structure of the Escherichia coli 23S rRNA:m5C methyltransferase RlmI (YccW) reveals evolutionary links between RNA modification enzymes

    DEFF Research Database (Denmark)

    Sunita, S; Tkaczuk, Karolina L; Purta, Elzbieta;

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I......; previously known as YccW) specifically modifies Escherichia coli 23S rRNA at nucleotide C1962 to form 5-methylcytosine. Here, we report the crystal structure of RlmI refined at 2 A to a final R-factor of 0.194 (R(free)=0.242). The RlmI molecule comprises three domains: the N-terminal PUA domain; the central...

  14. 16S rRNA gene-based identification of cultured bacterial flora from host-seeking Ixodes ricinus, Dermacentor reticulatus and Haemaphysalis concinna ticks, vectors of vertebrate pathogens

    Czech Academy of Sciences Publication Activity Database

    Rudolf, Ivo; Mendel, Jan; Šikutová, Silvie; Švec, P.; Masaříková, J.; Nováková, D.; Buňková, L.; Sedláček, I.; Hubálek, Zdeněk

    2009-01-01

    Roč. 54, č. 5 (2009), s. 419-428. ISSN 0015-5632 R&D Projects: GA AV ČR KJB600930613 Institutional research plan: CEZ:AV0Z60930519 Keywords : ixodid ticks * 16S rRNA gene sequencing * Ixodes ricinus * Dermacentor reticulatus * Haemaphysalis concinna * microbial diversity Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  15. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  16. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    Science.gov (United States)

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  17. 16S rRNA gene clone library analysis of bacterial communities of the tick with infection of 4 species of pathogens%4种病原菌特异基因片段阳性蜱的16S rRNA基因克隆文库分析

    Institute of Scientific and Technical Information of China (English)

    张守印; 俞东征; 孙继民; 贺金荣; 付秀萍; 张景山; 张建华; 蔡虹; 马凤琴; 海荣

    2009-01-01

    Objective To develop the method of 16S rRNA gene clone library for tick bacterial flora analysis, and to analyze the detection effective of pathogens in tick and capacity of bacterial flora diversity. Methods Primers were designed according to the specific gene of Borrelia burgdorferi, Bartonella henselae, Anaplasma phagocytophilum, Ehrlichia chaffeensis and templates were choosen by positive PCR result to amplify the DNA extracted from the ticks. One set of primers targeting 16S rRNA gene conserved region were chosen to amplify certain fragments, DNA extraction, PCR reaction, cloning and sequencing. Nucleotide sequences were compared with GenBank database. Calculated Coverage values of clone library and Shannon-Wiener diversity index. Results Sixteen defined genus-or species-bacteria were detected in 103 valid sequences. Eight species were edge type (Clone No. > 5). Three kinds of pathogens were identified (Borrelia burgdorferi, Bartonella henselae and Rickettsia sp). Three kinds of pathogens were not edge type(Clone No. 5个);检测到伯氏疏螺旋体、汉赛巴通体和立克次体3种病原菌,但这3种病原菌均不是优势类型(克隆子数均<5个).Coverage值为96.11%,Shannon-Wiener多样性指数为2.40.克隆序列分析结果表明,蜱寄生细菌主要为α、γ变形菌纲,占56.25%(9/16).结论 16S rRNA基因序列分析可以对蜱标本进行菌群相对定量研究,可以同时检出多种病原菌,是一种较好的细菌菌群多样性分析和病原菌筛检方法.

  18. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally....... In addition, a G2502----A transition caused a decreased growth rate, probably due to a partial selection against mutant ribosome incorporation into polysomes, while an A2503----C transversion produced a decreased growth rate and conferred resistance to chloramphenicol. All of the mutant RNAs were...

  19. Rapid Identification and Differentiation of the Soft Rot Erwinias by 16S-23S Intergenic Transcribed Spacer-PCR and Restriction Fragment Length Polymorphism Analyses

    OpenAIRE

    Toth, I. K.; Avrova, A. O.; Hyman, L. J.

    2001-01-01

    Current identification methods for the soft rot erwinias are both imprecise and time-consuming. We have used the 16S-23S rRNA intergenic transcribed spacer (ITS) to aid in their identification. Analysis by ITS-PCR and ITS-restriction fragment length polymorphism was found to be a simple, precise, and rapid method compared to current molecular and phenotypic techniques. The ITS was amplified from Erwinia and other genera using universal PCR primers. After PCR, the banding patterns generated al...

  20. Purification, crystallization and preliminary X-ray crystallographic analysis of 23S RNA m2G2445 methyltransferase RlmL from Escherichia coli

    International Nuclear Information System (INIS)

    RlmL, a 23S rRNA m2G2445 methyltransferase from Escherichia coli, was expressed, purified and crystallized, and crystals diffracted to 2.2 Å. The RlmL (YcbY) protein in Escherichia coli is an rRNA methyltransferase that is specific for m2G2445 modification of 23S RNA. The rlmL gene was cloned into the expression vector pET28a and expressed in the host E. coli strain BL21 (DE3). Recombinant protein with a six-histidine tag was purified by Ni2+-affinity chromatography followed by gel filtration. Crystals were grown using the hanging-drop vapour-diffusion method and a detergent was used as an additive to improve diffraction quality. The final crystals diffracted to 2.2 Å resolution. The crystals belonged to space group P21, with unit-cell parameters a = 73.6, b = 140.8, c = 102.9 Å, β = 102.3°. The crystal has a most probable solvent content of 62.8% with two molecules in the asymmetric unit

  1. Development of a Broad-Range 23S rDNA Real-Time PCR Assay for the Detection and Quantification of Pathogenic Bacteria in Human Whole Blood and Plasma Specimens

    OpenAIRE

    Paolo Gaibani; Mara Mariconti; Gloria Bua; Sonia Bonora; Davide Sassera; Maria Paola Landini; Patrizia Mulatto; Stefano Novati; Claudio Bandi; Vittorio Sambri

    2013-01-01

    Molecular methods are important tools in the diagnosis of bloodstream bacterial infections, in particular in patients treated with antimicrobial therapy, due to their quick turn-around time. Here we describe a new broad-range real-time PCR targeting the 23S rDNA gene and capable to detect as low as 10 plasmid copies per reaction of targeted bacterial 23S rDNA gene. Two commercially available DNA extraction kits were evaluated to assess their efficiency for the extraction of plasma and whole b...

  2. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes.

    Science.gov (United States)

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M

    2001-02-01

    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes. PMID:11166101

  3. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    DEFF Research Database (Denmark)

    Long, Katherine; Munck, Christian

    2010-01-01

    linezolid. Smaller decreases were observed with the A2503G, U2504G, and G2505A mutations at nucleotides proximal to linezolid, showing that the degree of resistance conferred is not simply inversely proportional to the nucleotide-drug distance. The double mutations G2032A-C2499A, G2032A-U2504G, C2055A-U2504...

  4. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    DEFF Research Database (Denmark)

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen; Chungjatupornchai, Wipa; Dahlberg, Albert E

    2008-01-01

    Translocation during the elongation phase of protein synthesis involves the relative movement of the 30S and 50S ribosomal subunits. This movement is the target of tuberactinomycin antibiotics. Here, we describe the isolation and characterization of mutants of Thermus thermophilus selected for...

  5. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  6. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    Science.gov (United States)

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  7. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    Science.gov (United States)

    Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

    2012-01-01

    In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life. PMID:23316189

  8. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    Directory of Open Access Journals (Sweden)

    Gbenga Adedeji Adewumi

    2013-01-01

    Full Text Available In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the sixteen iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, Staphylococcus saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and Uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA combined with 16S-23S rRNA gene internal transcribed spacer (ITS PCR amplification, restriction analysis (ITS-PCR-RFLP and randomly amplified polymorphic DNA (RAPD-PCR. This further discriminated Bacillus subtilis and its variants from food-borne pathogens such as Bacillus cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP for iru production to achieve product consistency, safety quality and improved shelf life.

  9. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    DEFF Research Database (Denmark)

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within...... contained substitutions at single sites, and these are confined to 12 nucleotide positions. These nucleotides, corresponding to A2051-A2060, C2611, and A2614 in 23S rRNA, presumably comprise the RNA recognition motif for ErmE methyltransferase. The structure formed by these nucleotides is highly conserved...

  10. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Science.gov (United States)

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  11. (e, 3e) differential cross section of He (21s) and He (23s)

    International Nuclear Information System (INIS)

    The angular distribution of the five-fold differential cross section for the electron impact double ionization of He (21s) and He (23s) has been studied. The kinematical conditions for maxima/minima in the angular distribution for the two cases have been compared. The two-step process for the double ionization is found to contribute very little in the triplet case. (author)

  12. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    Science.gov (United States)

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  13. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Institute of Scientific and Technical Information of China (English)

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  14. TaxMan: a server to trim rRNA reference databases and inspect taxonomic coverage

    OpenAIRE

    Brandt, B. W.; Bonder, M. J.; Huse, S.M.; Zaura, E.

    2012-01-01

    Amplicon sequencing of the hypervariable regions of the small subunit ribosomal RNA gene is a widely accepted method for identifying the members of complex bacterial communities. Several rRNA gene sequence reference databases can be used to assign taxonomic names to the sequencing reads using BLAST, USEARCH, GAST or the RDP classifier. Next-generation sequencing methods produce ample reads, but they are short, currently ∼100-450 nt (depending on the technology), as compared to the full rRNA g...

  15. Lifetime of the metastable 23S1 state in stored Li+ ions

    International Nuclear Information System (INIS)

    A laser-induced fluorescence technique combined with the observation of spontaneous magnetic dipole photons from the highly metastable 23S1 state of Li+ was used to measure the radiative lifetime of this state. The ions are created by electron impact on a lithium atomic beam and are subsequently stored for periods of many seconds in an RF-quadrupole ion trap. A tunable dye laser excites the 23S--23P, transition at 5485A, and the intercombination electric dipole transition 23P1--1 1S0 at 202A is observed. This process depletes the metastable population in a time tau/sub d/ 3S1/ and provides a measure of the total number of metastables. Comparison with the rate of 210A spontaneously emitted photons yields a measured value for the 23S1 radiative lifetime of tau/sub rad/ = 58.6 +- 12.9 sec, where the quoted error represents 95% confidence levels. The theoretical lifetime is tau/sub theory/ = 49.0 sec. The measured value includes data taken with both 6Li+ and 7Li+ isotopes and was corrected for the slightly different detector efficiencies at 202A and 210A. A careful study of nonradiative quenching of the metastable state was necessary to understand observed differences between tau/sub rad/ and tau/sub 3S1/, the total metastable lifetime. Spatial density profiles of the ions within the trap, useful for determining the ion temperature, were obtained by scanning the laser beam horizontally across the ion trap while storing 23P1--1S0 photon counts as a function of the laser beam's position. Agreement with a simple equilibrium model, including space charge effects, is satisfactory. A study of the optical pumping process is necessary to understand the laser-ion interaction, and observational and theoretical data are presented. 47 references

  16. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  17. Methods Used to Study Bacterial Diversity in the Marine Environment around Qingdao

    Institute of Scientific and Technical Information of China (English)

    Robertson P. A. W.; MacInnes J; Sparagano O. A. E.; Purdom I.; LI Y.; YU D.H; DU Z.J.; XU H.S.; Austin B.

    2002-01-01

    Pollution has a considerable effect on biological communities, in terms of size and diversity of the populations.Yet, the precise consequences of human activity on microbial communities in the marine environment are poorly understood.Therefore, in an ongoing collaborative research programme between Heriot-Watt University and the Ocean University ofQingdao, bacteria were isolated in 1999 and 2000 from marine sediment, seawater, seaweed, fish and shellfish, taken fromlocations in Shandong Province adjacent to Qingdao. Sampling locations were comprised of industrial and aquacultural sitesand a clean, control site. In order to analyse microbial diversity, a polyphasic approach was adopted for characterisation ofthese isolates, specifically through examination of key phenotypic traits, i.e. using Biolog GN MicroPlateTM profiles, bacteri-al whole cell protein profiles and 16S and 23S rRNA gene sequences. These techniques yielded complex taxonomic data,which were subjected to statistical and cluster analyses. The application of these methods to studies of microbial communitiesis discussed.

  18. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Science.gov (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  19. Precise determination of the magnetic moment of helium in its 23S1 metastable state

    International Nuclear Information System (INIS)

    The electronic magnetic moment of helium was measured by the atomic beam magnetic resonance method using separated oscillating fields. Actually, the magnetic moment of helium relative to that of rubidium was measured. The result was combined with the ratio g/sub J/(Rb)/g/sub J/(H) to get R = g/sub J/(He, 23S1)/g/sub J/(H,2S/sub 1/2/) = 1 - (23.19 +- 0.1) x 10-6. The motivation for this Zeeman measurement was to provide as sensitive a test of the theory of atomic magnetism for a multielectron atom as possible. In particular, the experiment provides a test of the relativistic corrections to the Zeeman effect. The experiment also tests the additivity of the radiative corrections to the magnetic moments of the two electrons. Another motivation concerns the determination of the fine structure constant α from measurements of the 23P fine structure intervals of 4He; namely, the understanding of the 23S states contributes to the knowledge of the theoretical expressions for the 23P intervals. For the chosen magnetic field of 9.5 kG, the helium resonance frequency was 26.8 GHz, the rubidium frequency, 26.4 GHz. The linewidth associated with the microwave double loop was 25 KHz. Thus it was necessary to pick the resonance line centers to only 1 part in 10 to achieve a 0.1 ppM accuracy. This result is in excellent agreement with the latest theoretical value, R = 1 - 23.21 x 10-6; and with earlier, less precise atomic beam measurements; and with the latest, comparably accurate optical pumping value. Many possible sources of error were investigated. The quoted error is based on analysis of residual systematic effects

  20. Bacterial gastroenteritis

    Science.gov (United States)

    Infectious diarrhea - bacterial gastroenteritis; Acute gastroenteritis; Gastroenteritis - bacterial ... Bacterial gastroenteritis can affect 1 person or a group of people who all ate the same food. It is ...

  1. Interaction potentials and energy transfer cross sections for collisions of metastable helium and neon I: He (23S) + Ne

    International Nuclear Information System (INIS)

    Differential cross sections have been measured for He(23S) + Ne at kinetic energies between 28 and 370 meV. For energies above 90 meV the elastic cross sections show Stueckelberg oscillations from curve crossings, which lead to the energy exchange process: He(23S) + Ne → He(11S) + Ne(2p54s,3d,4p). Differential cross sections for this inelastic process could be measured above 200 meV. A fit to the data gives the potentials for He(23S) + Ne and, less accurately, for He + Nesup(*). These results offer a simple explanation, why the exothermic pumping process of the infrared lines of the HeNe laser has a threshold of about 80 meV and a small cross section. (orig.)

  2. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    Science.gov (United States)

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  3. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    Science.gov (United States)

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-06-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  4. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    OpenAIRE

    Triman, K L; Peister, A; R. A. Goel

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  5. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis

    OpenAIRE

    Layton, A C; Karanth, P. N.; Lajoie, C. A.; Meyers, A J; Gregory, I. R.; Stapleton, R. D.; Taylor, D E; Sayler, G. S.

    2000-01-01

    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homolog...

  6. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    Science.gov (United States)

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  7. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis

    OpenAIRE

    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M

    2004-01-01

    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website (http://rdp.cme.msu.edu/). RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  8. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    Science.gov (United States)

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  9. Efficient subtraction of insect rRNA prior to transcriptome analysis of Wolbachia-Drosophila lateral gene transfer

    Directory of Open Access Journals (Sweden)

    Kumar Nikhil

    2012-05-01

    Full Text Available Abstract Background Numerous methods exist for enriching bacterial or mammalian mRNA prior to transcriptome experiments. Yet there persists a need for methods to enrich for mRNA in non-mammalian animal systems. For example, insects contain many important and interesting obligate intracellular bacteria, including endosymbionts and vector-borne pathogens. Such obligate intracellular bacteria are difficult to study by traditional methods. Therefore, genomics has greatly increased our understanding of these bacteria. Efficient subtraction methods are needed for removing both bacteria and insect rRNA in these systems to enable transcriptome-based studies. Findings A method is described that efficiently removes >95% of insect rRNA from total RNA samples, as determined by microfluidics and transcriptome sequencing. This subtraction yielded a 6.2-fold increase in mRNA abundance. Such a host rRNA-depletion strategy, in combination with bacterial rRNA depletion, is necessary to analyze transcription of obligate intracellular bacteria. Here, transcripts were identified that arise from a lateral gene transfer of an entire Wolbachia bacterial genome into a Drosophila ananassae chromosome. In this case, an rRNA depletion strategy is preferred over polyA-based enrichment since transcripts arising from bacteria-to-animal lateral gene transfer may not be poly-adenylated. Conclusions This enrichment method yields a significant increase in mRNA abundance when poly-A selection is not suitable. It can be used in combination with bacterial rRNA subtraction to enable experiments to simultaneously measure bacteria and insect mRNA in vector and endosymbiont biology experiments.

  10. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Directory of Open Access Journals (Sweden)

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  11. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  12. Bacterial biogeography of the human digestive tract

    OpenAIRE

    Stearns, Jennifer C.; Michael D. J. Lynch; Senadheera, Dilani B.; Howard C. Tenenbaum; Michael B. Goldberg; Cvitkovitch, Dennis G.; Kenneth Croitoru; Gabriel Moreno-Hagelsieb; Neufeld, Josh D.

    2011-01-01

    We present bacterial biogeography as sampled from the human gastrointestinal tract of four healthy subjects. This study generated >32 million paired-end sequences of bacterial 16S rRNA genes (V3 region) representing >95,000 unique operational taxonomic units (OTUs; 97% similarity clusters), with >99% Good's coverage for all samples. The highest OTU richness and phylogenetic diversity was found in the mouth samples. The microbial communities of multiple biopsy sites within the colon were highl...

  13. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  14. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Junko Obata

    Full Text Available While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  15. Downregulation of rRNA Transcription Triggers Cell Differentiation

    OpenAIRE

    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura

    2014-01-01

    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  16. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    Science.gov (United States)

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  17. Identification of bacteria associated with underground parts of Crocus sativus by 16S rRNA gene targeted metagenomic approach.

    Science.gov (United States)

    Ambardar, Sheetal; Sangwan, Naseer; Manjula, A; Rajendhran, J; Gunasekaran, P; Lal, Rup; Vakhlu, Jyoti

    2014-10-01

    Saffron (Crocus sativus L), an autumn-flowering perennial sterile plant, reproduces vegetatively by underground corms. Saffron has biannual corm-root cycle that makes it an interesting candidate to study microbial dynamics in its rhizosphere and cormosphere (area under influence of corm). Culture independent 16S rRNA gene metagenomic study of rhizosphere and cormosphere of Saffron during flowering stage revealed presence of 22 genera but none of the genus was common in all the three samples. Bulk soil bacterial community was represented by 13 genera with Acidobacteria being dominant. In rhizosphere, out of eight different genera identified, Pseudomonas was the most dominant genus. Cormosphere bacteria comprised of six different genera, dominated by the genus Pantoea. This study revealed that the bacterial composition of all the three samples is significantly different (P rhizosphere, cormosphere and bulk soil of Saffron, using cultivation independent 16S rRNA gene targeted metagenomic approach. PMID:24989343

  18. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    OpenAIRE

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

    2002-01-01

    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene.

  19. Characterization by 16S rRNA gene analysis and in situ hybridization of bacteria living in the hindgut of a deposit-feeding echinoid (Echinodermata)

    OpenAIRE

    da Silva, S.G.; Gillan, D. C.; Dubilier, N.; De Ridder, C.

    2006-01-01

    The hindgut caecum of the deposit-feeding echinoid Echinocardium cordatum harbours a symbiotic bacterial microflora, organized into layered mats around detrital particles owing to the proliferation of filamentous bacteria. The bacterial community was analysed using 16S rRNA gene analysis and fluorescence in situ hybridization. The purpose was to characterize its biodiversity and to identify its predominant members. The majority of the 16S sequences belong to the delta -Proteobacteria (61.5%),...

  20. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water

    OpenAIRE

    Ahmed, W.; Staley, C.; Sadowsky, M J; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.

    2015-01-01

    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial...

  1. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis

    OpenAIRE

    Steelman Samantha M; Chowdhary Bhanu P; Dowd Scot; Suchodolski Jan; Janečka Jan E

    2012-01-01

    Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to character...

  2. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    DEFF Research Database (Denmark)

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;

    2009-01-01

    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  3. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    Science.gov (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  4. Downregulation of rRNA transcription triggers cell differentiation.

    Directory of Open Access Journals (Sweden)

    Yuki Hayashi

    Full Text Available Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiation is considered to contribute to reduced cell growth. However, the downregulation of rRNA transcription can induce various cellular processes; therefore, it may positively regulate cell differentiation. To test this possibility, we specifically downregulated rRNA transcription using actinomycin D or a siRNA for Pol I-specific transcription factor IA (TIF-IA in HL-60 and THP-1 cells, both of which have differentiation potential. The inhibition of rRNA transcription induced cell differentiation in both cell lines, which was demonstrated by the expression of the common differentiation marker CD11b. Furthermore, TIF-IA knockdown in an ex vivo culture of mouse hematopoietic stem cells increased the percentage of myeloid cells and reduced the percentage of immature cells. We also evaluated whether differentiation was induced via the inhibition of cell cycle progression because rRNA transcription is tightly coupled to cell growth. We found that cell cycle arrest without affecting rRNA transcription did not induce differentiation. To the best of our knowledge, our results demonstrate the first time that the downregulation of rRNA levels could be a trigger for the induction of differentiation in mammalian cells. Furthermore, this phenomenon was not simply a reflection of cell cycle arrest. Our results provide a novel insight into the relationship between rRNA transcription and cell differentiation.

  5. Calculation and comparative analysis of the ir spectra of homobrassinolide and (22s,23s)-homobrassinolide

    International Nuclear Information System (INIS)

    Normal vibrational frequencies and absolute IR band intensities of the biologically active steroid phytohormones homobrassinolide and (22S,23S)-homobrassinolide were calculated in the framework of an original approach that combined classical analysis of normal modes using molecular mechanics with quantum-chemical estimation of the absolute intensities. IR absorption bands were interpreted based on a comparison of the experimental and theoretical absorption spectra. The impact of structural differences in the side chains of these molecules on the formation of their IR spectra in the region 1500-950 cm -1 was estimated. (authors)

  6. Calculation and Comparative Analysis of the IR Spectra of Homobrassinolide and (22S,23S)-Homobrassinolide

    Science.gov (United States)

    Andrianov, V. M.; Korolevich, M. V.

    2015-09-01

    Normal vibrational frequencies and absolute IR band intensities of the biologically active steroid phytohormones homobrassinolide and (22S,23S)-homobrassinolide were calculated in the framework of an original approach that combined classical analysis of normal modes using molecular mechanics with quantum-chemical estimation of the absolute intensities. IR absorption bands were interpreted based on a comparison of the experimental and theoretical absorption spectra. The impact of structural differences in the side chains of these molecules on the formation of their IR spectra in the region 1500-950 cm -1 was estimated.

  7. Simulation of the structures and calculation of IR Spectra of (22 s,23 s)-Homobrassinolide conformers

    Science.gov (United States)

    Andrianov, V. M.; Korolevich, M. V.

    2012-07-01

    Frequencies and intensities of normal vibrations of (22 S,23 S)-homobrassinolide, a biologically active representative of steroidal phytohormones, were calculated within the framework of an original approach that combined a classical analysis of normal vibrations by a molecular mechanics method with a quantum-chemical estimation of absolute intensities. Two molecular structures with different side-chain conformations were considered. The molecular IR absorption bands in the range 1500-900 cm-1 were interpreted for the first time and the influence of the side-chain conformation on the IR spectrum was analyzed based on a comparison of the experimental and calculated spectra.

  8. Simulation of the structures and calculation of IR Spectra of (22S,23S)-Homobrassinolide conformers

    International Nuclear Information System (INIS)

    Frequencies and intensities of normal vibrations of (22S,23S)-homobrassinolide, a biologically active representative of steroidal phytohormones, were calculated within the framework of an original approach that combined a classical analysis of normal vibrations by a molecular mechanics method with a quantum-chemical estimation of absolute intensities. Two molecular structures with different side-chain conformations were considered. The molecular IR absorption bands in the range 1500-900 cm-1 were interpreted for the first time and the influence of the side-chain conformation on the IR spectrum was analyzed based on a comparison of the experimental and calculated spectra. (authors)

  9. Measurement of the positronium 13S1-23S1 interval by continuous-wave two-photon excitation

    OpenAIRE

    Fee, M.; Mills, A.; Chu, S.; Shaw, E; Danzmann, K.; Chichester, R.; Zuckerman, D.

    1993-01-01

    Using continuous-wave excitation to eliminate the problems inherent with pulsed laser measurements of nonlinear transitions, we have measured the 13S1-23S1 interval in positronium (Ps) to be 1 233 607 216.4±3.2 MHz. The quoted 2.6 ppb (parts per 109) uncertainty is primarily due to the determination of the Ps resonance relative to the Te2 reference line, with a 1.5 ppb contribution from a recent calibration of the Te2 line relative to the hydrogen 1S-2S transition. The uncertainty corresponds...

  10. AtPPR2, an Arabidopsis pentatricopeptide repeat protein, binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis

    OpenAIRE

    Lu, Yuqing; Li, Cong; Wang, Hai; Chen, Hao; Berg, Howard; Xia, Yiji

    2011-01-01

    Pentatricopeptide repeat (PPR) proteins are mainly involved in regulating post-transcriptional processes in mitochondria and plastids, including chloroplasts. Mutations in the Arabidopsis PPR2 gene have previously been found to cause defects in seed development and reduced transmission through male and female gametophytes. However, the exact function of AtPPR2 has not been defined. We found that a loss-of-function mutation of AtPPR2 leads to arrest of the first mitotic division during both ma...

  11. Structure of the bifunctional methyltransferase YcbY (RlmKL) that adds the m7G2069 and m2G2445 modifications in Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Wang, Kai-Tuo; Desmolaize, Benoit; Nan, Jie;

    2012-01-01

    fusions from two separate proteins found in Gram-positives. The crystal structures described here show that both the N- and C-terminal halves of E. coli YcbY have a methyltransferase active site and their folding patterns respectively resemble the Streptococcus mutans proteins Smu472 and Smu776. Mass...

  12. Phylogenetic Diversity and Spatial Distribution of the Microbial Community Associated with the Caribbean Deep-water Sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA Gene Analysis

    OpenAIRE

    Meyer, Birte; Kuever, Jan

    2008-01-01

    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species...

  13. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  14. Bacterial Diversity in Çamalti Saltern, Turkey.

    Science.gov (United States)

    Mutlu, Mehmet Burçin; Güven, Kiymet

    2015-01-01

    A combination of culture-dependent and culture-independent approaches was employed to identify the bacterial diversity of Çamalti solar saltern in Turkey. The bacterial communities of Çamalti Saltern were analyzed by molecular techniques that included denaturing gradient gel electrophoresis of 16S rRNA gene fragments PCR amplified from DNA extracted from the water samples of the saltern and 16S rRNA gene library analysis. A total of 42 isolates were identified at the genus/species level and 17 of them were found to belong to the Bacteria domain. All bacterial isolates were phylogenetically related to Halobacillus, Virgibacillus and Halomonas genus. A total of 50 clones from 16S rRNA gene library were analyzed by ARDRA. 16S rRNA sequence analysisof these clones revealed that most (85%) of the bacterial clones were related to Salinibacter genus members of the Bacteroidetes. The sequences of DGGE bands were related to the uncultured Salinibacter, uncultured halophilic bacterium and Halomonas sp. This work highlights the halophilic bacterial diversity of Çamalti marine solar saltern. PMID:26094314

  15. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Directory of Open Access Journals (Sweden)

    Swee Hoe Ong

    Full Text Available The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90% in species-level identification thereby opening up potential application of this approach for clinical microbial characterization.

  16. Direct 16S rRNA Gene Sequencing from Clinical Specimens, with Special Focus on Polybacterial Samples and Interpretation of Mixed DNA Chromatograms ▿

    OpenAIRE

    Kommedal, Øyvind; Kvello, Kristine; Skjåstad, Rune; Langeland, Nina; Wiker, Harald G.

    2009-01-01

    RipSeq (iSentio, Bergen, Norway) is a web-based application for the analysis of mixed DNA chromatograms. It opens the possibility to analyze chromatograms obtained by direct 16S rRNA gene sequencing from polybacterial human clinical samples. In this study, we used direct 16S rRNA gene sequencing to investigate 264 samples from a wide range of suspected human bacterial infections. The sequence-based identification was compared with the results from routine culture-based identification. A total...

  17. The 11S → 23S and 11S → 13P excitation of helium by electron impact

    International Nuclear Information System (INIS)

    The R-matrix method calculations of Berrington et al (J. Phys. B.; 8: 1459 (1975)) and Fon et al (J. Phys. B.; 11: 325 (1978)) are extended to the calculation of the integrated and differential cross sections for electron excitation of the ground-state helium atom to the 23S and 23P states in the energy ranges (21.4 <= E <= 30 eV) and (80 <= E <= 200 eV). For intermediate energies (30 <= E <= 80 eV) pseudo-resonances arise which make accurate cross sections difficult to calculate and this region is therefore not considered. The calculations are compared with recent theoretical calculations and experimental measurements. (author)

  18. Bacterial community analysis of Indonesian hot springs.

    Science.gov (United States)

    Baker, G C; Gaffar, S; Cowan, D A; Suharto, A R

    2001-06-12

    We report the first attempts to describe thermophilic bacterial communities in Indonesia's thermal springs using molecular phylogenetic analyses. 16S rRNA genes from laboratory cultures and DNA directly amplified from three hot springs in West Java were sequenced. The 22 sequences obtained were assignable to the taxa Proteobacteria, Bacillus and Flavobacterium, including a number of clades not normally associated with thermophily. PMID:11410357

  19. Bacterial Community Development in Experimental Gingivitis

    OpenAIRE

    Kistler, James O; Veronica Booth; Bradshaw, David J.; Wade, William G.

    2013-01-01

    Current knowledge of the microbial composition of dental plaque in early gingivitis is based largely on microscopy and cultural methods, which do not provide a comprehensive description of oral microbial communities. This study used 454-pyrosequencing of the V1-V3 region of 16S rRNA genes (approximately 500 bp), and bacterial culture, to characterize the composition of plaque during the transition from periodontal health to gingivitis. A total of 20 healthy volunteers abstained from oral hygi...

  20. Bacterial Community Development in Experimental Gingivitis

    OpenAIRE

    Kistler, James O.; Booth, Veronica; Bradshaw, David J.; Wade, William G.

    2013-01-01

    Current knowledge of the microbial composition of dental plaque in early gingivitis is based largely on microscopy and cultural methods, which do not provide a comprehensive description of oral microbial communities. This study used 454-pyrosequencing of the V1–V3 region of 16S rRNA genes (approximately 500 bp), and bacterial culture, to characterize the composition of plaque during the transition from periodontal health to gingivitis. A total of 20 healthy volunteers abstained from oral hygi...

  1. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    Science.gov (United States)

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  2. Bacterial population structure and dynamics during the development of almond drupes

    Science.gov (United States)

    Aims: To describe the bacterial populations and their dynamics during the development of almond drupes. Methods and Results: We examined 16S rRNA gene libraries derived from the bacterial populations on almond drupes at three stages of development: 1) when the drupes were full sized, but before embr...

  3. 16S rRNA gene phylogenesis of culturable predominant bacteria from diseased Apostichopus japonicus (Holothuroidea, Echinodermata)

    Science.gov (United States)

    Ma, Haiyan; Jiang, Guoliang; Wu, Zhiqiang; Wang, Xin

    2009-06-01

    Cultured Apostichopus japonicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopus japonicus individuals.

  4. 16S rRNA Gene Phylogenesis of Culturable Predominant Bacteria from Diseased Apostichopus japonicus(Holothuroidea, Echinodermata)

    Institute of Scientific and Technical Information of China (English)

    MA Haiyan; JIANG Guoliang; WU Zhiqiang; WANG Xin

    2009-01-01

    Cultured Apostichopusjaponicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopusjaponicus individuals.

  5. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    Science.gov (United States)

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  6. Bacterial Vaginosis

    Science.gov (United States)

    ... 586. Related Content STDs during Pregnancy Fact Sheet Pregnancy and HIV, Viral Hepatitis, and STD Prevention Pelvic Inflammatory Disease ( ... Bacterial Vaginosis (BV) Chlamydia Gonorrhea Genital Herpes Hepatitis HIV/AIDS & STDs Human Papillomavirus ... STDs See Also Pregnancy Reproductive ...

