WorldWideScience

Sample records for bacterial 23s rrna

  1. Targeted next-generation sequencing of the 16S-23S rRNA region for culture-independent bacterial identification - increased discrimination of closely related species

    NARCIS (Netherlands)

    Sabat, Artur J.; van Zanten, Evert; Akkerboom, Viktoria; Wisselink, Guido J; van Slochteren, Kees; de Boer, Richard F; Hendrix, Ron; Friedrich, Alexander W.; Rossen, John W. A.; Kooistra-Smid, Anna M.D. (Mirjam)

    2017-01-01

    The aim of this study was to develop an easy-to-use culture-free diagnostic method based on next generation sequencing (NGS) of PCR amplification products encompassing whole 16S-23S rRNA region to improve the resolution of bacterial species identification. To determine the resolution of the new

  2. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation...... at nucleotide C2498. The loss of ygdE function causes a slight reduction in bacterial fitness. Methylation at C2498 was restored by complementing the knock-out strain with a recombinant copy of ygdE. The recombinant YgdE methyltransferase modifies C2498 in naked 23S rRNA, but not in assembled 50S subunits...

  3. Long PCR-RFLP of 16S-ITS-23S rRNA genes: a high-resolution molecular tool for bacterial genotyping

    Czech Academy of Sciences Publication Activity Database

    Zeng, Yonghui; Koblížek, Michal; Li, Y. X.; Liu, Y. P.; Feng, F. Y.; Ji, J. D.; Jian, J. C.; Wu, Z. H.

    2013-01-01

    Roč. 114, č. 2 (2013), s. 433-447 ISSN 1364-5072 R&D Project s: GA MŠk(CZ) ED2.1.00/03.0110 Institutional support: RVO:61388971 Keywords : 16S-ITS-23S * bacterial genome * computer simulation Subject RIV: EE - Microbiology, Virology Impact factor: 2.386, year: 2013

  4. Evaluation of a fluorescence-labelled oligonucleotide tide probe targeting 23S rRNA for in situ detection of Salmonella serovars in paraffin-embedded tissue sections and their rapid identification in bacterial smears

    DEFF Research Database (Denmark)

    Nordentoft, Steen; Christensen, H.; Wegener, Henrik Caspar

    1997-01-01

    A method for the detection of Salmonella based on fluorescence in situ hybridization (FISH) has been developed and applied for the direct detection of Salmonella in pure cultures and in formalin-fixed, paraffin-embedded tissue sections. On the basis of the 23S rRNA gene sequences representing all...... with the probe. The probe did not hybridize to serovars from subspecies IIIa (S. arizonae) or to S. bongori. No cross-reaction to 64 other strains of the family Enterobacteriaceae or 18 other bacterial strains outside this family was observed. The probe was tested with sections of formalin-fixed, paraffin...

  5. Intervening sequences in 23S rRNA genes and 23S rRNA fragmentation in Taylorella asinigenitalis UCD-1(T) strain.

    Science.gov (United States)

    Tazumi, Akihiro; Sekizuka, Tsuyoshi; Moore, John E; Millar, Cherie B; Taneike, Ikue; Matsuda, Motoo

    2008-08-01

    PCR was performed with Taylorella asinigenitalis UCD-1(T) using two primer pairs constructed in silico for the amplification of the intervening sequences (IVSs) in the first quarter and central regions of the 23S rRNA gene. Following TA cloning and sequencing, the strain was identified to carry heterogeneous and multiple IVSs. Two similar tandem repeat units of 25 and 24 base pairs (bp) with unknown function(s) were identified within the two IVSs in the central region. Secondary structure models of IVSs, containing stem and loop structures, were demonstrated. Although 16S rRNA and 4-5S RNA species were identified in the purified RNA fraction, no 23S rRNAs were evident, resulting in the occurrence of some smaller RNA fragments from approximately 500 to 1,600 bp, in length. Thus, the 23S rRNA primary transcripts may be cleaved into some smaller fragments and IVSs. No IVS transcript was detected by northern blot hybridization analysis. The present and previous results strongly demonstrate the occurrence of heterogeneous and multiple IVSs in 23S rRNA gene sequences and 23S rRNA fragmentation, in T. asinigenitalis. (c) 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Molecular characterization of intervening sequences in 23S rRNA genes and 23S rRNA fragmentation in Taylorella equigenitalis.

    Science.gov (United States)

    Tazumi, A; Sekizuka, T; Moore, J E; Millar, B C; Taneike, I; Matsuda, M

    2008-01-01

    Using two primer pairs constructed in silico for the amplification of the intervening sequences (IVSs) of the 23S rRNA gene sequences of the genus Taylorella, none of the three representative T. equigenitalis strains NCTC11184(T), Kentucky 188 and EQ59 was shown to contain any IVSs in the first quarter region. In the central region, all three strains possessed one approximately 70 bp IVS (TeIVS2) different from any IVSs found in T. asinigenitalis. The predicted secondary structure model of the IVSs contained stem and loop structures. The central region of the IVS-stem structure contains an identical double-stranded consensus 15-bp sequence. The purified RNA fraction from the three strains contained 16S and 4-5S RNA species but no 23S rRNA species. Thus, the primary 23S rRNA transcripts from the three strains would be cleaved into approximately 1.2- and 1.6-kb rRNA fragments and approximately 70-bp IVS. In addition, 16 other T. equigenitalis isolates were found to carry a similar 70-bp IVS in the central region and to produce fragmented 23S rRNA.

  7. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...

  8. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...

  9. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    The phylogenetic relationships among thirteen Rhizobium leguminosarum bv. viciae isolates collected from various geographical regions were studied by analysis of the 23S rRNA sequences. The average of genetic distance among the studied isolates was very narrow (ranged from 0.00 to 0.04) and the studied isolates ...

  10. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-08-31

    Aug 31, 2016 ... The phylogenetic relationships among thirteen Rhizobium leguminosarum bv. viciae isolates collected from various geographical regions were studied by analysis of the 23S rRNA sequences. The average of genetic distance among the studied isolates was very narrow (ranged from 0.00 to 0.04) and the ...

  11. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  12. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    The ErmE methyltransferase confers resistance to MLS antibiotics by specifically dimethylating adenine 2058 (A2058, Escherichia coli numbering) in bacterial 23S rRNA. To define nucleotides in the rRNA that are part of the motif recognized by ErmE, we investigated both in vivo and in vitro...... the effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair...... and it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...

  13. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

    1995-01-01

    -proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination...

  14. Mutations in 23S rRNA confer resistance against azithromycin in Pseudomonas aeruginosa.

    Science.gov (United States)

    Marvig, Rasmus Lykke; Søndergaard, Mette S R; Damkiær, Søren; Høiby, Niels; Johansen, Helle Krogh; Molin, Søren; Jelsbak, Lars

    2012-08-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that resistance is associated with specific mutations (A2058G, A2059G, and C2611T in Escherichia coli numbering) in domain V of 23S rRNA and that introduction of A2058G and C2611T into strain PAO1 results in azithromycin resistance.

  15. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate...... that resistance is associated with specific mutations (A2058G, A2059G, and C2611T in Escherichia coli numbering) in domain V of 23S rRNA and that introduction of A2058G and C2611T into strain PAO1 results in azithromycin resistance....

  16. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    , the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression......Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...

  17. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  18. A pseudogene cluster in the leader region of the Euglena chloroplast 16S-23S rRNA genes.

    Science.gov (United States)

    Miyata, T; Kikuno, R; Ohshima, Y

    1982-01-01

    The nucleotide sequence of a region (leader region) preceding the 5'-end of 16S-23S rRNA gene region of Euglena gracilis chloroplast DNA was compared with the homologous sequences that code for the 16S-23S rRNA operons of Euglena and E. coli. The leader region shows close homology in sequence to the 16S-23S rRNA gene region of Euglena (Orozco et al. (1980) J. Biol.Chem. 255, 10997-11003) as well as to the rrnD operon of E. coli, suggesting that it was derived from the 16S-23S rRNA gene region by gene duplication. It was shown that the leader region had accumulated nucleotide substitutions at an extremely rapid rate in its entirety, similar to the rate of tRNAIle pseudogene identified in the leader region. In addition, the leader region shows an unique base content which is quite distinct from those of 16S-23S rRNA gene regions of Euglena and E. coli, but again is similar to that of the tRNAIle pseudogene. The above two results strongly suggest that the leader region contains a pseudogene cluster which was derived from a gene cluster coding for the functional 16S-23S rRNA operon possibly by imperfect duplication during evolution of Euglena chloroplast DNA. PMID:7041094

  19. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single-site mutati......Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  20. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid......-coded Escherichia coli 23S rRNAs with single mutations at positions 1067 or 1095 were expressed in vivo. Mutant ribosomes are functional in protein synthesis, although those with transversion mutations function less effectively. Antibiotics were bound under conditions where wild-type and mutant ribosomes compete...

  1. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    DEFF Research Database (Denmark)

    Long, Katherine; Munck, Christian

    2010-01-01

    The oxazolidinone antibiotic linezolid targets the peptidyl transferase center (PTC) on the bacterial ribosome. Thirteen single and four double 23S rRNA mutations were introduced into a Mycobacterium smegmatis strain with a single rRNA operon. Converting bacterial base identity by single mutations...... at positions 2032, 2453, and 2499 to human cytosolic base identity did not confer significantly reduced susceptibility to linezolid. The largest decrease in linezolid susceptibility for any of the introduced single mutations was observed with the G2576U mutation at a position that is 7.9 Å from linezolid....... Smaller decreases were observed with the A2503G, U2504G, and G2505A mutations at nucleotides proximal to linezolid, showing that the degree of resistance conferred is not simply inversely proportional to the nucleotide-drug distance. The double mutations G2032A-C2499A, G2032A-U2504G, C2055A-U2504G, and C...

  2. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    Science.gov (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  3. Identification of pathogenic Nocardia species by reverse line blot hybridization targeting the 16S rRNA and 16S-23S rRNA gene spacer regions.

    Science.gov (United States)

    Xiao, Meng; Kong, Fanrong; Sorrell, Tania C; Cao, Yongyan; Lee, Ok Cha; Liu, Ying; Sintchenko, Vitali; Chen, Sharon C A

    2010-02-01

    Although 16S rRNA gene sequence analysis is employed most often for the definitive identification of Nocardia species, alternate molecular methods and polymorphisms in other gene targets have also enabled species determinations. We evaluated a combined Nocardia PCR-based reverse line blot (RLB) hybridization assay based on 16S and 16S-23S rRNA gene spacer region polymorphisms to identify 12 American Type Culture Collection and 123 clinical Nocardia isolates representing 14 species; results were compared with results from 16S rRNA gene sequencing. Thirteen 16S rRNA gene-based (two group-specific and 11 species-specific) and five 16S-23S spacer-targeted (two taxon-specific and three species-specific) probes were utilized. 16S rRNA gene-based probes correctly identified 124 of 135 isolates (sensitivity, 92%) but were unable to identify Nocardia paucivorans strains (n = 10 strains) and a Nocardia asteroides isolate with a novel 16S rRNA gene sequence. Nocardia farcinica and Nocardia cyriacigeorgica strains were identified by the sequential use of an N. farcinica-"negative" probe and a combined N. farcinica/N. cyriacigeorgica probe. The assay specificity was high (99%) except for weak cross-reactivity between the Nocardia brasiliensis probe with the Nocardia thailandica DNA product; however, cross-hybridization with closely related nontarget species may occur. The incorporation of 16S-23S rRNA gene spacer-based probes enabled the identification of all N. paucivorans strains. The overall sensitivity using both probe sets was >99%. Both N. farcinica-specific 16S-23S rRNA gene spacer-directed probes were required to identify all N. farcinica stains by using this probe set. The study demonstrates the utility of a combined PCR/RLB assay for the identification of clinically relevant Nocardia species and its potential for studying subtypes of N. farcinica. Where species assignment is ambiguous or not possible, 16S rRNA gene sequencing is recommended.

  4. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... of a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension analysis...

  5. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  6. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  7. Functional interactions within 23S rRNA involving the peptidyltransferase center

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    resistance than either mutation alone. 23S rRNAs containing mutations at position 2058 that confer clindamycin and erythromycin resistance become deleterious to cell growth when combined with the 2032A mutation and, additionally, confer hypersensitivity to erythromycin and sensitivity to clindamycin...

  8. Recombination drives evolution of the Clostridium difficile 16S-23S rRNA intergenic spacer region.

    Science.gov (United States)

    Janezic, Sandra; Indra, Alexander; Rattei, Thomas; Weinmaier, Thomas; Rupnik, Maja

    2014-01-01

    PCR-ribotyping, a typing method based on size variation in 16S-23S rRNA intergenic spacer region (ISR), has been used widely for molecular epidemiological investigations of C. difficile infections. In the present study, we describe the sequence diversity of ISRs from 43 C. difficile strains, representing different PCR-ribotypes and suggest homologous recombination as a possible mechanism driving the evolution of 16S-23S rRNA ISRs. ISRs of 45 different lengths (ranging from 185 bp to 564 bp) were found among 458 ISRs. All ISRs could be described with one of the 22 different structural groups defined by the presence or absence of different sequence modules; tRNAAla genes and different combinations of spacers of different lengths (33 bp, 53 bp or 20 bp) and 9 bp direct repeats separating the spacers. The ISR structural group, in most cases, coincided with the sequence length. ISRs that were of the same lengths had also very similar nucleotide sequence, suggesting that ISRs were not suitable for discriminating between different strains based only on the ISR sequence. Despite large variations in the length, the alignment of ISR sequences, based on the primary sequence and secondary structure information, revealed many conserved regions which were mainly involved in maturation of pre-rRNA. Phylogenetic analysis of the ISR alignment yielded strong evidence for intra- and inter-homologous recombination which could be one of the mechanisms driving the evolution of C. difficile 16S-23S ISRs. The modular structure of the ISR, the high sequence similarities of ISRs of the same sizes and the presence of homologous recombination also suggest that different copies of C. difficile 16S-23S rRNA ISR are evolving in concert.

  9. Recombination drives evolution of the Clostridium difficile 16S-23S rRNA intergenic spacer region.

    Directory of Open Access Journals (Sweden)

    Sandra Janezic

    Full Text Available PCR-ribotyping, a typing method based on size variation in 16S-23S rRNA intergenic spacer region (ISR, has been used widely for molecular epidemiological investigations of C. difficile infections. In the present study, we describe the sequence diversity of ISRs from 43 C. difficile strains, representing different PCR-ribotypes and suggest homologous recombination as a possible mechanism driving the evolution of 16S-23S rRNA ISRs. ISRs of 45 different lengths (ranging from 185 bp to 564 bp were found among 458 ISRs. All ISRs could be described with one of the 22 different structural groups defined by the presence or absence of different sequence modules; tRNAAla genes and different combinations of spacers of different lengths (33 bp, 53 bp or 20 bp and 9 bp direct repeats separating the spacers. The ISR structural group, in most cases, coincided with the sequence length. ISRs that were of the same lengths had also very similar nucleotide sequence, suggesting that ISRs were not suitable for discriminating between different strains based only on the ISR sequence. Despite large variations in the length, the alignment of ISR sequences, based on the primary sequence and secondary structure information, revealed many conserved regions which were mainly involved in maturation of pre-rRNA. Phylogenetic analysis of the ISR alignment yielded strong evidence for intra- and inter-homologous recombination which could be one of the mechanisms driving the evolution of C. difficile 16S-23S ISRs. The modular structure of the ISR, the high sequence similarities of ISRs of the same sizes and the presence of homologous recombination also suggest that different copies of C. difficile 16S-23S rRNA ISR are evolving in concert.

  10. Structure of 23S rRNA hairpin 35 and its interaction with the tylosin-resistance methyltransferase RlmAII

    Science.gov (United States)

    Lebars, Isabelle; Yoshizawa, Satoko; Stenholm, Anne R.; Guittet, Eric; Douthwaite, Stephen; Fourmy, Dominique

    2003-01-01

    The bacterial rRNA methyltransferase RlmAII (formerly TlrB) contributes to resistance against tylosin-like 16-membered ring macrolide antibiotics. RlmAII was originally discovered in the tylosin-producer Streptomyces fradiae, and members of this subclass of methyltransferases have subsequently been found in other Gram-positive bacteria, including Streptococcus pneumoniae. In all cases, RlmAII methylates 23S rRNA at nucleotide G748, which is situated in a stem–loop (hairpin 35) at the macrolide binding site of the ribosome. The conformation of hairpin 35 recognized by RlmAII is shown here by NMR spectroscopy to resemble the anticodon loop of tRNA. The loop folds independently of the rest of the 23S rRNA, and is stabilized by a non-canonical G–A pair and a U-turn motif, rendering G748 accessible. Binding of S.pneumoniae RlmAII induces changes in NMR signals at specific nucleotides that are involved in the methyltransferase–RNA interaction. The conformation of hairpin 35 that interacts with RlmAII is radically different from the structure this hairpin adopts within the 50S subunit. This indicates that the hairpin undergoes major structural rearrangement upon interaction with ribosomal proteins during 50S assembly. PMID:12514124

  11. Chloroplast RNA-Binding Protein RBD1 Promotes Chilling Tolerance through 23S rRNA Processing in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    2016-05-01

    Full Text Available Plants have varying abilities to tolerate chilling (low but not freezing temperatures, and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance.

  12. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...... important exception, however, occurred at nucleotide A1067 within a terminal loop where thiostrepton protected the N-1 position while micrococcin rendered it more reactive. This difference correlates with the opposite effects of the two antibiotics on GTPase activity....

  13. Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

    Science.gov (United States)

    Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

    2016-10-01

    Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

  14. Ketolide antimicrobial activity persists after disruption of interactions with domain II of 23S rRNA.

    Science.gov (United States)

    Novotny, Guy W; Jakobsen, Lene; Andersen, Niels M; Poehlsgaard, Jacob; Douthwaite, Stephen

    2004-10-01

    Ketolides are the latest derivatives developed from the macrolide erythromycin to improve antimicrobial activity. All macrolides and ketolides bind to the 50S ribosomal subunit, where they come into contact with adenosine 2058 (A2058) within domain V of the 23S rRNA and block protein synthesis. An additional interaction at nucleotide A752 in the rRNA domain II is made via the synthetic carbamate-alkyl-aryl substituent in the ketolides HMR3647 (telithromycin) and HMR3004, and this interaction contributes to their improved activities. Only a few macrolides, including tylosin, come into contact with domain II of the rRNA and do so via interactions with nucleotides G748 and A752. We have disrupted these macrolide-ketolide interaction sites in the rRNA to assess their relative importance for binding. Base substitutions at A752 were shown to confer low levels of resistance to telithromycin but not to HMR3004, while deletion of A752 confers low levels of resistance to both ketolides. Mutations at position 748 confer no resistance. Substitution of guanine at A2058 gives rise to the MLS(B) (macrolide, lincosamide, and streptogramin B) phenotype, which confers resistance to all the drugs. However, resistance to ketolides was abolished when the mutation at position 2058 was combined with a mutation in domain II of the same rRNA. In contrast, the same dual mutations in rRNAs conferred enhanced resistance to tylosin. Our results show that the domain II interactions of telithromycin and HMR3004 differ from each other and from those of tylosin. The data provide no indication that mutations within domain II, either alone or in combination with an A2058 mutation, can confer significant levels of telithromycin resistance.

  15. Molecular characterization of the full-length 23S and 5S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Saito, Satoru; Sekizuka, Tsuyoshi; Murayama, Ohoshi; Takamiya, Shinzaburo; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2007-08-01

    An approximately 4.2 kbp region encoding 23S and 5S rRNA genes was identified when recombinant plasmid DNAs from two genomic DNA libraries and an inverse PCR product of Taylorella asinigenitalis UK-1 isolate were analyzed. Full-length genes of 23S rRNA (3,225 bp) and 5S rRNA (117 bp) of T. asinigenitalis are described. The present sequence analysis identified a non-coding hypothetically intrinsic transcription terminator region downstream of the 5S rRNA gene. The sequence, however, downstream of the 5S rRNA gene did not show any distal tRNA genes. Surprisingly, an intervening sequence (IVS) of 270 bp in length, including two specific tandem repeat units of 80 bp and one partial unit of 48 bp with unknown functions was identified in the first quarter of the 23S rRNA gene sequence. A second IVS of 70 bp in length was also identified in the central region of the 23S rRNA gene. In addition, by using PCR and sequencing procedures, two T. asinigenitalis isolates, UK-1 and UK-2, carried multiple IVSs in the first quarter and central regions. Moreover, the 23S rRNA fragmentation occurred in the UK-1 isolate. A phylogenetic analysis was first carried out based on the 23S rRNA sequence data from T. asinigenitalis UK-1 and 13 other beta-Proteobacteria. This is the first report of IVSs in the 23S rRNA gene from the beta-Proteobacteria.

  16. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    DEFF Research Database (Denmark)

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller

    2011-01-01

    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in other RNAs when...

  17. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase....... The investigation has identified essential amino acids and Cfr variants with altered reaction mechanisms and represents a first step towards understanding the structural basis of Cfr activity....... of a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension analysis...

  18. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal...... cause of drug resistance in some clinical pathogens. The 2058G mutation disrupts the drug-domain V contact and leads to a further > 25 000-fold decrease in the binding of RU 56006. Drug binding to resistant ribosomes can be improved over 3000-fold by forming an alternative and more effective contact...... to A752 via alkyl-aryl groups linked to a carbamate at the drug 11/12 position (in the ketolide antibiotics HMR 3647 and HMR 3004). The data indicate that simultaneous drug interactions with domains II and V strengthen binding and that the domain II contact is of particular importance to achieve...

  19. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    DEFF Research Database (Denmark)

    Xiong, L; Kloss, P; Douthwaite, S

    2000-01-01

    , we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis...

  20. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Douthwaite, S

    1994-01-01

    investigated what structural elements in 23S rRNA are required for specific recognition by the ErmE methyltransferase. The ermE gene was cloned into R1 plasmid derivatives, providing a means of inducible expression in Escherichia coli. Expression of the methyltransferase in vivo confers resistance...... to erythromycin and clindamycin. The degree of resistance corresponds to the level of ermE expression. In turn, ermE expression also correlates with the proportion of 23S rRNA molecules that are dimethylated at adenine 2058. The methyltransferase was isolated in an active, concentrated form from E. coli......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  1. Identification and characterization of intervening sequences within 23S rRNA genes from more than 200 Campylobacter isolates from seven species including atypical campylobacters

    Directory of Open Access Journals (Sweden)

    Millar Beverley C

    2009-12-01

    Full Text Available Abstract Background Identification and characterization of intervening sequences (IVSs within 23S rRNA genes from Campylobacter organisms including atypical campylobacters were carried out using two PCR primer pairs, designed to generate helix 25 and 45 regions. Results Only C. sputorum biovar sputorum LMG7975 and fecalis LMG8531, LMG8534 and LMG6728 of a total of 204 Campylobacter isolates (n = 56 C. jejuni; n = 11 C. coli; n = 33 C. fetus; n = 43 C. upsaliensis; n = 30 C. hyointestinalis; n = 4 C. sputorum biovar sputorum; n = 5 C. sputorum biovar fecalis; n = 5 C. sputorum biovar paraureolyticus; n = 10 C. concisus; n = 7 C. curvus were shown to carry IVSs in helix 25 region. C. sputorum biovar fecalis LMG8531 and LMG8534, interestingly, carried two different kinds of the 23S rRNA genes with and without the IVS, respectively. Consequently, in a total of 265 isolates of 269, including 65 C. lari isolates examined previously, the absence of IVSs was identified in the helix 25 region. In the helix 45 region, all the C. hyointestinalis, C. sputorum and C. concisus isolates were shown not to carry any IVSs. However, the 30 of 56 C. jejuni isolates (54%, 5 of 11 C. coli (45%, 25 of 33 C. fetus (76%, 30 of 43 C. upsaliensis (70% and 6 of 7 C. curvus (90% were shown to carry IVSs. In C. jejuni and C. upsaliensis isolates, two different kinds of the 23S rRNA genes were also identified to occur with and without IVSs in the helix 45 region, respectively. Conclusions Secondary structure models were also constructed with all the IVSs identified in the present study. In the purified RNA fractions from the isolates which carried the 16S or 23S rRNA genes with the IVSs, no 16S or 23S rRNA was evident, respectively.

  2. Resistance to the macrolide antibiotic tylosin is conferred by single methylations at 23S rRNA nucleotides G748 and A2058 acting in synergy

    Science.gov (United States)

    Liu, Mingfu; Douthwaite, Stephen

    2002-01-01

    The macrolide antibiotic tylosin has been used extensively in veterinary medicine and exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin-synthesizing strains of the Gram-positive bacterium Streptomyces fradiae protect themselves from their own product by differential expression of four resistance determinants, tlrA, tlrB, tlrC, and tlrD. The tlrB and tlrD genes encode methyltransferases that add single methyl groups at 23S rRNA nucleotides G748 and A2058, respectively. Here we show that methylation by neither TlrB nor TlrD is sufficient on its own to give tylosin resistance, and resistance is conferred by the G748 and A2058 methylations acting together in synergy. This synergistic mechanism of resistance is specific for the macrolides tylosin and mycinamycin that possess sugars extending from the 5- and 14-positions of the macrolactone ring and is not observed for macrolides, such as carbomycin, spiramycin, and erythromycin, that have different constellations of sugars. The manner in which the G748 and A2058 methylations coincide with the glycosylation patterns of tylosin and mycinamycin reflects unambiguously how these macrolides fit into their binding site within the bacterial 50S ribosomal subunit. PMID:12417742

  3. Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history

    Directory of Open Access Journals (Sweden)

    Ma Junling

    2008-05-01

    Full Text Available Abstract Background A2143G mutation of 23S rRNA gene of H. pylori results in clarithromycin (CLR resistance. To investigate the prevalence of the CLR resistance-related A2143G mutation of the H. pylori-specific 23S rRNA gene in Chinese subjects with and without CLR use history, 307 subjects received the treatment with amoxicillin and omeprazole (OA and 310 subjects received a placebo in 1995, and 153 subjects received a triple therapy with OA and CLR (OAC in 2000. DNA was extracted from fasting gastric juice at the end of the intervention trial in 2003. H. pylori infection was determined by H. pylori-specific 23S rRNA PCR, ELISA, and13C-urea breath test assays. Mutations of the 23S rRNA gene were detected by RFLP assays. Results The presence of 23S rRNA due to H. pylori infection in the OA group remained lower than that in the placebo group 7.3 yrs after OA-therapy [51.1% (157/307 vs. 83.9% (260/310, p = 0.0000]. In the OAC group, the 23S rRNA detection rate was 26.8% (41/153 three yrs after OAC-treatment. The A2143G mutation rate among the 23S rRNA-positive subjects in the OAC group [31.7% (13/41] was significantly higher than that in the OA group [10.2% (16/157] and the placebo group [13.8% (36/260]. The frequency of the AAGGG → CTTCA (2222–2226 and AACC → GAAG (2081–2084 sequence alterations in the OAC group was also significantly higher than those in the OA group and the placebo group. Conclusion Primary prevalence of the A2143G mutation was 10~14% among Chinese population without history of CLR therapy. Administration of CLR to eliminate H. pylori infection increased the prevalence of the A2143G mutation in Chinese subjects (32% significantly.

  4. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Okamura, K; Hisada, T; Takata, K; Hiraishi, A

    2013-01-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  5. Methylation of 23S rRNA caused by tlrA (ermSF), a tylosin resistance determinant from Streptomyces fradiae.

    Science.gov (United States)

    Zalacain, M; Cundliffe, E

    1989-01-01

    Ribosomes from Streptomyces griseofuscus expressing tlrA, a resistance gene isolated from the tylosin producer Streptomyces fradiae, are resistant to macrolide and lincosamide antibiotics in vitro. The tlrA product was found to be a methylase that introduces two methyl groups into a single base within 23S rRNA, generating N6,N6-dimethyladenine at position 2058. This activity is therefore similar to the ermE resistance mechanism in Saccharopolyspora erythraea (formerly Streptomyces erythraeus). Images PMID:2753855

  6. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    Science.gov (United States)

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.

  7. Phylogenetic diversity of indigenous cowpea bradyrhizobia from soils in Japan based on sequence analysis of the 16S-23S rRNA internal transcribed spacer (ITS) region.

    Science.gov (United States)

    Sarr, Papa Saliou; Yamakawa, Takeo; Saeki, Yuichi; Guisse, Aliou

    2011-06-01

    Cowpea [Vigna unguiculata (L.) Walp.] is an important legume crop and yet its rhizobia have not been well characterized in many areas. In the present study, sequence analysis of the bacterial 16S-23S rRNA internal transcribed spacer (ITS) region was performed to characterize genetically 76 indigenous cowpea rhizobia from five different geographic regions (Okinawa, Miyazaki, Kyoto, Fukushima and Hokkaido) of Japan. The sequence analysis clustered all isolates in the genus Bradyrhizobium. They were conspecific with B. japonicum, B. yuanmingense, B. elkanii and Bradyrhizobium sp., although none of them grouped with B. liaoningense, B. canariense, B. betae or B. iriomotense. B. yuanmingense was only isolated from the southern region (Okinawa) where it achieved the highest frequency of 69%. B. japonicum was predominant at Miyazaki, Fukushima and Hokkaido with more than 60% of the isolates. B. elkanii was mainly recorded in the southern (Okinawa: 31%, Miyazaki: 33%) and middle (Kyoto: 33%) regions. This species was present at a very low frequency in Fukushima and absent in Hokkaido in the northern area. Bradyrhizobium sp. like-strains were absent in the southern part (Okinawa, Miyazaki) but were concentrated either in the middle regions with 67% of Kyoto isolates and 28% of Fukushima isolates, and in the northern region with 40% of the Hokkaido isolates. This study revealed a geographical distribution of cowpea bradyrhizobia which seemed to be related to the differences in the environmental characteristics (soil type and soil pH, temperature, climate, moisture) of the different regions in Japan. Copyright © 2011 Elsevier GmbH. All rights reserved.

  8. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...

  9. Identification of a Novel G2073A Mutation in 23S rRNA in Amphenicol-Selected Mutants of Campylobacter jejuni

    Science.gov (United States)

    Naren, Gaowa; Li, Hui; Xia, Xi; Wu, Congming; Shen, Jianzhong; Zhang, Qijing; Wang, Yang

    2014-01-01

    Objectives This study was conducted to examine the development and molecular mechanisms of amphenicol resistance in Campylobacter jejuni by using in vitro selection with chloramphenicol and florfenicol. The impact of the resistance development on growth rates was also determined using in vitro culture. Methods Chloramphenicol and florfenicol were used as selection agents to perform in vitro stepwise selection. Mutants resistant to the selective agents were obtained from the selection process. The mutant strains were compared with the parent strain for changes in MICs and growth rates. The 23S rRNA gene and the L4 and L22 ribosomal protein genes in the mutant strains and the parent strain were amplified and sequenced to identify potential resistance-associated mutations. Results C. jejuni strains that were highly resistant to chloramphenicol and florfenicol were obtained from in vitro selection. A novel G2073A mutation in all three copies of the 23S rRNA gene was identified in all the resistant mutants examined, which showed resistance to both chloramphenicol and florfenicol. In addition, all the mutants selected by chloramphenicol also exhibited the G74D modification in ribosomal protein L4, which was previously shown to confer a low-level erythromycin resistance in Campylobacter species. The mutants selected by florfenicol did not have the G74D mutation in L4. Notably, the amphenicol-resistant mutants also exhibited reduced susceptibility to erythromycin, suggesting that the selection resulted in cross resistance to macrolides. Conclusions This study identifies a novel point mutation (G2073A) in 23S rRNA in amphenicol-selected mutants of C. jejuni. Development of amphenicol resistance in Campylobacter likely incurs a fitness cost as the mutant strains showed slower growth rates in antibiotic-free media. PMID:24728007

  10. Resistance mechanisms of linezolid-nonsusceptible enterococci in Korea: low rate of 23S rRNA mutations in Enterococcus faecium.

    Science.gov (United States)

    Lee, Sae-Mi; Huh, Hee Jae; Song, Dong Joon; Shim, Hyang Jin; Park, Kyung Sun; Kang, Cheol-In; Ki, Chang-Seok; Lee, Nam Yong

    2017-12-01

    To investigate linezolid-resistance mechanisms in linezolid-nonsusceptible enterococci (LNSE) isolated from a tertiary hospital in Korea. Enterococcal isolates exhibiting linezolid MICs ≥4 mg l -1 that were isolated between December 2011 and May 2016 were investigated by PCR and sequencing for mutations in 23S rRNA or ribosomal proteins (L3, L4 and L22) and for the presence of cfr, cfr(B) and optrA genes.Results/Key findings. Among 135 LNSE (87 Enterococcus faecium and 48 Enterococcus faecalis isolates), 39.1 % (34/87) of E. faecium and 18.8 % (9/48) of E. faecalis isolates were linezolid-resistant. The optrA carriage was the dominant mechanism in E. faecalis: 13 isolates, including 10 E. faecalis [70 % (7/10) linezolid-resistant and 30 % (3/10) linezolid-intermediate] and three E. faecium [33.3 % (1/3) linezolid-resistant and 66.7 % (2/3) linezolid-intermediate], contained the optrA gene. G2576T mutations in the 23S rRNA gene were detected only in E. faecium [14 isolates; 71.4 % (10/14) linezolid-resistant and 28.6 % (4/14) linezolid-intermediate]. One linezolid-intermediate E. faecium harboured a L22 protein alteration (Ser77Thr). No isolates contained cfr or cfr(B) genes and any L3 or L4 protein alterations. No genetic mechanism of resistance was identified for 67.6 % (23/34) of linezolid-resistant E. faecium. A low rate of 23S rRNA mutations and the absence of known linezolid-resistance mechanisms in the majority of E. faecium isolates suggest regional differences in the mechanisms of linezolid resistance and the possibility of additional mechanisms.

  11. Variation of 16S-23S rRNA intergenic spacer regions (ISRs) in Acinetobacter baylyi (strain B2) isolated from activated sludge.

    Science.gov (United States)

    Carr, Emma L; Gürtler, Volker; Seviour, Robert J

    2004-08-01

    To determine the variability of the 16S-23S rRNA intergenic spacer region (ISR) of the newly described Acinetobacter baylyi, 88 clones containing ISR amplicons were screened and 14 chosen for further analysis. Two different sized 16S-23S rRNA ISRs were distinguished comprising five variable and four conserved nucleotide blocks. The major regions of heterogeneity between the different sized ISRs were due to blocks of substitutions with unique secondary structures interspersed with nucleotide substitutions, rather than differences caused by presence or absence of tRNA genes, which is often the case. Recombination events causing shuffling of nucleotide blocks are considered the most likely explanation for the mosaic structure observed between the different copies of the ISR. Single base differences present in the long ISR (LISR) were then exploited in attempts to detect possible heterogeneity between rrn copies in Acinetobacter baylyi but variability was not detected by RFLP analysis of LISR-specific PCR products. These primers were shown to be highly specific for 3 Acinetobacter baylyi strains based on LISR sequence homogeneity.

  12. A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

    Science.gov (United States)

    Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

    2018-01-01

    In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2008-01-01

    Methylation at the 5-position of cytosine [m(5)C (5-methylcytidine)] occurs at three RNA nucleotides in Escherichia coli. All these modifications are at highly conserved nucleotides in the rRNAs, and each is catalyzed by its own m(5)C methyltransferase enzyme. Two of the enzymes, RsmB and Rsm......F, are already known and methylate 16S rRNA at nucleotides C967 and C1407, respectively. Here, we report the identity of the third E. coli m(5)C methyltransferase. Analysis of rRNAs by matrix-assisted laser desorption/ionization mass spectrometry showed that inactivation of the yccW gene leads to loss of m(5)C....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...

  14. Maternal oral origin of Fusobacterium nucleatum in adverse pregnancy outcomes as determined using the 16S-23S rRNA gene intergenic transcribed spacer region.

    Science.gov (United States)

    Gonzales-Marin, Cecilia; Spratt, David A; Allaker, Robert P

    2013-01-01

    Fusobacterium nucleatum, a common Gram-negative anaerobe prevalent in the oral cavity, possesses the ability to colonize the amniotic cavity and the fetus. However, F. nucleatum may also be part of the vaginal microbiota from where it could reach the amniotic tissues. Due to the heterogeneity of F. nucleatum, consisting of five subspecies, analysis at the subspecies/strain level is desirable to determine its precise origin. The aims of this study were: (i) to evaluate the use of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region as a tool to differentiate subspecies of F. nucleatum, and (ii) to design a simplified technique based on the ITS to determine the origin of F. nucleatum strains associated with adverse pregnancy outcomes. Amplified fragments of the 16S-23S rRNA gene ITS region corresponding to the five subspecies of F. nucleatum were subjected to cloning and sequencing to characterize the different ribosomal operons of the subspecies. Distinctive length and sequence patterns with potential to be used for identification of the subspecies/strain were identified. These were used to evaluate the origin of F. nucleatum identified in neonatal gastric aspirates (swallowed amniotic fluid) by sequence comparisons with the respective oral and vaginal maternal samples. A simplified technique using a strain-specific primer in a more sensitive nested PCR was subsequently developed to analyse ten paired neonatal-maternal samples. Analysing the variable fragment of the ITS region allowed the identification of F. nucleatum subsp. polymorphum from an oral origin as potentially being involved in neonatal infections. Using a strain-specific primer, the F. nucleatum subsp. polymorphum strain was detected in both neonatal gastric aspirates and maternal oral samples in cases of preterm birth from mothers presenting with localized periodontal pockets. Interestingly, the same strain was not present in the vaginal sample of any case investigated. The 16S-23S rRNA

  15. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth......We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic...... distinct populations over the vertical interval. We were unable to identify patterns in genetic variation in Synechococcus 16S rRNA sequences that correlate with different vertically distributed populations. However, patterns of variation at the internal transcribed spacer locus separating 16S and 23S r...

  16. Molecular identification and characterization of the intervening sequences (IVSs) within 23S ribosomal RNA (rRNA) genes of Taylorella asinigenitalis isolated in France.

    Science.gov (United States)

    Tazumi, Akihiro; Petry, Sandrine; Hayashi, Kyohei; Moore, John E; Millar, Beverley C; Matsuda, Motoo

    2012-02-01

    In the helix 25 region, 32 French Taylorella asinigenitalis isolates carried at least one 23S rRNA gene not containing intervening sequences (IVSs). No IVSs in the region were identified in three isolates and the other remaining 29 isolates carried one or more IVSs (UCD-1(T)IVS1A, UCD-1(T)IVS1B and UK-1IVS1B) described already and two new kinds of IVS (TaIVS1C and TaIVS1D). In the helix 45 region, no T. asinigenitalis isolates not carrying any IVSs were identified. UK-1IVS2B was identified in the region from 26 isolates. Five new kinds of IVSs (TaIVS2D, E, F, G and H) occurred in the region in the 13 isolates. Distinctly different tandem repeat units (RS48 and RS32 and RS-A, -B and -C) were evident in both regions, respectively, from the French (n=32) and American (n=3) T. asinigenitalis isolates. Thus, several different kinds of tandem repeat units and their combinations in IVSs in both regions within the gene were shown in 32 French isolates. Copyright © 2010 Elsevier Ltd. All rights reserved.

  17. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  18. A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

    DEFF Research Database (Denmark)

    Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien

    2011-01-01

    Escherichia coli possesses three paralogues. These comprise the methyltransferases TrmA that targets U54 in tRNAs, RlmC that modifies U747 in 23S rRNA and RlmD that is specific for U1939 in 23S rRNA. The tRNAs and rRNAs of the Gram-positive bacterium Bacillus subtilis have the same three m(5)U modifications....... However, as previously shown, the m(5)U54 modification in B. subtilis tRNAs is catalysed in a fundamentally different manner by the folate-dependent enzyme TrmFO, which is unrelated to the E. coli TrmA. Here, we show that methylation of U747 and U1939 in B. subtilis rRNA is catalysed by a single enzyme...

  19. The Unusual 23S rRNA Gene of Coxiella burnetii: Two Self-Splicing Group I Introns Flank a 34-Base-Pair Exon, and One Element Lacks the Canonical ΩG▿

    Science.gov (United States)

    Raghavan, Rahul; Miller, Scott R.; Hicks, Linda D.; Minnick, Michael F.

    2007-01-01

    We describe the presence and characteristics of two self-splicing group I introns in the sole 23S rRNA gene of Coxiella burnetii. The two group I introns, Cbu.L1917 and Cbu.L1951, are inserted at sites 1917 and 1951 (Escherichia coli numbering), respectively, in the 23S rRNA gene of C. burnetii. Both introns were found to be self-splicing in vivo and in vitro even though the terminal nucleotide of Cbu.L1917 is adenine and not the canonical conserved guanine, termed ΩG, found in Cbu.L1951 and all other group I introns described to date. Predicted secondary structures for both introns were constructed and revealed that Cbu.L1917 and Cbu.L1951 were group IB2 and group IA3 introns, respectively. We analyzed strains belonging to eight genomic groups of C. burnetii to determine sequence variation and the presence or absence of the elements and found both introns to be highly conserved (≥99%) among them. Although phylogenetic analysis did not identify the specific identities of donors, it indicates that the introns were likely acquired independently; Cbu.L1917 was acquired from other bacteria like Thermotoga subterranea and Cbu.L1951 from lower eukaryotes like Acanthamoeba castellanii. We also confirmed the fragmented nature of mature 23S rRNA in C. burnetii due to the presence of an intervening sequence. The presence of three selfish elements in C. burnetii's 23S rRNA gene is very unusual for an obligate intracellular bacterium and suggests a recent shift to its current lifestyle from a previous niche with greater opportunities for lateral gene transfer. PMID:17644584

  20. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two......, indicating that TlrB is the first member to be described in a new subclass of rRNA methyltransferases that are implicated in macrolide drug resistance....

  1. Development of an endpoint genotyping assay to detect the Mycoplasma pneumoniae 23S rRNA gene and distinguish the existence of macrolide resistance-associated mutations at position 2063.

    Science.gov (United States)

    Suzuki, Yu; Seto, Junji; Shimotai, Yoshitaka; Ikeda, Tatsuya; Yahagi, Kazue; Mizuta, Katsumi; Matsuzaki, Yoko; Hongo, Seiji

    2016-12-01

    The prevalence of macrolide-resistant Mycoplasma pneumoniae harboring a mutation in the 23S rRNA gene is increasing, and rapid detection assays are needed for clinical management. We developed an endpoint genotyping assay to detect the M. pneumoniae 23S rRNA gene and determine the existence of macrolide resistance-associated mutations at position 2063 (A2063G, A2063T and A2063C mutations). This A2063B genotyping assay detected more than 50 copies/reaction of the M. pneumoniae gene in every nucleotide mutation at position 2063. Of 42 clinical specimens, 3 were positive without mutation, 6 were positive with the A2063G mutation, and 33 were negative. The results were confirmed using nested PCR with the sequencing of the M. pneumoniae 23S rRNA gene, and a high sensitivity (90%), specificity (100%), and coincidence ratio (kappa coefficient=0.93) were obtained. Therefore, the A2063B genotyping assay is useful for the rapid discrimination of macrolide resistance mutations at position 2063. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  3. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  4. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N...... decreases, at one or more rRNA sites but, with the exception of chloramphenicol, did not affect cross-linking to the ribosomal proteins. Moreover, the effects were closely similar for both deacylated and N-Ac-Phe-tRNAs, indicating that the drugs selectively perturb the 3' terminus of the tRNA. The strongest...... decreases in the rRNA cross-links were observed with pristinamycin IIA and chloramphenicol, which correlates with their both producing complex chemical footprints on 23S rRNA within E. coli ribosomes. Furthermore, gougerotin and pristinamycin IA strongly increased the yields of fragments F2' (U2506) and F4...

  5. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides.

    Science.gov (United States)

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H; Mankin, Alexander S

    2015-10-20

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism.

  6. Multicentre surveillance of prevalence of the 23S rRNA A2058G and A2059G point mutations and molecular subtypes of Treponema pallidum in Taiwan, 2009-2013.

    Science.gov (United States)

    Wu, B-R; Yang, C-J; Tsai, M-S; Lee, K-Y; Lee, N-Y; Huang, W-C; Wu, H; Lee, C-H; Chen, T-C; Ko, W-C; Lin, H-H; Lu, P-L; Chen, Y-H; Liu, W-C; Yang, S-P; Wu, P-Y; Su, Y-C; Hung, C-C; Chang, S-Y

    2014-08-01

    Resistance mutations A2058G and A2059G, within the 23S rRNA gene of Treponema pallidum, have been reported to cause treatment failures in patients receiving azithromycin for syphilis. Genotyping of T. pallidum strains sequentially isolated from patients with recurrent syphilis is rarely performed. From September 2009 to August 2013, we collected 658 clinical specimens from 375 patients who presented with syphilis for genotyping to examine the number of 60-bp repeats in the acidic repeat protein (arp) gene, T. pallidum repeat (tpr) polymorphism, and tp0548 gene, and to detect A2058G and A2059G point mutations by restriction fragment length polymorphism. Treponemal DNA was identified in 45.2% (n = 298) of the specimens that were collected from 216 (57.6%) patients; 268 (40.7%) specimens tested positive for the 23S rRNA gene, and were examined for macrolide resistance. Two isolates (0.7%) harboured the A2058G mutation, and no A2059G mutation was identified. A total of 14 strains of T. pallidum were identified, with 14f/f (57.5%) and 14b/c (10.0%) being the two predominant strains. Forty patients who presented with recurrent episodes of syphilis had T. pallidum DNA identified from the initial and subsequent episodes, with five cases showing strain discrepancies. One patient had two strains identified from different clinical specimens collected in the same episode. Our findings show that 14f/f is the most common T. pallidum strain in Taiwan, where the prevalence of T. pallidum strains that show A2058G or A2059G mutation remains low. Different genotypes of T. pallidum can be identified in patients with recurrent episodes of syphilis. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  7. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    Science.gov (United States)

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis.

  8. Functional role of the C-terminal tail of the archaeal ribosomal stalk in recruitment of two elongation factors to the sarcin/ricin loop of 23S rRNA.

    Science.gov (United States)

    Imai, Hirotatsu; Miyoshi, Tomohiro; Murakami, Ryo; Ito, Kosuke; Ishino, Yoshizumi; Uchiumi, Toshio

    2015-07-01

    Two types of elongation factors alternate in their binding to the factor-binding center of the ribosome. Both binding events are accompanied by GTP hydrolysis and drive the translation elongation cycle. The multicopy ribosomal protein family, termed the stalk, contributes actively to the elongation process. Recent evidence indicates that the mobile C-terminal tail of archaeal stalk aP1 directly interacts with both the elongation factors aEF1A and aEF2. To investigate the functional significance of these interactions in recruitment of elongation factors to the factor-binding center of the ribosome, we substituted the archaeal stalk complex aL10•aP1 for the bL10•bL12 stalk complex in the Escherichia coli 50S subunit. The resultant hybrid ribosome accessed archaeal aEF1A and aEF2 in a manner dependent on the C-terminal tail containing the hydrophobic residues Leu103, Leu106 and Phe107. Bases G2659 and A2660 in the sarcin/ricin loop (SRL) of 23S rRNA were protected against DMS modification by both factors as was A1067 by aEF2. Mutagenesis indicated that this protection was dependent on the intact C-terminal tail of aP1. The results suggest a crucial role for the interactions between the stalk C-terminal tail and elongation factors in their recruitment to the SRL of 23S rRNA within the ribosome. © 2015 The Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

  9. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  10. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......' at nucleotides C2601/A2602, U2584/U2585 (F1'), U2506 (F2'), and A2062/C2063 (F4'). Each of these nucleotides lies within the peptidyl transferase loop region of the 23S rRNA. Cross-links were also formed with ribosomal proteins L27 (strong) and L33 (weak), as shown earlier. The antibiotics sparsomycin......, chloramphenicol, the streptogramins pristinamycin IA and IIA, gougerotin, lincomycin, and spiramycin were tested for their capacity to alter the identities or yields of each of the cross-links. Although no new cross-links were detected, each of the drugs produced major changes in cross-linking yields, mainly...

  11. Evaluation of PacBio sequencing for full-length bacterial 16S rRNA gene classification.

    Science.gov (United States)

    Wagner, Josef; Coupland, Paul; Browne, Hilary P; Lawley, Trevor D; Francis, Suzanna C; Parkhill, Julian

    2016-11-14

    Currently, bacterial 16S rRNA gene analyses are based on sequencing of individual variable regions of the 16S rRNA gene (Kozich, et al Appl Environ Microbiol 79:5112-5120, 2013).This short read approach can introduce biases. Thus, full-length bacterial 16S rRNA gene sequencing is needed to reduced biases. A new alternative for full-length bacterial 16S rRNA gene sequencing is offered by PacBio single molecule, real-time (SMRT) technology. The aim of our study was to validate PacBio P6 sequencing chemistry using three approaches: 1) sequencing the full-length bacterial 16S rRNA gene from a single bacterial species Staphylococcus aureus to analyze error modes and to optimize the bioinformatics pipeline; 2) sequencing the full-length bacterial 16S rRNA gene from a pool of 50 different bacterial colonies from human stool samples to compare with full-length bacterial 16S rRNA capillary sequence; and 3) sequencing the full-length bacterial 16S rRNA genes from 11 vaginal microbiome samples and compare with in silico selected bacterial 16S rRNA V1V2 gene region and with bacterial 16S rRNA V1V2 gene regions sequenced using the Illumina MiSeq. Our optimized bioinformatics pipeline for PacBio sequence analysis was able to achieve an error rate of 0.007% on the Staphylococcus aureus full-length 16S rRNA gene. Capillary sequencing of the full-length bacterial 16S rRNA gene from the pool of 50 colonies from stool identified 40 bacterial species of which up to 80% could be identified by PacBio full-length bacterial 16S rRNA gene sequencing. Analysis of the human vaginal microbiome using the bacterial 16S rRNA V1V2 gene region on MiSeq generated 129 operational taxonomic units (OTUs) from which 70 species could be identified. For the PacBio, 36,000 sequences from over 58,000 raw reads could be assigned to a barcode, and the in silico selected bacterial 16S rRNA V1V2 gene region generated 154 OTUs grouped into 63 species, of which 62% were shared with the MiSeq dataset. The Pac

  12. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  13. Mycoplasma bovis isolates from dairy calves in Japan have less susceptibility than a reference strain to all approved macrolides associated with a point mutation (G748A) combined with multiple species-specific nucleotide alterations in 23S rRNA.

    Science.gov (United States)

    Sato, Toyotaka; Higuchi, Hidetoshi; Yokota, Shin-Ichi; Tamura, Yutaka

    2017-06-01

    Erythromycin, tylosin and tilmicosin are approved for use in cattle in Japan, the latter two being used to treat Mycoplasma bovis infection. In this study, 58 M. bovis isolates obtained from Japanese dairy calves all exhibited reduced susceptibility to these macrolides, this widespread reduced susceptibility being attributable to a few dominant lineages. All 58 isolates contained the G748A variant in both the rrl3 and rrl4 alleles of 23S rRNA, whereas a reference strain (PG45) did not. G748 localizes in the central loop of domain II (from C744 to A753) of 23S rRNA, which participates in binding to mycinose, a sugar residue present in both tylosin and tilmicosin. A number of in vitro-selected mutants derived from M. bovis PG45 showed reduced susceptibility to tylosin and tilmicosin and contained a nucleotide insertion within the central loop of domain II of rrl3 (U747-G748Ins_CU/GU or A743-U744Ins_UA), suggesting that mutations around G748 confer this reduced susceptibility phenotype. However, other Mycoplasma species containing G748A were susceptible to tylosin and tilmicosin. Sequence comparison with Escherichia coli revealed that M. bovis PG45 and isolates harbored five nucleotide alterations (U744C, G745A, U746C, A752C and A753G) in the central loop of domain II of 23S rRNA, whereas other Mycoplasma species lacked at least two of these five nucleotide alterations. It was therefore concluded that G748 mutations in combination with species-specific nucleotide alterations in the central loop of domain II of 23S rRNA are likely sufficient to reduce susceptibility of M. bovis to tylosin and tilmicosin. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  14. Fluoroscence in situ hybridization of chicken intestinal samples with bacterial rRNA targeted oligonucleotide probes

    DEFF Research Database (Denmark)

    Olsen, Katja Nyholm; Francesch, M.; Christensen, Henrik

    2006-01-01

    The objective was to develop a fast and accurate molecular method for the quantification of the intestinal flora in chickens by rRNA fluorescence in situ hybridization (FISH). Seven weeks old conventionally reared Lohmann hens were used to set up the method. To sample ileal intestinal content...... were hybridized for 24-72h, centrifuged, washed with pre-heated hybridization buffer, centrifuged and resuspended in Millipore quality water before filtration onto a 0.22 µm black polycarbonate filter. The probes used in this study were, LGC354A, LGC354B, LGC354C, Strc493, Bacto1080, Sal3, Chis150, EUB...... were counted by the EUB338 probe. Three weeks old male broiler Ross 308 chickens were used to investigate the bacterial composition of the intestine. The birds received a wheat-barley diet. Counts with the EUB338 probe were 1.97x108(std 1.45x108) The means of counts obtained with probes targeting the r...

  15. Spatial patterns of bacterial taxa in nature reflect ecological traits of deep branches of the 16S rRNA bacterial tree

    Czech Academy of Sciences Publication Activity Database

    Philippot, L.; Bru, D.; Saby, N.P.A.; Čuhel, Jiří; Arrouays, D.; Šimek, Miloslav; Hallin, S.

    2009-01-01

    Roč. 11, č. 12 (2009), s. 3096-3104 ISSN 1462-2912 R&D Projects: GA MŠk LC06066; GA AV ČR IAA600660605 Institutional research plan: CEZ:AV0Z60660521 Keywords : spatial patterns * bacterial taxa * 16S rRNA bacterial tree Subject RIV: EH - Ecology, Behaviour Impact factor: 4.909, year: 2009

  16. Development of a 9600-clone procedure for oligonucleotide fingerprinting of rRNA genes: utilization to identify soil bacterial rRNA genes that correlate in abundance with the development of avocado root rot.

    Science.gov (United States)

    Bent, Elizabeth; Yin, Bei; Figueroa, Andres; Ye, Jingxiao; Fu, Qi; Liu, Zheng; McDonald, Virginia; Jeske, Daniel; Jiang, Tao; Borneman, James

    2006-10-01

    Oligonucleotide fingerprinting of rRNA genes (OFRG) is an array-based method that generates microbial community profiles through analysis of rRNA gene clone libraries. The original OFRG method allowed 1536 clones to be analyzed per experiment. This report describes a procedure for analyzing 9600 clones per experiment, including a new probe set for bacterial analysis, and improved data processing and statistical analysis tools. The software tools are available at the OFRG website (). Use of the 9600-clone procedure was demonstrated by examining the bacterial rRNA gene compositions of soils subjected to various temperature treatments. These treatments produced a series of soils with a range of abilities to suppress avocado root rot, enabling the identification of bacterial rRNA genes that correlate in abundance with root rot suppressiveness. OFRG analysis of these soils produced 8876 bacterial rRNA gene fingerprints grouped into 5123 clusters, or operational taxonomic units (OTUs). Eleven OTUs exhibited a positive correlation between the number of clones and the percentage of healthy roots. An in silico analysis was performed to examine the relationship between the number of rRNA genes analyzed and the number of correlates (rRNA gene-avocado root rot symptoms) identified. As the number of clones decreased, fewer correlates were identified. To further increase the throughput of the OFRG method, use of a glass slide-fluorescent probe microarray format was also explored.

  17. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...

  18. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

    Science.gov (United States)

    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

    2015-03-01

    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

  19. How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

    Science.gov (United States)

    Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

    2018-03-15

    The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA

  20. Modified 16S-23S rRNA intergenic region restriction endonuclease analysis for species identification of Enterococcus strains isolated from pigs, compared with identification using classical methods and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Zięba, Przemysław; Trościańczyk, Aleksandra; Banach, Tomasz; Kowalski, Cezary

    2015-03-01

    Fast and reliable identification of bacteria to at least the species level is currently the basis for correct diagnosis and appropriate treatment of infections. This is particularly important in the case of bacteria of the genus Enterococcus, whose resistance profile is often correlated with their species (e.g. resistance to vancomycin). In this study, we evaluated restriction endonuclease analysis of the 16S-23S rRNA gene intergenic transcribed spacer (ITS) region for species identification of Enterococcus. The utility of the method was compared with that of phenotypic methods [biochemical profile evaluation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)]. Identification was based on 21 Enterococcus reference strains, of the species E. faecalis, E. faecium, E. hirae, E. durans, E. casseliflavus, E. gallinarum, E. avium, E. cecorum and E. columbae, and 47 Enterococcus field strains isolated from pigs. Restriction endonuclease analysis of the ITS-PCR product using HinfI, RsaI and MboI, in the order specified, enabled species differentiation of the Enterococcus reference and field strains, and in the case of the latter, the results of species identification were identical (47/47) to those obtained by MALDI-TOF MS. Moreover, as a result of digestion with MboI, a unique restriction profile was also obtained for the strains (3/3) identified by MALDI-TOF MS as E. thailandicus. In our opinion, restriction endonuclease analysis of the 16S-23S rRNA gene ITS region of Enterococcus may be a simple and relatively fast (less than 4 h) alternative method for identifying the species occurring most frequently in humans and animals. © 2015 The Authors.

  1. Modeling the integration of bacterial rRNA fragments into the human cancer genome.

    Science.gov (United States)

    Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C

    2016-03-21

    Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.

  2. Fluoroscence in situ hybridization of chicken intestinal samples with bacterial rRNA targeted oligonucleotide probes

    DEFF Research Database (Denmark)

    Olsen, Katja Nyholm; Francesch, M.; Christensen, Henrik

    2006-01-01

    The objective was to develop a fast and accurate molecular method for the quantification of the intestinal flora in chickens by rRNA fluorescence in situ hybridization (FISH). Seven weeks old conventionally reared Lohmann hens were used to set up the method. To sample ileal intestinal content......, the distal part from Meckels diverticulum to the ileo-caecal junction was removed. Fixation was performed in ethanol and phosphate buffered saline. After washing by centrifugation, the sample was resuspended in pre-heated hybridization buffer with oligonucleotide probe labelled with Cy3 (10ng/µl). The cells...... were hybridized for 24-72h, centrifuged, washed with pre-heated hybridization buffer, centrifuged and resuspended in Millipore quality water before filtration onto a 0.22 µm black polycarbonate filter. The probes used in this study were, LGC354A, LGC354B, LGC354C, Strc493, Bacto1080, Sal3, Chis150, EUB...

  3. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  4. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA. Ev...

  5. Band smearing of PCR amplified bacterial 16S rRNA genes: dependence on initial PCR target diversity.

    Science.gov (United States)

    Zrimec, Jan; Kopinč, Rok; Rijavec, Tomaž; Zrimec, Tatjana; Lapanje, Aleš

    2013-11-01

    Band smearing in agarose gels of PCR amplified bacterial 16S rRNA genes is understood to comprise amplicons of varying sizes arising from PCR errors, and requires elimination. We consider that with amplified heterogeneous DNA, delayed electro-migration is caused not by PCR errors but by dsDNA structures that arise from imperfect strand pairing. The extent of band smearing was found to be proportional to the sequence heterogeneity in 16S rRNA variable regions. Denaturing alkaline gels showed that all amplified DNA was of the correct size. A novel bioinformatic approach was used to reveal that band smearing occurred due to imperfectly paired strands of the amplified DNA. Since the smear is a structural fraction of the correct size PCR product, it carries important information on richness and diversity of the target DNA. For accurate analysis, the origin of the smear must first be identified before it is eliminated by examining the amplified DNA in denaturing alkaline gels. © 2013 Elsevier B.V. All rights reserved.

  6. Soil bacterial diversity screening using single 16S rRNA gene V regions coupled with multi-million read generating sequencing technologies.

    Directory of Open Access Journals (Sweden)

    Sotirios Vasileiadis

    Full Text Available The novel multi-million read generating sequencing technologies are very promising for resolving the immense soil 16S rRNA gene bacterial diversity. Yet they have a limited maximum sequence length screening ability, restricting studies in screening DNA stretches of single 16S rRNA gene hypervariable (V regions. The aim of the present study was to assess the effects of properties of four consecutive V regions (V3-6 on commonly applied analytical methodologies in bacterial ecology studies. Using an in silico approach, the performance of each V region was compared with the complete 16S rRNA gene stretch. We assessed related properties of the soil derived bacterial sequence collection of the Ribosomal Database Project (RDP database and concomitantly performed simulations based on published datasets. Results indicate that overall the most prominent V region for soil bacterial diversity studies was V3, even though it was outperformed in some of the tests. Despite its high performance during most tests, V4 was less conserved along flanking sites, thus reducing its ability for bacterial diversity coverage. V5 performed well in the non-redundant RDP database based analysis. However V5 did not resemble the full-length 16S rRNA gene sequence results as well as V3 and V4 did when the natural sequence frequency and occurrence approximation was considered in the virtual experiment. Although, the highly conserved flanking sequence regions of V6 provide the ability to amplify partial 16S rRNA gene sequences from very diverse owners, it was demonstrated that V6 was the least informative compared to the rest examined V regions. Our results indicate that environment specific database exploration and theoretical assessment of the experimental approach are strongly suggested in 16S rRNA gene based bacterial diversity studies.

  7. Detection of bacterial 16S rRNA and identification of four clinically important bacteria by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Robert J Clifford

    Full Text Available Within the paradigm of clinical infectious disease research, Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa represent the four most clinically relevant, and hence most extensively studied bacteria. Current culture-based methods for identifying these organisms are slow and cumbersome, and there is increasing need for more rapid and accurate molecular detection methods. Using bioinformatic tools, 962,279 bacterial 16S rRNA gene sequences were aligned, and regions of homology were selected to generate a set of real-time PCR primers that target 93.6% of all bacterial 16S rRNA sequences published to date. A set of four species-specific real-time PCR primer pairs were also designed, capable of detecting less than 100 genome copies of A. baumannii, E. coli, K. pneumoniae, and P. aeruginosa. All primers were tested for specificity in vitro against 50 species of Gram-positive and -negative bacteria. Additionally, the species-specific primers were tested against a panel of 200 clinical isolates of each species, randomly selected from a large repository of clinical isolates from diverse areas and sources. A comparison of culture and real-time PCR demonstrated 100% concordance. The primers were incorporated into a rapid assay capable of positive identification from plate or broth cultures in less than 90 minutes. Furthermore, our data demonstrate that current targets, such as the uidA gene in E.coli, are not suitable as species-specific genes due to sequence variation. The assay described herein is rapid, cost-effective and accurate, and can be easily incorporated into any research laboratory capable of real-time PCR.

  8. 16S rRNA gene pyrosequencing reveals bacterial dysbiosis in the duodenum of dogs with idiopathic inflammatory bowel disease.

    Directory of Open Access Journals (Sweden)

    Jan S Suchodolski

    Full Text Available BACKGROUND: Canine idiopathic inflammatory bowel disease (IBD is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. METHODOLOGY/PRINCIPAL FINDINGS: Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6 and dogs with moderate IBD (n = 7 or severe IBD (n = 7 as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001. Proportions of Fusobacteria (p = 0.010, Bacteroidaceae (p = 0.015, Prevotellaceae (p = 0.022, and Clostridiales (p = 0.019 were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044 and Acinetobacter (p = 0.040, were either more abundant or more frequently identified in IBD dogs. CONCLUSIONS/SIGNIFICANCE: In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation.

  9. Bacterial community variations in an alfalfa-rice rotation system revealed by 16S rRNA gene 454-pyrosequencing.

    Science.gov (United States)

    Lopes, Ana R; Manaia, Célia M; Nunes, Olga C

    2014-03-01

    Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  10. Tissue-associated bacterial alterations in rectal carcinoma patients revealed by 16S rRNA community profiling

    Directory of Open Access Journals (Sweden)

    Andrew Maltez Thomas

    2016-12-01

    Full Text Available Sporadic and inflammatory forms of colorectal cancer (CRC account for more than 80% of cases. Recent publications have shown mechanistic evidence for the involvement of gut bacteria in the development of both CRC-forms. Whereas colon and rectal cancer have been routinely studied together as CRC, increasing evidence show these to be distinct diseases. Also, the common use of fecal samples to study microbial communities may reflect disease state but possibly not the tumor microenvironment. We performed this study to evaluate differences in bacterial communities found in tissue samples of 18 rectal-cancer subjects when compared to 18 non-cancer controls. Samples were collected during exploratory colonoscopy (non-cancer group or during surgery for tumor excision (rectal-cancer group. High throughput 16S rRNA amplicon sequencing of the V4-V5 region was conducted on the Ion PGM platform, reads were filtered using Qiime and clustered using UPARSE. We observed significant increases in species richness and diversity in rectal cancer samples, evidenced by the total number of OTUs and the Shannon and Simpson indexes. Enterotyping analysis divided our cohort into two groups, with the majority of rectal cancer samples clustering into one enterotype, characterized by a greater abundance of Bacteroides and Dorea. At the phylum level, rectal-cancer samples had increased abundance of candidate phylum OD1 (also known as Parcubacteria whilst non-cancer samples had increased abundance of Planctomycetes. At the genera level, rectal-cancer samples had higher abundances of Bacteroides, Phascolarctobacterium, Parabacteroides, Desulfovibrio and Odoribacter whereas non-cancer samples had higher abundances of Pseudomonas, Escherichia, Acinetobacter, Lactobacillus and Bacillus. Two Bacteroides fragilis OTUs were more abundant among rectal-cancer patients seen through 16S rRNA amplicon sequencing, whose presence was confirmed by immunohistochemistry and enrichment verified

  11. Cataloguing the bacterial community of the Great Salt Plains, Oklahoma using 16S rRNA based metagenomics pyrosequencing

    Directory of Open Access Journals (Sweden)

    Ahmed H. Gad

    2017-06-01

    Full Text Available The Great Salt Plains of Oklahoma (GSP is an extreme region, a hypersaline environment from marine origin and a unique area of the Salt National Wild Refuge in the north-central region of Oklahoma. In this study we analyzed the diversity and distribution of bacteria in two habitats; vegetated areas (GAB and salt flat areas (GAS in the sediments of GSP using the high-throughput techniques of 16S rRNA gene amplicon (V1-V2 regions metagenomics-454 pyrosequencing. The filtered sequences resulted to a total of 303,723 paired end reads were generated, assigned into 1646 numbers of OTUs and 56.4% G + C content for GAB, and a total of 144,496 paired end reads were generated, assigned into 785 numbers of OTUs and 56.7% G+ C content for GAS. All the resulting 16S rRNA was of an average length ~ 187 bp, assigned to 37 bacterial phyla and candidate divisions. The abundant OTUs were affiliated with Proteobacteria (36.2% in GAB and 31.5% in GAS, Alphaproteobacteria (13.3% in GAB and 8.7% in GAS, Gammaproteobacteria (13% in GAB and 14.2% in GAS, Deltaproteobacteria (6.5% in GAB and 6.1% in GAS, Betaproteobacteria (2.6% in GAB and 1.14% in GAS, Bacteroidetes (16.8% in GAB and 24.3% in GAS, Chloroflexi (8.7% in GAB and 6% in GAS, Actinobacteria (8.5% in GAB and 5.8% in GAS and Firmicutes (6.5% in GAB and 6.6% in GAS. This is the first study of a high resolution microbial phylogenetic profile of the GSP and the findings stipulate evidence of the bacterial heterogeneity that might be originated by surface and subsurface environments and better understanding of the ecosystem dynamics of GSP. Metagenome sequence data are available at NCBI with accession numbers; LT699840-LT700186.

  12. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  13. Secondary structure and domain architecture of the 23S and 5S rRNAs.

    Science.gov (United States)

    Petrov, Anton S; Bernier, Chad R; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C; Hsiao, Chiaolong; Stepanov, Victor G; Gaucher, Eric A; Grover, Martha A; Harvey, Stephen C; Hud, Nicholas V; Wartell, Roger M; Fox, George E; Williams, Loren Dean

    2013-08-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery).

  14. Secondary structure and domain architecture of the 23S and 5S rRNAs

    Science.gov (United States)

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  15. Comparison of bacterial communities in the Solimões and Negro River tributaries of the Amazon River based on small subunit rRNA gene sequences.

    Science.gov (United States)

    Peixoto, J C C; Leomil, L; Souza, J V; Peixoto, F B S; Astolfi-Filho, S

    2011-12-08

    The microbiota of the Amazon River basin has been little studied. We compared the structure of bacterial communities of the Solimões and Negro Rivers, the main Amazon River tributaries, based on analysis of 16S rRNA gene sequences. Water was sampled with a 3-L Van Dorn collection bottle; samples were collected at nine different points/depths totaling 27 L of water from each river. Total DNA was extracted from biomass retained by a 0.22-μm filter after sequential filtration of the water through 0.8- and 0.22-μm filters. The 16S rRNA gene was amplified by PCR, cloned and sequenced, and the sequences were analyzed with the PHYLIP and DOTUR programs to obtain the operational taxonomic units (OTUs) and to calculate the diversity and richness indices using the SPADE program. Taxonomic affiliation was determined using the naive Bayesian rRNA Classifier of the RDP II (Ribosomal Database Project). We recovered 158 sequences from the Solimões River grouped into 103 OTUs, and 197 sequences from the Negro River library grouped into 90 OTUs by the DOTUR program. The Solimões River was found to have a greater diversity of bacterial genera, and greater estimated richness of 446 OTUs, compared with 242 OTUs from the Negro River, as calculated by ACE estimator. The Negro River has less bacterial diversity, but more 16S rRNA gene sequences belonging to the bacterial genus Polynucleobacter were detected; 56 sequences from this genus were found (about 30% of the total sequences). We suggest that a more in-depth investigation be made to elucidate the role played by these bacteria in the river environment. These differences in bacterial diversity between Solimões and Negro Rivers could be explained by differences in organic matter content and pH of the rivers.

  16. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    International Nuclear Information System (INIS)

    Zhou, Jiemin; Zhou, Xuemei; Li, Yuguang; Xing, Jianmin

    2015-01-01

    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities

  17. [Characterizing Beijing's Airborne Bacterial Communities in PM2.5 and PM1 Samples During Haze Pollution Episodes Using 16S rRNA Gene Analysis Method].

    Science.gov (United States)

    Wang, Bu-ying; Lang, Ji-dong; Zhang, Li-na; Fang, Jian-huo; Cao, Chen; Hao, Ji-ming; Zhu, Ting; Tian, Geng; Jiang, Jing-kun

    2015-08-01

    During 8th-14th Jan., 2013, severe particulate matter (PM) pollution episodes happened in Beijing. These air pollution events lead to high risks for public health. In addition to various PM chemical compositions, biological components in the air may also impose threaten. Little is known about airborne microbial community in such severe air pollution conditions. PM2.5 and PM10 samples were collected during that 7-day pollution period. The 16S rRNA gene V3 amplification and the MiSeq sequencing were performed for analyzing these samples. It is found that there is no significant difference at phylum level for PM2.5 bacterial communities during that 7-day pollution period both at phylum and at genus level. At genus level, Arthrobacter and Frankia are the major airborne microbes presented in Beijing winter.samples. At genus level, there are 39 common genera (combined by first 50 genera bacterial of the two analysis) between the 16S rRNA gene analysis and those are found by Metagenomic analysis on the same PM samples. Frankia and Paracoccus are relatively more abundant in 16S rRNA gene data, while Kocuria and Geodermatophilus are relatively more abundant in Meta-data. PM10 bacterial communities are similar to those of PM2.5 with some noticeable differences, i.e., at phylum level, more Firmicutes and less Actinobacteria present in PM10 samples than in PM2.5 samples, while at genus level, more Clostridium presents in PM10 samples. The findings in Beijing were compared with three 16S rRNA gene studies in other countries. Although the sampling locations and times are different from each other, compositions of bacterial community are similar for those sampled at the ground atmosphere. Airborne microbial communities near the ground surface are different from those sampled in the upper troposphere.

  18. 16S rRNA PCR followed by restriction endonuclease digestion: a rapid approach for genus level identification of important enteric bacterial pathogens.

    Science.gov (United States)

    Vergis, J; Negi, M; Poharkar, K; Das, D P; Malik, S V S; Kumar, A; Doijad, S P; Barbuddhe, S B; Rawool, D B

    2013-12-01

    The study describes a rapid approach for detection of common enteric bacterial pathogens, which involves partial amplification of the 16S rRNA gene by PCR using a colony from selective medium followed by restriction enzyme (RE) digestion using the EcoRI, HindIII and SalI enzymes. On the basis of RE digestion analysis different genera namely, Escherichia, Salmonella, Shigella, Vibrio, Campylobacter, Arcobacter, Yesinia and Listeria were differentiated. © 2013.

  19. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  20. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S r...

  1. Bacterial fauna associating with chironomid larvae from lakes of Bengaluru city, India - A 16s rRNA gene based identification

    Directory of Open Access Journals (Sweden)

    Ramprasad Kuncham

    2017-06-01

    Full Text Available Chironomid larvae that inhabit in aquatic sediments play an important role as vector for bacterial pathogens. Its life cycle consists of four stages i.e. eggs, larvae, pupae and adult. In the present study we identified bacterial species associated with whole larvae of chironomids from 11 lake sediments of Bangalore region using 16s rRNA gene Sanger sequencing. We found that larvae from all lake sediments associated with bacterial species which include key pathogens. Totally we identified 65 bacterial isolates and obtained GenBank accession numbers (KX980423 - KX980487. Phylogenetic tree constructed using MEGA 7 software and tree analysis highlight the predominant bacterial community associated with larvae which include Enterobacteriaceae (43.08%; 28 isolates and Aeromonas (24.62%; 16 isolates, Shewanella, Delftia, Bacillus (6.15%; 4 isolates each, Pseudomonas (4.62%; 3 isolates and Exiguobacterium (3.08%; 2 isolates. Current findings state that among bacterial population Aeromonas, Enterobacter and Escherichia with serotypes are commonly associated with larvae in maximum lake points. In other hand Vibrio, Pseudomonas, Klebsiella, Shigella, Bacillus, and other bacterial species were identified moderately in all lakes. Interestingly, we identified first time Shigella Gram negative, rod shaped pathogenic organism of Enterobacteriaceae and Rheinheimera Gram negative, rod shaped organism associating chironomid larvae.

  2. Bacterial fauna associating with chironomid larvae from lakes of Bengaluru city, India - A 16s rRNA gene based identification.

    Science.gov (United States)

    Kuncham, Ramprasad; Sivaprakasam, Thiyagarajan; Puneeth Kumar, R; Sreenath, P; Nayak, Ravi; Thayumanavan, Tha; Subba Reddy, Gopireddy V

    2017-06-01

    Chironomid larvae that inhabit in aquatic sediments play an important role as vector for bacterial pathogens. Its life cycle consists of four stages i.e. eggs, larvae, pupae and adult. In the present study we identified bacterial species associated with whole larvae of chironomids from 11 lake sediments of Bangalore region using 16s rRNA gene Sanger sequencing. We found that larvae from all lake sediments associated with bacterial species which include key pathogens. Totally we identified 65 bacterial isolates and obtained GenBank accession numbers (KX980423 - KX980487). Phylogenetic tree constructed using MEGA 7 software and tree analysis highlight the predominant bacterial community associated with larvae which include Enterobacteriaceae (43.08%; 28 isolates) and Aeromonas (24.62%; 16 isolates), Shewanella , Delftia , Bacillus (6.15%; 4 isolates each), Pseudomonas (4.62%; 3 isolates) and Exiguobacterium (3.08%; 2 isolates). Current findings state that among bacterial population Aeromonas , Enterobacter and Escherichia with serotypes are commonly associated with larvae in maximum lake points. In other hand Vibrio , Pseudomonas , Klebsiella , Shigella , Bacillus , and other bacterial species were identified moderately in all lakes. Interestingly, we identified first time Shigella Gram negative, rod shaped pathogenic organism of Enterobacteriaceae and Rheinheimera Gram negative, rod shaped organism associating chironomid larvae.

  3. Benthic Bacterial Community Composition in the Oligohaline-Marine Transition of Surface Sediments in the Baltic Sea Based on rRNA Analysis

    Directory of Open Access Journals (Sweden)

    Julia Klier

    2018-02-01

    Full Text Available Salinity has a strong impact on bacterial community composition such that freshwater bacterial communities are very different from those in seawater. By contrast, little is known about the composition and diversity of the bacterial community in the sediments (bacteriobenthos at the freshwater-seawater transition (mesohaline conditions. In this study, partial 16S-rRNA sequences were used to investigate the bacterial community at five stations, representing almost freshwater (oligohaline to marine conditions, in the Baltic Sea. Samples were obtained from the silty, top-layer (0–2.5 cm sediments with mostly oxygenated conditions. The long water residence time characteristic of the Baltic Sea, was predicted to enable the development of autochthonous bacteriobenthos at mesohaline conditions. Our results showed that, similar to the water column, salinity is a major factor in structuring the bacteriobenthos and that there is no loss of bacterial richness at intermediate salinities. The bacterial communities of marine, mesohaline, and oligohaline sediments differed in terms of the relative rRNA abundances of the major bacterial phyla/classes. At mesohaline conditions typical marine and oligohaline operational taxonomic units (OTUs were abundant. Putative unique OTUs in mesohaline sediments were present only at low abundances, suggesting that the mesohaline environment consists mainly of marine and oligohaline bacteria with a broad salinity tolerance. Our study provides a first overview of the diversity patterns and composition of bacteria in the sediments along the Baltic Sea salinity gradient as well as new insights into the bacteriobenthos at mesohaline conditions.

  4. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Directory of Open Access Journals (Sweden)

    Bryan E. Dutton

    2002-12-01

    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  5. Combination of 16S rRNA variable regions provides a detailed analysis of bacterial community dynamics in the lungs of cystic fibrosis patients

    Directory of Open Access Journals (Sweden)

    Doud Melissa S

    2010-02-01

    Full Text Available Abstract Chronic bronchopulmonary bacterial infections remain the most common cause of morbidity and mortality among patients with cystic fibrosis (CF. Recent community sequencing work has now shown that the bacterial community in the CF lung is polymicrobial. Identifying bacteria in the CF lung through sequencing can be costly and is not practical for many laboratories. Molecular techniques such as terminal restriction fragment length polymorphism or amplicon length heterogeneity-polymerase chain reaction (LH-PCR can provide many laboratories with the ability to study CF bacterial communities without costly sequencing. The aim of this study was to determine if the use of LH-PCR with multiple hypervariable regions of the 16S rRNA gene could be used to identify organisms found in sputum DNA. This work also determined if LH-PCR could be used to observe the dynamics of lung infections over a period of time. Nineteen samples were analysed with the V1 and the V1_V2 region of the 16S rRNA gene. Based on the amplicon size present in the V1_V2 region, Pseudomonas aeruginosa was confirmed to be in all 19 samples obtained from the patients. The V1 region provided a higher power of discrimination between bacterial profiles of patients. Both regions were able to identify trends in the bacterial population over a period of time. LH profiles showed that the CF lung community is dynamic and that changes in the community may in part be driven by the patient's antibiotic treatment. LH-PCR is a tool that is well suited for studying bacterial communities and their dynamics.

  6. Spatial Distribution of Escherichia coli in the Mouse Large Intestine Inferred from rRNA In Situ Hybridization

    DEFF Research Database (Denmark)

    Poulsen, Lars Kærgaard; Lan, Fusheng; Sternberg, Claus

    1994-01-01

    Fluorescent oligonucleotide probes targeting rRNA were used to develop an in situ hybridization technique by which the spatial distribution of Escherichia coli in the large intestines of streptomycin-treated mice was determined. Single E. coli cells were identified in thin frozen sections from...... the large intestines by the use of a probe specific for E. coli 23S rRNA. Furthermore, the total bacterial population was visualized with an rRNA probe targeting the domain Bacteria. By this technique, all E. coli cells were seen embedded in the mucosal material overlying the epithelial cells of the large...

  7. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    Directory of Open Access Journals (Sweden)

    Annette K. Møller

    2013-04-01

    Full Text Available The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers of chloroplasts were also observed. In the deepest snow layer, large percentages of Firmicutes and Fusobacteria were seen. In freshwater, Bacteroidetes, Actinobacteria and Verrucomicrobia were the most abundant phyla while relatively few Proteobacteria and Cyanobacteria were present. Possibly, light intensity controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input of organic carbon and nitrogen to the heterotrophic bacteria. Thus, differences in the physicochemical conditions may play an important role in the processes leading to distinctive bacterial community structures in High-Arctic snow and freshwater.

  8. Rifaximin Reduces Markers of Inflammation and Bacterial 16S rRNA in Zambian Adults with Hepatosplenic Schistosomiasis: A Randomized Control Trial.

    Science.gov (United States)

    Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R; Kelly, Paul

    2018-02-12

    Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, IQR 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower ( P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased ( P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS.

  9. Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes.

    Science.gov (United States)

    Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita

    2015-12-01

    Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)]. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

  10. Vineyard soil bacterial diversity and composition revealed by 16S rRNA genes: Differentiation by vineyard management

    Science.gov (United States)

    Here, we demonstrate how vineyard management practices influence shifts in soil resources, which in turn affects shifts in soil-borne bacterial communities. The objective is to determine the hierarchical effects of management practices, soil attributes and location factors on the structure of soil-b...

  11. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2016-06-01

    Full Text Available We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5 and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungal community structure, replicate dispersion and the number of operational taxonomic units (OTUs retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation.

  12. Evaluation of the Bacterial Diversity in the Human Tongue Coating Based on Genus-Specific Primers for 16S rRNA Sequencing

    Directory of Open Access Journals (Sweden)

    Beili Sun

    2017-01-01

    Full Text Available The characteristics of tongue coating are very important symbols for disease diagnosis in traditional Chinese medicine (TCM theory. As a habitat of oral microbiota, bacteria on the tongue dorsum have been proved to be the cause of many oral diseases. The high-throughput next-generation sequencing (NGS platforms have been widely applied in the analysis of bacterial 16S rRNA gene. We developed a methodology based on genus-specific multiprimer amplification and ligation-based sequencing for microbiota analysis. In order to validate the efficiency of the approach, we thoroughly analyzed six tongue coating samples from lung cancer patients with different TCM types, and more than 600 genera of bacteria were detected by this platform. The results showed that ligation-based parallel sequencing combined with enzyme digestion and multiamplification could expand the effective length of sequencing reads and could be applied in the microbiota analysis.

  13. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides

    DEFF Research Database (Denmark)

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon

    2015-01-01

    activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken...... together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism.......Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces...

  14. Illumina sequencing of bacterial 16S rDNA and 16S rRNA reveals seasonal and species-specific variation in bacterial communities in four moss species.

    Science.gov (United States)

    Ma, Jing; Tang, Jing Yan; Wang, Su; Chen, Zhi Ling; Li, Xue Dong; Li, Yan Hong

    2017-09-01

    In order to better understand the factors that influence bacterial diversity and community composition in moss-associated bacteria, a study of bacterial communities in four moss species collected in three seasons was carried out via high-throughput sequencing of 16S rDNA and 16S rRNA. Moss species included Cratoneuron filicinum, Pylaisiella polyantha, Campyliadelphus polygamum, and Grimmia pilifera, with samples collected in May, July, and October 2015 from rocks at Beijing Songshan National Nature Reserve. In total, the bacterial richness and diversity were high regardless of moss species, sampling season, or data source (DNA vs. RNA). Bacterial sequences were assigned to a total of 558 OTUs and 279 genera in 16 phyla. Proteobacteria and Actinobacteria were the two most abundant phyla, and Cellvibrio, Lapillicoccus, Jatrophihabitans, Friedmanniella, Oligoflexus, and Bosea the most common genera in the samples. A clustering algorithm and principal coordinate analysis revealed that C. filicinum and C. polygamum had similar bacterial communities, as did P. polyantha and G. pilifera. Metabolically active bacteria showed the same pattern in addition to seasonal variation: bacterial communities were most similar in summer and autumn, looking at each moss species separately. In contrast, DNA profiles lacked obvious seasonal dynamics. A partial least squares discriminant analysis identified three groups of samples that correlated with differences in moss species resources. Although bacterial community composition did vary with the sampling season and data source, these were not the most important factors influencing bacterial communities. Previous reports exhibited that mosses have been widely used in biomonitoring of air pollution by enriching some substances or elements in the moss-tag technique and the abundant moss associated bacteria might also be important components involved in the related biological processes. Thus, this survey not only enhanced our understanding

  15. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections.

    Directory of Open Access Journals (Sweden)

    Stephen J Salipante

    Full Text Available Classifying individual bacterial species comprising complex, polymicrobial patient specimens remains a challenge for culture-based and molecular microbiology techniques in common clinical use. We therefore adapted practices from metagenomics research to rapidly catalog the bacterial composition of clinical specimens directly from patients, without need for prior culture. We have combined a semiconductor deep sequencing protocol that produces reads spanning 16S ribosomal RNA gene variable regions 1 and 2 (∼360 bp with a de-noising pipeline that significantly improves the fraction of error-free sequences. The resulting sequences can be used to perform accurate genus- or species-level taxonomic assignment. We explore the microbial composition of challenging, heterogeneous clinical specimens by deep sequencing, culture-based strain typing, and Sanger sequencing of bulk PCR product. We report that deep sequencing can catalog bacterial species in mixed specimens from which usable data cannot be obtained by conventional clinical methods. Deep sequencing a collection of sputum samples from cystic fibrosis (CF patients reveals well-described CF pathogens in specimens where they were not detected by standard clinical culture methods, especially for low-prevalence or fastidious bacteria. We also found that sputa submitted for CF diagnostic workup can be divided into a limited number of groups based on the phylogenetic composition of the airway microbiota, suggesting that metagenomic profiling may prove useful as a clinical diagnostic strategy in the future. The described method is sufficiently rapid (theoretically compatible with same-day turnaround times and inexpensive for routine clinical use.

  16. Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing

    Directory of Open Access Journals (Sweden)

    Marilena Marino

    2017-11-01

    Full Text Available This study explored the bacterial diversity of brines used for cheesemaking in Italy, as well as their physicochemical characteristics. In this context, 19 brines used to salt soft, semi-hard, and hard Italian cheeses were collected in 14 commercial cheese plants and analyzed using a culture-independent amplicon sequencing approach in order to describe their bacterial microbiota. Large NaCl concentration variations were observed among the selected brines, with hard cheese brines exhibiting the highest values. Acidity values showed a great variability too, probably in relation to the brine use prior to sampling. Despite their high salt content, brine microbial loads ranged from 2.11 to 6.51 log CFU/mL for the total mesophilic count. Microbial community profiling assessed by 16S rRNA gene sequencing showed that these ecosystems were dominated by Firmicutes and Proteobacteria, followed by Actinobacteria and Bacteroidetes. Cheese type and brine salinity seem to be the main parameters accountable for brine microbial diversity. On the contrary, brine pH, acidity and protein concentration, correlated to cheese brine age, did not have any selective effect on the microbiota composition. Nine major genera were present in all analyzed brines, indicating that they might compose the core microbiome of cheese brines. Staphylococcus aureus was occasionally detected in brines using selective culture media. Interestingly, bacterial genera associated with a functional and technological use were frequently detected. Indeed Bifidobacteriaceae, which might be valuable probiotic candidates, and specific microbial genera such as Tetragenococcus, Corynebacterium and non-pathogenic Staphylococcus, which can contribute to sensorial properties of ripened cheeses, were widespread within brines.

  17. Diversity, Dynamics, and Activity of Bacterial Communities during Production of an Artisanal Sicilian Cheese as Evaluated by 16S rRNA Analysis†

    Science.gov (United States)

    Randazzo, Cinzia L.; Torriani, Sandra; Akkermans, Antoon D. L.; de Vos, Willem M.; Vaughan, Elaine E.

    2002-01-01

    The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene, respectively. DGGE profiles from samples taken during cheese production indicated dramatic shifts in the microbial community structure. Cloning and sequencing of rDNA amplicons revealed that mesophilic lactic acid bacteria (LAB), including species of Leuconostoc, Lactococcus lactis, and Macrococcus caseolyticus were dominant in the raw milk, while Streptococcus thermophilus prevailed during lactic fermentation. Other thermophilic LAB, especially Lactobacillus delbrueckii and Lactobacillus fermentum, also flourished during ripening. Comparison of the rRNA-derived patterns obtained by RT-PCR to the rDNA DGGE patterns indicated a substantially different degree of metabolic activity for the microbial groups detected. Identification of cultivated LAB isolates by phenotypic characterization and 16S rDNA analysis indicated a variety of species, reflecting to a large extent the results obtained from the 16S rDNA clone libraries, with the significant exception of the Lactobacillus delbrueckii species, which dominated in the ripening cheese but was not detected by cultivation. The present molecular approaches combined with culture can effectively describe the complex ecosystem of natural fermented dairy products, giving useful information for starter culture design and preservation of artisanal fermented food technology. PMID:11916708

  18. Characterisation and comparison of bacterial communities on reverse osmosis membranes of a full-scale desalination plant by bacterial 16S rRNA gene metabarcoding

    OpenAIRE

    Nagaraj, Veena; Skillman, Lucy; Ho, Goen; Li, Dan; Gofton, Alexander

    2017-01-01

    Microbiomes of full-scale seawater reverse osmosis membranes are complex and subject to variation within and between membrane units. The pre-existing bacterial communities of unused membranes before operation have been largely ignored in biofouling studies. This study is novel as unused membranes were used as a critical benchmark for comparison. Fouled seawater reverse osmosis membrane biofilm communities from an array of autopsied membrane samples, following a 7-year operational life-span in...

  19. Bacterial diversity in typical Italian salami at different ripening stages as revealed by high-throughput sequencing of 16S rRNA amplicons.

    Science.gov (United States)

    Połka, Justyna; Rebecchi, Annalisa; Pisacane, Vincenza; Morelli, Lorenzo; Puglisi, Edoardo

    2015-04-01

    The bacterial diversity involved in food fermentations is one of the most important factors shaping the final characteristics of traditional foods. Knowledge about this diversity can be greatly improved by the application of high-throughput sequencing technologies (HTS) coupled to the PCR amplification of the 16S rRNA subunit. Here we investigated the bacterial diversity in batches of Salame Piacentino PDO (Protected Designation of Origin), a dry fermented sausage that is typical of a regional area of Northern Italy. Salami samples from 6 different local factories were analysed at 0, 21, 49 and 63 days of ripening; raw meat at time 0 and casing samples at 21 days of ripening where also analysed, and the effect of starter addition was included in the experimental set-up. Culture-based microbiological analyses and PCR-DGGE were carried out in order to be compared with HTS results. A total of 722,196 high quality sequences were obtained after trimming, paired-reads assembly and quality screening of raw reads obtained by Illumina MiSeq sequencing of the two bacterial 16S hypervariable regions V3 and V4; manual curation of 16S database allowed a correct taxonomical classification at the species for 99.5% of these reads. Results confirmed the presence of main bacterial species involved in the fermentation of salami as assessed by PCR-DGGE, but with a greater extent of resolution and quantitative assessments that are not possible by the mere analyses of gel banding patterns. Thirty-two different Staphylococcus and 33 Lactobacillus species where identified in the salami from different producers, while the whole data set obtained accounted for 13 main families and 98 rare ones, 23 of which were present in at least 10% of the investigated samples, with casings being the major sources of the observed diversity. Multivariate analyses also showed that batches from 6 local producers tend to cluster altogether after 21 days of ripening, thus indicating that HTS has the potential

  20. Comparison of bacterial culture and 16S rRNA community profiling by clonal analysis and and pyrosequencing for the characterisation of the caries-associated microbiome

    Directory of Open Access Journals (Sweden)

    Kathrin eSchulze-Schweifing

    2014-11-01

    Full Text Available Culture-independent analyses have greatly expanded knowledge regarding the composition of complex bacterial communities including those associated with oral diseases. A consistent finding from such studies, however, has been the under-reporting of members of the phylum Actinobacteria. In this study, five pairs of broad range primers targeting 16S rRNA genes were used in clonal analysis of 6 samples collected from tooth lesions involving dentine in subjects with active caries. Samples were also subjected to cultural analysis and pyrosequencing by means of the 454 platform. A diverse bacterial community of 229 species-level taxa was revealed by culture and clonal analysis, dominated by representatives of the genera Prevotella, Lactobacillus, Selenomonas and Streptococcus. The five most abundant species were: Lactobacillus gasseri, Prevotella denticola, Alloprevotella tannerae, S. mutans and Streptococcus sp. HOT 070, which together made up 31.6 % of the sequences. Two samples were dominated by lactobacilli, while the remaining samples had low numbers of lactobacilli but significantly higher numbers of Prevotella species. The different primer pairs produced broadly similar data but proportions of the phylum Bacteroidetes were significantly higher when primer 1387R was used. All of the primer sets underestimated the proportion of Actinobacteria compared to culture. Pyrosequencing analysis of the samples was performed to a depth of sequencing of 4293 sequences per sample which were identified to 264 species-level taxa, and resulted in significantly higher coverage estimates than the clonal analysis. Pyrosequencing, however, also underestimated the relative abundance of Actinobacteria compared to culture.

  1. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada, Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, J. Gregory; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob; Bik, Holly

    2015-12-22

    ABSTRACT

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

    ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to

  2. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    Science.gov (United States)

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  3. High-resolution bacterial 16S rRNA gene profile meta-analysis and biofilm status reveal common colorectal cancer consortia.

    Science.gov (United States)

    Drewes, Julia L; White, James R; Dejea, Christine M; Fathi, Payam; Iyadorai, Thevambiga; Vadivelu, Jamuna; Roslani, April C; Wick, Elizabeth C; Mongodin, Emmanuel F; Loke, Mun Fai; Thulasi, Kumar; Gan, Han Ming; Goh, Khean Lee; Chong, Hoong Yin; Kumar, Sandip; Wanyiri, Jane W; Sears, Cynthia L

    2017-01-01

    Colorectal cancer (CRC) remains the third most common cancer worldwide, with a growing incidence among young adults. Multiple studies have presented associations between the gut microbiome and CRC, suggesting a link with cancer risk. Although CRC microbiome studies continue to profile larger patient cohorts with increasingly economical and rapid DNA sequencing platforms, few common associations with CRC have been identified, in part due to limitations in taxonomic resolution and differences in analysis methodologies. Complementing these taxonomic studies is the newly recognized phenomenon that bacterial organization into biofilm structures in the mucus layer of the gut is a consistent feature of right-sided (proximal), but not left-sided (distal) colorectal cancer. In the present study, we performed 16S rRNA gene amplicon sequencing and biofilm quantification in a new cohort of patients from Malaysia, followed by a meta-analysis of eleven additional publicly available data sets on stool and tissue-based CRC microbiota using Resphera Insight, a high-resolution analytical tool for species-level characterization. Results from the Malaysian cohort and the expanded meta-analysis confirm that CRC tissues are enriched for invasive biofilms (particularly on right-sided tumors), a symbiont with capacity for tumorigenesis ( Bacteroides fragilis ), and oral pathogens including Fusobacterium nucleatum , Parvimonas micra , and Peptostreptococcus stomatis . Considered in aggregate, species from the Human Oral Microbiome Database are highly enriched in CRC. Although no detected microbial feature was universally present, their substantial overlap and combined prevalence supports a role for the gut microbiota in a significant percentage (>80%) of CRC cases.

  4. Characterization of bacteria in biopsies of colon and stools by high throughput sequencing of the V2 region of bacterial 16S rRNA gene in human.

    Science.gov (United States)

    Momozawa, Yukihide; Deffontaine, Valérie; Louis, Edouard; Medrano, Juan F

    2011-02-10

    The characterization of the human intestinal microflora and their interactions with the host have been identified as key components in the study of intestinal disorders such as inflammatory bowel diseases. High-throughput sequencing has enabled culture-independent studies to deeply analyze bacteria in the gut. It is possible with this technology to systematically analyze links between microbes and the genetic constitution of the host, such as DNA polymorphisms and methylation, and gene expression. In this study the V2 region of the bacterial 16S ribosomal RNA (rRNA) gene using 454 pyrosequencing from seven anatomic regions of human colon and two types of stool specimens were analyzed. The study examined the number of reads needed to ascertain differences between samples, the effect of DNA extraction procedures and PCR reproducibility, and differences between biopsies and stools in order to design a large scale systematic analysis of gut microbes. It was shown (1) that sequence coverage lower than 1,000 reads influenced quantitative and qualitative differences between samples measured by UniFrac distances. Distances between samples became stable after 1,000 reads. (2) Difference of extracted bacteria was observed between the two DNA extraction methods. In particular, Firmicutes Bacilli were not extracted well by one method. (3) Quantitative and qualitative difference in bacteria from ileum to rectum colon were not observed, but there was a significant positive trend between distances within colon and quantitative differences. Between sample type, biopsies or stools, quantitative and qualitative differences were observed. Results of human colonic bacteria analyzed using high-throughput sequencing were highly dependent on the experimental design, especially the number of sequence reads, DNA extraction method, and sample type.

  5. Characterization of bacteria in biopsies of colon and stools by high throughput sequencing of the V2 region of bacterial 16S rRNA gene in human.

    Directory of Open Access Journals (Sweden)

    Yukihide Momozawa

    Full Text Available BACKGROUND: The characterization of the human intestinal microflora and their interactions with the host have been identified as key components in the study of intestinal disorders such as inflammatory bowel diseases. High-throughput sequencing has enabled culture-independent studies to deeply analyze bacteria in the gut. It is possible with this technology to systematically analyze links between microbes and the genetic constitution of the host, such as DNA polymorphisms and methylation, and gene expression. METHODS AND FINDINGS: In this study the V2 region of the bacterial 16S ribosomal RNA (rRNA gene using 454 pyrosequencing from seven anatomic regions of human colon and two types of stool specimens were analyzed. The study examined the number of reads needed to ascertain differences between samples, the effect of DNA extraction procedures and PCR reproducibility, and differences between biopsies and stools in order to design a large scale systematic analysis of gut microbes. It was shown (1 that sequence coverage lower than 1,000 reads influenced quantitative and qualitative differences between samples measured by UniFrac distances. Distances between samples became stable after 1,000 reads. (2 Difference of extracted bacteria was observed between the two DNA extraction methods. In particular, Firmicutes Bacilli were not extracted well by one method. (3 Quantitative and qualitative difference in bacteria from ileum to rectum colon were not observed, but there was a significant positive trend between distances within colon and quantitative differences. Between sample type, biopsies or stools, quantitative and qualitative differences were observed. CONCLUSIONS: Results of human colonic bacteria analyzed using high-throughput sequencing were highly dependent on the experimental design, especially the number of sequence reads, DNA extraction method, and sample type.

  6. Profiling the Succession of Bacterial Communities throughout the Life Stages of a Higher Termite Nasutitermes arborum (Termitidae, Nasutitermitinae) Using 16S rRNA Gene Pyrosequencing

    Science.gov (United States)

    Diouf, Michel; Roy, Virginie; Mora, Philippe; Frechault, Sophie; Lefebvre, Thomas; Hervé, Vincent; Rouland-Lefèvre, Corinne; Miambi, Edouard

    2015-01-01

    Previous surveys of the gut microbiota of termites have been limited to the worker caste. Termite gut microbiota has been well documented over the last decades and consists mainly of lineages specific to the gut microbiome which are maintained across generations. Despite this intimate relationship, little is known of how symbionts are transmitted to each generation of the host, especially in higher termites where proctodeal feeding has never been reported. The bacterial succession across life stages of the wood-feeding higher termite Nasutitermes arborum was characterized by 16S rRNA gene deep sequencing. The microbial community in the eggs, mainly affiliated to Proteobacteria and Actinobacteria, was markedly different from the communities in the following developmental stages. In the first instar and last instar larvae and worker caste termites, Proteobacteria and Actinobacteria were less abundant than Firmicutes, Bacteroidetes, Spirochaetes, Fibrobacteres and the candidate phylum TG3 from the last instar larvae. Most of the representatives of these phyla (except Firmicutes) were identified as termite-gut specific lineages, although their relative abundances differed. The most salient difference between last instar larvae and worker caste termites was the very high proportion of Spirochaetes, most of which were affiliated to the Treponema Ic, Ia and If subclusters, in workers. The results suggest that termite symbionts are not transmitted from mother to offspring but become established by a gradual process allowing the offspring to have access to the bulk of the microbiota prior to the emergence of workers, and, therefore, presumably through social exchanges with nursing workers. PMID:26444989

  7. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  8. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    DEFF Research Database (Denmark)

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    Erm methyltransferases modify bacterial 23S ribosomal RNA at adenosine 2058 (A2058, Escherichia coli numbering) conferring resistance to macrolide, lincosamide, and streptogramin B (MLS) antibiotics. The motif that is recognized by Erm methyltransferases is contained within helix 73 of 23S r......RNA and the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within the 72......-mer RNA. The RNAs were passed through a series of rounds of methylation with ErmE. After each round, RNAs were selected that had partially or completely lost their ability to be methylated. After several rounds of methylation/selection, 187 subclones were analyzed. Forty-three of the subclones...

  9. Polyethylene glycol and polyvinylpirrolidone effect on bacterial rRNA extraction and hybridization from cells exposed to tannins Efeito de polietilenoglicol e polivinilpirrolidona na extração e hibridização de rRNA bacteriano de células expostas a taninos

    Directory of Open Access Journals (Sweden)

    Pedro Braga Arcuri

    2003-09-01

    Full Text Available In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG and polyvinylpirrolidone (PVP on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp. skin, Desmodium ovalifolium, red grape (Vitis vinifera skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (PA recuperação de RNA ribossômico (rRNA intacto é necessária para a detecção de flutuações na população microbiana ruminal decorrentes dos taninos de forrageiras, utilizando-se sondas para 16S rRNA. O objetivo deste trabalho foi avaliar o efeito de polietilenoglicol (PEG e polivinilpirrolidona (PVP na extração de rRNA bacteriano, em presença de taninos de leguminosas forrageiras tropicais e de outras fontes, que possa ser hibridizado com sondas de oligonucleotídeos. Culturas de Ruminococcus albus 8 foram expostas ou não a 8 g/L de ácido tânico ou a 1 g/L de taninos condensados, extraídos de Acacia angustissima, casca de banana (Musa sp., Desmodium ovalifolium, cascas de uvas vermelhas (Vitis vinifera e Inga edulis. As culturas foram lavadas com tampão Tris pH 7 contendo 8% PEG ou 6% PVP antes do rompimento das c

  10. Evaluation of 16S rRNA gene primer pairs for monitoring microbial community structures showed high reproducibility within and low comparability between datasets generated with multiple archaeal and bacterial primer pairs

    Directory of Open Access Journals (Sweden)

    Martin Alexander Fischer

    2016-08-01

    Full Text Available The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community

  11. Mechanisms of Streptomycin Resistance: Selection of Mutations in the 16S rRNA Gene Conferring Resistance

    Science.gov (United States)

    Springer, Burkhard; Kidan, Yishak G.; Prammananan, Therdsak; Ellrott, Kerstin; Böttger, Erik C.; Sander, Peter

    2001-01-01

    Chromosomally acquired streptomycin resistance is frequently due to mutations in the gene encoding the ribosomal protein S12, rpsL. The presence of several rRNA operons (rrn) and a single rpsL gene in most bacterial genomes prohibits the isolation of streptomycin-resistant mutants in which resistance is mediated by mutations in the 16S rRNA gene (rrs). Three strains were constructed in this investigation: Mycobacterium smegmatis rrnB, M. smegmatis rpsL3+, and M. smegmatis rrnB rpsL3+. M. smegmatis rrnB carries a single functional rrn operon, i.e., rrnA (comprised of 16S, 23S, and 5S rRNA genes) and a single rpsL+ gene; M. smegmatis rpsL3+ is characterized by the presence of two rrn operons (rrnA and rrnB) and three rpsL+ genes; and M. smegmatis rrnB rpsL3+ carries a single functional rrn operon (rrnA) and three rpsL+ genes. By genetically altering the number of rpsL and rrs alleles in the bacterial genome, mutations in rrs conferring streptomycin resistance could be selected, as revealed by analysis of streptomycin-resistant derivatives of M. smegmatis rrnB rpsL3+. Besides mutations well known to confer streptomycin resistance, novel streptomycin resistance conferring mutations were isolated. Most of the mutations were found to map to a functional pseudoknot structure within the 530 loop region of the 16S rRNA. One of the mutations observed, i.e., 524G→C, severely distorts the interaction between nucleotides 524G and 507C, a Watson-Crick interaction which has been thought to be essential for ribosome function. The use of the single rRNA allelic M. smegmatis strain should help to elucidate the principles of ribosome-drug interactions. PMID:11557484

  12. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance...

  13. Bacterial community structure in Apis florea larvae analyzed by denaturing gradient gel electrophoresis and 16S rRNA gene sequencing.

    Science.gov (United States)

    Saraithong, Prakaimuk; Li, Yihong; Saenphet, Kanokporn; Chen, Zhou; Chantawannakul, Panuwan

    2015-10-01

    This study characterizes the colonization and composition of bacterial flora in dwarf Asian honeybee (Apis florea) larvae and compares bacterial diversity and distribution among different sampling locations. A. florea larvae were collected from 3 locations in Chiang Mai province, Thailand. Bacterial DNA was extracted from each larva using the phenol-chloroform method. Denaturing gradient gel electrophoresis was performed, and the dominant bands were excised from the gels, cloned, and sequenced for bacterial species identification. The result revealed similarities of bacterial community profiles in each individual colony, but differences between colonies from the same and different locations. A. florea larvae harbor bacteria belonging to 2 phyla (Firmicutes and Proteobacteria), 5 classes (Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Bacilli, and Clostridia), 6 genera (Clostridium, Gilliamella, Melissococcus, Lactobacillus, Saccharibacter, and Snodgrassella), and an unknown genus from uncultured bacterial species. The classes with the highest abundance of bacteria were Alphaproteobacteria (34%), Bacilli (25%), Betaproteobacteria (11%), Gammaproteobacteria (10%), and Clostridia (8%), respectively. Similarly, uncultured bacterial species were identified (12%). Environmental bacterial species, such as Saccharibacter floricola, were also found. This is the first study in which sequences closely related to Melissococcus plutonius, the causal pathogen responsible for European foulbrood, have been identified in Thai A. florea larvae. © 2014 Institute of Zoology, Chinese Academy of Sciences.

  14. Diagnostic utility of broad range bacterial 16S rRNA gene PCR with degradation of human and free bacterial DNA in bloodstream infection is more sensitive than an in-house developed PCR without degradation of human and free bacterial DNA.

    Science.gov (United States)

    Rogina, Petra; Skvarc, Miha; Stubljar, David; Kofol, Romina; Kaasch, Achim

    2014-01-01

    We compared a commercial broad range 16S rRNA gene PCR assay (SepsiTest) to an in-house developed assay (IHP). We assessed whether CD64 index, a biomarker of bacterial infection, can be used to exclude patients with a low probability of systemic bacterial infection. From January to March 2010, 23 patients with suspected sepsis were enrolled. CD64 index, procalcitonin, and C-reactive protein were measured on admission. Broad range 16S rRNA gene PCR was performed from whole blood (SepsiTest) or blood plasma (IHP) and compared to blood culture results. Blood samples spiked with Staphylococcus aureus were used to assess sensitivity of the molecular assays in vitro. CD64 index was lower in patients where possible sepsis was excluded than in patients with microbiologically confirmed sepsis (P = 0.004). SepsiTest identified more relevant pathogens than blood cultures (P = 0.008); in three patients (13%) results from blood culture and SepsiTest were congruent, whereas in four cases (17.4%) relevant pathogens were detected by SepsiTest only. In vitro spiking experiments suggested equal sensitivity of SepsiTest and IHP. A diagnostic algorithm using CD64 index as a decision maker to perform SepsiTest shows improved detection of pathogens in patients with suspected blood stream infection and may enable earlier targeted antibiotic therapy.

  15. Diagnostic Utility of Broad Range Bacterial 16S rRNA Gene PCR with Degradation of Human and Free Bacterial DNA in Bloodstream Infection Is More Sensitive Than an In-House Developed PCR without Degradation of Human and Free Bacterial DNA

    Directory of Open Access Journals (Sweden)

    Petra Rogina

    2014-01-01

    Full Text Available We compared a commercial broad range 16S rRNA gene PCR assay (SepsiTest to an in-house developed assay (IHP. We assessed whether CD64 index, a biomarker of bacterial infection, can be used to exclude patients with a low probability of systemic bacterial infection. From January to March 2010, 23 patients with suspected sepsis were enrolled. CD64 index, procalcitonin, and C-reactive protein were measured on admission. Broad range 16S rRNA gene PCR was performed from whole blood (SepsiTest or blood plasma (IHP and compared to blood culture results. Blood samples spiked with Staphylococcus aureus were used to assess sensitivity of the molecular assays in vitro. CD64 index was lower in patients where possible sepsis was excluded than in patients with microbiologically confirmed sepsis (P=0.004. SepsiTest identified more relevant pathogens than blood cultures (P=0.008; in three patients (13% results from blood culture and SepsiTest were congruent, whereas in four cases (17.4% relevant pathogens were detected by SepsiTest only. In vitro spiking experiments suggested equal sensitivity of SepsiTest and IHP. A diagnostic algorithm using CD64 index as a decision maker to perform SepsiTest shows improved detection of pathogens in patients with suspected blood stream infection and may enable earlier targeted antibiotic therapy.