  7. Bacterial Meningitis

    Science.gov (United States)

    ... Schedules Preteen & Teen Vaccines Meningococcal Disease Sepsis Bacterial Meningitis Recommend on Facebook Tweet Share Compartir On this ... serious disease. Laboratory Methods for the Diagnosis of Meningitis This manual summarizes laboratory methods used to isolate, ...

  8. Prostatitis - bacterial

    Science.gov (United States)

    Any bacteria that can cause a urinary tract infection can cause acute bacterial prostatitis. Infections spread through sexual contact can cause prostatitis. These include chlamydia and gonorrhea . Sexually transmitted ...

  9. Bacterial Conjunctivitis

    OpenAIRE

    Köhle, Ülkü; Kükner, Şahap

    2003-01-01

    Conjunctivitis is an infection of the conjunctiva, generally characterized by irritation, itching, foreign body sensation, tearing and discharge. Bacterial conjunctivitis may be distinguished from other types of conjunctivitis by the presence of yellow–white mucopurulent discharge. It is the most common form of ocular infection all around the world. Staphylococcus species are the most common bacterial pathogenes, followed by Streptococcus pneumoniae and Haemophilus i...

  10. Community analysis of chronic wound bacteria using 16S rRNA gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota.

    Directory of Open Access Journals (Sweden)

    Lance B Price

    Full Text Available BACKGROUND: Bacterial colonization is hypothesized to play a pathogenic role in the non-healing state of chronic wounds. We characterized wound bacteria from a cohort of chronic wound patients using a 16S rRNA gene-based pyrosequencing approach and assessed the impact of diabetes and antibiotics on chronic wound microbiota. METHODOLOGY/PRINCIPAL FINDINGS: We prospectively enrolled 24 patients at a referral wound center in Baltimore, MD; sampled patients' wounds by curette; cultured samples under aerobic and anaerobic conditions; and pyrosequenced the 16S rRNA V3 hypervariable region. The 16S rRNA gene-based analyses revealed an average of 10 different bacterial families in wounds--approximately 4 times more than estimated by culture-based analyses. Fastidious anaerobic bacteria belonging to the Clostridiales family XI were among the most prevalent bacteria identified exclusively by 16S rRNA gene-based analyses. Community-scale analyses showed that wound microbiota from antibiotic treated patients were significantly different from untreated patients (p = 0.007 and were characterized by increased Pseudomonadaceae abundance. These analyses also revealed that antibiotic use was associated with decreased Streptococcaceae among diabetics and that Streptococcaceae was more abundant among diabetics as compared to non-diabetics. CONCLUSIONS/SIGNIFICANCE: The 16S rRNA gene-based analyses revealed complex bacterial communities including anaerobic bacteria that may play causative roles in the non-healing state of some chronic wounds. Our data suggest that antimicrobial therapy alters community structure--reducing some bacteria while selecting for others.

  11. Polarized 3He ion source for the Van de Graaff based on the 23S1 state of helium

    International Nuclear Information System (INIS)

    We have reached an important stage in the construction of a source of polarized 3He ions since the end of June, 1981, when a grant was received for its construction. The production of an intense beam of metastables in the 23S1 state has been achieved, as well as Stern-Gerlach separation. We have set up a method of recirculating gas in the metastable production step, which permits the operation of the polarized ion source in the same way as an ordinary ion source. The design of the adiabatic transition according to the method of Abragam and Winter was prepared. We are now studying ionization methods. The fact that the ionization potential is very low allows us to envisage nontraditional methods for this type of ion source. These methods permit high ionization efficiency. The objective set out at the beginning, a source of polarized 3He ions producing 100 nA-Particle with a polarization of 80 percent will be surpassed easily by our source

  12. Development and evaluation of immunochromatography to detect Gram-negative bacteria producing ArmA 16S rRNA methylase responsible for aminoglycoside resistance.

    Science.gov (United States)

    Oshiro, Satoshi; Tada, Tatsuya; Kameoka, Yousuke; Suzuki, Kazuo; Ohmagari, Norio; Miyoshi-Akiyama, Tohru; Kirikae, Teruo

    2015-11-01

    Rapid and reliable detection of aminoglycoside-resistant bacteria is an important infection-control measure and a crucial aspect of antimicrobial chemotherapy. The enzyme 16S rRNA methylase has been shown to mediate aminoglycoside resistance in bacteria. This study describes a newly developed immunochromatographic assay using novel monoclonal antibodies (mAbs) that recognize ArmA 16S rRNA methylase. Epitope mapping showed that these mAbs recognized amino acids 1-93 of ArmA, which consists of 257 amino acids. Evaluation of the assay using ArmA producing and non-producing bacterial species, as well as bacteria producing other types of 16S rRNA methylases, indicated that immunochromatographic detection of the ArmA-type 16S rRNA methylase was fully consistent with PCR analysis for armA genes, with all immunochromatographically positive strains being resistant to aminoglycosides (MIC≥128μg/mL). The detection limit of the assay was 12ng ArmA. These findings indicate that this assay can be used for the rapid and reliable detection of the production of ArmA 16S rRNA methylase by Gram-negative bacteria, including Acinetobacter baumannii and Escherichia coli. PMID:26381663

  13. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    KAUST Repository

    Alikunhi, Nabeel M.

    2016-05-27

    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  14. Bacterial carbonatogenesis

    International Nuclear Information System (INIS)

    Several series of experiments in the laboratory as well as in natural conditions teach that the production of carbonate particles by heterotrophic bacteria follows different ways. The 'passive' carbonatogenesis is generated by modifications of the medium that lead to the accumulation of carbonate and bicarbonate ions and to the precipitation of solid particles. The 'active' carbonatogenesis is independent of the metabolic pathways. The carbonate particles are produced by ionic exchanges through the cell membrane following still poorly known mechanisms. Carbonatogenesis appears to be the response of heterotrophic bacterial communities to an enrichment of the milieu in organic matter. The active carbonatogenesis seems to start first. It is followed by the passive one which induces the growth of initially produced particles. The yield of heterotrophic bacterial carbonatogenesis and the amounts of solid carbonates production by bacteria are potentially very high as compared to autotrophic or chemical sedimentation from marine, paralic or continental waters. Furthermore, the bacterial processes are environmentally very ubiquitous; they just require organic matter enrichment. Thus, apart from purely evaporite and autotrophic ones, all Ca and/or Mg carbonates must be considered as from heterotrophic bacterial origin. By the way, the carbon of carbonates comes from primary organic matter. Such considerations ask questions about some interpretations from isotopic data on carbonates. Finally, bacterial heterotrophic carbonatogenesis appears as a fundamental phase in the relationships between atmosphere and lithosphere and in the geo-biological evolution of Earth. (author)

  15. rRNA fragmentation induced by a yeast killer toxin.

    Science.gov (United States)

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  16. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Science.gov (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  17. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    OpenAIRE

    Pasupuleti Sreenivasa Rao

    2013-01-01

    Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Seq...

  18. Bacterial Community Structure in Tree Hole Habitats of Ochlerotatus Triseriatus: Influences of Larval Feeding

    OpenAIRE

    Xu, Y.; Chen, S.; Kaufman, M. G.; Maknojia, S.; Bagdasarian, M; WALKER, E. D.

    2008-01-01

    We investigated the bacterial community composition of tree holes in relation to the presence and absence of larvae of the mosquito Ochlerotatus triseriatus. Larvae were eliminated from a subset of natural tree holes with Bacillus thuringiensis serovar israelensis, and total bacterial numbers, slow- and fast-growing colony-forming units on minimal media, and 16S rRNA gene sequence data from water column and leaf material were obtained. Total bacterial counts did not change significantly with ...

  19. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    OpenAIRE

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2014-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and...

  20. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    Directory of Open Access Journals (Sweden)

    Martins Cesar

    2010-01-01

    Full Text Available Abstract Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s occurring in 39.6% of the analyzed individuals (both male and female were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.

  1. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.

    Science.gov (United States)

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  2. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Directory of Open Access Journals (Sweden)

    Eric W. Triplett

    2010-07-01

    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.

  3. Direct and rapid detection by PCR of Erysipelothrix sp. DNAs prepared from bacterial strains and animal tissues.

    Science.gov (United States)

    Takeshi, K; Makino, S; Ikeda, T; Takada, N; Nakashiro, A; Nakanishi, K; Oguma, K; Katoh, Y; Sunagawa, H; Ohyama, T

    1999-12-01

    A PCR method for rapid screening of Erysipelothrix spp. in the slaughterhouse was carried out by using four species-specific sets of oligonucleotide primers after initial amplification with the primer set MO101-MO102, which amplifies the 16S rRNA sequences of all four Erysipelothrix species. The DNA sequences coding for the rRNA gene cluster, including 16S rRNA, 23S rRNA, and the noncoding region downstream of 5S rRNA, were determined in order to design primers for the species-specific PCR detection system. The homology among the 4.5-kb DNA sequences of the rRNA genes of Erysipelothrix rhusiopathiae serovar 2 (DNA Data Bank of Japan accession no. AB019247), E. tonsillarum serovar 7 (accession no. AB019248), E. rhusiopathiae serovar 13 (accession no. AB019249), and E. rhusiopathiae serovar 18 (accession no. AB019250) ranged from 96.0 to 98.4%. The PCR amplifications were specific and were able to distinguish the DNAs from each of the four Erysipelothrix species. The results of PCR tests performed directly with tissue specimens from diseased animals were compared with the results of cultivation tests, and the PCR tests were completed within 5 h. The test with this species-specific system based on PCR amplification with the DNA sequences coding for the rRNA gene cluster was an accurate, easy-to-read screening method for rapid diagnosis of Erysipelothrix sp. infection in the slaughterhouse. PMID:10565937

  4. Direct and Rapid Detection by PCR of Erysipelothrix sp. DNAs Prepared from Bacterial Strains and Animal Tissues

    Science.gov (United States)

    Takeshi, Kouichi; Makino, Souichi; Ikeda, Tetsuya; Takada, Noriko; Nakashiro, Atsushi; Nakanishi, Kazunori; Oguma, Keiji; Katoh, Yoshinobu; Sunagawa, Hiroyuki; Ohyama, Tohru

    1999-01-01

    A PCR method for rapid screening of Erysipelothrix spp. in the slaughterhouse was carried out by using four species-specific sets of oligonucleotide primers after initial amplification with the primer set MO101-MO102, which amplifies the 16S rRNA sequences of all four Erysipelothrix species. The DNA sequences coding for the rRNA gene cluster, including 16S rRNA, 23S rRNA, and the noncoding region downstream of 5S rRNA, were determined in order to design primers for the species-specific PCR detection system. The homology among the 4.5-kb DNA sequences of the rRNA genes of Erysipelothrix rhusiopathiae serovar 2 (DNA Data Bank of Japan accession no. AB019247), E. tonsillarum serovar 7 (accession no. AB019248), E. rhusiopathiae serovar 13 (accession no. AB019249), and E. rhusiopathiae serovar 18 (accession no. AB019250) ranged from 96.0 to 98.4%. The PCR amplifications were specific and were able to distinguish the DNAs from each of the four Erysipelothrix species. The results of PCR tests performed directly with tissue specimens from diseased animals were compared with the results of cultivation tests, and the PCR tests were completed within 5 h. The test with this species-specific system based on PCR amplification with the DNA sequences coding for the rRNA gene cluster was an accurate, easy-to-read screening method for rapid diagnosis of Erysipelothrix sp. infection in the slaughterhouse. PMID:10565937

  5. Bacterial Adhesion & Blocking Bacterial Adhesion

    DEFF Research Database (Denmark)

    Vejborg, Rebecca Munk

    2008-01-01

    parameters, which influence the transition from a planktonic lifestyle to a sessile lifestyle, have been studied. Protein conditioning film formation was found to influence bacterial adhesion and subsequent biofilm formation considerable, and an aqueous extract of fish muscle tissue was shown to...... tract to the microbial flocs in waste water treatment facilities. Microbial biofilms may however also cause a wide range of industrial and medical problems, and have been implicated in a wide range of persistent infectious diseases, including implantassociated microbial infections. Bacterial adhesion is...... the first committing step in biofilm formation, and has therefore been intensely scrutinized. Much however, still remains elusive. Bacterial adhesion is a highly complex process, which is influenced by a variety of factors. In this thesis, a range of physico-chemical, molecular and environmental...

  6. Bacterial lipases

    NARCIS (Netherlands)

    Jaeger, Karl-Erich; Ransac, Stéphane; Dijkstra, Bauke W.; Colson, Charles; Heuvel, Margreet van; Misset, Onno

    1994-01-01

    Many different bacterial species produce lipases which hydrolyze esters of glycerol with preferably long-chain fatty acids. They act at the interface generated by a hydrophobic lipid substrate in a hydrophilic aqueous medium. A characteristic property of lipases is called interfacial activation, mea

  7. Bacterial Ecology

    DEFF Research Database (Denmark)

    Fenchel, Tom

    2011-01-01

    Bacterial ecology is concerned with the interactions between bacteria and their biological and nonbiological environments and with the role of bacteria in biogeochemical element cycling. Many fundamental properties of bacteria are consequences of their small size. Thus, they can efficiently exploit...

  8. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    Directory of Open Access Journals (Sweden)

    Jennifer J Barb

    Full Text Available There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology.This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9 processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY. Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies and their sequencing data is subjected to a novel analytical pipeline.Results are presented at family and genus level. The Kullback-Leibler divergence (DKL, a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst average DKL while the V4 gave the lowest (best average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria.The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points

  9. Estimating bacterial diversity for ecological studies: methods, metrics, and assumptions.

    Directory of Open Access Journals (Sweden)

    Julia Birtel

    Full Text Available Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5. Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques.

  10. High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions

    DEFF Research Database (Denmark)

    Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.; Jacobsen, Carsten Suhr

    2014-01-01

    -resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that......In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High...... HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and...

  11. Terrestrial Runoff Controls the Bacterial Community Composition of Biofilms along a Water Quality Gradient in the Great Barrier Reef

    OpenAIRE

    Witt, Verena; Wild, Christian; Uthicke, Sven

    2012-01-01

    16S rRNA gene molecular analysis elucidated the spatiotemporal distribution of bacterial biofilm communities along a water quality gradient. Multivariate statistics indicated that terrestrial runoff, in particular dissolved organic carbon and chlorophyll a concentrations, induced shifts of specific bacterial communities between locations and seasons, suggesting microbial biofilms could be suitable bioindicators for water quality.

  12. [Bacterial vaginosis].

    Science.gov (United States)

    Romero Herrero, Daniel; Andreu Domingo, Antonia

    2016-07-01

    Bacterial vaginosis (BV) is the main cause of vaginal dysbacteriosis in the women during the reproductive age. It is an entity in which many studies have focused for years and which is still open for discussion topics. This is due to the diversity of microorganisms that cause it and therefore, its difficult treatment. Bacterial vaginosis is probably the result of vaginal colonization by complex bacterial communities, many of them non-cultivable and with interdependent metabolism where anaerobic populations most likely play an important role in its pathogenesis. The main symptoms are an increase of vaginal discharge and the unpleasant smell of it. It can lead to serious consequences for women, such as an increased risk of contracting sexually transmitted infections including human immunodeficiency virus and upper genital tract and pregnancy complications. Gram stain is the gold standard for microbiological diagnosis of BV, but can also be diagnosed using the Amsel clinical criteria. It should not be considered a sexually transmitted disease but it is highly related to sex. Recurrence is the main problem of medical treatment. Apart from BV, there are other dysbacteriosis less characterized like aerobic vaginitis of which further studies are coming slowly but are achieving more attention and consensus among specialists. PMID:27474242

  13. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    DEFF Research Database (Denmark)

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    ribonuclease from Naja naja oxiana, and the relatively unstructured and accessible sequences were detected with the single-strand-specific ribonucleases A, T1 and T2. The data enabled the three secondary structural models, proposed for the E. coli 23 S RNAs, to be examined critically and it was concluded that......An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large...... ribosomes of flowering plants. The structure of domain VI within the eubacterial RNAs was probed with chemical reagents in order to establish the degree of stacking and/or accessibility of each adenosine, cytidine and guanosine residue; the double-helical segments were localized with the cobra venom...

  14. Identification of Clinically Relevant Nonhemolytic Streptococci on the Basis of Sequence Analysis of 16S-23S Intergenic Spacer Region and Partial gdh Gene▿

    OpenAIRE

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas; Kemp, Michael; Christensen, Jens Jørgen

    2009-01-01

    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient for the identification of all species in this group of bacteria. The aim of the present study was to establish a method based on sequence analysis of the 16S-23S intergenic spacer (ITS) region and the part...

  15. In silico analysis of the 16S rRNA gene of endophytic bacteria, isolated from the aerial parts and seeds of important agricultural crops.

    Science.gov (United States)

    Bredow, C; Azevedo, J L; Pamphile, J A; Mangolin, C A; Rhoden, S A

    2015-01-01

    Because of human population growth, increased food production and alternatives to conventional methods of biocontrol and development of plants such as the use of endophytic bacteria and fungi are required. One of the methods used to study microorganism diversity is sequencing of the 16S rRNA gene, which has several advantages, including universality, size, and availability of databases for comparison. The objective of this study was to analyze endophytic bacterial diversity in agricultural crops using published papers, sequence databases, and phylogenetic analysis. Fourteen papers were selected in which the ribosomal 16S rRNA gene was used to identify endophytic bacteria, in important agricultural crops, such as coffee, sugar cane, beans, corn, soybean, tomatoes, and grapes, located in different geographical regions (America, Europe, and Asia). The corresponding 16S rRNA gene sequences were selected from the NCBI database, aligned using the Mega 5.2 program, and phylogenetic analysis was undertaken. The most common orders present in the analyzed cultures were Bacillales, Enterobacteriales, and Actinomycetales and the most frequently observed genera were Bacillus, Pseudomonas, and Microbacterium. Phylogenetic analysis showed that only approximately 1.56% of the total sequences were not properly grouped, demonstrating reliability in the identification of microorganisms. This study identified the main genera found in endophytic bacterial cultures from plants, providing data for future studies on improving plant agriculture, biotechnology, endophytic bacterium prospecting, and to help understand relationships between endophytic bacteria and their interactions with plants. PMID:26345903

  16. Jellyfish modulate bacterial dynamic and community structure.

    Directory of Open Access Journals (Sweden)

    Tinkara Tinta

    Full Text Available Jellyfish blooms have increased in coastal areas around the world and the outbreaks have become longer and more frequent over the past few decades. The Mediterranean Sea is among the heavily affected regions and the common bloom-forming taxa are scyphozoans Aurelia aurita s.l., Pelagia noctiluca, and Rhizostoma pulmo. Jellyfish have few natural predators, therefore their carcasses at the termination of a bloom represent an organic-rich substrate that supports rapid bacterial growth, and may have a large impact on the surrounding environment. The focus of this study was to explore whether jellyfish substrate have an impact on bacterial community phylotype selection. We conducted in situ jellyfish-enrichment experiment with three different jellyfish species. Bacterial dynamic together with nutrients were monitored to assess decaying jellyfish-bacteria dynamics. Our results show that jellyfish biomass is characterized by protein rich organic matter, which is highly bioavailable to 'jellyfish-associated' and 'free-living' bacteria, and triggers rapid shifts in bacterial population dynamics and composition. Based on 16S rRNA clone libraries and denaturing gradient gel electrophoresis (DGGE analysis, we observed a rapid shift in community composition from unculturable Alphaproteobacteria to culturable species of Gammaproteobacteria and Flavobacteria. The results of sequence analyses of bacterial isolates and of total bacterial community determined by culture independent genetic analysis showed the dominance of the Pseudoalteromonadaceae and the Vibrionaceae families. Elevated levels of dissolved proteins, dissolved organic and inorganic nutrient release, bacterial abundance and carbon production as well as ammonium concentrations characterized the degradation process. The biochemical composition of jellyfish species may influence changes in the amount of accumulated dissolved organic and inorganic nutrients. Our results can contribute insights into

  17. Pulmonary Bacterial Communities in Surgically Resected Noncystic Fibrosis Bronchiectasis Lungs Are Similar to Those in Cystic Fibrosis

    OpenAIRE

    Heather Maughan; Cunningham, Kristopher S.; Pauline W Wang; Yu Zhang; Marcelo Cypel; Cecilia Chaparro; D Elizabeth Tullis; Waddell, Thomas K; Shaf Keshavjee; Mingyao Liu; David S Guttman; David M Hwang

    2012-01-01

    Background. Recurrent bacterial infections play a key role in the pathogenesis of bronchiectasis, but conventional microbiologic methods may fail to identify pathogens in many cases. We characterized and compared the pulmonary bacterial communities of cystic fibrosis (CF) and non-CF bronchiectasis patients using a culture-independent molecular approach. Methods. Bacterial 16S rRNA gene libraries were constructed from lung tissue of 10 non-CF bronchiectasis and 21 CF patients, followed by DNA ...

  18. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification.

    Science.gov (United States)

    Sharma, Sunny; Lafontaine, Denis L J

    2015-10-01

    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  19. Endophytic bacterial and fungal microbiota in sprouts, roots and stems of rice (Oryza sativa L.).

    Science.gov (United States)

    Wang, Wenfeng; Zhai, Yanyan; Cao, Lixiang; Tan, Hongming; Zhang, Renduo

    2016-01-01

    The objective of this study was to elucidate the endophytic microbiota in rice sprouts, roots, and stems, and their transmission in the plant development. Prior to DNA extraction, roots and stems were treated with 36% formaldehyde and 0.1M NaOH solutions to remove epiphytic bacterial whole 16S rRNA genes. Bacterial and fungal taxa in the sprout, root, and stem samples were analyzed using Illumina-based sequencing of the V3-V4 hyper variable regions of bacterial 16S rRNA genes and the ITS2 regions of fungal rRNA genes, respectively. Results showed that more diverse bacterial OTUs were detected in roots than in stems, while more diverse fungal OTUs were detected in stems than in roots. Compared with the endophytic microbiota in sprouts, the bacterial OTUs increased in roots but decreased in stems, whereas the fungal OTUs in both stems and roots decreased. Sprout-borne bacterial genera Sphingomonas and Pseudomonus, and fungal genera Fusarium, Pestalotiopsis, and Penicillium were detected in stems and roots. The coexistence of these indigenous bacterial and fungal taxa in sprouts, roots, and stems indicated their transmission during the development from sprouts to mature plants. The results from this study should be useful to better understand the plant-microbe interactions and to select suitable microbial taxa for rice production. PMID:27296957

  20. Molecular Analysis of Bacterial Microbiota on Brazilian Currency Note Surfaces

    Directory of Open Access Journals (Sweden)

    Tairacan Augusto Pereira da Fonseca

    2015-10-01

    Full Text Available Currency notes have been implicated as a vehicle for transmitting community-acquired bacterial infections. However, the overall diversity of the bacterial population residing on banknotes is still unknown in Brazil. In this study, we aimed to investigate the overall bacterial population from 150 different Brazilian Rial (R$ notes in circulation using a culture-independent Illumina massively parallel sequencing approach of the 16S rRNA genes. Samples were randomly collected from three different street markets or “feiras” in the metropolitan region of São Paulo. Taxonomical composition revealed the abundance of Proteobacteria phyla, followed by Firmicutes and Streptophyta, with a total of 1193 bacterial families and 3310 bacterial genera. Most of these bacterial genera are of human, animal, and environmental origins. Also, our analysis revealed the presence of some potential pathogenic bacterial genera including Salmonella, Staphylococcus, and Klebsiella. The results demonstrate that there is a tremendous diversity of bacterial contamination on currency notes, including organisms known to be opportunistic pathogens. One of the factors that may contribute to the richness of bacterial diversity in currency notes is personal hygiene. Thus, our results underscore the need to increase public awareness of the importance of personal hygiene of money handlers who also handle food.

  1. Bacterial hydrodynamics

    CERN Document Server

    Lauga, Eric

    2015-01-01

    Bacteria predate plants and animals by billions of years. Today, they are the world's smallest cells yet they represent the bulk of the world's biomass, and the main reservoir of nutrients for higher organisms. Most bacteria can move on their own, and the majority of motile bacteria are able to swim in viscous fluids using slender helical appendages called flagella. Low-Reynolds-number hydrodynamics is at the heart of the ability of flagella to generate propulsion at the micron scale. In fact, fluid dynamic forces impact many aspects of bacteriology, ranging from the ability of cells to reorient and search their surroundings to their interactions within mechanically and chemically-complex environments. Using hydrodynamics as an organizing framework, we review the biomechanics of bacterial motility and look ahead to future challenges.

  2. Bacterial and archaeal communities in Lake Nyos (Cameroon, Central Africa)

    OpenAIRE

    Tiodjio, Rosine E.; Sakatoku, Akihiro; Nakamura, Akihiro; Tanaka, Daisuke; Fantong, Wilson Y.; Tchakam, Kamtchueng B.; Tanyileke, Gregory; Ohba, Takeshi; Hell, Victor J.; Kusakabe, Minoru; Nakamura, Shogo; Ueda, Akira

    2014-01-01

    The aim of this study was to assess the microbial diversity associated with Lake Nyos, a lake with an unusual chemistry in Cameroon. Water samples were collected during the dry season on March 2013. Bacterial and archaeal communities were profiled using Polymerase Chain Reaction-Denaturing Gradient Gel Electrophoresis (PCR-DGGE) approach of the 16S rRNA gene. The results indicate a stratification of both communities along the water column. Altogether, the physico-chemical data and microbial s...

  3. Defining pathogenic bacterial species in the genomic era

    OpenAIRE

    DidierRaoult

    2011-01-01

    Actual definitions of bacterial species are limited due to the current criteria of definition and the use of restrictive genetic tools. The 16S rRNA sequence, for example, has been widely used as a marker for phylogenetic analyses; however, its use often leads to misleading species definitions. According to the first genetic studies, removing a certain number of genes from pathogenic bacteria removes their capacity to infect hosts. However, more recent studies have demonstrated that the speci...

  4. Bacterial Community Mapping of the Mouse Gastrointestinal Tract

    OpenAIRE

    Gu, Shenghua; Chen, Dandan; Zhang, Jin-Na; Lv, Xiaoman; WANG Kun; Duan, Li-Ping; Nie, Yong; Wu, Xiao-Lei

    2013-01-01

    Keeping mammalian gastrointestinal (GI) tract communities in balance is crucial for host health maintenance. However, our understanding of microbial communities in the GI tract is still very limited. In this study, samples taken from the GI tracts of C57BL/6 mice were subjected to 16S rRNA gene sequence-based analysis to examine the characteristic bacterial communities along the mouse GI tract, including those present in the stomach, duodenum, jejunum, ileum, cecum, colon and feces. Further a...

  5. Bacterial Flora of Osteoradionecrosis Detected by Molecular techniques

    OpenAIRE

    2006-01-01

    The following is a report of a study undertaken to identify the bacterial species in bone samples from patients suffering from osteoradionecrosis. This was done using polymerase chain reaction (PCR), cloning and sequencing techniques, where 16S rRNA was the gene used for analysis. The results from two patient samples will be presented. As far as we know, this is the first study that includes molecular genetic techniques to detect bacteria associated with osteoradionecrosis.

  6. Successional Trajectories of Rhizosphere Bacterial Communities over Consecutive Seasons

    OpenAIRE

    Shi, Shengjing; Nuccio, Erin; Herman, Donald J.; Rijkers, Ruud; Estera, Katerina; Li, Jiabao; da Rocha, Ulisses Nunes; He, Zhili; Pett-Ridge, Jennifer; Eoin L. Brodie; Zhou, Jizhong; Firestone, Mary

    2015-01-01

    ABSTRACT It is well known that rhizosphere microbiomes differ from those of surrounding soil, and yet we know little about how these root-associated microbial communities change through the growing season and between seasons. We analyzed the response of soil bacteria to roots of the common annual grass Avena fatua over two growing seasons using high-throughput sequencing of 16S rRNA genes. Over the two periods of growth, the rhizosphere bacterial communities followed consistent successional p...

  7. Isolation of bacterial endophytes from germinated maize kernels.

    Science.gov (United States)

    Rijavec, Tomaz; Lapanje, Ales; Dermastia, Marina; Rupnik, Maja

    2007-06-01

    The germination of surface-sterilized maize kernels under aseptic conditions proved to be a suitable method for isolation of kernel-associated bacterial endophytes. Bacterial strains identified by partial 16S rRNA gene sequencing as Pantoea sp., Microbacterium sp., Frigoribacterium sp., Bacillus sp., Paenibacillus sp., and Sphingomonas sp. were isolated from kernels of 4 different maize cultivars. Genus Pantoea was associated with a specific maize cultivar. The kernels of this cultivar were often overgrown with the fungus Lecanicillium aphanocladii; however, those exhibiting Pantoea growth were never colonized with it. Furthermore, the isolated bacterium strain inhibited fungal growth in vitro. PMID:17668041

  8. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    OpenAIRE

    Seung Hak Yang; Joung Soo Lim; Modabber Ahmed Khan; Bong Soo Kim; Dong Yoon Choi; Eun Young Lee; Hee Kwon Ahn

    2015-01-01

    The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gen...

  9. Bacterial communities in fish sauce mash using culture-dependent and -independent methods

    OpenAIRE

    Fukui, Youhei; Yoshida, Mitsuhiro; Shozen, Kei-ichi; Funatsu, Yasuhiro; Takano, Takashi; OIKAWA, Hiroshi; Yano, Yutaka; Satomi, Masataka

    2012-01-01

    In fish sauce production, microorganisms are associated with the fermentation process; however, the sequential changes in the bacterial communities have never been examined throughout the period of fermentation. In this study, we determined the bacterial floras in a fish sauce mash over 8 months, using three different culture media and 16S rRNA gene clone library analysis. During the first 4 weeks, viable counts of non-halophilic and halophilic bacteria decreased and were dominated by Staphyl...

  10. Culturomics identified 11 new bacterial species from a single anorexia nervosa stool sample

    OpenAIRE

    Pfleiderer, A.; Lagier, J. C.; Armougom, Fabrice; Robert, C.; Vialettes, B; Raoult, Didier

    2013-01-01

    The rebirth of bacterial culture has been highlighted successively by environmental microbiologists, the design of axenic culture for intracellular bacteria in clinical microbiology, and, more recently, by human gut microbiota studies. Indeed, microbial culturomics (large scale of culture conditions with the identification of colonies by MALDI-TOF or 16S rRNA) allowed to culture 32 new bacterial species from only four stool samples studied. We performed culturomics in comparison with pyrosequ...

  11. Bacterial Communities in Rhizosphere of Maize Studied by T-RFLP

    OpenAIRE

    Ondreičková Katarína; Ficek Andrej; Mihálik Daniel; Gubišová Marcela; Hudcovicová Martina; Drahovská Hana; Kraic Ján

    2014-01-01

    The terminal restriction fragment length polymorphism munities from different collecting places was evaluated was used to determine the bacterial diversity in rhizo- by principal component analysis. Results showed that sphere of maize (Zea mays L.) collected from four sites the most different bacterial community originated from of experimental field plot in two dates of the vegetation marginal part of the experimental field plot collected in season (July and September). The 16S rRNA gene was ...

  12. Gut bacterial community structure of two Australian tropical fruit fly species (Diptera: Tephritidae)

    OpenAIRE

    Narit Thaochan; Richard A.I. Drew; Anuchit Chinajariyawong; Anurag Sunpapao; Chaninun Pornsuriya

    2015-01-01

    The community structure of the alimentary tract bacteria of two Australian fruit fly species, Bactrocera cacuminata (Hering) and Bactrocera tryoni (Froggatt), was studied using a molecular cloning method based on the 16S rRNA gene. Differences in the bacterial community structure were shown between the crops and midguts of the two species and sexes of each species. Proteobacteria was the dominant bacterial phylum in the flies, especially bacteria in the order Gammaproteobacteria w...

  13. Molecular Phylogenetic Diversity and Spatial Distribution of Bacterial Communities in Cooling Stage during Swine Manure Composting

    OpenAIRE

    Guo, Yan; Zhang, Jinliang; Yan, Yongfeng; Wu, Jian; Zhu, Nengwu; Deng, Changyan

    2015-01-01

    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and subsequent sub-cloning and sequencing were used in this study to analyze the molecular phylogenetic diversity and spatial distribution of bacterial communities in different spatial locations during the cooling stage of composted swine manure. Total microbial DNA was extracted, and bacterial near full-length 16S rRNA genes were subsequently amplified, cloned, RFLP-screened, and sequenced. A total of 420 positive ...

  14. Detection of bacterial DNA in painful degenerated spinal discs in patients without signs of clinical infection

    OpenAIRE

    Fritzell, Peter; Bergström, Tomas; Welinder-Olsson, Christina

    2004-01-01

    A local inflammatory and potentially painful response, of which the ultimate cause is unknown, has been described in nervous tissues in contact with degenerated disc material in patients with low back and leg pain. With the rationale that a possible cause of such inflammation could be bacterial infection, we utilized PCR (polymerase chain reaction) amplification of the 16S rRNA (ribosomal RNA) gene followed by gene sequencing, to investigate whether bacterial DNA might be detected in the dege...