  16. Identification of dairy lactic acid bacteria by tRNAAla-23S rDNA-RFLP.

    Science.gov (United States)

    Mancini, Andrea; Lazzi, Camilla; Bernini, Valentina; Neviani, Erasmo; Gatti, Monica

    2012-12-01

    The aim of this study was to evaluate the potential of target tRNA(Ala)-23S ribosomal DNA for identification of lactic acid bacteria strains associated with dairy ecosystem. For this purpose tRNA(Ala)-23S ribosomal DNA Restriction Fragment Length Polymorphism (tRNA(Ala)-23S rDNA-RFLP) was compared with two widely used DNA fingerprinting methods - P1 Random Amplified Polymorphic DNA (RAPD), (GTG)5 repetitive extragenic palindromic PCR (rep-PCR) - for their ability to identify different species on a set of 10 type and 34 reference strains. Moreover, 75 unknown isolates collected during different stages of Grana Padano cheese production and ripening were identified using tRNA(Ala)-23S rDNA-RFLP and compared to the RFLP profiles of the strains in the reference database. This study demonstrated that the target tRNA(Ala)-23S rDNA has high potential in bacterial identification and tRNA(Ala)-23S rDNA-RFLP is a promising method for reliable species-level identification of lactic acid bacteria (LAB) in dairy products. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip and 16S rRNA gene clone library sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.; Andersen, G.L.; Lu, S.-E.; Wang, N.

    2009-03-01

    The bacterial diversity associated with citrus leaf midribs was characterized 1 from citrus groves that contained the Huanglongbing (HLB) pathogen, which has yet to be cultivated in vitro. We employed a combination of high-density phylogenetic 16S rDNA microarray and 16S rDNA clone library sequencing to determine the microbial community composition of symptomatic and asymptomatic citrus midribs. Our results revealed that citrus leaf midribs can support a diversity of microbes. PhyloChip analysis indicated that 47 orders of bacteria from 15 phyla were present in the citrus leaf midribs while 20 orders from phyla were observed with the cloning and sequencing method. PhyloChip arrays indicated that nine taxa were significantly more abundant in symptomatic midribs compared to asymptomatic midribs. Candidatus Liberibacter asiaticus (Las) was detected at a very low level in asymptomatic plants, but was over 200 times more abundant in symptomatic plants. The PhyloChip analysis was further verified by sequencing 16S rDNA clone libraries, which indicated the dominance of Las in symptomatic leaves. These data implicate Las as the pathogen responsible for HLB disease. Citrus is the most important commercial fruit crop in Florida. In recent years, citrus Huanglongbing (HLB), also called citrus greening, has severely affected Florida's citrus production and hence has drawn an enormous amount of attention. HLB is one of the most devastating diseases of citrus (6,13), characterized by blotchy mottling with green islands on leaves, as well as stunting, fruit decline, and small, lopsided fruits with poor coloration. The disease tends to be associated with a phloem-limited fastidious {alpha}-proteobacterium given a provisional Candidatus status (Candidatus Liberobacter spp. later changed to Candidatus Liberibacter spp.) in nomenclature (18,25,34). Previous studies indicate that HLB infection causes disorder in the phloem and severely impairs the translocation of assimilates in

  18. Different bacterial communities in heat and gamma irradiation treated replant disease soils revealed by 16S rRNA gene analysis – contribution to improved aboveground apple plant growth?

    Directory of Open Access Journals (Sweden)

    Bunlong eYim

    2015-11-01

    Full Text Available Replant disease (RD severely affects apple production in propagation tree nurseries and in fruit orchards worldwide. This study aimed to investigate the effects of soil disinfection treatments on plant growth and health in a biotest in two different RD soil types under greenhouse conditions and to link the plant growth status with the bacterial community composition at the time of plant sampling. In the biotest performed we observed that the aboveground growth of apple rootstock M26 plants after eight weeks was improved in the two RD soils either treated at 50 °C or with gamma irradiation compared to the untreated RD soils. Total community DNA was extracted from soil loosely adhering to the roots and quantitative real-time PCR revealed no pronounced differences in 16S rRNA gene copy numbers. 16S rRNA gene-based bacterial community analysis by denaturing gradient gel electrophoresis (DGGE and 454-pyrosequencing revealed significant differences in the bacterial community composition even after eight weeks of plant growth. In both soils, the treatments affected different phyla but only the relative abundance of Acidobacteria was reduced by both treatments. The genera Streptomyces, Bacillus, Paenibacillus and Sphingomonas had a higher relative abundance in both heat treated soils, whereas the relative abundance of Mucilaginibacter, Devosia and Rhodanobacter was increased in the gamma-irradiated soils and only the genus Phenylobacterium was increased in both treatments. The increased abundance of genera with potentially beneficial bacteria, i.e. potential degraders of phenolic compounds might have contributed to the improved plant growth in both treatments.

  19. Characterization of Vibrio fischeri rRNA operons and subcloning of a ribosomal DNA promoter.

    Science.gov (United States)

    Amikam, D; Kuhn, J

    1987-01-01

    Analysis of rRNA genes in Vibrio fischeri indicates the presence of eight rRNA gene sets in this organism. It was found that the genes for 5S rRNA, 16S rRNA, and 23S rRNA are organized in operons in the following order: 5' end 16S rRNA 23S RNA 5S rRNA 3' end. Although the operons are homologous, they are not identical with regard to cleavage sites for various restriction endonucleases. A DNA library was constructed, and three ribosomal DNA clones were obtained. One of these clones contained an entire rRNA operon and was used as a source for subcloning. The promoter region which leads to plasmid instability was successfully subcloned into pHG165. The terminator region was subcloned into pBR322. PMID:3571170

  20. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  1. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  2. Analysis of Bacterial Communities in the Rhizosphere of Chrysanthemum via Denaturing Gradient Gel Electrophoresis of PCR-Amplified 16S rRNA as Well as DNA Fragments Coding for 16S rRNA†

    Science.gov (United States)

    Duineveld, Bernadette M.; Kowalchuk, George A.; Keijzer, Anneke; van Elsas, Jan Dirk; van Veen, Johannes A.

    2001-01-01

    The effect of developing chrysanthemum roots on the presence and activity of bacterial populations in the rhizosphere was examined by using culture-independent methods. Nucleic acids were extracted from rhizosphere soil samples associated with the bases of roots or root tips of plants harvested at different stages of development. PCR and reverse transcriptase (RT) PCR were used to amplify 16S ribosomal DNA (rDNA) and 16S rRNA, respectively, and the products were subjected to denaturing gradient gel electrophoresis (DGGE). Prominent DGGE bands were excised and sequenced to gain insight into the identities of predominantly present (PCR) and predominantly active (RT-PCR) bacterial populations. The majority of DGGE band sequences were related to bacterial genera previously associated with the rhizosphere, such as Pseudomonas, Comamonas, Variovorax, and Acetobacter, or typical of root-free soil environments, such as Bacillus and Arthrobacter. The PCR-DGGE patterns observed for bulk soil were somewhat more complex than those obtained from rhizosphere samples, and the latter contained a subset of the bands present in bulk soil. DGGE analysis of RT-PCR products detected a subset of bands visible in the rDNA-based analysis, indicating that some dominantly detected bacterial populations did not have high levels of metabolic activity. The sequences detected by the RT-PCR approach were, however, derived from a wide taxonomic range, suggesting that activity in the rhizosphere was not determined at broad taxonomic levels but rather was a strain- or species-specific phenomenon. Comparative analysis of DGGE profiles grouped all DNA-derived root tip samples together in a cluster, and within this cluster the root tip samples from young plants formed a separate subcluster. Comparison of rRNA-derived bacterial profiles showed no grouping of root tip samples versus root base samples. Rather, all profiles derived from 2-week-old plant rhizosphere soils grouped together regardless of

  3. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Science.gov (United States)

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

  4. Bacterial community structure associated with white band disease in the elkhorn coral Acropora palmata determined using culture-independent 16S rRNA techniques.

    Science.gov (United States)

    Pantos, Olga; Bythell, John C

    2006-03-23

    Culture-independent molecular (16S ribosomal RNA) techniques showed distinct differences in bacterial communities associated with white band disease (WBD) Type I and healthy elkhorn coral Acropora palmata. Differences were apparent at all levels, with a greater diversity present in tissues of diseased colonies. The bacterial community associated with remote, non-diseased coral was distinct from the apparently healthy tissues of infected corals several cm from the disease lesion. This demonstrates a whole-organism effect from what appears to be a localised disease lesion, an effect that has also been recently demonstrated in white plague-like disease in star coral Montastraea annularis. The pattern of bacterial community structure changes was similar to that recently demonstrated for white plague-like disease and black band disease. Some of the changes are likely to be explained by the colonisation of dead and degrading tissues by a micro-heterotroph community adapted to the decomposition of coral tissues. However, specific ribosomal types that are absent from healthy tissues appear consistently in all samples of each of the diseases. These ribotypes are closely related members of a group of alpha-proteobacteria that cause disease, notably juvenile oyster disease, in other marine organisms. It is clearly important that members of this group are isolated for challenge experiments to determine their role in the diseases.

  5. Comprehensive Meta-analysis of Ontology Annotated 16S rRNA Profiles Identifies Beta Diversity Clusters of Environmental Bacterial Communities.

    Directory of Open Access Journals (Sweden)

    Andreas Henschel

    2015-10-01

    Full Text Available Comprehensive mapping of environmental microbiomes in terms of their compositional features remains a great challenge in understanding the microbial biosphere of the Earth. It bears promise to identify the driving forces behind the observed community patterns and whether community assembly happens deterministically. Advances in Next Generation Sequencing allow large community profiling studies, exceeding sequencing data output of conventional methods in scale by orders of magnitude. However, appropriate collection systems are still in a nascent state. We here present a database of 20,427 diverse environmental 16S rRNA profiles from 2,426 independent studies, which forms the foundation of our meta-analysis. We conducted a sample size adaptive all-against-all beta diversity comparison while also respecting phylogenetic relationships of Operational Taxonomic Units(OTUs. After conventional hierarchical clustering we systematically test for enrichment of Environmental Ontology terms and their abstractions in all possible clusters. This post-hoc algorithm provides a novel formalism that quantifies to what extend compositional and semantic similarity of microbial community samples coincide. We automatically visualize significantly enriched subclusters on a comprehensive dendrogram of microbial communities. As a result we obtain the hitherto most differentiated and comprehensive view on global patterns of microbial community diversity. We observe strong clusterability of microbial communities in ecosystems such as human/mammal-associated, geothermal, fresh water, plant-associated, soils and rhizosphere microbiomes, whereas hypersaline and anthropogenic samples are less homogeneous. Moreover, saline samples appear less cohesive in terms of compositional properties than previously reported.

  6. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  7. Functional bacterial and archaeal diversity revealed by 16S rRNA gene pyrosequencing during potato starch processing wastewater treatment in an UASB.

    Science.gov (United States)

    Antwi, Philip; Li, Jianzheng; Opoku Boadi, Portia; Meng, Jia; Shi, En; Xue, Chi; Zhang, Yupeng; Ayivi, Frederick

    2017-07-01

    Microbial community structure of sludge sampled from an UASB treating potato starch processing wastewater (PSPW) was investigated. Operational taxonomic units revealed at 97% sequence identity tolerance was 2922, 2869 and 3919 for bottom, middle and top sections of the reactor, respectively. Overall abundant phylum observed within the UASB was low-G+C-Gram-positive bacteria affiliated to Firmicutes (26.01%) followed by Chloroflexi (16.70%), Proteobacteria (12.71%), Cloacimonetes (10.72%), Bacteroidetes (7.87%), Synergistetes (9.02%) and Euryarchaeota (8.82%). Whiles Firmicutes had dominated the bottom and top section by 34.01% and 28.64%, respectively, middle section was predominantly Euryarchaeota (24.32%) with major dominance in methanogens affiliated to genus Methanosaeta. The results demonstrated substantial stratification of the microbial community structure along the reactor height with various functional bacterial groups which subsequently allowed degradation of organics in PSPW in sequential mode. The findings herein would provide guidance for optimizing the anaerobic process and operation of the UASB. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Bacterial diversity of extremely alkaline bauxite residue site of alumina industrial plant using culturable bacteria and residue 16S rRNA gene clones.

    Science.gov (United States)

    Krishna, Pankaj; Babu, A Giridhar; Reddy, M Sudhakara

    2014-07-01

    Bauxite residue (red mud), generated during the extraction of alumina from bauxite ore is characterized by high pH, high concentrations of soluble ions with low or virtually no organic matter. These extreme conditions along with numerous nutrient deficiencies, limit the microbial growth and vegetation establishment. In the present study, diversity of both cultivable and non-cultivable bacteria present in the red mud was investigated by 16S rDNA sequence analyses. The cultivable bacteria were identified as Agromyces indicus, Bacillus litoralis, B. anthracis, Chungangia koreensis, Kokuria flava, K. polaris, Microbacterium hominis, Planococcus plakortidis, Pseudomonas alcaliphila and Salinococcus roseus based on their 16S rDNA sequence analysis. These isolates were alkali tolerant, positive for one or more of the enzyme activities tested, able to produce organic acids and oxidize wide range of carbon substrates. For non-cultivable diversity of bacteria, DNA was extracted from the bauxite residue samples and 16S rDNA clone library was constructed. The 16S rDNA clones of this study showed affiliation to three major phyla predominant being betaproteobacteria (41.1%) followed by gammaproteobacteria (37.5%) and bacteroidetes (21.4%). We are reporting for the first time about the bacterial diversity of this unique and extreme environment.

  9. Diversity of the total bacterial community associated with Ghanaian and Brazilian cocoa bean fermentation samples as revealed by a 16 S rRNA gene clone library.

    Science.gov (United States)

    Garcia-Armisen, Tamara; Papalexandratou, Zoi; Hendryckx, Hugo; Camu, Nicholas; Vrancken, Gino; De Vuyst, Luc; Cornelis, Pierre

    2010-08-01

    Cocoa bean fermentation is a spontaneous process involving a succession of microbial activities, starting with yeasts, followed by lactic acid bacteria and acetic acid bacteria. So far, all microbiological studies about cocoa bean fermentation were based on culture-dependent (isolation, cultivation, and identification), or, more recently, culture-independent (PCR-DGGE, or polymerase chain reaction denaturing gradient gel electrophoresis) methods. Using a metagenomic approach, total DNA was extracted from heap and box fermentations at different time points and from different locations (Ghana and Brazil, respectively) to generate a 16 S rDNA clone library that was sequenced. The sequencing data revealed a low bacterial diversity in the fermentation samples and were in accordance with the results obtained through culture-dependent and a second, culture-independent analysis (PCR-DGGE), suggesting that almost all bacteria involved in the fermentation process are cultivable. One exception was the identification by 16 S rDNA library sequencing of Gluconacetobacter species of acetic acid bacteria that were not detected by the two other approaches. The presence of Enterobacteriaceae related to Erwinia/Pantoea/Tatumella, as revealed by 16 S rDNA library sequencing, suggests an impact of these bacteria on fermentation.

  10. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim

    1999-01-01

    growth. The amounts of 23S rRNA and pre-16S rRNA measured for E. coli growing in intestinal mucus corresponded to that expected for bacteria with the observed growth rate. In contrast, the slow-growing E. coli cells present in intestinal contents turned out to have an approximately ninefold higher...

  11. Temporal dynamics of in-situ fiber-adherent bacterial community under ruminal acidotic conditions determined by 16S rRNA gene profiling.

    Directory of Open Access Journals (Sweden)

    Renee M Petri

    Full Text Available Subacute rumen acidotic (SARA conditions are a consequence of high grain feeding. Recent work has shown that the pattern of grain feeding can significantly impact the rumen epimural microbiota. In a continuation of these works, the objective of this study was to determine the role of grain feeding patterns on the colonization and associated changes in predicted functional properties of the fiber-adherent microbial community over a 48 h period. Eight rumen-cannulated Holstein cows were randomly assigned to interrupted or continuous 60%-grain challenge model (n = 4 per model to induce SARA conditions. Cows in the continuous model were challenged for 4 weeks, whereas cows of interrupted model had a 1-wk break in between challenges. To determine dynamics of rumen fiber-adherent microbial community we incubated the same hay from the diet samples for 24 and 48 h in situ during the baseline (no grain fed, week 1 and 4 of the continuous grain feeding model as well as during the week 1 following the break in the interrupted model. Microbial DNA was extracted and 16SrRNA amplicon (V3-V5 region sequencing was done with the Illumina MiSeq platform. A significant decrease (P 0.1% relative abundance in the rumen, 18 of which were significantly impacted by the feeding challenge model. Correlation analysis of the significant OTUs to rumen pH as an indicator of SARA showed genus Succiniclasticum had a positive correlation to SARA conditions regardless of treatment. Predictive analysis of functional microbial properties suggested that the glyoxylate/dicarboxylate pathway was increased in response to SARA conditions, decreased between 24h to 48h of incubation, negatively correlated with propanoate metabolism and positively correlated to members of the Veillonellaceae family including Succiniclasticum spp. This may indicate an adaptive response in bacterial metabolism under SARA conditions. This research clearly indicates that changes to the colonizing fiber

  12. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    conserved nucleotides. With a view to investigate the function of this RNA region further, four of these conserved nucleotides, including one indirectly implicated in chloramphenicol binding, were selected for mutation in Escherichia coli 23S rRNA using oligonucleotide primers. Mutant RNAs were expressed...

  13. A microarray for screening the variability of 16S–23S rRNA internal transcribed spacer in Pseudomonas syringae

    Czech Academy of Sciences Publication Activity Database

    Lenz, Ondřej; Beran, Pavel; Fousek, Jan; Mráz, Ivan

    2010-01-01

    Roč. 82, č. 1 (2010), s. 90-94 ISSN 0167-7012 R&D Projects: GA ČR GP522/07/P338 Institutional research plan: CEZ:AV0Z50510513 Keywords : microarray * ITS1 * mosaicism Subject RIV: EE - Microbiology, Virology Impact factor: 2.018, year: 2010

  14. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  15. Two distinct types of rRNA operons in the Bacillus cereus group.

    Science.gov (United States)

    Candelon, Benjamin; Guilloux, Kévin; Ehrlich, S Dusko; Sorokin, Alexei

    2004-03-01

    The Bacillus cereus group includes insecticidal bacteria (B. thuringiensis), food-borne pathogens (B. cereus and B. weihenstephanensis) and B. anthracis, the causative agent of anthrax. The precise number of rRNA operons in 12 strains of the B. cereus group was determined. Most of the tested strains possess 13 operons and the tested psychrotolerant strains contain 14 operons, the highest number ever found in bacteria. The separate clustering of the tested psychrotolerant strains was confirmed by partial sequencing of several genes distributed over the chromosomes. Analysis of regions downstream of the 23S rRNA genes in the type strain B. cereus ATCC 14579 indicates that the rRNA operons can be divided into two classes, I and II, consisting respectively of eight and five operons. Class II operons exhibit multiple tRNA genes downstream of the 5S rRNA gene and a putative promoter sequence in the 23S-5S intergenic region, suggesting that 5S rRNA and the downstream tRNA genes can be transcribed independently of the 16S and 23S genes. Similar observations were made in the recently sequenced genome of B. anthracis strain Ames. The existence of these distinct types of rRNA operons suggests an unknown mechanism for regulation of rRNA and tRNA synthesis potentially related to the pool of amino acids available for protein synthesis.

  16. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    conserved nucleotides. With a view to investigate the function of this RNA region further, four of these conserved nucleotides, including one indirectly implicated in chloramphenicol binding, were selected for mutation in Escherichia coli 23S rRNA using oligonucleotide primers. Mutant RNAs were expressed...... of highly conserved nucleotides in the chloramphenicol binding region. A mechanistic model is also presented to explain the disruptive effect of chloramphenicol (and other antibiotics) on peptide bond formation at the ribosomal subunit interface....

  17. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance...... alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin....... The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature...

  18. 16S rRNA gene-based identification of cultured bacterial flora from host-seeking Ixodes ricinus, Dermacentor reticulatus and Haemaphysalis concinna ticks, vectors of vertebrate pathogens

    Czech Academy of Sciences Publication Activity Database

    Rudolf, Ivo; Mendel, Jan; Šikutová, Silvie; Švec, P.; Masaříková, J.; Nováková, D.; Buňková, L.; Sedláček, I.; Hubálek, Zdeněk

    2009-01-01

    Roč. 54, č. 5 (2009), s. 419-428 ISSN 0015-5632 R&D Projects: GA AV ČR KJB600930613 Institutional research plan: CEZ:AV0Z60930519 Keywords : ixodid ticks * 16S rRNA gene sequencing * Ixodes ricinus * Dermacentor reticulatus * Haemaphysalis concinna * microbial diversity Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  19. Estimation of growth rates of Escherichia coli BJ4 in streptomycin-treated and previously germfree mice by in situ rRNA hybridization.

    Science.gov (United States)

    Rang, C U; Licht, T R; Midtvedt, T; Conway, P L; Chao, L; Krogfelt, K A; Cohen, P S; Molin, S

    1999-05-01

    The growth physiology of Escherichia coli during colonization of the intestinal tract was studied with four animal models: the streptomycin-treated mouse carrying a reduced microflora, the monoassociated mouse with no other microflora than the introduced strain, the conventionalized streptomycin-treated mouse, and the conventionalized monoassociated mouse harboring a full microflora. A 23S rRNA fluorescent oligonucleotide probe was used for hybridization to whole E. coli cells fixed directly after being taken from the animals, and the respective growth rates of E. coli BJ4 in the four animal models were estimated by correlating the cellular concentrations of ribosomes with the growth rate of the strain. The growth rates thus estimated from the ribosomal content of E. coli BJ4 in vivo did not differ in the streptomycin-treated and the monoassociated mice. After conventionalization there was a slight decrease of the bacterial growth rates in both animal models.

  20. Demonstration of the absence of intervening sequences (IVSs) within 16S rRNA genes of Taylorella equigenitalis and Taylorella asinigenitalis isolates.

    Science.gov (United States)

    Tazumi, Akihiro; Nakanishi, Shigeyuki; Hayashi, Kyohei; Petry, Sandrine; Tasaki, Erina; Nakajima, Takuya; Ueno, Hitomi; Moore, John E; Millar, Beverley C; Matsuda, Motoo

    2012-06-01

    A total of 57 Taylorella equigenitalis (n=22) and Taylorella asinigenitalis (n=35) isolates was shown not to carry any intervening sequences (IVSs) within 16S rRNA gene sequences. By contrast, we have already shown the genus Taylorella group to carry several kinds of IVSs within the 23S rRNA gene sequences. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Bacterial isolates exhibiting multidrug resistance, hemolytic activity, and high 16S rRNA gene similarity with well-known pathogens found in camel milk samples of Riyadh region.

    Science.gov (United States)

    Hirad, Abdurahman H; Ahmad, Javed; Alkhedhairy, Abdulaziz A; Bahkali, Ali H; Khan, Shams T

    2018-03-01

    Customary consumption of unpasteurized milk by the population in the central Najed region of Saudi Arabia may pose a health risk. Therefore, 80 camel milk samples were collected aseptically from seven different stations of Riyadh region. The biochemical and microbiological properties of these milk samples were determined. Nutrient agar and brain heart infusion agar were used to determine mesophilic aerobic counts (MACs). The MAC in each mL of milk varied from 60 to 16 × 10 4  CFU/mL on nutrient agar. Based on the colony morphology, 176 colonies were collected from different samples, and these isolates were de-replicated into 80 unique isolates using rep-PCR analysis. Surprisingly, the 16S rRNA sequence analysis of these strains revealed that more than one-third of the collected milk samples contained strains that share maximum sequence similarities with well-known pathogens, such as Brucella, Bacillus anthracis, Listeria monocytogenes, and MRSA. Furthermore, many strains exhibit 16S rRNA gene similarity with opportunistic pathogens such as Citrobacter freundii and Kytococcus schroeteri. Many strains exhibit β-hemolytic activity and resistant to six different antibiotics. Our study suggested that consumption of raw camel milk from this region constitutes a great health risk. © 2018 APMIS. Published by John Wiley & Sons Ltd.

  2. Localization of the site of 23S RNA photoaffinity labeling by [3H]-p-azidopuromycin. Additional evidence that domain V contains the peptidyl transferase center

    International Nuclear Information System (INIS)

    Hall, C.C.; Johnson, D.; Cooperman, B.S.

    1987-01-01

    The photoincorporation of [ 3 H]-p-azidopuromycin, a photolabile functional analogue of puromycin, into the RNA portion of 70S ribosomes was analyzed by hybridization of photoaffinity-labeled rRNA to restriction fragments of complementary DNA derived from plasmid pKK3535. The method of analysis was as previously described, except that a double-labeling approach, using uniformly labeled [ 14 C]-rRNA, was employed to correct for differences in the yields of specific hybrids. Approximately 3/4 of the labeling was found in 23S rRNA, with the major site of labeling falling within bases 2445-2668, in region V of 23S rRNA. Such labeling was decreased in the presence of puromycin, providing evidence that it occurs from the peptidyl transferase center. Efforts to localize the site of p-zaidopuromycin labeling to a specific base within this region, using an approach based on the interference of a photoaffinity labeled base with reverse transcriptase activity, are underway

  3. Illumina amplicon sequencing of 16S rRNA tag reveals bacterial community development in the rhizosphere of apple nurseries at a replant disease site and a new planting site.

    Directory of Open Access Journals (Sweden)

    Jian Sun

    Full Text Available We used a next-generation, Illumina-based sequencing approach to characterize the bacterial community development of apple rhizosphere soil in a replant site (RePlant and a new planting site (NewPlant in Beijing. Dwarfing apple nurseries of 'Fuji'/SH6/Pingyitiancha trees were planted in the spring of 2013. Before planting, soil from the apple rhizosphere of the replant site (ReSoil and from the new planting site (NewSoil was sampled for analysis on the Illumina MiSeq platform. In late September, the rhizosphere soil from both sites was resampled (RePlant and NewPlant. More than 16,000 valid reads were obtained for each replicate, and the community was composed of five dominant groups (Proteobacteria, Acidobacteria, Bacteroidetes, Gemmatimonadetes and Actinobacteria. The bacterial diversity decreased after apple planting. Principal component analyses revealed that the rhizosphere samples were significantly different among treatments. Apple nursery planting showed a large impact on the soil bacterial community, and the community development was significantly different between the replanted and newly planted soils. Verrucomicrobia were less abundant in RePlant soil, while Pseudomonas and Lysobacter were increased in RePlant compared with ReSoil and NewPlant. Both RePlant and ReSoil showed relatively higher invertase and cellulase activities than NewPlant and NewSoil, but only NewPlant soil showed higher urease activity, and this soil also had the higher plant growth. Our experimental results suggest that planting apple nurseries has a significant impact on soil bacterial community development at both replant and new planting sites, and planting on new site resulted in significantly higher soil urease activity and a different bacterial community composition.

  4. Influence of a 23S ribosomal RNA mutation in Helicobacter pylori strains on the in vitro synergistic effect of clarithromycin and amoxicillin.

    Science.gov (United States)

    Sakinc, Türkan; Baars, Barbara; Wüppenhorst, Nicole; Kist, Manfred; Huebner, Johannes; Opferkuch, Wolfgang

    2012-10-30

    Clarithromycin (CLR) is the most commonly recommended antibiotic in Helicobacter pylori eradication regimens, but the prevalence of CLR-resistant H. pylori is increasing. CLR resistance is associated with mutations in the 23S rRNA gene. However, H. pylori eradication can still be achieved with triple therapy, and an additive effect may occur with multiple antibiotics. Twenty-six CLR-resistant strains were examined. The MIC of clarithromycin was determined by agar-dilution-testing on Columbia agar, as described elsewhere. The conserved region of the H. pylori 23S rRNA gene between nucleotide positions 1445 and 2846 [GenBank: U27270] was amplified. RFLP and sequence analysis were performed with the 1402-bp PCR product. Synergy between clarithromycin and amoxicillin was assessed using the agar dilution checkerboard technique. To confirm the correlation between mutation and synergistic effect with subinhibitory concentrations of AMX, site-directed mutagenesis was performed in four CLR-susceptible H. pylori isolates. Twenty-six clarithromycin-resistant strains were examined. The conserved region of the H. pylori 23S rRNA gene was amplified, and the purified PCR product was checked for mutations by restriction fragment length polymorphism (RFLP) analysis and sequencing. A synergistic effect was found in only three of the 12 H. pylori strains (25%) with the A2142G mutation and five of the 10 H. pylori strains (50%) with the A2143G mutation (fractional inhibitory concentration: FIC 16 mg/L), and all three strains showed the synergistic effect (FICresistant to CLR (MIC>16 mg/L) and showed no synergism with amoxicillin (FIC>2). Here we demonstrate that in 100% of the in vitro transformed strains, a mutation at position A2143G leads to a synergistic effect between clarithromycin and amoxicillin, whereas a mutation at position at A2142G had no discernible effect.

  5. Identification of bacterial contaminants in polyherbal medicines used for the treatment of tuberculosis in Amatole District of the Eastern Cape Province, South Africa, using rapid 16S rRNA technique

    OpenAIRE

    Famewo, Elizabeth Bosede; Clarke, Anna Maria; Afolayan, Anthony Jide

    2016-01-01

    Background Polyherbal medicines are used for the treatment of many diseases in many African and Asian communities. With the increasing use of these remedies, several investigations have shown that they are associated with a broad variety of residues and contaminants. This study investigates the presence of bacteria in the polyherbal medicines used for the treatment of tuberculosis (TB) in the Eastern Cape Province of South Africa. Methods Bacterial DNA was extracted from the polyherbal medici...

  6. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  7. Recognition elements in rRNA for the tylosin resistance methyltransferase RlmA(II)

    DEFF Research Database (Denmark)

    Lebars, Isabelle; Husson, Clotilde; Yoshizawa, Satoko

    2007-01-01

    The methyltransferase RlmA(II) (formerly TlrB) is found in many Gram-positive bacteria, and methylates the N-1 position of nucleotide G748 within the loop of hairpin 35 in 23S rRNA. Methylation of the rRNA by RlmA(II) confers resistance to tylosin and other mycinosylated 16-membered ring macrolide...... are insufficient on their own to support the methylation reaction. Here we use biochemical techniques in conjunction with heteronuclear/homonuclear nuclear magnetic resonance spectroscopy to define the RNA structures that are required for efficient methylation by RlmA(II). Progressive truncation of the r...

  8. Restriction Profiling of 23S Microheterogenic Ribosomal Repeats for Detection and Characterizing of E. coli and Their Clonal, Pathogenic, and Phylogroups

    Directory of Open Access Journals (Sweden)

    Parvathi Jayasree Rajagopalan Nair

    2015-01-01

    Full Text Available Correlating ribosomal microheterogenicity with unique restriction profiles can prove to be an efficacious and cost-effective approach compared with sequencing for microbial identification. An attempt to peruse restriction profiling of 23S ribosomal assemblage was ventured; digestion patterns with Bfa I discriminated E. coli from its colony morphovars, while Hae III profiles assisted in establishing distinct clonal groups. Among the gene pool of 399 ribosomal sequences extrapolated from 57 E. coli genomes, varying degree of predominance (I > III > IV > II of Hae III pattern was observed. This was also corroborated in samples collected from clinical, commensal, and environmental origin. K-12 and its descendants showed type I pattern whereas E. coli-B and its descendants exhibited type IV, both of these patterns being exclusively present in E. coli. A near-possible association between phylogroups and Hae III profiles with presumable correlation between the clonal groups and different pathovars was established. The generic nature, conservation, and barcode gap of 23S rRNA gene make it an ideal choice and substitute to 16S rRNA gene, the most preferred region for molecular diagnostics in bacteria.

  9. Mutations in the bacterial ribosomal protein l3 and their association with antibiotic resistance

    DEFF Research Database (Denmark)

    Klitgaard, Rasmus N; Ntokou, Eleni; Nørgaard, Katrine

    2015-01-01

    Different groups of antibiotics bind to the peptidyl transferase center (PTC) in the large subunit of the bacterial ribosome. Resistance to these groups of antibiotics has often been linked with mutations or methylations of the 23S rRNA. In recent years, there has been a rise in the number...... of studies where mutations have been found in the ribosomal protein L3 in bacterial strains resistant to PTC-targeting antibiotics but there is often no evidence that these mutations actually confer antibiotic resistance. In this study, a plasmid exchange system was used to replace plasmid-carried wild...... background. Ten plasmid-carried mutated L3 genes were constructed, and their effect on growth and antibiotic susceptibility was investigated. Additionally, computational modeling of the impact of L3 mutations in E. coli was used to assess changes in 50S structure and antibiotic binding. All mutations...

  10. Macrolide resistance conferred by rRNA mutations in field isolates of Mannheimia haemolytica and Pasteurella multocida

    DEFF Research Database (Denmark)

    Olsen, Anders S; Warrass, Ralf; Douthwaite, Stephen Roger

    2014-01-01

    OBJECTIVES: To determine how resistance to macrolides is conferred in field isolates of Pasteurella multocida and Mannheimia haemolytica that lack previously identified resistance determinants for rRNA methylation, efflux and macrolide-modifying enzymes. METHODS: Isolates of P. multocida and M...... by genome sequencing and primer extension on the rRNAs. RESULTS: Macrolide resistance in one M. haemolytica isolate was conferred by the 23S rRNA mutation A2058G; resistance in three P. multocida isolates were caused by mutations at the neighbouring nucleotide A2059G. In each strain, all six copies...... of the rrn operons encoded the respective mutations. There were no mutations in the ribosomal protein genes rplD or rplV, and no other macrolide resistance mechanism was evident. CONCLUSIONS: High-level macrolide resistance can arise from 23S rRNA mutations in P. multocida and M. haemolytica despite...

  11. Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar

    Directory of Open Access Journals (Sweden)

    Aleksandra Štornik

    2016-01-01

    Full Text Available Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplifi ed 16S-23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S-23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90 %, Acetobacter ghanensis (12.50 %, Komagataeibacter oboediens (9.35 % and Komagataeibacter saccharivorans (6.25 %. Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70 % and Komagataeibacter oboediens (33.30 %. Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1-5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the

  12. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    DEFF Research Database (Denmark)

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen

    2008-01-01

    Translocation during the elongation phase of protein synthesis involves the relative movement of the 30S and 50S ribosomal subunits. This movement is the target of tuberactinomycin antibiotics. Here, we describe the isolation and characterization of mutants of Thermus thermophilus selected for re...

  13. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    of the cladinose, and substitution of a 3-keto group (forming the ketolide RU 56006), results in loss of the A752 interaction and an approximately 100-fold drop in drug binding affinity. Within domain V, the key determinant of drug binding is nucleotide A2058 and substitution of G at this position is the major...

  14. Cysteine methylation controls radical generation in the Cfr radical AdoMet rRNA methyltransferase.

    Directory of Open Access Journals (Sweden)

    Martin R Challand

    Full Text Available The 'radical S-adenosyl-L-methionine (AdoMet' enzyme Cfr methylates adenosine 2503 of the 23S rRNA in the peptidyltransferase centre (P-site of the bacterial ribosome. This modification protects host bacteria, notably methicillin-resistant Staphylococcus aureus (MRSA, from numerous antibiotics, including agents (e.g. linezolid, retapamulin that were developed to treat such organisms. Cfr contains a single [4Fe-4S] cluster that binds two separate molecules of AdoMet during the reaction cycle. These are used sequentially to first methylate a cysteine residue, Cys338; and subsequently generate an oxidative radical intermediate that facilitates methyl transfer to the unreactive C8 (and/or C2 carbon centres of adenosine 2503. How the Cfr active site, with its single [4Fe-4S] cluster, catalyses these two distinct activities that each utilise AdoMet as a substrate remains to be established. Here, we use absorbance and electron paramagnetic resonance (EPR spectroscopy to investigate the interactions of AdoMet with the [4Fe-4S] clusters of wild-type Cfr and a Cys338 Ala mutant, which is unable to accept a methyl group. Cfr binds AdoMet with high (∼ 10 µM affinity notwithstanding the absence of the RNA cosubstrate. In wild-type Cfr, where Cys338 is methylated, AdoMet binding leads to rapid oxidation of the [4Fe-4S] cluster and production of 5'-deoxyadenosine (DOA. In contrast, while Cys338 Ala Cfr binds AdoMet with equivalent affinity, oxidation of the [4Fe-4S] cluster is not observed. Our results indicate that the presence of a methyl group on Cfr Cys338 is a key determinant of the activity of the enzyme towards AdoMet, thus enabling a single active site to support two distinct modes of AdoMet cleavage.

  15. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    DEFF Research Database (Denmark)

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko

    2008-01-01

    RlmA(II) methylates the N1-position of nucleotide G748 in hairpin 35 of 23 S rRNA. The resultant methyl group extends into the peptide channel of the 50 S ribosomal subunit and confers resistance to tylosin and other mycinosylated macrolide antibiotics. Methylation at G748 occurs in several groups...... of Gram-positive bacteria, including the tylosin-producer Streptomyces fradiae and the pathogen Streptococcus pneumoniae. Recombinant S. pneumoniae RlmA(II) was purified and shown to retain its activity and specificity in vitro when tested on unmethylated 23 S rRNA substrates. RlmA(II) makes multiple...

  16. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli

    OpenAIRE

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M. Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan; Ishihama, Akira

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters rec...

  17. Conventional and molecular methods to detect bacterial pathogens in mussels.

    Science.gov (United States)

    Gugliandolo, C; Lentini, V; Spanò, A; Maugeri, T L

    2011-01-01

    To detect Aeromonas spp., Salmonella spp., Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus in mussels and water samples from a farming area, conventional and molecular methods were applied to enrichment cultures. The aerolysin gene (aero) of Aeromonas spp., the invasion plasmid antigen B (ipaB) gene of Salmonella spp., the enterotoxin secretion protein (epsM) gene of V. cholerae, the species-specific region of 16S rRNA gene of V. vulnificus, the 16S-23S rDNA (IGS) gene of V. parahaemolyticus and the pR72H fragment of V. parahaemolyticus were amplified by multiplex polymerase chain reaction (PCR) assays on DNA extracted from enrichment cultures. The haemolysin gene (tdh) of pathogenic V. parahaemolyticus was also amplified. Conventional culture method allowed the isolation of V. parahaemolyticus and V. vulnificus from water and mussels. The genes aero, epsM and 16S rRNA of V. vulnificus were occasionally detected in the enrichment cultures. In mussels, the ipaB and IGS genes were detected from June to September and from April to November, respectively. All genes, except aero, were amplified from mussels collected in September, when pathogenic V. parahaemolyticus (tdh+) strains were also isolated. Multiplex-PCR assays were more sensitive and faster than conventional procedures. The results emphasize the need of an accurate and rapid detection of bacterial pathogens in mussels to protect human health. © 2010 The Authors. Letters in Applied Microbiology © 2010 The Society for Applied Microbiology.

  18. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    Science.gov (United States)

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. © 2013.

  19. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  20. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli

    Science.gov (United States)

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M. Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3’ proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons are expressed

  1. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Science.gov (United States)

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan; Ishihama, Akira

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons are expressed

  2. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    Directory of Open Access Journals (Sweden)

    Gbenga Adedeji Adewumi

    2013-01-01

    Full Text Available In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the sixteen iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, Staphylococcus saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and Uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA combined with 16S-23S rRNA gene internal transcribed spacer (ITS PCR amplification, restriction analysis (ITS-PCR-RFLP and randomly amplified polymorphic DNA (RAPD-PCR. This further discriminated Bacillus subtilis and its variants from food-borne pathogens such as Bacillus cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP for iru production to achieve product consistency, safety quality and improved shelf life.

  3. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    Science.gov (United States)

    Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

    2012-01-01

    In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life.

  4. Evidence for indigenous Streptomyces populations in a marine environment determined with a 16S rRNA probe.

    OpenAIRE

    Moran, M A; Rutherford, L T; Hodson, R E

    1995-01-01

    A 16S rRNA genus-specific probe was used to determine whether Streptomyces populations are an indigenous component of marine sediment bacterial communities. Previous debates have suggested that marine Streptomyces isolates are derived not from resident populations but from spores of terrestrial species which have been physically transported to marine ecosystems but remain dormant until isolation. Rigorously controlled hybridization of rRNA extracted from coastal marsh sediments with the genus...

  5. Evidence for indigenous Streptomyces populations in a marine environment determined with a 16S rRNA probe.

    Science.gov (United States)

    Moran, M A; Rutherford, L T; Hodson, R E

    1995-10-01

    A 16S rRNA genus-specific probe was used to determine whether Streptomyces populations are an indigenous component of marine sediment bacterial communities. Previous debates have suggested that marine Streptomyces isolates are derived not from resident populations but from spores of terrestrial species which have been physically transported to marine ecosystems but remain dormant until isolation. Rigorously controlled hybridization of rRNA extracted from coastal marsh sediments with the genus-specific probe indicated that Streptomyces rRNA accounted for 2 to 5% of the sediment community rRNA and that spores are not the source of the hybridization signal. Streptomyces populations must therefore be at least the 26th most abundant genus-level source of bacterial rRNA. the relative amounts of rRNAs from Streptomyces spp. and members of the Bacteria (69 to 79%) and Archaea (4 to 7%) domains were highly consistent in these marine sediments throughout an annual cycle, indicating that the species composition of sediment bacterial communities may be more stable than recent studies suggest for marine planktonic bacterial communities. Laboratory studies designed to investigate the possible functional roles of Streptomyces populations in coastal sediments demonstrated that population levels of this genus changed relatively rapidly (within a time frame of 6 weeks) in response to manipulation of substrate availability. Amendments of intact sediment cores with two compounds (vanillic acid and succinic acid) consistently resulted in Streptomyces populations contributing an increased percentage of rRNA (6 to 15%) to the total bacterial rRNA pool.

  6. Mutations in 23 S ribosomal RNA perturb transfer RNA selection and can lead to streptomycin dependence.

    Science.gov (United States)

    Bilgin, N; Ehrenberg, M

    1994-01-21

    Escherichia coli ribosomes with a G to C transversion at position 2661 in 23 S ribosomal RNA are more accurate in tRNA selection than wild-type ribosomes. This enhanced accuracy is due to improved initial selection of ternary complexes rather than proofreading of aminoacyl tRNAs. The 2661C mutation reduces the binding rate of cognate ternary complexes to the A-site. This binding rate deficiency becomes dramatic when ribosomes also harbour an S12 mutation with a streptomycin-resistant, hyperaccurate phenotype. In this case, severe loss of kinetic efficiency in EF-Tu function leads to cell death. Streptomycin restores viability by increasing the association rate of ternary complex to these doubly altered ribosomes. The binding rate of EF-G to 2661C ribosomes is also reduced while the translocation rate is unaffected.

  7. Behavior of 23S metastable state He atoms in low-temperature recombining plasmas

    Science.gov (United States)

    Kajita, Shin; Tsujihara, Tadashi; Aramaki, Mitsutoshi; van der Meiden, Hennie; Oshima, Hiroshi; Ohno, Noriyasu; Tanaka, Hirohiko; Yasuhara, Ryo; Akiyama, Tsuyoshi; Fujii, Keisuke; Shikama, Taiichi

    2017-07-01

    We measured the electron density and temperature using laser Thomson scattering and metastable state (23S) of He atoms by laser absorption spectroscopy in the detached recombining plasmas in the divertor simulator NAGDIS-II. Using the measured electron density and temperature combined with the particle trajectory trace simulation, we discussed the behavior of the metastable state He atoms based on comparisons with the experimental results. It is shown that the metastable state atoms are mainly produced in the peripheral region of the plasma column, where the temperature is lower than the central part, and diffused in the vacuum vessel. It was shown that the 0D model is not valid and the transport of the metastable states is to be taken into account for the population distribution of He atoms in the detached plasmas.

  8. ANALISA URUTAN GEN 16S rRNA DARI BAKTERI ORAL YANG TIDAK DIKENAL

    Directory of Open Access Journals (Sweden)

    Ariana Djais

    2015-07-01

    Full Text Available The purpose of this study was to identify five unknown bacterial strains by using 16S rRNA gene sequencing. These strains isolated from endodontic lesions and periodontal pocket are culture-difficult and inert in most biochemical tests, and could not be classified to any established bacterial species by conventional bacteriological method. In the present study, genomic DNA was extracted from the cultured bacterial cells with InstaGene (BIO-RAD, and the 16S rRNA gene was amplified by PCR with universal primers (27F and 1492R and Premix Taq (Ex Taq version, Takara, then was sequenced by using a Thermo Sequence Fluorescent Labelled Primer Cycle Sequencing Kit (Amersham and an ALFexpress DNA sequencer (Pharmacin LKB. The segmented nucleotide sequences of 16S rDNA were integrated by using SEQMAN in LASERGENE computer program (DNASTAR. The 16S rDNA sequences of the unknown bacterial strain were applied to GenBank by using BLAST program to search the suspected bacterial species . The MEGALIGN search program showed that the sequence similarities were 89.5% - 91.3% to a type strain of Dialister pneumosintes among the established bacterial species. Based on the phylogenetic data, it is considered that the five unknown strains have to be presented a new bacterial species as Dialister-like bacterium.

  9. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  10. Macrolide resistance conferred by rRNA mutations in field isolates of Mannheimia haemolytica and Pasteurella multocida.

    Science.gov (United States)

    Olsen, Anders S; Warrass, Ralf; Douthwaite, Stephen

    2015-02-01

    To determine how resistance to macrolides is conferred in field isolates of Pasteurella multocida and Mannheimia haemolytica that lack previously identified resistance determinants for rRNA methylation, efflux and macrolide-modifying enzymes. Isolates of P. multocida and M. haemolytica identified as being highly resistant (MICs >64 mg/L) to the macrolides erythromycin, gamithromycin, tilmicosin, tildipirosin and tulathromycin were screened by multiplex PCR for the previously identified resistance genes erm(42), msr(E) and mph(E). Strains lacking these determinants were analysed by genome sequencing and primer extension on the rRNAs. Macrolide resistance in one M. haemolytica isolate was conferred by the 23S rRNA mutation A2058G; resistance in three P. multocida isolates were caused by mutations at the neighbouring nucleotide A2059G. In each strain, all six copies of the rrn operons encoded the respective mutations. There were no mutations in the ribosomal protein genes rplD or rplV, and no other macrolide resistance mechanism was evident. High-level macrolide resistance can arise from 23S rRNA mutations in P. multocida and M. haemolytica despite their multiple copies of rrn. Selective pressures from exposure to different macrolide or lincosamide drugs presumably resulted in consolidation of either the A2058G or the A2059G mutation. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

    Science.gov (United States)

    Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

    As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

  12. Determination of Active Marine Bacterioplankton: a Comparison of Universal 16S rRNA Probes, Autoradiography, and Nucleoid Staining

    OpenAIRE

    Karner, M.; Fuhrman, J. A.

    1997-01-01

    We compared several currently discussed methods for the assessment of bacterial numbers and activity in marine waters, using samples from a variety of marine environments, from aged offshore seawater to rich harbor water. Samples were simultaneously tested for binding to a fluorescently labeled universal 16S rRNA probe; (sup3)H-labeled amino acid uptake via autoradiography; nucleoid-containing bacterial numbers by modified DAPI (4(prm1),6-diamidino-2-phenylindole) staining; staining with 5-cy...

  13. Molecular characterization of the non-coding promoter and leader regions and full-length 16S ribosomal RNA (rRNA) gene of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, A; Saito, S; Sekizuka, T; Murayama, O; Moore, J E; Millar, B C; Matsuda, M

    2007-06-01

    The 3,339 base pair (bp) sequences encoding a putative open reading frame (ORF), non-coding promoter and leader regions (approximately 320 bp), full-length 16S ribosomal RNA (rRNA) gene (approximate 1,540 bp) and part of the 16S-23S rDNA internal spacer region (ISR) were determined from genome DNA libraries of the Taylorella asinigenitalis (UK-1) isolate. The non-coding promoter and leader regions included antiterminators (boxB, boxA and boxC) immediately upstream of the 16S rRNA gene sequence. An approximately 680 bp region upstream of the non-coding promoter region appears to contain a putative ORF with high sequence similarity to GTP cyclohydrolase I. In addition, a typical order of intercistronic tRNA genes with the 48 nucleotide spacer of 5'-16S rDNA-tRNA(Ile)-tRNA(Ala)-23S rDNA-3' was demonstrated in a part of the 16S-23S rDNA ISR. The antiterminators of boxB and boxA were also identified in the ISR.A phylogenetic analysis based on the 16S rRNA gene sequence information clearly demonstrated that the five T. asinigenitalis isolates formed a cluster together with the three T. equigenitalis strains, more similar to Pelistega europaea than the other beta-Proteobacteria from the 13 species of 11 genera.

  14. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...

  15. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    DEFF Research Database (Denmark)

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.

    2006-01-01

    and recently shown to encode a methyltransferase that modifies 23S rRNA at A2503. Antimicrobial susceptibility testing shows that S. aureus and E. coli strains expressing the cfr gene exhibit elevated MICs to a number of chemically unrelated drugs. The phenotype is named PhLOPSA for resistance to the following......A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin...... drug classes: Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics. Each of these five drug classes contains important antimicrobial agents that are currently used in human and/or veterinary medicine. We find that binding of the PhLOPSA drugs, which bind...

  16. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  17. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1995-01-01

    ) and numerous multiple mutations were generated. Expression of mutant 23S rRNAs in vivo shows that all the mutations detectably alter the phenotype, with effects ranging from a slight growth rate reduction to lack of viability. Temperature sensitivity is conferred by 1071G-->A and 1092C-->U substitutions...

  18. Macrolide Resistance in Treponema pallidum Correlates With 23S rDNA Mutations in Recently Isolated Clinical Strains.

    Science.gov (United States)

    Molini, Barbara J; Tantalo, Lauren C; Sahi, Sharon K; Rodriguez, Veronica I; Brandt, Stephanie L; Fernandez, Mark C; Godornes, Charmie B; Marra, Christina M; Lukehart, Sheila A

    2016-09-01

    High rates of 23S rDNA mutations implicated in macrolide resistance have been identified in Treponema pallidum samples from syphilis patients in many countries. Nonetheless, some clinicians have been reluctant to abandon azithromycin as a treatment for syphilis, citing the lack of a causal association between these mutations and clinical evidence of drug resistance. Although azithromycin resistance has been demonstrated in vivo for the historical Street 14 strain, no recent T. pallidum isolates have been tested. We used the well-established rabbit model of syphilis to determine the in vivo efficacy of azithromycin against 23S rDNA mutant strains collected in 2004 to 2005 from patients with syphilis in Seattle, Wash. Groups of 9 rabbits were each infected with a strain containing 23S rDNA mutation A2058G (strains UW074B, UW189B, UW391B) or A2059G (strains UW228B, UW254B, and UW330B), or with 1 wild type strain (Chicago, Bal 3, and Mexico A). After documentation of infection, 3 animals per strain were treated with azithromycin, 3 were treated with benzathine penicillin G, and 3 served as untreated control groups. Treatment efficacy was documented by darkfield microscopic evidence of T. pallidum, serological response, and rabbit infectivity test. Azithromycin uniformly failed to cure rabbits infected with strains harboring either 23S rDNA mutation, although benzathine penicillin G was effective. Infections caused by wild type strains were successfully treated by either azithromycin or benzathine penicillin G. A macrolide resistant phenotype was demonstrated for all strains harboring a 23S rDNA mutation, demonstrating that either A2058G or A2059G mutation confers in vivo drug resistance.

  19. Efficient subtraction of insect rRNA prior to transcriptome analysis of Wolbachia-Drosophila lateral gene transfer

    Directory of Open Access Journals (Sweden)

    Kumar Nikhil

    2012-05-01

    Full Text Available Abstract Background Numerous methods exist for enriching bacterial or mammalian mRNA prior to transcriptome experiments. Yet there persists a need for methods to enrich for mRNA in non-mammalian animal systems. For example, insects contain many important and interesting obligate intracellular bacteria, including endosymbionts and vector-borne pathogens. Such obligate intracellular bacteria are difficult to study by traditional methods. Therefore, genomics has greatly increased our understanding of these bacteria. Efficient subtraction methods are needed for removing both bacteria and insect rRNA in these systems to enable transcriptome-based studies. Findings A method is described that efficiently removes >95% of insect rRNA from total RNA samples, as determined by microfluidics and transcriptome sequencing. This subtraction yielded a 6.2-fold increase in mRNA abundance. Such a host rRNA-depletion strategy, in combination with bacterial rRNA depletion, is necessary to analyze transcription of obligate intracellular bacteria. Here, transcripts were identified that arise from a lateral gene transfer of an entire Wolbachia bacterial genome into a Drosophila ananassae chromosome. In this case, an rRNA depletion strategy is preferred over polyA-based enrichment since transcripts arising from bacteria-to-animal lateral gene transfer may not be poly-adenylated. Conclusions This enrichment method yields a significant increase in mRNA abundance when poly-A selection is not suitable. It can be used in combination with bacterial rRNA subtraction to enable experiments to simultaneously measure bacteria and insect mRNA in vector and endosymbiont biology experiments.

  20. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Directory of Open Access Journals (Sweden)

    Chenyu Zhang

    2009-05-01

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  1. Bacterial Keratitis

    Science.gov (United States)

    ... Español Eye Health / Eye Health A-Z Bacterial Keratitis Sections What Is Bacterial Keratitis? Bacterial Keratitis Symptoms ... Lens Care Bacterial Keratitis Treatment What Is Bacterial Keratitis? Leer en Español: ¿Qué Es la Queratitis Bacteriana? ...

  2. Identification and Analysis of Informative Single Nucleotide Polymorphisms in 16S rRNA Gene Sequences of the Bacillus cereus Group.