  15. Determination of the differential cross section for electron excitation of the 23S1 state of helium near threshold via metastable time-of-flight spectra

    International Nuclear Information System (INIS)

    The differential cross section for the inelastic process He(11S0) + e- → He(23S1) + e- just above threshold. For a given detector angle and metastable atom speed there corresponds only one value of cos theta, where theta is the electron scattering angle. Since the excitation cross section for unpolarized beams is symmetric in theta, there is a one-to-one relation between atom times of flight and electron scattering angles. Since the kinematics of the problem are understood, the differential cross section can be extracted from the time-of-flight spectrum by using a computer analysis that incorporates factors such as the finite angular resolutions, the finite energy resolution of the electron gun, and the Maxwellian distribution of velocities in the ground state atomic beam. The angular range and resolution available in both conventional electron scattering experiments and in the present time-of-flight experiment show that there is considerable anisotropy in the electron distribution at energies just a few millivolts above the 19.82 eV, 23S1 threshold. Recent theoretical calculations predict that interference should be apparent, in agreement with what we observe. The total cross section for production of the 23S1 state by electron impact shows a peak near 20.4 eV that has been previously interpreted as a p-wave resonance. It is found that the cross section is most ''p-like'' at about 20.2 eV, but evidence for still more partial waves seems to appear even at this relatively low energy

  16. Attachment sites of primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli

    DEFF Research Database (Denmark)

    Egebjerg, Jan; Christiansen, Jan; Garrett, Roger Antony

    1991-01-01

    The attachment sites of the primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli were examined by a chemical and ribonuclease footprinting method using several probes with different specificities. The results show that the sites are confined to localized RNA regions...... within the large ribonuclease-protected ribonucleoprotein fragments that were characterized earlier. They are as follows: 1. (1) L1 recognizes a tertiary structural motif in domain V centred on two interacting internal loops; the main protein interaction sites occur at the internal loop/helix junctions.2...

  17. Applicability of the 16S-23S rDNA internal spacer for PCR detection of the phytostimulatory PGPR inoculant Azospirillum lipoferum CRT1 in field soil

    OpenAIRE

    Baudoin, Ezékiel; Couillerot, O.; Spaepen, S.; Moenne-Loccoz, Y.; Nazaret, S.

    2010-01-01

    Aims: To assess the applicability of the 16S-23S rDNA internal spacer regions (ISR) as targets for PCR detection of Azospirillum ssp. and the phytostimulatory plant growth-promoting rhizobacteria seed inoculant Azospirillum lipoferum CRT1 in soil. Methods and Results: Primer sets were designed after sequence analysis of the ISR of A. lipoferum CRT1 and Azospirillum brasilense Sp245. The primers fAZO/rAZO targeting the Azospirillum genus successfully yielded PCR amplicons (400-550 bp) from Azo...

  18. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

    Directory of Open Access Journals (Sweden)

    Mahyarudin

    2015-07-01

    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  19. Novel bacterial sulfur oxygenase reductases from bioreactors treating gold-bearing concentrates

    DEFF Research Database (Denmark)

    Chen, Z-W; Liu, Y-Y; Wu, J-F;

    2007-01-01

    The microbial community and sulfur oxygenase reductases of metagenomic DNA from bioreactors treating gold-bearing concentrates were studied by 16S rRNA library, real-time polymerase chain reaction (RT-PCR), conventional cultivation, and molecular cloning. Results indicated that major bacterial sp...... SOR gene in bioleaching reactors and Acidithiobacillus species....

  20. High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions

    DEFF Research Database (Denmark)

    Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob;

    2014-01-01

    In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-r...

  1. Bacterial diversity and biogeography in deep-sea sediments of the South Atlantic Ocean

    DEFF Research Database (Denmark)

    Schauer, Regina; Bienhold, Christina; Ramette, Alban; Harder, Jens

    2010-01-01

    communities in three basins of the eastern South Atlantic Ocean to determine diversity and biogeography of bacterial communities in deep-sea surface sediments. The analysis of 16S ribosomal RNA (rRNA) gene clone libraries in each basin revealed a high diversity, representing 521 phylotypes with 98% identity...

  2. Bacterial community structure of a full-scale biofilter treating pig house exhaust air

    DEFF Research Database (Denmark)

    Kristiansen, Anja; Pedersen, Kristina Hadulla; Nielsen, Per Halkjær; Nielsen, Lars Peter; Nielsen, Jeppe Lund; Schramm, Andreas

    2011-01-01

    Biological air filters represent a promising tool for treating emissions of ammonia and odor from pig facilities. Quantitative fluorescence in situ hybridization (FISH) and 16S rRNA gene sequencing were used to investigate the bacterial community structure and diversity in a full-scale biofilter...

  3. Louse (Insecta : Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable

    OpenAIRE

    Page, R.D.M.; Cruickshank, R.; Johnson, K P

    2002-01-01

    Lice are ectoparasitic insects hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length variation and are very difficult to align. We show that the louse 12S rRNA domain III secondary structure displays considerable variation compared to other insects, in both the shape and number of stems and loops. Phylogenetic trees constructed from tree edit distances between louse 12S rRNA structures do not closely resemble trees constructed from sequence ...

  4. A phylogenetic comparison of the 16S rRNA sequence of the fish pathogen, Renibacterium salmoninarum, to gram-positive bacteria.

    Science.gov (United States)

    Gutenberger, S K; Giovannoni, S J; Field, K G; Fryer, J L; Rohovec, J S

    1991-01-15

    The 16S rRNA of Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonids, was sequenced by reverse transcriptase to produce a nearly complete sequence (97%) of 1475 nucleotides. Phylogenetic comparisons to seventeen genera and signature sequence analysis indicated that R. salmoninarum was a member of the high G + C Gram-positive eubacterial subdivision although the reported G + C value is only 53%. A phylogenetic tree details the relationship of R. salmoninarum to ten actinomycetes from diverse environments. PMID:1709893

  5. Measurement of metastable He*(23S1) density in dielectric barrier discharges with two different configurations operating at around atmospheric pressure

    International Nuclear Information System (INIS)

    We have measured the density of metastable He atoms in the lowest triplet state (23S1) with a diode-laser absorption spectroscopic technique in atmospheric pressure plasmas produced by dielectric barrier discharge schemes. Two different types of electrode configuration are employed: one is a conventional parallel-plate system and the other is a microdischarge integrated system with stacked metal-mesh electrodes covered by insulating films. We have analyzed the pressure-broadened spectral line corresponding to the 23S1→23PJ (J=0-2) transition to derive the broadening coefficient and to calibrate absolute densities. The measured density ranges from 1011 to 1012 cm-3, but the values in the mesh-type system are larger than those in the parallel-plate system by about one order of magnitude. The density, however, depends strongly on the gas flow rate, showing the influence of quenching by the Penning-ionization process with impurities. Those behaviors are consistent with the variation of the electron density estimated by millimeter-wave transmittance measurement

  6. Combining flow cytometry and 16S rRNA gene pyrosequencing: A promising approach for drinking water monitoring and characterization

    KAUST Repository

    Prest, Emmanuelle I E C

    2014-10-01

    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5min intervals for 1h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345±15×103 to 425±35×103cellsmL-1) and in the percentage of intact bacterial cells (from 39±3.5% to 53±4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. © 2014 Elsevier Ltd.

  7. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    OpenAIRE

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restrict...

  8. 30S Subunit-Dependent Activation of the Sorangium cellulosum So ce56 Aminoglycoside Resistance-Conferring 16S rRNA Methyltransferase Kmr

    Science.gov (United States)

    Savic, Miloje; Sunita, S.; Zelinskaya, Natalia; Desai, Pooja M.; Macmaster, Rachel; Vinal, Kellie

    2015-01-01

    Methylation of bacterial 16S rRNA within the ribosomal decoding center confers exceptionally high resistance to aminoglycoside antibiotics. This resistance mechanism is exploited by aminoglycoside producers for self-protection while functionally equivalent methyltransferases have been acquired by human and animal pathogenic bacteria. Here, we report structural and functional analyses of the Sorangium cellulosum So ce56 aminoglycoside resistance-conferring methyltransferase Kmr. Our results demonstrate that Kmr is a 16S rRNA methyltransferase acting at residue A1408 to confer a canonical aminoglycoside resistance spectrum in Escherichia coli. Kmr possesses a class I methyltransferase core fold but with dramatic differences in the regions which augment this structure to confer substrate specificity in functionally related enzymes. Most strikingly, the region linking core β-strands 6 and 7, which forms part of the S-adenosyl-l-methionine (SAM) binding pocket and contributes to base flipping by the m1A1408 methyltransferase NpmA, is disordered in Kmr, correlating with an exceptionally weak affinity for SAM. Kmr is unexpectedly insensitive to substitutions of residues critical for activity of other 16S rRNA (A1408) methyltransferases and also to the effects of by-product inhibition by S-adenosylhomocysteine (SAH). Collectively, our results indicate that adoption of a catalytically competent Kmr conformation and binding of the obligatory cosubstrate SAM must be induced by interaction with the 30S subunit substrate. PMID:25733511

  9. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria.

    Directory of Open Access Journals (Sweden)

    Sujatha Srinivasan

    Full Text Available BACKGROUND: Bacterial vaginosis (BV is a common condition that is associated with numerous adverse health outcomes and is characterized by poorly understood changes in the vaginal microbiota. We sought to describe the composition and diversity of the vaginal bacterial biota in women with BV using deep sequencing of the 16S rRNA gene coupled with species-level taxonomic identification. We investigated the associations between the presence of individual bacterial species and clinical diagnostic characteristics of BV. METHODOLOGY/PRINCIPAL FINDINGS: Broad-range 16S rRNA gene PCR and pyrosequencing were performed on vaginal swabs from 220 women with and without BV. BV was assessed by Amsel's clinical criteria and confirmed by Gram stain. Taxonomic classification was performed using phylogenetic placement tools that assigned 99% of query sequence reads to the species level. Women with BV had heterogeneous vaginal bacterial communities that were usually not dominated by a single taxon. In the absence of BV, vaginal bacterial communities were dominated by either Lactobacillus crispatus or Lactobacillus iners. Leptotrichia amnionii and Eggerthella sp. were the only two BV-associated bacteria (BVABs significantly associated with each of the four Amsel's criteria. Co-occurrence analysis revealed the presence of several sub-groups of BVABs suggesting metabolic co-dependencies. Greater abundance of several BVABs was observed in Black women without BV. CONCLUSIONS/SIGNIFICANCE: The human vaginal bacterial biota is heterogeneous and marked by greater species richness and diversity in women with BV; no species is universally present. Different bacterial species have different associations with the four clinical criteria, which may account for discrepancies often observed between Amsel and Nugent (Gram stain diagnostic criteria. Several BVABs exhibited race-dependent prevalence when analyzed in separate groups by BV status which may contribute to increased

  10. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    OpenAIRE

    Honoré, N; Marchal, G.; Cole, S T

    1995-01-01

    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  11. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    International Nuclear Information System (INIS)

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  12. Initial insights into bacterial succession during human decomposition.

    Science.gov (United States)

    Hyde, Embriette R; Haarmann, Daniel P; Petrosino, Joseph F; Lynne, Aaron M; Bucheli, Sibyl R

    2015-05-01

    Decomposition is a dynamic ecological process dependent upon many factors such as environment, climate, and bacterial, insect, and vertebrate activity in addition to intrinsic properties inherent to individual cadavers. Although largely attributed to microbial metabolism, very little is known about the bacterial basis of human decomposition. To assess the change in bacterial community structure through time, bacterial samples were collected from several sites across two cadavers placed outdoors to decompose and analyzed through 454 pyrosequencing and analysis of variable regions 3-5 of the bacterial 16S ribosomal RNA (16S rRNA) gene. Each cadaver was characterized by a change in bacterial community structure for all sites sampled as time, and decomposition, progressed. Bacteria community structure is variable at placement and before purge for all body sites. At bloat and purge and until tissues began to dehydrate or were removed, bacteria associated with flies, such as Ignatzschineria and Wohlfahrtimonas, were common. After dehydration and skeletonization, bacteria associated with soil, such as Acinetobacter, were common at most body sites sampled. However, more cadavers sampled through multiple seasons are necessary to assess major trends in bacterial succession. PMID:25431049

  13. Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

    Energy Technology Data Exchange (ETDEWEB)

    Jansson, Janet; Edlund, Anna; Hardeman, Fredrik; Jansson, Janet K.; Sjoling, Sara

    2008-05-15

    Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities were most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.

  14. Seasonal changes in nitrogen-cycle gene abundances and in bacterial communities in acidic forest soils.

    Science.gov (United States)

    Jung, Jaejoon; Yeom, Jinki; Han, Jiwon; Kim, Jisun; Park, Woojun

    2012-06-01

    The abundance of genes related to the nitrogen biogeochemical cycle and the microbial community in forest soils (bacteria, archaea, fungi) were quantitatively analyzed via real-time PCR using 11 sets of specific primers amplifying nifH, bacterial amoA, archaeal amoA, narG, nirS, nirK, norB, nosZ, bacterial 16S rRNA gene, archaeal 16S rRNA gene, and the ITS sequence of fungi. Soils were sampled from Bukhan Mountain from September of 2010 to July of 2011 (7 times). Bacteria were the predominant microbial community in all samples. However, the abundance of archaeal amoA was greater than bacterial amoA throughout the year. The abundances of nifH, nirS, nirK, and norB genes changed in a similar pattern, while narG and nosZ appeared in sensitive to the environmental changes. Clone libraries of bacterial 16S rRNA genes were constructed from summer and winter soil samples and these revealed that Acidobacteria was the most predominant phylum in acidic forest soil environments in both samples. Although a specific correlation of environmental factor and gene abundance was not verified by principle component analysis, our data suggested that the combination of biological, physical, and chemical characteristics of forest soils created distinct conditions favoring the nitrogen biogeochemical cycle and that bacterial communities in undisturbed acidic forest soils were quite stable during seasonal change. PMID:22752898

  15. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    Science.gov (United States)

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  16. Parity nonconservation effect with laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions

    CERN Document Server

    Shabaev, V M; Kozhuharov, C; Plunien, G; Stöhlker, Th

    2010-01-01

    The parity nonconservation (PNC) effect on the laser-induced 2^3S_1 - 2^1S_0 transition in heavy heliumlike ions is considered. A simple analytical formula for the PNC correction to the cross section is derived for the case, when the opposite-parity 2^1S_0 and 2^3P_0 states are almost degenerate and, therefore, the PNC effect is strongly enhanced. Numerical results are presented for heliumlike gadolinium and thorium, which seem most promising candidates for such kind of experiments. In both Gd and Th cases the photon energy required will be anticipated with a high-energy laser built at GSI. Alternatively, it can be gained with ultraviolet lasers utilizing relativistic Doppler tuning at FAIR facilities in Darmstadt.

  17. Assessment of a 16S rRNA amplicon Illumina sequencing procedure for studying the microbiome of a symbiont-rich aphid genus.

    Science.gov (United States)

    Jousselin, E; Clamens, A-L; Galan, M; Bernard, M; Maman, S; Gschloessl, B; Duport, G; Meseguer, A S; Calevro, F; Coeur d'acier, A

    2016-05-01

    The bacterial communities inhabiting arthropods are generally dominated by a few endosymbionts that play an important role in the ecology of their hosts. Rather than comparing bacterial species richness across samples, ecological studies on arthropod endosymbionts often seek to identify the main bacterial strains associated with each specimen studied. The filtering out of contaminants from the results and the accurate taxonomic assignment of sequences are therefore crucial in arthropod microbiome studies. We aimed here to validate an Illumina 16S rRNA gene sequencing protocol and analytical pipeline for investigating endosymbiotic bacteria associated with aphids. Using replicate DNA samples from 12 species (Aphididae: Lachninae, Cinara) and several controls, we removed individual sequences not meeting a minimum threshold number of reads in each sample and carried out taxonomic assignment for the remaining sequences. With this approach, we show that (i) contaminants accounted for a negligible proportion of the bacteria identified in our samples; (ii) the taxonomic composition of our samples and the relative abundance of reads assigned to a taxon were very similar across PCR and DNA replicates for each aphid sample; in particular, bacterial DNA concentration had no impact on the results. Furthermore, by analysing the distribution of unique sequences across samples rather than aggregating them into operational taxonomic units (OTUs), we gained insight into the specificity of endosymbionts for their hosts. Our results confirm that Serratia symbiotica is often present in Cinara species, in addition to the primary symbiont, Buchnera aphidicola. Furthermore, our findings reveal new symbiotic associations with Erwinia- and Sodalis-related bacteria. We conclude with suggestions for generating and analysing 16S rRNA gene sequences for arthropod-endosymbiont studies. PMID:26458227

  18. Secondary Metabolites Control the Associated Bacterial Communities of Saprophytic Basidiomycotina Fungi.

    Science.gov (United States)

    de Carvalho, Maira Peres; Türck, Patrick; Abraham, Wolf-Rainer

    2015-01-01

    Fungi grow under humid conditions and are, therefore, prone to biofilm infections. A 16S rRNA fingerprint analysis was performed on 49 sporocarps of Basidiomycotina in order to determine whether they are able to control these biofilms. Ninety-five bacterial phylotypes, comprising 4 phyla and 10 families, were identified. While ectomycorrhizal fungi harbored the highest bacterial diversity, saprophytic fungi showed little or no association with bacteria. Seven fungal species were screened for antimicrobial and antibiofilm activities. Biofilm formation and bacterial growth was inhibited by extracts obtained from saprophytic fungi, which confirmed the hypothesis that many fungi modulate biofilm colonization on their sporocarps. PMID:25904019

  19. Metagenomic analysis of bacterial and archaeal assemblages in the soil-mousse surrounding a geothermal spring.

    Science.gov (United States)

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Joshi, Amit; Souza, Leila; Almeida, Paulo; Chauhan, Ashvini

    2015-09-01

    The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche. PMID:26484255

  20. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites

    Science.gov (United States)

    Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng

    2015-07-01

    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.

  1. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis

    Directory of Open Access Journals (Sweden)

    Steelman Samantha M

    2012-11-01

    Full Text Available Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to characterize hindgut bacterial communities in healthy horses and those with chronic laminitis. Results Fecal samples were collected from 10 normal horses and 8 horses with chronic laminitis. Genomic DNA was extracted and the V4-V5 segment of the 16S rRNA gene was PCR amplified and sequenced on the 454 platform generating a mean of 2,425 reads per sample after quality trimming. The bacterial communities were dominated by Firmicutes (69.21% control, 56.72% laminitis and Verrucomicrobia (18.13% control, 27.63% laminitis, followed by Bacteroidetes, Proteobacteria, and Spirochaetes. We observed more OTUs per individual in the laminitis group than the control group (419.6 and 355.2, respectively, P = 0.019 along with a difference in the abundance of two unassigned Clostridiales genera (P = 0.03 and P = 0.01. The most abundant bacteria were Streptococcus spp., Clostridium spp., and Treponema spp.; along with unassigned genera from Subdivision 5 of Verrucomicrobia, Ruminococcaceae, and Clostridiaceae, which together constituted ~ 80% of all OTUs. There was a high level of individual variation across all taxonomic ranks. Conclusions Our exploration of the equine fecal microflora revealed higher bacterial diversity in horses with chronic laminitis and identification of two Clostridiales genera that differed in abundance from control horses. There was large individual variation in bacterial communities that was not explained in our study. The core hindgut microflora was

  2. Bacterial Succession in the Broiler Gastrointestinal Tract.

    Science.gov (United States)

    Ranjitkar, Samir; Lawley, Blair; Tannock, Gerald; Engberg, Ricarda M

    2016-04-15

    A feeding trial was performed with broilers receiving a diet of wheat-based feed (WBF), maize-based feed (MBF), or maize-based concentrates supplemented with 15% or 30% crimped kernel maize silage (CKMS-15 or CKMS-30, respectively). The aim of the study was to investigate the bacterial community compositions of the crop, gizzard, ileum, and cecum contents in relation to the feeding strategy and age (8, 15, 22, 25, 29, or 36 days). Among the four dietary treatments, bacterial diversity was analyzed for MBF and CKMS-30 by 454 pyrosequencing of the 16S rRNA gene. Since the diets had no significant influence on bacterial diversity, data were pooled for downstream analysis. With increasing age, a clear succession of bacterial communities and increased bacterial diversity were observed.Lactobacillaceae(belonging mainly to the genusLactobacillus) represented most of theFirmicutesat all ages and in all segments of the gut except the cecum. The development of a "mature" microbiota in broilers occurred during the period from days 15 to 22. Striking increases in the relative abundances ofLactobacillus salivarius(17 to 36%) and clostridia (11 to 18%), and a concomitant decrease in the relative abundance ofLactobacillus reuteri, were found in the ileum after day 15. The concentration of deconjugated bile salts increased in association with the increased populations ofL. salivariusand clostridia. BothL. salivariusand clostridia deconjugate bile acids, and increases in the abundances of these bacteria might be associated with growth reduction and gastrointestinal (GI) disorders occurring in the critical period of broiler life between days 20 and 30. PMID:26873323

  3. Bacterial Nail Infection (Paronychia)

    Science.gov (United States)

    ... of nail infection is often caused by a bacterial infection but may also be caused by herpes, a ... to a type of yeast called Candida , or bacterial infection, and this may lead to abnormal nail growth. ...

  4. Prevention of bacterial adhesion

    DEFF Research Database (Denmark)

    Klemm, Per; Vejborg, Rebecca Munk; Hancock, Viktoria

    2010-01-01

    Management of bacterial infections is becoming increasingly difficult due to the emergence and increasing prevalence of bacterial pathogens that are resistant to available antibiotics. Conventional antibiotics generally kill bacteria by interfering with vital cellular functions, an approach that....... As such, adhesion represents the Achilles heel of crucial pathogenic functions. It follows that interference with adhesion can reduce bacterial virulence. Here, we illustrate this important topic with examples of techniques being developed that can inhibit bacterial adhesion. Some of these will...

  5. Comparative study of endophytic and endophytic diazotrophic bacterial communities across rice landraces grown in the highlands of northern Thailand

    OpenAIRE

    Rangjaroen, Chakrapong; Rerkasem, Benjavan; Teaumroong, Neung; Sungthong, Rungroch; Lumyong, Saisamorn

    2014-01-01

    Communities of bacterial endophytes within the rice landraces cultivated in the highlands of northern Thailand were studied using fingerprinting data of 16S rRNA and nifH genes profiling by polymerase chain reaction–denaturing gradient gel electrophoresis. The bacterial communities’ richness, diversity index, evenness, and stability were varied depending on the plant tissues, stages of growth, and rice cultivars. These indices for the endophytic diazotrophic bacteria within the landrace rice ...

  6. Characterization of Bacterial Community Structure in a Drinking Water Distribution System during an Occurrence of Red Water▿

    OpenAIRE

    Li, Dong; Li, Zheng; Yu, Jianwei; Cao, Nan; Liu, Ruyin; Yang, Min

    2010-01-01

    The role of bacteria in the occasional emergence of red water, which has been documented worldwide, has yet to be determined. To better understand the mechanisms that drive occurrences of red water, the bacterial community composition and the relative abundance of several functional bacterial groups in a water distribution system of Beijing during a large-scale red water event were determined using several molecular methods. Individual clone libraries of the 16S rRNA gene were constructed for...

  7. Pyrosequencing-Based Assessment of Bacterial Community Structure Along Different Management Types in German Forest and Grassland Soils

    OpenAIRE

    Nacke, Heiko; Thürmer, Andrea; Wollherr, Antje; Will, Christiane; Hodac, Ladislav; Herold, Nadine; Schöning, Ingo; Schrumpf, Marion; Daniel, Rolf

    2011-01-01

    Background: Soil bacteria are important drivers for nearly all biogeochemical cycles in terrestrial ecosystems and participate in most nutrient transformations in soil. In contrast to the importance of soil bacteria for ecosystem functioning, we understand little how different management types affect the soil bacterial community composition. Methodology/Principal Findings: We used pyrosequencing-based analysis of the V2-V3 16S rRNA gene region to identify changes in bacterial dive...

  8. Unexpected co-occurrence of six bacterial symbionts in the gills of the cold seep mussel Idas sp (Bivalvia : Mytilidae)

    OpenAIRE

    Duperron, Sebastien; Halary, S.; Lorion, J; Sibuet, Myriam; F. Gaill

    2008-01-01

    Bathymodioline mussels occur in chemosynthesis-based ecosystems such as cold seeps, hydrothermal vents and organic debris worldwide. Their key adaptation to these environments is their association with bacterial endosymbionts which ensure a chemosynthetic primary production based on the oxidation of reduced compounds such as methane and sulfide. We herein report a multiple symbiosis involving six distinct bacterial 16S rRNA phylotypes, including two belonging to groups not yet reported as sym...

  9. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Loreto Abusleme

    2014-04-01

    Full Text Available Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction procedures is important when comparing studies that use different methods. Identifying the method that best portrays communities is also desirable. Accordingly, the aim of this study was to evaluate bias introduced by different DNA extraction procedures on oral microbiome profiles. Design: Four DNA extraction methods were tested on mock communities consisting of seven representative oral bacteria. Additionally, supragingival plaque samples were collected from seven individuals and divided equally to test two commonly used DNA extraction procedures. Amplicon libraries of the 16S rRNA gene were generated and sequenced via 454-pyrosequencing. Results: Evaluation of mock communities revealed that DNA yield and bacterial species representation varied with DNA extraction methods. Despite producing the lowest yield of DNA, a method that included bead beating was the only protocol capable of detecting all seven species in the mock community. Comparison of the performance of two commonly used methods (crude lysis and a chemical/enzymatic lysis+column-based DNA isolation on plaque samples showed no effect of extraction protocols on taxa prevalence but global community structure and relative abundance of individual taxa were affected. At the phylum level, the latter method improved the recovery of Actinobacteria, Bacteroidetes, and Spirochaetes over crude lysis. Conclusion: DNA extraction distorts microbial profiles in simulated and clinical oral samples, reinforcing the

  10. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis

    OpenAIRE

    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja

    2002-01-01

    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  11. 16s-23S rDNA: polymorphisms and their use for detection and identification of Xylella fastidiosa strains 16S-23S rDNA: polimorfismos e sua aplicação na detecção e identificação de linhagens de Xylella fastidiosa

    Directory of Open Access Journals (Sweden)

    Juliana Camargo Martinati

    2007-03-01

    Full Text Available Strains of Xylella fastidiosa from several hosts (coffee, citrus, grape, almond, oleander, peach, plum, etc. were characterized by analyzing the content of the nucleotide sequences of 16S-23S rDNA (coding for a small subunit ribosomal RNA spacer region (ITS. Current methods for sequencing the ITS region yields partial sequences that do not contribute with significant information. According to this fact, new primers have been designed in order to obtain a complete sequence and facilitate the sequencing. The complete 16S-23S sequences from 08 strains were amplified through PCR using the primers designed in our lab. The 16S-23S sequences obtained were compared with 52 others sequences entries in GenBank database. The results revealed a higher level of variation than that found in 16S gene sequences, with similarity values ranging from 0.79-1.00. The dendogram based on similarity data revealed 5 main groups. This spacer sequence contains two genes for tRNA (tRNAala and tRNAile. The sequence analysis of the tRNA content showed a conserved region with a few differences in the nucleotide composition.Linhagens de Xylella fastidiosa de diferentes hospedeiros (café, uva, amêndoa, ameixa, etc. foram caracterizados analisando as sequências de nucleotídeos do espaço intergênico 16S-23S (ITS. Os métodos atuais para o sequenciamento da região ITS produzem fragmentos parciais das sequências que não contribuem com informações significantes. Em vista disso, novos primers foram desenhados a fim de obter uma sequência completa e facilitar o sequenciamento. A sequencia completa da região ITS de 08 linhagens de X. Fastidiosa foram amplificadas via PCR, sequenciadas e comparadas com outras 52 sequencias depositadas no GenBank. Os resultados revelaram um alto nível de variação sendo maior que os níveis encontrados quando se utiliza o gene 16S para este tipo de análise, com valores variando entre 0.79 a 1.00. O dendograma baseado em dados de

  12. Metamorphosis of a butterfly-associated bacterial community.

    Directory of Open Access Journals (Sweden)

    Tobin J Hammer

    Full Text Available Butterflies are charismatic insects that have long been a focus of biological research. They are also habitats for microorganisms, yet these microbial symbionts are little-studied, despite their likely importance to butterfly ecology and evolution. In particular, the diversity and composition of the microbial communities inhabiting adult butterflies remain uncharacterized, and it is unknown how the larval (caterpillar and adult microbiota compare. To address these knowledge gaps, we used Illumina sequencing of 16S rRNA genes from internal bacterial communities associated with multiple life stages of the neotropical butterfly Heliconius erato. We found that the leaf-chewing larvae and nectar- and pollen-feeding adults of H. erato contain markedly distinct bacterial communities, a pattern presumably rooted in their distinct diets. Larvae and adult butterflies host relatively small and similar numbers of bacterial phylotypes, but few are common to both stages. The larval microbiota clearly simplifies and reorganizes during metamorphosis; thus, structural changes in a butterfly's bacterial community parallel those in its own morphology. We furthermore identify specific bacterial taxa that may mediate larval and adult feeding biology in Heliconius and other butterflies. Although male and female Heliconius adults differ in reproductive physiology and degree of pollen feeding, bacterial communities associated with H. erato are not sexually dimorphic. Lastly, we show that captive and wild individuals host different microbiota, a finding that may have important implications for the relevance of experimental studies using captive butterflies.

  13. Effects of Fertilization and Sampling Time on Composition and Diversity of Entire and Active Bacterial Communities in German Grassland Soils

    Science.gov (United States)

    Herzog, Sarah; Wemheuer, Franziska; Wemheuer, Bernd; Daniel, Rolf

    2015-01-01

    Soil bacteria are major players in driving and regulating ecosystem processes. Thus, the identification of factors shaping the diversity and structure of these communities is crucial for understanding bacterial-mediated processes such as nutrient transformation and cycling. As most studies only target the entire soil bacterial community, the response of active community members to environmental changes is still poorly understood. The objective of this study was to investigate the effect of fertilizer application and sampling time on structure and diversity of potentially active (RNA-based) and the entire (DNA-based) bacterial communities in German grassland soils. Analysis of more than 2.3 million 16S rRNA transcripts and gene sequences derived from amplicon-based sequencing of 16S rRNA genes revealed that fertilizer application and sampling time significantly altered the diversity and composition of entire and active bacterial communities. Although the composition of both the entire and the active bacterial community was correlated with environmental factors such as pH or C/N ratio, the active community showed a higher sensitivity to environmental changes than the entire community. In addition, functional analyses were performed based on predictions derived from 16S rRNA data. Genes encoding the uptake of nitrate/nitrite, nitrification, and denitrification were significantly more abundant in fertilized plots compared to non-fertilized plots. Hence, this study provided novel insights into changes in dynamics and functions of soil bacterial communities as response to season and fertilizer application. PMID:26694644

  14. The rhizosphere and PAH amendment mediate impacts on functional and structural bacterial diversity in sandy peat soil

    Energy Technology Data Exchange (ETDEWEB)

    Yrjaelae, Kim, E-mail: kim.yrjala@helsinki.f [Department of Biological and Environmental Sciences, General Microbiology, University of Helsinki, P.O. Box 56, (Biocenter 1C), 00014 Helsinki (Finland); Keskinen, Anna-Kaisa; Akerman, Marja-Leena; Fortelius, Carola [METROPOLIA University of Applied Science, Vantaa (Finland); Sipilae, Timo P. [Department of Biological and Environmental Sciences, General Microbiology, University of Helsinki, P.O. Box 56, (Biocenter 1C), 00014 Helsinki (Finland)

    2010-05-15

    To reveal the degradation capacity of bacteria in PAH polluted soil and rhizosphere we combined bacterial extradiol ring-cleavage dioxygenase and 16S rRNA analysis in Betula pubescens rhizoremediation. Characterisation of the functional bacterial community by RFLP revealed novel environmental dioxygenases, and their putative hosts were studied by 16S rRNA amplification. Plant rhizosphere and PAH amendment effects were detected by the RFLP/T-RFLP analysis. Functional species richness increased in the birch rhizosphere and PAH amendment impacted the compositional diversity of the dioxygenases and the structural 16S rRNA community. A shift from an Acidobacteria and Verrucomicrobia dominated to an Alpha- and Betaproteobacteria dominated community structure was detected in polluted soil. Clone sequence analysis indicated catabolic significance of Burkholderia in PAH polluted soil. These results advance our understanding of rhizoremediation and unveil the extent of uncharacterized functional bacteria to benefit bioremediation by facilitating the development of the molecular tool box to monitor bacterial populations in biodegradation. - The bacterial community analysis using 16S rRNA and extradiol dioxygenase marker genes in rhizoremediation revealed both a rhizosphere and a PAH-pollution effect.