    Science.gov (United States)

    Hakovirta, Janetta R; Prezioso, Samantha; Hodge, David; Pillai, Segaran P; Weigel, Linda M

    2016-11-01

    Analysis of 16S rRNA genes is important for phylogenetic classification of known and novel bacterial genera and species and for detection of uncultivable bacteria. PCR amplification of 16S rRNA genes with universal primers produces a mixture of amplicons from all rRNA operons in the genome, and the sequence data generally yield a consensus sequence. Here we describe valuable data that are missing from consensus sequences, variable effects on sequence data generated from nonidentical 16S rRNA amplicons, and the appearance of data displayed by different software programs. These effects are illustrated by analysis of 16S rRNA genes from 50 strains of the Bacillus cereus group, i.e., Bacillus anthracis, Bacillus cereus, Bacillus mycoides, and Bacillus thuringiensis These species have 11 to 14 rRNA operons, and sequence variability occurs among the multiple 16S rRNA genes. A single nucleotide polymorphism (SNP) previously reported to be specific to B. anthracis was detected in some B. cereus strains. However, a different SNP, at position 1139, was identified as being specific to B. anthracis, which is a biothreat agent with high mortality rates. Compared with visual analysis of the electropherograms, basecaller software frequently missed gene sequence variations or could not identify variant bases due to overlapping basecalls. Accurate detection of 16S rRNA gene sequences that include intragenomic variations can improve discrimination among closely related species, improve the utility of 16S rRNA databases, and facilitate rapid bacterial identification by targeted DNA sequence analysis or by whole-genome sequencing performed by clinical or reference laboratories. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Insertions or deletions (Indels) in the rrn 16S-23S rRNA gene internal transcribed spacer region (ITS) compromise the typing and identification of strains within the Acinetobacter calcoaceticus-baumannii (Acb) complex and closely related members.

    Science.gov (United States)

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2-13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species.

  4. Insertions or deletions (Indels in the rrn 16S-23S rRNA gene internal transcribed spacer region (ITS compromise the typing and identification of strains within the Acinetobacter calcoaceticus-baumannii (Acb complex and closely related members.

    Directory of Open Access Journals (Sweden)

    Christopher Maslunka

    Full Text Available To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp and other strains (607 bp can be explained by presence of an insertion (indel 13i/1 in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2-13i/5 were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp. These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp as those in Acinetobacter strains b/n1&3, A. pittii (10 strains, A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member, their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species.

  5. An RNA molecular switch: Intrinsic flexibility of 23S rRNA helices 40 and 68 5’-UAA/5’-GAN internal loops studied by molecular dynamics methods

    Czech Academy of Sciences Publication Activity Database

    Réblová, Kamila; Střelcová, Z.; Kulhánek, P.; Beššeová, Ivana; Mathews, D.H.; Van Nostrand, K.; Yildirim, I.; Turner, D.H.; Šponer, Jiří

    2010-01-01

    Roč. 6, č. 3 (2010), s. 910-929 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA AV ČR(CZ) KJB400040901 Grant - others:GA MŠk(CZ) LC06030; GA ČR(CZ) GD203/09/H046; GA ČR(CZ) GA203/09/1476 Program:LC; GD; GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : RNA * internal loop * molecular dynamics Subject RIV: AQ - Safety, Health Protection, Human - Machine Impact factor: 5.138, year: 2010

  6. Structure of the bifunctional methyltransferase YcbY (RlmKL) that adds the m7G2069 and m2G2445 modifications in Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Wang, Kai-Tuo; Desmolaize, Benoit; Nan, Jie

    2012-01-01

    , and this nucleotide remains unmodified in Gram-positive rRNAs. The E.coli YcbY enzyme is the first example of a methyltransferase catalyzing two mechanistically different types of RNA modification, and has been renamed as the Ribosomal large subunit methyltransferase, RlmKL. Our structural and functional data provide...

  7. A plasmid-coded and site-directed mutation in Escherichia coli 23S RNA that confers resistance to erythromycin

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1987-01-01

    , and cells grown in the presence of erythromycin contain ribosomes with high levels of mutated 23S RNA. In these cells, wild type 50S subunits 'fall off' the message and are selectively degraded, possibly as a result of an erythromycin-induced conformational change. A fast in vitro poly(U) assay revealed...... minimal effects of erythromycin on elongation beyond tetrapeptides. We correlated these results with the literature data and concluded that erythromycin acts immediately post-initiation and directly, or indirectly, destabilizes mRNA-bound 70S ribosomes, and prevents their recycling by causing 50S subunit...

  8. Molecular Characterization and Potential of Bacterial Species ...

    African Journals Online (AJOL)

    Knowledge of the true microbial diversity in cassava waste (CW) is fundamental to effective utilization of this waste. This paper reports, on the identification of bacteria species associated with CW, using molecular tools. The 16S rRNA gene of total bacteria community and bacterial isolates were amplified by Polymerase ...

  9. Development of Faecalibacterium 16S rRNA gene marker for identification of human faeces.

    Science.gov (United States)

    Zheng, G; Yampara-Iquise, H; Jones, J E; Andrew Carson, C

    2009-02-01

    The focus of this study was to identify a bacterial 16S rRNA gene sequence, unique to microbiota in the human gut, for use in development of a dependable PCR assay to detect human faecal pollution in water. Suppression subtractive hybridization (SSH) and bioinformatics were used to identify a genetic marker, within the 16S rRNA gene of Faecalibacterium, for the detection of human faeces. DNA sequencing analysis demonstrated that a majority (16) of 74 clones of the SSH library contained insertion sequences identified as Faecalibacterium 16S rRNA genes. Human faeces-specific sequences were derived and six PCR primer sets designed and tested against faecal DNA samples from human and nonhuman sources. One PCR primer set, HFB-F3 and HFB-R5, was exclusively associated with human faeces. These primers generated a human faeces-specific amplicon of 399 bp from 60.2% of human faecal samples and 100% of sewage samples. The subject Faecalibacterium marker is specific for sewage. This study represents the initial report of a Faecalibacterium marker for human faeces, which may prove useful for microbial source tracking.

  10. Emergence of methicillin-resistant coagulase-negative staphylococci resistant to linezolid with rRNA gene C2190T and G2603T mutations.

    Science.gov (United States)

    Cidral, Thiago André; Carvalho, Maria Cícera; Figueiredo, Agnes Marie Sá; de Melo, Maria Celeste Nunes

    2015-10-01

    The aim of this article were to determinate the mechanism of linezolid resistance in coagulase-negative methicillin-resistant staphylococci from hospitals in the northeast of Brazil. We identified the isolates using VITEK(®) 2 and MALDI-TOF. Susceptibility to antibiotics was measured by the disk-diffusion method and by Etest(®) . Extraction of the whole genome DNA was performed, followed by screening of all the strains for the presence of mecA and cfr genes. The domain V region of 23S rRNA gene was sequenced and then aligned with a linezolid-susceptible reference strain. Pulsed-field gel electrophoresis (PFGE) macro-restriction analysis was performed. Three linezolid-resistant Staphylococcus hominis and two linezolid-resistant Staphylococcus epidermidis strains were analyzed. The isolates showed two point mutations in the V region of the 23S rRNA gene (C2190T and G2603T). We did not detect the cfr gene in any isolate by PCR. The S. hominis showed the same pulsotype, while the S. epidermidis did not present any genetic relation to each other. In conclusion, this study revealed three S. hominis and two S. epidermidis strains with resistance to linezolid due to a double mutation (C2190T and G2603T) in the domain V of the 23S rRNA gene. For the first time, the mutation of C2190T in S. epidermidis is described. This study also revealed the clonal spread of a S. hominis pulsotype between three public hospitals in the city of Natal, Brazil. These findings highlight the importance of continued vigilance of linezolid resistance in staphylococci. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  11. High level bacterial contamination of secondary school students' mobile phones.

    Science.gov (United States)

    Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet

    2017-06-01

    While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students' mobile phones. Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline ( tet A, tet B, tet M), erythromycin ( erm B) and sulphonamide ( sul 1) resistance genes was assessed. We found a high median bacterial count on secondary school students' mobile phones (10.5 CFU/cm 2 ) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes ( Staphylococcus aureus , Acinetobacter spp. , Pseudomonas spp., Bacillus cereus and Neisseria flavescens ) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner's gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Quantitative study methods revealed high level bacterial contamination of secondary school students' mobile phones.

  12. 16S rRNA gene-based identification of bacteria in postoperative endophthalmitis by PCR- Denaturing Gradient Gel Electrophoresis (PCR-DGGE) fingerprinting

    OpenAIRE

    Navarro-Noya, Yendi; Hernández-Rodríguez, César; Zenteno, Juan C; Buentello-Volante, Beatriz; Cancino-Díaz, Mario E; Jan-Roblero, Janet; Cancino-Díaz, Juan C

    2012-01-01

    Conventional microbiological culture techniques are frequently insufficient to confirm endophthalmitis clinical cases which could require urgent medical attention because it could lead to permanent vision loss. We are proposing PCR-DGGE and 16S rRNA gene libraries as an alternative to improve the detection and identification rate of bacterial species from endophthalmitis cases.

  13. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    Science.gov (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  14. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development - Poster

    Science.gov (United States)

    We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

  15. Bacterial meningitis

    NARCIS (Netherlands)

    Roos, Karen L.; van de Beek, Diederik

    2010-01-01

    Bacterial meningitis is a neurological emergency. Empiric antimicrobial and adjunctive therapy should be initiated as soon as a single set of blood cultures has been obtained. Clinical signs suggestive of bacterial meningitis include fever, headache, meningismus, vomiting, photophobia, and an

  16. Chronic N-amended soils exhibit an altered bacterial community structure in Harvard Forest, MA, USA

    Science.gov (United States)

    Swathi A. Turlapati; Rakesh Minocha; Premsai S. Bhiravarasa; Louise S. Tisa; William K. Thomas; Subhash C. Minocha

    2013-01-01

    At the Harvard Forest, Petersham, MA, the impact of 20 years of annual ammonium nitrate application to the mixed hardwood stand on soil bacterial communities was studied using 16S rRNA genes pyrosequencing. Amplification of 16S rRNA genes was done using DNA extracted from 30 soil samples (three treatments x two horizons x five subplots) collected from untreated (...

  17. Seasonal Dynamics of Bacterioplankton Community Structure in a Eutrophic Lake as Determined by 5S rRNA Analysis

    Science.gov (United States)

    Höfle, Manfred G.; Haas, Heike; Dominik, Katja

    1999-01-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plußsee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (β-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments. PMID:10388718

  18. Molecular Characterization of the 16S rRNA Gene of Helicobacter fennelliae Isolated from Stools and Blood Cultures from Paediatric Patients in South Africa

    Directory of Open Access Journals (Sweden)

    Heidi E. M. Smuts

    2011-01-01

    Full Text Available Forty strains of H. fennelliae collected from paediatric blood and stool samples over an 18 year period at a children's hospital in Cape Town, South Africa, were amplified by PCR of the 16S rRNA. Two distinct genotypes of H. fennelliae were identified based on the phylogenetic analysis. This was confirmed by sequencing a portion of the beta subunit of the RNA polymerase (rpoB gene. All isolates from South Africa clustered with a proposed novel Helicobacter strain (accession number AF237612 isolated in Australia, while three H. fennelliae type strains from the northern hemisphere, NCTC 11612, LMG 7546 and CCUG 18820, formed a separate branch. A large (355bp highly conserved intervening sequence (IVS in the 16S rRNA was found in all isolates. Predicted secondary structures of the IVS from the 16S rRNA and 23S rRNA were characterised by a primary stem structure formed by base pairing of the 3′ and 5′ ends and internal loops and stems. This phylogenetic analysis is the largest undertaken of H. fennelliae. The South African H. fennelliae isolates are closely related to an Australian isolate previously reported to be a possible novel species of Helicobacter. This study suggests that the latter is strain of H. fennelliae.

  19. Crystal structure of the Escherichia coli 23S rRNA:m5C methyltransferase RlmI (YccW) reveals evolutionary links between RNA modification enzymes

    DEFF Research Database (Denmark)

    Sunita, S; Tkaczuk, Karolina L; Purta, Elzbieta

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I...

  20. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    Science.gov (United States)

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Rifaximin has minor effects on bacterial composition, inflammation and bacterial translocation in cirrhosis

    DEFF Research Database (Denmark)

    Kimer, Nina; Pedersen, Julie S.; Tavenier, Juliette

    2018-01-01

    .4), and MELD score 12 (±3.9). Patients received rifaximin 550 mg BD (n=36) or placebo BD (n=18). Blood and faecal (n=15) sampling were conducted at baseline and after four weeks. Bacterial DNA in blood was determined by real-time qPCR 16S rRNA gene quantification. Bacterial composition in faeces was analysed......: Four weeks of treatment with rifaximin had no impact on the inflammatory state and only minor effects on BT and intestinal bacterial composition in stable, decompensated cirrhosis (NCT01769040)....

  2. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  3. Bacterial Proteasomes.

    Science.gov (United States)

    Jastrab, Jordan B; Darwin, K Heran

    2015-01-01

    Interest in bacterial proteasomes was sparked by the discovery that proteasomal degradation is required for the pathogenesis of Mycobacterium tuberculosis, one of the world's deadliest pathogens. Although bacterial proteasomes are structurally similar to their eukaryotic and archaeal homologs, there are key differences in their mechanisms of assembly, activation, and substrate targeting for degradation. In this article, we compare and contrast bacterial proteasomes with their archaeal and eukaryotic counterparts, and we discuss recent advances in our understanding of how bacterial proteasomes function to influence microbial physiology.

  4. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  5. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

  6. Characterization of the Fecal Microbial Communities of Duroc Pigs Using 16S rRNA Gene Pyrosequencing

    Directory of Open Access Journals (Sweden)

    Edward Alain B. Pajarillo

    2015-04-01

    Full Text Available This study characterized the fecal bacterial community structure and inter-individual variation in 30-week-old Duroc pigs, which are known for their excellent meat quality. Pyrosequencing of the V1–V3 hypervariable regions of the 16S rRNA genes generated 108,254 valid reads and 508 operational taxonomic units at a 95% identity cut-off (genus level. Bacterial diversity and species richness as measured by the Shannon diversity index were significantly greater than those reported previously using denaturation gradient gel electrophoresis; thus, this study provides substantial information related to both known bacteria and the untapped portion of unclassified bacteria in the population. The bacterial composition of Duroc pig fecal samples was investigated at the phylum, class, family, and genus levels. Firmicutes and Bacteroidetes predominated at the phylum level, while Clostridia and Bacteroidia were most abundant at the class level. This study also detected prominent inter-individual variation starting at the family level. Among the core microbiome, which was observed at the genus level, Prevotella was consistently dominant, as well as a bacterial phylotype related to Oscillibacter valericigenes, a valerate producer. This study found high bacterial diversity and compositional variation among individuals of the same breed line, as well as high abundance of unclassified bacterial phylotypes that may have important functions in the growth performance of Duroc pigs.

  7. Bacterial adhesion

    NARCIS (Netherlands)

    Loosdrecht, van M.C.M.

    1988-01-01

    As mentioned in the introduction of this thesis bacterial adhesion has been studied from a variety of (mostly practice oriented) starting points. This has resulted in a range of widely divergent approaches. In order to elucidate general principles in bacterial adhesion phenomena, we felt it

  8. 16S rRNA gene phylogenesis of culturable predominant bacteria from diseased Apostichopus japonicus (Holothuroidea, Echinodermata)

    Science.gov (United States)

    Ma, Haiyan; Jiang, Guoliang; Wu, Zhiqiang; Wang, Xin

    2009-06-01

    Cultured Apostichopus japonicus in China suffers from a kind of skin ulceration disease that has caused severe economic loss in recent years. The disease, pathogens of which are supposed to be bacteria by most researchers, is highly infectious and can often cause all individuals in the same culture pool to die in a very short time. The 16S rRNA gene phylogenesis of the culturable bacteria from the lesions of diseased individuals was conducted to study the biodiversity of the bacterial communities in the lesions and to identify probable pathogen(s) associated with this kind of disease. S. japonica samples were selected from a hatchery located in the eastern part of Qingdao, China. Bacterial universal primers GM5F and DS907R were used to amplify the 16S rRNA gene of bacteria colonies, and touchdown PCR was performed to amplify the target sequences. The results suggest that γ- proteobacteria (Alteromonadales and Vibrionales) of CFB group, many strains of which have been also determined as pathogens in other marine species, are the predominant bacterial genera of the diseased Apostichopus japonicus individuals.

  9. The Variability of the 16S rRNA Gene in Bacterial Genomes and Its Consequences for Bacterial Community Analyses

    Czech Academy of Sciences Publication Activity Database

    Větrovský, Tomáš; Baldrian, Petr

    2013-01-01

    Roč. 8, č. 2 (2013) E-ISSN 1932-6203 R&D Projects: GA MŠk LD12048; GA MŠk LD12050 Institutional support: RVO:61388971 Keywords : OPERON COPY NUMBER * MICROBIAL COMMUNITIES * MOLECULAR MARKERS Subject RIV: EE - Microbiology, Virology Impact factor: 3.534, year: 2013

  10. Clearance of viable Mycobacterium ulcerans from Buruli ulcer lesions during antibiotic treatment as determined by combined 16S rRNA reverse transcriptase /IS 2404 qPCR assay.

    Science.gov (United States)

    Sarpong-Duah, Mabel; Frimpong, Michael; Beissner, Marcus; Saar, Malkin; Laing, Ken; Sarpong, Francisca; Loglo, Aloysius Dzigbordi; Abass, Kabiru Mohammed; Frempong, Margaret; Sarfo, Fred Stephen; Bretzel, Gisela; Wansbrough-Jones, Mark; Phillips, Richard Odame

    2017-07-01

    Buruli ulcer (BU) caused by Mycobacterium ulcerans is effectively treated with rifampicin and streptomycin for 8 weeks but some lesions take several months to heal. We have shown previously that some slowly healing lesions contain mycolactone suggesting continuing infection after antibiotic therapy. Now we have determined how rapidly combined M. ulcerans 16S rRNA reverse transcriptase / IS2404 qPCR assay (16S rRNA) became negative during antibiotic treatment and investigated its influence on healing. Fine needle aspirates and swab samples were obtained for culture, acid fast bacilli (AFB) and detection of M. ulcerans 16S rRNA and IS2404 by qPCR (16S rRNA) from patients with IS2404 PCR confirmed BU at baseline, during antibiotic and after treatment. Patients were followed up at 2 weekly intervals to determine the rate of healing. The Kaplan-Meier survival analysis was used to analyse the time to clearance of M. ulcerans 16S rRNA and the influence of persistent M ulcerans 16S rRNA on time to healing. The Mann Whitney test was used to compare the bacillary load at baseline in patients with or without viable organisms at week 4, and to analyse rate of healing at week 4 in relation to detection of viable organisms. Out of 129 patients, 16S rRNA was detected in 65% of lesions at baseline. The M. ulcerans 16S rRNA remained positive in 78% of patients with unhealed lesions at 4 weeks, 52% at 8 weeks, 23% at 12 weeks and 10% at week 16. The median time to clearance of M. ulcerans 16S rRNA was 12 weeks. BU lesions with positive 16S rRNA after antibiotic treatment had significantly higher bacterial load at baseline, longer healing time and lower healing rate at week 4 compared with those in which 16S rRNA was not detected at baseline or had become undetectable by week 4. Current antibiotic therapy for BU is highly successful in most patients but it may be possible to abbreviate treatment to 4 weeks in patients with a low initial bacterial load. On the other hand persistent

  11. Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

    Science.gov (United States)

    Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

    2017-01-01

    RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse

  12. Combining 16S rRNA gene variable regions enables high-resolution microbial community profiling.

    Science.gov (United States)

    Fuks, Garold; Elgart, Michael; Amir, Amnon; Zeisel, Amit; Turnbaugh, Peter J; Soen, Yoav; Shental, Noam

    2018-01-26

    Most of our knowledge about the remarkable microbial diversity on Earth comes from sequencing the 16S rRNA gene. The use of next-generation sequencing methods has increased sample number and sequencing depth, but the read length of the most widely used sequencing platforms today is quite short, requiring the researcher to choose a subset of the gene to sequence (typically 16-33% of the total length). Thus, many bacteria may share the same amplified region, and the resolution of profiling is inherently limited. Platforms that offer ultra-long read lengths, whole genome shotgun sequencing approaches, and computational frameworks formerly suggested by us and by others all allow different ways to circumvent this problem yet suffer various shortcomings. There is a need for a simple and low-cost 16S rRNA gene-based profiling approach that harnesses the short read length to provide a much larger coverage of the gene to allow for high resolution, even in harsh conditions of low bacterial biomass and fragmented DNA. This manuscript suggests Short MUltiple Regions Framework (SMURF), a method to combine sequencing results from different PCR-amplified regions to provide one coherent profiling. The de facto amplicon length is the total length of all amplified regions, thus providing much higher resolution compared to current techniques. Computationally, the method solves a convex optimization problem that allows extremely fast reconstruction and requires only moderate memory. We demonstrate the increase in resolution by in silico simulations and by profiling two mock mixtures and real-world biological samples. Reanalyzing a mock mixture from the Human Microbiome Project achieved about twofold improvement in resolution when combing two independent regions. Using a custom set of six primer pairs spanning about 1200 bp (80%) of the 16S rRNA gene, we were able to achieve ~ 100-fold improvement in resolution compared to a single region, over a mock mixture of common human gut

  13. Beyond 16S rRNA Community Profiling: Intra-Species Diversity in the Gut Microbiota.

    Science.gov (United States)

    Ellegaard, Kirsten M; Engel, Philipp

    2016-01-01

    Interactions with microbes affect many aspects of animal biology, including immune system development, nutrition and health. In vertebrates, the gut microbiota is dominated by a small subset of phyla, but the species composition within these phyla is typically not conserved. Moreover, several recent studies have shown that bacterial species in the gut are composed of a multitude of strains, which frequently co-exist in their host, and may be host-specific. However, since the study of intra-species diversity is challenging, particularly in the setting of complex, host-associated microbial communities, our current understanding of the distribution, evolution and functional relevance of intra-species diversity in the gut is scarce. In order to unravel how genomic diversity translates into phenotypic diversity, community analyses going beyond 16S rRNA profiling, in combination with experimental approaches, are needed. Recently, the honeybee has emerged as a promising model for studying gut bacterial communities, particularly in terms of strain-level diversity. Unlike most other invertebrates, the honeybee gut is colonized by a remarkably consistent and specific core microbiota, which is dominated by only eight bacterial species. As for the vertebrate gut microbiota, these species are composed of highly diverse strains suggesting that similar evolutionary forces shape gut community structures in vertebrates and social insects. In this review, we outline current knowledge on the evolution and functional relevance of strain diversity within the gut microbiota, including recent insights gained from mammals and other animals such as the honeybee. We discuss methodological approaches and propose possible future avenues for studying strain diversity in complex bacterial communities.

  14. [Identification of 23 mycobacterial species by Invader assay with targeting 16S rRNA gene and ITS-1 region--comparison with DDH method in clinical isolates].

    Science.gov (United States)

    Nagano, Makoto; Ichimura, Sadahiro; Ito, Nobuko; Tomii, Takayuki; Kazumi, Yuko; Takei, Katsuaki; Abe, Chiyoji; Sugawara, Isamu

    2008-07-01

    The Invader assay was developed to identify 23 mycobacterial species using probes derived from the species-specific region of the 16S rRNA gene and the 16S-23S rRNA internal transcribed spacer 1 (ITS-1) region, with minor modifications of our previous study. In the present study, we compared the identification capability between the Invader assay and DNA-DNA hybridization (DDH) method. DDH is commonly used to identify non-tuberculosis mycobacterium in Japan and 636 clinical mycobacterial strains cultured on Ogawa slants were tested. The Invader assay could identify 615 (96.7%) of the 636 strains. The results contained 14 M.lentiflavum, 3 M. parascrofulaceum and 1 M. intermedium, which were undetectable with DDH method. On the other hand, DDH method could identify 580 (91.2%) strains with duplicate assay. Of 628 strains except 8 strains identified as a few species by Invader assay, 551 (87.7%) strains were identified as the same species by two methods. Discordant results were mainly recognized for the identification of M. gordonae, M. avium, M. lentiflavum and M. intracellurare. The results of other methods targeting 16S rRNA indicated correctness of the Invader assay. These results indicate that Invader assay could identify more correctly than DDH method and could identify about 97% of clinically important mycobacterium.

  15. Community analysis of chronic wound bacteria using 16S rRNA gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota.

    Directory of Open Access Journals (Sweden)

    Lance B Price

    Full Text Available BACKGROUND: Bacterial colonization is hypothesized to play a pathogenic role in the non-healing state of chronic wounds. We characterized wound bacteria from a cohort of chronic wound patients using a 16S rRNA gene-based pyrosequencing approach and assessed the impact of diabetes and antibiotics on chronic wound microbiota. METHODOLOGY/PRINCIPAL FINDINGS: We prospectively enrolled 24 patients at a referral wound center in Baltimore, MD; sampled patients' wounds by curette; cultured samples under aerobic and anaerobic conditions; and pyrosequenced the 16S rRNA V3 hypervariable region. The 16S rRNA gene-based analyses revealed an average of 10 different bacterial families in wounds--approximately 4 times more than estimated by culture-based analyses. Fastidious anaerobic bacteria belonging to the Clostridiales family XI were among the most prevalent bacteria identified exclusively by 16S rRNA gene-based analyses. Community-scale analyses showed that wound microbiota from antibiotic treated patients were significantly different from untreated patients (p = 0.007 and were characterized by increased Pseudomonadaceae abundance. These analyses also revealed that antibiotic use was associated with decreased Streptococcaceae among diabetics and that Streptococcaceae was more abundant among diabetics as compared to non-diabetics. CONCLUSIONS/SIGNIFICANCE: The 16S rRNA gene-based analyses revealed complex bacterial communities including anaerobic bacteria that may play causative roles in the non-healing state of some chronic wounds. Our data suggest that antimicrobial therapy alters community structure--reducing some bacteria while selecting for others.

  16. Identification and Characterization of Novel Biocontrol Bacterial

    Directory of Open Access Journals (Sweden)

    Young Cheol Kim

    2014-09-01

    Full Text Available Because bacterial isolates from only a few genera have been developed commercially as biopesticides, discovery and characterization of novel bacterial strains will be a key to market expansion. Our previous screen using plant bioassays identified 24 novel biocontrol isolates representing 12 different genera. In this study, we characterized the 3 isolates showing the best biocontrol activities. The isolates were Pantoea dispersa WCU35, Proteus myxofaciens WCU244, and Exiguobacterium acetylicum WCU292 based on 16S rRNA sequence analysis. The isolates showed differential production of extracellular enzymes, antimicrobial activity against various fungal or bacterial plant pathogens, and induced systemic resistance activity against tomato gray mold disease caused by Botrytis cinerea. E. acetylicum WCU292 lacked strong in vitro antimicrobial activity against plant pathogens, but induced systemic resistance against tomato gray mold disease. These results confirm that the trait of biological control is found in a wide variety of bacterial genera

  17. A method for high precision sequencing of near full-length 16S rRNA genes on an Illumina MiSeq

    Directory of Open Access Journals (Sweden)

    Catherine M. Burke

    2016-09-01

    Full Text Available Background The bacterial 16S rRNA gene has historically been used in defining bacterial taxonomy and phylogeny. However, there are currently no high-throughput methods to sequence full-length 16S rRNA genes present in a sample with precision. Results We describe a method for sequencing near full-length 16S rRNA gene amplicons using the high throughput Illumina MiSeq platform and test it using DNA from human skin swab samples. Proof of principle of the approach is demonstrated, with the generation of 1,604 sequences greater than 1,300 nt from a single Nano MiSeq run, with accuracy estimated to be 100-fold higher than standard Illumina reads. The reads were chimera filtered using information from a single molecule dual tagging scheme that boosts the signal available for chimera detection. Conclusions This method could be scaled up to generate many thousands of sequences per MiSeq run and could be applied to other sequencing platforms. This has great potential for populating databases with high quality, near full-length 16S rRNA gene sequences from under-represented taxa and environments and facilitates analyses of microbial communities at higher resolution.

  18. Bacterial Vaginosis

    Science.gov (United States)

    ... Archive STDs Home Page Bacterial Vaginosis (BV) Chlamydia Gonorrhea Genital Herpes Hepatitis HIV/AIDS & STDs Human Papillomavirus ( ... of getting other STDs, such as chlamydia and gonorrhea . These bacteria can sometimes cause pelvic inflammatory disease ( ...

  19. Culture-dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Nabeel M. Alikunhi

    2017-09-01

    Full Text Available Fish contamination has been extensively investigated along the Saudi coasts, but studies pertaining to bacterial pathogens are scarce. We conducted qualitative assessment and molecular identification of culture-dependent bacteria in 13 fish species from three coastal sites and a local fish market in Jeddah, Saudi Arabia. Bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac, Eosin Methylene Blue (EMB and Thiosulfate Citrate Bile Salts (TCBS culture media. Bacterial counts significantly differed between species, sources and feeding habits of examined fishes. Mugil cephalus exhibited higher counts on TCBS (all body parts, Mac (gills, muscle and gut and EMB (gills and muscle. Fishes from Area I had higher bacterial loads, coinciding with those in seawater and sediment from the same site, indicating direct association between habitat conditions and the levels of bacterial contamination. By feeding habit, detritivorous fish harbored higher counts than herbivorous and carnivorous species. Bacterial counts of skin were higher in fish from market than field sites, and positively correlated with other body parts indicating the relation of surface bacterial load on the overall quality of fish. Rahnella aquatilis (Enterobacteriaceae and Photobacterium damselae (Vibrionaceae were among the dominant species from fish muscle based on 16S rRNA sequencing. These species are known human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens, e.g. Hafnia sp. (Enterobacteriaceae and Pseudomonas stutzeri (Pseudomonadaceae also occurred in fish muscle. The inclusion of bacterial contamination in future monitoring efforts is thus crucial.

  20. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    KAUST Repository

    Alikunhi, Nabeel M.

    2016-05-27

    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  1. Bacterioplankton community structure in the Arctic waters as revealed by pyrosequencing of 16S rRNA genes.

    Science.gov (United States)

    Zeng, Yin-Xin; Zhang, Fang; He, Jian-Feng; Lee, Sang H; Qiao, Zong-Yun; Yu, Yong; Li, Hui-Rong

    2013-06-01

    Fjords and open oceans are two typical marine ecosystems in the Arctic region, where glacial meltwater and sea ice meltwater have great effects on the bacterioplankton community structure during the summer season. This study aimed to determine the differences in bacterioplankton communities between these two ecosystems in the Arctic region. We conducted a detailed census of microbial communities in Kongsfjorden (Spitsbergen) and the Chukchi Borderland using high-throughput pyrosequencing of the 16S rRNA gene. Gammaproteobacteria and Bacteroidetes were the dominant members of the bacterioplankton community in Kongsfjorden. By contrast, the most abundant bacterial groups in the surface seawater samples from the Chukchi Borderland were Alphaproteobacteria and Actinobacteria. Differences in bacterial communities were found between the surface and subsurface waters in the investigation area of the Chukchi Borderland, and significant differences in bacterial community structure were also observed in the subsurface water between the shelf and deep basin areas. These results suggest the effect of hydrogeographic conditions on bacterial communities. Ubiquitous phylotypes found in all the investigated samples belonged to a few bacterial groups that dominate marine bacterioplankton communities. The sequence data suggested that changes in environmental conditions result in abundant rare phylotypes and reduced amounts of other phylotypes.

  2. Bacterial diversity in the intestinal tract of the fungus- cultivating ...

    African Journals Online (AJOL)

    GREGO

    2007-03-19

    Mar 19, 2007 ... culture dependent techniques, most of the isolates obtained belonged to the Gram-positive bacteria with a high G+C ... Key words: Fungus-cultivating termites, bacterial diversity, intestinal tract, 16S rRNA gene, RFLP. INTRODUCTION ...... disturbance and greenhouse gas fluxes in Sabah, East Malaysia.

  3. Bacterial diversity in agricultural soils during litter decomposition

    NARCIS (Netherlands)

    Dilly, O.; Bloem, J.; Vos, A.; Munch, J.C.

    2004-01-01

    Denaturing gradient gel electrophoresis (DGGE) of amplified fragments of genes coding for 16S rRNA was used to study the development of bacterial communities during decomposition of crop residues in agricultural soils. Ten strains were tested, and eight of these strains produced a single band.

  4. Metagenomic analysis of bacterial diversity of Siloam hot water ...

    African Journals Online (AJOL)

    The bacterial diversity of Siloam hot water spring was determined using 454 pyrosequencing of two 16S rRNA variable regions V1-3 and V4-7. Analysis of the community DNA revealed that the phyla Proteobacteria, Cyanobacteria, Bacteriodetes, Planctomycetes, Firmicutes, Chloroflexi and Verrucomicrobia were the most ...

  5. Bacterial diversity in the intestinal tract of the funguscultivating ...

    African Journals Online (AJOL)

    Microorganisms in the intestinal tracts of termites play a crucial role in the nutritional physiology of termites. The bacterial diversity in the fungus-cultivating Macrotermes michaelseni was examined using both molecular and culture dependent methods. Total DNA was extracted from the gut of the termite and 16S rRNA genes ...

  6. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua; (NCI)

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  7. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Directory of Open Access Journals (Sweden)

    Eric W. Triplett

    2010-07-01

    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.

  8. Comparative analysis of the reproductive tract microbial communities in female dogs with and without pyometra through the 16S rRNA gene pyrosequencing

    OpenAIRE

    Young, Young Gang; Guevarra, Robin B.; Jun, Hyung Lee; Wattanaphansak, Suphot; Bit, Na Kang; Hyeun, Bum Kim; Kun, Ho Song

    2017-01-01

    Canine pyometra is one of the most common illnesses in middle-aged to aged bitches. We used the 16S rRNA gene analysis to evaluate whether there are differences in bacterial compositions between dogs with and without pyometra. Control vaginal swabs were obtained from clinically healthy bitches (n = 5) while uterus of bitches (n = 5) with pyometra were obtained through ovariohysterectomy. Results from this study showed that bacteria belonging to families Pasteurellaceae, Fusobacteriaceae an...

  9. 16S rRNA Amplicon Sequencing for Epidemiological Surveys of Bacteria in Wildlife.

    Science.gov (United States)

    Galan, Maxime; Razzauti, Maria; Bard, Emilie; Bernard, Maria; Brouat, Carine; Charbonnel, Nathalie; Dehne-Garcia, Alexandre; Loiseau, Anne; Tatard, Caroline; Tamisier, Lucie; Vayssier-Taussat, Muriel; Vignes, Helene; Cosson, Jean-François

    2016-01-01

    The human impact on natural habitats is increasing the complexity of human-wildlife interactions and leading to the emergence of infectious diseases worldwide. Highly successful synanthropic wildlife species, such as rodents, will undoubtedly play an increasingly important role in transmitting zoonotic diseases. We investigated the potential for recent developments in 16S rRNA amplicon sequencing to facilitate the multiplexing of the large numbers of samples needed to improve our understanding of the risk of zoonotic disease transmission posed by urban rodents in West Africa. In addition to listing pathogenic bacteria in wild populations, as in other high-throughput sequencing (HTS) studies, our approach can estimate essential parameters for studies of zoonotic risk, such as prevalence and patterns of coinfection within individual hosts. However, the estimation of these parameters requires cleaning of the raw data to mitigate the biases generated by HTS methods. We present here an extensive review of these biases and of their consequences, and we propose a comprehensive trimming strategy for managing these biases. We demonstrated the application of this strategy using 711 commensal rodents, including 208 Mus musculus domesticus , 189 Rattus rattus , 93 Mastomys natalensis , and 221 Mastomys erythroleucus , collected from 24 villages in Senegal. Seven major genera of pathogenic bacteria were detected in their spleens: Borrelia , Bartonella , Mycoplasma , Ehrlichia , Rickettsia , Streptobacillus , and Orientia . Mycoplasma , Ehrlichia , Rickettsia , Streptobacillus , and Orientia have never before been detected in West African rodents. Bacterial prevalence ranged from 0% to 90% of individuals per site, depending on the bacterial taxon, rodent species, and site considered, and 26% of rodents displayed coinfection. The 16S rRNA amplicon sequencing strategy presented here has the advantage over other molecular surveillance tools of dealing with a large spectrum of

  10. Robust computational analysis of rRNA hypervariable tag datasets.

    Directory of Open Access Journals (Sweden)

    Maksim Sipos

    Full Text Available Next-generation DNA sequencing is increasingly being utilized to probe microbial communities, such as gastrointestinal microbiomes, where it is important to be able to quantify measures of abundance and diversity. The fragmented nature of the 16S rRNA datasets obtained, coupled with their unprecedented size, has led to the recognition that the results of such analyses are potentially contaminated by a variety of artifacts, both experimental and computational. Here we quantify how multiple alignment and clustering errors contribute to overestimates of abundance and diversity, reflected by incorrect OTU assignment, corrupted phylogenies, inaccurate species diversity estimators, and rank abundance distribution functions. We show that straightforward procedural optimizations, combining preexisting tools, are effective in handling large (10(5-10(6 16S rRNA datasets, and we describe metrics to measure the effectiveness and quality of the estimators obtained. We introduce two metrics to ascertain the quality of clustering of pyrosequenced rRNA data, and show that complete linkage clustering greatly outperforms other widely used methods.

  11. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    Directory of Open Access Journals (Sweden)

    Jennifer J Barb

    Full Text Available There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology.This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9 processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY. Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies and their sequencing data is subjected to a novel analytical pipeline.Results are presented at family and genus level. The Kullback-Leibler divergence (DKL, a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst average DKL while the V4 gave the lowest (best average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria.The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points

  12. Pyrosequencing 16S rRNA genes of bacteria associated with wild tiger mosquito Aedes albopictus: a pilot study

    Directory of Open Access Journals (Sweden)

    Guillaume eMinard

    2014-05-01

    Full Text Available The Asian tiger mosquito Aedes (Stegomya albopictus is an invasive species that has spread across the world in the last two decades, showing a great capacity to adapt to contrasting climates and environments. While demonstrated in many insects, the contribution of bacterial symbionts in Aedes ecology is a challenging aspect that needs to be investigated however. Some bacterial species have already been identified in Ae. albopictus using classical methods, but a more accurate survey of mosquito-associated bacterial diversity is needed to decipher the potential biological functions of bacterial symbionts in mediating or constraining insect adaptation. We surveyed the bacteria associated with field populations of Ae. albopictus from Madagascar by pyrosequencing 16S rRNA gene amplicons. Different aspects of amplicon preparation and sequencing depth were tested to optimise the breadth of bacterial diversity identified. The results revealed that all mosquitoes collected from different sites have a bacterial microbiota dominated by a single taxon, Wolbachia pipientis, which accounted for about 99% of all 98,520 sequences obtained. Ae. albopictus is known to harbour two Wolbachia strains, wAlbA and wAlbB, and quantitative PCR was used to estimate the relative densities, i.e. the bacteria-to-host gene ratios, of the strains in individual mosquitoes. Relative densities were between 6.25 × 100.01 and 5.47 × 100.1 for wAlbA and between 2.03 × 100.1 and 1.4 × 101 for wAlbB. Apart from Wolbachia, a total of 32 bacterial taxa were identified at the genus level using the different in method variations. Diversity index values were low and probably underestimated the true diversity due to the high abundance of Wolbachia sequences vastly outnumbering sequences from other taxa. Further studies should implement alternative strategies to specifically discard from analysis any sequences from Wolbachia, the dominant endosymbiotic bacterium in Ae. albopictus from

  13. BACTERIAL CONSORTIUM

    Directory of Open Access Journals (Sweden)

    Payel Sarkar

    2013-01-01

    Full Text Available Petroleum aromatic hydrocarbons like benzen e, toluene, ethyl benzene and xylene, together known as BTEX, has almost the same chemical structure. These aromatic hydrocarbons are released as pollutants in th e environment. This work was taken up to develop a solvent tolerant bacterial cons ortium that could degrade BTEX compounds as they all share a common chemical structure. We have isolated almost 60 different types of bacterial strains from different petroleum contaminated sites. Of these 60 bacterial strains almost 20 microorganisms were screene d on the basis of capability to tolerate high concentration of BTEX. Ten differe nt consortia were prepared and the compatibility of the bacterial strains within the consortia was checked by gram staining and BTEX tolerance level. Four successful mi crobial consortia were selected in which all the bacterial strains concomitantly grew in presence of high concentration of BTEX (10% of toluene, 10% of benzene 5% ethyl benzene and 1% xylene. Consortium #2 showed the highest growth rate in pr esence of BTEX. Degradation of BTEX by consortium #2 was monitored for 5 days by gradual decrease in the volume of the solvents. The maximum reduction observed wa s 85% in 5 days. Gas chromatography results also reveal that could completely degrade benzene and ethyl benzene within 48 hours. Almost 90% degradation of toluene and xylene in 48 hours was exhibited by consortium #2. It could also tolerate and degrade many industrial solvents such as chloroform, DMSO, acetonitrile having a wide range of log P values (0.03–3.1. Degradation of aromatic hydrocarbon like BTEX by a solvent tolerant bacterial consortium is greatly significant as it could degrade high concentration of pollutants compared to a bacterium and also reduces the time span of degradation.

  14. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    DEFF Research Database (Denmark)

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large...... ribosomes of flowering plants. The structure of domain VI within the eubacterial RNAs was probed with chemical reagents in order to establish the degree of stacking and/or accessibility of each adenosine, cytidine and guanosine residue; the double-helical segments were localized with the cobra venom...... ribonuclease from Naja naja oxiana, and the relatively unstructured and accessible sequences were detected with the single-strand-specific ribonucleases A, T1 and T2. The data enabled the three secondary structural models, proposed for the E. coli 23 S RNAs, to be examined critically and it was concluded...

  15. Bacterial RNAs activate innate immunity in Arabidopsis.

    Science.gov (United States)

    Lee, Boyoung; Park, Yong-Soon; Lee, Soohyun; Song, Geun Cheol; Ryu, Choong-Min

    2016-01-01

    The common molecular patterns of microbes play a critical role in the regulation of plant innate immunity. However, little is known about the role of nucleic acids in this process in plants. We pre-infiltrated Arabidopsis leaves with total RNAs from Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) and subsequently inoculated these plants with the same bacterial cells. Total Pto DC3000 RNAs pre-infiltrated into Arabidopsis leaves elicited plant immune responses against Pto DC3000. However, sheared RNAs and RNase A application failed to induce immunity, suggesting that intact bacterial RNAs function in plant innate immunity. This notion was supported by the positive regulation of superoxide anion levels, callose deposition, two mitogen-activated protein kinases and defense-related genes observed in bacterial RNA-pre-treated leaves. Intriguingly, the Pto DC3000 population was not compromised in known pattern recognition receptor mutants for chitin, flagellin and elongation factor-Tu (EF-Tu). Plant defense-related mutant analyses further revealed that bacterial RNA-elicited innate immunity was normally required for salicylic and jasmonic acid signaling. Notably, among total RNAs, the abundant bacterial RNA species 16S and 23S ribosomal RNAs were the major determinants of this response. Our findings provide evidence that bacterial RNA serves as a microbe-associated molecular pattern in plants. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  16. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  17. Diverse Bacterial Groups Contribute to the Alkane Degradation Potential of Chronically Polluted Subantarctic Coastal Sediments

    Energy Technology Data Exchange (ETDEWEB)

    Guibert, Lilian M.; Loviso, Claudia L.; Borglin, Sharon; Jansson, Janet K.; Dionisi, Hebe M.; Lozada, Mariana

    2015-11-07

    We aimed to gain insight into the alkane degradation potential of microbial communities from chronically polluted sediments of a subantarctic coastal environment using a combination of metagenomic approaches. A total of 6178 sequences annotated as alkane-1-monooxygenases (EC 1.14.15.3) were retrieved from a shotgun metagenomic dataset that included two sites analyzed in triplicate. The majority of the sequences binned with AlkB described in Bacteroidetes (32 ± 13 %) or Proteobacteria (29 ± 7 %), although a large proportion remained unclassified at the phylum level. Operational taxonomic unit (OTU)-based analyses showed small differences in AlkB distribution among samples that could be correlated with alkane concentrations, as well as with site-specific variations in pH and salinity. A number of low-abundance OTUs, mostly affiliated with Actinobacterial sequences, were found to be only present in the most contaminated samples. On the other hand, the molecular screening of a large-insert metagenomic library of intertidal sediments from one of the sampling sites identified two genomic fragments containing novel alkB gene sequences, as well as various contiguous genes related to lipid metabolism. Both genomic fragments were affiliated with the phylum Planctomycetes, and one could be further assigned to the genus Rhodopirellula due to the presence of a partial sequence of the 23S ribosomal RNA (rRNA) gene. This work highlights the diversity of bacterial groups contributing to the alkane degradation potential and reveals patterns of functional diversity in relation with environmental stressors in a chronically polluted, high-latitude coastal environment. In addition, alkane biodegradation genes are described for the first time in members of Planctomycetes.

  18. Comparison of DNA-, PMA-, and RNA-based 16S rRNA Illumina sequencing for detection of live bacteria in water.

    Science.gov (United States)

    Li, Ru; Tun, Hein Min; Jahan, Musarrat; Zhang, Zhengxiao; Kumar, Ayush; Fernando, Dilantha; Farenhorst, Annemieke; Khafipour, Ehsan

    2017-07-18

    The limitation of 16S rRNA gene sequencing (DNA-based) for microbial community analyses in water is the inability to differentiate live (dormant cells as well as growing or non-growing metabolically active cells) and dead cells, which can lead to false positive results in the absence of live microbes. Propidium-monoazide (PMA) has been used to selectively remove DNA from dead cells during downstream sequencing process. In comparison, 16S rRNA sequencing (RNA-based) can target live microbial cells in water as both dormant and metabolically active cells produce rRNA. The objective of this study was to compare the efficiency and sensitivity of DNA-based, PMA-based and RNA-based 16S rRNA Illumina sequencing methodologies for live bacteria detection in water samples experimentally spiked with different combination of bacteria (2 gram-negative and 2 gram-positive/acid fast species either all live, all dead, or combinations of live and dead species) or obtained from different sources (First Nation community drinking water; city of Winnipeg tap water; water from Red River, Manitoba, Canada). The RNA-based method, while was superior for detection of live bacterial cells still identified a number of 16S rRNA targets in samples spiked with dead cells. In environmental water samples, the DNA- and PMA-based approaches perhaps overestimated the richness of microbial community compared to RNA-based method. Our results suggest that the RNA-based sequencing was superior to DNA- and PMA-based methods in detecting live bacterial cells in water.

  19. Bacterial Ecology

    DEFF Research Database (Denmark)

    Fenchel, Tom

    2011-01-01

    Bacterial ecology is concerned with the interactions between bacteria and their biological and nonbiological environments and with the role of bacteria in biogeochemical element cycling. Many fundamental properties of bacteria are consequences of their small size. Thus, they can efficiently exploit...

  20. Bacterial meningitis

    NARCIS (Netherlands)

    Heckenberg, Sebastiaan G. B.; Brouwer, Matthijs C.; van de Beek, Diederik

    2014-01-01

    Bacterial meningitis is a neurologic emergency. Vaccination against common pathogens has decreased the burden of disease. Early diagnosis and rapid initiation of empiric antimicrobial and adjunctive therapy are vital. Therapy should be initiated as soon as blood cultures have been obtained,

  1. Bacterial lipases

    NARCIS (Netherlands)

    Jaeger, Karl-Erich; Ransac, Stéphane; Dijkstra, Bauke W.; Colson, Charles; Heuvel, Margreet van; Misset, Onno

    Many different bacterial species produce lipases which hydrolyze esters of glycerol with preferably long-chain fatty acids. They act at the interface generated by a hydrophobic lipid substrate in a hydrophilic aqueous medium. A characteristic property of lipases is called interfacial activation,

  2. Bacterial Ecology

    DEFF Research Database (Denmark)

    Fenchel, Tom

    2011-01-01

    , the production and oxidation of methane, nitrate reduction and fixation of atmospheric nitrogen are exclusively carried out by different groups of bacteria. Some bacterial species – ‘extremophiles’ – thrive in extreme environments in which no eukaryotic organisms can survive with respect to temperature, salinity...

  3. Bacterial Vaginosis

    Science.gov (United States)

    ... that coats the walls of the vagina Vaginal discharge with an unpleasant or fishlike odor Vaginal pain or itching Burning during urination Doctors are unsure of the incubation period for bacterial vaginosis. How Is the Diagnosis Made? Your child’s pediatrician can make the diagnosis ...

  4. Bacterial stress

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Bacterial stress. Physicochemical and chemical parameters: temperature, pressure, pH, salt concentration, oxygen, irradiation. Nutritional depravation: nutrient starvation, water shortage. Toxic compounds: Antibiotics, heavy metals, toxins, mutagens. Interactions with other cells: ...

  5. 16S rRNA gene-based profiling of the human infant gut microbiota is strongly influenced by sample processing and PCR primer choice.

    Science.gov (United States)

    Walker, Alan W; Martin, Jennifer C; Scott, Paul; Parkhill, Julian; Flint, Harry J; Scott, Karen P

    2015-01-01

    Characterisation of the bacterial composition of the gut microbiota is increasingly carried out with a view to establish the role of different bacterial species in causation or prevention of disease. It is thus essential that the methods used to determine the microbial composition are robust. Here, several widely used molecular techniques were compared to establish the optimal methods to assess the bacterial composition in faecal samples from babies, before weaning. The bacterial community profile detected in the faeces of infants is highly dependent on the methodology used. Bifidobacteria were the most abundant bacteria detected at 6 weeks in faeces from two initially breast-fed babies using fluorescent in situ hybridisation (FISH), in agreement with data from previous culture-based studies. Using the 16S rRNA gene sequencing approach, however, we found that the detection of bifidobacteria in particular crucially depended on the optimisation of the DNA extraction method, and the choice of primers used to amplify the V1-V3 regions of 16S rRNA genes prior to subsequent sequence analysis. Bifidobacteria were only well represented among amplified 16S rRNA gene sequences when mechanical disruption (bead-beating) procedures for DNA extraction were employed together with optimised "universal" PCR primers. These primers incorporate degenerate bases at positions where mismatches to bifidobacteria and other bacterial taxa occur. The use of a DNA extraction kit with no bead-beating step resulted in a complete absence of bifidobacteria in the sequence data, even when using the optimised primers. This work emphasises the importance of sample processing methodology to downstream sequencing results and illustrates the value of employing multiple approaches for determining microbiota composition.

  6. Structure of mouse rRNA precursors. Complete sequence and potential folding of the spacer regions between 18S and 28S rRNA.

    OpenAIRE

    Michot, B; Bachellerie, J P; Raynal, F

    1983-01-01

    We have determined the complete nucleotide sequence of the regions of mouse ribosomal RNA transcription unit which separate mature rRNA genes. These internal transcribed spacers (ITS) are excised from rRNA precursor during ribosome biosynthesis. ITS 1, between 18S and 5.8S rRNA genes, is 999 nucleotides long. ITS 2, between 5.8S and 28S rRNA genes, is 1089 nucleotides long. Both spacers are very rich in G + C, 70 and 74% respectively. Mouse sequences have been compared with the other availabl...

  7. Bacterial Adhesion & Blocking Bacterial Adhesion

    DEFF Research Database (Denmark)

    Vejborg, Rebecca Munk

    2008-01-01

    reduce or delay bacterial biofilm formation of a range of urinary tract infectious E.coli and Klebsiella isolates. Several other proteinaceous coatings were also found to display anti-adhesive properties, possibly providing a measure for controlling the colonization of implant materials. Several other...... components. These substances may both mediate and stabilize the bacterial biofilm. Finally, several adhesive structures were examined, and a novel physiological biofilm phenotype in E.coli biofilms was characterized, namely cell chain formation. The autotransporter protein, antigen 43, was implicated...

  8. Community structure of the metabolically active rumen bacterial and archaeal communities of dairy cows over the transition period

    DEFF Research Database (Denmark)

    Zhu, Zhigang; Noel, Samantha Joan; Difford, Gareth Frank

    2017-01-01

    was extracted from the rumen samples and cDNA thereof was subsequently used for characterizing the metabolically active bacterial (16S rRNA transcript amplicon sequencing) and archaeal (qPCR, T-RFLP and mcrA and 16S rRNA transcript amplicon sequencing) communities. The metabolically active bacterial community......% of the total reads, dominated by the genera Methanobrevibacter (75%) and Methanosphaera (24%), whereas the Methanomassiliicoccales order covered only 0.2% of the total reads. In conclusion, the present study showed that the structure of the metabolically active bacterial and archaeal rumen communities changed...... prepartum to postpartum decrease (from 15% to 2%) was observed in relative abundance of Methanomassiliicoccales 16S rRNA transcripts. In contrast to qPCR analysis of the 16S rRNA transcripts, quantification of mcrA transcripts revealed no change in total abundance of metabolically active methanogens over...

  9. Estimating bacterial diversity for ecological studies: methods, metrics, and assumptions.

    Directory of Open Access Journals (Sweden)

    Julia Birtel

    Full Text Available Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5. Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques.

  10. Bacterial lipases

    OpenAIRE

    Jaeger, Karl-Erich; Ransac, Stéphane; Dijkstra, Bauke W.; Colson, Charles; Heuvel, Margreet van; Misset, Onno

    1994-01-01

    Many different bacterial species produce lipases which hydrolyze esters of glycerol with preferably long-chain fatty acids. They act at the interface generated by a hydrophobic lipid substrate in a hydrophilic aqueous medium. A characteristic property of lipases is called interfacial activation, meaning a sharp increase in lipase activity observed when the substrate starts to form an emulsion, thereby presenting to the enzyme an interfacial area. As a consequence, the kinetics of a lipase rea...

  11. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  12. Molecular characterization of the sequences of the 16S-23S rDNA internal spacer region (ISR) from isolates of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, Akihiro; Ono, Shinji; Sekizuka, Tsuyoshi; Moore, John E; Millar, B Cherie; Matsuda, Motoo

    2009-03-03

    Sequence information on the 16S-23S rDNA internal spacer region (ISR) exhibits a large degree of sequence and length variation at both the genus and species levels. A primer pair for the amplification of 16S-23S rDNA ISR generated three amplicons for each of isolates of Taylorella asinigenitalis (UCD-1T, UK-1 and UK-2). Following TA cloning and sequencing, the three isolates of T. asinigenitalis were demonstrated to possess three ISR units of different lengths. Although the three corresponding ISRs (A, B and C) were identified to be identical to each other (UK-1 and UK-2 isolates), the ISRs shared approximately 95.3-98.9% nucleotide sequence similarities between the UCD-1T and UK-1/-2 isolates. A typical order of two intercistronic tRNA genes (5'-tRNAIle-tRNAAla-3') with the different nucleotide spacers [44 through 51 base pairs (bp)] in length was identified among the isolates. The consensus sequences of the antiterminators of boxB and boxA were also identified in all ISRs. Thus, three ISRs were identified for each isolate, and therefore, at least three distinctly different ribosomal RNA operons were suggested to occur in the genome of T. asinigenitalis. This was also confirmed by Southern hybridization procedure. The present study represents a dendrogram constructed based on the nucleotide sequence data of 16S-23S rDNA ISR for T. asinigenitalis, which may aid in the phylogenetic positioning of T. asinigenitalis within the genus Taylorella, and in the molecular discrimination of T. asinigenitalis.

  13. Molecular characterization of the sequences of the 16S-23S rDNA internal spacer region (ISR from isolates of Taylorella asinigenitalis

    Directory of Open Access Journals (Sweden)

    Millar B Cherie

    2009-03-01

    Full Text Available Abstract Background Sequence information on the 16S-23S rDNA internal spacer region (ISR exhibits a large degree of sequence and length variation at both the genus and species levels. A primer pair for the amplification of 16S-23S rDNA ISR generated three amplicons for each of isolates of Taylorella asinigenitalis (UCD-1T, UK-1 and UK-2. Findings Following TA cloning and sequencing, the three isolates of T. asinigenitalis were demonstrated to possess three ISR units of different lengths. Although the three corresponding ISRs (A, B and C were identified to be identical to each other (UK-1 and UK-2 isolates, the ISRs shared approximately 95.3–98.9% nucleotide sequence similarities between the UCD-1T and UK-1/-2 isolates. A typical order of two intercistronic tRNA genes (5'-tRNAIle-tRNAAla-3' with the different nucleotide spacers [44 through 51 base pairs (bp] in length was identified among the isolates. The consensus sequences of the antiterminators of boxB and boxA were also identified in all ISRs. Thus, three ISRs were identified for each isolate, and therefore, at least three distinctly different ribosomal RNA operons were suggested to occur in the genome of T. asinigenitalis. This was also confirmed by Southern hybridization procedure. Conclusion The present study represents a dendrogram constructed based on the nucleotide sequence data of 16S-23S rDNA ISR for T. asinigenitalis, which may aid in the phylogenetic positioning of T. asinigenitalis within the genus Taylorella, and in the molecular discrimination of T. asinigenitalis.

  14. High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions

    DEFF Research Database (Denmark)

    Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob

    2014-01-01

    -resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized......In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High...... that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide...

  15. Structure of mouse rRNA precursors. Complete sequence and potential folding of the spacer regions between 18S and 28S rRNA.

    Science.gov (United States)

    Michot, B; Bachellerie, J P; Raynal, F

    1983-05-25

    We have determined the complete nucleotide sequence of the regions of mouse ribosomal RNA transcription unit which separate mature rRNA genes. These internal transcribed spacers (ITS) are excised from rRNA precursor during ribosome biosynthesis. ITS 1, between 18S and 5.8S rRNA genes, is 999 nucleotides long. ITS 2, between 5.8S and 28S rRNA genes, is 1089 nucleotides long. Both spacers are very rich in G + C, 70 and 74% respectively. Mouse sequences have been compared with the other available eukaryotes: while no homology is apparent with yeast or xenopus, mouse and rat ITS sequences have been largely conserved, with homologous segments interspersed with highly divergent tracts. Homology with rat is much more extensive for ITS 1 than for ITS 2. Tentative secondary structure models are proposed for the folding of these regions within rRNA precursor; they are closely related in mouse and rat.

  16. In silico analysis of the 16S rRNA gene of endophytic bacteria, isolated from the aerial parts and seeds of important agricultural crops.

    Science.gov (United States)

    Bredow, C; Azevedo, J L; Pamphile, J A; Mangolin, C A; Rhoden, S A

    2015-08-19

    Because of human population growth, increased food production and alternatives to conventional methods of biocontrol and development of plants such as the use of endophytic bacteria and fungi are required. One of the methods used to study microorganism diversity is sequencing of the 16S rRNA gene, which has several advantages, including universality, size, and availability of databases for comparison. The objective of this study was to analyze endophytic bacterial diversity in agricultural crops using published papers, sequence databases, and phylogenetic analysis. Fourteen papers were selected in which the ribosomal 16S rRNA gene was used to identify endophytic bacteria, in important agricultural crops, such as coffee, sugar cane, beans, corn, soybean, tomatoes, and grapes, located in different geographical regions (America, Europe, and Asia). The corresponding 16S rRNA gene sequences were selected from the NCBI database, aligned using the Mega 5.2 program, and phylogenetic analysis was undertaken. The most common orders present in the analyzed cultures were Bacillales, Enterobacteriales, and Actinomycetales and the most frequently observed genera were Bacillus, Pseudomonas, and Microbacterium. Phylogenetic analysis showed that only approximately 1.56% of the total sequences were not properly grouped, demonstrating reliability in the identification of microorganisms. This study identified the main genera found in endophytic bacterial cultures from plants, providing data for future studies on improving plant agriculture, biotechnology, endophytic bacterium prospecting, and to help understand relationships between endophytic bacteria and their interactions with plants.

  17. Attachment sites of primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli

    DEFF Research Database (Denmark)

    Egebjerg, Jan; Christiansen, Jan; Garrett, Roger Antony

    1991-01-01

    The attachment sites of the primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli were examined by a chemical and ribonuclease footprinting method using several probes with different specificities. The results show that the sites are confined to localized RNA regions......, of the peptidyl transferase centre. Moreover, each of the protein sites, but particularly those of L2 and L23, lies at the centre of RNA domains where they can maximally influence both the assembly of secondary binding proteins and the function of the RNA region....

  18. Metagenomic analysis of two important, but difficult to culture soil borne bacterial phyla, the Acidobacteria and the Verrucomicrobia

    NARCIS (Netherlands)

    Kielak, A.M.

    2010-01-01

    Based on phylogenetic marker genes, such as 16S rRNA genes, it is clear that numerous bacterial lineages exist that appear to be quite common in the environment, yet poorly characterized and underrepresented in culture. Two of the most common bacterial phyla in soils that fall into this category are

  19. Pigments Characterization and Molecular Identification of Bacterial Symbionts of Brown Algae Padinasp. Collected from Karimunjawa Island

    Directory of Open Access Journals (Sweden)

    Damar Bayu Murti

    2016-06-01

    Full Text Available The search for carotenoids in nature has been extensively studied because of their applications in foods. One treasure of the biopigment source is symbiotic-microorganisms with marine biota. The advantages of symbiont bacteria are easy to culture and sensitize pigments. The use of symbiont bacteria helps to conserve fish, coral reefs, seagrass, and seaweed. Therefore, the bacteria keeps their existence in their ecosystems. In this study, bacterial symbionts were successfully isolated from brown algae Padina sp. The bacterial symbionts had yellow pigment associated with carotenoids. The pigments were characterized using High Performance Liquid Chromatography (HPLC with a Photo Diode Array (PDA detector. The carotenoid pigments in the bacterial symbionts were identified as dinoxanthin, lutein and neoxanthin. Molecular identification by using a 16S rRNA gene sequence method, reveals that the bacterial symbionts were closely related to Bacillus marisflavi with a homology of 99%. Keywords :carotenoid pigments, brown algae, Padina, bacterial symbionts, 16S rRNA

  20. Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

    Science.gov (United States)

    Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

    2018-01-01

    Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

  1. [Bacterial diversity within different sections of summer sea-ice samples from the Prydz Bay, Antarctica].

    Science.gov (United States)

    Ma, Jifei; Du, Zongjun; Luo, Wei; Yu, Yong; Zeng, Yixin; Chen, Bo; Li, Huirong

    2013-02-04

    In order to assess bacterial abundance and diversity within three different sections of summer sea-ice samples collected from the Prydz Bay, Antarctica. Fluorescence in situ hybridization was applied to determine the proportions of Bacteria in sea-ice. Bacterial community composition within sea ice was analyzed by 16S rRNA gene clone library construction. Correlation analysis was performed between the physicochemical parameters and the bacterial diversity and abundance within sea ice. The result of fluorescence in situ hybridization shows that bacteria were abundant in the bottom section, and the concentration of total organic carbon, total organic nitrogen and phosphate may be the main factors for bacterial abundance. In bacterial 16S rRNA gene libraries of sea-ice, nearly complete 16S rRNA gene sequences were grouped into three distinct lineages of Bacteria (gamma-Proteobacteria, alpha-Proteobacteria and Bacteroidetes). Most clone sequences were related to cultured bacterial isolates from the marine environment, arctic and Antarctic sea-ice with high similarity. The member of Bacteroidetes was not detected in the bottom section of sea-ice. The bacterial communities within sea-ice were little heterogeneous at the genus-level between different sections, and the concentration of NH4+ may cause this distribution. The number of bacteria was abundant in the bottom section of sea-ice. Gamma-proteobacteria was the dominant bacterial lineage in sea-ice.

  2. Secondary Structural Models (16S rRNA of Polyhydroxyalkanoates Producing Bacillus Species Isolated from Different Rhizospheric Soil: Phylogenetics and Chemical Analysis

    Directory of Open Access Journals (Sweden)

    Swati Mohapatra

    2016-09-01

    Full Text Available Polyhydroxyalkanoates (PHAs producing bacterial isolates are gaining more importance over the world due to the synthesis of a biodegradable polymer which is extremely desirable to substitute synthetic plastics. PHAs are produced by various microorganisms under certain stress conditions. In this study, sixteen bacterial isolates characterized previously by partial 16S rRNA gene sequencing (NCBI Accession No. KF626466 to KF626481 were again stained by Nile red after three years of preservation in order to confirm their ability to accumulate PHAs. Also, phylogenetic analysis carried out in the present investigation evidenced that the bacterial species belonging to genus Bacillus are the dominant flora of the rhizospheric region, with a potentiality of biodegradable polymer (PHAs production. Again, RNA secondary structure prediction hypothesized that there is no direct correlation between RNA folding pattern stability with a rate of PHAs production among the selected isolates of genus Bacillus.

  3. Bacterial mitosis

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Borch, Jonas; Dam, Mette

    2003-01-01

    Bacterial DNA segregation takes place in an active and ordered fashion. In the case of Escherichia coli plasmid R1, the partitioning system (par) separates paired plasmid copies and moves them to opposite cell poles. Here we address the mechanism by which the three components of the R1 par system...... movement is powered by insertional polymerization of ParM. Consistently, we find that segregating plasmids are positioned at the ends of extending ParM filaments. Thus, the process of R1 plasmid segregation in E. coli appears to be mechanistically analogous to the actin-based motility operating...

  4. Molecular analysis of the 16S-23S rDNA internal spacer region (ISR) and truncated tRNA(Ala) gene segments in Campylobacter lari.

    Science.gov (United States)

    Hayashi, K; Tazumi, A; Nakanishi, S; Nakajima, T; Matsubara, K; Ueno, H; Moore, J E; Millar, B C; Matsuda, M

    2012-06-01

    Following PCR amplification and sequencing, nucleotide sequence alignment analyses demonstrated the presence of two kinds of 16S-23S rDNA internal spacer regions (ISRs), namely, long length ISRs of 837-844 base pair (bp) [n = six for urease-negative (UN) Campylobacter lari isolates, UN C. lari JCM2530(T), RM2100, 176, 293, 299 and 448] and short length ISRs of 679-725 bp [n = six for UN C. lari: n = 14 for urease-positive thermophilic Campylobacter (UPTC) isolates]. The analyses also indicated that the short length ISRs mainly lacked the 156 bp sequence from the nucleotide positions 122-277 bp in long length ISRs for UN C. lari JCM2530(T). The 156 bp sequences shared 94.9-96.8 % sequence similarity among six isolates. Surprisingly, atypical tRNA(Ala) gene segment (5' end 35 bp), which was extremely truncated, occurred within the 156 bp sequences in the long length ISRs, as an unexpected tRNA(Ala) pseudogene. An order of the intercistronic tRNA genes within the short nucleotide spacer of 5'-16S rDNA-tRNA(Ala)-tRNA(Ile)-23S rDNA-3' occurred in all the C. lari isolates examined.

  5. Beyond Streptococcus mutans: dental caries onset linked to multiple species by 16S rRNA community analysis.

    Directory of Open Access Journals (Sweden)

    Erin L Gross

    Full Text Available Dental caries in very young children may be severe, result in serious infection, and require general anesthesia for treatment. Dental caries results from a shift within the biofilm community specific to the tooth surface, and acidogenic species are responsible for caries. Streptococcus mutans, the most common acid producer in caries, is not always present and occurs as part of a complex microbial community. Understanding the degree to which multiple acidogenic species provide functional redundancy and resilience to caries-associated communities will be important for developing biologic interventions. In addition, microbial community interactions in health and caries pathogenesis are not well understood. The purpose of this study was to investigate bacterial community profiles associated with the onset of caries in the primary dentition. In a combination cross-sectional and longitudinal design, bacterial community profiles at progressive stages of caries and over time were examined and compared to those of health. 16S rRNA gene sequencing was used for bacterial community analysis. Streptococcus mutans was the dominant species in many, but not all, subjects with caries. Elevated levels of S. salivarius, S. sobrinus, and S. parasanguinis were also associated with caries, especially in subjects with no or low levels of S. mutans, suggesting these species are alternative pathogens, and that multiple species may need to be targeted for interventions. Veillonella, which metabolizes lactate, was associated with caries and was highly correlated with total acid producing species. Among children without previous history of caries, Veillonella, but not S. mutans or other acid-producing species, predicted future caries. Bacterial community diversity was reduced in caries as compared to health, as many species appeared to occur at lower levels or be lost as caries advanced, including the Streptococcus mitis group, Neisseria, and Streptococcus sanguinis. This

  6. Beyond Streptococcus mutans: Dental Caries Onset Linked to Multiple Species by 16S rRNA Community Analysis

    Science.gov (United States)

    Gross, Erin L.; Beall, Clifford J.; Kutsch, Stacey R.; Firestone, Noah D.; Leys, Eugene J.; Griffen, Ann L.

    2012-01-01

    Dental caries in very young children may be severe, result in serious infection, and require general anesthesia for treatment. Dental caries results from a shift within the biofilm community specific to the tooth surface, and acidogenic species are responsible for caries. Streptococcus mutans, the most common acid producer in caries, is not always present and occurs as part of a complex microbial community. Understanding the degree to which multiple acidogenic species provide functional redundancy and resilience to caries-associated communities will be important for developing biologic interventions. In addition, microbial community interactions in health and caries pathogenesis are not well understood. The purpose of this study was to investigate bacterial community profiles associated with the onset of caries in the primary dentition. In a combination cross-sectional and longitudinal design, bacterial community profiles at progressive stages of caries and over time were examined and compared to those of health. 16S rRNA gene sequencing was used for bacterial community analysis. Streptococcus mutans was the dominant species in many, but not all, subjects with caries. Elevated levels of S. salivarius, S. sobrinus, and S. parasanguinis were also associated with caries, especially in subjects with no or low levels of S. mutans, suggesting these species are alternative pathogens, and that multiple species may need to be targeted for interventions. Veillonella, which metabolizes lactate, was associated with caries and was highly correlated with total acid producing species. Among children without previous history of caries, Veillonella, but not S. mutans or other acid-producing species, predicted future caries. Bacterial community diversity was reduced in caries as compared to health, as many species appeared to occur at lower levels or be lost as caries advanced, including the Streptococcus mitis group, Neisseria, and Streptococcus sanguinis. This may have

  7. A need for standardization in drinking water analysis – an investigation of DNA extraction procedure, primer choice and detection limit of 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Brandt, Jakob; Nielsen, Per Halkjær; Albertsen, Mads

    have been made to illuminate the effects specifically related to bacterial communities in drinking water. In this study, we investigated the impact of the DNA extraction and primer choice on the observed community structure, and we also estimated the detection limit of the 16S rRNA amplicon sequencing....... The PowerWater DNA Isolation Kit resulted in significantly higher amounts of isolated DNA compared to the FastDNA SPIN Kit for Soil. Furthermore, extraction with the PowerWater kit lead to detection of a significantly higher number of OTUs. Likewise, the primer experiment revealed great discrepancies in OTU....... coli could be detected in all samples. However, samples with 101 cells/mL had several contaminating OTUs, constituting approximately 8% of the read abundances. For 16S rRNA gene analysis in drinking water samples, we recommend using the PowerWater DNA Isolation Kit for DNA extraction in combination...

  8. Genomic GC-content affects the accuracy of 16S rRNA gene sequencing bsed microbial profiling due to PCR bias

    DEFF Research Database (Denmark)

    Laursen, Martin F.; Dalgaard, Marlene Danner; Bahl, Martin Iain

    2017-01-01

    Profiling of microbial community composition is frequently performed by partial 16S rRNA gene sequencing on benchtop platforms following PCR amplification of specific hypervariable regions within this gene. Accuracy and reproducibility of this strategy are two key parameters to consider, which may...... be influenced during all processes from sample collection and storage, through DNA extraction and PCR based library preparation to the final sequencing. In order to evaluate both the reproducibility and accuracy of 16S rRNA gene based microbial profiling using the Ion Torrent PGM platform, we prepared libraries...... and performed sequencing of a well-defined and validated 20-member bacterial DNA mock community on five separate occasions and compared results with the expected even distribution. In general the applied method had a median coefficient of variance of 11.8% (range 5.5-73.7%) for all 20 included strains...

  9. Analysis of stomach bacterial communities in Australian feral horses.

    Science.gov (United States)

    St-Pierre, Benoit; de la Fuente, Gabriel; O'Neill, Sean; Wright, André-Denis G; Al Jassim, Rafat

    2013-01-01

    We investigated the community structure of bacteria that populate the stomach of the Brumby, a breed of feral horses from the Australian outback. Using a 16S rRNA gene clone library, we identified 155 clones that were assigned to 26 OTUs based on a 99.0 % sequence identity cutoff. Two OTUs represented 73.5 % of clones, while 18 OTUs were each assigned only a single clone. Four major bacterial types were identified in the Brumby stomach: Lactobacillaceae, Streptococcaceae, Veillonellaceae and Pasteurellaceae. The first three groups, which represented 98.1 % of the Brumby stomach library clones, belonged to the bacterial phylum Firmicutes. We found that 49.7 % of clones were related to bacterial species previously identified in the equine hindgut, and that 44.5 % of clones were related to symbiotic bacterial species identified in the mouth or throat of either horses or other mammals. Our results indicated that the composition of mutualistic bacterial communities of feral horses was consistent with other studies on domestic horses. In addition to bacterial sequences, we also identified four plastid 16S rRNA gene sequences, which may help in further characterizing the type of vegetation consumed by Brumby horses in their natural environment.

  10. Similar gene estimates from circular and linear standards in quantitative PCR analyses using the prokaryotic 16S rRNA gene as a model.

    Directory of Open Access Journals (Sweden)

    Athenia L Oldham

    Full Text Available Quantitative PCR (qPCR is one of the most widely used tools for quantifying absolute numbers of microbial gene copies in test samples. A recent publication showed that circular plasmid DNA standards grossly overestimated numbers of a target gene by as much as 8-fold in a eukaryotic system using quantitative PCR (qPCR analysis. Overestimation of microbial numbers is a serious concern in industrial settings where qPCR estimates form the basis for quality control or mitigation decisions. Unlike eukaryotes, bacteria and archaea most commonly have circular genomes and plasmids and therefore may not be subject to the same levels of overestimation. Therefore, the feasibility of using circular DNA plasmids as standards for 16S rRNA gene estimates was assayed using these two prokaryotic systems, with the practical advantage being rapid standard preparation for ongoing qPCR analyses. Full-length 16S rRNA gene sequences from Thermovirga lienii and Archaeoglobus fulgidus were cloned and used to generate standards for bacterial and archaeal qPCR reactions, respectively. Estimates of 16S rRNA gene copies were made based on circular and linearized DNA conformations using two genomes from each domain: Desulfovibrio vulgaris, Pseudomonas aeruginosa, Archaeoglobus fulgidus, and Methanocaldocococcus jannaschii. The ratio of estimated to predicted 16S rRNA gene copies ranged from 0.5 to 2.2-fold in bacterial systems and 0.5 to 1.0-fold in archaeal systems, demonstrating that circular plasmid standards did not lead to the gross over-estimates previously reported for eukaryotic systems.

  11. Salinity and bacterial diversity: to what extent does the concentration of salt affect the bacterial community in a saline soil?

    Directory of Open Access Journals (Sweden)

    Loredana Canfora

    Full Text Available In this study, the evaluation of soil characteristics was coupled with a pyrosequencing analysis of the V2-V3 16S rRNA gene region in order to investigate the bacterial community structure and diversity in the A horizon of a natural saline soil located in Sicily (Italy. The main aim of the research was to assess the organisation and diversity of microbial taxa using a spatial scale that revealed physical and chemical heterogeneity of the habitat under investigation. The results provided information on the type of distribution of different bacterial groups as a function of spatial gradients of soil salinity and pH. The analysis of bacterial 16S rRNA showed differences in bacterial composition and diversity due to a variable salt concentration in the soil. The bacterial community showed a statistically significant spatial variability. Some bacterial phyla appeared spread in the whole area, whatever the salinity gradient. It emerged therefore that a patchy saline soil can not contain just a single microbial community selected to withstand extreme osmotic phenomena, but many communities that can be variously correlated to one or more environmental parameters. Sequences have been deposited to the SRA database and can be accessed on ID Project PRJNA241061.

  12. Rates of rRNA synthesis and degradation in senescing wheat leaves

    International Nuclear Information System (INIS)

    Lamattina, L.; Pinedo, M.; Pont Lezica, R.; Conde, R.

    1987-01-01

    Changes in cytoplasmic and chloroplastic rRNA content and rates of rRNA synthesis and degradation of detached wheat leaves were determined. It was found that rRNA loss occurs mainly in chloroplast. Rates of synthesis were measured by incorporation of large amounts of ( 3 H)orotic acid into rRNA. This approach overcome size differences between pyrimidine pools of cells under different physiological status. Rate of degradation were estimated either as the difference between synthesis and net variation of rRNA or by disappearance of radioactivity from ( 32 P)-labeled rRNA. Results indicate a decrease in the net rRNA synthesis capacity of leaves after 48 h of detachment. However the fractional rates of rRNA synthesis were maintained in both cytoplasma and chloroplast. Ribosomal RNA degradation rates were 2.5-fold higher in chloroplast than in cytoplasm. It is concluded that the observed chloroplastic rRNA loss is due to an increased degradation rate which is 15-fold higher than synthesis rate at 48 h after detachment

  13. Estimation of rRNA synthesis and degradation rates in senescing wheat leaves

    International Nuclear Information System (INIS)

    Lamattina, L.; Pinedo, M.; Yudi, V.P.; Pont Lezica, R.F.; Conde, R.D.

    1988-01-01

    Changes in cytoplasmic and chloroplast rRNA content and rates of rRNA synthesis and degradation of detached wheat leaves were determined. It was found that rRNA loss is proportionally higher in chloroplasts than in cytoplasm. Rates of synthesis were measured by incorporation of large amounts of [ 3 H]orotic acid into rRNA. This approach overcame size differences between pyrimidine pools of cells under different physiological status. Furthermore, these pools reached nearly the same specific radioactivity as that of the administered solution. Rates of degradation were estimated either as the difference between synthesis and net variation of rRNA or by disappearance of radioactivity from 32 P-labeled rRNA. Results indicated a decrease in the net rRNA synthesis capacity of leaves after 48 h of detachment. However, the fractional rates of rRNA synthesis were maintained in both cytoplasm and chloroplasts. Ribosomal RNA degradation rates were 2.5-fold higher in chloroplast than in cytoplasm. The observed chloroplast rRNA loss is due to an increased degradation rate which is 15-fold higher than the synthesis rate 48 h after detachment

  14. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    DEFF Research Database (Denmark)

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    ribosomes of flowering plants. The structure of domain VI within the eubacterial RNAs was probed with chemical reagents in order to establish the degree of stacking and/or accessibility of each adenosine, cytidine and guanosine residue; the double-helical segments were localized with the cobra venom...... level of structural conservation has occurred throughout the RNA domain during the evolution of the Gram negative and Gram positive bacteria although the thermophile was generally more stable at base-pairs adjacent to the terminal loops.......An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large...

  15. Applicability of the 16S-23S rDNA internal spacer for PCR detection of the phytostimulatory PGPR inoculant Azospirillum lipoferum CRT1 in field soil.

    Science.gov (United States)

    Baudoin, E; Couillerot, O; Spaepen, S; Moënne-Loccoz, Y; Nazaret, S

    2010-01-01

    To assess the applicability of the 16S-23S rDNA internal spacer regions (ISR) as targets for PCR detection of Azospirillum ssp. and the phytostimulatory plant growth-promoting rhizobacteria seed inoculant Azospirillum lipoferum CRT1 in soil. Primer sets were designed after sequence analysis of the ISR of A. lipoferum CRT1 and Azospirillum brasilense Sp245. The primers fAZO/rAZO targeting the Azospirillum genus successfully yielded PCR amplicons (400-550 bp) from Azospirillum strains but also from certain non-Azospirillum strains in vitro, therefore they were not appropriate to monitor indigenous Azospirillum soil populations. The primers fCRT1/rCRT1 targeting A. lipoferum CRT1 generated a single 249-bp PCR product but could also amplify other strains from the same species. However, with DNA extracts from the rhizosphere of field-grown maize, both fAZO/rAZO and fCRT1/rCRT1 primer sets could be used to evidence strain CRT1 in inoculated plants by nested PCR, after a first ISR amplification with universal ribosomal primers. In soil, a 7-log dynamic range of detection (10(2)-10(8) CFU g(-1) soil) was obtained. The PCR primers targeting 16S-23S rDNA ISR sequences enabled detection of the inoculant A. lipoferum CRT1 in field soil. Convenient methods to monitor Azospirillum phytostimulators in the soil are lacking. The PCR protocols designed based on ISR sequences will be useful for detection of the crop inoculant A. lipoferum CRT1 under field conditions.

  16. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

    Directory of Open Access Journals (Sweden)

    Mahyarudin

    2015-07-01

    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  17. Molecular Analysis of Bacterial Microbiota on Brazilian Currency Note Surfaces

    Directory of Open Access Journals (Sweden)

    Tairacan Augusto Pereira da Fonseca

    2015-10-01

    Full Text Available Currency notes have been implicated as a vehicle for transmitting community-acquired bacterial infections. However, the overall diversity of the bacterial population residing on banknotes is still unknown in Brazil. In this study, we aimed to investigate the overall bacterial population from 150 different Brazilian Rial (R$ notes in circulation using a culture-independent Illumina massively parallel sequencing approach of the 16S rRNA genes. Samples were randomly collected from three different street markets or “feiras” in the metropolitan region of São Paulo. Taxonomical composition revealed the abundance of Proteobacteria phyla, followed by Firmicutes and Streptophyta, with a total of 1193 bacterial families and 3310 bacterial genera. Most of these bacterial genera are of human, animal, and environmental origins. Also, our analysis revealed the presence of some potential pathogenic bacterial genera including Salmonella, Staphylococcus, and Klebsiella. The results demonstrate that there is a tremendous diversity of bacterial contamination on currency notes, including organisms known to be opportunistic pathogens. One of the factors that may contribute to the richness of bacterial diversity in currency notes is personal hygiene. Thus, our results underscore the need to increase public awareness of the importance of personal hygiene of money handlers who also handle food.

  18. Molecular Analysis of Bacterial Microbiota on Brazilian Currency Note Surfaces.

    Science.gov (United States)

    Pereira da Fonseca, Tairacan Augusto; Pessôa, Rodrigo; Sanabani, Sabri Saeed

    2015-10-22

    Currency notes have been implicated as a vehicle for transmitting community-acquired bacterial infections. However, the overall diversity of the bacterial population residing on banknotes is still unknown in Brazil. In this study, we aimed to investigate the overall bacterial population from 150 different Brazilian Rial (R$) notes in circulation using a culture-independent Illumina massively parallel sequencing approach of the 16S rRNA genes. Samples were randomly collected from three different street markets or "feiras" in the metropolitan region of São Paulo. Taxonomical composition revealed the abundance of Proteobacteria phyla, followed by Firmicutes and Streptophyta, with a total of 1193 bacterial families and 3310 bacterial genera. Most of these bacterial genera are of human, animal, and environmental origins. Also, our analysis revealed the presence of some potential pathogenic bacterial genera including Salmonella, Staphylococcus, and Klebsiella. The results demonstrate that there is a tremendous diversity of bacterial contamination on currency notes, including organisms known to be opportunistic pathogens. One of the factors that may contribute to the richness of bacterial diversity in currency notes is personal hygiene. Thus, our results underscore the need to increase public awareness of the importance of personal hygiene of money handlers who also handle food.

  19. Diversity of Bacterial Photosymbionts in Lubomirskiidae Sponges from Lake Baikal

    OpenAIRE

    Kulakova, Nina V.; Denikina, Natalia N.; Belikov, Sergei I.

    2014-01-01

    Sponges are permanent benthos residents which establish complex associations with a variety of microorganisms that raise interest in the nature of sponge-symbionts interactions. A molecular approach, based on the identification of the 16S rRNA and ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit genes, was applied to investigate diversity and phylogeny of bacterial phototrophs associated with four species of Lubomirskiidae in Lake Baikal. The phylogeny inferred from both genes sh...

  20. Bacterial diversity in the oral cavity of ten healthy individuals

    OpenAIRE

    Bik, Elisabeth M.; Long, Clara Davis; Armitage, Gary C.; Loomer, Peter; Emerson, Joanne; Mongodin, Emmanuel F.; Nelson, Karen E.; Gill, Steven R.; Fraser-Liggett, Claire M.; Relman, David A.

    2010-01-01

    The composition of the oral microbiota from 10 individuals with healthy oral tissues was determined using culture-independent techniques. From each individual, 26 specimens, each from different oral sites at a single point in time, were collected and pooled. An eleventh pool was constructed using portions of the subgingival specimens from all 10 individuals. The 16S rRNA gene was amplified using broad-range bacterial primers, and clone libraries from the individual and subgingival pools were ...

  1. rRNA chemical groups required for aminoglycoside binding.

    Science.gov (United States)

    Blanchard, S C; Fourmy, D; Eason, R G; Puglisi, J D

    1998-05-26

    Through an affinity chromatography based modification-interference assay, we have identified chemical groups within Escherichia coli 16S ribosomal RNA sequence that are required for binding the aminoglycoside antibiotic paromomycin. Paromomycin was covalently linked to solid support via a nine atom spacer from the 6"'-amine of ring IV, and chemical modifications to an A-site oligonucleotide that disrupted binding were identified. Positions in the RNA oligonucleotide that correspond to G1405(N7), G1491(N7), G1494(N7), A1408(N7), A1493(N7), A1408(N1), A1492(N1), and A1493(N1), as well as the pro-R phosphate oxygens of A1492 and A1493 in 16S rRNA are chemical groups that are essential for a high-affinity RNA-paromomycin interaction. These data are consistent with genetic, biochemical, and structural studies related to neomycin-class antibiotics and provide additional information for establishing an exact model for their interaction with the ribosome.

  2. Combining flow cytometry and 16S rRNA gene pyrosequencing: A promising approach for drinking water monitoring and characterization

    KAUST Repository

    Prest, Emmanuelle I E C

    2014-10-01

    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5min intervals for 1h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345±15×103 to 425±35×103cellsmL-1) and in the percentage of intact bacterial cells (from 39±3.5% to 53±4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. © 2014 Elsevier Ltd.

  3. Simultaneous Detection of Three Bacterial Seed-Borne Diseases in Rice Using Multiplex Polymerase Chain Reaction

    OpenAIRE

    Kang, In Jeong; Kang, Mi-Hyung; Noh, Tae-Hwan; Shim, Hyeong Kwon; Shin, Dong Bum; Heu, Suggi

    2016-01-01

    Burkholderia glumae (bacterial grain rot), Xanthomonas oryzae pv. oryzae (bacterial leaf blight), and Acidovorax avenae subsp. avenae (bacterial brown stripe) are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae, and transposase A gene sequence for X. oryzae pv. oryzae, three sets of primers had been designed to produce 402 bp for B. glumae, 490 bp for X. oryzae, and 290 bp for A. avenae subsp. avenae with the 63°C as an opti...

  4. BACTERIAL PLASMIDS

    Directory of Open Access Journals (Sweden)

    Marina Dinic

    2007-12-01

    Full Text Available Plasmids, extrachromosomal DNA, were identified in bacteria pertaining to family of Enterobacteriacae for the very first time. After that, they were discovered in almost every single observed strain. The structure of plasmids is made of circular double chain DNA molecules which are replicated autonomously in a host cell. Their length may vary from few up to several hundred kilobase (kb. Among the bacteria, plasmids are mostly transferred horizontally by conjugation process. Plasmid replication process can be divided into three stages: initiation, elongation, and termination. The process involves DNA helicase I, DNA gyrase, DNA polymerase III, endonuclease, and ligase.Plasmids contain genes essential for plasmid function and their preservation in a host cell (the beginning and the control of replication. Some of them possess genes whichcontrol plasmid stability. There is a common opinion that plasmids are unnecessary fora growth of bacterial population and their vital functions; thus, in many cases they can be taken up or kicked out with no lethal effects to a plasmid host cell. However,there are numerous biological functions of bacteria related to plasmids. Plasmids identification and classification are based upon their genetic features which are presented permanently in all of them, and these are: abilities to preserve themselves in a host cell and to control a replication process. In this way, plasmids classification among incompatibility groups is performed. The method of replicon typing, which is based on genotype and not on phenotype characteristics, has the same results as in compatibility grouping.

  5. Bacterial communities in petroleum oil in stockpiles.

    Science.gov (United States)

    Yoshida, Nobuyuki; Yagi, Kazuhiro; Sato, Daisuke; Watanabe, Noriko; Kuroishi, Takeshi; Nishimoto, Kana; Yanagida, Akira; Katsuragi, Tohoru; Kanagawa, Takahiro; Kurane, Ryuichiro; Tani, Yoshiki

    2005-02-01

    Bacterial communities in crude-oil samples from Japanese oil stockpiles were investigated by 16S rRNA gene cloning, followed by denaturing gradient gel electrophoresis (DGGE) analysis. 16S rRNA genes were successfully amplified by PCR after isooctane treatment from three kinds of crude-oil sample collected at four oil stockpiles in Japan. DGGE profiles showed that bacteria related to Ochrobactrum anthropi, Burkholderia cepacia, Stenotrophomonas maltophilia, Propionibacterium acnes, and Brevundimonas diminuta were frequently detected in most crude-oil samples. The bacterial communities differed in the sampling time and layer. Among the predominant bacteria detected in the crude oil, only three species were found for bacteria isolated on agar plates and were related to Burkholderia, Stenotrophomonas, and Propionibacterium, while Ochrobactrum sp. could not be isolated although this species seemed to be the most abundant bacterium in crude oil from the DGGE profiles. Using an archaea-specific primer set, methanogens were found in crude-oil sludge but not in crude-oil samples, indicating that methanogens might be involved in sludge formation in oil stockpiles.

  6. Alteration of rRNA gene copy number and expression in patients ...

    African Journals Online (AJOL)

    Background: Intellectual disability (ID) is an important medical and social problem that can be caused by different genetic and environmental factors. One such factor could be rDNA amplification and changes in rRNA expression and maturation. Aim of the study: The aim of the present study was to investigate rRNA levels in ...

  7. Hepatic rRNA Transcription Regulates High-Fat-Diet-Induced Obesity

    Directory of Open Access Journals (Sweden)

    Shohei Oie

    2014-05-01

    Full Text Available Ribosome biosynthesis is a major intracellular energy-consuming process. We previously identified a nucleolar factor, nucleomethylin (NML, which regulates intracellular energy consumption by limiting rRNA transcription. Here, we show that, in livers of obese mice, the recruitment of NML to rRNA gene loci is increased to repress rRNA transcription. To clarify the relationship between obesity and rRNA transcription, we generated NML-null (NML-KO mice. NML-KO mice show elevated rRNA level, reduced ATP concentration, and reduced lipid accumulation in the liver. Furthermore, in high-fat-diet (HFD-fed NML-KO mice, hepatic rRNA levels are not decreased. Both weight gain and fat accumulation in HFD-fed NML-KO mice are significantly lower than those in HFD-fed wild-type mice. These findings indicate that rRNA transcriptional activation promotes hepatic energy consumption, which alters hepatic lipid metabolism. Namely, hepatic rRNA transcriptional repression by HFD feeding is essential for energy storage.

  8. Utility of 16S rRNA PCR performed on clinical specimens in patient management

    Directory of Open Access Journals (Sweden)

    A. Akram

    2017-04-01

    Conclusions: Despite the low diagnostic yield, results of 16S rRNA PCR can still have a significant impact on patient management due to rationalization or cessation of the antimicrobial therapy. The yield of 16S rRNA PCR was highest for heart valves.

  9. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    OpenAIRE

    Honoré, N; Marchal, G; Cole, S T

    1995-01-01

    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  10. Restructuring of the Aquatic Bacterial Community by Hydric Dynamics Associated with Superstorm Sandy.

    Science.gov (United States)

    Ulrich, Nikea; Rosenberger, Abigail; Brislawn, Colin; Wright, Justin; Kessler, Collin; Toole, David; Solomon, Caroline; Strutt, Steven; McClure, Erin; Lamendella, Regina

    2016-06-15

    Bacterial community composition and longitudinal fluctuations were monitored in a riverine system during and after Superstorm Sandy to better characterize inter- and intracommunity responses associated with the disturbance associated with a 100-year storm event. High-throughput sequencing of the 16S rRNA gene was used to assess microbial community structure within water samples from Muddy Creek Run, a second-order stream in Huntingdon, PA, at 12 different time points during the storm event (29 October to 3 November 2012) and under seasonally matched baseline conditions. High-throughput sequencing of the 16S rRNA gene was used to track changes in bacterial community structure and divergence during and after Superstorm Sandy. Bacterial community dynamics were correlated to measured physicochemical parameters and fecal indicator bacteria (FIB) concentrations. Bioinformatics analyses of 2.1 million 16S rRNA gene sequences revealed a significant increase in bacterial diversity in samples taken during peak discharge of the storm. Beta-diversity analyses revealed longitudinal shifts in the bacterial community structure. Successional changes were observed, in which Betaproteobacteria and Gammaproteobacteria decreased in 16S rRNA gene relative abundance, while the relative abundance of members of the Firmicutes increased. Furthermore, 16S rRNA gene sequences matching pathogenic bacteria, including strains of Legionella, Campylobacter, Arcobacter, and Helicobacter, as well as bacteria of fecal origin (e.g., Bacteroides), exhibited an increase in abundance after peak discharge of the storm. This study revealed a significant restructuring of in-stream bacterial community structure associated with hydric dynamics of a storm event. In order to better understand the microbial risks associated with freshwater environments during a storm event, a more comprehensive understanding of the variations in aquatic bacterial diversity is warranted. This study investigated the bacterial

  11. Comparative sequence analysis of bacterial symbionts from the marine sponges Geodia cydonium and Ircinia muscarum

    OpenAIRE

    Zuppa, Antonio; Costantini, Susan; Costantini, Maria

    2014-01-01

    Marine sponges (Porifera) live in a symbiotic relationship with microorganisms, primarily bacteria. Recently, several studies indicated that sponges are the most prolific source of biologically-active compounds produced by symbiotic microorganisms rather than by the sponges themselves. In the present study we characterized the bacterial symbionts from two Demospongiae, Ircinia muscarum and Geodia cydonium. We amplified 16S rRNA by PCR, using specific bacterial-primers. The phylogenetic analys...

  12. Gut bacterial community structure of two Australian tropical fruit fly species (Diptera: Tephritidae)

    OpenAIRE

    Narit Thaochan; Richard A.I. Drew; Anuchit Chinajariyawong; Anurag Sunpapao; Chaninun Pornsuriya

    2015-01-01

    The community structure of the alimentary tract bacteria of two Australian fruit fly species, Bactrocera cacuminata (Hering) and Bactrocera tryoni (Froggatt), was studied using a molecular cloning method based on the 16S rRNA gene. Differences in the bacterial community structure were shown between the crops and midguts of the two species and sexes of each species. Proteobacteria was the dominant bacterial phylum in the flies, especially bacteria in the order Gammaproteobacteria w...

  13. Novel inhibitors of the rRNA ErmC' methyltransferase to block resistance to macrolides, lincosamides, streptogramine B antibiotics.

    Science.gov (United States)

    Foik, Ilona P; Tuszynska, Irina; Feder, Marcin; Purta, Elzbieta; Stefaniak, Filip; Bujnicki, Janusz M

    2018-02-25

    In erythromycin-resistant bacteria, the N6 position of A2058 in 23S rRNA is mono- or dimethylated by Erm family methyltransferases. This modification results in cross-resistance to macrolides, lincosamides and streptogramin B. Most inhibitors of Erm methyltransferases developed up-to-date target the cofactor-binding pocket, resulting in a lack of selectivity whereas inhibitors that bind the substrate-binding pocket demonstrate low in vitro activity. In this study, a molecular docking approach followed by biochemical screening was applied to search for inhibitors targeting both cofactor- and substrate-binding pockets of ErmC' methyltransferase. Based on the results of the molecular docking-based virtual screening of the clean-leads subset of the ZINC database, 29 compounds were chosen for experimental verification. Among them inhibitor 28 (ZINC code 32747906), with an IC 50 of 100 μM, decreased the minimal inhibitory concentration of erythromycin in the Escherichia coli strain overexpressing ErmC'. Docking analysis of 28 to the ErmC' structure and the competitive ligand binding assay revealed a non-competitive model of inhibition. Inhibitor 28 served as a template for similarity-based virtual screening, which resulted in the identification of two derivatives 3s (ZINC code 62022572) and 4s (ZINC code 49032257) with an IC 50 of 116 μM and 110 μM, respectively. Our results provide a basis for the development of inhibitors against the Erm-family of enzymes. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  14. Construction and analysis of a bacterial community exhibiting strong chitinolytic activity.

    Science.gov (United States)

    Sato, Kazuaki; Kato, Yuichi; Fukamachi, Ayabi; Nogawa, Masahiro; Taguchi, Goro; Shimosaka, Makoto

    2010-01-01

    A stable bacterial community expressing strong chitinolytic activity was constructed by mixing and cultivating chitinolytic bacteria collected from different natural sources. The DNA fragment pattern, after PCR-denaturing gradient gel electrophoresis (DGGE) targeting 16S rRNA genes using total DNA prepared from whole cells, indicated that the community was composed of four dominant bacterial species. All four species were isolated on agar medium, and one strain, SAY3, was deduced to be a novel species belonging to a new genus based on the 16S rRNA nucleotide sequence. The other strains showed high similarity in their 16S rRNA sequences to those of previously identified bacteria (Acinetobacter and Microbacterium). Strain SAY3 degraded and utilized larger particles of chitin faster than the community, indicating that it plays an important role in the chitin degradation conferred by the community.

  15. Molecular diversity in the bacterial community and the fluorescent pseudomonads group in natural and chlorobenzoate-stressed peat-forest soil

    NARCIS (Netherlands)

    Ramirez-Saad, H.C.; Sessitsch, A.; Akkermans, A.D.L.

    2003-01-01

    Bacterial community shifts in a soil microcosm spiked with 3-chlorobenzoate or 2,5-dichlorobenzoate were monitored. The V6-V8 variable regions of soil bacterial 16S rRNA and rDNA were amplified and separated by temperature gradient gel electrophoresis (TGGE) profiling. Culturing in the presence of

  16. Amplicon sequencing for the quantification of spoilage microbiota in complex foods including bacterial spores

    NARCIS (Netherlands)

    Boer, de P.; Caspers, M.; Sanders, J.W.; Kemperman, R.; Wijman, J.; Lommerse, G.; Roeselers, G.; Montijn, R.; Abee, T.; Kort, R.

    2015-01-01

    Background
    Spoilage of food products is frequently caused by bacterial spores and lactic acid bacteria. Identification of these organisms by classic cultivation methods is limited by their ability to form colonies on nutrient agar plates. In this study, we adapted and optimized 16S rRNA amplicon

  17. Presence of bacterial 16S ribosomal RNA gene segments in human intestinal lymph follicles.

    Science.gov (United States)

    Chiba, M; Kono, M; Hoshina, S; Komatsu, M; Kitagawa, Y; Iizuka, M; Watanabe, S

    2000-08-01

    There is currently no information regarding microbial agents inside the intestinal lymph follicles. Biopsy or resected specimens, mostly from macroscopically normal areas, were sectioned with a cryostat. DNA was extracted from microdissected samples, exclusively from the lymph follicle. Amplification of DNA was performed using universal primers designed from conserved regions of bacterial 16S ribosomal RNA (rRNA). Several clones with inserts of around 400 base pairs were subjected to DNA sequence analysis followed by a database homology search. Bacterial 16S rRNA gene segments were detected in the lymph follicle in 2 of 14 (14%) non-inflammatory bowel disease (IBD) cases, 4 of 14 (28%) Crohn disease cases, and in 2 of 5 (40%) ulcerative colitis cases. Nineteen 16S rRNA gene segments were recognized in the eight positive cases. Five segments showed 100% identity to known bacterial 16S rRNAs, namely staphylococcus species, Streptococcus sanguis, and Paracoccus marcusii. However, the other 14 segments showed below 100% identity, indicating either the presence of unknown bacteria or of bacteria without known DNA data. No single identified or unidentified bacterium, characteristic of IBD, including Mycobacterium paratuberculosis and Listeria monocytogenes, was detected. The present study confirms the presence of bacterial 16S rRNA gene segments in human intestinal lymph follicles and paves the way for new investigations into the microbiology of the lymph follicle. Whether or not bacteria inside the lymph follicle is a primary stimulus in IBD has yet to be clarified.

  18. Metagenomic evaluation of bacterial and archaeal diversity in the geothermal hot springs of manikaran, India.

    Science.gov (United States)

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Green, Stefan J; Joshi, Amit; Chauhan, Ashvini

    2015-02-19

    Bacterial and archaeal diversity in geothermal spring water were investigated using 16S rRNA gene amplicon metagenomic sequencing. This revealed the dominance of Firmicutes, Aquificae, and the Deinococcus-Thermus group in this thermophilic environment. A number of sequences remained taxonomically unresolved, indicating the presence of potentially novel microbes in this unique habitat. Copyright © 2015 Bhatia et al.

  19. 18S rRNA degradation is not accompanied by altered rRNA transport at early times following irradiation of HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Fuchs, P.; Krolak, J.M.; McClain, D.; Minton, K.W.

    1990-01-01

    In recent investigations on the effects of radiation on rRNA processing in HeLa S3 cells, the authors pulse-labeled the cells with uridine immediately prior to irradiation. The 45 S rRNA precursor, which undergoes nuclear processing to form one each of its major daughter species, 28S and 18S rRNA, was separated from the daughter species by gel electrophoresis and the radiolabel in each species determined at various times after irradiation. By pulse-labeling the cells prior to irradiation, superimposed effects caused by radiation-induced alterations of rRNA transcription and Refs. therein were minimized, permitting selective analysis of the processing of that fraction of 45S precursor that had been synthesized (radiolabeled) predominantly prior to irradiation. They now report more detailed studies on 45S rRNA processing within the first 2 h following irradiation in which they have found a maximum 28 S:18 S ratio of 2:1 that is observed about 1 h following irradiation of 5 or 10 Gy.

  20. Practically delineating bacterial species with genealogical concordance.

    Science.gov (United States)

    Venter, Stephanus N; Palmer, Marike; Beukes, Chrizelle W; Chan, Wai-Yin; Shin, Giyoon; van Zyl, Elritha; Seale, Tarren; Coutinho, Teresa A; Steenkamp, Emma T

    2017-10-01

    Bacterial species are commonly defined by applying a set of predetermined criteria, including DNA-DNA hybridization values, 16S rRNA gene sequence similarity, phenotypic data as well as genome-based criteria such as average nucleotide identity or digital DNA-DNA hybridization. These criteria mostly allow for the delimitation of taxa that resemble typical bacterial species. Their application is often complicated when the objective is to delineate new species that are characterized by significant population-level diversity or recent speciation. However, we believe that these complexities and limitations can be easily circumvented by recognizing that bacterial species represent unique and exclusive assemblages of diversity. Within such a framework, methods that account for the population processes involved in species evolution are used to infer species boundaries. A method such as genealogical concordance analysis is well suited to delineate a putative species. The existence of the new taxon is then interrogated using an array of traditional and genome-based characters. By making use of taxa in the genera Pantoea, Paraburkholderia and Escherichia we demonstrate in a step-wise process how genealogical concordance can be used to delimit a bacterial species. Genetic, phenotypic and biological criteria were used to provide independent lines of evidence for the existence of that taxon. Our six-step approach to species recognition is straightforward and applicable to bacterial species especially in the post-genomic era, with increased availability of whole genome sequences. In fact, our results indicated that a combined genome-based comparative and evolutionary approach would be the preferred alternative for delineating coherent bacterial taxa.

  1. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  2. Gut Microbiota Analysis Results Are Highly Dependent on the 16S rRNA Gene Target Region, Whereas the Impact of DNA Extraction Is Minor.

    Science.gov (United States)

    Rintala, Anniina; Pietilä, Sami; Munukka, Eveliina; Eerola, Erkki; Pursiheimo, Juha-Pekka; Laiho, Asta; Pekkala, Satu; Huovinen, Pentti

    2017-04-01

    Next-generation sequencing (NGS) is currently the method of choice for analyzing gut microbiota composition. As gut microbiota composition is a potential future target for clinical diagnostics, it is of utmost importance to enhance and optimize the NGS analysis procedures. Here, we have analyzed the impact of DNA extraction and selected 16S rDNA primers on the gut microbiota NGS results. Bacterial DNA from frozen stool specimens was extracted with 5 commercially available DNA extraction kits. Special attention was paid to the semiautomated DNA extraction methods that could expedite the analysis procedure, thus being especially suitable for clinical settings. The microbial composition was analyzed with 2 distinct protocols: 1 targeting the V3-V4 and the other targeting the V4-V5 area of the bacterial 16S rRNA gene. The overall effect of DNA extraction on the gut microbiota 16S rDNA profile was relatively small, whereas the 16S rRNA gene target region had an immense impact on the results. Furthermore, semiautomated DNA extraction methods clearly appeared suitable for NGS procedures, proposing that application of these methods could importantly reduce hands-on time and human errors without compromising the validity of results.

  3. The potential role of incorporating real-time PCR and DNA sequencing for amplification and detection of 16S rRNA gene signatures in neonatal sepsis.

    Science.gov (United States)

    Midan, Dina A; Abo El Fotoh, Wafaa Moustafa M; El Shalakany, Abeer H

    2017-06-01

    This study aimed to explore whether 16S rRNA gene amplification by real time PCR and sequencing could serve as genetic-based methods in rapid and accurate diagnosis of neonatal sepsis. This case control study was conducted on 40 neonates suffering from sepsis like manifestations recruited from the neonatal intensive care unit of Menoufia university hospital over a period of 6 months. Their blood samples were used for paired analysis of bacterial growth using BACTEC 9050 instrument and real time PCR assay with subsequent DNA sequencing for bacterial species identification. The detection rate of culture proven sepsis was 70%. By using real time 16S r RNA PCR amplification method, the detection of bacteria was improved to 80%. Real time PCR revealed sensitivity, specificity, positive predictive value and negative predictive value of [100%, 66.7%, 87.5% and 100%] respectively. Compared to culture, the 16S rRNA real time PCR demonstrated a high negative value for ruling out neonatal sepsis. There was significant statistical difference between the PCR positive and negative cases as regards the hematological sepsis score. The results demonstrated the ability of DNA sequencing to recognize 4 pathogens which were negative by blood culture. The time consumed to detect sepsis using blood culture was up to 5 days while it took up to 16 h only by PCR and sequencing methods. 16S rRNA gene amplification by real time PCR and sequence analysis could be served as ideal and reliable genetic-based methods to diagnose and rule out sepsis with provision of additional data that cannot be obtained by routine laboratory tests with a shorter turnaround time than those with culture-based protocols.

  4. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    Science.gov (United States)

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2). Images PMID:6340063

  5. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  6. Intragenomic Variation Among 16S rRNA Copies in Vibrio - Significance of Lifestyle

    OpenAIRE

    Karlsholm, Line Strand

    2017-01-01

    Intragenomic heterogeneity among 16S rRNA gene copies has been found in several species of bacteria. In this thesis, the presence of different 16S rRNA gene copies and the differences in the relative abundance of these 16S rRNA gene variants for different lifestyles was examined for three species of Vibrio. The Vibrio strains used were Vibrio anguillarum strain HI610, Vibrio campbellii strain BB120 and the Vibrio sp. strain RD5-30. The methods used to examine this were denaturing gradient g...

  7. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    OpenAIRE

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-01-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-staine...

  8. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis

    Directory of Open Access Journals (Sweden)

    Steelman Samantha M

    2012-11-01

    Full Text Available Abstract Background The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to characterize hindgut bacterial communities in healthy horses and those with chronic laminitis. Results Fecal samples were collected from 10 normal horses and 8 horses with chronic laminitis. Genomic DNA was extracted and the V4-V5 segment of the 16S rRNA gene was PCR amplified and sequenced on the 454 platform generating a mean of 2,425 reads per sample after quality trimming. The bacterial communities were dominated by Firmicutes (69.21% control, 56.72% laminitis and Verrucomicrobia (18.13% control, 27.63% laminitis, followed by Bacteroidetes, Proteobacteria, and Spirochaetes. We observed more OTUs per individual in the laminitis group than the control group (419.6 and 355.2, respectively, P = 0.019 along with a difference in the abundance of two unassigned Clostridiales genera (P = 0.03 and P = 0.01. The most abundant bacteria were Streptococcus spp., Clostridium spp., and Treponema spp.; along with unassigned genera from Subdivision 5 of Verrucomicrobia, Ruminococcaceae, and Clostridiaceae, which together constituted ~ 80% of all OTUs. There was a high level of individual variation across all taxonomic ranks. Conclusions Our exploration of the equine fecal microflora revealed higher bacterial diversity in horses with chronic laminitis and identification of two Clostridiales genera that differed in abundance from control horses. There was large individual variation in bacterial communities that was not explained in our study. The core hindgut microflora was

  9. Pyrosequencing of 16S rRNA genes in fecal samples reveals high diversity of hindgut microflora in horses and potential links to chronic laminitis.