  15. Fecal Bacterial Composition of the Endangered Yangtze Finless Porpoises Living Under Captive and Semi-natural Conditions.

    Science.gov (United States)

    Wan, Xiaoling; Ruan, Rui; McLaughlin, Richard William; Hao, Yujiang; Zheng, Jinsong; Wang, Ding

    2016-03-01

    Intestinal microbiota is essential to the health and physiology of host animals. We undertook the first microbiological study of the fecal bacterial composition from critically endangered (CR) Yangtze finless porpoises (Neophocaena asiaeorientalis asiaeorientalis; YFPs) living under captive and semi-natural conditions using both high-throughput sequencing method and 16S rRNA gene clone library method. As determined by high-throughput sequencing of V3-V4 regions of the 16S rRNA gene, semi-natural samples harbored 30 and 36 operational taxonomic units (OTUs), which was more than the 22 and 27 OTUs detected from YFPs living in captivity. In captive YFPs Firmicutes was the predominant phylum, whereas this was Proteobacteria for YFPs living in semi-nature conditions. This suggests habitat-specific fecal bacterial composition of YFPs. Plesiomonas spp. and Aeromonas spp., which are potentially pathogenic, were identified in all the feces. Bacterial diversity from one porpoise living in captivity was also determined by constructing a 16S rRNA gene clone library and only 1 phylum was identified. High-throughput sequencing was more effective at determining the bacterial diversity compared to the 16S rRNA gene clone library. This study provides important information for the management and conservation of the CR YFPs. PMID:26620537

  16. The rhizosphere and PAH amendment mediate impacts on functional and structural bacterial diversity in sandy peat soil

    International Nuclear Information System (INIS)

    To reveal the degradation capacity of bacteria in PAH polluted soil and rhizosphere we combined bacterial extradiol ring-cleavage dioxygenase and 16S rRNA analysis in Betula pubescens rhizoremediation. Characterisation of the functional bacterial community by RFLP revealed novel environmental dioxygenases, and their putative hosts were studied by 16S rRNA amplification. Plant rhizosphere and PAH amendment effects were detected by the RFLP/T-RFLP analysis. Functional species richness increased in the birch rhizosphere and PAH amendment impacted the compositional diversity of the dioxygenases and the structural 16S rRNA community. A shift from an Acidobacteria and Verrucomicrobia dominated to an Alpha- and Betaproteobacteria dominated community structure was detected in polluted soil. Clone sequence analysis indicated catabolic significance of Burkholderia in PAH polluted soil. These results advance our understanding of rhizoremediation and unveil the extent of uncharacterized functional bacteria to benefit bioremediation by facilitating the development of the molecular tool box to monitor bacterial populations in biodegradation. - The bacterial community analysis using 16S rRNA and extradiol dioxygenase marker genes in rhizoremediation revealed both a rhizosphere and a PAH-pollution effect.

  17. Emergence of Competitive Dominant Ammonia-Oxidizing Bacterial Populations in a Full-Scale Industrial Wastewater Treatment Plant

    OpenAIRE

    Layton, Alice C.; Dionisi, Hebe; Kuo, H.-W.; Robinson, Kevin G.; Garrett, Victoria M.; Meyers, Arthur; Sayler, Gary S.

    2005-01-01

    Ammonia-oxidizing bacterial populations in an industrial wastewater treatment plant were investigated with amoA and 16S rRNA gene real-time PCR assays. Nitrosomonas nitrosa initially dominated, but over time RI-27-type ammonia oxidizers, also within the Nitrosomonas communis lineage, increased from below detection to codominance. This shift occurred even though nitrification remained constant.

  18. Simultaneous determination of gene expression and bacterial identity in single cells in defined mixtures of pure cultures

    DEFF Research Database (Denmark)

    Poulsen, Lars K.; Dalton, Helen M.; Angels, Mark; Marshall, Kevin C.; Molin, Søren; Goodman, Amanda E.

    1997-01-01

    A protocol was developed to achieve the simultaneous determination of gene expression and bacterial identity at the level of single cells: a chromogenic beta-galactosidase activity assay was combined with in situ hybridization of Fluorescently labelled oligonucleotide probes to rRNA. The method a...

  19. Characterization of the airborne bacteria community at different distances from the rotating brushes in a wastewater treatment plant by 16S rRNA gene clone libraries

    Institute of Scientific and Technical Information of China (English)

    Yunping Han; Lin Li; Junxin Liu

    2013-01-01

    Biological risks of bioaerosols emitted from wastewater treatment processes have attracted wide attention in the recent years.However,the culture-based analysis method has been mostly adopted for detecting the bacterial community in bioaerosols,which may result in the underestimation of total microorganism concentration as not all microorganisms are cultivable.In this study,oligonucleotide fingerprinting of 16S rRNA genes was applied to reveal the composition and structure of the bacterial community in bioaerosols from an Orbal oxidation ditch in a Beijing wastewater treatment plant (WWTP).Bioaerosols were collected at different distances from the aerosol source,rotating brushes,and the sampling height was 1.5 m which is the common respiratory height of a human being.The bacterial communities of bioaerosols were diverse,and the lowest bacterial diversity was found at the sampling site just after the rotating brush rotating brush.A large proportion of bacteria in bioaerosols were affiliated with Proteobacteria and Bacteroidetes.Numerous bacteria present in the bioaerosols also emerged in water,indicating that the bacterial community in the bioaerosols was related to that of the aerosols' sources.The forced aeration of rotating brushes brought about observably distinct bacterial communities between sampling sites situated before and after the rotating brush.Isolation sources of closest relatives in bioaerosols done libraries were associated with the aqueous environment in the WWTP.Common potential pathogens in bioaerosols as well as those not reported in previous research were also analyzed in this study.Measures should be adopted to reduce the emission of bioaerosols and prevent their exposure to workers.

  20. Characterization of the airborne bacteria community at different distances from the rotating brushes in a wastewater treatment plant by 16S rRNA gene clone libraries.

    Science.gov (United States)

    Han, Yunping; Li, Lin; Liu, Junxin

    2013-01-01

    Biological risks of bioaerosols emitted from wastewater treatment processes have attracted wide attention in the recent years. However, the culture-based analysis method has been mostly adopted for detecting the bacterial community in bioaerosols, which may result in the underestimation of total microorganism concentration as not all microorganisms are cultivable. In this study, oligonucleotide fingerprinting of 16S rRNA genes was applied to reveal the composition and structure of the bacterial community in bioaerosols from an Orbal oxidation ditch in a Beijing wastewater treatment plant (WWTP). Bioaerosols were collected at different distances from the aerosol source, rotating brushes, and the sampling height was 1.5 in which is the common respiratory height of a human being. The bacterial communities of bioaerosols were diverse, and the lowest bacterial diversity was found at the sampling site just after the rotating brush rotating brush. A large proportion of bacteria in bioaerosols were affiliated with Proteobacteria and Bacteroidetes. Numerous bacteria present in the bioaerosols also emerged in water, indicating that the bacterial community in the bioaerosols was related to that of the aerosols' sources. The forced aeration of rotating brushes brought about observably distinct bacterial communities between sampling sites situated before and after the rotating brush. Isolation sources of closest relatives in bioaerosols clone libraries were associated with the aqueous environment in the WWTP. Common potential pathogens in bioaerosols as well as those not reported in previous research were also analyzed in this study. Measures should be adopted to reduce the emission of bioaerosols and prevent their exposure to workers. PMID:23586294

  1. Comparative 16S rRNA signatures and multilocus sequence analysis for the genus Salinicola and description of Salinicola acroporae sp. nov., isolated from coral Acropora digitifera.

    Science.gov (United States)

    Lepcha, Rinchen T; Poddar, Abhijit; Schumann, Peter; Das, Subrata K

    2015-07-01

    A novel Gram-negative, aerobic, motile marine bacterium, strain S4-41(T), was isolated from mucus of the coral Acropora digitifera from the Andaman Sea. Heterotrophic growth was observed in 0-25 % NaCl, at 15-45 °C and pH 4.5-9. In phylogenetic trees, strain S4-41(T) was grouped within the genus Salinicola but formed a separate branch distant from a cluster composed of Salinicola salarius M27(T) and Salinicola socius SMB35(T). DNA-DNA relatedness between strain S4-41(T) and these reference strains were well below 70 %. Q-9 was the sole respiratory quinone. The DNA G+C content was determined to be 63.6 mol%. Based on a polyphasic analysis, strain S4-41(T) is concluded to represent a novel species in the genus Salinicola for which the name Salinicola acroporae sp. nov. is proposed. The type strain is S4-41(T) (=JCM 30412(T) = LMG 28587(T)). Comparative 16S rRNA analysis of the genera Salinicola, Kushneria, Chromohalobacter and Cobetia revealed the presence of genus specific sequence signatures. Multilocus sequence analysis based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes (atpA, gyrB, secA, rpoD) was found to be unnecessary for phylogenetic studies of the genus Salinicola. PMID:25944083

  2. Soil bacterial metagenomic analysis from uranium ore deposit of Domiasiat in Northeast India

    International Nuclear Information System (INIS)

    Total bacterial community analyses were performed for uranium ore deposit soil samples of Domiasiat utilizing cultivation-independent approach. Screening based on amplified ribosomal DNA restriction analysis (ARDRA) using MspI and HaeIII was performed to analyse 150 clones which generated 59 distinct ribo-types from the clone library. Representative 96 clone partial 16S rRNA gene were phylogenetically related to 10 different bacterial groups. Proteobacteria and Acidobacteria were the most abundant bacterial group while 7% of the clones represented novel bacterial lineages. The bacterial diversity obtained by the culture-independent approach presented a larger diversity of bacteria as compared to the conditioned cultivation method. The study also provides baseline me-tagenomic information to assess subsequent impact of environment perturbation consequent to uranium mining at the studied site. (author)

  3. IDENTIFICATION OF ACTIVE BACTERIAL COMMUNITIES IN A MODEL DRINKING WATER BIOFILM SYSTEM USING 16S RRNA-BASED CLONE LIBRARIES

    Science.gov (United States)

    Recent phylogenetic studies have used DNA as the target molecule for the development of environmental 16S rDNA clone libraries. As DNA may persist in the environment, DNA-based libraries cannot be used to identify metabolically active bacteria in water systems. In this study, a...

  4. Bacterial communities in chitin-amended soil as revealed by 16S rRNA gene based pyrosequencing

    NARCIS (Netherlands)

    Cretoiu, Mariana Silvia; Kielak, Anna Maria; Schluter, Andreas; van Elsas, Jan Dirk

    2014-01-01

    Chitin and its derivatives are natural biopolymers that are often used as compounds for the control of soilborne plant pathogens. In spite of recent advances in agricultural practices involving chitin amendments, the microbial communities in chitin-amended soils remain poorly known. The objectives o

  5. Vineyard soil bacterial diversity and composition revealed by 16S rRNA genes: differentiation by geographic features

    Science.gov (United States)

    Here, we examine soil-borne microbial biogeography as a function of the features that 31 define an American Viticultural Area (AVA), a geographically delimited American wine grape32 growing region, defined for its distinguishing features of climate, geology, soils, physical 33 features (topography a...

  6. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences.

    Science.gov (United States)

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1996-12-01

    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  7. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  8. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline

    OpenAIRE

    Trieber, Catharine A.; Taylor, Diane E.

    2002-01-01

    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  9. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium

    OpenAIRE

    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.

    1998-01-01

    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  10. Functional profiling and distribution of the forest soil bacterial communities along the soil mycorrhizosphere continuum.

    Science.gov (United States)

    Uroz, S; Courty, P E; Pierrat, J C; Peter, M; Buée, M; Turpault, M P; Garbaye, J; Frey-Klett, P

    2013-08-01

    An ectomycorrhiza is a multitrophic association between a tree root, an ectomycorrhizal fungus, free-living fungi and the associated bacterial communities. Enzymatic activities of ectomycorrhizal root tips are therefore result of the contribution from different partners of the symbiotic organ. However, the functional potential of the fungus-associated bacterial communities remains unknown. In this study, a collection of 80 bacterial strains randomly selected and isolated from a soil-ectomycorrhiza continuum (oak-Scleroderma citrinum ectomycorrhizas, the ectomycorrhizosphere and the surrounding bulk soil) were characterized. All the bacterial isolates were identified by partial 16S rRNA gene sequences as members of the genera Burkholderia, Collimonas, Dyella, Mesorhizobium, Pseudomonas, Rhizobium and Sphingomonas. The bacterial strains were then assayed for β-xylosidase, β-glucosidase, N-acetyl-hexosaminidase, β-glucuronidase, cellobiohydrolase, phosphomonoesterase, leucine-aminopeptidase and laccase activities, chitin solubilization and auxin production. Using these bioassays, we demonstrated significant differences in the functional distribution of the bacterial communities living in the different compartments of the soil-ectomycorrhiza continuum. The surrounding bulk soil was significantly enriched in bacterial isolates capable of hydrolysing cellobiose and N-acetylglucosamine. In contrast, the ectomycorrhizosphere appeared significantly enriched in bacterial isolates capable of hydrolysing glucopyranoside and chitin. Notably, chitinase and laccase activities were found only in bacterial isolates belonging to the Collimonas and Pseudomonas genera. Overall, the results suggest that the ectomycorrhizal fungi favour specific bacterial communities with contrasting functional characteristics from the surrounding soil. PMID:23455431

  11. Molecular characterization of bacterial populations of different soils Caracterização molecular de populações bacterianas de diferentes solos

    OpenAIRE

    Rodrigo Matheus Pereira; Érico Leandro da Silveira; Denilson César Scaquitto; Eliamar Aparecida Nascimbém Pedrinho; Silvana Pompéia Val-Moraes; Ester Wickert; Lúcia Maria Carareto-Alves; Eliana Gertrudes de Macedo Lemos

    2006-01-01

    Until recently, few studies were carried out in Brazil about diversity of bacterial soil communities. Aiming to characterize the bacterial population in the soil through 16S rRNA analysis, two types of soil have been analyzed: one of them characterized by intensive use where tomato, beans and corn were cultivated (CS); the other analyzed soil was under forest (FS), unchanged by man; both located in Guaíra, São Paulo State, Brazil. Using specific primers, 16S rRNA genes from metagenomic DNA in...

  12. Coverage evaluation of universal bacterial primers using the metagenomic datasets

    Directory of Open Access Journals (Sweden)

    Mao Dan-Ping

    2012-05-01

    Full Text Available Abstract Background The coverage of universal primers for the bacterial 16S rRNA gene plays a crucial role in the correct understanding of microbial community structure. However, existing studies on primer coverage are limited by the lack of appropriate databases and are restricted to the domain level. Additionally, most studies do not account for the positional effect of single primer-template mismatches. In this study, we used 7 metagenomic datasets as well as the Ribosomal Database Project (RDP to assess the coverage of 8 widely used bacterial primers. Results The coverage rates for bacterial primers were found to be overestimated by previous studies that only investigated the RDP because of PCR amplification bias in the sequence composition of the dataset. In the RDP, the non-coverage rates for all primers except 27F were ≪6%, while in the metagenomic datasets, most were ≫10%. If one considers that a single mismatch near the 3′ end of the primer might greatly reduce PCR efficiency, then some phylum non-coverage rates would change by more than 20%. Primer binding-site sequence variants that could not pair with their corresponding primers are discussed. Conclusions Our study revealed the potential bias introduced by the use of universal bacterial primers in the assessment of microbial communities. With the development of high-throughput, next-generation sequencing techniques, it will become feasible to sequence more of the hypervariable regions of the bacterial 16S rRNA gene. This, in turn, will lead to the more frequent use of the primers discussed here.

  13. Bacterial communities associated with the ctenophores Mnemiopsis leidyi and Beroe ovata.

    Science.gov (United States)

    Daniels, Camille; Breitbart, Mya

    2012-10-01

    Residing in a phylum of their own, ctenophores are gelatinous zooplankton that drift through the ocean's water column. Although ctenophores are known to be parasitized by a variety of eukaryotes, no studies have examined their bacterial associates. This study describes the bacterial communities associated with the lobate ctenophore Mnemiopsis leidyi and its natural predator Beroe ovata in Tampa Bay, Florida, USA. Investigations using terminal restriction fragment length polymorphism (T-RFLP) and cloning and sequencing of 16S rRNA genes demonstrated that ctenophore bacterial communities were distinct from the surrounding water. In addition, each ctenophore genus contained a unique microbiota. Ctenophore samples contained fewer bacterial operational taxonomic units (OTUs) by T-RFLP and lower diversity communities by 16S rRNA gene sequencing than the water column. Both ctenophore genera contained sequences related to bacteria previously described in marine invertebrates, and sequences similar to a sea anemone pathogen were abundant in B. ovata. Temporal sampling revealed that the ctenophore-associated bacterial communities varied over time, with no single OTU detected at all time points. This is the first report of distinct and dynamic bacterial communities associated with ctenophores, suggesting that these microbial consortia may play important roles in ctenophore ecology. Future work needs to elucidate the functional roles and mode of acquisition of these bacteria. PMID:22571334

  14. Impacts of poultry house environment on poultry litter bacterial community composition.

    Directory of Open Access Journals (Sweden)

    Michael D Dumas

    Full Text Available Viral and bacterial pathogens are a significant economic concern to the US broiler industry and the ecological epicenter for poultry pathogens is the mixture of bedding material, chicken excrement and feathers that comprises the litter of a poultry house. This study used high-throughput sequencing to assess the richness and diversity of poultry litter bacterial communities, and to look for connections between these communities and the environmental characteristics of a poultry house including its history of gangrenous dermatitis (GD. Cluster analysis of 16S rRNA gene sequences revealed differences in the distribution of bacterial phylotypes between Wet and Dry litter samples and between houses. Wet litter contained greater diversity with 90% of total bacterial abundance occurring within the top 214 OTU clusters. In contrast, only 50 clusters accounted for 90% of Dry litter bacterial abundance. The sixth largest OTU cluster across all samples classified as an Arcobacter sp., an emerging human pathogen, occurring in only the Wet litter samples of a house with a modern evaporative cooling system. Ironically, the primary pathogenic clostridial and staphylococcal species associated with GD were not found in any house; however, there were thirteen 16S rRNA gene phylotypes of mostly gram-positive phyla that were unique to GD-affected houses and primarily occurred in Wet litter samples. Overall, the poultry house environment appeared to substantially impact the composition of litter bacterial communities and may play a key role in the emergence of food-borne pathogens.

  15. Vimentin in Bacterial Infections

    DEFF Research Database (Denmark)

    Mak, Tim N; Brüggemann, Holger

    2016-01-01

    -vimentin interactions are presented in this review: the role of vimentin in pathogen-binding on the cell surface and subsequent bacterial invasion and the interaction of cytosolic vimentin and intracellular pathogens with regards to innate immune signaling. Mechanistic insight is presented involving distinct bacterial......Despite well-studied bacterial strategies to target actin to subvert the host cell cytoskeleton, thus promoting bacterial survival, replication, and dissemination, relatively little is known about the bacterial interaction with other components of the host cell cytoskeleton, including intermediate...... filaments (IFs). IFs have not only roles in maintaining the structural integrity of the cell, but they are also involved in many cellular processes including cell adhesion, immune signaling, and autophagy, processes that are important in the context of bacterial infections. Here, we summarize the knowledge...

  16. Molecular survey of bacterial communities associated with bacterial chondronecrosis with osteomyelitis (BCO) in broilers.

    Science.gov (United States)

    Jiang, Tieshan; Mandal, Rabindra K; Wideman, Robert F; Khatiwara, Anita; Pevzner, Igal; Min Kwon, Young

    2015-01-01

    Bacterial chondronecrosis with osteomyelitis (BCO) is recognized as an important cause of lameness in commercial broiler chickens (meat-type chickens). Relatively little is known about the microbial communities associated with BCO. This study was conducted to increase our understanding of the microbial factors associated with BCO using a culture-independent approach. Using Illumina sequencing of the hyper-variable region V6 in the 16S rRNA gene, we characterized the bacterial communities in 97 femoral or tibial heads from normal and lame broilers carefully selected to represent diverse variations in age, line, lesion type, floor type, clinical status and bone type. Our in-depth survey based on 14 million assembled sequence reads revealed that complex bacterial communities exist in all samples, including macroscopically normal bones from clinically healthy birds. Overall, Proteobacteria (mean 90.9%) comprised the most common phylum, followed by Firmicutes (6.1%) and Actinobacteria (2.6%), accounting for more than 99% of all reads. Statistical analyses demonstrated that there are differences in bacterial communities in different types of bones (femur vs. tibia), lesion types (macroscopically normal femora or tibiae vs. those with pathognomonic BCO lesions), and among individual birds. This analysis also showed that BCO samples overrepresented genera Staphylococcus, whose species have been frequently isolated in BCO samples in previous studies. Rarefaction analysis demonstrated the general tendency that increased severities of BCO lesions were associated with reduced species diversity in both femoral and tibial samples when compared to macroscopically normal samples. These observations suggest that certain bacterial subgroups are preferentially selected in association with the development of BCO lesions. Understanding the microbial species associated with BCO will identify opportunities for understanding and modulating the pathogenesis of this form of lameness in

  17. Molecular survey of bacterial communities associated with bacterial chondronecrosis with osteomyelitis (BCO in broilers.

    Directory of Open Access Journals (Sweden)

    Tieshan Jiang

    Full Text Available Bacterial chondronecrosis with osteomyelitis (BCO is recognized as an important cause of lameness in commercial broiler chickens (meat-type chickens. Relatively little is known about the microbial communities associated with BCO. This study was conducted to increase our understanding of the microbial factors associated with BCO using a culture-independent approach. Using Illumina sequencing of the hyper-variable region V6 in the 16S rRNA gene, we characterized the bacterial communities in 97 femoral or tibial heads from normal and lame broilers carefully selected to represent diverse variations in age, line, lesion type, floor type, clinical status and bone type. Our in-depth survey based on 14 million assembled sequence reads revealed that complex bacterial communities exist in all samples, including macroscopically normal bones from clinically healthy birds. Overall, Proteobacteria (mean 90.9% comprised the most common phylum, followed by Firmicutes (6.1% and Actinobacteria (2.6%, accounting for more than 99% of all reads. Statistical analyses demonstrated that there are differences in bacterial communities in different types of bones (femur vs. tibia, lesion types (macroscopically normal femora or tibiae vs. those with pathognomonic BCO lesions, and among individual birds. This analysis also showed that BCO samples overrepresented genera Staphylococcus, whose species have been frequently isolated in BCO samples in previous studies. Rarefaction analysis demonstrated the general tendency that increased severities of BCO lesions were associated with reduced species diversity in both femoral and tibial samples when compared to macroscopically normal samples. These observations suggest that certain bacterial subgroups are preferentially selected in association with the development of BCO lesions. Understanding the microbial species associated with BCO will identify opportunities for understanding and modulating the pathogenesis of this form of

  18. Demonstrating Bacterial Flagella.

    Science.gov (United States)

    Porter, John R.; And Others

    1992-01-01

    Describes an effective laboratory method for demonstrating bacterial flagella that utilizes the Proteus mirabilis organism and a special harvesting technique. Includes safety considerations for the laboratory exercise. (MDH)

  19. Preliminary molecular analysis of bacterial composition in periapical lesions with primary endodontic infections of deciduous teeth

    Institute of Scientific and Technical Information of China (English)

    SHANG Jia-jian; YANG Qiu-bo; ZHAO Huan-ying; CAI Shuang; ZHOU Yan; SUN Zheng

    2013-01-01

    Background The bacterial composition of periapical lesions in deciduous teeth has not been well documented.This study was designed to explore the bacterial compositions,especially the dominant bacteria in periapical lesions using 16S rRNA sequencing.Methods Tissue samples were collected from 11 periapical lesions in deciduous teeth with primary endodontic infections.DNA was extracted from each sample and analyzed using 16S rRNA cloning and sequencing for the identification of bacteria.Results All DNA samples were positive for 16S rRNA gene PCR.One hundred and fifty-one phylotypes from 810 clones were identified to eight phyla,and each sample contained an average of 25.9 phylotypes.In addition,59 phylotypes were detected in more than two samples,and Fusobacterium (F.) nucleatum (8/11),Dialister (D.) invisus (8/11),Campylobacter (C.) gracilis (7/11),Escherichia (E.) coil DH1 (6/11),Aggregatibacter (A.) segnis (6/11),and Streptococcus (S.) mitis (6/11) were the most prevalent species.Furthermore,45 as-yet-uncultivated phylotypes were also identified.Conclusions Chronic periapical lesions in deciduous teeth contained polymicrobial infections.F.nucleatum,D.invisus,C.gracilis,E.coli DH1,A.segnis,and S.mitis were the most prevalent species detected by 16S rRNA sequencing.

  20. Sequencing of 16S rRNA reveals a distinct salivary microbiome signature in Behçet's disease.

    Science.gov (United States)

    Coit, Patrick; Mumcu, Gonca; Ture-Ozdemir, Filiz; Unal, Ali Ugur; Alpar, Ugur; Bostanci, Nagihan; Ergun, Tulin; Direskeneli, Haner; Sawalha, Amr H

    2016-08-01

    Behçet's disease (BD) is characterized by recurrent oro-genital ulcers, mucocutaneous lesions, and serious organ involvement. We investigated the salivary microbiome in BD using high-throughput sequencing of the 16S rRNA V4 region. Stimulated saliva samples were collected from 31 BD patients and 15 healthy controls, and in 9 BD patients, a second saliva sample was collected following dental and periodontal treatment. Sequence analysis identified a total of 908 operational taxonomic units (OTUs) present across all samples. Patients had a microbial community structure that is significantly less diverse than healthy controls. The most overabundant species in BD was Haemophilus parainfluenzae, while the most depleted included Alloprevotella rava and species in the genus Leptotrichia. Periodontal treatment improved oral health indices in BD but had no short-term effect on bacterial community structure. Neither the BD-associated genetic risk locus within the HLA-B/MICA region nor being on immunosuppressive medications explained the differences between patients and controls. PMID:27283393

  1. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species

    Science.gov (United States)

    Fogarty, L.R.; Voytek, M.A.

    2005-01-01

    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  2. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Directory of Open Access Journals (Sweden)

    Pasupuleti Sreenivasa Rao

    2013-08-01

    Full Text Available Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Sequences of various species related to genus Leptospira obtained from the NCBI database etc and aligned (CLUSTAL_X. Two Phylogenetic trees were constructed (MEGA-5 in which the first one is related to various serovars of L. interrogans and the other is related to various species of Leptospira. The Phylogenetic trees revealed the relationship and genetic diversity of various serovars of L. interrogans and the other Leptospira species, with their nearest phylogenetic relatives. In the first tree, two major clades were observed which were named as A and B, whereas in the second tree, three major clades were observed and named as A, B and C respectively. Aquifex pyrophilus strain has been used for out grouping in both the trees. The genetic distance between the species in the phylogenetic tree is presented by a bar which represents 0.5 nucleotide substitutions per alignment position in the 16S rRNA gene sequence among the various serovars of L. interrogans while 0.05 nucleotide substitutions in case of various species related to the genus Leptospira. Thus, the findings from the above study confirm that the genus Leptospira exhibits genetic diversity in the 16S rRNA gene. [Int J Res Med Sci 2013; 1(4.000: 369-377

  3. Insect Gut Bacterial Diversity Determined by Environmental Habitat, Diet, Developmental Stage, and Phylogeny of Host

    OpenAIRE

    Yun, Ji-Hyun; Roh, Seong Woon; Whon, Tae Woong; Jung, Mi-Ja; Kim, Min-Soo; Park, Doo-Sang; Yoon, Changmann; Nam, Young-Do; Kim, Yun-Ji; Choi, Jung-Hye; Kim, Joon-Yong; Shin, Na-Ri; Kim, Sung-Hee; Lee, Won-Jae; Bae, Jin-Woo

    2014-01-01

    Insects are the most abundant animals on Earth, and the microbiota within their guts play important roles by engaging in beneficial and pathological interactions with these hosts. In this study, we comprehensively characterized insect-associated gut bacteria of 305 individuals belonging to 218 species in 21 taxonomic orders, using 454 pyrosequencing of 16S rRNA genes. In total, 174,374 sequence reads were obtained, identifying 9,301 bacterial operational taxonomic units (OTUs) at the 3% dista...

  4. Diversity and functions of bacterial community in drinking water biofilms revealed by high-throughput sequencing

    OpenAIRE

    Chao, Yuanqing; Mao, Yanping; Wang, Zhiping,; Tong ZHANG

    2015-01-01

    The development of biofilms in drinking water (DW) systems may cause various problems to water quality. To investigate the community structure of biofilms on different pipe materials and the global/specific metabolic functions of DW biofilms, PCR-based 454 pyrosequencing data for 16S rRNA genes and Illumina metagenomic data were generated and analysed. Considerable differences in bacterial diversity and taxonomic structure were identified between biofilms formed on stainless steel and biofilm...

  5. Bacterial-biota dynamics of eight bryophyte species from different ecosystems

    OpenAIRE

    Koua, Faisal Hammad Mekky; Kimbara, Kazuhide; Tani, Akio

    2014-01-01

    Despite the importance of bryophyte-associated microorganisms in various ecological aspects including their crucial roles in the soil-enrichment of organic mass and N2 fixation, nonetheless, little is known about the microbial diversity of the bryophyte phyllospheres (epi-/endophytes). To get insights into bacterial community structures and their dynamics on the bryophyte habitats in different ecosystems and their potential biological roles, we utilized the 16S rRNA gene PCR-DGGE and subseque...

  6. Comparison of Diversities and Compositions of Bacterial Populations Inhabiting Natural Forest Soils

    OpenAIRE

    Hackl, Evelyn; Zechmeister-Boltenstern, Sophie; Bodrossy, Levente; Sessitsch, Angela

    2004-01-01

    The diversity and composition of soil bacterial communities were compared among six Austrian natural forests, including oak-hornbeam, spruce-fir-beech, and Austrian pine forests, using terminal restriction fragment length polymorphism (T-RFLP, or TRF) analysis and sequence analysis of 16S rRNA genes. The forests studied differ greatly in soil chemical characteristics, microbial biomass, and nutrient turnover rates. The aim of this study was to relate these differences to the composition of th...

  7. Structure and Function of the Bacterial Root Microbiota in Wild and Domesticated Barley

    OpenAIRE

    Bulgarelli, D.; Garrido Oter, R.; Muench, P.; Weiman, A.; Droege, J.; Pan, Y.; McHardy, A; Schulze-Lefert, P.

    2015-01-01

    Summary The microbial communities inhabiting the root interior of healthy plants, as well as the rhizosphere, which consists of soil particles firmly attached to roots, engage in symbiotic associations with their host. To investigate the structural and functional diversification among these communities, we employed a combination of 16S rRNA gene profiling and shotgun metagenome analysis of the microbiota associated with wild and domesticated accessions of barley (Hordeum vulgare). Bacterial f...

  8. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards* #

    OpenAIRE

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang

    2014-01-01

    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profili...

  9. Dynamics of bacterial and fungal communities associated with eggshells during incubation

    OpenAIRE

    Grizard, Stéphanie; Dini-Andreote, Francisco; Tieleman, B Irene; Salles, Joana F

    2014-01-01

    Microorganisms are closely associated with eggs and may play a determinant role in embryo survival. Yet, the majority of studies focusing on this association relied on culture-based methodology, eventually leading to a skewed assessment of microbial communities. By targeting the 16S rRNA gene and internal transcribed spacer (ITS) region, we, respectively, described bacterial and fungal communities on eggshells of the homing pigeon Columba livia. We explored their structure, abundance, and com...

  10. Multiple gene sequence analysis using genes of the bacterial DNA repair pathway

    OpenAIRE

    Miguel Rotelok Neto; Carolina Weigert Galvão; Leonardo Magalhães Cruz; Dieval Guizelini; Leilane Caline Silva; Jarem Raul Garcia; Rafael Mazer Etto

    2015-01-01

    The ability to recognize and repair abnormal DNA structures is common to all forms of life. Physiological studies and genomic sequencing of a variety of bacterial species have identified an incredible diversity of DNA repair pathways. Despite the amount of available genes in public database, the usual method to place genomes in a taxonomic context is based mainly on the 16S rRNA or housekeeping genes. Thus, the relationships among genomes remain poorly understood. In this work, an approach of...

  11. Mechanism of uranium (VI) removal by two anaerobic bacterial communities

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Monica [Centro de Ciencias do Mar, Universidade do Algarve, FCT-DQF (edificio 8), Campus de Gambelas, 8005-139 Faro (Portugal); Faleiro, Maria Leonor [IBB - Centro de Biomedicina Molecular e Estrutural, Universidade do Algarve, FCT, Campus de Gambelas, 8005-139 Faro (Portugal); Costa, Ana M. Rosa da [Centro de Investigacao em Quimica do Algarve, Universidade do Algarve, FCT, DQF, Campus de Gambelas, 8005-139 Faro (Portugal); Chaves, Sandra; Tenreiro, Rogerio [Universidade de Lisboa, Faculdade de Ciencias, Centro de Biodiversidade, Genomica Integrativa e Funcional (BioFIG), Campus de FCUL, Campo Grande, 1749-016 Lisboa (Portugal); Matos, Antonio Pedro [Servico de Anatomia Patologica, Hospital Curry Cabral, Lisboa (Portugal); Costa, Maria Clara, E-mail: mcorada@ualg.pt [Centro de Ciencias do Mar, Universidade do Algarve, FCT-DQF (edificio 8), Campus de Gambelas, 8005-139 Faro (Portugal)

    2010-12-15

    The mechanism of uranium (VI) removal by two anaerobic bacterial consortia, recovered from an uncontaminated site (consortium A) and other from an uranium mine (consortium U), was investigated. The highest efficiency of U (VI) removal by both consortia (97%) occurred at room temperature and at pH 7.2. Furthermore, it was found that U (VI) removal by consortium A occurred by enzymatic reduction and bioaccumulation, while the enzymatic process was the only mechanism involved in metal removal by consortium U. FTIR analysis suggested that after U (VI) reduction, U (IV) could be bound to carboxyl, phosphate and amide groups of bacterial cells. Phylogenetic analysis of 16S rRNA showed that community A was mainly composed by bacteria closely related to Sporotalea genus and Rhodocyclaceae family, while community U was mainly composed by bacteria related to Clostridium genus and Rhodocyclaceae family.

  12. Mechanism of uranium (VI) removal by two anaerobic bacterial communities

    International Nuclear Information System (INIS)

    The mechanism of uranium (VI) removal by two anaerobic bacterial consortia, recovered from an uncontaminated site (consortium A) and other from an uranium mine (consortium U), was investigated. The highest efficiency of U (VI) removal by both consortia (97%) occurred at room temperature and at pH 7.2. Furthermore, it was found that U (VI) removal by consortium A occurred by enzymatic reduction and bioaccumulation, while the enzymatic process was the only mechanism involved in metal removal by consortium U. FTIR analysis suggested that after U (VI) reduction, U (IV) could be bound to carboxyl, phosphate and amide groups of bacterial cells. Phylogenetic analysis of 16S rRNA showed that community A was mainly composed by bacteria closely related to Sporotalea genus and Rhodocyclaceae family, while community U was mainly composed by bacteria related to Clostridium genus and Rhodocyclaceae family.

  13. Shuffling bacterial metabolomes

    OpenAIRE

    Thomason, Brendan; Read, Timothy D.

    2006-01-01

    Horizontal gene transfer (HGT) has a far more significant role than gene duplication in bacterial evolution. This has recently been illustrated by work demonstrating the importance of HGT in the emergence of bacterial metabolic networks, with horizontally acquired genes being placed in peripheral pathways at the outer branches of the networks.

  14. Vimentin in Bacterial Infections.

    Science.gov (United States)

    Mak, Tim N; Brüggemann, Holger

    2016-01-01

    Despite well-studied bacterial strategies to target actin to subvert the host cell cytoskeleton, thus promoting bacterial survival, replication, and dissemination, relatively little is known about the bacterial interaction with other components of the host cell cytoskeleton, including intermediate filaments (IFs). IFs have not only roles in maintaining the structural integrity of the cell, but they are also involved in many cellular processes including cell adhesion, immune signaling, and autophagy, processes that are important in the context of bacterial infections. Here, we summarize the knowledge about the role of IFs in bacterial infections, focusing on the type III IF protein vimentin. Recent studies have revealed the involvement of vimentin in host cell defenses, acting as ligand for several pattern recognition receptors of the innate immune system. Two main aspects of bacteria-vimentin interactions are presented in this review: the role of vimentin in pathogen-binding on the cell surface and subsequent bacterial invasion and the interaction of cytosolic vimentin and intracellular pathogens with regards to innate immune signaling. Mechanistic insight is presented involving distinct bacterial virulence factors that target vimentin to subvert its function in order to change the host cell fate in the course of a bacterial infection. PMID:27096872

  15. Prevention of bacterial adhesion

    DEFF Research Database (Denmark)

    Klemm, Per; Vejborg, Rebecca Munk; Hancock, Viktoria

    2010-01-01

    Management of bacterial infections is becoming increasingly difficult due to the emergence and increasing prevalence of bacterial pathogens that are resistant to available antibiotics. Conventional antibiotics generally kill bacteria by interfering with vital cellular functions, an approach that ...... become valuable weapons for preventing pathogen contamination and fighting infectious diseases in the future....

  16. Vimentin in Bacterial Infections

    Directory of Open Access Journals (Sweden)

    Tim N. Mak

    2016-04-01

    Full Text Available Despite well-studied bacterial strategies to target actin to subvert the host cell cytoskeleton, thus promoting bacterial survival, replication, and dissemination, relatively little is known about the bacterial interaction with other components of the host cell cytoskeleton, including intermediate filaments (IFs. IFs have not only roles in maintaining the structural integrity of the cell, but they are also involved in many cellular processes including cell adhesion, immune signaling, and autophagy, processes that are important in the context of bacterial infections. Here, we summarize the knowledge about the role of IFs in bacterial infections, focusing on the type III IF protein vimentin. Recent studies have revealed the involvement of vimentin in host cell defenses, acting as ligand for several pattern recognition receptors of the innate immune system. Two main aspects of bacteria-vimentin interactions are presented in this review: the role of vimentin in pathogen-binding on the cell surface and subsequent bacterial invasion and the interaction of cytosolic vimentin and intracellular pathogens with regards to innate immune signaling. Mechanistic insight is presented involving distinct bacterial virulence factors that target vimentin to subvert its function in order to change the host cell fate in the course of a bacterial infection.

  17. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Science.gov (United States)

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  18. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  19. Analysis of 16S rRNA and mxaF genes reveling insights into Methylobacterium niche-specific plant association

    Directory of Open Access Journals (Sweden)

    Manuella Nóbrega Dourado

    2012-01-01

    Full Text Available The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  20. Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene

    Science.gov (United States)

    Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.

    2007-01-01

    We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

  1. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  2. Investigating the etiology of bovine digital dermatitis by a combination of 16S rRNA gene analysis and fluorescence in situ hybridization

    DEFF Research Database (Denmark)

    Schou, Kirstine Klitgaard; Rasmussen, Marianne; Capion, Nynne; Boye, Mette; Jensen, Tim Kåre

    Bovine digital dermatitis, the cause of lameness and wasting in cattle, was first reported in 1974. Today, this disease has considerable negative effects on animal welfare and production economy in many parts of the world. A bacterial etiology of digital dermatitis is now well documented, and the...... etiology of the disease. Here, a PCR-based approach targeting the 16S rRNA gene along with fluorescence in situ hybridization was used to determine the prevalence and diversity of 17 Treponema phylotypes in 85 digital dermatitis lesions from six Danish dairy herds as well as additional biopsies of healthy...... skin and previously examined digital dermatitis lesions. All skin samples were evaluated histopathologically for possible predisposing abnormalities. Furthermore, fluorescence in situ hybridization tests for Fusobacterium. necrophorum and D. nodosus was applied. All lesions revealed intermingled...

  3. Specific detection of Pasteurella multocida in chickens with fowl cholera and in pig lung tissues using fluorescent rRNA in situ hybridization

    DEFF Research Database (Denmark)

    Mbuthia, P.G.; Christensen, H.; Boye, Mette;

    2001-01-01

    further detected in formalin-fixed paraffin-embedded lung tissues from experimental fowl cholera in chickens and infections in pigs. In chicken lung tissues P. multocida cells were detected singly, in pairs, as microcolonies, and as massive colonies within air capillaries (septa and lumen), parabronchial...... a suitable and fast method for specific detection of P. multocida in histological formalin-fixed tissues. The test was replicable and reproducible and is recommended as a supplementary test for diagnosis and as a tool in pathogenesis studies of fowl cholera and respiratory tract infections in pigs......A Pasteurella multocida species-specific oligonucleotide probe, pmhyb449, targeting 16S rRNA was designed and evaluated by whole-cell hybridization against 22 selected reference strains in animal tissues. it differentiated P. multocida from other bacterial species of the families Pasteurellaceae...

  4. The murine lung microbiome in relation to the intestinal and vaginal bacterial communities

    OpenAIRE

    Barfod, Kenneth Klingenberg; Roggenbuck, Michael; Hansen, Lars H.; Schjørring, Susanne; Larsen, Søren Thor; Sørensen, Søren Johannes; Krogfelt, Karen Angeliki

    2013-01-01

    Background This work provides the first description of the bacterial population of the lung microbiota in mice. The aim of this study was to examine the lung microbiome in mice, the most used animal model for inflammatory lung diseases such as COPD, cystic fibrosis and asthma. Bacterial communities from broncho-alveolar lavage fluids and lung tissue were compared to samples taken from fecal matter (caecum) and vaginal lavage fluid from female BALB/cJ mice. Results Using a customized 16S rRNA ...

  5. Characterization of a Bacterial Community in an Abandoned Semiarid Lead-Zinc Mine Tailing Site▿ †

    OpenAIRE

    Mendez, Monica O.; Neilson, Julia W; Maier, Raina M.

    2008-01-01

    Bacterial diversity in mine tailing microbial communities has not been thoroughly investigated despite the correlations that have been observed between the relative microbial diversity and the success of revegetation efforts at tailing sites. This study employed phylogenetic analyses of 16S rRNA genes to compare the bacterial communities present in highly disturbed, extremely (pH 2.7) and moderately (pH 5.7) acidic lead-zinc mine tailing samples from a semiarid environment with those from a v...

  6. Bacterial population structure of the jute-retting environment.

    Science.gov (United States)

    Munshi, Tulika K; Chattoo, Bharat B

    2008-08-01

    Jute is one of the most versatile bast fibers obtained through the process of retting, which is a result of decomposition of stalks by the indigenous microflora. However, bacterial communities associated with the retting of jute are not well characterized. To investigate the presence of microorganisms during the process of jute retting, full-cycle rRNA approach was followed, and two 16S rRNA gene libraries, from jute-retting locations of Krishnanagar and Barrackpore, were constructed. Phylotypes affiliating to seven bacterial divisions were identified in both libraries. The bulk of clones came from Proteobacteria ( approximately 37, 41%) and a comparatively smaller proportion of clones from the divisions-Firmicutes ( approximately 11, 12%), Cytophaga-Flexibacter-Bacteroidetes group (CFB; approximately 9, 7%), Verrucomicrobia ( approximately 6, 5%), Acidobacteria ( approximately 4, 5%), Chlorobiales ( approximately 5, 5%), and Actinobacteria ( approximately 4, 2%) were identified. Percent coverage value and diversity estimations of phylotype richness, Shannon-Weiner index, and evenness confirmed the diverse nature of both the libraries. Evaluation of the retting waters by whole cell rRNA-targeted flourescent in situ hybridization, as detected by domain- and group-specific probes, we observed a considerable dominance of the beta-Proteobacteria (25.9%) along with the CFB group (24.4%). In addition, 32 bacterial species were isolated on culture media from the two retting environments and identified by 16S rDNA analysis, confirming the presence of phyla, Proteobacteria ( approximately 47%), Firmicutes ( approximately 22%), CFB group ( approximately 19%), and Actinobacteria ( approximately 13%) in the retting niche. Thus, our study presents the first quantification of the dominant and diverse bacterial phylotypes in the retting ponds, which will further help in improving the retting efficiency, and hence the fiber quality. PMID:18097714

  7. Changes of Bacterial Community Structure in Copper Mine Tailings After Colonization of Reed (Phragmites communis)

    Institute of Scientific and Technical Information of China (English)

    CHEN Yu-Qing; REN Guan-Ju; AN Shu-Qing; SUN Qing-Ye; LIU Chang-Hong; SHUANG Jing-Lei

    2008-01-01

    Soil samples were collected from both bare and vegetated mine tailings to study the changes in bacterial communities and soil chemical properties of copper mine tailings due to reed (Phragmites communis) colonization. The structures of bacterial communities were investigated using culture-independent 16S rRNA gene sequencing method. The bacterial diversity in the bare mine tailing was lower than that of the vegetated mine tailing. The former was dominated by sulfur metabolizing bacteria, whereas the latter was by nitrogen fixing bacteria. The bare mine tailing was acidic (pH = 3.78), whereas the vegetated mine tailing was near neutral (pH = 7.28). The contents of organic matter, total nitrogen, and ammonium acetate-extractable otassium in vegetated mine tailings were significantly higher than those in the bare mine tailings (P < 0.01), whereas available phosphorus and electrical conductivity were significantly lower than those in the bare mine tailings (P < 0.01). The results demonstrated that 16S rRNA gene sequencing could be successfully used to study the bacterial diversity in mine tailings. The colonization of the mine tailings by reed significantly changed the bacterial community and the chemical properties of tailings. The complex interactions between bacteria and plants deserve further investigation.

  8. Bacterial community composition and abundance in leachate of semi-aerobic and anaerobic landfills

    Institute of Scientific and Technical Information of China (English)

    Wei Zhang; Bo Yue; Qi Wang; Zechun Huang; Qifei Huang; Zengqiang Zhang

    2011-01-01

    The abundance and phylogenetic composition of bacterial community in leachate of semi-aerobic and anaerobic landfill were compared through real-time polymerase chain reaction and denaturing gradient gel electrophoresis.In semi-aerobic landfill scenario,the bacterial 16S rRNA copy numbers in leachate had no significant reduction from initial stage to stable period.In the scenario of anaerobic landfill,the largest bacterial 16S rRNA gene copy number was found in leachate at initial stage,but it reduced significantly at stable period.Moreover,methane-oxidizing bacteria population in stable period was lower than that in initial period in both two landfill processes.However,semi-aerobic landfill leachate had more methanotrophic bacteria populations than that in the anaerobic one.Furthermore,according to the sequences and phylogenetic analysis,obvious difference could be detected in bacterial community composition in different scenarios.Proteobacteria and bacteroidetes took up a dominantly higher proportion in semi-aerobic landfill leachate.To summarize up,different landfill methods and its landfill ages had crucial impacts on bacterial abundance and composition in leachate of semi-aerobic and anaerobic landfills.

  9. Bacterial diversity at different stages of the composting process

    Directory of Open Access Journals (Sweden)

    Paulin Lars

    2010-03-01

    Full Text Available Abstract Background Composting is an aerobic microbiological process that is facilitated by bacteria and fungi. Composting is also a method to produce fertilizer or soil conditioner. Tightened EU legislation now requires treatment of the continuously growing quantities of organic municipal waste before final disposal. However, some full-scale composting plants experience difficulties with the efficiency of biowaste degradation and with the emission of noxious odours. In this study we examine the bacterial species richness and community structure of an optimally working pilot-scale compost plant, as well as a full-scale composting plant experiencing typical problems. Bacterial species composition was determined by isolating total DNA followed by amplifying and sequencing the gene encoding the 16S ribosomal RNA. Results Over 1500 almost full-length 16S rRNA gene sequences were analysed and of these, over 500 were present only as singletons. Most of the sequences observed in either one or both of the composting processes studied here were similar to the bacterial species reported earlier in composts, including bacteria from the phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Deinococcus-Thermus. In addition, a number of previously undetected bacterial phylotypes were observed. Statistical calculations estimated a total bacterial diversity of over 2000 different phylotypes in the studied composts. Conclusions Interestingly, locally enriched or evolved bacterial variants of familiar compost species were observed in both composts. A detailed comparison of the bacterial diversity revealed a large difference in composts at the species and strain level from the different composting plants. However, at the genus level, the difference was much smaller and illustrated a delay of the composting process in the full-scale, sub-optimally performing plants.

  10. Bacterial diversity in Greenlandic soils as affected by potato cropping and inorganic versus organic fertilization

    DEFF Research Database (Denmark)

    Michelsen, Charlotte Frydenlund; Pedas, Pai Rosager; Glaring, Mikkel Andreas;

    2014-01-01

    limited research has been performed on the effects of these treatments on bacterial communities in Arctic and Subarctic agricultural soils. The major objective of this study was to investigate the short-term impact of conventional (NPK) and organic (sheep manure supplemented with nitrogen) fertilizer...... treatments on bacterial diversity, nutrient composition and crop yield in two Greenlandic agricultural soils. An effect of fertilizer was found on soil and plant nutrient levels and on crop yields. Pyrosequencing of 16S rRNA gene sequences did not reveal any major changes in the overall bacterial community...... composition as a result of different fertilizer treatments, indicating a robust microbial community in these soils. In addition, differences in nutrient levels, crop yields and bacterial abundances were found between the two field sites and the two experimental growth seasons, which likely reflect differences...

  11. Universal primer PCR with DGGE for rapid detection of bacterial pathogens.

    Science.gov (United States)

    Ji, Niannian; Peng, Bo; Wang, Guizhong; Wang, Sanying; Peng, Xuanxian

    2004-06-01

    A universal primer PCR (UPPCR) combined with denaturing gradient gel electrophoresis (DGGE) was evaluated as a method permitting the rapid detection of pathogens. The results show that this method is efficient at amplifying the conserved regions of bacterial 16S rRNA genes with universal primers and can detect causative bacterial pathogens rapidly. Six species of bacteria from fisheries (Pseudomonas fluorescens, Vibrio anguillarum, Aeromonas hydrophila, Vibrio fluvialis, Providencia rettgeri and Aeromonas sobria) were examined. Our results indicate that the approach we undertook can be adopted not only for axenic bacterial populations but also for mixed communities as well. Furthermore, we were able to achieve the rapid detection of multiple bacteria a single in sample. In addition, UPPCR-DGGE was shown to be better than previously reported UPPCR-single-stranded conformation polymorphism (SSCP)-based methods for the rapid detection of bacterial pathogens. PMID:15134888

  12. Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.

    OpenAIRE

    Fujiwara, H.; H. Ishikawa

    1982-01-01

    The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and...

  13. The Bacterial Communities of Full-Scale Biologically Active, Granular Activated Carbon Filters Are Stable and Diverse and Potentially Contain Novel Ammonia-Oxidizing Microorganisms

    OpenAIRE

    LaPara, Timothy M.; Hope Wilkinson, Katheryn; Strait, Jacqueline M.; Hozalski, Raymond M.; Sadowksy, Michael J.; Hamilton, Matthew J

    2015-01-01

    The bacterial community composition of the full-scale biologically active, granular activated carbon (BAC) filters operated at the St. Paul Regional Water Services (SPRWS) was investigated using Illumina MiSeq analysis of PCR-amplified 16S rRNA gene fragments. These bacterial communities were consistently diverse (Shannon index, >4.4; richness estimates, >1,500 unique operational taxonomic units [OTUs]) throughout the duration of the 12-month study period. In addition, only modest shifts in t...

  14. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Directory of Open Access Journals (Sweden)

    Susan M Huse

    2008-11-01

    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  15. A Markovian analysis of bacterial genome sequence constraints

    Directory of Open Access Journals (Sweden)

    Aaron D. Skewes

    2013-08-01

    Full Text Available The arrangement of nucleotides within a bacterial chromosome is influenced by numerous factors. The degeneracy of the third codon within each reading frame allows some flexibility of nucleotide selection; however, the third nucleotide in the triplet of each codon is at least partly determined by the preceding two. This is most evident in organisms with a strong G + C bias, as the degenerate codon must contribute disproportionately to maintaining that bias. Therefore, a correlation exists between the first two nucleotides and the third in all open reading frames. If the arrangement of nucleotides in a bacterial chromosome is represented as a Markov process, we would expect that the correlation would be completely captured by a second-order Markov model and an increase in the order of the model (e.g., third-, fourth-…order would not capture any additional uncertainty in the process. In this manuscript, we present the results of a comprehensive study of the Markov property that exists in the DNA sequences of 906 bacterial chromosomes. All of the 906 bacterial chromosomes studied exhibit a statistically significant Markov property that extends beyond second-order, and therefore cannot be fully explained by codon usage. An unrooted tree containing all 906 bacterial chromosomes based on their transition probability matrices of third-order shares ∼25% similarity to a tree based on sequence homologies of 16S rRNA sequences. This congruence to the 16S rRNA tree is greater than for trees based on lower-order models (e.g., second-order, and higher-order models result in diminishing improvements in congruence. A nucleotide correlation most likely exists within every bacterial chromosome that extends past three nucleotides. This correlation places significant limits on the number of nucleotide sequences that can represent probable bacterial chromosomes. Transition matrix usage is largely conserved by taxa, indicating that this property is likely

  16. Metatranscriptomics reveals overall active bacterial composition in caries lesions

    Directory of Open Access Journals (Sweden)

    Aurea Simón-Soro

    2014-10-01

    Full Text Available Background: Identifying the microbial species in caries lesions is instrumental to determine the etiology of dental caries. However, a significant proportion of bacteria in carious lesions have not been cultured, and the use of molecular methods has been limited to DNA-based approaches, which detect both active and inactive or dead microorganisms. Objective: To identify the RNA-based, metabolically active bacterial composition of caries lesions at different stages of disease progression in order to provide a list of potential etiological agents of tooth decay. Design: Non-cavitated enamel caries lesions (n=15 and dentin caries lesions samples (n=12 were collected from 13 individuals. RNA was extracted and cDNA was constructed, which was used to amplify the 16S rRNA gene. The resulting 780 bp polymerase chain reaction products were pyrosequenced using Titanium-plus chemistry, and the sequences obtained were used to determine the bacterial composition. Results: A mean of 4,900 sequences of the 16S rRNA gene with an average read length of 661 bp was obtained per sample, giving a comprehensive view of the active bacterial communities in caries lesions. Estimates of bacterial diversity indicate that the microbiota of cavities is highly complex, each sample containing between 70 and 400 metabolically active species. The composition of these bacterial consortia varied among individuals and between caries lesions of the same individuals. In addition, enamel and dentin lesions had a different bacterial makeup. Lactobacilli were found almost exclusively in dentin cavities. Streptococci accounted for 40% of the total active community in enamel caries, and 20% in dentin caries. However, Streptococcus mutans represented only 0.02–0.73% of the total bacterial community. Conclusions: The data indicate that the etiology of dental caries is tissue dependent and that the disease has a clear polymicrobial origin. The low proportion of mutans streptococci

  17. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Michihisa Maeda

    Full Text Available The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  18. A yeast transcription system for the 5S rRNA gene.

    OpenAIRE

    Keulen, H.; Thomas, D. Y.

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  19. Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition

    OpenAIRE

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-01-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones d...

  20. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    OpenAIRE

    Cangelosi, G A; Brabant, W H

    1997-01-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  1. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    Science.gov (United States)

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  2. Bacterial colonization of colonic crypt mucous gel and disease activity in ulcerative colitis.

    LENUS (Irish Health Repository)

    Rowan, Fiachra

    2012-02-01

    OBJECTIVE: To optimize total bacterial 16S rRNA quantification in microdissected colonic crypts in healthy controls and patients with ulcerative colitis (UC) and to characterize the findings with disease activity. BACKGROUND: Microscopic and molecular techniques have recently converged to allow bacterial enumeration in remote anatomic locations [eg, crypt-associated mucous gel (CAMG)]. The aims of this study were to combine laser capture microdissection (LCM) and 16S rRNA-based quantitative polymerase chain reaction (qPCR) to determine total bacterial copy number in CAMG both in health and in UC and to characterize the findings with disease activity. METHODS: LCM was used to microdissect CAMG from colonic mucosal biopsies from controls (n = 20) and patients with acute (n = 10) or subacute (n = 10) UC. Pan-bacterial 16S rRNA copy number per millimeter square in samples from 6 locations across the large bowel was obtained by qPCR using Desulfovibrio desulfuricans as a reference strain. Copy numbers were correlated with the UC disease activity index (UCDAI) and the simple clinical colitis activity index (SCCAI). RESULTS: Bacterial colonization of CAMG was detectable in all groups. Copy numbers were significantly reduced in acute UC. In subacute colitis, there was a positive correlation between copy number and UCDAI and SCCAI in the ascending, transverse and sigmoid colon. CONCLUSIONS: This study describes a sensitive method of quantitatively assessing bacterial colonization of the colonic CAMG. A positive correlation was found between CAMG bacterial load and subacute disease activity in UC, whereas detectable bacterial load was reduced in acute UC.

  3. Differential growth responses of soil bacterial taxa to carbon substrates of varying chemical recalcitrance

    Energy Technology Data Exchange (ETDEWEB)

    Goldfarb, K.C.; Karaoz, U.; Hanson, C.A.; Santee, C.A.; Bradford, M.A.; Treseder, K.K.; Wallenstein, M.D.; Brodie, E.L.

    2011-04-18

    Soils are immensely diverse microbial habitats with thousands of co-existing bacterial, archaeal, and fungal species. Across broad spatial scales, factors such as pH and soil moisture appear to determine the diversity and structure of soil bacterial communities. Within any one site however, bacterial taxon diversity is high and factors maintaining this diversity are poorly resolved. Candidate factors include organic substrate availability and chemical recalcitrance, and given that they appear to structure bacterial communities at the phylum level, we examine whether these factors might structure bacterial communities at finer levels of taxonomic resolution. Analyzing 16S rRNA gene composition of nucleotide analog-labeled DNA by PhyloChip microarrays, we compare relative growth rates on organic substrates of increasing chemical recalcitrance of >2,200 bacterial taxa across 43 divisions/phyla. Taxa that increase in relative abundance with labile organic substrates (i.e., glycine, sucrose) are numerous (>500), phylogenetically clustered, and occur predominantly in two phyla (Proteobacteria and Actinobacteria) including orders Actinomycetales, Enterobacteriales, Burkholderiales, Rhodocyclales, Alteromonadales, and Pseudomonadales. Taxa increasing in relative abundance with more chemically recalcitrant substrates (i.e., cellulose, lignin, or tannin-protein) are fewer (168) but more phylogenetically dispersed, occurring across eight phyla and including Clostridiales, Sphingomonadalaes, Desulfovibrionales. Just over 6% of detected taxa, including many Burkholderiales increase in relative abundance with both labile and chemically recalcitrant substrates. Estimates of median rRNA copy number per genome of responding taxa demonstrate that these patterns are broadly consistent with bacterial growth strategies. Taken together, these data suggest that changes in availability of intrinsically labile substrates may result in predictable shifts in soil bacterial composition.

  4. Differential growth responses of soil bacterial taxa to carbon substrates of varying chemical recalcitrance

    Directory of Open Access Journals (Sweden)

    Katherine C Goldfarb

    2011-05-01

    Full Text Available Soils are immensely diverse microbial habitats with thousands of co-existing bacterial, archaeal and fungal species. Across broad spatial scales, factors such as pH and soil moisture appear to determine the diversity and structure of soil bacterial communities. Within any one site however, bacterial taxon diversity is high and factors maintaining this diversity are poorly resolved. Candidate factors include organic substrate availability and chemical recalcitrance, and given that they appear to structure bacterial communities at the phylum-level, we examine whether these factors might structure bacterial communities at finer levels of taxonomic resolution. Analyzing 16S rRNA gene composition of nucleotide analog-labeled DNA by PhyloChip microarrays, we compare relative growth rates on organic substrates of increasing chemical recalcitrance of >2,200 bacterial taxa across 43 divisions/phyla. Taxa that increase in relative abundance with labile organic substrates (i.e. glycine, sucrose are numerous (>500, phylogenetically-clustered, and occur predominantly in two phyla (Proteobacteria and Actinobacteria including orders Actinomycetales, Enterobacterales, Burkholderiales, Rhodocyclales, Alteromonadales and Pseudomonadales. Taxa increasing in relative abundance with more chemically recalcitrant substrates (i.e. cellulose, lignin or tannin-protein are fewer (168 but more phylogenetically-dispersed, occurring across 8 phyla and including Clostridiales, Sphingomonadalaes, Desulfovibrionales. Just over 6% of detected taxa, including many Burkholderiales increase in relative abundance with both labile and chemically recalcitrant substrates. Estimates of median rRNA copy number per genome of responding taxa demonstrate that these patterns are broadly consistent with bacterial growth strategies. Taken together, these data suggest that changes in availability of intrinsically labile substrates may result in predictable shifts in soil bacterial composition.

  5. In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination

    OpenAIRE

    Torres, Martha; Balada, Joan-Miquel; Zellars, Malcolm; Squires, Craig; Squires, Catherine L.

    2004-01-01

    Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking. We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essential for it. We used a plasmid test system in which reporter gene mRNA was measured to monitor rRNA antiterminato...

  6. Characterization of bacterial populations in Danish raw milk cheeses made with different starter cultures by denaturating gradient gel electrophoresis and pyrosequencing

    DEFF Research Database (Denmark)

    Masoud, Wafa Mahmoud Hasan; Takamiya, Monica K Wik; Vogensen, Finn Kvist;

    2011-01-01

    ripening. Other bacteria like Corynebacterium, Halomonas, Pediococcus, Micrococcus and Staphylococcus, which were encountered in some cheese samples at low percentages compared with the total bacterial populations, were only detected by pyrosequencing. 16S rRNA gene pyrosequencing is an efficient method...

  7. Isolation of Polymer-Degrading Bacteria and Characterization of the Hindgut Bacterial Community from the Detritus-Feeding Larvae of Tipula abdominalis (Diptera: Tipulidae)▿

    OpenAIRE

    Cook, Dana M.; DeCrescenzo Henriksen, Emily; Upchurch, Rima; Peterson, Joy B. Doran

    2007-01-01

    The Tipula abdominalis larval hindgut microbial community presumably facilitates digestion of the lignocellulosic diet. The microbial community was investigated through characterization of bacterial isolates and analysis of 16S rRNA gene clone libraries. This initial study revealed novel bacteria and provides a framework for future studies of this symbiosis.

  8. Amazonian dark Earth and plant species from the Amazon region contribute to shape rhizosphere bacterial communities.

    Science.gov (United States)

    Barbosa Lima, Amanda; Cannavan, Fabiana Souza; Navarrete, Acacio Aparecido; Teixeira, Wenceslau Geraldes; Kuramae, Eiko Eurya; Tsai, Siu Mui

    2015-05-01

    Amazonian Dark Earths (ADE) or Terra Preta de Índio formed in the past by pre-Columbian populations are highly sustained fertile soils supported by microbial communities that differ from those extant in adjacent soils. These soils are found in the Amazon region and are considered as a model soil when compared to the surrounding and background soils. The aim of this study was to assess the effects of ADE and its surrounding soil on the rhizosphere bacterial communities of two leguminous plant species that frequently occur in the Amazon region in forest sites (Mimosa debilis) and open areas (Senna alata). Bacterial community structure was evaluated using terminal restriction fragment length polymorphism (T-RFLP) and bacterial community composition by V4 16S rRNA gene region pyrosequencing. T-RFLP analysis showed effect of soil types and plant species on rhizosphere bacterial community structure. Differential abundance of bacterial phyla, such as Acidobacteria, Actinobacteria, Verrucomicrobia, and Firmicutes, revealed that soil type contributes to shape the bacterial communities. Furthermore, bacterial phyla such as Firmicutes and Nitrospira were mostly influenced by plant species. Plant roots influenced several soil chemical properties, especially when plants were grown in ADE. These results showed that differences observed in rhizosphere bacterial community structure and composition can be influenced by plant species and soil fertility due to variation in soil attributes. PMID:25103911

  9. Compositional stability of a salivary bacterial population against supragingival microbiota shift following periodontal therapy.

    Directory of Open Access Journals (Sweden)

    Wataru Yamanaka

    Full Text Available Supragingival plaque is permanently in contact with saliva. However, the extent to which the microbiota contributes to the salivary bacterial population remains unclear. We compared the compositional shift in the salivary bacterial population with that in supragingival plaque following periodontal therapy. Samples were collected from 19 patients with periodontitis before and after periodontal therapy (mean sample collection interval, 25.8 ± 2.6 months, and their bacterial composition was investigated using barcoded pyrosequencing analysis of the 16S rRNA gene. Phylogenetic community analysis using the UniFrac distance metric revealed that the overall bacterial community composition of saliva is distinct from that of supragingival plaque, both pre- and post-therapy. Temporal variation following therapy in the salivary bacterial population was significantly smaller than in the plaque microbiota, and the post-therapy saliva sample was significantly more similar to that pre-therapy from the same individual than to those from other subjects. Following periodontal therapy, microbial richness and biodiversity were significantly decreased in the plaque microbiota, but not in the salivary bacterial population. The operational taxonomic units whose relative abundances changed significantly after therapy were not common to the two microbiotae. These results reveal the compositional stability of salivary bacterial populations against shifts in the supragingival microbiota, suggesting that the effect of the supragingival plaque microbiota on salivary bacterial population composition is limited.