    Science.gov (United States)

    Steelman, Samantha M; Chowdhary, Bhanu P; Dowd, Scot; Suchodolski, Jan; Janečka, Jan E

    2012-11-27

    The nutrition and health of horses is closely tied to their gastrointestinal microflora. Gut bacteria break down plant structural carbohydrates and produce volatile fatty acids, which are a major source of energy for horses. Bacterial communities are also essential for maintaining gut homeostasis and have been hypothesized to contribute to various diseases including laminitis. We performed pyrosequencing of 16S rRNA bacterial genes isolated from fecal material to characterize hindgut bacterial communities in healthy horses and those with chronic laminitis. Fecal samples were collected from 10 normal horses and 8 horses with chronic laminitis. Genomic DNA was extracted and the V4-V5 segment of the 16S rRNA gene was PCR amplified and sequenced on the 454 platform generating a mean of 2,425 reads per sample after quality trimming. The bacterial communities were dominated by Firmicutes (69.21% control, 56.72% laminitis) and Verrucomicrobia (18.13% control, 27.63% laminitis), followed by Bacteroidetes, Proteobacteria, and Spirochaetes. We observed more OTUs per individual in the laminitis group than the control group (419.6 and 355.2, respectively, P = 0.019) along with a difference in the abundance of two unassigned Clostridiales genera (P = 0.03 and P = 0.01). The most abundant bacteria were Streptococcus spp., Clostridium spp., and Treponema spp.; along with unassigned genera from Subdivision 5 of Verrucomicrobia, Ruminococcaceae, and Clostridiaceae, which together constituted ~ 80% of all OTUs. There was a high level of individual variation across all taxonomic ranks. Our exploration of the equine fecal microflora revealed higher bacterial diversity in horses with chronic laminitis and identification of two Clostridiales genera that differed in abundance from control horses. There was large individual variation in bacterial communities that was not explained in our study. The core hindgut microflora was dominated by Streptococcus spp., several cellulytic genera, and

  10. Bacterial community analyses of two Red Sea sponges.

    Science.gov (United States)

    Radwan, Mona; Hanora, Amro; Zan, Jindong; Mohamed, Naglaa M; Abo-Elmatty, Dina M; Abou-El-Ela, Soad H; Hill, Russell T

    2010-06-01

    Red Sea sponges offer potential as sources of novel drugs and bioactive compounds. Sponges harbor diverse and abundant prokaryotic communities. The diversity of Egyptian sponge-associated bacterial communities has not yet been explored. Our study is the first culture-based and culture-independent investigation of the total bacterial assemblages associated with two Red Sea Demosponges, Hyrtios erectus and Amphimedon sp. Denaturing gradient gel electrophoresis fingerprint-based analysis revealed statistically different banding patterns of the bacterial communities of the studied sponges with H. erectus having the greater diversity. 16S rRNA clone libraries of both sponges revealed diverse and complex bacterial assemblages represented by ten phyla for H. erectus and five phyla for Amphimedon sp. The bacterial community associated with H. erectus was dominated by Deltaproteobacteria. Clones affiliated with Gammaproteobacteria were the major component of the clone library of Amphimedon sp. About a third of the 16S rRNA gene sequences in these communities were derived from bacteria that are novel at least at the species level. Although the overall bacterial communities were significantly different, some bacterial groups, including members of Alphaproteobacteria, Gammaproteobacteria, Acidobacteria, and Actinobacteria, were found in both sponge species. The culture-based component of this study targeted Actinobacteria and resulted in the isolation of 35 sponge-associated microbes. The current study lays the groundwork for future studies of the role of these diverse microbes in the ecology, evolution, and development of marine sponges. In addition, our work provides an excellent resource of several candidate bacteria for production of novel pharmaceutically important compounds.

  11. Analysis of microbiota associated with peri-implantitis using 16S rRNA gene clone library

    Directory of Open Access Journals (Sweden)

    Tatsuro Koyanagi

    2010-05-01

    Full Text Available Background: Peri-implantitis (PI is an inflammatory disease which leads to the destruction of soft and hard tissues around osseointegrated implants. The subgingival microbiota appears to be responsible for peri-implant lesions and although the complexity of the microbiota has been reported in PI, the microbiota responsible for PI has not been identified. Objective: The purpose of this study was to identify the microbiota in subjects who have PI, clinically healthy implants, and periodontitis-affected teeth using 16S rRNA gene clone library analysis to clarify the microbial differences. Design: Three subjects participated in this study. The conditions around the teeth and implants were evaluated based on clinical and radiographic examinations and diseased implants, clinically healthy implants, and periodontally diseased teeth were selected. Subgingival plaque samples were taken from the deepest pockets using sterile paper points. Prevalence and identity of bacteria was analyzed using a 16S rRNA gene clone library technique. Results: A total of 112 different species were identified from 335 clones sequenced. Among the 112 species, 51 (46% were uncultivated phylotypes, of which 22 were novel phylotypes. The numbers of bacterial species identified at the sites of PI, periodontitis, and periodontally healthy implants were 77, 57, and 12, respectively. Microbiota in PI mainly included Gram-negative species and the composition was more diverse when compared to that of the healthy implant and periodontitis. The phyla Chloroflexi, Tenericutes, and Synergistetes were only detected at PI sites, as were Parvimonas micra, Peptostreptococcus stomatis, Pseudoramibacter alactolyticus, and Solobacterium moorei. Low levels of periodontopathic bacteria, such as Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans, were seen in peri-implant lesions. Conclusions: The biofilm in PI showed a more complex microbiota when compared to periodontitis and

  12. Diversity of 16S rRNA and dioxygenase genes detected in coal-tar-contaminated site undergoing active bioremediation.

    Science.gov (United States)

    Kumar, M; Khanna, S

    2010-04-01

    In order to develop effective bioremediation strategies for polyaromatic hydrocarbons (PAHs) degradation, the composition and metabolic potential of microbial communities need to be better understood, especially in highly PAH contaminated sites in which little information on the cultivation-independent communities is available. Coal-tar-contaminated soil was collected, which consisted of 122.5 mg g(-1) total extractable PAH compounds. Biodegradation studies with this soil indicated the presence of microbial community that is capable of degrading the model PAH compounds viz naphthalene, phenanthrene and pyrene at 50 ppm each. PCR clone libraries were established from the DNA of the coal-tar-contaminated soil, targeting the 16S rRNA to characterize (i) the microbial communities, (ii) partial gene fragment encoding the Rieske iron sulfur center (alpha-subunit) common to all PAH dioxygenase enzymes and (iii) beta-subunit of dioxygenase. Phylotypes related to Proteobacteria (Alpha-, Epsilon- and Gammaproteobacteria), Acidobacteria, Actinobacteria, Firmicutes, Gemmatimonadetes and Deinococci were detected in 16S rRNA derived clone libraries. Many of the gene fragment sequences of alpha-subunit and beta-subunit of dioxygenase obtained from the respective clone libraries fell into clades that are distinct from the reference dioxygenase gene sequences. Presence of consensus sequence of the Rieske type [2Fe-2S] cluster binding site suggested that these gene fragments encode for alpha-subunit of dioxygenase gene. Sequencing of the cloned libraries representing alpha-subunit gene fragments (Rf1) and beta-subunit of dioxygenase showed the presence of hitherto unidentified dioxygenase in coal-tar-contaminated soil. The combination of the Rieske primers and bacterial community profiling represents a powerful tool for both assessing bioremediation potential and the exploration of novel dioxygenase genes in a contaminated environment.

  13. Structural Insights into the Methylation of C1402 in 16S rRNA by Methyltransferase RsmI.

    Directory of Open Access Journals (Sweden)

    Mohan Zhao

    Full Text Available RsmI and RsmH are conserved S-Adenosylmethionine (AdoMet-dependent methyltransferases (MTases that are responsible for the 2'-O-methylation and N4-methylation of C1402 in bacterial 16S rRNA, respectively. Methylation of m4Cm1402 plays a role in fine-tuning the shape and functions of the P-site to increase the decoding fidelity, and was recently found to contribute to the virulence of Staphylococcus aureus in host animals. Here we report the 2.20-Å crystal structure of homodimeric RsmI from Escherichia coli in complex with the cofactor AdoMet. RsmI consists of an N-terminal putative RNA-binding domain (NTD and a C-terminal catalytic domain (CTD with a Rossmann-like fold, and belongs to the class III MTase family. AdoMet is specifically bound into a negatively charged deep pocket formed by both domains by making extensive contacts. Structure-based mutagenesis and isothermal titration calorimetry (ITC assays revealed Asp100 and Ala124 are vital for AdoMet-binding. Although the overall fold of RsmI shows remarkable similarities to the characterized MTases involved in vitamin B12 biosynthesis, it exhibits a distinct charge distribution especially around the AdoMet-binding pocket because of different substrate specificity. The docking model of RsmI-AdoMet-RNA ternary complex suggested a possible base-flipping mechanism of the substrate RNA that has been observed in several known RNA MTases. Our structural and biochemical studies provide novel insights into the catalytic mechanism of C1402 methylation in 16S rRNA.

  14. Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

    Directory of Open Access Journals (Sweden)

    Guoqin Yu

    Full Text Available Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention.In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20 and microbial diversity (relatively low in vagina vs. high in stool were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles. Stool samples showed significant differences in alpha diversity (except Shannon's index and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P27% of total OTUs in stool.Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies.

  15. Counting and Size Classification of Active Soil Bacteria by Fluorescence In Situ Hybridization with an rRNA Oligonucleotide Probe

    Science.gov (United States)

    Christensen, Henrik; Hansen, Michael; Sørensen, Jan

    1999-01-01

    A fluorescence in situ hybridization (FISH) technique based on binding of a rhodamine-labelled oligonucleotide probe to 16S rRNA was used to estimate the numbers of ribosome-rich bacteria in soil samples. Such bacteria, which have high cellular rRNA contents, were assumed to be active (and growing) in the soil. Hybridization to an rRNA probe, EUB338, for the domain Bacteria was performed with a soil slurry, and this was followed by collection of the bacteria by membrane filtration (pore size, 0.2 μm). A nonsense probe, NONEUB338 (which has a nucleotide sequence complementary to the nucleotide sequence of probe EUB338), was used as a control for nonspecific staining. Counting and size classification into groups of small, medium, and large bacteria were performed by fluorescence microscopy. To compensate for a difference in the relative staining intensities of the probes and for binding by the rhodamine part of the probe, control experiments in which excess unlabelled probe was added were performed. This resulted in lower counts with EUB338 but not with NONEUB338, indicating that nonspecific staining was due to binding of rhodamine to the bacteria. A value of 4.8 × 108 active bacteria per g of dry soil was obtained for bulk soil incubated for 2 days with 0.3% glucose. In comparison, a value of 3.8 × 108 active bacteria per g of dry soil was obtained for soil which had been air dried and subsequently rewetted. In both soils, the majority (68 to 77%) of actively growing bacteria were members of the smallest size class (cell width, 0.25 to 0.5 μm), but the active (and growing) bacteria still represented only approximately 5% of the total bacterial population determined by DAPI (4′,6-diamidino-2-phenylindole) staining. The FISH technique in which slurry hybridization is used holds great promise for use with phylogenetic probes and for automatic counting of soil bacteria. PMID:10103277

  16. Molecular Typing of Papillomatous Digital Dermatitis-Associated Treponema Isolates Based on Analysis of 16S-23S Ribosomal DNA Intergenic Spacer Regions

    Science.gov (United States)

    Stamm, L. V.; Bergen, H. L.; Walker, R. L.

    2002-01-01

    Papillomatous digital dermatitis (PDD), an emerging infectious disease of cattle, is characterized by painful, ulcerative foot lesions. The detection of high numbers of invasive spirochetes in PDD lesions suggests an important role for these organisms in the pathogenesis of PDD. PDD-associated spirochetes have phenotypic characteristics consistent with members of the genus Treponema. Partial 16S ribosomal DNA (rDNA) sequence analysis of clonal isolates from California cattle showed that they comprise three phylotypes which cluster closely with human-associated Treponema spp. of the oral cavity (T. denticola and T. medium/T. vincentii) or genital area (T. phagedenis). The goal of our study was to apply 16S-23S rDNA intergenic spacer region (ISR) sequence analysis to the molecular typing of U.S. PDD-associated Treponema isolates. This methodology has potentially greater discriminatory power for differentiation of closely related bacteria than 16S rDNA analysis. We PCR amplified, cloned, and sequenced the ISRs from six California PDD-associated Treponema isolates and, for comparative purposes, one strain each of T. denticola, T. medium, T. vincentii, and T. phagedenis. Two ISRs that varied in length and composition were present in all the PDD-associated Treponema isolates and in T. denticola, T. medium, and T. phagedenis. ISR1 contained a tRNAAla gene, while ISR2 contained a tRNAIle gene. Only a single ISR (ISR1) was identified in T. vincentii. Comparative analyses of the ISR1 and ISR2 sequences indicated that the California PDD-associated Treponema isolates comprised three phylotypes, in agreement with the results of 16S rDNA analysis. PCR amplification of the 16S-tRNAIle region of ISR2 permitted rapid phylotyping of California and Iowa PDD-associated Treponema isolates based on product length polymorphisms. PMID:12202594

  17. Bacterial communities in chitin-amended soil as revealed by 16S rRNA gene based pyrosequencing

    NARCIS (Netherlands)

    Cretoiu, Mariana Silvia; Kielak, Anna Maria; Schluter, Andreas; van Elsas, Jan Dirk

    Chitin and its derivatives are natural biopolymers that are often used as compounds for the control of soilborne plant pathogens. In spite of recent advances in agricultural practices involving chitin amendments, the microbial communities in chitin-amended soils remain poorly known. The objectives

  18. IDENTIFICATION OF ACTIVE BACTERIAL COMMUNITIES IN A MODEL DRINKING WATER BIOFILM SYSTEM USING 16S RRNA-BASED CLONE LIBRARIES

    Science.gov (United States)

    Recent phylogenetic studies have used DNA as the target molecule for the development of environmental 16S rDNA clone libraries. As DNA may persist in the environment, DNA-based libraries cannot be used to identify metabolically active bacteria in water systems. In this study, a...

  19. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015

  20. [Molecular relationship of Eurytrema coelmaticum inferred from 18S rRNA sequence].

    Science.gov (United States)

    Zheng, Ya-dong; Luo, Xue-nong; Shi, Cheng-hong; Zong, Rui-qian; Jing, Zhi-zhong; Cai, Xue-peng

    2006-10-01

    To elucidate the taxonomic position of Eurytrema coelmaticum by using molecular technology. 18S rRNA fragment was amplified from E. coelmaticum genomic DNA by specific conservative primers and sequenced. Homology and phylogenic tree of 18S rRNA sequences between E. coelmaticum and other Dicrocoeliidae trematodes were analyzed and constructed by DNAStar and MEGA3 respectively, and their evolutionary relationship was determined. E. coelmaticum 18S rRNA sequence was with high homology to those from Dicrocoelium dendriticum, Lyperosomum collurionis and Brachylecithum lobatum. Among them, the diversity of E. coelmaticum from D. dendriticum was 2.42%, and that from L. collurionis was 1.75%; D. dendriticum and B. lobatum were closer in evolution only with 1.09% diversity. For Dicrocoeliidae trematodes, classification based on 18S rRNA target is valid and the sequences are highly conservative. E. coelmaticum is evolutionarily closer to L. collurionis than to D. dendriticum and B. lobatum.

  1. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  2. Bacterial selection by mycospheres of Atlantic Rainforest mushrooms.

    Science.gov (United States)

    Halsey, Joshua Andrew; de Cássia Pereira E Silva, Michele; Andreote, Fernando Dini

    2016-10-01

    This study focuses on the selection exerted on bacterial communities in the mycospheres of mushrooms collected in the Brazilian Atlantic Rainforest. A total of 24 paired samples (bulk soil vs. mycosphere) were assessed to investigate potential interactions between fungi and bacteria present in fungal mycospheres. Prevalent fungal families were identified as Marasmiaceae and Lepiotaceae (both Basidiomycota) based on ITS partial sequencing. We used culture-independent techniques to analyze bacterial DNA from soil and mycosphere samples. Bacterial communities in the samples were distinguished based on overall bacterial, alphaproteobacterial, and betaproteobacterial PCR-DGGE patterns, which were different in fungi belonging to different taxa. These results were confirmed by pyrosequencing the V4 region of the 16S rRNA gene (based on five bulk soil vs. mycosphere pairs), which revealed the most responsive bacterial families in the different conditions generated beneath the mushrooms, identified as Bradyrhizobiaceae, Burkholderiaceae, and Pseudomonadaceae. The bacterial families Acetobacteraceae, Chrhoniobacteraceae, Planctomycetaceae, Conexibacteraceae, and Burkholderiaceae were found in all mycosphere samples, composing the core mycosphere microbiome. Similarly, some bacterial groups identified as Koribacteriaceae, Acidobacteria (Solibacteriaceae) and an unclassified group of Acidobacteria were preferentially present in the bulk soil samples (found in all of them). In this study we depict the mycosphere effect exerted by mushrooms inhabiting the Brazilian Atlantic Rainforest, and identify the bacteria with highest response to such a specific niche, possibly indicating the role bacteria play in mushroom development and dissemination within this yet-unexplored environment.

  3. Molecular identification of airborne bacteria associated with aerial spraying of bovine slurry waste employing 16S rRNA gene PCR and gene sequencing techniques.

    Science.gov (United States)

    Murayama, Mayumi; Kakinuma, Yuki; Maeda, Yasunori; Rao, Juluri R; Matsuda, Motoo; Xu, Jiru; Moore, Peter J A; Millar, B Cherie; Rooney, Paul J; Goldsmith, Colin E; Loughrey, Anne; McMahon, M Ann S; McDowell, David A; Moore, John E

    2010-03-01

    Polymerase chain reaction amplification of the universal 16S ribosomal RNA (rRNA) gene was performed on a collection of 38 bacterial isolates, originating from air sampled immediately adjacent to the agricultural spreading of bovine slurry. A total of 16 bacterial genera were identified including both Gram-positive and Gram-negative genera. Gram-positive organisms accounted for 34/38 (89.5%) of total bacterial numbers consisting of 12 genera and included Staphylococcus (most common genus isolated), Arthrobacter (2nd most common genus isolated), Brachybacterium, Exiguobacterium, Lactococcus, Microbacterium and Sporosarcina (next most common genera isolated) and finally, Bacillus, Brevibacterium, Frigoribacterium, Mycoplana and Pseudoclavibacter. Gram-negative organisms accounted for only 4/38 (10.5%) bacterial isolates and included the following genera, Brevundimonas, Lysobacter, Psychrobacter and Rhizobium. No gastrointestinal pathogens were detected. Although this study demonstrated a high diversity of the microorganisms present, only a few have been shown to be opportunistically pathogenic to humans and none of these organisms described have been described previously as having an inhalational route of infection and therefore we do not believe that the species of organisms identified pose a significant health and safety threat for immunocompetant individuals. (c) 2009 Elsevier Inc. All rights reserved.

  4. Ice formation and growth shape bacterial community structure in Baltic Sea drift ice.

    Science.gov (United States)

    Eronen-Rasimus, Eeva; Lyra, Christina; Rintala, Janne-Markus; Jürgens, Klaus; Ikonen, Vilma; Kaartokallio, Hermanni

    2015-02-01

    Drift ice, open water and under-ice water bacterial communities covering several developmental stages from open water to thick ice were studied in the northern Baltic Sea. The bacterial communities were assessed with 16S rRNA gene terminal-restriction fragment length polymorphism and cloning, together with bacterial abundance and production measurements. In the early stages, open water and pancake ice were dominated by Alphaproteobacteria and Actinobacteria, which are common bacterial groups in Baltic Sea wintertime surface waters. The pancake ice bacterial communities were similar to the open-water communities, suggesting that the parent water determines the sea-ice bacterial community in the early stages of sea-ice formation. In consolidated young and thick ice, the bacterial communities were significantly different from water bacterial communities as well as from each other, indicating community development in Baltic Sea drift ice along with ice-type changes. The thick ice was dominated by typical sea-ice genera from classes Flavobacteria and Gammaproteobacteria, similar to those in polar sea-ice bacterial communities. Since the thick ice bacterial community was remarkably different from that of the parent seawater, results indicate that thick ice bacterial communities were recruited from the rarer members of the seawater bacterial community. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

    Energy Technology Data Exchange (ETDEWEB)

    Jansson, Janet; Edlund, Anna; Hardeman, Fredrik; Jansson, Janet K.; Sjoling, Sara

    2008-05-15

    Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities were most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.

  6. Prevalence of 16S rRNA methylase genes among β-lactamase ...

    African Journals Online (AJOL)

    Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...

  7. Differentiation of Shigella flexneri strains by rRNA gene restriction patterns.

    OpenAIRE

    Faruque, S M; Haider, K; Rahman, M M; Abdul Alim, A R; Ahmad, Q S; Albert, M J; Sack, R B

    1992-01-01

    We studied the restriction endonuclease cleavage patterns of rRNA genes (ribotypes) of 72 clinical isolates of Shigella flexneri representing eight serotypes to determine whether ribotyping could be used to distinguish S. flexneri strains and to compare the discriminating ability of the method with that of serotyping. By using a cloned Escherichia coli rRNA operon as the probe, Southern blot hybridization of restriction endonuclease-digested total DNA was carried out. Ribotyping of the isolat...

  8. Two distinct 18S rRNA secondary structures in Dipodascus (Hemiascomycetes).

    Science.gov (United States)

    Ueda-Nishimura, K; Mikata, K

    2000-05-01

    The nucleotide sequences of the 18S rRNA gene from ascomycetous yeast-like fungi in the genera Dipodascus, Galactomyces and Geotrichum were determined and the tested strains were separated into two groups by sequence length. In group 1, the length and secondary structure of 18S rRNA corresponded to those of typical eukaryotes. In group 2, the 18S rRNA gene sequences were about 150 nt shorter than those of most other eukaryotes and the predicted secondary structure lacked helices 10 and E21-5. Many substitutions and some deletions in group 2 18S rRNA gene were not only found in variable regions, but also in regions that are highly conserved among ascomycetes. Despite the considerable differences in 18S rRNA gene sequence and secondary structure between group 2 and other fungi, including group 1, phylogenetic analysis revealed that groups 1 and 2 are closely related. These findings suggest that a number of deletions occurred in the 18S rRNA of the common ancestor of group 2 strains.

  9. Urban greenness influences airborne bacterial community composition.

    Science.gov (United States)

    Mhuireach, Gwynne; Johnson, Bart R; Altrichter, Adam E; Ladau, Joshua; Meadow, James F; Pollard, Katherine S; Green, Jessica L

    2016-11-15

    Urban green space provides health benefits for city dwellers, and new evidence suggests that microorganisms associated with soil and vegetation could play a role. While airborne microorganisms are ubiquitous in urban areas, the influence of nearby vegetation on airborne microbial communities remains poorly understood. We examined airborne microbial communities in parks and parking lots in Eugene, Oregon, using high-throughput sequencing of the bacterial 16S rRNA gene on the Illumina MiSeq platform to identify bacterial taxa, and GIS to measure vegetation cover in buffer zones of different diameters. Our goal was to explore variation among highly vegetated (parks) versus non-vegetated (parking lots) urban environments. A secondary objective was to evaluate passive versus active collection methods for outdoor airborne microbial sampling. Airborne bacterial communities from five parks were different from those of five parking lots (p=0.023), although alpha diversity was similar. Direct gradient analysis showed that the proportion of vegetated area within a 50m radius of the sampling station explained 15% of the variation in bacterial community composition. A number of key taxa, including several Acidobacteriaceae were substantially more abundant in parks, while parking lots had higher relative abundance of Acetobacteraceae. Parks had greater beta diversity than parking lots, i.e. individual parks were characterized by unique bacterial signatures, whereas parking lot communities tended to be similar to each other. Although parks and parking lots were selected to form pairs of nearby sites, spatial proximity did not appear to affect compositional similarity. Our results also showed that passive and active collection methods gave comparable results, indicating the "settling dish" method is effective for outdoor airborne sampling. This work sets a foundation for understanding how urban vegetation may impact microbial communities, with potential implications for designing

  10. Detection of bacterial DNA in cerebrospinal fluid by an assay for simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and streptococci using a seminested PCR strategy.

    OpenAIRE

    Rådström, P; Bäckman, A; Qian, N; Kragsbjerg, P; Påhlson, C; Olcén, P

    1994-01-01

    Primers specific to conserved and variable regions in the 16S rRNA sequence were selected from the partially sequenced 16S rRNA genes of Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, S. agalactiae, and Staphylococcus epidermidis. The PCR assay was divided into two DNA amplifications. The first resulted in a general bacterial amplicon, and the second resulted in a species-specific amplicon. The high specificity of the PCR assay was documented after testing bacteria ...

  11. Optimization of ribosome structure and function by rRNA base modification.

    Directory of Open Access Journals (Sweden)

    Jennifer L Baxter-Roshek

    2007-01-01

    Full Text Available Translating mRNA sequences into functional proteins is a fundamental process necessary for the viability of organisms throughout all kingdoms of life. The ribosome carries out this process with a delicate balance between speed and accuracy. This work investigates how ribosome structure and function are affected by rRNA base modification. The prevailing view is that rRNA base modifications serve to fine tune ribosome structure and function.To test this hypothesis, yeast strains deficient in rRNA modifications in the ribosomal peptidyltransferase center were monitored for changes in and translational fidelity. These studies revealed allele-specific sensitivity to translational inhibitors, changes in reading frame maintenance, nonsense suppression and aa-tRNA selection. Ribosomes isolated from two mutants with the most pronounced phenotypic changes had increased affinities for aa-tRNA, and surprisingly, increased rates of peptidyltransfer as monitored by the puromycin assay. rRNA chemical analyses of one of these mutants identified structural changes in five specific bases associated with the ribosomal A-site.Together, the data suggest that modification of these bases fine tune the structure of the A-site region of the large subunit so as to assure correct positioning of critical rRNA bases involved in aa-tRNA accommodation into the PTC, of the eEF-1A.aa-tRNA.GTP ternary complex with the GTPase associated center, and of the aa-tRNA in the A-site. These findings represent a direct demonstration in support of the prevailing hypothesis that rRNA modifications serve to optimize rRNA structure for production of accurate and efficient ribosomes.

  12. Ontogenetic Changes in the Bacterial Symbiont Community of the Tropical Demosponge Amphimedon queenslandica: Metamorphosis Is a New Beginning

    OpenAIRE

    Fieth, Rebecca A.; Gauthier, Marie-Emilie A.; Bayes, Joanne; Green, Kathryn M.; Degnan, Sandie M.

    2016-01-01

    Vertical transmission of bacterial symbionts, which is known in many species of sponge (Porifera), is expected to promote strong fidelity between the partners. Combining 16S rRNA gene amplicon sequencing and electron microscopy, we have assayed the relative abundance of vertically-inherited bacterial symbionts in several stages of the life cycle of Amphimedon queenslandica, a tropical coral reef sponge. We reveal that adult A. queenslandica house a low diversity microbiome dominated by just t...

  13. Intra- and Interspecific Comparisons of Bacterial Diversity and Community Structure Support Coevolution of Gut Microbiota and Termite Host†

    OpenAIRE

    Hongoh, Yuichi; Deevong, Pinsurang; Inoue, Tetsushi; Moriya, Shigeharu; Trakulnaleamsai, Savitr; Ohkuma, Moriya; Vongkaluang, Charunee; Noparatnaraporn, Napavarn; Kudo, Toshiaki

    2005-01-01

    We investigated the bacterial gut microbiota from 32 colonies of wood-feeding termites, comprising four Microcerotermes species (Termitidae) and four Reticulitermes species (Rhinotermitidae), using terminal restriction fragment length polymorphism analysis and clonal analysis of 16S rRNA. The obtained molecular community profiles were compared statistically between individuals, colonies, locations, and species of termites. Both analyses revealed that the bacterial community structure was rema...

  14. 16S rRNA gene sequencing reveals effects of photoperiod on cecal microbiota of broiler roosters

    Directory of Open Access Journals (Sweden)

    Jun Wang

    2018-02-01

    Full Text Available Photoperiod is an important factor in stimulating broiler performance in commercial poultry practice. However, the mechanism by which photoperiod affects the performance of broiler chickens has not been adequately explored. The current study evaluated the effects of three different photoperiod regimes (short day (LD = 8 h light, control (CTR = 12.5 h light, and long day (SD = 16 h light on the cecal microbiota of broiler roosters by sequencing bacterial 16S rRNA genes. At the phylum level, the dominant bacteria were Firmicutes (CTR: 68%, SD: 69%, LD: 67% and Bacteroidetes (CTR: 25%, SD: 26%, and LD: 28%. There was a greater abundance of Proteobacteria (p < 0.01 and Cyanobacteria (p < 0.05 in chickens in the LD group than in those in the CTR group. A significantly greater abundance of Actinobacteria was observed in CTR chickens than in SD and LD chickens (p < 0.01. The abundance of Deferribacteres was significantly higher in LD chickens than in SD chickens (p < 0.01. Fusobacteria and Proteobacteria were more abundant in SD chickens than in CTR and LD chickens. The predicted functional properties indicate that cellular processes may be influenced by photoperiod. Conversely, carbohydrate metabolism was enhanced in CTR chickens as compared to that in SD and LD chickens. The current results indicate that different photoperiod regimes may influence the abundance of specific bacterial populations and then contribute to differences in the functional properties of gut microbiota of broiler roosters.

  15. Prevention of bacterial adhesion

    DEFF Research Database (Denmark)

    Klemm, Per; Vejborg, Rebecca Munk; Hancock, Viktoria

    2010-01-01

    Management of bacterial infections is becoming increasingly difficult due to the emergence and increasing prevalence of bacterial pathogens that are resistant to available antibiotics. Conventional antibiotics generally kill bacteria by interfering with vital cellular functions, an approach...... that imposes selection pressure for resistant bacteria. New approaches are urgently needed. Targeting bacterial virulence functions directly is an attractive alternative. An obvious target is bacterial adhesion. Bacterial adhesion to surfaces is the first step in colonization, invasion, and biofilm formation....... As such, adhesion represents the Achilles heel of crucial pathogenic functions. It follows that interference with adhesion can reduce bacterial virulence. Here, we illustrate this important topic with examples of techniques being developed that can inhibit bacterial adhesion. Some of these will become...

  16. Metamorphosis of a butterfly-associated bacterial community.

    Directory of Open Access Journals (Sweden)

    Tobin J Hammer

    Full Text Available Butterflies are charismatic insects that have long been a focus of biological research. They are also habitats for microorganisms, yet these microbial symbionts are little-studied, despite their likely importance to butterfly ecology and evolution. In particular, the diversity and composition of the microbial communities inhabiting adult butterflies remain uncharacterized, and it is unknown how the larval (caterpillar and adult microbiota compare. To address these knowledge gaps, we used Illumina sequencing of 16S rRNA genes from internal bacterial communities associated with multiple life stages of the neotropical butterfly Heliconius erato. We found that the leaf-chewing larvae and nectar- and pollen-feeding adults of H. erato contain markedly distinct bacterial communities, a pattern presumably rooted in their distinct diets. Larvae and adult butterflies host relatively small and similar numbers of bacterial phylotypes, but few are common to both stages. The larval microbiota clearly simplifies and reorganizes during metamorphosis; thus, structural changes in a butterfly's bacterial community parallel those in its own morphology. We furthermore identify specific bacterial taxa that may mediate larval and adult feeding biology in Heliconius and other butterflies. Although male and female Heliconius adults differ in reproductive physiology and degree of pollen feeding, bacterial communities associated with H. erato are not sexually dimorphic. Lastly, we show that captive and wild individuals host different microbiota, a finding that may have important implications for the relevance of experimental studies using captive butterflies.

  17. Metamorphosis of a butterfly-associated bacterial community.

    Science.gov (United States)

    Hammer, Tobin J; McMillan, W Owen; Fierer, Noah

    2014-01-01

    Butterflies are charismatic insects that have long been a focus of biological research. They are also habitats for microorganisms, yet these microbial symbionts are little-studied, despite their likely importance to butterfly ecology and evolution. In particular, the diversity and composition of the microbial communities inhabiting adult butterflies remain uncharacterized, and it is unknown how the larval (caterpillar) and adult microbiota compare. To address these knowledge gaps, we used Illumina sequencing of 16S rRNA genes from internal bacterial communities associated with multiple life stages of the neotropical butterfly Heliconius erato. We found that the leaf-chewing larvae and nectar- and pollen-feeding adults of H. erato contain markedly distinct bacterial communities, a pattern presumably rooted in their distinct diets. Larvae and adult butterflies host relatively small and similar numbers of bacterial phylotypes, but few are common to both stages. The larval microbiota clearly simplifies and reorganizes during metamorphosis; thus, structural changes in a butterfly's bacterial community parallel those in its own morphology. We furthermore identify specific bacterial taxa that may mediate larval and adult feeding biology in Heliconius and other butterflies. Although male and female Heliconius adults differ in reproductive physiology and degree of pollen feeding, bacterial communities associated with H. erato are not sexually dimorphic. Lastly, we show that captive and wild individuals host different microbiota, a finding that may have important implications for the relevance of experimental studies using captive butterflies.

  18. Mapping and predictive variations of soil bacterial richness across France.

    Directory of Open Access Journals (Sweden)

    Sébastien Terrat

    Full Text Available Although numerous studies have demonstrated the key role of bacterial diversity in soil functions and ecosystem services, little is known about the variations and determinants of such diversity on a nationwide scale. The overall objectives of this study were i to describe the bacterial taxonomic richness variations across France, ii to identify the ecological processes (i.e. selection by the environment and dispersal limitation influencing this distribution, and iii to develop a statistical predictive model of soil bacterial richness. We used the French Soil Quality Monitoring Network (RMQS, which covers all of France with 2,173 sites. The soil bacterial richness (i.e. OTU number was determined by pyrosequencing 16S rRNA genes and related to the soil characteristics, climatic conditions, geomorphology, land use and space. Mapping of bacterial richness revealed a heterogeneous spatial distribution, structured into patches of about 111km, where the main drivers were the soil physico-chemical properties (18% of explained variance, the spatial descriptors (5.25%, 1.89% and 1.02% for the fine, medium and coarse scales, respectively, and the land use (1.4%. Based on these drivers, a predictive model was developed, which allows a good prediction of the bacterial richness (R2adj of 0.56 and provides a reference value for a given pedoclimatic condition.

  19. Mapping and predictive variations of soil bacterial richness across France.

    Science.gov (United States)

    Terrat, Sébastien; Horrigue, Walid; Dequiedt, Samuel; Saby, Nicolas P A; Lelièvre, Mélanie; Nowak, Virginie; Tripied, Julie; Régnier, Tiffanie; Jolivet, Claudy; Arrouays, Dominique; Wincker, Patrick; Cruaud, Corinne; Karimi, Battle; Bispo, Antonio; Maron, Pierre Alain; Chemidlin Prévost-Bouré, Nicolas; Ranjard, Lionel

    2017-01-01

    Although numerous studies have demonstrated the key role of bacterial diversity in soil functions and ecosystem services, little is known about the variations and determinants of such diversity on a nationwide scale. The overall objectives of this study were i) to describe the bacterial taxonomic richness variations across France, ii) to identify the ecological processes (i.e. selection by the environment and dispersal limitation) influencing this distribution, and iii) to develop a statistical predictive model of soil bacterial richness. We used the French Soil Quality Monitoring Network (RMQS), which covers all of France with 2,173 sites. The soil bacterial richness (i.e. OTU number) was determined by pyrosequencing 16S rRNA genes and related to the soil characteristics, climatic conditions, geomorphology, land use and space. Mapping of bacterial richness revealed a heterogeneous spatial distribution, structured into patches of about 111km, where the main drivers were the soil physico-chemical properties (18% of explained variance), the spatial descriptors (5.25%, 1.89% and 1.02% for the fine, medium and coarse scales, respectively), and the land use (1.4%). Based on these drivers, a predictive model was developed, which allows a good prediction of the bacterial richness (R2adj of 0.56) and provides a reference value for a given pedoclimatic condition.

  20. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species

    Science.gov (United States)

    Fogarty, L.R.; Voytek, M.A.

    2005-01-01

    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  1. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  2. The rhizosphere and PAH amendment mediate impacts on functional and structural bacterial diversity in sandy peat soil

    Energy Technology Data Exchange (ETDEWEB)

    Yrjaelae, Kim, E-mail: kim.yrjala@helsinki.f [Department of Biological and Environmental Sciences, General Microbiology, University of Helsinki, P.O. Box 56, (Biocenter 1C), 00014 Helsinki (Finland); Keskinen, Anna-Kaisa; Akerman, Marja-Leena; Fortelius, Carola [METROPOLIA University of Applied Science, Vantaa (Finland); Sipilae, Timo P. [Department of Biological and Environmental Sciences, General Microbiology, University of Helsinki, P.O. Box 56, (Biocenter 1C), 00014 Helsinki (Finland)

    2010-05-15

    To reveal the degradation capacity of bacteria in PAH polluted soil and rhizosphere we combined bacterial extradiol ring-cleavage dioxygenase and 16S rRNA analysis in Betula pubescens rhizoremediation. Characterisation of the functional bacterial community by RFLP revealed novel environmental dioxygenases, and their putative hosts were studied by 16S rRNA amplification. Plant rhizosphere and PAH amendment effects were detected by the RFLP/T-RFLP analysis. Functional species richness increased in the birch rhizosphere and PAH amendment impacted the compositional diversity of the dioxygenases and the structural 16S rRNA community. A shift from an Acidobacteria and Verrucomicrobia dominated to an Alpha- and Betaproteobacteria dominated community structure was detected in polluted soil. Clone sequence analysis indicated catabolic significance of Burkholderia in PAH polluted soil. These results advance our understanding of rhizoremediation and unveil the extent of uncharacterized functional bacteria to benefit bioremediation by facilitating the development of the molecular tool box to monitor bacterial populations in biodegradation. - The bacterial community analysis using 16S rRNA and extradiol dioxygenase marker genes in rhizoremediation revealed both a rhizosphere and a PAH-pollution effect.

  3. Simultaneous determination of gene expression and bacterial identity in single cells in defined mixtures of pure cultures

    DEFF Research Database (Denmark)

    Poulsen, Lars K.; Dalton, Helen M.; Angels, Mark

    1997-01-01

    A protocol was developed to achieve the simultaneous determination of gene expression and bacterial identity at the level of single cells: a chromogenic beta-galactosidase activity assay was combined with in situ hybridization of Fluorescently labelled oligonucleotide probes to rRNA. The method...... allows monitoring of gene expression and quantification of beta-galactosidase activity in single cells....

  4. Composition of the bacterial community in the gut of the pine engraver, Ips pini (Say) (Coloptera) colonizing red pine

    Science.gov (United States)

    Italo Jr. Delalibera; Archana Vasanthakumar; Benjamin J. Burwitz; Patrick D. Schloss; Kier D. Klepzig; Jo Handelsman; Kenneth F. Raffa

    2007-01-01

    The gut bacterial community of a bark beetle, the pine engraver Ips pini (Say), was characterized using culture-dependent and culture-independent methods. Bacteria from individual guts of larvae, pupae and adults were cultured and DNA was extracted from samples of pooled larval guts. Analysis of 16S rRNA gene sequences amplified directly from the gut...

  5. The rhizosphere and PAH amendment mediate impacts on functional and structural bacterial diversity in sandy peat soil

    International Nuclear Information System (INIS)

    Yrjaelae, Kim; Keskinen, Anna-Kaisa; Akerman, Marja-Leena; Fortelius, Carola; Sipilae, Timo P.

    2010-01-01

    To reveal the degradation capacity of bacteria in PAH polluted soil and rhizosphere we combined bacterial extradiol ring-cleavage dioxygenase and 16S rRNA analysis in Betula pubescens rhizoremediation. Characterisation of the functional bacterial community by RFLP revealed novel environmental dioxygenases, and their putative hosts were studied by 16S rRNA amplification. Plant rhizosphere and PAH amendment effects were detected by the RFLP/T-RFLP analysis. Functional species richness increased in the birch rhizosphere and PAH amendment impacted the compositional diversity of the dioxygenases and the structural 16S rRNA community. A shift from an Acidobacteria and Verrucomicrobia dominated to an Alpha- and Betaproteobacteria dominated community structure was detected in polluted soil. Clone sequence analysis indicated catabolic significance of Burkholderia in PAH polluted soil. These results advance our understanding of rhizoremediation and unveil the extent of uncharacterized functional bacteria to benefit bioremediation by facilitating the development of the molecular tool box to monitor bacterial populations in biodegradation. - The bacterial community analysis using 16S rRNA and extradiol dioxygenase marker genes in rhizoremediation revealed both a rhizosphere and a PAH-pollution effect.

  6. Modulation of 16S rRNA function by ribosomal protein S12.

    Science.gov (United States)

    Vila-Sanjurjo, Anton; Lu, Ying; Aragonez, Jamie L; Starkweather, Rebekah E; Sasikumar, Manoj; O'Connor, Michael

    2007-01-01

    Ribosomal protein S12 is a critical component of the decoding center of the 30S ribosomal subunit and is involved in both tRNA selection and the response to streptomycin. We have investigated the interplay between S12 and some of the surrounding 16S rRNA residues by examining the phenotypes of double-mutant ribosomes in strains of Escherichia coli carrying deletions in all chromosomal rrn operons and expressing total rRNA from a single plasmid-borne rrn operon. We show that the combination of S12 and otherwise benign mutations at positions C1409-G1491 in 16S rRNA severely compromises cell growth while the level and range of aminoglycoside resistances conferred by the G1491U/C substitutions is markedly increased by a mutant S12 protein. The G1491U/C mutations in addition confer resistance to the unrelated antibiotic, capreomycin. S12 also interacts with the 912 region of 16S rRNA. Genetic selection of suppressors of streptomycin dependence caused by mutations at proline 90 in S12 yielded a C912U substitution in 16S rRNA. The C912U mutation on its own confers resistance to streptomycin and restricts miscoding, properties that distinguish it from a majority of the previously described error-promoting ram mutants that also reverse streptomycin dependence.

  7. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  8. Community analysis of picocyanobacteria in an oligotrophic lake by cloning 16S rRNA gene and 16S rRNA gene amplicon sequencing.

    Science.gov (United States)

    Fujimoto, Naoshi; Mizuno, Keigo; Yokoyama, Tomoki; Ohnishi, Akihiro; Suzuki, Masaharu; Watanabe, Satoru; Komatsu, Kenji; Sakata, Yoichi; Kishida, Naohiro; Akiba, Michihiro; Matsukura, Satoko

    2015-01-01

    In this study, the picocyanobacterial species composition of Lake Miyagase was examined by analyzing the 16S rRNA gene in a clone library and by amplicon sequencing using a benchtop next-generation sequencer. Five separate samples were analyzed from different days over a ten-month period. In the picocyanobacterial lineage, 9 and 12 OTUs were identified from a clone library and by amplicon sequencing, respectively. Both analyses suggested that a picocyanobacterium related to Synechococcus sp. MW6B4 was dominant in Lake Miyagase. Our findings suggest that 16S rRNA gene amplicon sequencing enables detailed evaluation of picocyanobacteria composition. One OTU identified was found to be a novel cluster that does not group with any of the known freshwater picocyanobacteria.

  9. Changes in Soil Bacterial Communities and Diversity in ...

    Science.gov (United States)

    Silver-induced selective pressure is becoming increasingly important due to the growing use of silver (Ag) as an antimicrobial agent in biomedical and commercial products. With demonstrated links between environmental resistomes and clinical pathogens, it is important to identify microbial profiles related to silver tolerance/resistance. We investigated the effects of ionic Ag stress on soil bacterial communities and identified resistant/persistant bacterial populations. Silver treatments of 50 - 400 mg Ag kg-1 soil were established in five soils. Chemical lability measurements using diffusive gradients in thin-film devices confirmed that significant (albeit decreasing) labile Ag concentrations were present throughout the 9-month incubation period. Synchrotron X-ray absorption near edge structure spectroscopy demonstrate that this decreasing lability was due to changes in Ag speciation to less soluble forms such as Ag0 and Ag2S. Real-time PCR and Illumina MiSeq screening of 16S rRNA bacterial genes showed β-diversity in response to Ag pressure, and immediate and significant reductions in 16S rRNA gene counts with varying degrees of recovery. These effects were more strongly influenced by exposure time than by Ag dose at these rates. Ag-selected dominant OTUs principally resided in known persister taxa (mainly Gram positive), including metal-tolerant bacteria and slow-growing Mycobacteria. Soil microbial communities have been implicated as sources of an

  10. Comparative Genetic Diversity of the narG, nosZ, and 16S rRNA Genes in Fluorescent Pseudomonads

    Science.gov (United States)

    Delorme, Sandrine; Philippot, Laurent; Edel-Hermann, Veronique; Deulvot, Chrystel; Mougel, Christophe; Lemanceau, Philippe

    2003-01-01

    The diversity of the membrane-bound nitrate reductase (narG) and nitrous oxide reductase (nosZ) genes in fluorescent pseudomonads isolated from soil and rhizosphere environments was characterized together with that of the 16S rRNA gene by a PCR-restriction fragment length polymorphism assay. Fragments of 1,008 bp and 1,433 bp were amplified via PCR with primers specific for the narG and nosZ genes, respectively. The presence of the narG and nosZ genes in the bacterial strains was confirmed by hybridization of the genomic DNA and the PCR products with the corresponding probes. The ability of the strains to either reduce nitrate or totally dissimilate nitrogen was assessed. Overall, there was a good correspondence between the reductase activities and the presence of the corresponding genes. Distribution in the different ribotypes of strains harboring both the narG and nosZ genes and of strains missing both genes suggests that these two groups of strains had different evolutionary histories. Both dissimilatory genes showed high polymorphism, with similarity indexes (Jaccard) of between 0.04 and 0.8, whereas those of the 16S rRNA gene only varied from 0.77 to 0.99. No correlation between the similarity indexes of 16S rRNA and dissimilatory genes was seen, suggesting that the evolution rates of ribosomal and functional genes differ. Pairwise comparison of similarity indexes of the narG and nosZ genes led to the delineation of two types of strains. Within the first type, the similarity indexes of both genes varied in the same range, suggesting that these two genes have followed a similar evolution. Within the second type of strain, the range of variations was higher for the nosZ than for the narG gene, suggesting that these genes have had a different evolutionary rate. PMID:12571023

  11. Loss of a conserved 7-methylguanosine modification in 16S rRNA confers low-level streptomycin resistance in bacteria.

    Science.gov (United States)

    Okamoto, Susumu; Tamaru, Aki; Nakajima, Chie; Nishimura, Kenji; Tanaka, Yukinori; Tokuyama, Shinji; Suzuki, Yasuhiko; Ochi, Kozo

    2007-02-01

    Streptomycin has been an important drug for the treatment of tuberculosis since its discovery in 1944. But numerous strains of Mycobacterium tuberculosis, the bacterial pathogen that causes tuberculosis, are now streptomycin resistant. Although such resistance is often mediated by mutations within rrs, a 16S rRNA gene or rpsL, which encodes the ribosomal protein S12, these mutations are found in a limited proportion of clinically isolated streptomycin-resistant M. tuberculosis strains. Here we have succeeded in identifying a mutation that confers low-level streptomycin resistance to bacteria, including M. tuberculosis. We found that mutations within the gene gidB confer low-level streptomycin resistance and are an important cause of resistance found in 33% of resistant M. tuberculosis isolates. We further clarified that the gidB gene encodes a conserved 7-methylguanosine (m(7)G) methyltransferase specific for the 16S rRNA, apparently at position G527 located in the so-called 530 loop. Thus, we have identified gidB as a new streptomycin-resistance locus and uncovered a resistance mechanism that is mediated by loss of a conserved m(7)G modification in 16S rRNA. The clinical significance of M. tuberculosis gidB mutation also is noteworthy, as gidB mutations emerge spontaneously at a high frequency of 10(-6) and, once emerged, result in vigorous emergence of high-level streptomycin-resistant mutants at a frequency more than 2000 times greater than that seen in wild-type strains. Further studies on the precise function of GidB may provide a basis for developing strategies to suppress pathogenic bacteria, including M. tuberculosis.

  12. Indigenous and spoilage microbiota of farmed sea bream stored in ice identified by phenotypic and 16S rRNA gene analysis.

    Science.gov (United States)

    Parlapani, F F; Meziti, A; Kormas, K Ar; Boziaris, I S

    2013-02-01

    Investigation of the initial and spoilage microbial diversity of iced stored sea bream was carried out. Culture dependent methods were used for bacterial enumeration and phenotypic identification of bacterial isolates, while culture independent methods, using bacterial 16S rRNA gene amplification, cloning and sequencing of DNA extracted directly from the flesh were also employed. The culture dependent approach revealed that the initial microbiota was dominated by Acinetobacter, Shewanella, Pseudomonas and Flavobacterium, while at the end of shelf-life determined by sensory analysis (16 days), the predominant microbiota was Pseudomonas and Shewanella. Culture independent approach showed that initially the sea bream flesh was strongly dominated by Acinetobacter, while Pseudomonas, Aeromonas salmonicida and Shewanella were the predominant phylotypes at the end of shelf-life. Initial and spoilage microbiota comprised of phylotypes previously identified by others using traditional or molecular techniques. However, Aeromonas has not been reported as part of the dominant microbiota of sea bream at the time of spoilage. Combination of classical and molecular methodologies better reveals the microbiota during storage by revealing bacteria that escape standard approaches and, thus, provides valuable complementary information regarding microbiological spoilage. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Sequence organization of the Acanthamoeba rRNA intergenic spacer: identification of transcriptional enhancers.

    Science.gov (United States)

    Yang, Q; Zwick, M G; Paule, M R

    1994-01-01

    The primary sequence of the entire 2330 bp intergenic spacer of the A.castellanii ribosomal RNA gene was determined. Repeated sequence elements averaging 140 bp were identified and found to bind a protein required for optimum initiation at the core promoter. These repeated elements were shown to stimulate rRNA transcription by RNA polymerase I in vitro. The repeats inhibited transcription when placed in trans, and stimulated transcription when in cis, in either orientation, but only when upstream of the core promoter. Thus, these repeated elements have characteristics similar to polymerase I enhancers found in higher eukaryotes. The number of rRNA repeats in Acanthamoeba cells was determined to be 24 per haploid genome, the lowest number so far identified in any eukaryote. However, because Acanthamoeba is polyploid, each cell contains approximately 600 rRNA genes. Images PMID:7984432

  14. Microbial dynamics during harmful dinoflagellate Ostreopsis cf. ovata growth: Bacterial succession and viral abundance pattern.

    Science.gov (United States)

    Guidi, Flavio; Pezzolesi, Laura; Vanucci, Silvana

    2018-02-27

    Algal-bacterial interactions play a major role in shaping diversity of algal associated bacterial communities. Temporal variation in bacterial phylogenetic composition reflects changes of these complex interactions which occur during the algal growth cycle as well as throughout the lifetime of algal blooms. Viruses are also known to cause shifts in bacterial community diversity which could affect algal bloom phases. This study investigated on changes of bacterial and viral abundances, bacterial physiological status, and on bacterial successional pattern associated with the harmful benthic dinoflagellate Ostreopsis cf. ovata in batch cultures over the algal growth cycle. Bacterial community phylogenetic structure was assessed by 16S rRNA gene ION torrent sequencing. A comparison between bacterial community retrieved in cultures and that one co-occurring in situ during the development of the O. cf. ovata bloom from where the algal strain was isolated was also reported. Bacterial community growth was characterized by a biphasic pattern with the highest contributions (~60%) of highly active bacteria found at the two bacterial exponential growth steps. An alphaproteobacterial consortium composed by the Rhodobacteraceae Dinoroseobacter (22.2%-35.4%) and Roseovarius (5.7%-18.3%), together with Oceanicaulis (14.2-40.3%), was strongly associated with O. cf. ovata over the algal growth. The Rhodobacteraceae members encompassed phylotypes with an assessed mutualistic-pathogenic bimodal behavior. Fabibacter (0.7%-25.2%), Labrenzia (5.6%-24.3%), and Dietzia (0.04%-1.7%) were relevant at the stationary phase. Overall, the successional pattern and the metabolic and functional traits of the bacterial community retrieved in culture mirror those ones underpinning O. cf. ovata bloom dynamics in field. Viral abundances increased synoptically with bacterial abundances during the first bacterial exponential growth step while being stationary during the second step. Microbial trends

  15. Status of the Archaeal and Bacterial Census: an Update

    Science.gov (United States)

    Girard, Rene A.; Martin, Thomas; Edwards, Joshua

    2016-01-01

    ABSTRACT A census is typically carried out for people across a range of geographical levels; however, microbial ecologists have implemented a molecular census of bacteria and archaea by sequencing their 16S rRNA genes. We assessed how well the census of full-length 16S rRNA gene sequences is proceeding in the context of recent advances in high-throughput sequencing technologies because full-length sequences are typically used as references for classification of the short sequences generated by newer technologies. Among the 1,411,234 and 53,546 full-length bacterial and archaeal sequences, 94.5% and 95.1% of the bacterial and archaeal sequences, respectively, belonged to operational taxonomic units (OTUs) that have been observed more than once. Although these metrics suggest that the census is approaching completion, 29.2% of the bacterial and 38.5% of the archaeal OTUs have been observed more than once. Thus, there is still considerable diversity to be explored. Unfortunately, the rate of new full-length sequences has been declining, and new sequences are primarily being deposited by a small number of studies. Furthermore, sequences from soil and aquatic environments, which are known to be rich in bacterial diversity, represent only 7.8 and 16.5% of the census, while sequences associated with host-associated environments represent 55.0% of the census. Continued use of traditional approaches and new technologies such as single-cell genomics and short-read assembly are likely to improve our ability to sample rare OTUs if it is possible to overcome this sampling bias. The success of ongoing efforts to use short-read sequencing to characterize archaeal and bacterial communities requires that researchers strive to expand the depth and breadth of this census. PMID:27190214

  16. Status of the Archaeal and Bacterial Census: an Update

    Directory of Open Access Journals (Sweden)

    Patrick D. Schloss

    2016-05-01

    Full Text Available A census is typically carried out for people across a range of geographical levels; however, microbial ecologists have implemented a molecular census of bacteria and archaea by sequencing their 16S rRNA genes. We assessed how well the census of full-length 16S rRNA gene sequences is proceeding in the context of recent advances in high-throughput sequencing technologies because full-length sequences are typically used as references for classification of the short sequences generated by newer technologies. Among the 1,411,234 and 53,546 full-length bacterial and archaeal sequences, 94.5% and 95.1% of the bacterial and archaeal sequences, respectively, belonged to operational taxonomic units (OTUs that have been observed more than once. Although these metrics suggest that the census is approaching completion, 29.2% of the bacterial and 38.5% of the archaeal OTUs have been observed more than once. Thus, there is still considerable diversity to be explored. Unfortunately, the rate of new full-length sequences has been declining, and new sequences are primarily being deposited by a small number of studies. Furthermore, sequences from soil and aquatic environments, which are known to be rich in bacterial diversity, represent only 7.8 and 16.5% of the census, while sequences associated with host-associated environments represent 55.0% of the census. Continued use of traditional approaches and new technologies such as single-cell genomics and short-read assembly are likely to improve our ability to sample rare OTUs if it is possible to overcome this sampling bias. The success of ongoing efforts to use short-read sequencing to characterize archaeal and bacterial communities requires that researchers strive to expand the depth and breadth of this census.