  10. Bacterial Communities in Rhizosphere of Maize Studied by T-RFLP

    Directory of Open Access Journals (Sweden)

    Ondreičková Katarína

    2014-12-01

    Full Text Available The terminal restriction fragment length polymorphism munities from different collecting places was evaluated was used to determine the bacterial diversity in rhizo- by principal component analysis. Results showed that sphere of maize (Zea mays L. collected from four sites the most different bacterial community originated from of experimental field plot in two dates of the vegetation marginal part of the experimental field plot collected in season (July and September. The 16S rRNA gene was September was caused probably by combination of the amplified from metagenomic DNA using universal eubac- marginal effect and drought before sampling date in Sep- terial primers and PCR products were digested separately tember. Other rhizosphere samples showed from moderate with three restriction enzymes. Significant differences in to small differences in the structure of the bacterial com- the number of terminal restriction fragments among rhi- munity. Nevertheless, significant differences among all zosphere samples and between sampling dates were not collected bacterial communities were not observed. detected (P < 0.05. Variation within the bacterial communities from different collecting places was evaluated by principal component analysis. Results showed that the most different bacterial community originated from marginal part of the experimental field plot collected in September was caused probably by combination of the marginal effect and drought before sampling date in September. Other rhizosphere samples showed from moderate to small differences in the structure of the bacterial community. Nevertheless, significant differences among all collected bacterial communities were not observed.

  11. Diversity of Bacterial Communities of Fitness Center Surfaces in a U.S. Metropolitan Area

    Directory of Open Access Journals (Sweden)

    Nabanita Mukherjee

    2014-12-01

    Full Text Available Public fitness centers and exercise facilities have been implicated as possible sources for transmitting community-acquired bacterial infections. However, the overall diversity of the bacterial community residing on the surfaces in these indoor environments is still unknown. In this study, we investigated the overall bacterial ecology of selected fitness centers in a metropolitan area (Memphis, TN, USA utilizing culture-independent pyrosequencing of the 16S rRNA genes. Samples were collected from the skin-contact surfaces (e.g., exercise instruments, floor mats, handrails, etc. within fitness centers. Taxonomical composition revealed the abundance of Firmicutes phyla, followed by Proteobacter and Actinobacteria, with a total of 17 bacterial families and 25 bacterial genera. Most of these bacterial genera are of human and environmental origin (including, air, dust, soil, and water. Additionally, we found the presence of some pathogenic or potential pathogenic bacterial genera including Salmonella, Staphylococcus, Klebsiella, and Micrococcus. Staphylococcus was found to be the most prevalent genus. Presence of viable forms of these pathogens elevates risk of exposure of any susceptible individuals. Several factors (including personal hygiene, surface cleaning and disinfection schedules of the facilities may be the reasons for the rich bacterial diversity found in this study. The current finding underscores the need to increase public awareness on the importance of personal hygiene and sanitation for public gym users.

  12. Metagenomic 16s rRNA investigation of microbial communities in the Black Sea estuaries in South-West of Ukraine.

    Science.gov (United States)

    Bobrova, Oleksandra; Kristoffersen, Jon Bent; Oulas, Anastasis; Ivanytsia, Volodymyr

    2016-01-01

    The Black Sea estuaries represent interfaces of the sea and river environments. Microorganisms that inhabit estuarine water play an integral role in all biochemical processes that occur there and form unique ecosystems. There are many estuaries located in the Southern-Western part of Ukraine and some of them are already separated from the sea. The aim of this research was to determine the composition of microbial communities in the Khadzhibey, Dniester and Sukhyi estuaries by metagenomic 16S rDNA analysis. This study is the first complex analysis of estuarine microbiota based on isolation of total DNA from a biome that was further subjected to sequencing. DNA was extracted from water samples and sequenced on the Illumina Miseq platform using primers to the V4 variable region of the 16S rRNA gene. Computer analysis of the obtained raw sequences was done with QIIME (Quantitative Insights Into Microbial Ecology) software. As the outcome, 57970 nucleotide sequences were retrieved. Bioinformatic analysis of bacterial community in the studied samples demonstrated a high taxonomic diversity of Prokaryotes at above genus level. It was shown that majority of 16S rDNA bacterial sequences detected in the estuarine samples belonged to phyla Cyanobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Verrucomicrobia, Planctomycetes. The Khadhzibey estuary was dominated by the Proteobacteria phylum, while Dniester and Sukhyi estuaries were characterized by dominance of Cyanobacteria. The differences in bacterial populations between the Khadzhibey, Dniester and Sukhyi estuaries were demonstrated through the Beta-diversity analysis. It showed that the Khadzhibey estuary's microbial community significantly varies from the Sukhyi and Dniester estuaries. The majority of identified bacterial species is known as typical inhabitants of marine environments, however, for 2.5% of microbial population members in the studied estuaries no relatives were determined. PMID:26929931

  13. Bacterial Wound Culture

    Science.gov (United States)

    ... Home Visit Global Sites Search Help? Bacterial Wound Culture Share this page: Was this page helpful? Also known as: Aerobic Wound Culture; Anaerobic Wound Culture Formal name: Culture, wound Related ...

  14. Bacterial Meningitis in Infants

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2004-04-01

    Full Text Available A retrospective study of 80 infantile patients (ages 30-365 days; 47 male, 33 female with culture-proven bacterial meningitis seen over a 16 year period (1986-2001 is reported from Taiwan.

  15. Calibrating bacterial evolution

    OpenAIRE

    Ochman, Howard; Elwyn, Susannah; Moran, Nancy A

    1999-01-01

    Attempts to calibrate bacterial evolution have relied on the assumption that rates of molecular sequence divergence in bacteria are similar to those of higher eukaryotes, or to those of the few bacterial taxa for which ancestors can be reliably dated from ecological or geological evidence. Despite similarities in the substitution rates estimated for some lineages, comparisons of the relative rates of evolution at different classes of nucleotide sites indicate no basis for their universal appl...

  16. Molecular bacterial diversity and bioburden of commercial airliner cabin air

    Energy Technology Data Exchange (ETDEWEB)

    La Duc, M.T.; Stuecker, T.; Venkateswaran, K. [California Inst. of Technology, Pasadena, CA (United States). Jet Propulsion Laboratory, Biotechnology and Planetary Protection Group

    2007-11-15

    Microorganisms that exist in aircraft air systems are considered to be the primary source of microbial contamination that can lead to illness shortly after flying. More than 600 million passengers board commercial airline flights annually in the United States alone. In this study, culture-independent, biomarker-targeted bacterial enumeration and identification strategies were used to estimate total bacterial burden and diversity within the cabin air of commercial airliners. Air-impingement was used to collect samples of microorganisms from 4 flights on 2 commercial carriers. The total viable microbial population ranged from below detection limits to 4.1 x 10{sup 6} cells/m{sup 3} of air. Microbes were found to gradually accumulate from the time of passenger boarding through mid-flight. A sharp decline in bacterial abundance was then observed. Representatives of the {alpha}, {beta} and {gamma} Proteobacteria, as well as Gram-positive bacteria, were isolated in varying abundance. Airline A had large abundances of Neisseria meningitidis rRNA gene sequences and Streptococcus oralis/mitis sequences. Airline B was dominated by pseudomonas synxantha sequences as well as N. meningitidis and S. oralis/mitis. The cabin air samples housed low bacterial diversity and were typically dominated by a particular subset of bacteria, notably opportunistic pathogenic inhabitants of the human respiratory tract and oral cavity. The microbes were found largely around the ventilation ducts and gasper conduits that supply cabin air. 45 refs., 4 tabs., 3 figs.

  17. Bacterial diversity in soils around a lead and zinc mine

    Institute of Scientific and Technical Information of China (English)

    HU Qing; QI Hong-yan; ZENG Jing-hai; ZHANG Hong-xun

    2007-01-01

    Five samples of soil collected from a lead and zinc mine were used to assess the effect of combined contamination of heavy metals on soil bacterial communities using a polyphasic approach including characterization of isolates by culture method, community level catabolic profiling in BIOLOG GN microplates, and genetic community fingerprinting by denaturing gradient gel electrophoresis of 16S rDNA fragments amplified by PCR from community DNA (PCR-DGGE). The structure of the bacterial community was affected to a certain extent by heavy metals. The PCR-DGGE analysis of 16S rRNA genes showed that there were significant differences in the structure of the microbial community among the soil samples, which were related to the contamination levels. The number of bacteria and the number of denaturing gradient gel electrophoresis (DGGE) bands in the soils increased with increasing distance from the lead and zinc mine tailing, whereas the concentration of lead (Pb) and cadmium (Cd) was decreased. Heavily polluted soils could be characterized by a community that differs from those of lightly polluted soils in richness and structure of dominating bacterial populations. The clustering analysis of the DGGE profiles showed that the bacteria in all the five samples of soil belonged to three clusters. The data from the BIOLOG analysis also showed the same result. This study showed that heavy metal contamination decreased both the biomass and diversity of the bacterial community in soil.

  18. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    International Nuclear Information System (INIS)

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture

  19. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi, E-mail: shilpi@dbeb.iitd.ac.in

    2015-06-30

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture.

  20. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

    OpenAIRE

    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H

    1981-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  1. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Czech Academy of Sciences Publication Activity Database

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.

    2005-01-01

    Roč. 280, č. 47 (2005), s. 38942-38947. ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  2. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten; Dalgaard, Jacob; Lykke-Andersen, Jens; Phan, Hoa T.N.; Trevisanato, Siro; Østergaard, Laust; Larsen, Niels; Leffers, Henrik

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows is a...

  3. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S; Bibb, M J; Vijgenboom, E; Bosch, L

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  4. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA

    OpenAIRE

    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing

    2012-01-01

    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  5. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Directory of Open Access Journals (Sweden)

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  6. Magnetic and electrical properties of Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Bodnar, I. V., E-mail: chemzav@bsuir.by [Belarusian State University of Information and Radio Electronics (Belarus); Trukhanov, S. V. [National Academy of Sciences of Belarus, Scientific and Practical Materials Research Center (Belarus); Barugu, T. H. [Belarusian State University of Information and Radio Electronics (Belarus)

    2015-10-15

    The magnetic and electrical properties of the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal are studied in the temperature range 4–300 K and in magnetic fields of 0–14 T. It is established that the sample under study is paramagnetic. In the ground state, short-range-order correlations typical of a spin glass with a freezing temperature of 10 K are detected. The magnetic ordering temperature is 15 K. The sample is a semiconductor with a resistivity of 3.5 kΩ cm at room temperature. For the Fe{sub 0.9}Ag{sub 0.1}In{sub 2.3}S{sub 4.4} single crystal, a mechanism for the formation of magnetic and electrical states is suggested.

  7. The bacterial community of entomophilic nematodes and host beetles.

    Science.gov (United States)

    Koneru, Sneha L; Salinas, Heilly; Flores, Gilberto E; Hong, Ray L

    2016-05-01

    Insects form the most species-rich lineage of Eukaryotes and each is a potential host for organisms from multiple phyla, including fungi, protozoa, mites, bacteria and nematodes. In particular, beetles are known to be associated with distinct bacterial communities and entomophilic nematodes. While entomopathogenic nematodes require symbiotic bacteria to kill and reproduce inside their insect hosts, the microbial ecology that facilitates other types of nematode-insect associations is largely unknown. To illuminate detailed patterns of the tritrophic beetle-nematode-bacteria relationship, we surveyed the nematode infestation profiles of scarab beetles in the greater Los Angeles area over a five-year period and found distinct nematode infestation patterns for certain beetle hosts. Over a single season, we characterized the bacterial communities of beetles and their associated nematodes using high-throughput sequencing of the 16S rRNA gene. We found significant differences in bacterial community composition among the five prevalent beetle host species, independent of geographical origin. Anaerobes Synergistaceae and sulphate-reducing Desulfovibrionaceae were most abundant in Amblonoxia beetles, while Enterobacteriaceae and Lachnospiraceae were common in Cyclocephala beetles. Unlike entomopathogenic nematodes that carry bacterial symbionts, insect-associated nematodes do not alter the beetles' native bacterial communities, nor do their microbiomes differ according to nematode or beetle host species. The conservation of Diplogastrid nematodes associations with Melolonthinae beetles and sulphate-reducing bacteria suggests a possible link between beetle-bacterial communities and their associated nematodes. Our results establish a starting point towards understanding the dynamic interactions between soil macroinvertebrates and their microbiota in a highly accessible urban environment. PMID:26992100

  8. Bacterial community diversity in municipal waste landfill sites.

    Science.gov (United States)

    Song, Liyan; Wang, Yangqing; Tang, Wei; Lei, Yu

    2015-09-01

    Little is known about the bacterial diversity of landfills and how environmental factors impact the diversity. In this study, PCR-based 454 pyrosequencing was used to investigate the bacterial communities of ten landfill leachate samples from five landfill sites in China. A total of 137 K useable sequences from the V3-V6 regions of the 16S rRNA gene were retrieved from 205 K reads. These sequences revealed the presence of a large number of operational taxonomic units (OTUs) in the landfills (709-1599 OTUs per sample). The most predominant bacterial representatives in the landfills investigated, regardless of geographic area, included Gammaproteobacteria, Firmicutes, and Bacteroidetes. The phyla Fusobacteria and Tenericutes were also found for the first time to be predominant in the landfills. The phylum Fusobacteria predominated (51.5 and 48.8%) in two semi-arid landfills, and the phylum Tenericutes dominated (30.6%) at one humid, subtropical landfill. Further, a large number of Pseudomonas was detected in most samples, comprising the dominant group and accounting for 40.9 to 92.4% of the total abundance. Principal component analysis (PCA) and cluster analysis based on OTU abundance showed that the abundant taxa separated the bacterial community. Canonical correlation analysis (CCA) suggested that precipitation and landfilling age significantly impact on the bacterial community structure. The bacterial community function (e.g., cellulolytic bacteria, sulfate-reducing bacteria (SRB), sulfate-oxidizing bacteria, and xenobiotic organic compound (XOC)-degrading bacteria) was also diverse, but the pattern is unclear. PMID:25981996

  9. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  10. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Nicholas A Kennedy

    Full Text Available Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories.Fecal samples from two healthy volunteers (H3 and H4 and two relapsing IBD patients (I1 and I2 were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient.DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561 and 22 (IQR 9-36 ng/µL respectively (p<0.0001. Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05.This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring

  11. Distinct soil bacterial communities revealed under a diversely managed agroecosystem.

    Directory of Open Access Journals (Sweden)

    Raymon S Shange

    Full Text Available Land-use change and management practices are normally enacted to manipulate environments to improve conditions that relate to production, remediation, and accommodation. However, their effect on the soil microbial community and their subsequent influence on soil function is still difficult to quantify. Recent applications of molecular techniques to soil biology, especially the use of 16S rRNA, are helping to bridge this gap. In this study, the influence of three land-use systems within a demonstration farm were evaluated with a view to further understand how these practices may impact observed soil bacterial communities. Replicate soil samples collected from the three land-use systems (grazed pine forest, cultivated crop, and grazed pasture on a single soil type. High throughput 16S rRNA gene pyrosequencing was used to generate sequence datasets. The different land use systems showed distinction in the structure of their bacterial communities with respect to the differences detected in cluster analysis as well as diversity indices. Specific taxa, particularly Actinobacteria, Acidobacteria, and classes of Proteobacteria, showed significant shifts across the land-use strata. Families belonging to these taxa broke with notions of copio- and oligotrphy at the class level, as many of the less abundant groups of families of Actinobacteria showed a propensity for soil environments with reduced carbon/nutrient availability. Orders Actinomycetales and Solirubrobacterales showed their highest abundance in the heavily disturbed cultivated system despite the lowest soil organic carbon (SOC values across the site. Selected soil properties ([SOC], total nitrogen [TN], soil texture, phosphodiesterase [PD], alkaline phosphatase [APA], acid phosphatase [ACP] activity, and pH also differed significantly across land-use regimes, with SOM, PD, and pH showing variation consistent with shifts in community structure and composition. These results suggest that use of

  12. Microbial profiles of liquid and solid fraction associated biomaterial in buffalo rumen fed green and dry roughage diets by tagged 16S rRNA gene pyrosequencing.

    Science.gov (United States)

    Singh, K M; Jisha, T K; Reddy, Bhaskar; Parmar, Nidhi; Patel, Anand; Patel, A K; Joshi, C G

    2015-01-01

    The microbiome of buffalo rumen plays an important role in animal health and productivity. The rumen bacterial composition of both liquid and solid fraction was surveyed using pyrosequencing of the 16S rRNA gene. Sequences were analyzed using taxonomy-dependent clustering methods and revealed that the dominant ruminal bacteria shared by samples belonged to phyla Bacteroidetes, Firmicutes, Fibrobacteres and Proteobacteria. The core rumen microbiome of the rumen consisted of 10 phyla, 19 classes, 22 orders and 25 families. However, the relative abundance of these bacterial groups was markedly affected by diet composition as well as in type of biomaterial. In animals fed with a green and dry roughage diet, the cellulolytic bacteria, Ruminococcaceae, and Fibrobacteraceae was found in highest abundance in all biomaterials which reflected the need for enhanced fiber-digesting capacity in buffalo. The polysaccharide-degrading Prevotellaceae bacteria were most abundant in buffalo rumen. In taxonomic comparison of rumen bacteria, about 26 genera were differentially abundant among liquid and solid fraction of ruminal fluid. These results highlight the buffalo ruminal microbiome's ability to adapt to feed with different composition. PMID:25249226

  13. Contrasting spatial patterns and ecological attributes of soil bacterial and archaeal taxa across a landscape.

    Science.gov (United States)

    Constancias, Florentin; Saby, Nicolas P A; Terrat, Sébastien; Dequiedt, Samuel; Horrigue, Wallid; Nowak, Virginie; Guillemin, Jean-Philippe; Biju-Duval, Luc; Chemidlin Prévost-Bouré, Nicolas; Ranjard, Lionel

    2015-06-01

    Even though recent studies have clarified the influence and hierarchy of environmental filters on bacterial community structure, those constraining bacterial populations variations remain unclear. In consequence, our ability to understand to ecological attributes of soil bacteria and to predict microbial community response to environmental stress is therefore limited. Here, we characterized the bacterial community composition and the various bacterial taxonomic groups constituting the community across an agricultural landscape of 12 km(2) , by using a 215 × 215 m systematic grid representing 278 sites to precisely decipher their spatial distribution and drivers at this scale. The bacterial and Archaeal community composition was characterized by applying 16S rRNA gene pyrosequencing directly to soil DNA from samples. Geostatistics tools were used to reveal the heterogeneous distribution of bacterial composition at this scale. Soil physical parameters and land management explained a significant amount of variation, suggesting that environmental selection is the major process shaping bacterial composition. All taxa systematically displayed also a heterogeneous and particular distribution patterns. Different relative influences of soil characteristics, land use and space were observed, depending on the taxa, implying that selection and spatial processes might be differentially but not exclusively involved for each bacterial phylum. Soil pH was a major factor determining the distribution of most of the bacterial taxa and especially the most important factor explaining the spatial patterns of α-Proteobacteria and Planctomycetes. Soil texture, organic carbon content and quality were more specific to a few number of taxa (e.g., β-Proteobacteria and Chlorobi). Land management also influenced the distribution of bacterial taxa across the landscape and revealed different type of response to cropping intensity (positive, negative, neutral or hump-backed relationships

  14. Bioturbating shrimp alter the structure and diversity of bacterial communities in coastal marine sediments.

    Science.gov (United States)

    Laverock, Bonnie; Smith, Cindy J; Tait, Karen; Osborn, A Mark; Widdicombe, Steve; Gilbert, Jack A

    2010-12-01

    Bioturbation is a key process in coastal sediments, influencing microbially driven cycling of nutrients as well as the physical characteristics of the sediment. However, little is known about the distribution, diversity and function of the microbial communities that inhabit the burrows of infaunal macroorganisms. In this study, terminal-restriction fragment length polymorphism analysis was used to investigate variation in the structure of bacterial communities in sediment bioturbated by the burrowing shrimp Upogebia deltaura or Callianassa subterranea. Analyses of 229 sediment samples revealed significant differences between bacterial communities inhabiting shrimp burrows and those inhabiting ambient surface and subsurface sediments. Bacterial communities in burrows from both shrimp species were more similar to those in surface-ambient than subsurface-ambient sediment (R=0.258, P<0.001). The presence of shrimp was also associated with changes in bacterial community structure in surrounding surface sediment, when compared with sediments uninhabited by shrimp. Bacterial community structure varied with burrow depth, and also between individual burrows, suggesting that the shrimp's burrow construction, irrigation and maintenance behaviour affect the distribution of bacteria within shrimp burrows. Subsequent sequence analysis of bacterial 16S rRNA genes from surface sediments revealed differences in the relative abundance of bacterial taxa between shrimp-inhabited and uninhabited sediments; shrimp-inhabited sediment contained a higher proportion of proteobacterial sequences, including in particular a twofold increase in Gammaproteobacteria. Chao1 and ACE diversity estimates showed that taxon richness within surface bacterial communities in shrimp-inhabited sediment was at least threefold higher than that in uninhabited sediment. This study shows that bioturbation can result in significant structural and compositional changes in sediment bacterial communities, increasing

  15. Chronic N-amended soils exhibit an altered bacterial community structure in Harvard Forest, MA, USA.

    Science.gov (United States)

    Turlapati, Swathi A; Minocha, Rakesh; Bhiravarasa, Premsai S; Tisa, Louis S; Thomas, William K; Minocha, Subhash C

    2013-02-01

    At the Harvard Forest, Petersham, MA, the impact of 20 years of annual ammonium nitrate application to the mixed hardwood stand on soil bacterial communities was studied using 16S rRNA genes pyrosequencing. Amplification of 16S rRNA genes was done using DNA extracted from 30 soil samples (three treatments × two horizons × five subplots) collected from untreated (control), low N-amended (50 kg ha(-1) year(-1)) and high N-amended (150 kg ha(-1) year(-1)) plots. A total of 1.3 million sequences were processed using qiime. Although Acidobacteria represented the most abundant phylum based on the number of sequences, Proteobacteria were the most diverse in terms of operational taxonomic units (OTUs). UniFrac analyses revealed that the bacterial communities differed significantly among soil horizons and treatments. Microsite variability among the five subplots was also evident. Nonmetric multidimensional scaling ordination of normalized OTU data followed by permutational manova further confirmed these observations. Richness indicators and indicator species analyses revealed higher bacterial diversity associated with N amendment. Differences in bacterial diversity and community composition associated with the N treatments were also observed at lower phylogenetic levels. Only 28-35% of the 6 936 total OTUs identified were common to three treatments, while the rest were specific to one treatment or common to two. PMID:22974374

  16. Evolution of bacterial consortia in spontaneously started rye sourdoughs during two months of daily propagation.

    Directory of Open Access Journals (Sweden)

    Marianna Bessmeltseva

    Full Text Available The evolution of bacterial consortia was studied in six semi-solid rye sourdoughs during long-term backslopping at different temperatures. Each rye sourdough was started spontaneously in a laboratory (dough yield 200, propagated at either 20°C or 30°C, and renewed daily at an inoculation rate of 1∶10 for 56 days. The changes in bacterial diversity over time were followed by both DGGE coupled with partial 16S rRNA gene sequencing and pyrosequencing of bar-coded 16S rRNA gene amplicons. Four species from the genus Lactobacillus (brevis, crustorum, plantarum, and paralimentarius were detected in different combinations in all sourdoughs after 56 propagation cycles. Facultative heterofermentative lactic acid bacteria dominated in sourdoughs fermented at 30°C, while both obligate and facultative heterofermentative LAB were found to dominate in sourdoughs fermented at 20°C. After 56 propagation cycles, Kazachstania unispora (formerly Saccharomyces unisporus was identified as the only yeast species that dominated in sourdoughs fermented at 20°C, while different combinations of strains from four yeast species (Kazachstania unispora, Saccharomyces cerevisiae, Candida krusei and Candida glabrata were detected in sourdoughs propagated at 30°C. The evolution of bacterial communities in sourdoughs fermented at the same temperature did not follow the same time course and changes in the composition of dominant and subdominant bacterial communities occurred even after six weeks of backslopping.

  17. Spatial Distribution of Bacterial Communities Driven by Multiple Environmental Factors in a Beach Wetland of the Largest Freshwater Lake in China

    Directory of Open Access Journals (Sweden)

    Xia eDing

    2015-02-01

    Full Text Available The spatial distributions of bacterial communities may be driven by multiple environmental factors. Thus, understanding the relationships between bacterial distribution and environmental factors is critical for understanding wetland stability and the functioning of freshwater lakes. However, little research on the bacterial communities in deep sediment layers exists. In this study, thirty clone libraries of 16S rRNA were constructed from a beach wetland of the Poyang Lake along both horizontal (distance to the water-land junction and vertical (sediment depth gradients to assess the effects of sediment properties on bacterial community structure and diversity. Our results showed that bacterial diversity increased along the horizontal gradient and decreased along the vertical gradient. The heterogeneous sediment properties along gradients substantially affected the dominant bacterial groups at the phylum and species levels. For example, the NH4+ concentration decreased with increasing depth, which was positively correlated with the relative abundance of Alphaproteobacteria. The changes in bacterial diversity and dominant bacterial groups showed that the top layer had a different bacterial community structure than the deeper layers. Principal component analysis revealed that both gradients, not each gradient independently, contributed to the shift in the bacterial community structure. A multiple linear regression model explained the changes in bacterial diversity and richness along the depth and distance gradients. Overall, our results suggest that spatial gradients associated with sediment properties shaped the bacterial communities in the Poyang Lake beach wetland.

  18. Analysis of bacterial and fungal communities in Japanese- and Chinese-fermented soybean pastes using nested PCR-DGGE.

    Science.gov (United States)

    Kim, Tae Woon; Lee, Jun-Hwa; Park, Min-Hee; Kim, Hae-Yeong

    2010-05-01

    The microbial diversity of Japanese- and Chinese-fermented soybean pastes was investigated using nested PCR-denaturing gradient gel electrophoresis (DGGE). Five Japanese-fermented soybean paste samples and three Chinese-fermented soybean paste samples were analyzed for bacteria and fungi. Extracted DNA was used as a template for PCR to amplify 16S rRNA and 18S rRNA genes. The nearly complete 16S rRNA and 18S rRNA genes were amplified using universal primers, and the resulting products were subsequently used as a template in a nested PCR to obtain suitable fragments for DGGE. Tetragenococcus halophilus and Staphylococcus gallinarum were found to dominate the bacterial microbiota in Japanese samples, whereas Bacillus sp. was detected as the predominant species in Chinese samples. DGGE analysis of fungi in soybean pastes determined the presence of Aspergillus oryzae and Zygosaccharomyces rouxii in most of the Chinese and Japanese samples. Some differences were observed in the bacterial diversity of Japanese- and Chinese-fermented soybean pastes. PMID:19924476

  19. Bacterial meningitis in children

    International Nuclear Information System (INIS)

    To demonstrate the epidemiology, clinical manifestations and bacteriological profile of bacterial meningitis in children beyond the neonatal period in our hospital. This was a retrospective descriptive study conducted at Prince Rashid Hospital in Irbid, Jordan. The medical records of 50 children with the diagnosis of bacterial meningitis during 4 years period, were reviewed. The main cause of infection was streptococcus pneumoniae, followed by Haemophilus influenza and Niesseria meningitides. Mortality was higher in infants and meningococcal infection, while complications were more encountered in cases of streptococcus pneumoniae. Cerebrospinal fluid culture was positive in 11 cases and Latex agglutination test in 39. There is a significant reduction of the numbers of bacterial meningitis caused by Haemophilus influenza type B species. (author)

  20. Dynamic bacterial communities on reverse-osmosis membranes in a full-scale desalination plant.

    Science.gov (United States)

    Manes, C-L de O; West, N; Rapenne, S; Lebaron, P

    2011-01-01

    To better understand biofouling of seawater reverse osmosis (SWRO) membranes, bacterial diversity was characterized in the intake water, in subsequently pretreated water and on SWRO membranes from a full-scale desalination plant (FSDP) during a 9 month period. 16S rRNA gene fingerprinting and sequencing revealed that bacterial communities in the water samples and on the SWRO membranes were very different. For the different sampling dates, the bacterial diversity of the active and the total bacterial fractions of the water samples remained relatively stable over the sampling period whereas the bacterial community structure on the four SWRO membrane samples was significantly different. The richness and evenness of the SWRO membrane bacterial communities increased with usage time with an increase in the Shannon diversity index of 2.2 to 3.7. In the oldest SWRO membrane (330 days), no single operational taxonomic unit (OTU) dominated and the majority of the OTUs fell into the Alphaproteobacteria or the Planctomycetes. In striking contrast, a Betaproteobacteria OTU affiliated to the genus Ideonella was dominant and exclusively found in the membrane used for the shortest time (10 days). This suggests that bacteria belonging to this genus could be one of the primary colonizers of the SWRO membrane. Knowledge of the dominant bacterial species on SWRO membranes and their dynamics should help guide culture studies for physiological characterization of biofilm forming species. PMID:21108068

  1. Regulation of bacterial communities through antimicrobial activity by the coral holobiont.

    Science.gov (United States)

    Kvennefors, E Charlotte E; Sampayo, Eugenia; Kerr, Caroline; Vieira, Genyess; Roff, George; Barnes, Andrew C

    2012-04-01

    Interactions between corals and associated bacteria and amongst these bacterial groups are likely to play a key role in coral health. However, the complexity of these interactions is poorly understood. We investigated the functional role of specific coral-associated bacteria in maintaining microbial communities on the coral Acropora millepora (Ehrenberg 1834) and the ability of coral mucus to support or inhibit bacterial growth. Culture-independent techniques were used to assess bacterial community structures whilst bacterial culture was employed to assess intra- and inter-specific antimicrobial activities of bacteria. Members of Pseudoalteromonas and ribotypes closely related to Vibrio coralliilyticus displayed potent antimicrobial activity against a range of other cultured isolates and grew readily on detached coral mucus. Although such bacterial ribotypes would be expected to have a competitive advantage, they were rare or absent on intact and healthy coral colonies growing in situ (analysed using denaturing gradient gel electrophoresis and 16S rRNA gene sequencing). The most abundant bacterial ribotypes found on healthy corals were Gammaproteobacteria, previously defined as type A coral associates. Our results indicate that this group of bacteria and specific members of the Alphaproteobacteria described here as 'type B associates' may be important functional groups for coral health. We suggest that bacterial communities on coral are kept in check by a combination of host-derived and microbial interactions and that the type A associates in particular may play a key role in maintaining stability of microbial communities on healthy coral colonies. PMID:21984347

  2. Bacterial dynamics within the mucus, tissue and skeleton of the coral Porites lutea during different seasons

    Science.gov (United States)

    Li, Jie; Chen, Qi; Long, Li-Juan; Dong, Jun-De; Yang, Jian; Zhang, Si

    2014-12-01

    Investigation of the response of coral microbial communities to seasonal ecological environment at the microscale will advance our understanding of the relationship between coral-associated bacteria community and coral health. In this study, we examined bacteria community composition from mucus, tissue and skeleton of Porites lutea and surrounding seawater every three months for 1 year on Luhuitou fringing reef. The bacterial communities were analyzed using pyrosequencing of the V1-V2 region of the 16S rRNA gene, which demonstrated diverse bacterial consortium profiles in corals. The bacterial communities in all three coral compartments studied were significantly different from the surrounding seawater. Moreover, they had a much more dynamic seasonal response compared to the seawater communities. The bacterial communities in all three coral compartments collected in each seasonal sample tended to cluster together. Analysis of the relationship between bacterial assemblages and the environmental parameters showed that the bacterial community correlated to dissolved oxygen and rainfall significantly at our study site. This study highlights a dynamic relationship between the high complexity of coral associated bacterial community and seasonally varying ecosystem parameters.

  3. Co-occurrence patterns in aquatic bacterial communities across changing permafrost landscapes

    Directory of Open Access Journals (Sweden)

    J. Comte

    2015-07-01

    Full Text Available Permafrost thaw ponds and lakes are widespread across the northern landscape and may play a central role in global biogeochemical cycles, yet knowledge about their microbial ecology is limited. We sampled a set of thaw ponds and lakes as well as shallow rock-basin lakes that are located in distinct valleys along a North–South permafrost degradation gradient. We applied high-throughput sequencing of the 16S rRNA gene to determine co-occurrence patterns among bacterial taxa, and then analyzed these results relative to environmental variables to identify factors controlling bacterial community structure. Network analysis was applied to identify possible ecological linkages among the bacterial taxa and with abiotic and biotic variables. The results showed an overall high level of shared taxa among bacterial communities within each valley, however the bacterial co-occurrence patterns were non-random, with evidence of habitat preferences. There were taxonomic differences in bacterial assemblages among the different valleys that were statistically related to dissolved organic carbon concentration, conductivity and phytoplankton biomass. Co-occurrence networks revealed complex interdependencies within the bacterioplankton communities and showed contrasting linkages to environmental conditions among the main bacterial phyla. The thaw pond networks were composed of a limited number of highly connected taxa. This "small world network" property would render the communities more robust to environmental change but vulnerable to the loss of microbial keystone species.

  4. Bacterial communities in Malagasy soils with differing levels of disturbance affecting botanical diversity.

    Science.gov (United States)

    Blasiak, Leah C; Schmidt, Alex W; Andriamiarinoro, Honoré; Mulaw, Temesgen; Rasolomampianina, Rado; Applequist, Wendy L; Birkinshaw, Chris; Rejo-Fienena, Félicitée; Lowry, Porter P; Schmidt, Thomas M; Hill, Russell T

    2014-01-01

    Madagascar is well-known for the exceptional biodiversity of its macro-flora and fauna, but the biodiversity of Malagasy microbial communities remains relatively unexplored. Understanding patterns of bacterial diversity in soil and their correlations with above-ground botanical diversity could influence conservation planning as well as sampling strategies to maximize access to bacterially derived natural products. We present the first detailed description of Malagasy soil bacterial communities from a targeted 16S rRNA gene survey of greater than 290,000 sequences generated using 454 pyrosequencing. Two sampling plots in each of three forest conservation areas were established to represent different levels of disturbance resulting from human impact through agriculture and selective exploitation of trees, as well as from natural impacts of cyclones. In parallel, we performed an in-depth characterization of the total vascular plant morphospecies richness within each plot. The plots representing different levels of disturbance within each forest did not differ significantly in bacterial diversity or richness. Changes in bacterial community composition were largest between forests rather than between different levels of impact within a forest. The largest difference in bacterial community composition with disturbance was observed at the Vohibe forest conservation area, and this difference was correlated with changes in both vascular plant richness and soil pH. These results provide the first survey of Malagasy soil bacterial diversity and establish a baseline of botanical diversity within important conservation areas. PMID:24465484

  5. Bacterial communities in Malagasy soils with differing levels of disturbance affecting botanical diversity.

    Directory of Open Access Journals (Sweden)

    Leah C Blasiak

    Full Text Available Madagascar is well-known for the exceptional biodiversity of its macro-flora and fauna, but the biodiversity of Malagasy microbial communities remains relatively unexplored. Understanding patterns of bacterial diversity in soil and their correlations with above-ground botanical diversity could influence conservation planning as well as sampling strategies to maximize access to bacterially derived natural products. We present the first detailed description of Malagasy soil bacterial communities from a targeted 16S rRNA gene survey of greater than 290,000 sequences generated using 454 pyrosequencing. Two sampling plots in each of three forest conservation areas were established to represent different levels of disturbance resulting from human impact through agriculture and selective exploitation of trees, as well as from natural impacts of cyclones. In parallel, we performed an in-depth characterization of the total vascular plant morphospecies richness within each plot. The plots representing different levels of disturbance within each forest did not differ significantly in bacterial diversity or richness. Changes in bacterial community composition were largest between forests rather than between different levels of impact within a forest. The largest difference in bacterial community composition with disturbance was observed at the Vohibe forest conservation area, and this difference was correlated with changes in both vascular plant richness and soil pH. These results provide the first survey of Malagasy soil bacterial diversity and establish a baseline of botanical diversity within important conservation areas.

  6. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA.

    Science.gov (United States)

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T

    2016-07-15

    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps. PMID:27016627

  7. Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

    Science.gov (United States)

    Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

    2016-09-01

    Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing. PMID:27338271

  8. Diagnosis of bacterial vaginosis

    Directory of Open Access Journals (Sweden)

    Đukić Slobodanka

    2013-01-01

    Full Text Available Bacterial vaginosis is a common, complex clinical syndrome characterized by alterations in the normal vaginal flora. When symptomatic, it is associated with a malodorous vaginal discharge and on occasion vaginal burning or itching. Under normal conditions, lactobacilli constitute 95% of the bacteria in the vagina. Bacterial vaginosis is associated with severe reduction or absence of the normal H2O2­producing lactobacilli and overgrowth of anaerobic bacteria and Gardnerella vaginalis, Atopobium vaginae, Mycoplasma hominis and Mobiluncus species. Most types of infectious disease are diagnosed by culture, by isolating an antigen or RNA/DNA from the microbe, or by serodiagnosis to determine the presence of antibodies to the microbe. Therefore, demonstration of the presence of an infectious agent is often a necessary criterion for the diagnosis of the disease. This is not the case for bacterial vaginosis, since the ultimate cause of the disease is not yet known. There are a variety of methods for the diagnosis of bacterial vaginosis but no method can at present be regarded as the best. Diagnosing bacterial vaginosis has long been based on the clinical criteria of Amsel, whereby three of four defined criteria must be satisfied. Nugent’s scoring system has been further developed and includes validation of the categories of observable bacteria structures. Up­to­date molecular tests are introduced, and better understanding of vaginal microbiome, a clear definition for bacterial vaginosis, and short­term and long­term fluctuations in vaginal microflora will help to better define molecular tests within the broader clinical context.

  9. Bacterial community development in experimental gingivitis.

    Science.gov (United States)

    Kistler, James O; Booth, Veronica; Bradshaw, David J; Wade, William G

    2013-01-01

    Current knowledge of the microbial composition of dental plaque in early gingivitis is based largely on microscopy and cultural methods, which do not provide a comprehensive description of oral microbial communities. This study used 454-pyrosequencing of the V1-V3 region of 16S rRNA genes (approximately 500 bp), and bacterial culture, to characterize the composition of plaque during the transition from periodontal health to gingivitis. A total of 20 healthy volunteers abstained from oral hygiene for two weeks, allowing plaque to accumulate and gingivitis to develop. Plaque samples were analyzed at baseline, and after one and two weeks. In addition, plaque samples from 20 chronic periodontitis patients were analyzed for cross-sectional comparison to the experimental gingivitis cohort. All of the healthy volunteers developed gingivitis after two weeks. Pyrosequencing yielded a final total of 344,267 sequences after filtering, with a mean length of 354 bases, that were clustered into an average of 299 species-level Operational Taxonomic Units (OTUs) per sample. Principal coordinates analysis (PCoA) plots revealed significant shifts in the bacterial community structure of plaque as gingivitis was induced, and community diversity increased significantly after two weeks. Changes in the relative abundance of OTUs during the transition from health to gingivitis were correlated to bleeding on probing (BoP) scores and resulted in the identification of new health- and gingivitis-associated taxa. Comparison of the healthy volunteers to the periodontitis patients also confirmed the association of a number of putative periodontal pathogens with chronic periodontitis. Taxa associated with gingivitis included Fusobacterium nucleatum subsp. polymorphum, Lachnospiraceae [G-2] sp. HOT100, Lautropia sp. HOTA94, and Prevotella oulorum, whilst Rothia dentocariosa was associated with periodontal health. Further study of these taxa is warranted and may lead to new therapeutic approaches

  10. Bacterial community development in experimental gingivitis.

    Directory of Open Access Journals (Sweden)

    James O Kistler

    Full Text Available Current knowledge of the microbial composition of dental plaque in early gingivitis is based largely on microscopy and cultural methods, which do not provide a comprehensive description of oral microbial communities. This study used 454-pyrosequencing of the V1-V3 region of 16S rRNA genes (approximately 500 bp, and bacterial culture, to characterize the composition of plaque during the transition from periodontal health to gingivitis. A total of 20 healthy volunteers abstained from oral hygiene for two weeks, allowing plaque to accumulate and gingivitis to develop. Plaque samples were analyzed at baseline, and after one and two weeks. In addition, plaque samples from 20 chronic periodontitis patients were analyzed for cross-sectional comparison to the experimental gingivitis cohort. All of the healthy volunteers developed gingivitis after two weeks. Pyrosequencing yielded a final total of 344,267 sequences after filtering, with a mean length of 354 bases, that were clustered into an average of 299 species-level Operational Taxonomic Units (OTUs per sample. Principal coordinates analysis (PCoA plots revealed significant shifts in the bacterial community structure of plaque as gingivitis was induced, and community diversity increased significantly after two weeks. Changes in the relative abundance of OTUs during the transition from health to gingivitis were correlated to bleeding on probing (BoP scores and resulted in the identification of new health- and gingivitis-associated taxa. Comparison of the healthy volunteers to the periodontitis patients also confirmed the association of a number of putative periodontal pathogens with chronic periodontitis. Taxa associated with gingivitis included Fusobacterium nucleatum subsp. polymorphum, Lachnospiraceae [G-2] sp. HOT100, Lautropia sp. HOTA94, and Prevotella oulorum, whilst Rothia dentocariosa was associated with periodontal health. Further study of these taxa is warranted and may lead to new

  11. Isolation and Characterization of Lactococcus garvieae from Diseased Rainbow Trout (Oncorhynchus mykiss, Walbaum Cultured in Northern Iran Based on the Nucleotide Sequences of the 16s rRNA Gene

    Directory of Open Access Journals (Sweden)

    Milad ADEL

    2014-08-01

    Full Text Available This study was done to determine the molecular and biochemical identification of some causative agents of lactococcosis in farmed rainbow trout in Mazandaran provenience (northern Iran. A total of 200 moribund rainbow trout, suspected of lactococcosis from 10 rainbow trout farms in Mazandaran province, were collected during spring 2012 to winter 2012. Sampling was done from the kidney, spleen, liver and brain and cultured aseptically onto brain heart infusion (BHI agar plates and incubated at 25 °C for 24 - 48 h. Results of bacteriological cultures of these organs showed 19 % Lactococcus garvieae (38 fish, 9 % Streptococcus spp., (18 fish, 17 % Yersinia spp. (36 fish, and 55 % of fish were culture negative. The PCR assay was developed based on the 16s rRNA gene of L. garvieae for the rapid and specific detection and identification of this pathogen from different sources. Two pairs of primers were designed based on the nucleotide sequences of the 16s rRNA gene of L. garvieae. After PCR assay on isolated bacterial colonies, DNAs extracted from 38 L. garvieae gave the expected 1107 bp PCR fragment of 16S rDNA sequences, which is specific for L. garvieae. The results of this study suggest the use of molecular methods along with current biochemical methods are effective diagnostic tools in the identification of L. garvieae. The combination of these methods for diagnosis of other bacterial disease is recommended.

  12. Interfering with bacterial gossip

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Tolker-Nielsen, Tim; Givskov, Michael

    2011-01-01

    defense. Antibiotics exhibit a rather limited effect on biofilms. Furthermore, antibiotics have an ‘inherent obsolescence’ because they select for development of resistance. Bacterial infections with origin in bacterial biofilms have become a serious threat in developed countries. Pseudomonas aeruginosa......, resistance and QS inhibition as future antimicrobial targets, in particular those that would work to minimize selection pressures for the development of resistant bacteria.......Biofilm resilience poses major challenges to the development of novel antimicrobial agents. Biofilm bacteria can be considered small groups of “Special Forces” capable of infiltrating the host and destroying important components of the cellular defense system with the aim of crippling the host...

  13. Diversity rankings among bacterial lineages in soil.

    Science.gov (United States)

    Youssef, Noha H; Elshahed, Mostafa S

    2009-03-01

    We used rarefaction curve analysis and diversity ordering-based approaches to rank the 11 most frequently encountered bacterial lineages in soil according to diversity in 5 previously reported 16S rRNA gene clone libraries derived from agricultural, undisturbed tall grass prairie and forest soils (n=26,140, 28 328, 31 818, 13 001 and 53 533). The Planctomycetes, Firmicutes and the delta-Proteobacteria were consistently ranked among the most diverse lineages in all data sets, whereas the Verrucomicrobia, Gemmatimonadetes and beta-Proteobacteria were consistently ranked among the least diverse. On the other hand, the rankings of alpha-Proteobacteria, Acidobacteria, Actinobacteria, Bacteroidetes and Chloroflexi varied widely in different soil clone libraries. In general, lineages exhibiting largest differences in diversity rankings also exhibited the largest difference in relative abundance in the data sets examined. Within these lineages, a positive correlation between relative abundance and diversity was observed within the Acidobacteria, Actinobacteria and Chloroflexi, and a negative diversity-abundance correlation was observed within the Bacteroidetes. The ecological and evolutionary implications of these results are discussed. PMID:18987677

  14. Long term repeated fire disturbance alters soil bacterial diversity but not the abundance in an Australian wet sclerophyll forest

    Science.gov (United States)

    Shen, Ju-Pei; Chen, C. R.; Lewis, Tom

    2016-01-01

    Effects of fire on biogeochemical cycling in terrestrial ecosystem are widely acknowledged, while few studies have focused on the bacterial community under the disturbance of long-term frequent prescribed fire. In this study, three treatments (burning every two years (B2), burning every four years (B4) and no burning (B0)) were applied for 38 years in an Australian wet sclerophyll forest. Results showed that bacterial alpha diversity (i.e. bacterial OTU) in the top soil (0-10 cm) was significantly higher in the B2 treatment compared with the B0 and B4 treatments. Non-metric multidimensional analysis (NMDS) of bacterial community showed clear separation of the soil bacterial community structure among different fire frequency regimes and between the depths. Different frequency fire did not have a substantial effect on bacterial composition at phylum level or bacterial 16S rRNA gene abundance. Soil pH and C:N ratio were the major drivers for bacterial community structure in the most frequent fire treatment (B2), while other factors (EC, DOC, DON, MBC, NH4+, TC and TN) were significant in the less frequent burning and no burning treatments (B4 and B0). This study suggested that burning had a dramatic impact on bacterial diversity but not abundance with more frequent fire.

  15. Long term repeated fire disturbance alters soil bacterial diversity but not the abundance in an Australian wet sclerophyll forest.

    Science.gov (United States)

    Shen, Ju-pei; Chen, C R; Lewis, Tom

    2016-01-01

    Effects of fire on biogeochemical cycling in terrestrial ecosystem are widely acknowledged, while few studies have focused on the bacterial community under the disturbance of long-term frequent prescribed fire. In this study, three treatments (burning every two years (B2), burning every four years (B4) and no burning (B0)) were applied for 38 years in an Australian wet sclerophyll forest. Results showed that bacterial alpha diversity (i.e. bacterial OTU) in the top soil (0-10 cm) was significantly higher in the B2 treatment compared with the B0 and B4 treatments. Non-metric multidimensional analysis (NMDS) of bacterial community showed clear separation of the soil bacterial community structure among different fire frequency regimes and between the depths. Different frequency fire did not have a substantial effect on bacterial composition at phylum level or bacterial 16S rRNA gene abundance. Soil pH and C:N ratio were the major drivers for bacterial community structure in the most frequent fire treatment (B2), while other factors (EC, DOC, DON, MBC, NH4(+), TC and TN) were significant in the less frequent burning and no burning treatments (B4 and B0). This study suggested that burning had a dramatic impact on bacterial diversity but not abundance with more frequent fire. PMID:26787458

  16. Bacterial Growth Physiology

    DEFF Research Database (Denmark)

    Kongstad, Mette

    the induction of amino acid starvation. Indeed, the RNA chaperone Hfq is known to facilitate a pairing of small RNA (sRNA) with their target mRNA, affecting gene expression. Thus, our attention was drawn towards sRNA and other regulatory RNAs. The tRNA-linked-repeats (TLR) acting as regulatory RNA...... (regRNA) in collaboration with Hfq seemed to be good candidates for starvation-induced down regulation of tRNA. This is because TLRs are small intergenic repeats located in operons of tRNA and rRNA that share 18-19 nt of homology with the RNA they are located next to with yet an unknown function. It...... turned out that the TLRs were not involved in starvation-induced down regulation of tRNA. As such, my project was subdivided into the following segments:...

  17. Anterior foregut microbiota of the glassy-winged sharpshooter explored using deep 16S rRNA gene sequencing from individual insects.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available The glassy-winged sharpshooter (GWSS is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony, were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas. Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the

  18. Anterior foregut microbiota of the glassy-winged sharpshooter explored using deep 16S rRNA gene sequencing from individual insects.

    Science.gov (United States)

    Rogers, Elizabeth E; Backus, Elaine A

    2014-01-01

    The glassy-winged sharpshooter (GWSS) is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium) of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony), were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia) and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas). Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the cibarium and

  19. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water.

    Science.gov (United States)

    Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S

    2015-10-01

    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. PMID:26231650

  20. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Science.gov (United States)

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  1. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  2. Polyphasic Approach to Bacterial Dynamics during the Ripening of Spanish Farmhouse Cheese, Using Culture-Dependent and -Independent Methods▿

    OpenAIRE

    Martín-Platero, Antonio M.; Valdivia, Eva; Maqueda, Mercedes; Martín-Sánchez, Inés; Martínez-Bueno, Manuel

    2008-01-01

    We studied the dynamics of the microbial population during ripening of Cueva de la Magahá cheese using a combination of classical and molecular techniques. Samples taken during ripening of this Spanish goat's milk cheese in which Lactococcus lactis and Streptococcus thermophilus were used as starter cultures were analyzed. All bacterial isolates were clustered by using randomly amplified polymorphic DNA (RAPD) and identified by 16S rRNA gene sequencing, species-specific PCR, and multiplex PCR...

  3. Influence of the Biliary System on Biliary Bacteria Revealed by Bacterial Communities of the Human Biliary and Upper Digestive Tracts

    OpenAIRE

    Ye, Fuqiang; Shen, Hongzhang; Li, Zhen; Meng, Fei; Li, Lei; Yang, Jianfeng; Chen, Ying; Bo, Xiaochen; Zhang, Xiaofeng; Ni, Ming

    2016-01-01

    Biliary bacteria have been implicated in gallstone pathogenesis, though a clear understanding of their composition and source is lacking. Moreover, the effects of the biliary environment, which is known to be generally hostile to most bacteria, on biliary bacteria are unclear. Here, we investigated the bacterial communities of the biliary tract, duodenum, stomach, and oral cavity from six gallstone patients by using 16S rRNA amplicon sequencing. We found that all observed biliary bacteria wer...

  4. Abundance of Broad Bacterial Taxa in the Sargasso Sea Explained by Environmental Conditions but Not Water Mass

    OpenAIRE

    Sjöstedt, Johanna; Martiny, Jennifer B. H.; Munk, Peter; Riemann, Lasse

    2014-01-01

    To explore the potential linkage between distribution of marine bacterioplankton groups, environmental conditions, and water mass, we investigated the factors determining the abundance of bacterial taxa across the hydrographically complex Subtropical Convergence Zone in the Sargasso Sea. Based on information from 16S rRNA gene clone libraries from various locations and two depths, abundances of the predominant taxa (eubacteria, Archaea, Alphaproteobacteria, Gammaproteobacteria, Bacteroidetes,...

  5. Bacterial profiling of White Plague Disease across corals and oceans indicates a conserved and distinct disease microbiome

    OpenAIRE

    Roder, Cornelia; Arif, Chatchanit; Daniels, Camille; Weil, Ernesto; Voolstra, Christian R.

    2014-01-01

    Coral diseases are characterized by microbial community shifts in coral mucus and tissue, but causes and consequences of these changes are vaguely understood due to the complexity and dynamics of coral-associated bacteria. We used 16S rRNA gene microarrays to assay differences in bacterial assemblages of healthy and diseased colonies displaying White Plague Disease (WPD) signs from two closely related Caribbean coral species, Orbicella faveolata and Orbicella franksi. Analysis of differential...

  6. Phyllosphere Bacterial Community of Floating Macrophytes in Paddy Soil Environments as Revealed by Illumina High-Throughput Sequencing

    OpenAIRE

    Xie, Wan-Ying; Su, Jian-Qiang; Zhu, Yong-Guan

    2014-01-01

    The phyllosphere of floating macrophytes in paddy soil ecosystems, a unique habitat, may support large microbial communities but remains largely unknown. We took Wolffia australiana as a representative floating plant and investigated its phyllosphere bacterial community and the underlying driving forces of community modulation in paddy soil ecosystems using Illumina HiSeq 2000 platform-based 16S rRNA gene sequence analysis. The results showed that the phyllosphere of W. australiana harbored c...

  7. Co-occurrence patterns for abundant marine archaeal and bacterial lineages in the deep chlorophyll maximum of coastal California

    OpenAIRE

    Beman, J. Michael; Steele, Joshua A; Fuhrman, Jed A.

    2011-01-01

    Microorganisms remineralize and respire half of marine primary production, yet the niches occupied by specific microbial groups, and how these different groups may interact, are poorly understood. In this study, we identify co-occurrence patterns for marine Archaea and specific bacterial groups in the chlorophyll maximum of the Southern California Bight. Quantitative PCR time series of marine group 1 (MG1) Crenarchaeota 16S rRNA genes varied substantially over time but were well-correlated (r...

  8. Linkage between bacterial and fungal rhizosphere communities in hydrocarbon-contaminated soils is related to plant phylogeny

    OpenAIRE

    Bell, Terrence H.; El-Din Hassan, Saad; Lauron-Moreau, Aurélien; Al-Otaibi, Fahad; Hijri, Mohamed; Yergeau, Etienne; St-Arnaud, Marc

    2013-01-01

    Phytoremediation is an attractive alternative to excavating and chemically treating contaminated soils. Certain plants can directly bioremediate by sequestering and/or transforming pollutants, but plants may also enhance bioremediation by promoting contaminant-degrading microorganisms in soils. In this study, we used high-throughput sequencing of bacterial 16S rRNA genes and the fungal internal transcribed spacer (ITS) region to compare the community composition of 66 soil samples from the rh...

  9. Initial community and environment determine the response of bacterial communities to dispersant and oil contamination.

    Science.gov (United States)

    Ortmann, Alice C; Lu, YueHan

    2015-01-15

    Bioremediation of seawater by natural bacterial communities is one potential response to coastal oil spills, but the success of the approach may vary, depending on geographical location, oil composition and the timing of spill. The short term response of coastal bacteria to dispersant, oil and dispersed oil was characterized using 16S rRNA gene tags in two mesocosm experiments conducted two months apart. Despite differences in the amount of oil-derived alkanes across the treatments and experiments, increases in the contributions of hydrocarbon degrading taxa and decreases in common estuarine bacteria were observed in response to dispersant and/or oil. Between the two experiments, the direction and rates of changes in particulate alkane concentrations differed, as did the magnitude of the bacterial response to oil and/or dispersant. Together, our data underscore large variability in bacterial responses to hydrocarbon pollutants, implying that bioremediation success varies with starting biological and environmental conditions. PMID:25487088

  10. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.

    OpenAIRE

    Escalante, A A; Ayala, F. J.

    1994-01-01

    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  11. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    OpenAIRE

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.

    2007-01-01

    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  12. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    OpenAIRE

    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  13. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    OpenAIRE

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this...

  14. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta

    OpenAIRE

    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.

    1996-01-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  15. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    OpenAIRE

    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun

    2015-01-01

    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  16. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  17. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  18. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Science.gov (United States)

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  19. Bacterial extracellular lignin peroxidase

    Science.gov (United States)

    Crawford, Donald L.; Ramachandra, Muralidhara

    1993-01-01

    A newly discovered lignin peroxidase enzyme is provided. The enzyme is obtained from a bacterial source and is capable of degrading the lignin portion of lignocellulose in the presence of hydrogen peroxide. The enzyme is extracellular, oxidative, inducible by lignin, larch wood xylan, or related substrates and capable of attacking certain lignin substructure chemical bonds that are not degradable by fungal lignin peroxidases.

  20. Bacterial Skin Infections

    Science.gov (United States)

    ... or scraped, the injury should be washed with soap and water and covered with a sterile bandage. Petrolatum may be applied to open areas to keep the tissue moist and to try to prevent bacterial invasion. Doctors recommend that people do not use ...

  1. Bacterial microflora of nectarines

    Science.gov (United States)

    Microflora of fruit surfaces has been the best source of antagonists against fungi causing postharvest decays of fruit. However, there is little information on microflora colonizing surfaces of fruits other than grapes, apples, and citrus fruit. We characterized bacterial microflora on nectarine f...

  2. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Directory of Open Access Journals (Sweden)

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  3. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    Science.gov (United States)

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  4. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    Science.gov (United States)

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  5. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  6. Panamanian frog species host unique skin bacterial communities.

    Science.gov (United States)

    Belden, Lisa K; Hughey, Myra C; Rebollar, Eria A; Umile, Thomas P; Loftus, Stephen C; Burzynski, Elizabeth A; Minbiole, Kevin P C; House, Leanna L; Jensen, Roderick V; Becker, Matthew H; Walke, Jenifer B; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N

    2015-01-01

    Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont

  7. Patterned progression of bacterial populations in the premature infant gut.

    Science.gov (United States)

    La Rosa, Patricio S; Warner, Barbara B; Zhou, Yanjiao; Weinstock, George M; Sodergren, Erica; Hall-Moore, Carla M; Stevens, Harold J; Bennett, William E; Shaikh, Nurmohammad; Linneman, Laura A; Hoffmann, Julie A; Hamvas, Aaron; Deych, Elena; Shands, Berkley A; Shannon, William D; Tarr, Phillip I

    2014-08-26

    In the weeks after birth, the gut acquires a nascent microbiome, and starts its transition to bacterial population equilibrium. This early-in-life microbial population quite likely influences later-in-life host biology. However, we know little about the governance of community development: does the gut serve as a passive incubator where the first organisms randomly encountered gain entry and predominate, or is there an orderly progression of members joining the community of bacteria? We used fine interval enumeration of microbes in stools from multiple subjects to answer this question. We demonstrate via 16S rRNA gene pyrosequencing of 922 specimens from 58 subjects that the gut microbiota of premature infants residing in a tightly controlled microbial environment progresses through a choreographed succession of bacterial classes from Bacilli to Gammaproteobacteria to Clostridia, interrupted by abrupt population changes. As infants approach 33-36 wk postconceptional age (corresponding to the third to the twelfth weeks of life depending on gestational age at birth), the gut is well colonized by anaerobes. Antibiotics, vaginal vs. Caesarian birth, diet, and age of the infants when sampled influence the pace, but not the sequence, of progression. Our results suggest that in infants in a microbiologically constrained ecosphere of a neonatal intensive care unit, gut bacterial communities have an overall nonrandom assembly that is punctuated by microbial population abruptions. The possibility that the pace of this assembly depends more on host biology (chiefly gestational age at birth) than identifiable exogenous factors warrants further consideration. PMID:25114261

  8. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    OpenAIRE

    Fujiwara, H.; Kawata, Y.; H. Ishikawa

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs...

  9. Exploring links between pH and bacterial community composition in soils from the Craibstone Experimental Farm.

    Science.gov (United States)

    Bartram, Andrea K; Jiang, Xingpeng; Lynch, Michael D J; Masella, Andre P; Nicol, Graeme W; Dushoff, Jonathan; Neufeld, Josh D

    2014-02-01

    Soil pH is an important determinant of microbial community composition and diversity, yet few studies have characterized the specific effects of pH on individual bacterial taxa within bacterial communities, both abundant and rare. We collected composite soil samples over 2 years from an experimentally maintained pH gradient ranging from 4.5 to 7.5 from the Craibstone Experimental Farm (Craibstone, Scotland). Extracted nucleic acids were characterized by bacterial and group-specific denaturing gradient gel electrophoresis and next-generation sequencing of bacterial 16S rRNA genes. Both methods demonstrated comparable and reproducible shifts within higher taxonomic bacterial groups (e.g. Acidobacteria, Alphaproteobacteria, Verrucomicrobia, and Gammaproteobacteria) across the pH gradient. In addition, we used non-negative matrix factorization (NMF) for the first time on 16S rRNA gene data to identify positively interacting (i.e. co-occurring) operational taxonomic unit (OTU) clusters (i.e. 'components'), with abundances that correlated strongly with pH, and sample year to a lesser extent. All OTUs identified by NMF were visualized within principle coordinate analyses of UNIFRAC distances and subjected to taxonomic network analysis (SSUnique), which plotted OTU abundance and similarity against established taxonomies. Most pH-dependent OTUs identified here would not have been identified by previous methodologies for microbial community profiling and were unrelated to known lineages. PMID:24117982

  10. Structure and diversity of bacterial, eukaryotic and archaeal communities in glacial cryoconite holes from the Arctic and the Antarctic.

    Science.gov (United States)

    Cameron, Karen A; Hodson, Andrew J; Osborn, A Mark

    2012-11-01

    The cryosphere presents some of the most challenging conditions for life on earth. Nevertheless, (micro)biota survive in a range of niches in glacial systems, including water-filled depressions on glacial surfaces termed cryoconite holes (centimetre to metre in diameter and up to 0.5 m deep) that contain dark granular material (cryoconite). In this study, the structure of bacterial and eukaryotic cryoconite communities from ten different locations in the Arctic and Antarctica was compared using T-RFLP analysis of rRNA genes. Community structure varied with geography, with greatest differences seen between communities from the Arctic and the Antarctic. DNA sequencing of rRNA genes revealed considerable diversity, with individual cryoconite hole communities containing between six and eight bacterial phyla and five and eight eukaryotic 'first-rank' taxa and including both bacterial and eukaryotic photoautotrophs. Bacterial Firmicutes and Deltaproteobacteria and Epsilonproteobacteria, eukaryotic Rhizaria, Haptophyta, Choanomonada and Centroheliozoa, and archaea were identified for the first time in cryoconite ecosystems. Archaea were only found within Antarctic locations, with the majority of sequences (77%) related to members of the Thaumarchaeota. In conclusion, this research has revealed that Antarctic and Arctic cryoconite holes harbour geographically distinct highly diverse communities and has identified hitherto unknown bacterial, eukaryotic and archaeal taxa, therein. PMID:22168226

  11. An efficient rRNA removal method for RNA sequencing in GC-rich bacteria

    Directory of Open Access Journals (Sweden)

    Peano Clelia

    2013-01-01

    Full Text Available Abstract Background Next generation sequencing (NGS technologies have revolutionized gene expression studies and functional genomics analysis. However, further improvement of RNA sequencing protocols is still desirable, in order to reduce NGS costs and to increase its accuracy. In bacteria, a major problem in RNA sequencing is the abundance of ribosomal RNA (rRNA, which accounts for 95-98% of total RNA and can therefore hinder sufficient coverage of mRNA, the main focus of transcriptomic studies. Thus, efficient removal of rRNA is necessary to achieve optimal coverage, good detection sensitivity and reliable results. An additional challenge is presented by microorganisms with GC-rich genomes, in which rRNA removal is less efficient. Results In this work, we tested two commercial kits for rRNA removal, either alone or in combination, on Burkholderia thailandensis. This bacterium, chosen as representative of the important Burkholderia genus, which includes both pathogenic and environmental bacteria, has a rather large (6.72 Mb and GC-rich (67.7% genome. Each enriched mRNA sample was sequenced through paired-end Illumina GAIIx run in duplicate, yielding between 10 and 40 million reads. We show that combined treatment with both kits allows an mRNA enrichment of more than 238-fold, enabling the sequencing of almost all (more than 90% B. thailandensis transcripts from less than 10 million reads, without introducing any bias in mRNA relative abundance, thus preserving differential expression profile. Conclusions The mRNA enrichment protocol presented in this work leads to an increase in detection sensitivity up to 770% compared to total RNA; such increased sensitivity allows for a corresponding reduction in the number of sequencing reads necessary for the complete analysis of whole transcriptome expression profiling. Thus we can conclude that the MICROBExpress/Ovation combined rRNA removal method could be suitable for RNA sequencing of whole

  12. A fast molecular nondestructive protocol for evaluating aerobic bacterial load on fresh-cut lettuce.

    Science.gov (United States)

    Gómez, P; Pagnon, M; Egea-Cortines, M; Artés, F; Weiss, J

    2010-10-01

    Elaboration of minimally processed or fresh-cut vegetables requires a quick and reliable method for detection of bacterial contamination over the recommended limits. PCR-based methods fulfil these requirements, but amplification from DNA preparations of the food product is often hampered due to inhibiting substances. The purpose of this study was to develop a fast quantitative PCR (qPCR)-based method for aerobic bacterial enumeration in fresh-cut lettuce, using as reference the centrifugation water (CW) that comes up during processing instead of the food matrix itself. Comparisons between bacterial numbers on lettuce leaves before processing and bacterial numbers in the CW both for naturally occurring bacterial populations and for artificially inoculated lettuce were performed. On an average, 35% of the natural bacterial population and 64% of inoculated bacteria were recovered in the CW. Bacterial number in CW was proportional to initial lettuce contamination suggesting that measures on CW allow a narrow estimation of lettuce contamination. In qPCR, a 23S rDNA region was amplified from bacterial DNA present in the CW, followed by melting peak analyses and quantification. Enumeration of cell number by qPCR did not differ significantly from plate assay and might therefore replace it. The proposed protocol, which includes sample taking, DNA extraction and qPCR from the CW can be performed within less than 5 h. The resulting quantification might be used as a proxy of initial lettuce contamination, allowing direct intervention measures before fresh-cut commodity is shipped from the factory. PMID:21339159

  13. Heme uptake in bacterial pathogens

    OpenAIRE

    Contreras, Heidi; Chim, Nicholas; Credali, Alfredo; Goulding, Celia W.