  17. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Directory of Open Access Journals (Sweden)

    Susan M Huse

    2008-11-01

    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  18. 16S rRNA gene sequencing of mock microbial populations- impact of DNA extraction method, primer choice and sequencing platform.

    Science.gov (United States)

    Fouhy, Fiona; Clooney, Adam G; Stanton, Catherine; Claesson, Marcus J; Cotter, Paul D

    2016-06-24

    Next-generation sequencing platforms have revolutionised our ability to investigate the microbiota composition of complex environments, frequently through 16S rRNA gene sequencing of the bacterial component of the community. Numerous factors, including DNA extraction method, primer sequences and sequencing platform employed, can affect the accuracy of the results achieved. The aim of this study was to determine the impact of these three factors on 16S rRNA gene sequencing results, using mock communities and mock community DNA. The use of different primer sequences (V4-V5, V1-V2 and V1-V2 degenerate primers) resulted in differences in the genera and species detected. The V4-V5 primers gave the most comparable results across platforms. The three Ion PGM primer sets detected more of the 20 mock community species than the equivalent MiSeq primer sets. Data generated from DNA extracted using the 2 extraction methods were very similar. Microbiota compositional data differed depending on the primers and sequencing platform that were used. The results demonstrate the risks in comparing data generated using different sequencing approaches and highlight the merits of choosing a standardised approach for sequencing in situations where a comparison across multiple sequencing runs is required.

  19. Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

    Science.gov (United States)

    Wei, Yulong; Silke, Jordan R; Xia, Xuhua

    2017-12-15

    Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

  20. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR.

    Science.gov (United States)

    Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J

    2016-06-11

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

  1. Phylogenetic diversity and dietary association of rumen Treponema revealed using group-specific 16S rRNA gene-based analysis.

    Science.gov (United States)

    Bekele, Aschalew Z; Koike, Satoshi; Kobayashi, Yasuo

    2011-03-01

    Treponema spp. are a commonly detected bacterial group in the rumen that are involved in the degradation of soluble fibers. In this study, a ruminal Treponema group-specific PCR primer targeting the 16S rRNA gene was designed and used to assess the phylogenetic diversity and diet association of this group in sheep rumen. Total DNA was extracted from rumen digesta of three sheep fed a diet based on alfalfa/orchardgrass hay or concentrate. The real-time PCR quantification indicated that the relative abundance of the Treponema group in the total rumen bacteria was as high as 1.05%, while the known species Treponema bryantii accounted for only 0.02%. Fingerprints of the Treponema community determined by 16S rDNA-targeted denaturing gradient gel electrophoresis (DGGE) analysis tended to differ among the diets. Principal component analysis of the DGGE profiles distinguished those Treponema associated with either the hay or the concentrate diets. Analysis of a Treponema 16S rRNA gene clone library showed phylogenetically distinct operational taxonomic units for a specific dietary condition, and significant (P=0.001) differences in community composition were observed among clone libraries constructed from each dietary regimen. The majority of clones (75.4%) had Treponema. These results suggest the predominance of uncultured Treponema that appear to have distinct members related to the digestion of either hay or concentrate diet. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  2. Mineral composition and charcoal determine the bacterial community structure in artificial soils.

    Science.gov (United States)

    Ding, Guo-Chun; Pronk, Geertje Johanna; Babin, Doreen; Heuer, Holger; Heister, Katja; Kögel-Knabner, Ingrid; Smalla, Kornelia

    2013-10-01

    To study the influence of the clay minerals montmorillonite (M) and illite (I), the metal oxides ferrihydrite (F) and aluminum hydroxide (A), and charcoal (C) on soil bacterial communities, seven artificial soils with identical texture provided by quartz (Q) were mixed with sterilized manure as organic carbon source before adding a microbial inoculant derived from a Cambisol. Bacterial communities established in artificial soils after 90 days of incubation were compared by DGGE analysis of bacterial and taxon-specific 16S rRNA gene amplicons. The bacterial community structure of charcoal-containing soils highly differed from the other soils at all taxonomic levels studied. Effects of montmorillonite and illite were observed for Bacteria and Betaproteobacteria, but not for Actinobacteria or Alphaproteobacteria. A weak influence of metal oxides on Betaproteobacteria was found. Barcoded pyrosequencing of 16S rRNA gene amplicons done for QM, QI, QIF, and QMC revealed a high bacterial diversity in the artificial soils. The composition of the artificial soils was different from the inoculant, and the structure of the bacterial communities established in QMC soil was most different from the other soils, suggesting that charcoal provided distinct microenvironments and biogeochemical interfaces formed. Several populations with discriminative relative abundance between artificial soils were identified. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. Acclimation of Culturable Bacterial Communities under the Stresses of Different Organic Compounds

    Science.gov (United States)

    Wang, Hui; Zhang, Shuangfei; Pratush, Amit; Ye, Xueying; Xie, Jinli; Wei, Huan; Sun, Chongran; Hu, Zhong

    2018-01-01

    The phylogenetic diversity of bacterial communities in response to environmental disturbances such as organic pollution has been well studied, but little is known about the way in which organic contaminants influence the acclimation of functional bacteria. In the present study, tolerance assays for bacterial communities from the sediment in the Pearl River Estuary were conducted with the isolation of functional bacteria using pyrene and different estrogens as environmental stressors. Molecular ecological networks and phylogenetic trees were constructed using both 16S rRNA gene sequences of cultured bacterial strains and 16S rRNA gene-based pyrosequencing data to illustrate the successions of bacterial communities and their acclimations to the different organic compounds. A total of 111 bacterial strains exhibiting degradation and endurance capabilities in response to the pyrene estrogen-induced stress were successfully isolated and were mainly affiliated with three orders, Pseudomonadales, Vibrionales, and Rhodobacterales. Molecular ecological networks and phylogenetic trees showed various adaptive abilities of bacteria to the different organic compounds. For instance, some bacterial OTUs could be found only in particular organic compound-treated groups while some other OTUs could tolerate stresses from different organic compounds. Furthermore, the results indicated that some new phylotypes were emerged under stresses of different organic pollutions and these new phylotypes could adapt to the contaminated environments and contribute significantly to the microbial community shifts. Overall, this study demonstrated a crucial role of the community succession and the acclimation of functional bacteria in the adaptive responses to various environmental disturbances. PMID:29520254

  4. Impacts of poultry house environment on poultry litter bacterial community composition.

    Science.gov (United States)

    Dumas, Michael D; Polson, Shawn W; Ritter, Don; Ravel, Jacques; Gelb, Jack; Morgan, Robin; Wommack, K Eric

    2011-01-01

    Viral and bacterial pathogens are a significant economic concern to the US broiler industry and the ecological epicenter for poultry pathogens is the mixture of bedding material, chicken excrement and feathers that comprises the litter of a poultry house. This study used high-throughput sequencing to assess the richness and diversity of poultry litter bacterial communities, and to look for connections between these communities and the environmental characteristics of a poultry house including its history of gangrenous dermatitis (GD). Cluster analysis of 16S rRNA gene sequences revealed differences in the distribution of bacterial phylotypes between Wet and Dry litter samples and between houses. Wet litter contained greater diversity with 90% of total bacterial abundance occurring within the top 214 OTU clusters. In contrast, only 50 clusters accounted for 90% of Dry litter bacterial abundance. The sixth largest OTU cluster across all samples classified as an Arcobacter sp., an emerging human pathogen, occurring in only the Wet litter samples of a house with a modern evaporative cooling system. Ironically, the primary pathogenic clostridial and staphylococcal species associated with GD were not found in any house; however, there were thirteen 16S rRNA gene phylotypes of mostly gram-positive phyla that were unique to GD-affected houses and primarily occurred in Wet litter samples. Overall, the poultry house environment appeared to substantially impact the composition of litter bacterial communities and may play a key role in the emergence of food-borne pathogens.

  5. Studying bacterial multispecies biofilms

    DEFF Research Database (Denmark)

    Røder, Henriette Lyng; Sørensen, Søren Johannes; Burmølle, Mette

    2016-01-01

    , but the identity and significance of interspecies bacterial interactions is neglected in these analyses. There is therefore an urgent need for bridging the gap between metagenomic analysis and in vitro models suitable for studies of bacterial interactions.Bacterial interactions and coadaptation are important......The high prevalence and significance of multispecies biofilms have now been demonstrated in various bacterial habitats with medical, industrial, and ecological relevance. It is highly evident that several species of bacteria coexist and interact in biofilms, which highlights the need for evaluating...

  6. A two-step species-specific 16S rRNA PCR assay for the detection of Taylorella equigenitalis in horses.

    Science.gov (United States)

    Buckley, Thomas C; Millar, B Cherie; Egan, Claire L; Gibson, Paula; Cosgrove, Hazel; Stanbridge, Siobhan; Matsuda, Motoo; Moore, John E

    2005-03-01

    : A two-step PCR assay was developed for the molecular detection of Taylorella equigenitalis, a Gram-negative genital bacterial pathogen in horses. Two specific oligonucleotide primers (TE16SrRNABCHf [25mer] and TE16SrRNABCHr [29mer]) were designed from multiple alignments of the 16S rRNA gene loci of several closely related taxa, including T. asinigenitalis. Subsequent enhanced surveillance of 250 Thoroughbred animals failed to detect the presence of this organism directly from clinical swabs taken from the genital tract of mares and stallions. Such a molecular approach offers a sensitive and specific alternative to conventional culture techniques, and has the potential to lead to improved diagnosis and subsequent management of horses involved in breeding programmes.

  7. A two-step species-specific 16S rRNA PCR assay for the detection of Taylorella equigenitalis in horses

    Directory of Open Access Journals (Sweden)

    Buckley Thomas C

    2005-03-01

    Full Text Available A two-step PCR assay was developed for the molecular detection of Taylorella equigenitalis, a Gram-negative genital bacterial pathogen in horses. Two specific oligonucleotide primers (TE16SrRNABCHf [25mer] and TE16SrRNABCHr [29mer] were designed from multiple alignments of the 16S rRNA gene loci of several closely related taxa, including T. asinigenitalis. Subsequent enhanced surveillance of 250 Thoroughbred animals failed to detect the presence of this organism directly from clinical swabs taken from the genital tract of mares and stallions. Such a molecular approach offers a sensitive and specific alternative to conventional culture techniques, and has the potential to lead to improved diagnosis and subsequent management of horses involved in breeding programmes.

  8. Diagnosis and follow-up of Whipple's disease by amplification of the 16S rRNA gene of Tropheryma whippelii.

    Science.gov (United States)

    Pron, B; Poyart, C; Abachin, E; Fest, T; Belanger, C; Bonnet, C; Capelle, P; Bretagne, J F; Fabianek, A; Girard, L; Hagège, H; Berche, P

    1999-01-01

    Amplification of the 16S rRNA gene of Tropheryma whippelii was performed in eight patients with Whipple's disease and 34 control patients to confirm a diagnosis of Whipple's disease and to monitor the course of disease. Polymerase chain reaction (PCR) tests were positive before treatment in 13 of 15 tissue samples from Whipple's disease patients (gut 8/8; lymph nodes 2/2; bone marrow 1/2; peripheral blood 2/3), in contrast to none of 54 tissue samples from controls. PCR tests converted to negative within 4-6 months in six of the Whipple's disease patients undergoing therapy. These results show that PCR is a reliable and useful tool for diagnosis of Whipple's disease and for monitoring bacterial elimination during antibiotic therapy.

  9. Large-scale benchmarking reveals false discoveries and count transformation sensitivity in 16S rRNA gene amplicon data analysis methods used in microbiome studies

    DEFF Research Database (Denmark)

    Thorsen, Jonathan; Brejnrod, Asker Daniel; Mortensen, Martin Steen

    2016-01-01

    detection power. For beta-diversity-based sample separation, we show that library size normalization has very little effect and that the distance metric is the most important factor in terms of separation power. CONCLUSIONS: Our results, generalizable to datasets from different sequencing platforms......, demonstrate how the choice of method considerably affects analysis outcome. Here, we give recommendations for tools that exhibit low false positive rates, have good retrieval power across effect sizes and case/control proportions, and have low sparsity bias. Result output from some commonly used methods......BACKGROUND: There is an immense scientific interest in the human microbiome and its effects on human physiology, health, and disease. A common approach for examining bacterial communities is high-throughput sequencing of 16S rRNA gene hypervariable regions, aggregating sequence-similar amplicons...

  10. Events during eucaryotic rRNA transcription initiation and elongation: Conversion from the closed to the open promoter complex requires nucleotide substrates

    Energy Technology Data Exchange (ETDEWEB)

    Bateman, E.; Paule, M.R.

    1988-05-01

    Chemical footprinting and topological analysis were carried out on the Acanthamoeba castellanii rRNA transcription initiation factor (TIF) and RNA polymerase I complexes with DNA during transcription initiation and elongation. The results show that the binding of TIF and polymerase to the promoter does not alter the supercoiling of the DNA template and the template does not become sensitive to modification by diethylpyro-carbonate, which can identify melted DNA regions. Thus, in contrast to bacterial RNA polymerase, the eucaryotic RNA polymerase I-promoter complex is in a closed configuration preceding addition of nucleotides in vitro. Initiation and 3'-O-methyl CTP-limited translocation by RNA polymerase I results in separation of the polymerase-TIF footprints, leaving the TIF footprint unaltered. In contrast, initiation and translocation result in a significant change in the conformation of the polymerase-DNA complex, culminating in an unwound DNA region of at least 10 base pairs.

  11. Bacterial community structure and predicted alginate metabolic pathway in an alginate-degrading bacterial consortium.

    Science.gov (United States)

    Kita, Akihisa; Miura, Toyokazu; Kawata, Satoshi; Yamaguchi, Takeshi; Okamura, Yoshiko; Aki, Tsunehiro; Matsumura, Yukihiko; Tajima, Takahisa; Kato, Junichi; Nishio, Naomichi; Nakashimada, Yutaka

    2016-03-01

    Methane fermentation is one of the effective approaches for utilization of brown algae; however, this process is limited by the microbial capability to degrade alginate, a main polysaccharide found in these algae. Despite its potential, little is known about anaerobic microbial degradation of alginate. Here we constructed a bacterial consortium able to anaerobically degrade alginate. Taxonomic classification of 16S rRNA gene, based on high-throughput sequencing data, revealed that this consortium included two dominant strains, designated HUA-1 and HUA-2; these strains were related to Clostridiaceae bacterium SK082 (99%) and Dysgonomonas capnocytophagoides (95%), respectively. Alginate lyase activity and metagenomic analyses, based on high-throughput sequencing data, revealed that this bacterial consortium possessed putative genes related to a predicted alginate metabolic pathway. However, HUA-1 and 2 did not grow on agar medium with alginate by using roll-tube method, suggesting the existence of bacterial interactions like symbiosis for anaerobic alginate degradation. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Exposing the Three-Dimensional Biogeography and Metabolic States of Pathogens in Cystic Fibrosis Sputum via Hydrogel Embedding, Clearing, and rRNA Labeling

    Directory of Open Access Journals (Sweden)

    William H. DePas

    2016-09-01

    Full Text Available Physiological resistance to antibiotics confounds the treatment of many chronic bacterial infections, motivating researchers to identify novel therapeutic approaches. To do this effectively, an understanding of how microbes survive in vivo is needed. Though much can be inferred from bulk approaches to characterizing complex environments, essential information can be lost if spatial organization is not preserved. Here, we introduce a tissue-clearing technique, termed MiPACT, designed to retain and visualize bacteria with associated proteins and nucleic acids in situ on various spatial scales. By coupling MiPACT with hybridization chain reaction (HCR to detect rRNA in sputum samples from cystic fibrosis (CF patients, we demonstrate its ability to survey thousands of bacteria (or bacterial aggregates over millimeter scales and quantify aggregation of individual species in polymicrobial communities. By analyzing aggregation patterns of four prominent CF pathogens, Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus sp., and Achromobacter xylosoxidans, we demonstrate a spectrum of aggregation states: from mostly single cells (A. xylosoxidans, to medium-sized clusters (S. aureus, to a mixture of single cells and large aggregates (P. aeruginosa and Streptococcus sp.. Furthermore, MiPACT-HCR revealed an intimate interaction between Streptococcus sp. and specific host cells. Lastly, by comparing standard rRNA fluorescence in situ hybridization signals to those from HCR, we found that different populations of S. aureus and A. xylosoxidans grow slowly overall yet exhibit growth rate heterogeneity over hundreds of microns. These results demonstrate the utility of MiPACT-HCR to directly capture the spatial organization and metabolic activity of bacteria in complex systems, such as human sputum.

  13. Explorative Multivariate Analyses of 16S rRNA Gene Data from Microbial Communities in Modified-Atmosphere-Packed Salmon and Coalfish

    Science.gov (United States)

    Rudi, Knut; Maugesten, Tove; Hannevik, Sigrun E.; Nissen, Hilde

    2004-01-01

    Modified-atmosphere packaging (MAP) of foods in combination with low-temperature storage extends product shelf life by limiting microbial growth. We investigated the microbial biodiversity of MAP salmon and coalfish by using an explorative approach and analyzing both the total amounts of bacteria and the microbial group composition (both aerobic and anaerobic bacteria). Real-time PCR analyses revealed a surprisingly large difference in the microbial loads for the different fish samples. The microbial composition was determined by examining partial 16S rRNA gene sequences from 180 bacterial isolates, as well as by performing terminal restriction fragment length polymorphism analysis and cloning 92 sequences from PCR products of DNA directly retrieved from the fish matrix. Twenty different bacterial groups were identified. Partial least-squares (PLS) regression was used to relate the major groups of bacteria identified to the fish matrix and storage time. A strong association of coalfish with Photobacterium phosphoreum was observed. Brochothrix spp. and Carnobacterium spp., on the other hand, were associated with salmon. These bacteria dominated the fish matrixes after a storage period. Twelve Carnobacterium isolates were identified as either Carnobacterium piscicola (five isolates) or Carnobacterium divergens (seven isolates), while the eight Brochothrix isolates were identified as Brochothrix thermosphacta by full-length 16S rRNA gene sequencing. Principal-component analyses and PLS analysis of the growth characteristics (with 49 different substrates) showed that C. piscicola had distinct substrate requirements, while the requirements of B. thermosphacta and C. piscicola were quite divergent. In conclusion, our explorative multivariate approach gave a picture of the total microbial biodiversity in MAP fish that was more comprehensive than the picture that could be obtained previously. Such information is crucial in controlled food production when, for example, the

  14. Correlation of Aggregatibacter actinomycetemcomitans detection with clinical/immunoinflammatory profile of localized aggressive periodontitis using a 16S rRNA microarray method: a cross-sectional study.

    Directory of Open Access Journals (Sweden)

    Patricia F Gonçalves

    Full Text Available The objective of this study was to determine whether the detection of Aggregatibacter actinomycetemcomitans (Aa correlates with the clinical and immunoinflammatory profile of Localized Aggressive Periodontitis (LAP, as determined by by 16S rRNA gene-based microarray.Subgingival plaque samples from the deepest diseased site of 30 LAP patients [PD ≥ 5 mm, BoP and bone loss] were analyzed by 16S rRNA gene-based microarrays. Gingival crevicular fluid (GCF samples were analyzed for 14 cyto/chemokines. Peripheral blood was obtained and stimulated in vitro with P.gingivalis and E.coli to evaluate inflammatory response profiles. Plasma lipopolysaccharide (LPS levels were also measured.Aa was detected in 56% of LAP patients and was shown to be an indicator for different bacterial community structures (p0.05. Clinical parameters and serum LPS levels were similar between groups. However, Aa-non-detected GCF contained higher concentration of IL-8 than Aa-detected sites (p<0.05. TNFα and IL1β were elevated upon E.coli LPS stimulation of peripheral blood cells derived from patients with Aa-detected sites.Our findings demonstrate that the detection of Aa in LAP affected sites, did not correlate with clinical severity of the disease at the time of sampling in this cross-sectional study, although it did associate with lower local levels of IL-8, a different subgingival bacterial profile and elevated LPS-induced levels of TNFα and IL1β.

  15. Evidence of two lineages of the symbiont 'Candidatus Erwinia dacicola' in Italian populations of Bactrocera oleae (Rossi) based on 16S rRNA gene sequences.

    Science.gov (United States)

    Savio, Claudia; Mazzon, Luca; Martinez-Sañudo, Isabel; Simonato, Mauro; Squartini, Andrea; Girolami, Vincenzo

    2012-01-01

    The close association between the olive fly Bactrocera oleae (Rossi) (Diptera: Tephritidae) and bacteria has been known for more than a century. Recently, the presence of a host-specific, hereditary, unculturable symbiotic bacterium, designated 'Candidatus Erwinia dacicola', has been described inside the cephalic organ of the fly, called the oesophageal bulb. In the present study, the 16S rRNA gene sequence variability of 'Ca. E. dacicola' was examined within and between 26 Italian olive fly populations sampled across areas where olive trees occur in the wild and areas where cultivated olive trees have been introduced through history. The bacterial contents of the oesophageal bulbs of 314 olive flies were analysed and a minimum of 781 bp of the 16S rRNA gene was sequenced. The corresponding host fly genotype was assessed by sequencing a 776 bp portion of the mitochondrial genome. Two 'Ca. E. dacicola' haplotypes were found (htA and htB), one being slightly more prevalent than the other (57%). The two haplotypes did not co-exist in the same individuals, as confirmed by cloning. Interestingly, the olive fly populations of the two main Italian islands, Sicily and Sardinia, appeared to be represented exclusively by the htB and htA haplotypes, respectively, while peninsular populations showed both bacterial haplotypes in different proportions. No significant correlation emerged between the two symbiont haplotypes and the 16 host fly haplotypes observed, suggesting evidence for a mixed model of vertical and horizontal transmission of the symbiont during the fly life cycle.

  16. The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.

    Science.gov (United States)

    Jay, Zackary J; Inskeep, William P

    2015-07-09

    Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.

  17. Airborne bacterial communities in residences: similarities and differences with fungi.

    Directory of Open Access Journals (Sweden)

    Rachel I Adams

    Full Text Available Genetic analysis of indoor air has uncovered a rich microbial presence, but rarely have both the bacterial and fungal components been examined in the same samples. Here we present a study that examined the bacterial component of passively settled microbes from both indoor and outdoor air over a discrete time period and for which the fungal component has already been reported. Dust was allowed to passively settle in five common locations around a home - living room, bedroom, bathroom, kitchen, and balcony - at different dwellings within a university-housing complex for a one-month period at two time points, once in summer and again in winter. We amplified the bacterial 16S rRNA gene in these samples and analyzed them with high-throughput sequencing. Like fungal OTU-richness, bacterial OTU-richness was higher outdoors then indoors and was invariant across different indoor room types. While fungal composition was structured largely by season and residential unit, bacterial composition varied by residential unit and room type. Bacteria from putative outdoor sources, such as Sphingomonas and Deinococcus, comprised a large percentage of the balcony samples, while human-associated taxa comprised a large percentage of the indoor samples. Abundant outdoor bacterial taxa were also observed indoors, but the reverse was not true; this is unlike fungi, in which the taxa abundant indoors were also well-represented outdoors. Moreover, there was a partial association of bacterial composition and geographic distance, such that samples separated by even a few hundred meters tended have greater compositional differences than samples closer together in space, a pattern also observed for fungi. These data show that while the outdoor source for indoor bacteria and fungi varies in both space and time, humans provide a strong and homogenizing effect on indoor bacterial bioaerosols, a pattern not observed in fungi.

  18. Distributions of Bacterial Generalists among the Guts of Birds ...

    Science.gov (United States)

    Complex distributions of bacterial taxa within diverse animal microbiomes have inspired ecological and biogeographical approaches to revealing the functions of taxa that may be most important for host health. Of particular interest are bacteria that find many diverse habitats suitable for growth and remain competitive amongst finely-tuned host specialists. While previous work has focused on identifying these specialists, here our aims were to 1) identify generalist taxa, 2) identify taxonomic clades with enriched generalist diversity, and 3) describe the distribution of the largest generalist groups among hosts. We analyzed existing bacterial rRNA tag-sequencing data (v6) available on VAMPs (vamps.mbl.edu) from the microbiomes of 12 host species (106 samples total) spanning birds, mammals, and fish for generalist taxa using the CLAM test. OTUs with approximately equal abundance and a minimum of 10 reads in two hosts were classified as generalists. Generalist OTUs (n=2,982) were found in all hosts tested. Bacterial families Alcaligenaceae and Burkholderiaceae were significantly enriched with generalists OTUs compared to other families. Bacterial families such as Bacteroidaceae and Lachnospiraceae significantly lacked generalists OTUs compared to other families. Enterobacteriaceae, Peptostreptococcaceae, and Erysipelotrichaceae more so than other bacterial families were widely distributed and abundant in birds, mammals, and fish suggesting that these taxa mainta

  19. Bacterial diversity characterization in petroleum samples from Brazilian reservoirs

    Science.gov (United States)

    de Oliveira, Valéria Maia; Sette, Lara Durães; Simioni, Karen Christina Marques; dos Santos Neto, Eugênio Vaz

    2008-01-01

    This study aimed at evaluating potential differences among the bacterial communities from formation water and oil samples originated from biodegraded and non-biodegraded Brazilian petroleum reservoirs by using a PCR-DGGE based approach. Environmental DNA was isolated and used in PCR reactions with bacterial primers, followed by separation of 16S rDNA fragments in the DGGE. PCR products were also cloned and sequenced, aiming at the taxonomic affiliation of the community members. The fingerprints obtained allowed the direct comparison among the bacterial communities from oil samples presenting distinct degrees of biodegradation, as well as between the communities of formation water and oil sample from the non-biodegraded reservoir. Very similar DGGE band profiles were observed for all samples, and the diversity of the predominant bacterial phylotypes was shown to be low. Cloning and sequencing results revealed major differences between formation water and oil samples from the non-biodegraded reservoir. Bacillus sp. and Halanaerobium sp. were shown to be the predominant components of the bacterial community from the formation water sample, whereas the oil sample also included Alicyclobacillus acidoterrestris, Rhodococcus sp., Streptomyces sp. and Acidithiobacillus ferrooxidans. The PCR-DGGE technique, combined with cloning and sequencing of PCR products, revealed the presence of taxonomic groups not found previously in these samples when using cultivation-based methods and 16S rRNA gene library assembly, confirming the need of a polyphasic study in order to improve the knowledge of the extent of microbial diversity in such extreme environments. PMID:24031244

  20. Bacterial diversity of symptomatic primary endodontic infection by clonal analysis

    Directory of Open Access Journals (Sweden)

    Letícia Maria Menezes NÓBREGA

    Full Text Available Abstract The aim of this study was to explore the bacterial diversity of 10 root canals with acute apical abscess using clonal analysis. Samples were collected from 10 patients and submitted to bacterial DNA isolation, 16S rRNA gene amplification, cloning, and sequencing. A bacterial genomic library was constructed and bacterial diversity was estimated. The mean number of taxa per canal was 15, ranging from 11 to 21. A total of 689 clones were analyzed and 76 phylotypes identified, of which 47 (61.84% were different species and 29 (38.15% were taxa reported as yet-uncultivable or as yet-uncharacterized species. Prevotella spp., Fusobacterium nucleatum, Filifactor alocis, and Peptostreptococcus stomatis were the most frequently detected species, followed by Dialister invisus, Phocaeicola abscessus, the uncharacterized Lachnospiraceae oral clone, Porphyromonas spp., and Parvimonas micra. Eight phyla were detected and the most frequently identified taxa belonged to the phylum Firmicutes (43.5%, followed by Bacteroidetes (22.5% and Proteobacteria (13.2%. No species was detected in all studied samples and some species were identified in only one case. It was concluded that acute primary endodontic infection is characterized by wide bacterial diversity and a high intersubject variability was observed. Anaerobic Gram-negative bacteria belonging to the phylum Firmicutes, followed by Bacteroidetes, were the most frequently detected microorganisms.

  1. Selective isolation and detailed analysis of intra-RNA cross-links induced in the large ribosomal subunit of E. coli: a model for the tertiary structure of the tRNA binding domain in 23S RNA.

    OpenAIRE

    Mitchell, P; Osswald, M; Schueler, D; Brimacombe, R

    1990-01-01

    Intramolecular RNA cross-links were induced within the large ribosomal subunit of E. coli by mild ultraviolet irradiation. Regions of the 23S RNA previously implicated in interactions with ribosomal-bound tRNA were then specifically excised by addressed cleavage using ribonuclease H, in conjunction with synthetic complementary decadeoxyribonucleotides. Individual cross-linked fragments within these regions released by such 'directed digests' were isolated by two-dimensional gel electrophoresi...

  2. Robertsonian translocation 13/14 associated with rRNA genes ...

    African Journals Online (AJOL)

    Alexander A. Dolskiy

    2017-12-01

    Dec 1, 2017 ... Robertsonian translocation 13/14 associated with rRNA genes ... Chromosome 13. Chromosome 14. Intellectual disability. a b s t r a c t. Background: The Robertsonian translocations inherited from parents with a normal ..... expression in lymphocyte of trisomy 21 babies/children: in vivo evaluation.

  3. Alteration of rRNA gene copy number and expression in patients ...

    African Journals Online (AJOL)

    Irina S. Kolesnikova

    2017-09-01

    Sep 1, 2017 ... Background: Intellectual disability (ID) is an important medical and social problem that can be caused by different genetic and environmental factors. One such factor could be rDNA amplification and changes in. rRNA expression and maturation. Aim of the study: The aim of the present study was to ...

  4. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  5. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Czech Academy of Sciences Publication Activity Database

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.

    2005-01-01

    Roč. 280, č. 47 (2005), s. 38942-38947 ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  6. Global Perspectives on Activated Sludge Community Composition analyzed using 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Saunders, Aaron Marc; Albertsen, Mads

    Activated sludge is the most commonly applied bioprocess throughout the world for wastewater treatment. Microorganisms are key to the process, yet our knowledge of their identity and function is still limited. High-througput16S rRNA amplicon sequencing can reliably characterize microbial...

  7. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  8. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  9. NOF1 encodes an Arabidopsis protein involved in the control of rRNA expression.

    Directory of Open Access Journals (Sweden)

    Erwana Harscoët

    Full Text Available The control of ribosomal RNA biogenesis is essential for the regulation of protein synthesis in eukaryotic cells. Here, we report the characterization of NOF1 that encodes a putative nucleolar protein involved in the control of rRNA expression in Arabidopsis. The gene has been isolated by T-DNA tagging and its function verified by the characterization of a second allele and genetic complementation of the mutants. The nof1 mutants are affected in female gametogenesis and embryo development. This result is consistent with the detection of NOF1 mRNA in all tissues throughout plant life's cycle, and preferentially in differentiating cells. Interestingly, the closely related proteins from zebra fish and yeast are also necessary for cell division and differentiation. We showed that the nof1-1 mutant displays higher rRNA expression and hypomethylation of rRNA promoter. Taken together, the results presented here demonstrated that NOF1 is an Arabidopsis gene involved in the control of rRNA expression, and suggested that it encodes a putative nucleolar protein, the function of which may be conserved in eukaryotes.

  10. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    OpenAIRE

    B Dhawan; S Sebastian; R Malhotra; A Kapil; D Gautam

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  11. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    B Dhawan

    2016-01-01

    Full Text Available We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  12. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  13. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  14. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    NARCIS (Netherlands)

    Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this

  15. Culture -independent Pathogenic Bacterial Communities in Bottled Mineral Water

    Directory of Open Access Journals (Sweden)

    Hamdy A. Hassan

    2015-08-01

    Full Text Available Bottled mineral water (BMW is an alternative to mains water and consider it to be better and safer. Access to safe BMW from the bacteria involving potential health hazard is essential to health. Cultivation-independent technique PCR-based single-strand conformation polymorphism (SSCP for genetic profiling of PCR-amplified 16S rRNA genes was performed using Com primer set targeting the 16S rRNA genes for detection of pathogenic bacteria in bottled mineral water from the final product of six factories for bottled mineral drinking water in Wadi El-natron region- Egypt. These factories use often ozone technology to treat large quantities of water because of its effectiveness in purifying and conditioning water. A total of 27 single products were isolated from the profiles by PCR re-amplification and cloning. Sequence analysis of 27 SSCP bands revealed that the 16S rRNA sequences were clustered into seven operational taxonomic units (OTUs and the compositions of the communities of the six samples were all common. The results showed that most communities from phyla Alphaproteobacteria and certainly in the Sphingomonas sp. Culture-independent approaches produced complementary information, thus generating a more accurate view for the bacterial community in the BMW, particularly in the disinfection step, as it constitutes the final barrier before BMW distribution to the consumer

  16. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    Science.gov (United States)

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  17. Growth increase of Arabidopsis by forced expression of rice 45S rRNA gene.

    Science.gov (United States)

    Makabe, So; Motohashi, Reiko; Nakamura, Ikuo

    2017-02-01

    Forced expression of rice 45S rRNA gene conferred ca. 2-fold increase of above-ground growth in transgenic Arabidopsis . This growth increase was probably brought by cell proliferation, not by cell enlargement. Recent increase in carbon dioxide emissions is causing global climate change. The use of plant biomass as alternative energy source is one way to reduce these emissions. Therefore, reinforcement of plant biomass production is an urgent key issue to overcome both depletion of fossil energies and emission of carbon dioxide. Here, we created transgenic Arabidopsis with a 2-fold increase in above-ground growth by forced expression of the rice 45S rRNA gene using the maize ubiquitin promoter. Although the size of guard cells and ploidy of leaf-cells were similar between transgenic and control plants, numbers of stomata and pavement cells were much increased in the transgenic leaf. This data suggested that cell number, not cell expansion, was responsible for the growth increase, which might be brought by the forced expression of exogenous and full-length 45S rRNA gene. The expression level of rice 45S rRNA transcripts was very low, possibly triggering unknown machinery to enhance cell proliferation. Although microarray analysis showed enhanced expression of ethylene-responsive transcription factors, these factors might respond to ethylene induced by abiotic/biotic stresses or genomic incompatibility, which might be involved in the expression of species-specific internal transcribed spacer (ITS) sequences within rice 45S rRNA transcripts. Further analysis of the mechanism underlying the growth increase will contribute to understanding the regulation of the cell proliferation and the mechanism of hybrid vigor.

  18. Riboprinting and 16S rRNA Gene Sequencing for Identification of Brewery Pediococcus Isolates

    Science.gov (United States)

    Barney, Michael; Volgyi, Antonia; Navarro, Alfonso; Ryder, David

    2001-01-01

    A total of 46 brewery and 15 ATCC Pediococcus isolates were ribotyped using a Qualicon RiboPrinter. Of these, 41 isolates were identified as Pediococcus damnosus using EcoRI digestion. Three ATCC reference strains had patterns similar to each other and matched 17 of the brewery isolates. Six other brewing isolates were similar to ATCC 25249. The other 18 P. damnosus brewery isolates had unique patterns. Of the remaining brewing isolates, one was identified as P. parvulus, two were identified as P. acidilactici, and two were identified as unique Pediococcus species. The use of alternate restriction endonucleases indicated that PstI and PvuII could further differentiate some strains having identical EcoRI profiles. An acid-resistant P. damnosus isolate could be distinguished from non-acid-resistant varieties of the same species using PstI instead of EcoRI. 16S rRNA gene sequence analysis was compared to riboprinting for identifying pediococci. The complete 16S rRNA gene was PCR amplified and sequenced from seven brewery isolates and three ATCC references with distinctive riboprint patterns. The 16S rRNA gene sequences from six different brewery P. damnosus isolates were homologous with a high degree of similarity to the GenBank reference strain but were identical to each other and one ATCC strain with the exception of 1 bp in one strain. A slime-producing, beer spoilage isolate had 16S rRNA gene sequence homology to the P. acidilactici reference strain, in agreement with the riboprint data. Although 16S rRNA gene sequencing correctly identified the genus and species of the test Pediococcus isolates, riboprinting proved to be a better method for subspecies differentiation. PMID:11157216

  19. The role of human ribosomal proteins in the maturation of rRNA and ribosome production.

    Science.gov (United States)

    Robledo, Sara; Idol, Rachel A; Crimmins, Dan L; Ladenson, Jack H; Mason, Philip J; Bessler, Monica

    2008-09-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a human disease with a specific defect in red cell development is unknown. Here, we investigated the role of r-proteins in ribosome biogenesis in order to find out whether those mutated in DBA have any similarities. We depleted HeLa cells using siRNA for several individual r-proteins of the small (RPS6, RPS7, RPS15, RPS16, RPS17, RPS19, RPS24, RPS25, RPS28) or large subunit (RPL5, RPL7, RPL11, RPL14, RPL26, RPL35a) and studied the effect on rRNA processing and ribosome production. Depleting r-proteins in one of the subunits caused, with a few exceptions, a decrease in all r-proteins of the same subunit and a decrease in the corresponding subunit, fully assembled ribosomes, and polysomes. R-protein depletion, with a few exceptions, led to the accumulation of specific rRNA precursors, highlighting their individual roles in rRNA processing. Depletion of r-proteins mutated in DBA always compromised ribosome biogenesis while affecting either subunit and disturbing rRNA processing at different levels, indicating that the rate of ribosome production rather than a specific step in ribosome biogenesis is critical in patients with DBA.

  20. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Directory of Open Access Journals (Sweden)

    Jiyoung Ahn

    Full Text Available The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray.Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity.The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84.Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  1. Mechanism of uranium (VI) removal by two anaerobic bacterial communities

    International Nuclear Information System (INIS)

    Martins, Monica; Faleiro, Maria Leonor; Costa, Ana M. Rosa da; Chaves, Sandra; Tenreiro, Rogerio; Matos, Antonio Pedro; Costa, Maria Clara

    2010-01-01

    The mechanism of uranium (VI) removal by two anaerobic bacterial consortia, recovered from an uncontaminated site (consortium A) and other from an uranium mine (consortium U), was investigated. The highest efficiency of U (VI) removal by both consortia (97%) occurred at room temperature and at pH 7.2. Furthermore, it was found that U (VI) removal by consortium A occurred by enzymatic reduction and bioaccumulation, while the enzymatic process was the only mechanism involved in metal removal by consortium U. FTIR analysis suggested that after U (VI) reduction, U (IV) could be bound to carboxyl, phosphate and amide groups of bacterial cells. Phylogenetic analysis of 16S rRNA showed that community A was mainly composed by bacteria closely related to Sporotalea genus and Rhodocyclaceae family, while community U was mainly composed by bacteria related to Clostridium genus and Rhodocyclaceae family.

  2. Metagenomic insights into zooplankton-associated bacterial communities

    DEFF Research Database (Denmark)

    De Corte, Daniele; Srivastava, Abhishek; Koski, Marja

    2018-01-01

    ocean. The zooplankton-associated bacterial community is able to colonize the zooplankton's internal and external surfaces by using a large set of adhesion mechanisms and to metabolize complex organic compounds released or exuded by the zooplankton such as chitin, taurine and other complex molecules....... Moreover, the high number of genes involved in iron and phosphorus metabolisms in the zooplankton-associated microbiome suggests that this zooplankton-associated bacterial community mediates specific biogeochemical processes (through the proliferation of specific taxa) that are generally underrepresented......, we assessed the phylogenetic composition and metabolic potential of microbial communities associated with crustacean zooplankton species collected in the North Atlantic. Using Illumina sequencing of the 16S rRNA gene we found significant differences between the microbial communities associated...

  3. The effect of the macrolide antibiotic tylosin on microbial diversity in the canine small intestine as demonstrated by massive parallel 16S rRNA gene sequencing.

    Science.gov (United States)

    Suchodolski, Jan S; Dowd, Scot E; Westermarck, Elias; Steiner, Jörg M; Wolcott, Randy D; Spillmann, Thomas; Harmoinen, Jaana A

    2009-10-02

    Recent studies have shown that the fecal microbiota is generally resilient to short-term antibiotic administration, but some bacterial taxa may remain depressed for several months. Limited information is available about the effect of antimicrobials on small intestinal microbiota, an important contributor to gastrointestinal health. The antibiotic tylosin is often successfully used for the treatment of chronic diarrhea in dogs, but its exact mode of action and its effect on the intestinal microbiota remain unknown. The aim of this study was to evaluate the effect of tylosin on canine jejunal microbiota. Tylosin was administered at 20 to 22 mg/kg q 24 hr for 14 days to five healthy dogs, each with a pre-existing jejunal fistula. Jejunal brush samples were collected through the fistula on days 0, 14, and 28 (14 days after withdrawal of tylosin). Bacterial diversity was characterized using massive parallel 16S rRNA gene pyrosequencing. Pyrosequencing revealed a previously unrecognized species richness in the canine small intestine. Ten bacterial phyla were identified. Microbial populations were phylogenetically more similar during tylosin treatment. However, a remarkable inter-individual response was observed for specific taxa. Fusobacteria, Bacteroidales, and Moraxella tended to decrease. The proportions of Enterococcus-like organisms, Pasteurella spp., and Dietzia spp. increased significantly during tylosin administration (p tylosin increased in their proportions. Tylosin may lead to prolonged effects on the composition and diversity of jejunal microbiota. However, these changes were not associated with any short-term clinical signs of gastrointestinal disease in healthy dogs. Our results illustrate the complexity of the intestinal microbiota and the challenges associated with evaluating the effect of antibiotic administration on the various bacterial groups and their potential interactions.

  4. Bacterial diversity in relation to secondary production and succession on surfaces of the kelp Laminaria hyperborea

    Science.gov (United States)

    Bengtsson, Mia M; Sjøtun, Kjersti; Lanzén, Anders; Øvreås, Lise

    2012-01-01

    Kelp forests worldwide are known as hotspots for macroscopic biodiversity and primary production, yet very little is known about the biodiversity and roles of microorganisms in these ecosystems. Secondary production by heterotrophic bacteria associated to kelp is important in the food web as a link between kelp primary production and kelp forest consumers. The aim of this study was to investigate the relationship between bacterial diversity and two important processes in this ecosystem; bacterial secondary production and primary succession on kelp surfaces. To address this, kelp, Laminaria hyperborea, from southwestern Norway was sampled at different geographical locations and during an annual cycle. Pyrosequencing (454-sequencing) of amplicons of the 16S rRNA gene of bacteria was used to study bacterial diversity. Incorporation of tritiated thymidine was used as a measure of bacterial production. Our data show that bacterial diversity (richness and evenness) increases with the age of the kelp surface, which corresponds to the primary succession of its bacterial communities. Higher evenness of bacterial operational taxonomical units (OTUs) is linked to higher bacterial production. Owing to the dominance of a few abundant OTUs, kelp surface biofilm communities may be characterized as low-diversity habitats. This is the first detailed study of kelp-associated bacterial communities using high-throughput sequencing and it extends current knowledge on microbial community assembly and dynamics on living surfaces. PMID:22763650

  5. Bacterial diversity in different regions of gastrointestinal tract of Giant African Snail (Achatina fulica)

    Science.gov (United States)

    Pawar, Kiran D; Banskar, Sunil; Rane, Shailendra D; Charan, Shakti S; Kulkarni, Girish J; Sawant, Shailesh S; Ghate, Hemant V; Patole, Milind S; Shouche, Yogesh S

    2012-01-01

    The gastrointestinal (GI) tract of invasive land snail Achatina fulica is known to harbor metabolically active bacterial communities. In this study, we assessed the bacterial diversity in the different regions of GI tract of Giant African snail, A. fulica by culture-independent and culture-dependent methods. Five 16S rRNA gene libraries from different regions of GI tract of active snails indicated that sequences affiliated to phylum γ-Proteobacteria dominated the esophagus, crop, intestine, and rectum libraries, whereas sequences affiliated to Tenericutes dominated the stomach library. On phylogenetic analysis, 30, 27, 9, 27, and 25 operational taxonomic units (OTUs) from esophagus, crop, stomach, intestine, and rectum libraries were identified, respectively. Estimations of the total bacterial diversity covered along with environmental cluster analysis showed highest bacterial diversity in the esophagus and lowest in the stomach. Thirty-three distinct bacterial isolates were obtained, which belonged to 12 genera of two major bacterial phyla namely γ-Proteobacteria and Firmicutes. Among these, Lactococcus lactis and Kurthia gibsonii were the dominant bacteria present in all GI tract regions. Quantitative real-time polymerase chain reaction (qPCR) analysis indicated significant differences in bacterial load in different GI tract regions of active and estivating snails. The difference in the bacterial load between the intestines of active and estivating snail was maximum. Principal component analysis (PCA) of terminal restriction fragment length polymorphism suggested that bacterial community structure changes only in intestine when snail enters estivation state. PMID:23233413

  6. The Bacterial Microbiome in Paired Vaginal and Vestibular Samples from Women with Vulvar Vestibulitis Syndrome

    OpenAIRE

    Jayaram, Aswathi; Witkin, Steven S.; Zhou, IA; Brown, Celeste J.; Rey, Gustavo E.; Linhares, Iara M.; Ledger, William J.; Forney, Larry J.

    2014-01-01

    Composition of the bacterial microbiome in the vagina and vestibule from 30 women with vulvar vestibulitis syndrome (VVS) and 15 healthy controls were compared by pyrosequencing 16S rRNA amplicons. Vaginal concentrations of interleukin (IL)-1β were determined by ELISA. Questionnaires elicited clinical and symptom data. Eighteen genera were detected in vaginal samples, and 23 genera were identified in vestibule samples, from women with VVS. The genera at both sites and the mean number of gener...

  7. [Spontaneous bacterial peritonitis].

    Science.gov (United States)

    Strauss, Edna; Caly, Wanda Regina

    2003-01-01

    Spontaneous bacterial peritonitis occurs in 30% of patients with ascites due to cirrhosis leading to high morbidity and mortality rates. The pathogenesis of spontaneous bacterial peritonitis is related to altered host defenses observed in end-stage liver disease, overgrowth of microorganisms, and bacterial translocation from the intestinal lumen to mesenteric lymph nodes. Clinical manifestations vary from severe to slight or absent, demanding analysis of the ascitic fluid. The diagnosis is confirmed by a number of neutrophils over 250/mm3 associated or not to bacterial growth in culture of an ascites sample. Enterobacteriae prevail and Escherichia coli has been the most frequent bacterium reported. Mortality rates decreased markedly in the last two decades due to early diagnosis and prompt antibiotic treatment. Third generation intravenous cephalosporins are effective in 70% to 95% of the cases. Recurrence of spontaneous bacterial peritonitis is common and can be prevented by the continuous use of oral norfloxacin. The development of bacterial resistance demands the search for new options in the prophylaxis of spontaneous bacterial peritonitis; probiotics are a promising new approach, but deserve further evaluation. Short-term antibiotic prophylaxis is recommended for patients with cirrhosis and ascites shortly after an acute episode of gastrointestinal bleeding.

  8. [Bacterial diversity in a deep-sea hydrothermal plume in the southwest Indian Ocean].

    Science.gov (United States)

    Ren, Fei; Xi, Lijun; Song, Lei; Zhu, Yaxin; Dong, Zhiyang; Huang, Ying; Huang, Li; Dai, Xin

    2012-11-04

    We characterized bacterial divefity in a deep-sea hydrothermal plume seawater in the southwest Indian Ocean to increase our understanding of the impact of the microorganisms on the ocean ecosystem and to survey microbial resources in this special environment. The deep-sea hydrothermal plume seawater in the southwest Indian Ocean was concentrated in situ by 1000 folds, enrichment cultures were established with the concentrated sample, and isolates were purified. Bacterial 16S rRNA gene libraries were constructed from both the concentrated seawater sample and from the enrichment culture and analyzed. The 16S rRNA genes from the isolated strains were also analyzed. A total of 104 16S rRNA genes were obtained, in which 50 were from the concentrated plume seawater, 40 from the enrichment culture, and 14 from the isolated strains. These sequences are affiliated with gamma-proteobacteria (74), alpha-proteobacteria (14), beta-Proteobacteria (5), Bacteroidetes (4), Firmicutes (2), Planctomycetes (2), Verrucomicrobia (2) and Actinobacteria (1), and fall into 29 different operational taxonomic units (OTUs). Twenty-six sequences share less than 97% identity with the best-matched sequences in the public database, with the lowest being 86%. There is rich bacterial diversity in the deep-sea hydrothermal plume seawater in the southwest Indian Ocean, where gamma-proteobacterial groups were dominant, followed by alpha-proteobacterial groups. A number of species remain uncultured.

  9. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  10. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  11. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...

  12. Identification of bacteriology and risk factor analysis of asymptomatic bacterial colonization in pacemaker replacement patients.

    Directory of Open Access Journals (Sweden)

    Xian-Ming Chu

    Full Text Available Recent researches revealed that asymptomatic bacterial colonization on PMs might be ubiquitous and increase the risk of clinical PM infection. Early diagnosis of patients with asymptomatic bacterial colonization could provide opportunity for targeted preventive measures.The present study explores the incidence of bacterial colonization of generator pockets in pacemaker replacement patients without signs of infection, and to analyze risk factors for asymptomatic bacterial colonization.From June 2011 to December 2013, 118 patients underwent pacemaker replacement or upgrade. Identification of bacteria was carried out by bacterial culture and 16S rRNA sequencing. Clinical risk characteristics were analyzed.The total bacterial positive rate was 37.3% (44 cases, and the coagulase-negative Staphylococcus aureus detection rate was the highest. Twenty two (18.6% patients had positive bacterial culture results, of which 50% had coagulase-negative staphylococcus. The bacterial DNA detection rate was 36.4 % (43 cases. Positive bacterial DNA results from pocket tissues and the surface of the devices were 22.0% and 29.7%, respectively. During follow-up (median, 27.0 months, three patients (6.8%, 3/44 became symptomatic with the same genus of microorganism, S. aureus (n=2 and S. epidermidis (n=1. Multivariable logistic regression analysis showed that history of bacterial infection, use of antibiotics, application of antiplatelet drugs, replacement frequency were independent risk factors for asymptomatic bacterial colonization.There was a high incidence of asymptomatic bacterial colonization in pacemaker patients with independent risk factors. Bacterial culture combined genetic testing could improve the detection rate.

  13. Interfering with bacterial gossip

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Tolker-Nielsen, Tim; Givskov, Michael

    2011-01-01

    defense. Antibiotics exhibit a rather limited effect on biofilms. Furthermore, antibiotics have an ‘inherent obsolescence’ because they select for development of resistance. Bacterial infections with origin in bacterial biofilms have become a serious threat in developed countries. Pseudomonas aeruginosa...... that appropriately target bacteria in their relevant habitat with the aim of mitigating their destructive impact on patients. In this review we describe molecular mechanisms involved in “bacterial gossip” (more scientifically referred to as quorum sensing (QS) and c-di-GMP signaling), virulence, biofilm formation......, resistance and QS inhibition as future antimicrobial targets, in particular those that would work to minimize selection pressures for the development of resistant bacteria....

  14. Watershed Urbanization Linked to Differences in Stream Bacterial Community Composition.

    Science.gov (United States)

    Hosen, Jacob D; Febria, Catherine M; Crump, Byron C; Palmer, Margaret A

    2017-01-01

    Urbanization strongly influences headwater stream chemistry and hydrology, but little is known about how these conditions impact bacterial community composition. We predicted that urbanization would impact bacterial community composition, but that stream water column bacterial communities would be most strongly linked to urbanization at a watershed-scale, as measured by impervious cover, while sediment bacterial communities would correlate with environmental conditions at the scale of stream reaches. To test this hypothesis, we determined bacterial community composition in the water column and sediment of headwater streams located across a gradient of watershed impervious cover using high-throughput 16S rRNA gene amplicon sequencing. Alpha diversity metrics did not show a strong response to catchment urbanization, but beta diversity was significantly related to watershed impervious cover with significant differences also found between water column and sediment samples. Samples grouped primarily according to habitat-water column vs. sediment-with a significant response to watershed impervious cover nested within each habitat type. Compositional shifts for communities in urbanized streams indicated an increase in taxa associated with human activity including bacteria from the genus Polynucleobacter , which is widespread, but has been associated with eutrophic conditions in larger water bodies. Another indicator of communities in urbanized streams was an OTU from the genus Gallionella , which is linked to corrosion of water distribution systems. To identify changes in bacterial community interactions, bacterial co-occurrence networks were generated from urban and forested samples. The urbanized co-occurrence network was much smaller and had fewer co-occurrence events per taxon than forested equivalents, indicating a loss of keystone taxa with urbanization. Our results suggest that urbanization has significant impacts on the community composition of headwater streams

  15. Bacterial diversity at different stages of the composting process

    Directory of Open Access Journals (Sweden)

    Paulin Lars

    2010-03-01

    Full Text Available Abstract Background Composting is an aerobic microbiological process that is facilitated by bacteria and fungi. Composting is also a method to produce fertilizer or soil conditioner. Tightened EU legislation now requires treatment of the continuously growing quantities of organic municipal waste before final disposal. However, some full-scale composting plants experience difficulties with the efficiency of biowaste degradation and with the emission of noxious odours. In this study we examine the bacterial species richness and community structure of an optimally working pilot-scale compost plant, as well as a full-scale composting plant experiencing typical problems. Bacterial species composition was determined by isolating total DNA followed by amplifying and sequencing the gene encoding the 16S ribosomal RNA. Results Over 1500 almost full-length 16S rRNA gene sequences were analysed and of these, over 500 were present only as singletons. Most of the sequences observed in either one or both of the composting processes studied here were similar to the bacterial species reported earlier in composts, including bacteria from the phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Deinococcus-Thermus. In addition, a number of previously undetected bacterial phylotypes were observed. Statistical calculations estimated a total bacterial diversity of over 2000 different phylotypes in the studied composts. Conclusions Interestingly, locally enriched or evolved bacterial variants of familiar compost species were observed in both composts. A detailed comparison of the bacterial diversity revealed a large difference in composts at the species and strain level from the different composting plants. However, at the genus level, the difference was much smaller and illustrated a delay of the composting process in the full-scale, sub-optimally performing plants.