    2014-01-01

    Iron is an essential nutrient for the survival of organisms. Bacterial pathogens possess specialized pathways to acquire heme from their human hosts. In this review, we present recent structural and biochemical data that provide mechanistic insights into several bacterial heme uptake pathways, encompassing the sequestration of heme from human hemoproteins to secreted or membrane-associated bacterial proteins, the transport of heme across bacterial membranes, and the degradation of heme within...

  14. Monitoring of oil pollution at Gemsa Bay and bioremediation capacity of bacterial isolates with biosurfactants and nanoparticles.

    Science.gov (United States)

    El-Sheshtawy, H S; Khalil, N M; Ahmed, W; Abdallah, R I

    2014-10-15

    Fifteen crude oil-degrading bacterial isolates were isolated from an oil-polluted area in Gemsa Bay, Red Sea, Egypt. Two bacterial species showed the highest growth rate on crude oil hydrocarbons. From an analysis of 16S rRNA sequences, these isolates were identified as Pseudomonas xanthomarina KMM 1447 and Pseudomonas stutzeri ATCC 17588. Gas Chromatographic (GC) analysis of the crude oil remaining in the culture medium after one week at 30°C showed that the optimum biodegradation of crude petroleum oil was demonstrated at 50% in medium containing biosurfactant with two types of nanoparticles separately and two bacterial species. The complete degradation of some different members of polyaromatics and the percentage biodegradation of other polyaromatics increased in microcosm containing two different types of nanoparticles with biosurfactant after 7 days. In conclusion, these bacterial strains may be useful for the bioremediation process in the Gemsa Bay, Red Sea decreasing oil pollution in this marine ecosystem. PMID:25139301

  15. Evolutionary transitions in bacterial symbiosis

    OpenAIRE

    Sachs, Joel L.; Skophammer, Ryan G.; Regus, John U.

    2011-01-01

    Diverse bacterial lineages form beneficial infections with eukaryotic hosts. The origins, evolution, and breakdown of these mutualisms represent important evolutionary transitions. To examine these key events, we synthesize data from diverse interactions between bacteria and eukaryote hosts. Five evolutionary transitions are investigated, including the origins of bacterial associations with eukaryotes, the origins and subsequent stable maintenance of bacterial mutualism with hosts, the captur...

  16. Extension of model potential methods to treat charge transfer in open shell systems. Application to the Si3+/He, He2+/He (21S) and He2+/He (23S) systems

    International Nuclear Information System (INIS)

    Charge transfer reactions in ion-atom collisions are investigated theoretically for systems involving open-shell configurations. Both model potential and ab-initio methods are used to treat the adiabatic states of the collision complex. A quantum mechanical treatment of the collision dynamics is used. Electron capture cross sections for two representative systems (He2+ in collision with either 21S or 23S metastable He and for Si3+ with ground state He) are calculated in the eV-keV energy range. (author)

  17. Investigation of bacterial diversity of hot springs of Odisha, India

    Directory of Open Access Journals (Sweden)

    Rajesh Kumar Sahoo

    2015-12-01

    Full Text Available 16S rRNA deep sequencing analysis, targeting V3 region was performed using Illumina bar coded sequencing. Sediment samples from two hot springs (Atri and Taptapani were collected. Atri and Taptapani metagenomes were classified into 50 and 51 bacterial phyla. Proteobacteria (45.17% dominated the Taptapani sample metagenome followed by Bacteriodetes (23.43% and Cyanobacteria (10.48% while in the Atri sample, Chloroflexi (52.39%, Nitrospirae (10.93% and Proteobacteria (9.98% dominated. A large number of sequences remained taxonomically unresolved in both hot springs, indicating the presence of potentially novel microbes in these two unique habitats thus unraveling the importance of the current study. Metagenome sequence information is now available at NCBI, SRA database accession no. SRP057428.

  18. Enterobacter spp.: A new evidence causing bacterial wilt on mulberry

    Institute of Scientific and Technical Information of China (English)

    PRAPHAT; Kawicha

    2010-01-01

    Thirty-six pathogenetic bacterial strains were isolated from wilted mulberry plants in Hangzhou,Zhejiang province of China.The six representative strains were confirmed to be involved in more than one Enterobacter species by common bacteriological test,electron microscope observation,hypersensitive reaction,Koch’s postulates,physiological and biochemical test,biolog,fatty acid methyl esters analysis (FAMEs),enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR),16s rRNA sequences analysis,and comparative analysis with 7 type strains and 3 reference strains.This is the first report on mulberry disease caused by Enterobacter spp.in the world providing new evidence on induction of the plant disease in this genus.The results are not only important in the mulberry disease management but also have significant scientific value for further studies of opportunistic human pathogens and environmental strains in Enterobacter.

  19. Caracterização da região espaçadora 16-23S rDNA para diferenciação de estirpes de rizóbios utilizadas na produção de inoculantes comerciais no Brasil Characterization of the spacer region 16-23S rDNA for differentiation of strains of rhizobia used in the production of commercial inoculants in Brazil

    Directory of Open Access Journals (Sweden)

    Andréia Mara Rotta Oliveira

    2012-08-01

    Full Text Available A identificação de estirpes de rizóbio tem sido feita pela especificidade por hospedeiros e ensaios microbiológicos tradicionais. Por constituírem um grupo filogeneticamente heterogêneo, diferentes técnicas moleculares têm sido empregadas para auxiliar na caracterização genética e na identificação de estirpes eficientes e competitivas para a produção de inoculantes. Este trabalho teve por objetivos caracterizar a região espaçadora 16S-23S rDNA das estirpes de rizóbios utilizadas nos inoculantes comercializados no Brasil para espécies leguminosas, utilizando a técnica da PCR em combinação com a de RFLP, e avaliar a possibilidade do uso desse marcador molecular como método auxiliar para identificação das estipes. A amplificação da região espaçadora 16-23 S rDNA das estirpes de rizóbios gerou fragmentos com tamanhos que variaram entre 700pb e 1350pb. Os produtos resultantes da amplificação foram submetidos à digestão com as endonucleases. Mps I, Dde I e Hae III. Os resultados obtidos neste estudo indicam a possibilidade do uso da técnica de PCR-RFLP da região espaçadora 16S-23S rDNA como marcador molecular para a diferenciar as estirpes de rizóbios, em complemento às técnicas microbiológicas tradicionais. Contudo, este marcador não é suficientemente discriminatório para ser usado na identificação das estirpes recomendadas para a produção de inoculantes comerciais.The identification of strains of rhizobia has been made by host specificity and regular microbiological tests. By forming a phylogenetically heterogeneous group, different molecular techniques have been employed to assist in the genetic characterization and identification of efficient and competitive strains for production of inoculants. This study aimed to characterize the spacer region 16S-23S rDNA of the strains of rhizobia used in commercial inoculants in Brazil for legume species, using PCR combined with RFLP, and assess the possibility

  20. [Bacterial diseases of rape].

    Science.gov (United States)

    Zakharova, O M; Mel'nychuk, M D; Dankevych, L A; Patyka, V P

    2012-01-01

    Bacterial destruction of the culture was described and its agents identified in the spring and winter rape crops. Typical symptoms are the following: browning of stem tissue and its mucilagization, chlorosis of leaves, yellowing and beginning of soft rot in the place of leaf stalks affixion to stems, loss of pigmentation (violet). Pathogenic properties of the collection strains and morphological, cultural, physiological, and biochemical properties of the agents of rape's bacterial diseases isolated by the authors have been investigated. It was found that all the isolates selected by the authors are highly or moderately aggressive towards different varieties of rape. According to the complex of phenotypic properties 44% of the total number of isolates selected by the authors are related to representatives of the genus Pseudomonas, 37% - to Xanthomonas and 19% - to Pectobacterium. PMID:23293826

  1. Bacterial proteases and virulence

    DEFF Research Database (Denmark)

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing...... tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell...... cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host....

  2. Bacterial community composition of a wastewater treatment system reliant on N{sub 2} fixation

    Energy Technology Data Exchange (ETDEWEB)

    Reid, N.M.; Bowers, T.H.; Lloyd-Jones, G. [Scion, Rotorua (New Zealand)

    2008-05-15

    The temporal stability and change of the dominant phylogenetic groups of the domain bacteria were studied in a model plant-based industrial wastewater treatment system showing high levels of organic carbon removal supported by high levels of N{sub 2} fixation. Community profiles were obtained through terminal restriction fragment length polymorphism analysis and cloning of 16S rRNA amplicons followed by sequencing. Bacterial community profiles showed that ten common terminal restriction fragments made up approximately 50% of the measured bacterial community. As much as 42% of the measured bacterial community could be monitored by using quantitative PCR and primers that targeted three dominant operational taxonomic units. Despite changes in wastewater composition and dissolved oxygen levels, the bacterial community composition appeared stable and was dominated by {alpha}-Proteobacteria and {beta}-Proteobacteria, with a lesser amount of the highly diverse bacterial phylum Bacteroidetes. A short period of considerable change in the bacterial community composition did not appear to affect treatment performance indicating functional redundancy in this treatment system. (orig.)

  3. The intestinal bacterial community in the food waste-reducing larvae of Hermetia illucens.

    Science.gov (United States)

    Jeon, Hyunbum; Park, Soyoung; Choi, Jiyoung; Jeong, Gilsang; Lee, Sang-Beom; Choi, Youngcheol; Lee, Sung-Jae

    2011-05-01

    As it is known that food waste can be reduced by the larvae of Hermetia illucens (Black soldier fly, BSF), the scientific and commercial value of BSF larvae has increased recently. We hypothesised that the ability of catabolic degradation by BSF larvae might be due to intestinal microorganisms. Herein, we analysed the bacterial communities in the gut of BSF larvae by pyrosequencing of extracting intestinal metagenomic DNA from larvae that had been fed three different diets. The 16S rRNA sequencing results produced 9737, 9723 and 5985 PCR products from larval samples fed food waste, cooked rice and calf forage, respectively. A BLAST search using the EzTaxon program showed that the bacterial community in the gut of larvae fed three different diets was mainly composed of the four phyla with dissimilar proportions. Although the composition of the bacterial communities depended on the different nutrient sources, the identified bacterial strains in the gut of BSF larvae represented unique bacterial species that were unlike the intestinal microflora of other insects. Thus, our study analysed the structure of the bacterial communities in the gut of BSF larvae after three different feedings and assessed the application of particular bacteria for the efficient degradation of organic compounds. PMID:21267722

  4. Gut bacterial communities across tadpole ecomorphs in two diverse tropical anuran faunas

    Science.gov (United States)

    Vences, Miguel; Lyra, Mariana L.; Kueneman, Jordan G.; Bletz, Molly C.; Archer, Holly M.; Canitz, Julia; Handreck, Svenja; Randrianiaina, Roger-Daniel; Struck, Ulrich; Bhuju, Sabin; Jarek, Michael; Geffers, Robert; McKenzie, Valerie J.; Tebbe, Christoph C.; Haddad, Célio F. B.; Glos, Julian

    2016-04-01

    Animal-associated microbial communities can play major roles in the physiology, development, ecology, and evolution of their hosts, but the study of their diversity has yet focused on a limited number of host species. In this study, we used high-throughput sequencing of partial sequences of the bacterial 16S rRNA gene to assess the diversity of the gut-inhabiting bacterial communities of 212 specimens of tropical anuran amphibians from Brazil and Madagascar. The core gut-associated bacterial communities among tadpoles from two different continents strongly overlapped, with eight highly represented operational taxonomic units (OTUs) in common. In contrast, the core communities of adults and tadpoles from Brazil were less similar with only one shared OTU. This suggests a community turnover at metamorphosis. Bacterial diversity was higher in tadpoles compared to adults. Distinct differences in composition and diversity occurred among gut bacterial communities of conspecific tadpoles from different water bodies and after experimental fasting for 8 days, demonstrating the influence of both environmental factors and food on the community structure. Communities from syntopic tadpoles clustered by host species both in Madagascar and Brazil, and the Malagasy tadpoles also had species-specific isotope signatures. We recommend future studies to analyze the turnover of anuran gut bacterial communities at metamorphosis, compare the tadpole core communities with those of other aquatic organisms, and assess the possible function of the gut microbiota as a reservoir for protective bacteria on the amphibian skin.

  5. A Meta-Analysis of the Bacterial and Archaeal Diversity Observed in Wetland Soils

    Directory of Open Access Journals (Sweden)

    Xiaofei Lv

    2014-01-01

    Full Text Available This study examined the bacterial and archaeal diversity from a worldwide range of wetlands soils and sediments using a meta-analysis approach. All available 16S rRNA gene sequences recovered from wetlands in public databases were retrieved. In November 2012, a total of 12677 bacterial and 1747 archaeal sequences were collected in GenBank. All the bacterial sequences were assigned into 6383 operational taxonomic units (OTUs 0.03, representing 31 known bacterial phyla, predominant with Proteobacteria (2791 OTUs, Bacteroidetes (868 OTUs, Acidobacteria (731 OTUs, Firmicutes (540 OTUs, and Actinobacteria (418 OTUs. The genus Flavobacterium (11.6% of bacterial sequences was the dominate bacteria in wetlands, followed by Gp1, Nitrosospira, and Nitrosomonas. Archaeal sequences were assigned to 521 OTUs from phyla Euryarchaeota and Crenarchaeota. The dominating archaeal genera were Fervidicoccus and Methanosaeta. Rarefaction analysis indicated that approximately 40% of bacterial and 83% of archaeal diversity in wetland soils and sediments have been presented. Our results should be significant for well-understanding the microbial diversity involved in worldwide wetlands.

  6. Bacterial communities in fish sauce mash using culture-dependent and -independent methods.

    Science.gov (United States)

    Fukui, Youhei; Yoshida, Mitsuhiro; Shozen, Kei-ichi; Funatsu, Yasuhiro; Takano, Takashi; Oikawa, Hiroshi; Yano, Yutaka; Satomi, Masataka

    2012-01-01

    In fish sauce production, microorganisms are associated with the fermentation process; however, the sequential changes in the bacterial communities have never been examined throughout the period of fermentation. In this study, we determined the bacterial floras in a fish sauce mash over 8 months, using three different culture media and 16S rRNA gene clone library analysis. During the first 4 weeks, viable counts of non-halophilic and halophilic bacteria decreased and were dominated by Staphylococcus species. Between 4 and 6 weeks, halophilic and highly halophilic bacterial counts markedly increased from 10(7) to 10(8) cfu/g, and the predominant species changed to Tetragenococcus halophilus. The occurrence of T. halophilus was associated with an increase of lactic acid and a reduction of pH values. In contrast, non-halophilic bacterial counts decreased to 10(6) cfu/g by 6 weeks with Bacillus subtilis as the dominant isolate. Clone library analysis revealed that the dominant bacterial group also changed from Staphylococcus spp. to T. halophilus, and the changes were consistent with those of the floras of halophilic and highly halophilic isolates. This is the first report describing a combination approach of culture and clone library methods for the analysis of bacterial communities in fish sauce mash. PMID:22990487

  7. Temporal dynamics of sediment bacterial communities in monospecific stands of Juncus maritimus and Spartina maritima.

    Science.gov (United States)

    Cleary, D F R; Polónia, A R M; Sousa, A I; Lillebø, A I; Queiroga, H; Gomes, N C M

    2016-09-01

    In the present study, we used 16S rRNA barcoded pyrosequencing to investigate to what extent monospecific stands of different salt marsh plant species (Juncus maritimus and Spartina maritima), sampling site and temporal variation affect sediment bacterial communities. We also used a bioinformatics tool, PICRUSt, to predict metagenome gene functional content. Our results showed that bacterial community composition from monospecific stands of both plant species varied temporally, but both host plant species maintained compositionally distinct communities of bacteria. Juncus sediment was characterised by higher abundances of Alphaproteobacteria, Myxococcales, Rhodospirillales, NB1-j and Ignavibacteriales, while Spartina sediment was characterised by higher abundances of Anaerolineae, Synechococcophycidae, Desulfobacterales, SHA-20 and Rhodobacterales. The differences in composition and higher taxon abundance between the sediment bacterial communities of stands of both plant species may be expected to affect overall metabolic diversity. In line with this expectation, there were also differences in the predicted enrichment of selected metabolic pathways. In particular, bacterial communities of Juncus sediment were predicted to be enriched for pathways related to the degradation of various (xenobiotic) compounds. Bacterial communities of Spartina sediment in turn were predicted to be enriched for pathways related to the biosynthesis of various bioactive compounds. Our study highlights the differences in composition and predicted functions of sediment-associated bacterial communities from two different salt marsh plant species. Loss of salt marsh habitat may thus be expected to both adversely affect microbial diversity and ecosystem functioning and have consequences for environmental processes such as nutrient cycling and pollutant remediation. PMID:27061465

  8. Analysis of the Bacterial Diversity in Liver Abscess: Differences Between Pyogenic and Amebic Abscesses.

    Science.gov (United States)

    Reyna-Fabián, Miriam E; Zermeño, Valeria; Ximénez, Cecilia; Flores, Janin; Romero, Miguel F; Diaz, Daniel; Argueta, Jesús; Moran, Patricia; Valadez, Alicia; Cerritos, René

    2016-01-01

    Several recent studies have demonstrated that virulence in Entamoeba histolytica is triggered in the presence of both pathogenic and nonpathogenic bacteria species using in vitro and in vivo experimental animal models. In this study, we examined samples aspirated from abscess material obtained from patients who were clinically diagnosed with amebic liver abscess (ALA) or pyogenic liver abscess (PLA). To determine the diversity of bacterial species in the abscesses, we performed partial 16S rRNA gene sequencing. In addition, the E. histolytica and Entamoeba dispar species were genotyped using tRNA-linked short tandem repeats as specific molecular markers. The association between clinical data and bacterial and parasite genotypes were examined through a correspondence analysis. The results showed the presence of numerous bacterial groups. These taxonomic groups constitute common members of the gut microbiota, although all of the detected bacterial species have a close phylogenetic relationship with bacterial pathogens. Furthermore, some patients clinically diagnosed with PLA and ALA were coinfected with E. dispar or E. histolytica, which suggests that the virulence of these parasites increased in the presence of bacteria. However, no specific bacterial groups were associated with this effect. Together, our results suggest a nonspecific mechanism of virulence modulation by bacteria in Entamoeba. PMID:26572872

  9. Assessment of bacterial community structure in nitrifying biofilm under inorganic carbon-sufficient and -limited conditions.

    Science.gov (United States)

    Bae, Hyokwan; Chung, Yun-Chul; Yang, Heejeong; Lee, Changsoo; Aryapratama, Rio; Yoo, Young J; Lee, Seockheon

    2015-01-01

    In this work, nitrification and changes in the composition of the total bacterial community under inorganic carbon (IC)-limited conditions, in a nitrifying moving bed biofilm reactor, was investigated. A culture-independent analysis of cloning and sequencing based on the 16S rRNA gene was applied to quantify the bacterial diversity and to determine bacterial taxonomic assignment. IC concentrations had significant effects on the stability of ammonia-oxidation as indicated by the reduction of the nitrogen conversion rate with high NH4(+)-N loadings. The predominance of Nitrosomonas europaea was maintained in spite of changes in the IC concentration. In contrast, heterotrophic bacterial species contributed to a high bacterial diversity, and to a dynamic shift in the bacterial community structure, under IC-limited conditions. In this study, individual functions of heterotrophic bacteria were estimated based on taxonomic information. Possible key roles of coexisting heterotrophic bacteria are the assimilation of organic compounds of extracellular polymeric substances produced by nitrifiers, and biofilm formation by providing a filamentous structure and aggregation properties. PMID:25560266

  10. Biogeographic Patterns Between Bacterial Phyllosphere Communities of the Southern Magnolia (Magnolia grandiflora) in a Small Forest.

    Science.gov (United States)

    Stone, Bram W G; Jackson, Colin R

    2016-05-01

    The phyllosphere presents a unique system of discrete and easily replicable surfaces colonized primarily by bacteria. However, the biogeography of bacteria in the phyllosphere is little understood, especially at small to intermediate scales. Bacterial communities on the leaves of 91 southern magnolia (Magnolia grandiflora) trees 1-452 m apart in a small forest plot were analyzed and fragments of the 16S ribosomal RNA (rRNA) gene sequenced using the Illumina platform. Assemblages were dominated by members of the Alphaproteobacteria, Bacteroidetes, and Acidobacteria. Patterns in community composition were measured by both relative abundance (theta) and presence-absence (Jaccard) dissimilarity metrics. Distance-based Moran's eigenvector map analyses of the distance-decay relationship found a significant, positive relationship between each dissimilarity metric and significant eigenfunctions derived from geographic distance between trees, indicating trees that were closer together had more similar bacterial phyllosphere communities. Indirect gradient analyses revealed that several environmental parameters (canopy cover, tree elevation, and the slope and aspect of the ground beneath trees) were significantly related to multivariate ordination scores based on relative bacterial sequence abundances; however, these relationships were not significant when looking at the incidence of bacterial taxa. This suggests that bacterial growth and abundance in the phyllosphere is shaped by different assembly mechanisms than bacterial presence or absence. More broadly, this study demonstrates that the distance-decay relationship applies to phyllosphere communities at local scales, and that environmental parameters as well as neutral forces may both influence spatial patterns in the phyllosphere. PMID:26883131

  11. Soil bacterial endemism and potential functional redundancy in natural broadleaf forest along a latitudinal gradient.

    Science.gov (United States)

    Zhang, Yuguang; Cong, Jing; Lu, Hui; Deng, Ye; Liu, Xiao; Zhou, Jizhong; Li, Diqiang

    2016-01-01

    Microorganisms play key roles in ecosystem processes and biogeochemical cycling, however, the relationship between soil microbial taxa diversity and their function in natural ecosystems is largely unknown. To determine how soil bacteria community and function are linked from the local to regional scale, we studied soil bacteria community composition, potential function and environmental conditions in natural and mature broadleaf forests along a latitudinal gradient in China, using the Illumina 16S rRNA sequencing and GeoChip technologies. The results showed strong biogeographic endemism pattern in soil bacteria were existed, and the spatial distance and climatic variables were the key controlling factors for this pattern. Therefore, dispersal limitation and environmental selection may represent two key processes in generating and maintaining the soil bacterial biogeographic pattern. By contrast, the soil bacterial potential function is highly convergent along the latitudinal gradient and there were highly differing bacterial community compositions, and the soil chemistry may include the main factors active in shaping the soil bacterial potential function. Therefore, the soil bacterial potential function may be affected by local gradients in resource availability, and predicting soil bacterial potential function requires knowledge of abiotic and biotic environmental factors. PMID:27357005

  12. Supramolecular bacterial systems

    OpenAIRE

    Sankaran, Shrikrishnan

    2015-01-01

    For nearly over a decade, a wide variety of dynamic and responsive supramolecular architectures have been investigated and developed to address biological systems. Since the non-covalent interactions between individual molecular components in such architectures are similar to the interactions found in living systems, it was possible to integrate chemically-synthesized and naturally-occurring components to create platforms with interesting bioactive properties. Bacterial cells and recombinant ...

  13. Bacterial transformation of terpenoids

    International Nuclear Information System (INIS)

    Data on the bacterial transformation of terpenoids published in the literature in the past decade are analyzed. Possible pathways for chemo-, regio- and stereoselective modifications of terpenoids are discussed. Considerable attention is given to new technological approaches to the synthesis of terpenoid derivatives suitable for the use in the perfume and food industry and promising as drugs and chiral intermediates for fine organic synthesis. The bibliography includes 246 references

  14. Succession of lignocellulolytic bacterial consortia bred anaerobically from lake sediment.

    Science.gov (United States)

    Korenblum, Elisa; Jiménez, Diego Javier; van Elsas, Jan Dirk

    2016-03-01

    Anaerobic bacteria degrade lignocellulose in various anoxic and organically rich environments, often in a syntrophic process. Anaerobic enrichments of bacterial communities on a recalcitrant lignocellulose source were studied combining polymerase chain reaction-denaturing gradient gel electrophoresis, amplicon sequencing of the 16S rRNA gene and culturing. Three consortia were constructed using the microbiota of lake sediment as the starting inoculum and untreated switchgrass (Panicum virgatum) (acid or heat) or treated (with either acid or heat) as the sole source of carbonaceous compounds. Additionally, nitrate was used in order to limit sulfate reduction and methanogenesis. Bacterial growth took place, as evidenced from 3 to 4 log unit increases in the 16S rRNA gene copy numbers as well as direct cell counts through three transfers on cleaned and reused substrate placed in fresh mineral medium. After 2 days, Aeromonas bestiarum-like organisms dominated the enrichments, irrespective of the substrate type. One month later, each substrate revealed major enrichments of organisms affiliated with different species of Clostridium. Moreover, only the heat-treated substrate selected Dysgonomonas capnocytophagoides-affiliated bacteria (Bacteroidetes). Towards the end of the experiment, members of the Proteobacteria (Aeromonas, Rhizobium and/or Serratia) became dominant in all three types of substrates. A total of 160 strains was isolated from the enrichments. Most of the strains tested (78%) were able to grow anaerobically on carboxymethyl cellulose and xylan. The final consortia yield attractive biological tools for the depolymerization of recalcitrant lignocellulosic materials and are proposed for the production of precursors of biofuels. PMID:26875750

  15. Highly heterogeneous bacterial communities associated with the South China Sea reef corals Porites lutea, Galaxea fascicularis and Acropora millepora.

    Directory of Open Access Journals (Sweden)

    Jie Li

    Full Text Available Coral harbor diverse and specific bacteria play significant roles in coral holobiont function. Bacteria associated with three of the common and phylogenetically divergent reef-building corals in the South China Sea, Porites lutea, Galaxea fascicularis and Acropora millepora, were investigated using 454 barcoded-pyrosequencing. Three colonies of each species were sampled, and 16S rRNA gene libraries were constructed individually. Analysis of pyrosequencing libraries showed that bacterial communities associated with the three coral species were more diverse than previous estimates based on corals from the Caribbean Sea, Indo-Pacific reefs and the Red Sea. Three candidate phyla, including BRC1, OD1 and SR1, were found for the first time in corals. Bacterial communities were separated into three groups: P. lutea and G. fascicular, A. millepora and seawater. P. lutea and G. fascicular displayed more similar bacterial communities, and bacterial communities associated with A. millepora differed from the other two coral species. The three coral species shared only 22 OTUs, which were distributed in Alphaproteobacteria, Deltaproteobacteria, Gammaproteobacteria, Chloroflexi, Actinobacteria, Acidobacteria and an unclassified bacterial group. The composition of bacterial communities within each colony of each coral species also showed variation. The relatively small common and large specific bacterial communities in these corals implies that bacterial associations may be structured by multiple factors at different scales and that corals may associate with microbes in terms of similar function, rather than identical species.

  16. Responsiveness of soil nitrogen fractions and bacterial communities to afforestation in the Loess Hilly Region (LHR) of China.

    Science.gov (United States)

    Ren, Chengjie; Sun, Pingsheng; Kang, Di; Zhao, Fazhu; Feng, Yongzhong; Ren, Guangxin; Han, Xinhui; Yang, Gaihe

    2016-01-01

    In the present paper, we investigated the effects of afforestation on nitrogen fractions and microbial communities. A total of 24 soil samples were collected from farmland (FL) and three afforested lands, namely Robinia pseudoacacia L (RP), Caragana korshinskii Kom (CK), and abandoned land (AL), which have been arable for the past 40 years. Quantitative PCR and Illumina sequencing of 16S rRNA genes were used to analyze soil bacterial abundance, diversity, and composition. Additionally, soil nitrogen (N) stocks and fractions were estimated. The results showed that soil N stock, N fractions, and bacterial abundance and diversity increased following afforestation. Proteobacteria, Acidobacteria, and Actinobacteria were the dominant phyla of soil bacterial compositions. Overall, soil bacterial compositions generally changed from Actinobacteria (Acidobacteria)-dominant to Proteobacteria-dominant following afforestation. Soil N fractions, especially for dissolved organic nitrogen (DON), were significantly correlated with most bacterial groups and bacterial diversity, while potential competitive interactions between Proteobacteria (order Rhizobiales) and Cyanobacteria were suggested. In contrast, nitrate nitrogen (NO3(-)-N) influenced soil bacterial compositions less than other N fractions. Therefore, the present study demonstrated that bacterial diversity and specific species respond to farmland-to-forest conversion and hence have the potential to affect N dynamic processes in the Loess Plateau. PMID:27334692

  17. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    OpenAIRE

    Ong, SH; Kukkillaya, VU; Wilm, A; Lay, C; Ho, EX; Low, L; Hibberd, ML; Nagarajan, N.

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequenc...

  18. Bacterial diversity and tetrodotoxin analysis in the viscera of the gastropods from Portuguese coast.

    Science.gov (United States)

    Pratheepa, Vijayakumari; Alex, Anoop; Silva, Marisa; Vasconcelos, Vitor

    2016-09-01

    To trace the pathway of tetrodotoxin (TTX) producing microorganism in the Atlantic coast of Portugal, culture-dependent evaluation of the bacterial isolates from the viscera of the gastropods Monodonta lineata, Gibbula umbilicalis, Nucella lapillus and Patella intermedia, and from the environmental samples (biofilm and surrounding sea water) was carried out. Samples were collected from eight different coastal locations of Northern Portugal. A total of 311 isolates were identified. The observed bacterial diversity was distributed over five different classes (Gammaproteobacteria, Alphaproteobacteria, Flavobacteria, Bacilli and Actinobacteria) with the greatest number of 16S rRNA gene sequence derived from the Gammaproteobacteria (75%). Phylogenetic analysis based on the 16S rRNA gene showed that bacterial isolates were highly diverse and most of which were found in other marine environment. Among the different species isolated, Vibrio was found abundant. Eventhough TTX was not detected (UPLC-MS/MS) in the isolates from this study, PCR screening identified some natural product biosynthesis genes (PKS and NRPS) involved in its assembly. Further PCR screening of the TTX producing two ATCC Vibrio sp. reveals that NRPS might be involved in the biosynthesis of TTX through the incorporation of arginine. PMID:27312988

  19. Penning and associative ionisations of argon atoms by collisions with metastable helium atoms He(21S) and He(23S) of thermal energies 0.03-0.40eV

    International Nuclear Information System (INIS)

    This work, devoted to the 21S and 23S metastable states of the helium atom, is mainly experimental. It centres on observation of the non-bound states Ar+ and bound states HeAr+ created during collisions of these metastable atoms with argon atoms in the ground state. The Penning and associative ionisation cross-sections corresponding to these two processes were obtained as a function of the relative speed of approach of the He*+Ar particles in the thermal region 1200-4500m/s (0.3-0.40eV). The experimental time of flight method used in this experiment is original in its application to the measurement of reaction products such as Ar+ and HeAr+ ions. The results obtained testify to the efficiency of this method since the variations in the Penning ionisation cross-section sigmasub(IP)(v) and associative ionisation cross-section sigmasub(IA)(v) against speed have not been observed in other laboratories. They are given here for the couples He(23S)+Ar and He(21S) + Ar. The theoretical interpretation attempted for the cross-sections sigmasub(IP)(v) and sigmasub(IA)(v) is based on a very recent model due to the American school of Miller and the Japanese school of Nakamura. This model, common to all interpretations, can lead to different results according to whether quantum effects are taken into account

  20. The spatio-temporal distribution of He (23S1) metastable atoms in a MHz-driven helium plasma jet is influenced by the oxygen/nitrogen ratio of the surrounding atmosphere

    Science.gov (United States)

    Winter, J.; Santos Sousa, J.; Sadeghi, N.; Schmidt-Bleker, A.; Reuter, S.; Puech, V.

    2015-04-01

    The density of helium He (23S1) metastable atoms is measured in a 1.6 mm diameter MHz-driven atmospheric pressure helium plasma jet by laser absorption spectroscopy with spatial and temporal resolution. The surrounding atmosphere of the jet is varied from pure oxygen to pure nitrogen with a gas shielding device. The highest metastable density of 1.3 × 1013 cm-3 is obtained in the center of the jet close to the nozzle exit at normal atmospheric air conditions. Within 0.3 mm in the radial direction and 2 mm in the axial direction, the He metastable density drops below the detection limit. The obtained He metastable lifetime is almost independent of the shielding gas composition. By analyzing the diffusion of shielding gas species into the effluent it is concluded that their density is too low to explain the observed He metastable lifetime. Instead, impurities from the feed gas, especially water molecules, are more likely to be responsible. However, a drastic change in metastable He density is observed when decreasing the amount of oxygen in the shielding gas. The lower the oxygen amount, the lower the metastable He density. For pure nitrogen, no He metastables are detected at all. By exchanging nitrogen with argon, a similar behavior is observed. Thus, it is concluded that it is the absence of ambient oxygen rather than the elevated presence of nitrogen, which is responsible for the observed decrease in the He (23S1) density.