  16. Watershed Urbanization Linked to Differences in Stream Bacterial Community Composition

    Directory of Open Access Journals (Sweden)

    Jacob D. Hosen

    2017-08-01

    Full Text Available Urbanization strongly influences headwater stream chemistry and hydrology, but little is known about how these conditions impact bacterial community composition. We predicted that urbanization would impact bacterial community composition, but that stream water column bacterial communities would be most strongly linked to urbanization at a watershed-scale, as measured by impervious cover, while sediment bacterial communities would correlate with environmental conditions at the scale of stream reaches. To test this hypothesis, we determined bacterial community composition in the water column and sediment of headwater streams located across a gradient of watershed impervious cover using high-throughput 16S rRNA gene amplicon sequencing. Alpha diversity metrics did not show a strong response to catchment urbanization, but beta diversity was significantly related to watershed impervious cover with significant differences also found between water column and sediment samples. Samples grouped primarily according to habitat—water column vs. sediment—with a significant response to watershed impervious cover nested within each habitat type. Compositional shifts for communities in urbanized streams indicated an increase in taxa associated with human activity including bacteria from the genus Polynucleobacter, which is widespread, but has been associated with eutrophic conditions in larger water bodies. Another indicator of communities in urbanized streams was an OTU from the genus Gallionella, which is linked to corrosion of water distribution systems. To identify changes in bacterial community interactions, bacterial co-occurrence networks were generated from urban and forested samples. The urbanized co-occurrence network was much smaller and had fewer co-occurrence events per taxon than forested equivalents, indicating a loss of keystone taxa with urbanization. Our results suggest that urbanization has significant impacts on the community composition

  17. Microbial community composition and diversity via 16S rRNA gene amplicons: evaluating the illumina platform.

    Directory of Open Access Journals (Sweden)

    Lucas Sinclair

    Full Text Available As new sequencing technologies become cheaper and older ones disappear, laboratories switch vendors and platforms. Validating the new setups is a crucial part of conducting rigorous scientific research. Here we report on the reliability and biases of performing bacterial 16S rRNA gene amplicon paired-end sequencing on the MiSeq Illumina platform. We designed a protocol using 50 barcode pairs to run samples in parallel and coded a pipeline to process the data. Sequencing the same sediment sample in 248 replicates as well as 70 samples from alkaline soda lakes, we evaluated the performance of the method with regards to estimates of alpha and beta diversity. Using different purification and DNA quantification procedures we always found up to 5-fold differences in the yield of sequences between individually barcodes samples. Using either a one-step or a two-step PCR preparation resulted in significantly different estimates in both alpha and beta diversity. Comparing with a previous method based on 454 pyrosequencing, we found that our Illumina protocol performed in a similar manner - with the exception for evenness estimates where correspondence between the methods was low. We further quantified the data loss at every processing step eventually accumulating to 50% of the raw reads. When evaluating different OTU clustering methods, we observed a stark contrast between the results of QIIME with default settings and the more recent UPARSE algorithm when it comes to the number of OTUs generated. Still, overall trends in alpha and beta diversity corresponded highly using both clustering methods. Our procedure performed well considering the precisions of alpha and beta diversity estimates, with insignificant effects of individual barcodes. Comparative analyses suggest that 454 and Illumina sequence data can be combined if the same PCR protocol and bioinformatic workflows are used for describing patterns in richness, beta-diversity and taxonomic

  18. Bacterial population dynamics during the ensiling of Medicago sativa (alfalfa) and subsequent exposure to air.

    Science.gov (United States)

    McGarvey, J A; Franco, R B; Palumbo, J D; Hnasko, R; Stanker, L; Mitloehner, F M

    2013-06-01

    To describe, at high resolution, the bacterial population dynamics and chemical transformations during the ensiling of alfalfa and subsequent exposure to air. Samples of alfalfa, ensiled alfalfa and silage exposed to air were collected and their bacterial population structures compared using 16S rRNA gene libraries containing approximately 1900 sequences each. Cultural and chemical analyses were also performed to complement the 16S gene sequence data. Sequence analysis revealed significant differences (P alfalfa-derived library contained mostly sequences associated with the Gammaproteobacteria (including the genera: Enterobacter, Erwinia and Pantoea); the ensiled material contained mostly sequences associated with the lactic acid bacteria (LAB) (including the genera: Lactobacillus, Pediococcus and Lactococcus). Exposure to air resulted in even greater percentages of LAB, especially among the genus Lactobacillus, and a significant drop in bacterial diversity. In-depth 16S rRNA gene sequence analysis revealed significant bacterial population structure changes during ensiling and again during exposure to air. This in-depth description of the bacterial population dynamics that occurred during ensiling and simulated feed out expands our knowledge of these processes. © 2013 The Society for Applied Microbiology No claim to US Government works.

  19. Bacterial diversity in dried colostrum and whey sold as nutraceutical products.

    Science.gov (United States)

    Hayes, M Melissa; Hughes, Thomas A; Greene, Annel K

    2012-07-01

    The microbial communities were analyzed from commercially available dried dairy nutraceutical products, including 4 brands of dried colostrum, 2 brands of dried whey, and 1 brand of nonfat dry milk. A culture-dependent 16S rRNA sequencing approach was utilized to elucidate the identity of individual isolates recovered from each dried dairy product. Approximately 69% of all bacterial isolates were members the genus of Bacillus, while approximately 14% of all bacterial isolates were identified as members of the genus Pseudomonas. Members of the Kocuria, Microbacterium, and Enterococcus genera were identified as well. This project investigated the microbial populations inherent in dried commercially available nutraceutical products. Bovine colostrum has been reported to have protective activity against certain viral and bacterial pathogens. This project was designed to identify the bacterial populations within dried dairy nutraceutical products to determine if any species were common to all products and which may impact the reported nutraceutical properties. © 2012 Institute of Food Technologists®

  20. A bacterial community-based index to assess the ecological status of estuarine and coastal environments

    KAUST Repository

    Aylagas, Eva

    2016-10-23

    Biotic indices for monitoring marine ecosystems are mostly based on the analysis of benthic macroinvertebrate communities. Due to their high sensitivity to pollution and fast response to environmental changes, bacterial assemblages could complement the information provided by benthic metazoan communities as indicators of human-induced impacts, but so far, this biological component has not been well explored for this purpose. Here we performed 16S rRNA gene amplicon sequencing to analyze the bacterial assemblage composition of 51 estuarine and coastal stations characterized by different environmental conditions and human-derived pressures. Using the relative abundance of putative indicator bacterial taxa, we developed a biotic index that is significantly correlated with a sediment quality index calculated on the basis of organic and inorganic compound concentrations. This new index based on bacterial assemblage composition can be a sensitive tool for providing a fast environmental assessment and allow a more comprehensive integrative ecosystem approach for environmental management. © 2016.

  1. A Markovian analysis of bacterial genome sequence constraints

    Directory of Open Access Journals (Sweden)

    Aaron D. Skewes

    2013-08-01

    Full Text Available The arrangement of nucleotides within a bacterial chromosome is influenced by numerous factors. The degeneracy of the third codon within each reading frame allows some flexibility of nucleotide selection; however, the third nucleotide in the triplet of each codon is at least partly determined by the preceding two. This is most evident in organisms with a strong G + C bias, as the degenerate codon must contribute disproportionately to maintaining that bias. Therefore, a correlation exists between the first two nucleotides and the third in all open reading frames. If the arrangement of nucleotides in a bacterial chromosome is represented as a Markov process, we would expect that the correlation would be completely captured by a second-order Markov model and an increase in the order of the model (e.g., third-, fourth-…order would not capture any additional uncertainty in the process. In this manuscript, we present the results of a comprehensive study of the Markov property that exists in the DNA sequences of 906 bacterial chromosomes. All of the 906 bacterial chromosomes studied exhibit a statistically significant Markov property that extends beyond second-order, and therefore cannot be fully explained by codon usage. An unrooted tree containing all 906 bacterial chromosomes based on their transition probability matrices of third-order shares ∼25% similarity to a tree based on sequence homologies of 16S rRNA sequences. This congruence to the 16S rRNA tree is greater than for trees based on lower-order models (e.g., second-order, and higher-order models result in diminishing improvements in congruence. A nucleotide correlation most likely exists within every bacterial chromosome that extends past three nucleotides. This correlation places significant limits on the number of nucleotide sequences that can represent probable bacterial chromosomes. Transition matrix usage is largely conserved by taxa, indicating that this property is likely

  2. Metatranscriptomics reveals overall active bacterial composition in caries lesions

    Directory of Open Access Journals (Sweden)

    Aurea Simón-Soro

    2014-10-01

    Full Text Available Background: Identifying the microbial species in caries lesions is instrumental to determine the etiology of dental caries. However, a significant proportion of bacteria in carious lesions have not been cultured, and the use of molecular methods has been limited to DNA-based approaches, which detect both active and inactive or dead microorganisms. Objective: To identify the RNA-based, metabolically active bacterial composition of caries lesions at different stages of disease progression in order to provide a list of potential etiological agents of tooth decay. Design: Non-cavitated enamel caries lesions (n=15 and dentin caries lesions samples (n=12 were collected from 13 individuals. RNA was extracted and cDNA was constructed, which was used to amplify the 16S rRNA gene. The resulting 780 bp polymerase chain reaction products were pyrosequenced using Titanium-plus chemistry, and the sequences obtained were used to determine the bacterial composition. Results: A mean of 4,900 sequences of the 16S rRNA gene with an average read length of 661 bp was obtained per sample, giving a comprehensive view of the active bacterial communities in caries lesions. Estimates of bacterial diversity indicate that the microbiota of cavities is highly complex, each sample containing between 70 and 400 metabolically active species. The composition of these bacterial consortia varied among individuals and between caries lesions of the same individuals. In addition, enamel and dentin lesions had a different bacterial makeup. Lactobacilli were found almost exclusively in dentin cavities. Streptococci accounted for 40% of the total active community in enamel caries, and 20% in dentin caries. However, Streptococcus mutans represented only 0.02–0.73% of the total bacterial community. Conclusions: The data indicate that the etiology of dental caries is tissue dependent and that the disease has a clear polymicrobial origin. The low proportion of mutans streptococci

  3. The effect of the macrolide antibiotic tylosin on microbial diversity in the canine small intestine as demonstrated by massive parallel 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Wolcott Randy D

    2009-10-01

    Full Text Available Abstract Background Recent studies have shown that the fecal microbiota is generally resilient to short-term antibiotic administration, but some bacterial taxa may remain depressed for several months. Limited information is available about the effect of antimicrobials on small intestinal microbiota, an important contributor to gastrointestinal health. The antibiotic tylosin is often successfully used for the treatment of chronic diarrhea in dogs, but its exact mode of action and its effect on the intestinal microbiota remain unknown. The aim of this study was to evaluate the effect of tylosin on canine jejunal microbiota. Tylosin was administered at 20 to 22 mg/kg q 24 hr for 14 days to five healthy dogs, each with a pre-existing jejunal fistula. Jejunal brush samples were collected through the fistula on days 0, 14, and 28 (14 days after withdrawal of tylosin. Bacterial diversity was characterized using massive parallel 16S rRNA gene pyrosequencing. Results Pyrosequencing revealed a previously unrecognized species richness in the canine small intestine. Ten bacterial phyla were identified. Microbial populations were phylogenetically more similar during tylosin treatment. However, a remarkable inter-individual response was observed for specific taxa. Fusobacteria, Bacteroidales, and Moraxella tended to decrease. The proportions of Enterococcus-like organisms, Pasteurella spp., and Dietzia spp. increased significantly during tylosin administration (p Escherichia coli-like organisms increased by day 28 (p = 0.04. These changes were not accompanied by any obvious clinical effects. On day 28, the phylogenetic composition of the microbiota was similar to day 0 in only 2 of 5 dogs. Bacterial diversity resembled the pre-treatment state in 3 of 5 dogs. Several bacterial taxa such as Spirochaetes, Streptomycetaceae, and Prevotellaceae failed to recover at day 28 (p Conclusion Tylosin may lead to prolonged effects on the composition and diversity of

  4. Inhibition of the endosymbiont "Candidatus Midichloria mitochondrii" during 16S rRNA gene profiling reveals potential pathogens in Ixodes ticks from Australia.

    Science.gov (United States)

    Gofton, Alexander W; Oskam, Charlotte L; Lo, Nathan; Beninati, Tiziana; Wei, Heng; McCarl, Victoria; Murray, Dáithí C; Paparini, Andrea; Greay, Telleasha L; Holmes, Andrew J; Bunce, Michael; Ryan, Una; Irwin, Peter

    2015-06-25

    The Australian paralysis tick (Ixodes holocyclus) is of significant medical and veterinary importance as a cause of dermatological and neurological disease, yet there is currently limited information about the bacterial communities harboured by these ticks and the risk of infectious disease transmission to humans and domestic animals. Ongoing controversy about the presence of Borrelia burgdorferi sensu lato (the aetiological agent of Lyme disease) in Australia increases the need to accurately identify and characterise bacteria harboured by I. holocyclus ticks. Universal PCR primers were used to amplify the V1-2 hyper-variable region of bacterial 16S rRNA genes present in DNA samples from I. holocyclus and I. ricinus ticks, collected in Australia and Germany respectively. The 16S amplicons were purified, sequenced on the Ion Torrent platform, and analysed in USEARCH, QIIME, and BLAST to assign genus and species-level taxonomy. Initial analysis of I. holocyclus and I. ricinus identified that > 95 % of the 16S sequences recovered belonged to the tick intracellular endosymbiont "Candidatus Midichloria mitochondrii" (CMM). A CMM-specific blocking primer was designed that decreased CMM sequences by approximately 96 % in both tick species and significantly increased the total detectable bacterial diversity, allowing identification of medically important bacterial pathogens that were previously masked by CMM. Borrelia burgdorferi sensu lato was identified in German I. ricinus, but not in Australian I. holocyclus ticks. However, bacteria of medical significance were detected in I. holocyclus ticks, including a Borrelia relapsing fever group sp., Bartonella henselae, novel "Candidatus Neoehrlichia" spp., Clostridium histolyticum, Rickettsia spp., and Leptospira inadai. Abundant bacterial endosymbionts, such as CMM, limit the effectiveness of next-generation 16S bacterial community profiling in arthropods by masking less abundant bacteria, including pathogens. Specific

  5. Bacterial surface adaptation

    Science.gov (United States)

    Utada, Andrew

    2014-03-01

    Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.

  6. Bacterial Meningitis in Infants

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2004-04-01

    Full Text Available A retrospective study of 80 infantile patients (ages 30-365 days; 47 male, 33 female with culture-proven bacterial meningitis seen over a 16 year period (1986-2001 is reported from Taiwan.

  7. Factitious Bacterial Meningitis Revisited

    Science.gov (United States)

    Peterson, E.; Thrupp, L.; Uchiyama, N.; Hawkins, B.; Wolvin, B.; Greene, G.

    1982-01-01

    Nonviable gram-negative bacilli were seen in smears of cerebrospinal fluid from eight infants in whom bacterial meningitis was ruled out. Tubes from commercial kits were the source of the factitious organisms. PMID:7153328

  8. Vimentin in Bacterial Infections

    DEFF Research Database (Denmark)

    Mak, Tim N; Brüggemann, Holger

    2016-01-01

    filaments (IFs). IFs have not only roles in maintaining the structural integrity of the cell, but they are also involved in many cellular processes including cell adhesion, immune signaling, and autophagy, processes that are important in the context of bacterial infections. Here, we summarize the knowledge...... about the role of IFs in bacterial infections, focusing on the type III IF protein vimentin. Recent studies have revealed the involvement of vimentin in host cell defenses, acting as ligand for several pattern recognition receptors of the innate immune system. Two main aspects of bacteria......-vimentin interactions are presented in this review: the role of vimentin in pathogen-binding on the cell surface and subsequent bacterial invasion and the interaction of cytosolic vimentin and intracellular pathogens with regards to innate immune signaling. Mechanistic insight is presented involving distinct bacterial...

  9. IDENTIFICATION OF A LOCAL PROBIOTIC BACTERIUM USING 16S rRNA GENE SEQUENCE THAT WAS USED FOR FIELD TRIAL TO ENHANCED WHITELEG SHRIMP (Litopenaeus vannamei SURVIVAL

    Directory of Open Access Journals (Sweden)

    Tb. Haeru Rahayu

    2015-12-01

    Full Text Available The use of local probiotics in the culture of aquatic organisms is increasing with the demand for more environmental-friendly aquaculture practices. The local bacterium isolate considered as a probiotic was added into the water of whiteleg shrimp (Litopenaeus vannamei culture in a field trial. Four rectangular plastic ponds (ca. 20 m x 30 m per pond were used for 100 days experimentation for six consecutive crops in two years experiment. Survival, harvest size, feed conversion ratio (FCR and Vibrio bacterial count was compared with those of shrimp receiving and none of local isolate. Identification based on 16S rRNA gene sequence shown those isolate was Bacillus pumilus strain DURCK14 with 99% homology. Water shrimp pond added a local isolate had significantly higher survival at about 10.0% to 11.7% than shrimp without added the isolate (p<0.05, and better FCR, but no significant different in shrimp harvest size. Vibrio bacterial was undetected by total plate count. Moreover, it shown better projected yields on an annual basis (three crops per year.

  10. Distribution and diversity of bacteria in a saline meromictic lake as determined by PCR-DGGE of 16S rRNA gene fragments.

    Science.gov (United States)

    Gugliandolo, Concetta; Lentini, Valeria; Maugeri, Teresa L

    2011-01-01

    The variations in vertical distribution and composition of bacteria in the meromictic Lake Faro (Messina, Italy) were analysed by culture-independent methods in two different mixing conditions. Water samples were collected from a central station from the surface to the bottom (30 m depth) on two different sampling dates--the first characterised by a well-mixed water mass and the second by a marked stratification. A 'red-water' layer, caused by a dense growth of photosynthetic sulphur bacteria, was present at a depth of 25 m in December 2005 and at 15 m in August 2006, defining two different zones in terms of their physicochemical properties. The vertical distribution of bacterioplankton showed that the interface zones were more densely populated than others. In both sampling periods, the highest numbers of live cells were observed within 'red water' layers. The dominant phylotypes of the bacterial community were determined by sequencing the Denaturing Gradient Gel Electrophoresis (DGGE) bands resulting from PCR amplification of 16S rRNA gene fragments. The number of DGGE bands, considered indicative of the total species richness, did not vary predictably across the two different sampling periods. Proteobacteria (α-, γ-, δ- and ε subclass members), Cytophaga-Flavobacterium-Bacteroides, green sulphur bacteria and Cyanobacteria were retrieved from Lake Faro. Most of the bands showed DNA sequences that did not match with other previously described organisms, suggesting the presence of new indigenous bacterial phylotypes.

  11. Simultaneous Detection of Three Bacterial Seed-Borne Diseases in Rice Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    In Jeong Kang

    2016-12-01

    Full Text Available Burkholderia glumae (bacterial grain rot, Xanthomonas oryzae pv. oryzae (bacterial leaf blight, and Acidovorax avenae subsp. avenae (bacterial brown stripe are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae, and transposase A gene sequence for X. oryzae pv. oryzae, three sets of primers had been designed to produce 402 bp for B. glumae, 490 bp for X. oryzae, and 290 bp for A. avenae subsp. avenae with the 63°C as an optimum annealing temperature. Samples collected from naturally infected fields were detected with two bacteria, B. glumae and A. avenae subsp. avenae but X. oryzae pv. oryzae was not detected. This assay can be used to identify pathogens directly from infected seeds, and will be an effective tool for the identification of the three pathogens in rice plants.

  12. Simultaneous Detection of Three Bacterial Seed-Borne Diseases in Rice Using Multiplex Polymerase Chain Reaction.

    Science.gov (United States)

    Kang, In Jeong; Kang, Mi-Hyung; Noh, Tae-Hwan; Shim, Hyeong Kwon; Shin, Dong Bum; Heu, Suggi

    2016-12-01

    Burkholderia glumae (bacterial grain rot), Xanthomonas oryzae pv. oryzae (bacterial leaf blight), and Acidovorax avenae subsp. avenae (bacterial brown stripe) are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae , and transposase A gene sequence for X. oryzae pv. oryzae , three sets of primers had been designed to produce 402 bp for B. glumae , 490 bp for X. oryzae , and 290 bp for A. avenae subsp. avenae with the 63°C as an optimum annealing temperature. Samples collected from naturally infected fields were detected with two bacteria, B. glumae and A. avenae subsp. avenae but X. oryzae pv. oryzae was not detected. This assay can be used to identify pathogens directly from infected seeds, and will be an effective tool for the identification of the three pathogens in rice plants.

  13. Bacterial colonization of colonic crypt mucous gel and disease activity in ulcerative colitis.

    LENUS (Irish Health Repository)

    Rowan, Fiachra

    2012-02-01

    OBJECTIVE: To optimize total bacterial 16S rRNA quantification in microdissected colonic crypts in healthy controls and patients with ulcerative colitis (UC) and to characterize the findings with disease activity. BACKGROUND: Microscopic and molecular techniques have recently converged to allow bacterial enumeration in remote anatomic locations [eg, crypt-associated mucous gel (CAMG)]. The aims of this study were to combine laser capture microdissection (LCM) and 16S rRNA-based quantitative polymerase chain reaction (qPCR) to determine total bacterial copy number in CAMG both in health and in UC and to characterize the findings with disease activity. METHODS: LCM was used to microdissect CAMG from colonic mucosal biopsies from controls (n = 20) and patients with acute (n = 10) or subacute (n = 10) UC. Pan-bacterial 16S rRNA copy number per millimeter square in samples from 6 locations across the large bowel was obtained by qPCR using Desulfovibrio desulfuricans as a reference strain. Copy numbers were correlated with the UC disease activity index (UCDAI) and the simple clinical colitis activity index (SCCAI). RESULTS: Bacterial colonization of CAMG was detectable in all groups. Copy numbers were significantly reduced in acute UC. In subacute colitis, there was a positive correlation between copy number and UCDAI and SCCAI in the ascending, transverse and sigmoid colon. CONCLUSIONS: This study describes a sensitive method of quantitatively assessing bacterial colonization of the colonic CAMG. A positive correlation was found between CAMG bacterial load and subacute disease activity in UC, whereas detectable bacterial load was reduced in acute UC.

  14. Differential growth responses of soil bacterial taxa to carbon substrates of varying chemical recalcitrance

    Energy Technology Data Exchange (ETDEWEB)

    Goldfarb, K.C.; Karaoz, U.; Hanson, C.A.; Santee, C.A.; Bradford, M.A.; Treseder, K.K.; Wallenstein, M.D.; Brodie, E.L.

    2011-04-18

    Soils are immensely diverse microbial habitats with thousands of co-existing bacterial, archaeal, and fungal species. Across broad spatial scales, factors such as pH and soil moisture appear to determine the diversity and structure of soil bacterial communities. Within any one site however, bacterial taxon diversity is high and factors maintaining this diversity are poorly resolved. Candidate factors include organic substrate availability and chemical recalcitrance, and given that they appear to structure bacterial communities at the phylum level, we examine whether these factors might structure bacterial communities at finer levels of taxonomic resolution. Analyzing 16S rRNA gene composition of nucleotide analog-labeled DNA by PhyloChip microarrays, we compare relative growth rates on organic substrates of increasing chemical recalcitrance of >2,200 bacterial taxa across 43 divisions/phyla. Taxa that increase in relative abundance with labile organic substrates (i.e., glycine, sucrose) are numerous (>500), phylogenetically clustered, and occur predominantly in two phyla (Proteobacteria and Actinobacteria) including orders Actinomycetales, Enterobacteriales, Burkholderiales, Rhodocyclales, Alteromonadales, and Pseudomonadales. Taxa increasing in relative abundance with more chemically recalcitrant substrates (i.e., cellulose, lignin, or tannin-protein) are fewer (168) but more phylogenetically dispersed, occurring across eight phyla and including Clostridiales, Sphingomonadalaes, Desulfovibrionales. Just over 6% of detected taxa, including many Burkholderiales increase in relative abundance with both labile and chemically recalcitrant substrates. Estimates of median rRNA copy number per genome of responding taxa demonstrate that these patterns are broadly consistent with bacterial growth strategies. Taken together, these data suggest that changes in availability of intrinsically labile substrates may result in predictable shifts in soil bacterial composition.

  15. A renaissance for the pioneering 16S rRNA gene.

    Science.gov (United States)

    Tringe, Susannah G; Hugenholtz, Philip

    2008-10-01

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the past quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata, and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  16. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  17. Structural analysis of base substitutions in Thermus thermophilus 16S rRNA conferring streptomycin resistance.

    Science.gov (United States)

    Demirci, Hasan; Murphy, Frank V; Murphy, Eileen L; Connetti, Jacqueline L; Dahlberg, Albert E; Jogl, Gerwald; Gregory, Steven T

    2014-08-01

    Streptomycin is a bactericidal antibiotic that induces translational errors. It binds to the 30S ribosomal subunit, interacting with ribosomal protein S12 and with 16S rRNA through contacts with the phosphodiester backbone. To explore the structural basis for streptomycin resistance, we determined the X-ray crystal structures of 30S ribosomal subunits from six streptomycin-resistant mutants of Thermus thermophilus both in the apo form and in complex with streptomycin. Base substitutions at highly conserved residues in the central pseudoknot of 16S rRNA produce novel hydrogen-bonding and base-stacking interactions. These rearrangements in secondary structure produce only minor adjustments in the three-dimensional fold of the pseudoknot. These results illustrate how antibiotic resistance can occur as a result of small changes in binding site conformation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. [Diagnosis of bacterial vaginosis].

    Science.gov (United States)

    Djukić, Slobodanka; Ćirković, Ivana; Arsić, Biljana; Garalejić, Eliana

    2013-01-01

    Bacterial vaginosis is a common, complex clinical syndrome characterized by alterations in the normal vaginal flora. When symptomatic, it is associated with a malodorous vaginal discharge and on occasion vaginal burning or itching. Under normal conditions, lactobacilli constitute 95% of the bacteria in the vagina. Bacterial vaginosis is associated with severe reduction or absence of the normal H2O2-producing lactobacilli and overgrowth of anaerobic bacteria and Gardnerella vaginalis, Atopobium vaginae, Mycoplasma hominis and Mobiluncus species. Most types of infectious disease are diagnosed by culture, by isolating an antigen or RNA/DNA from the microbe, or by serodiagnosis to determine the presence of antibodies to the microbe. Therefore, demonstration of the presence of an infectious agent is often a necessary criterion for the diagnosis of the disease. This is not the case for bacterial vaginosis, since the ultimate cause of the disease is not yet known. There are a variety of methods for the diagnosis of bacterial vaginosis but no method can at present be regarded as the best. Diagnosing bacterial vaginosis has long been based on the clinical criteria of Amsel, whereby three of four defined criteria must be satisfied. Nugent's scoring system has been further developed and includes validation of the categories of observable bacteria structures. Up-to-date molecular tests are introduced, and better understanding of vaginal microbiome, a clear definition for bacterial vaginosis, and short-term and long-term fluctuations in vaginal microflora will help to better define molecular tests within the broader clinical context.

  19. Broilers fed dietary vitamins harbor higher diversity of cecal bacteria and higher ratio of Clostridium, Faecalibacterium, and Lactobacillus than broilers with no dietary vitamins revealed by 16S rRNA gene clone libraries.

    Science.gov (United States)

    Luo, Yu-heng; Peng, Huan-wei; Wright, André-Denis G; Bai, Shi-ping; Ding, Xue-mei; Zeng, Qiu-feng; Li, Hua; Zheng, Ping; Su, Zhuo-wei; Cui, Ren-yong; Zhang, Ke-ying

    2013-09-01

    Research on the interaction between dietary vitamins and intestinal bacteria is poorly understood. To investigate the effect of dietary vitamins on the cecal bacterial communities, 2 bacterial 16S rRNA gene clone libraries were constructed from pooled PCR products obtained from the cecal digesta of 28-d broilers fed diets with vitamins (V) at the NRC level or with no vitamins (NV). The results showed that BW gain and average feed intake of V broilers was significantly higher (P vitamins can increase the ratio of facultative pathogenic bacteria and decrease the diversity of bacteria in the cecum of broilers. Our results provide new leads for further investigations on the interaction between dietary vitamin additives and the gut health of broilers.

  20. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  1. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  2. Phylogenetic Analysis of Cryptosporidium Parasites Based on the Small-Subunit rRNA Gene Locus

    OpenAIRE

    Xiao, Lihua; Escalante, Lillian; Yang, Chunfu; Sulaiman, Irshad; Escalante, Anannias A.; Montali, Richard J.; Fayer, Ronald; Lal, Altaf A.

    1999-01-01

    Biological data support the hypothesis that there are multiple species in the genus Cryptosporidium, but a recent analysis of the available genetic data suggested that there is insufficient evidence for species differentiation. In order to resolve the controversy in the taxonomy of this parasite genus, we characterized the small-subunit rRNA genes of Cryptosporidium parvum, Cryptosporidium baileyi, Cryptosporidium muris, and Cryptosporidium serpentis and performed a phylogenetic analysis of t...

  3. Prevalence of 16S rRNA methylase genes among b-lactamase ...

    African Journals Online (AJOL)

    2014-07-07

    Jul 7, 2014 ... 16S rRNA methylase genes bla genes were detected in b-lactamase-producing isolates by PCR using the previously reported oligonucleotide primers for blaTEM-1, blaSHV-12, blaCTX-M-14 (18), and the. armA, rmtA, rmtB, rmtC, rmtD, and npmA genes by using the following previously described primers ...

  4. Use of 16S ribosomal RNA gene analyses to characterize the bacterial signature associated with poor oral health in West Virginia.

    Science.gov (United States)

    Olson, Joan C; Cuff, Christopher F; Lukomski, Slawomir; Lukomska, Ewa; Canizales, Yeremi; Wu, Bei; Crout, Richard J; Thomas, John G; McNeil, Daniel W; Weyant, Robert J; Marazita, Mary L; Paster, Bruce J; Elliott, Thomas

    2011-03-01

    West Virginia has the worst oral health in the United States, but the reasons for this are unclear. This pilot study explored the etiology of this disparity using culture-independent analyses to identify bacterial species associated with oral disease. Bacteria in subgingival plaque samples from twelve participants in two independent West Virginia dental-related studies were characterized using 16S rRNA gene sequencing and Human Oral Microbe Identification Microarray (HOMIM) analysis. Unifrac analysis was used to characterize phylogenetic differences between bacterial communities obtained from plaque of participants with low or high oral disease, which was further evaluated using clustering and Principal Coordinate Analysis. Statistically different bacterial signatures (Poral disease in West Virginia based on 16S rRNA gene sequencing. Low disease contained a high frequency of Veillonella and Streptococcus, with a moderate number of Capnocytophaga. High disease exhibited substantially increased bacterial diversity and included a large proportion of Clostridiales cluster bacteria (Selenomonas, Eubacterium, Dialister). Phylogenetic trees constructed using 16S rRNA gene sequencing revealed that Clostridiales were repeated colonizers in plaque associated with high oral disease, providing evidence that the oral environment is somehow influencing the bacterial signature linked to disease. Culture-independent analyses identified an atypical bacterial signature associated with high oral disease in West Virginians and provided evidence that the oral environment influenced this signature. Both findings provide insight into the etiology of the oral disparity in West Virginia.

  5. A soil-based microbial biofilm exposed to 2,4-D: bacterial community development and establishment of conjugative plasmid pJP4

    DEFF Research Database (Denmark)

    Aspray, T.J.; Hansen, Susse Kirkelund; Burns, R.G.

    2005-01-01

    A soil suspension was used as a source to initiate the development of microbial communities in flow cells irrigated with 2,4-dichlorophenoxyacetic acid (2,4-D) (25 mu g ml(-1)). Culturable bacterial members of the community were identified by 16S rRNA gene sequencing and found to be members...

  6. Characterization of bacterial populations in Danish raw milk cheeses made with different starter cultures by denaturating gradient gel electrophoresis and pyrosequencing

    DEFF Research Database (Denmark)

    Masoud, Wafa Mahmoud Hasan; Takamiya, Monica K Wik; Vogensen, Finn Kvist

    2011-01-01

    ripening. Other bacteria like Corynebacterium, Halomonas, Pediococcus, Micrococcus and Staphylococcus, which were encountered in some cheese samples at low percentages compared with the total bacterial populations, were only detected by pyrosequencing. 16S rRNA gene pyrosequencing is an efficient method...

  7. Intraspecific sequence variation in 16S rRNA gene of Ureaplasma diversum isolates.

    Science.gov (United States)

    Marques, L M; Buzinhani, M; Guimaraes, A M S; Marques, R C P; Farias, S T; Neto, R L; Yamaguti, M; Oliveira, R C; Timenetsky, J

    2011-08-26

    Ureaplasma diversum infection in bulls may result in seminal vesiculitis, balanoposthitis and alterations in spermatozoids. In cows, it can cause placentitis, fetal alveolitis, abortion and the birth of weak calves. U. diversum ATCC 49782 (serogroups A), ATCC 49783 (serogroup C) and 34 field isolates were used for this study. These microorganisms were submitted to Polymerase Chain Reaction for 16S gene sequence determination using Taq High Fidelity and the products were purified and bi-directionally sequenced. Using the sequence obtained, a fragment containing four hypervariable regions was selected and nucleotide polymorphisms were identified based on their position within the 16S rRNA gene. Forty-four single nucleotide polymorphisms (SNP) were detected. The genotypic variability of the 16S rRNA gene of U. diversum isolates shows that the taxonomy classification of these organisms is likely much more complex than previously described and that 16S rRNA gene sequencing may be used to suggest an epidemiologic pattern of different origin strains. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Directory of Open Access Journals (Sweden)

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  9. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    Science.gov (United States)

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  10. Compositional stability of a salivary bacterial population against supragingival microbiota shift following periodontal therapy.

    Directory of Open Access Journals (Sweden)

    Wataru Yamanaka

    Full Text Available Supragingival plaque is permanently in contact with saliva. However, the extent to which the microbiota contributes to the salivary bacterial population remains unclear. We compared the compositional shift in the salivary bacterial population with that in supragingival plaque following periodontal therapy. Samples were collected from 19 patients with periodontitis before and after periodontal therapy (mean sample collection interval, 25.8 ± 2.6 months, and their bacterial composition was investigated using barcoded pyrosequencing analysis of the 16S rRNA gene. Phylogenetic community analysis using the UniFrac distance metric revealed that the overall bacterial community composition of saliva is distinct from that of supragingival plaque, both pre- and post-therapy. Temporal variation following therapy in the salivary bacterial population was significantly smaller than in the plaque microbiota, and the post-therapy saliva sample was significantly more similar to that pre-therapy from the same individual than to those from other subjects. Following periodontal therapy, microbial richness and biodiversity were significantly decreased in the plaque microbiota, but not in the salivary bacterial population. The operational taxonomic units whose relative abundances changed significantly after therapy were not common to the two microbiotae. These results reveal the compositional stability of salivary bacterial populations against shifts in the supragingival microbiota, suggesting that the effect of the supragingival plaque microbiota on salivary bacterial population composition is limited.

  11. Diversity of Bacterial Communities of Fitness Center Surfaces in a U.S. Metropolitan Area

    Directory of Open Access Journals (Sweden)

    Nabanita Mukherjee

    2014-12-01

    Full Text Available Public fitness centers and exercise facilities have been implicated as possible sources for transmitting community-acquired bacterial infections. However, the overall diversity of the bacterial community residing on the surfaces in these indoor environments is still unknown. In this study, we investigated the overall bacterial ecology of selected fitness centers in a metropolitan area (Memphis, TN, USA utilizing culture-independent pyrosequencing of the 16S rRNA genes. Samples were collected from the skin-contact surfaces (e.g., exercise instruments, floor mats, handrails, etc. within fitness centers. Taxonomical composition revealed the abundance of Firmicutes phyla, followed by Proteobacter and Actinobacteria, with a total of 17 bacterial families and 25 bacterial genera. Most of these bacterial genera are of human and environmental origin (including, air, dust, soil, and water. Additionally, we found the presence of some pathogenic or potential pathogenic bacterial genera including Salmonella, Staphylococcus, Klebsiella, and Micrococcus. Staphylococcus was found to be the most prevalent genus. Presence of viable forms of these pathogens elevates risk of exposure of any susceptible individuals. Several factors (including personal hygiene, surface cleaning and disinfection schedules of the facilities may be the reasons for the rich bacterial diversity found in this study. The current finding underscores the need to increase public awareness on the importance of personal hygiene and sanitation for public gym users.

  12. Diversity of bacterial communities of fitness center surfaces in a U.S. metropolitan area.

    Science.gov (United States)

    Mukherjee, Nabanita; Dowd, Scot E; Wise, Andy; Kedia, Sapna; Vohra, Varun; Banerjee, Pratik

    2014-12-03

    Public fitness centers and exercise facilities have been implicated as possible sources for transmitting community-acquired bacterial infections. However, the overall diversity of the bacterial community residing on the surfaces in these indoor environments is still unknown. In this study, we investigated the overall bacterial ecology of selected fitness centers in a metropolitan area (Memphis, TN, USA) utilizing culture-independent pyrosequencing of the 16S rRNA genes. Samples were collected from the skin-contact surfaces (e.g., exercise instruments, floor mats, handrails, etc.) within fitness centers. Taxonomical composition revealed the abundance of Firmicutes phyla, followed by Proteobacter and Actinobacteria, with a total of 17 bacterial families and 25 bacterial genera. Most of these bacterial genera are of human and environmental origin (including, air, dust, soil, and water). Additionally, we found the presence of some pathogenic or potential pathogenic bacterial genera including Salmonella, Staphylococcus, Klebsiella, and Micrococcus. Staphylococcus was found to be the most prevalent genus. Presence of viable forms of these pathogens elevates risk of exposure of any susceptible individuals. Several factors (including personal hygiene, surface cleaning and disinfection schedules of the facilities) may be the reasons for the rich bacterial diversity found in this study. The current finding underscores the need to increase public awareness on the importance of personal hygiene and sanitation for public gym users.

  13. Amazonian dark Earth and plant species from the Amazon region contribute to shape rhizosphere bacterial communities.

    Science.gov (United States)

    Barbosa Lima, Amanda; Cannavan, Fabiana Souza; Navarrete, Acacio Aparecido; Teixeira, Wenceslau Geraldes; Kuramae, Eiko Eurya; Tsai, Siu Mui

    2015-05-01

    Amazonian Dark Earths (ADE) or Terra Preta de Índio formed in the past by pre-Columbian populations are highly sustained fertile soils supported by microbial communities that differ from those extant in adjacent soils. These soils are found in the Amazon region and are considered as a model soil when compared to the surrounding and background soils. The aim of this study was to assess the effects of ADE and its surrounding soil on the rhizosphere bacterial communities of two leguminous plant species that frequently occur in the Amazon region in forest sites (Mimosa debilis) and open areas (Senna alata). Bacterial community structure was evaluated using terminal restriction fragment length polymorphism (T-RFLP) and bacterial community composition by V4 16S rRNA gene region pyrosequencing. T-RFLP analysis showed effect of soil types and plant species on rhizosphere bacterial community structure. Differential abundance of bacterial phyla, such as Acidobacteria, Actinobacteria, Verrucomicrobia, and Firmicutes, revealed that soil type contributes to shape the bacterial communities. Furthermore, bacterial phyla such as Firmicutes and Nitrospira were mostly influenced by plant species. Plant roots influenced several soil chemical properties, especially when plants were grown in ADE. These results showed that differences observed in rhizosphere bacterial community structure and composition can be influenced by plant species and soil fertility due to variation in soil attributes.

  14. Decontamination Efficiency of Fish Bacterial Flora from Processing Surfaces

    Directory of Open Access Journals (Sweden)

    Birna Guðbjörnsdóttir

    2009-01-01

    Full Text Available There are numerous parameters that can influence bacterial decontamination during washing of machinery and equipment in a food processing establishment. Incomplete decontamination of bacteria will increase the risk of biofilm formation and consequently increase the risk of pathogen contamination or prevalence of other undesirable microorganisms such as spoilage bacteria in the processing line. The efficiency of a typical washing protocol has been determined by testing three critical parameters and their effects on bacterial decontamination. Two surface materials (plastic and stainless steel, water temperatures (7 and 25 °C and detergent concentrations (2 and 4 % were used for this purpose in combination with two types of detergents. Biofilm was prepared on the surfaces with undefined bacterial flora obtained from minced cod fillets. The bacterial flora of the biofilm was characterised by cultivation and molecular analysis of 16S rRNA genes. All different combinations of washing protocols tested were able to remove more than 99.9 % of the bacteria in the biofilm and reduce the cell number from 7 to 0 or 2 log units of bacteria/cm2. The results show that it is possible to use less diluted detergents than recommended with comparable success, and it is easier to clean surface material made of stainless steel compared to polyethylene plastic.

  15. Molecular bacterial diversity and bioburden of commercial airliner cabin air

    Energy Technology Data Exchange (ETDEWEB)

    La Duc, M.T.; Stuecker, T.; Venkateswaran, K. [California Inst. of Technology, Pasadena, CA (United States). Jet Propulsion Laboratory, Biotechnology and Planetary Protection Group

    2007-11-15

    Microorganisms that exist in aircraft air systems are considered to be the primary source of microbial contamination that can lead to illness shortly after flying. More than 600 million passengers board commercial airline flights annually in the United States alone. In this study, culture-independent, biomarker-targeted bacterial enumeration and identification strategies were used to estimate total bacterial burden and diversity within the cabin air of commercial airliners. Air-impingement was used to collect samples of microorganisms from 4 flights on 2 commercial carriers. The total viable microbial population ranged from below detection limits to 4.1 x 10{sup 6} cells/m{sup 3} of air. Microbes were found to gradually accumulate from the time of passenger boarding through mid-flight. A sharp decline in bacterial abundance was then observed. Representatives of the {alpha}, {beta} and {gamma} Proteobacteria, as well as Gram-positive bacteria, were isolated in varying abundance. Airline A had large abundances of Neisseria meningitidis rRNA gene sequences and Streptococcus oralis/mitis sequences. Airline B was dominated by pseudomonas synxantha sequences as well as N. meningitidis and S. oralis/mitis. The cabin air samples housed low bacterial diversity and were typically dominated by a particular subset of bacteria, notably opportunistic pathogenic inhabitants of the human respiratory tract and oral cavity. The microbes were found largely around the ventilation ducts and gasper conduits that supply cabin air. 45 refs., 4 tabs., 3 figs.

  16. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi, E-mail: shilpi@dbeb.iitd.ac.in

    2015-06-30

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture.

  17. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    International Nuclear Information System (INIS)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi

    2015-01-01

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture

  18. Influence of Starvation on the Structure of Gut-Associated Bacterial Communities in the Chinese White Pine Beetle (Dendroctonus armandi

    Directory of Open Access Journals (Sweden)

    Xia Hu

    2016-06-01

    Full Text Available This study investigated the influence of starvation on the structure of the gut bacterial community in the Chinese white pine beetle (Dendroctonus armandi. A total of 14 operational taxonomic units (OTUs0.03 clusters belonging to nine genera were identified. Denaturing gradient gel electrophoresis (DGGE profiles of bacterial PCR-amplified 16S rRNA gene fragments from the guts of starved male and female adults revealed that the bacterial community diversity increased after starvation. The dominant genus Citrobacter decreased significantly, whereas the genus Serratia increased in both starved female and starved male adults. The most predominant bacterial genus in D. armandi adults was Citrobacter, except for starved male adults, in which Serratia was the most abundant genus (27%. Our findings reveal that starvation affects gut bacterial dynamics in D. armandi, as has been observed in other insect species.

  19. Improved identification of Gordonia, Rhodococcus and Tsukamurella species by 5'-end 16S rRNA gene sequencing.

    Science.gov (United States)

    Wang, Tao; Kong, Fanrong; Chen, Sharon; Xiao, Meng; Sorrell, Tania; Wang, Xiaoyan; Wang, Shuo; Sintchenko, Vitali

    2011-01-01

    The identification of fastidious aerobic Actinomycetes such as Gordonia, Rhodococcus, and Tsukamurella has remained a challenge leading to clinically significant misclassifications. This study is intended to examine the feasibility of partial 5'-end 16S rRNA gene sequencing for the identification of Gordonia, Rhodococcus, and Tsukamurella, and defined potential reference sequences for species from each of these genera. The 16S rRNA gene sequence based identification algorithm for species identification was used and enhanced by aligning test sequences with reference sequences from the List of Prokaryotic Names with Standing in Nomenclature. Conventional PCR based 16S rRNA gene sequencing and the alignment of the isolate 16S rRNA gene sequence with reference sequences accurately identified 100% of clinical strains of aerobic Actinomycetes. While partial 16S rRNA gene sequences of reference type strains matched with the 16S rRNA gene sequences of 19 isolates in our data set, another 13 strains demonstrated a degree of polymorphism with a 1-4 bp difference in the regions of difference. 5'-end 606 bp 16S rRNA gene sequencing, coupled with the assignment of well defined reference sequences to clinically relevant species of bacteria, can be a useful strategy for improving the identification of clinically relevant aerobic Actinomycetes.

  20. [Phylogenetic comparison between Spirulina and Arthrospira based on 16S rRNA and rpoC1 gene].

    Science.gov (United States)

    Wu, Yuemei; Wang, Suying; Dong, Shirui

    2016-02-04

    Based on 16S rRNA and rpoC1 gene sequences, the phylogenetic relationship between Spirulina and Arthrospira were studied and compared. We amplified, sequenced and analyzed 16S rRNA and rpoC1 of 84 strains. Then the phylogenetic trees were constructed and compared. The conserved sites percentage, average G+C content and sequence identity of rpoC1 were 49.7%, 47.7%, 76%-100% respectively, significantly lower than 79.4%, 55.6% and 91%-100% of 16S rRNA, and the heterogeneity degree was higher. The trees generated with two different genes showed similar topologies and thus inferred consistent phylogenetic relationships. Eighty-four experimental strains were divided into 3 groups belonging to 2 genera: F-35 1, F-904-2, F-1070 and TJBC14 were Spirulina and the rest were Arthrospira. Although morphospecies and geographical species could not be distinguished based on 16S rRNA and rpoC1 gene sequences, the bootstrap value of rpoC1 (100%) was higher than that of 16S rRNA (99%). Moreover, clustering effect of rpoC1 for Spirulina and Arthrospirai was better than 16S rRNA. Spirulina and Arthrospira were different genera, rpoC1 gene has more advantage to distinguish the strains in the same genus than that of 16S rRNA gene.

  1. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  2. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water.

    Science.gov (United States)

    Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S

    2015-10-01

    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  3. Microbiological changes, shelf life and identification of initial and spoilage microbiota of sea bream fillets stored under various conditions using 16S rRNA gene analysis.

    Science.gov (United States)

    Parlapani, Foteini F; Kormas, Konstantinos Ar; Boziaris, Ioannis S

    2015-09-01

    Sea bream fillets are one of the most important value-added products of the seafood market. Fresh seafood spoils mainly owing to bacterial action. In this study an exploration of initial and spoilage microbiota of sea bream fillets stored under air and commercial modified atmosphere packaging (MAP) at 0 and 5 °C was conducted by 16S rRNA gene sequence analysis of isolates grown on plates. Sensory evaluation and enumeration of total viable counts and spoilage microorganisms were also conducted to determine shelf life and bacterial growth respectively. Different temperatures and atmospheres affected growth and synthesis of spoilage microbiota as well as shelf life. Shelf life under air at 0 and 5 °C was 14 and 5 days respectively, while under MAP it was 20 and 8 days respectively. Initial microbiota were dominated by Pseudomonas fluorescens, Psychrobacter and Macrococcus caseolyticus. Different temperatures and atmospheres affected the synthesis of spoilage microbiota. At the end of shelf life, different phylotypes of Pseudomonas closely related to Pseudomonas fragi were found to dominate in most cases, while Pseudomonas veronii dominated in fillets under MAP at 0 °C. Furthermore, in fillets under MAP at 5 °C, new dominant species such as Carnobacterium maltaromaticum, Carnobacterium divergens and Vagococcus fluvialis were revealed. Different temperature and atmospheric conditions affected bacterial growth, shelf life and the synthesis of spoilage microbiota. Molecular identification revealed species and strains of microorganisms that have not been reported before for sea bream fillets stored under various conditions, thus providing valuable information regarding microbiological spoilage. © 2014 Society of Chemical Industry.

  4. Anterior foregut microbiota of the glassy-winged sharpshooter explored using deep 16S rRNA gene sequencing from individual insects.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available The glassy-winged sharpshooter (GWSS is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony, were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas. Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the

  5. Presence of pathogenic Escherichia coli is correlated with bacterial community diversity and composition on pre-harvest cattle hides.

    Science.gov (United States)

    Chopyk, Jessica; Moore, Ryan M; DiSpirito, Zachary; Stromberg, Zachary R; Lewis, Gentry L; Renter, David G; Cernicchiaro, Natalia; Moxley, Rodney A; Wommack, K Eric

    2016-03-22

    Since 1982, specific serotypes of Shiga toxin-producing Escherichia coli (STEC) have been recognized as significant foodborne pathogens acquired from contaminated beef and, more recently, other food products. Cattle are the major reservoir hosts of these organisms, and while there have been advancements in food safety practices and industry standards, STEC still remains prevalent within beef cattle operations with cattle hides implicated as major sources of carcass contamination. To investigate whether the composition of hide-specific microbial communities are associated with STEC prevalence, 16S ribosomal RNA (rRNA) bacterial community profiles were obtained from hide and fecal samples collected from a large commercial feedlot over a 3-month period. These community data were examined amidst an extensive collection of prevalence data on a subgroup of STEC that cause illness in humans, referred to as enterohemorrhagic E. coli (EHEC). Fecal 16S rRNA gene OTUs (operational taxonomic units) were subtracted from the OTUs found within each hide 16S rRNA amplicon library to identify hide-specific bacterial populations. Comparative analysis of alpha diversity revealed a significant correlation between low bacterial diversity and samples positive for the presence of E. coli O157:H7 and/or the non-O157 groups: O26, O111, O103, O121, O45, and O145. This trend occurred regardless of diversity metric or fecal OTU presence. The number of EHEC serogroups present in the samples had a compounding effect on the inverse relationship between pathogen presence and bacterial diversity. Beta diversity data showed differences in bacterial community composition between samples containing O157 and non-O157 populations, with certain OTUs demonstrating significant changes in relative abundance. The cumulative prevalence of the targeted EHEC serogroups was correlated with low bacterial community diversity on pre-harvest cattle hides. Understanding the relationship between indigenous hide

  6. Canopy soil bacterial communities altered by severing host tree limbs

    Directory of Open Access Journals (Sweden)

    Cody R. Dangerfield

    2017-09-01

    Full Text Available Trees of temperate rainforests host a large biomass of epiphytic plants, which are associated with soils formed in the forest canopy. Falling of epiphytic material results in the transfer of carbon and nutrients from the canopy to the forest floor. This study provides the first characterization of bacterial communities in canopy soils enabled by high-depth environmental sequencing of 16S rRNA genes. Canopy soil included many of the same major taxonomic groups of Bacteria that are also found in ground soil, but canopy bacterial communities were lower in diversity and contained different operational taxonomic units. A field experiment was conducted with epiphytic material from six Acer macrophyllum trees in Olympic National Park, Washington, USA to document changes in the bacterial communities of soils associated with epiphytic material that falls to the forest floor. Bacterial diversity and composition of canopy soil was highly similar, but not identical, to adjacent ground soil two years after transfer to the forest floor, indicating that canopy bacteria are almost, but not completely, replaced by ground soil bacteria. Furthermore, soil associated with epiphytic material on branches that were severed from the host tree and suspended in the canopy contained altered bacterial communities that were distinct from those in canopy material moved to the forest floor. Therefore, the unique nature of canopy soil bacteria is determined in part by the host tree and not only by the physical environmental conditions associated with the canopy. Connection to the living tree appears to be a key feature of the canopy habitat. These results represent an initial survey of bacterial diversity of the canopy and provide a foundation upon which future studies can more fully investigate the ecological and evolutionary dynamics of these communities.

  7. Bacterial Cell Mechanics.

    Science.gov (United States)

    Auer, George K; Weibel, Douglas B

    2017-07-25

    Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.

  8. Nucleotide sequencing and analysis of 16S rDNA and 16S-23S rDNA internal spacer region (ISR) of Taylorella equigenitalis, as an important pathogen for contagious equine metritis (CEM).

    Science.gov (United States)

    Kagawa, S; Nagano, Y; Tazumi, A; Murayama, O; Millar, B C; Moore, J E; Matsuda, M

    2006-05-01

    The primer set for 16S rDNA amplified an amplicon of about 1500 bp in length for three strains of Taylorella equigenitalis (NCTC11184(T), Kentucky188 and EQ59). Sequence differences of the 16S rDNA among the six sequences, including three reference sequences, occurred at only a few nucleotide positions and thus, an extremely high sequence similarity of the 16S rDNA was first demonstrated among the six sequences. In addition, the primer set for 16S-23S rDNA internal spacer region (ISR) amplified two amplicons about 1300 bp and 1200 bp in length for the three strains. The ISRs were estimated to be about 920 bp in length for large ISR-A and about 830 bp for small ISR-B. Sequence alignment of the ISR-A and ISR-B demonstrated about 10 base differences between NCTC11184(T) and EQ59 and between Kentucky188 and EQ59. However, only minor sequence differences were demonstrated between the ISR-A and ISR-B from NCTC11184(T) and Kentucky188, respectively. A typical order of the intercistronic tRNAs with the 29 nucleotide spacer of 5'-16S rDNA-tRNA(Ile)-tRNA(Ala)-23S rDNA-3' was demonstrated in the all ISRs. The ISRs may be useful for the discrimination amongst isolates of T. equigenitalis if sequencing is employed.

  9. The Structure of Aquifex aeolicus Ribosomal Protein S8 Reveals a Unique Subdomain That Contributes to Extremely-Tight Association With 16S rRNA

    Science.gov (United States)

    Menichelli, Elena; Edgcomb, Stephen P.; Recht, Michael I.; Williamson, James R.

    2011-01-01

    The assembly of ribonucleoprotein complexes occurs in a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from the hyperthemophilic bacterium Aquifex aeolicus (AS8) is unique in that there is a 41 residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually-high affinity for the 16S ribosomal RNA (rRNA), characterized by a picomolar dissociation constant that is approximately 26,000 fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to rRNA. PMID:22079365

  10. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua (NCI)

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  11. Bacterial meningitis in children

    International Nuclear Information System (INIS)

    Marji, S.

    2007-01-01

    To demonstrate the epidemiology, clinical manifestations and bacteriological profile of bacterial meningitis in children beyond the neonatal period in our hospital. This was a retrospective descriptive study conducted at Prince Rashid Hospital in Irbid, Jordan. The medical records of 50 children with the diagnosis of bacterial meningitis during 4 years period, were reviewed. The main cause of infection was streptococcus pneumoniae, followed by Haemophilus influenza and Niesseria meningitides. Mortality was higher in infants and meningococcal infection, while complications were more encountered in cases of streptococcus pneumoniae. Cerebrospinal fluid culture was positive in 11 cases and Latex agglutination test in 39. There is a significant reduction of the numbers of bacterial meningitis caused by Haemophilus influenza type B species. (author)

  12. Interfering with bacterial gossip

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Tolker-Nielsen, Tim; Givskov, Michael

    2011-01-01

    Biofilm resilience poses major challenges to the development of novel antimicrobial agents. Biofilm bacteria can be considered small groups of “Special Forces” capable of infiltrating the host and destroying important components of the cellular defense system with the aim of crippling the host...... defense